Upregulation of ferritin heavy chain 1 expression
Patent Information
- Application Number
- JP2024546221
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-02-04
- Filing Date
- 2023-02-03
- Publication Date
- 2026-02-06
Abstract
Description
[Technical field]
[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 306,978, filed February 4, 2022, the contents of which are incorporated herein by reference in their entirety.
[0002] (Reference to Electronic Sequence Listing) The contents of the electronic sequence listing (197732000740SEQLIST.xml; size: 18,684 bytes; and creation date: January 31, 2023) are incorporated herein by reference in their entirety.
[0003] (Field) The present disclosure relates to isolated oligopeptides capable of increasing expression of ferritin heavy chain 1 (FTH1) by epithelial cells, and formulations of the oligopeptides, which are suitable for treating diseases or conditions associated with iron deficiency and / or anemia. [Background technology]
[0004] (background) Protein powder mixed with milk, water or other beverages is a common dietary supplement that has been reported to help active adults improve physical performance by increasing muscle mass and strength (Pasiakos et al., Sports Med, 45:111-131, 2015). Protein supplements may also be beneficial for athletes in the middle of endurance training and recovery from injury. Furthermore, consumption of salmon protein hydrolysates as a protein supplement is known to increase serum hemoglobin levels in patients suffering from iron deficiency anemia (Bomi et al., J Nutr Food Sci, 5:4, 2015). However, protein powders are very complex compositions, and supplements from some manufacturers may contain added sugars or toxic contaminants.Therefore, what is needed in the art are isolated oligopeptides and formulations of said oligopeptides that have desirable properties.In particular, formulations that are rich in bioactive oligopeptides are needed. [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] Pasiakos et al., Sports Med, 45:111–131, 2015 [Non-Patent Document 2] Bomi et al., J Nutr Food Sci, 5:4, 2015 Summary of the Invention [Means for solving the problem]
[0006] (overview) The present disclosure relates to isolated oligopeptides capable of increasing expression of ferritin heavy chain 1 (FTH1) by epithelial cells, and formulations of the oligopeptides, which are suitable for treating diseases or conditions associated with iron deficiency and / or anemia. [Brief description of the drawings]
[0007] [Figure 1] FIG. 1 is an alignment of the amino acid sequences of the eight major oligopeptides derived from the three bioactive fractions FRP18, FRP20 and FRP30, with shared "EES" motifs, consensus sequences and sequence identifiers. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0008] (Detailed Description) The present disclosure relates to isolated oligopeptides capable of increasing expression of ferritin heavy chain 1 (FTH1) by epithelial cells, and formulations of the oligopeptides, which are suitable for treating diseases or conditions associated with iron deficiency and / or anemia.
[0009] (definition) As used in this specification and the appended claims, the singular forms "a," "or," and "the" include plural referents unless the context dictates otherwise. For example, "an excipient" includes one or more excipients.
[0010] It will be understood that aspects and embodiments described herein as "comprising" include aspects and embodiments "consisting of" and / or "consisting essentially of."
[0011] The term "about" as used herein with respect to a value describes 90% to 110% of that value. For example, about a 2-fold change in FTH1 mRNA expression includes from a 1.8-fold to a 2.2-fold change in FTH1 mRNA, including a 2.0-fold change in FTH1 mRNA.
[0012] As used herein, the terms "ferritin heavy chain 1" and "FTH1" refer to a nucleic acid sequence encoding the "ferritin heavy chain" protein (also known as the "ferritin H subunit"). The amino acid sequence of human ferritin heavy chain is set forth under GenBank Accession No. NP_002023, its mRNA sequence is set forth under GenBank Accession No. NM_002032, and its coding sequence spans nucleotides 210-761.
[0013] The term "isolated" as used herein with respect to a molecule (e.g., an oligopeptide) refers to a molecule that has been removed from its natural or synthetic environment or otherwise purified. A substantially "isolated" molecule is at least 75% free, preferably at least 90% free, and more preferably at least 95%, 96%, 97%, 98% or 99% free from other components. For example, an "isolated oligopeptide consisting of the amino acid sequence of SEQ ID NO:18" is at least 75% free from peptides and proteins that do not contain the amino acid sequence of SEQ ID NO:18.
[0014] The term "increasing" and grammatical equivalents as used herein with respect to expression or levels of FTH1 mRNA refers to a greater amount of FTH1 mRNA. Preferably, the increase in FTH1 mRNA comprises a statistically significant increase, preferably an increase of about 2-fold to about 200-fold, about 2-fold to 20-fold, or about 2-fold to 4-fold, preferably at least a 2.0-fold, 2.1-fold, 2.2-fold, 2.3-fold, 2.4-fold, 2.5-fold, 3.0-fold, 3.1-fold, 3.2-fold, 3.3-fold, 3.4-fold, or 3.5-fold increase.
[0015] As used herein, the terms "treating" and "treatment" refer to an approach to obtain beneficial or desired results (including clinical results). Beneficial or desired clinical results include, but are not limited to, alleviation or improvement of one or more symptoms, whether detectable or undetectable, reduction in the extent of disease, stabilization of disease state (i.e., not worsening), prevention of disease spread, delay or slowing of disease progression, improvement or alleviation of disease state, and remission (whether partial or total). Thus, as used herein, the terms "treating" and "treatment" do not require complete alleviation of signs or symptoms, do not require cure, and specifically include protocols that have modest effect on individuals.
[0016] An "effective amount" of an agent (e.g., an isolated oligopeptide or formulation of an oligopeptide) disclosed herein is an amount sufficient to carry out a specifically described purpose. An "effective amount" may be empirically determined for that described purpose. An "effective amount" or "sufficient amount" of an agent is an amount sufficient to produce a desired biological effect (e.g., a beneficial outcome (including a beneficial clinical outcome)). The term "therapeutically effective amount" refers to an amount of an agent (e.g., an isolated oligopeptide or formulation of an oligopeptide) effective to "treat" a disease or disorder in a subject (e.g., a mammal, e.g., a human). An "effective amount" or "sufficient amount" of an agent may be administered in one or more doses.
[0017] The terms "individual" and "subject" refer to mammals, including, but not limited to, humans, non-human primates (e.g., monkeys), farm animals, sport animals, rodents (e.g., mice and rats), and pets (e.g., dogs and cats).
[0018] I. Isolated Oligopeptides The isolated oligopeptides of the present disclosure consist of an amino acid sequence of Xm(R / D)EES(G / D)(E / K)Xn (consensus number 1), where m and n are integers independently selected from the range of 0 to 10, and each X, if present, is independently selected from any amino acid. Specifically, in some embodiments, the integers m and n are each selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Thus, the presently claimed oligopeptides are between 6 and 26 residues in length. In some embodiments, the oligopeptide is 6 or more residues long, 7 or more residues long, 8 or more residues long, 9 or more residues long, 10 or more residues long, 11 or more residues long, 12 or more residues long, 13 or more residues long, 14 or more residues long, 15 or more residues long, 16 or more residues long, 17 or more residues long, 18 or more residues long, 19 or more residues long, 20 or more residues long, 21 or more residues long, 22 or more residues long, 23 or more residues long, 24 or more residues long, or 25 or more residues long; and / or or the oligopeptide is 26 or less residues long, 25 or less residues long, 24 or less residues long, 23 or less residues long, 22 or less residues long, 21 or less residues long, 20 or less residues long, 19 or less residues long, 18 or less residues long, 17 or less residues long, 16 or less residues long, 15 or less residues long, 14 or less residues long, 13 or less residues long, 12 or less residues long, 11 or less residues long, 10 or less residues long, 9 or less residues long, 8 or less residues long, or 7 or less residues long, the lower limit being less than the upper limit. In some embodiments, the isolated oligopeptide comprises the amino acid sequence of REESGE (SEQ ID NO: 1). In some embodiments, the isolated oligopeptide comprises the amino acid sequence of REESGEP (SEQ ID NO: 2). In some embodiments, the isolated oligopeptide comprises the amino acid sequence of KEEDEESGE (SEQ ID NO: 3). In some embodiments, the isolated oligopeptide comprises the amino acid sequence of KPREESGE (SEQ ID NO: 4). In some embodiments, the isolated oligopeptide comprises the amino acid sequence of LDEESGEP (SEQ ID NO:5). In some embodiments, the isolated oligopeptide comprises the amino acid sequence of REESDKPMY (SEQ ID NO:6). In some embodiments, the isolated oligopeptide comprises the amino acid sequence of PREESDKP (SEQ ID NO:7).In some embodiments, the isolated oligopeptide comprises the amino acid sequence of REESGEL (SEQ ID NO: 8). In some embodiments, the isolated oligopeptide comprises an amino acid sequence having at least 90% (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity to any one of SEQ ID NOs: 1-8. In some embodiments, an isolated oligopeptide of the present disclosure comprises the amino acid sequence of XjREESDKPXk (consensus number 2 / SEQ ID NO: 18), where j is an integer selected from the range of 0 to 10, k is an integer selected from the range of 0 to 9, and each X, if present, is independently selected from any amino acid. Thus, in some embodiments, the claimed oligopeptides are 7 residues to 26 residues in length. In some embodiments, the oligopeptide is 7 or more residues long, 8 or more residues long, 9 or more residues long, 10 or more residues long, 11 or more residues long, 12 or more residues long, 13 or more residues long, 14 or more residues long, 15 or more residues long, 16 or more residues long, 17 or more residues long, 18 or more residues long, 19 or more residues long, 20 or more residues long, 21 or more residues long, 22 or more residues long, 23 or more residues long, 24 or more residues long, or 25 or more residues long; and / or or the oligopeptide is 26 or less, 25 or less, 24 or less, 23 or less, 22 or less, 21 or less, 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, 11 or less, 10 or less, 9 or less, or 8 or less, the lower limit being less than the upper limit. In some embodiments, the oligopeptide comprises the amino acid sequence of XgREESDKP(XhXi) (consensus number 3 / SEQ ID NO: 19), where Xg is proline (P) or absent, and XhXi is methionine and tyrosine (MY) or absent. In some embodiments, the isolated oligopeptide comprises the amino acid sequence of REESDKPMY (SEQ ID NO: 6) or the amino acid sequence of PREESDKP (SEQ ID NO: 7).
[0019] In a preferred embodiment, the isolated oligopeptide is capable of increasing expression of ferritin heavy chain 1 (FTH1) mRNA by intestinal epithelial cells contacted with the oligopeptide. The increase in expression of FTH1 mRNA as a result of contact with the oligopeptide is compared to intestinal epithelial cells not contacted with the oligopeptide (e.g., baseline), compared to intestinal epithelial cells cultured under the same conditions except for the absence of the oligopeptide, or compared to intestinal epithelial cells cultured under the same conditions except for the presence of a negative control oligopeptide (e.g., an oligopeptide of approximately the same length but not containing consensus number 1). In some embodiments, the intestinal epithelial cells are mammalian cells. In some preferred embodiments, the mammalian cells are human cells. In an exemplary embodiment, the intestinal epithelial cells are HIEC-6 cells. In other embodiments, the intestinal epithelial cells are primary human intestinal epithelial cells.
[0020] In some preferred embodiments, the oligopeptide is synthetically produced. In exemplary embodiments, the oligopeptide is produced by solid phase synthesis as known in the art and purified by high performance liquid chromatography. Nevertheless, the present disclosure also provides an isolated nucleic acid encoding the oligopeptide. The nucleic acid can be in an expression cassette or expression vector in operable combination with a promoter. A host cell comprising the isolated nucleic acid, expression cassette or expression vector is also provided for recombinant expression of the oligopeptide.
[0021] II. Formulations The present disclosure provides a formulation comprising at least one isolated oligopeptide of the above paragraph and at least one pharma- ceutically acceptable excipient and / or oral delivery agent.In some embodiments, the formulation may further comprise enteric coating, liposome, microsphere, or microparticle / nanoparticle.For example, in some embodiments, the isolated oligopeptide is encapsulated in enteric coating, liposome, microsphere, or microparticle / nanoparticle.However, since the oligopeptide of the formulation is isolated, the formulation of the present disclosure does not comprise fish protein hydrolysate, for example salmon protein hydrolysate.
[0022] The amount of the oligopeptide of the present disclosure that is effective in treating a particular disorder or condition disclosed herein will depend on the nature of the disorder or disease, and the amount can be determined by standard clinical techniques. Additionally, in vitro or in vivo assays can be used, as necessary, to help identify optimal dosage ranges. In some embodiments, the dose of the oligopeptide of the present disclosure is about 0.1 mg to about 1000 mg, about 1.0 mg to about 100 mg, or about 10 mg per kg of body weight of the subject to be treated. In some embodiments, the dose of the oligopeptide is 0.1 mg / kg or more, 0.5 mg / kg or more, 1.0 mg / kg or more, 5.0 mg / kg or more, 10 mg / kg or more, 20 mg / kg or more, 30 mg / kg or more, 40 mg / kg or more, 50 mg / kg or more, 60 mg / kg or more, 70 mg / kg or more, 80 mg / kg or more, 90 mg / kg or more, 100 mg / kg or more, or 500 mg / kg or more, and / or the dose of the oligopeptide is 1000 mg / kg or less, 500 mg / kg or less, 100 mg / kg or less, 90 mg / kg or less, 80 mg / kg or less, 70 mg / kg or less, 60 mg / kg or less, 50 mg / kg or less, 40 mg / kg or less, 30 mg / kg or less, 20 mg / kg or less, 10 mg / kg or less, 5.0 mg / kg or less, 1.0 mg / kg or less, or 0.5 mg / kg, with the lower limit being less than the upper limit.
[0023] A. Excipients Pharmaceutically acceptable excipients of the present disclosure include, for example, solvents, bulking agents, buffers, tonicity adjusters, and preservatives (Pramanick et al., Pharma Times, 45:65-77, 2013). In some embodiments, the formulation may include an excipient that functions as one or more of a solvent, bulking agent, buffer, and tonicity adjuster (e.g., sodium chloride in saline may serve as both an aqueous medium and a tonicity adjuster).
[0024] In some embodiments, the formulation comprises an aqueous medium as a solvent. Suitable media include, for example, sterile water, saline solution, phosphate buffered saline, and Ringer's solution. In some embodiments, the formulation is isotonic.
[0025] The formulation may include a buffering agent. The buffering agent controls the pH to inhibit degradation of the active agent during processing, storage, and, if necessary, reconstitution. Suitable buffers include, for example, acetate-containing salts, citrate-containing salts, phosphate-containing salts, or sulfate-containing salts. Other suitable buffers include, for example, amino acids, such as arginine, glycine, histidine, and lysine. The buffering agent may further include hydrochloric acid or sodium hydroxide. In some embodiments, the buffering agent maintains the pH of the formulation within the range of 6 to 9. In some embodiments, the pH is greater than (lower limit) 6, 7, or 8. In some embodiments, the pH is less than (upper limit) 9, 8, or 7. That is, the pH is in the range of about 6 to 9, and the lower limit is less than the upper limit.
[0026] The formulation may include a tonicity adjuster. Suitable tonicity adjusters include, for example, dextrose, glycerol, sodium chloride, glycerin and mannitol.
[0027] The formulation may include a bulking agent. Bulking agents are particularly useful when the pharmaceutical formulation is freeze-dried before administration. In some embodiments, the bulking agent is a protective agent that helps stabilize and prevent degradation of active agent during freeze-drying or spray-drying and / or storage. Suitable bulking agents are sugars (monosaccharides, disaccharides, and polysaccharides), such as sucrose, lactose, trehalose, mannitol, sorbitol, glucose, and raffinose.
[0028] The formulation may contain a preservative. Suitable preservatives include, for example, antioxidants and antimicrobial agents. However, in a preferred embodiment, the formulation is prepared under sterile conditions and is in a single-use container, and therefore does not need to contain a preservative.
[0029] B. Orally Delivered Drugs Oral delivery agents of the present disclosure include, for example, absorption enhancers, fatty acids, enzyme inhibitors, polyethylene glycol, mucoadhesive polymers, and cell-penetrating peptides (Dan et al., Children, 7:307, 2020).
[0030] Commonly utilized routes of administration for therapeutic peptides and proteins include intravenous (IV), intraperitoneal (IP), and intramuscular (IM) injections. However, oral administration is preferred by patients, and oral medications are typically less expensive to manufacture, distribute, and administer. Unfortunately, the development of orally available dosage forms of therapeutic peptides and proteins is complicated for a variety of reasons, including but not limited to poor stability in physiological conditions, short biological half-life, and low permeability through the epithelial barrier in the small intestine. Thus, in some embodiments, the formulations of the present disclosure are designed to protect the isolated oligopeptide from the proteolytic enzymes and acidic environment found in the stomach, such that the formulation retains its biological activity when absorbed into the bloodstream (see, e.g., Dan et al., Children, 7:307, 2020).
[0031] (III. How to use) The isolated oligopeptide and preparation of the present disclosure finds use in methods and medicines for increasing the expression of FTH1 mRNA expression by mammalian cells.In some embodiments, the mammalian cells are epithelial cells, such as human epithelial cells.In some preferred embodiments, the isolated oligopeptide and preparation of the present disclosure finds use in methods and medicines for increasing serum ferritin concentration in human subjects in need of increasing serum ferritin concentration.In some preferred embodiments, the isolated oligopeptide and preparation of the present disclosure finds use in methods and medicines for treating or preventing disease or condition in human subjects in need of treating or preventing disease or condition, said disease or condition being associated with insufficient serum ferritin concentration.
[0032] In some in vivo embodiments, the formulation is administered orally. For example, the formulation may be administered enterally. In some embodiments, the formulation is administered by buccal, sublabial, or sublingual route. In some embodiments, the mammalian subject (recipient) does not have cancer. In certain embodiments, the subject is a human subject that does not have prostate cancer. In some embodiments, the human subject is male. In other embodiments, the human subject is female.
[0033] (Increased FTH1 mRNA expression) In some aspects, the disclosure provides methods and medicaments for increasing expression of ferritin heavy chain 1 (FTH1) mRNA in a mammalian subject in need thereof, comprising administering to said subject an effective amount of an oligopeptide or formulation of clause I or clause II. In some embodiments, said mammalian subject is a human subject.
[0034] Ferritin is a ubiquitously expressed, highly conserved protein that consists of two types of oligopeptide chains: ferritin heavy chains and ferritin light chains. The ferritin heavy chains are2+ catalyzes oxidation reactions, whereas ferritin light chains are 3+ FTH1 plays an important role in the storage of iron. Both chains are essential to maintain iron homeostasis and prevent iron overload (Tian et al., Neurotherapeutics, 17:1796-1812, 2020). The FTH1 gene encodes the heavy chain subunit of ferritin. An increase in FTH1 expression, and therefore an increase in ferritin, leads to an increase in iron absorption and bioavailability. This increase in iron absorption and bioavailability is beneficial for improving diseases and disorders that result from insufficient amounts of iron (e.g., iron deficiency anemia).
[0035] In some embodiments, the method for increasing expression of ferritin heavy chain 1 (FTH1) mRNA by a mammalian cell comprises contacting the mammalian cell with an effective amount of the formulation. In some embodiments, the method for increasing expression of FTH1 mRNA comprises contacting the mammalian cell with an effective amount of the formulation, the increase being compared to a baseline (e.g., before contact). In some embodiments, the method for increasing expression of FTH1 mRNA comprises contacting the mammalian cell with an effective amount of the formulation, the increase being compared to a mammalian cell not contacted with the formulation. In some embodiments, the method for increasing expression of FTH1 mRNA comprises contacting the mammalian cell with an effective amount of the formulation, the increase being compared to a mammalian cell contacted with a control formulation lacking the oligopeptide. In some embodiments, the method for increasing expression of FTH1 mRNA comprises contacting the mammalian cell with an effective amount of the formulation, the increase being compared to a mammalian cell that includes a negative control oligopeptide.
[0036] In some embodiments, the contacting is performed in vivo. Thus, in some embodiments, the method and medicament for increasing ferritin heavy chain 1 (FTH1) expression in a mammalian subject in need of increasing FTH1 expression comprises administering to the subject an effective amount of the formulation to increase FTH1 expression, and the increase is compared to baseline (e.g., before administration). In some embodiments, the method and medicament further comprises increasing serum ferritin concentration in a mammalian subject in need of increasing serum ferritin concentration. Thus, in some embodiments, the method and medicament for increasing serum ferritin concentration in a mammalian subject in need of increasing serum ferritin concentration comprises administering to the subject an effective amount of the formulation to increase serum ferritin concentration, and the increase is compared to baseline (e.g., before administration).
[0037] (Treatment or prevention of iron deficiency) In some aspects, provided herein are methods of treating or preventing a disease or condition in a mammalian subject in need thereof, the methods comprising administering to the subject an amount of the formulation effective to treat or prevent the condition. In some embodiments, the disease or condition is associated with iron deficiency.
[0038] Iron is essential for the physiological function of humans and animals. Insufficient iron in humans and animals can cause many diseases and disorders, including iron deficiency anemia and growth retardation. Iron deficiency can be classified into two levels according to hemoglobin measurements: iron deficiency without anemia and iron deficiency with anemia (IDNA and IDA, respectively). Iron deficiency without anemia (IDNA, also known as nonanemic iron deficiency) is usually insidious and challenging to diagnose and manage (Zhu et al., Front Neur, 11:298, 2020). In some embodiments, the disease or condition to be treated or prevented is associated with iron deficiency without anemia. In other embodiments, the disease or condition to be treated or prevented is associated with iron deficiency with anemia.
[0039] (Treatment or prevention of anemia) In some aspects, provided herein is a method of treating or preventing a disease or condition in a mammalian subject in need thereof, said method comprising administering to said subject an amount of said formulation effective to treat or prevent said disease or condition, wherein said disease or condition is associated with anemia.
[0040] In another embodiment, the disorder is iron deficiency anemia. Anemia is a disorder characterized by a lack of red blood cells. Iron deficiency anemia is anemia caused by an insufficient amount of iron. This iron deficiency can result from insufficient iron intake, insufficient iron absorption, blood loss, or a combination thereof.
[0041] Anemia due to iron deficiency can be distinguished from many other anemias, for example, iron deficiency anemia is different from anemia resulting from chronic infectious, inflammatory, or malignant disorders such as arthritis or cancer.
[0042] (Treatment or prevention of restless legs syndrome) In some aspects, provided herein is a method of treating or preventing a disease or condition in a mammalian subject in need thereof, the method comprising administering to the subject an effective amount of the formulation to treat or prevent the disease or condition, wherein the disease or condition is restless leg syndrome (also called restless legs syndrome).
[0043] Restless legs syndrome (RLS) is a common neurological disorder, and iron deficiency is thought to play a key role in its pathogenesis. Iron deficiency is common in RLS, and iron deficiency anemia (IDA) is a well-known cause of secondary RLS. In addition, IDA is frequently observed in patients with RLS (Zhu et al., Front Neurol, 11:298, 2020). However, there is no known cure for RLS, and although some individuals suffering from RLS may find some relief with neuroactive drugs or iron supplementation, there is no single drug that works for every patient (Mayo Clinic, 2020). Enumerated Embodiments 1. An isolated oligopeptide consisting of an amino acid sequence of Xm(R / D)EES(G / D)(E / K)Xn (consensus number 1), where m and n are integers independently selected from the range of 0 to 10, and each X, if present, is independently selected from any amino acid. 2. An isolated oligopeptide consisting of an amino acid sequence of XjREESDKPXk (SEQ ID NO: 18), where j is an integer selected from the range of 0 to 10, k is an integer selected from the range of 0 to 9, and each X, if present, is independently selected from any amino acid. 3. The isolated oligopeptide of embodiment 2, comprising an amino acid sequence of XgREESDKP(XhXi) (SEQ ID NO: 19), wherein Xg is proline or absent, and XhXi is methionine and tyrosine or absent. 4. The isolated oligopeptide of embodiment 3, comprising the amino acid sequence of REESDKPMY (sequence number 6). 5. The isolated oligopeptide described in embodiment 3, comprising the amino acid sequence of PREESDKP (SEQ ID NO: 7). 6. The isolated oligopeptide described in embodiment 1, comprising the amino acid sequence of REESGEL (sequence number 8). 7. The isolated oligopeptide of embodiment 1, comprising the amino acid sequence of REESGE (SEQ ID NO: 1), REESGEP (SEQ ID NO: 2), KEEDEESGE (SEQ ID NO: 3), KPREESGE (SEQ ID NO: 4), LDEESGEP (SEQ ID NO: 5), REESDKPMY (SEQ ID NO: 6), PREESDKP (SEQ ID NO: 7), or REESGEL (SEQ ID NO: 8). 8. The isolated oligopeptide of any one of embodiments 1-7, wherein the oligopeptide is capable of increasing expression of ferritin heavy chain 1 (FTH1) mRNA by a mammalian cell contacted with the oligopeptide, and optionally the mammalian cell is a human cell, and / or optionally the mammalian cell is an intestinal epithelial cell, a skeletal muscle cell, an astrocyte, or a macrophage. 9. A formulation comprising an isolated oligopeptide according to any one of embodiments 1 to 8 and at least one pharma- ceutically acceptable excipient. 10. A formulation comprising an isolated oligopeptide described in any one of embodiments 1 to 8 and an oral delivery agent. 11. The formulation of embodiment 10, wherein the oral delivery agent comprises an absorption enhancer, a fatty acid, an enzyme inhibitor, polyethylene glycol, a mucoadhesive polymer, a cell-penetrating peptide, or a combination thereof. 12. The formulation of any one of embodiments 9 to 11, further comprising an enteric coating, liposomes, microspheres, and / or microparticles / nanoparticles. 13. An isolated nucleic acid encoding an oligopeptide described in any one of embodiments 1 to 7. 14. An expression vector comprising the nucleic acid of embodiment 13 operably combined with a promoter. 15. A host cell comprising the isolated nucleic acid of embodiment 13 or the expression vector of embodiment 14. 16. A pharmaceutical comprising the formulation described in any one of embodiments 9 to 12. 17. A method for increasing expression of ferritin heavy chain 1 (FTH1) mRNA by a mammalian cell, comprising: Contacting the mammalian cells with a formulation according to any one of embodiments 9 to 12 in an amount effective to increase FTH1 expression. A method comprising: 18. The method of embodiment 17, wherein the mammalian cell is an intestinal epithelial cell, a skeletal muscle cell, an astrocyte, or a macrophage, and / or optionally the mammalian cell is a human cell, or optionally the mammalian cell is a human intestinal epithelial cell. 19. The method of embodiment 17 or embodiment 18, wherein the contacting is performed in vivo. 20. A method for increasing ferritin heavy chain 1 (FTH1) expression in a mammalian subject in need thereof, comprising: administering to the subject a formulation according to any one of embodiments 9 to 12 in an amount effective to increase FTH1 expression. A method comprising: 21. A method for increasing serum ferritin concentrations in a mammalian subject in need thereof, comprising: administering to the subject a formulation of any one of embodiments 9-12 in an amount effective to increase serum ferritin concentration. A method comprising: 22. A method for treating or preventing a disease or condition in a mammalian subject in need thereof, comprising: administering to said subject a formulation of any one of embodiments 9-12 in an amount effective to treat or prevent said disease or condition. A method comprising: 23. The method of embodiment 22, wherein the disease or condition is associated with iron deficiency. 24. The method of embodiment 22 or embodiment 23, wherein the disease or condition is associated with anemia. 25. The method of any one of embodiments 22-24, wherein the disease or condition is restless legs syndrome. 26. The method of any one of embodiments 20-25, wherein the formulation is administered orally. 27. The method of embodiment 26, wherein the formulation is administered enterally. 28. The method of embodiment 26, wherein the formulation is administered by the buccal, sublabial, or sublingual route. 29. The method of any one of embodiments 20 to 28, wherein the mammalian subject is a human subject. 30. The method of embodiment 29, wherein the human subject does not have cancer. EXAMPLES
[0044] (Example) Abbreviations: ACTB (beta-actin); FTH1 (ferritin heavy chain 1); H&E (hematoxylin and eosin); HSkMC (human skeletal muscle); LDH (lactate dehydrogenase); MBMM (murine bone marrow-derived macrophages); RLS (restless legs syndrome); and SPH (salmon protein hydrolysates).
[0045] Example 1 Preparation of biologically active salmon protein hydrolysates Salmon protein hydrolysate (SPH) powder was produced by enzymatic hydrolysis of salmon (Salmo salar) heads and backbones after filleting as described (US2021 / 0252099). Briefly, 1000 grams of crushed heads and backbones were added to 1000 ml of water and the mixture was heated to 50°C. 10 g of endopeptidase enzyme (pepsin) was added and the mixture was stirred for 30 minutes. Then, 10 g of exopeptidase enzyme (carboxypeptidase) was added and the mixture was stirred for 15 minutes. Next, 5 grams of Flavourzyme® (a blend of endo- and exo-proteases derived from Aspergillus oryzae; commercially available from Novozymes A / S, Bagsvaerd, Denmark) was added and the mixture was stirred for 10 minutes. The endopeptidase and exopeptidase treated salmon protein mixture was then heated to 85°C for 15 minutes to inactivate the proteases. After filtration, the hydrolysate fraction was concentrated to 30% dry matter in a conventional evaporator and spray dried to obtain salmon protein hydrolysate powder.
[0046] Example 2 (Size exclusion fraction of salmon protein hydrolysates) A Dionex / Thermo UltiMate™ 3000 HPLC System (Thermo Fisher Scientific, Waltham, MA) equipped with a quaternary pump, autosampler, RS variable wavelength UV-Vis detector and automated fraction collector was used for preparative chromatography of the salmon protein hydrolysates (SPH). Separation was performed on a BioSep™-SEC-s2000 size exclusion column (Phenomenex, Torrance, CA) (300 mm x 7.8 mm internal diameter, 145 Å pore size) at 25°C using TS software version 7.0.
[0047] The mobile phase consisted of 0.1 M phosphate buffer (pH 6.9). Isocratic elution was performed using a flow rate of 5 ml / min for 48 min and monitored at 214 nm wavelength. An injection volume of 1 ml of aqueous SPH solution (100 mg / ml) was used and 12 fractions (F1-F12) were collected from 4 to 48 min. The collected fractions were lyophilized and stored at -20°C.
[0048] Example 3 (Regulation of ferritin heavy chain 1 expression by fractions F1 to F12) An epithelial cell line derived from the human small intestine was chosen to evaluate the effect of SPH fractions on gene expression. This cell type was chosen because SPH has been studied as a regulator of gastrointestinal health. HIEC-6 (CRL-3266™) cells obtained from ATCC (Manassas, VA) were grown on 100 mm cell culture dishes in OptiMEM™1 serum-reduced medium supplemented with 20 mM HEPES, 10 mM GlutaMAX™, 10 ng / ml epidermal growth factor, and a final concentration of 4% fetal bovine serum. For this assay, HIEC-6 cells were grown in 24-well plates at a cell density of 1×10 5 cells / cm 2 and maintained in a humidified 5% CO2 atmosphere at 37° C. After approximately 24 hours, the cells were incubated with each of the SPH fractions F1 to F12 for 12 hours.
[0049] Total RNA was extracted using UPzol reagent on the cell pellets, followed by DNAse treatment (DNAse TURBO) according to the manufacturer's protocol. Complementary DNA (cDNA) was synthesized using random hexamers with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Gene expression levels were measured by qRT-PCR.
[0050] One μl of cDNA corresponding to 50 ng of reverse transcribed RNA was amplified by Qpcr (QuantStudio™ 6 Flex Real-Time PCR System) using TaqMan™ Universal PCR Master Mix (catalog no. 4304437) and TaqMan™ assays (Roche Molecular Systems, Inc., Pleasanton, CA).
[0051] FTH1 gene expression was estimated relative to the expression of the housekeeping gene β-actin (ACTB) according to the standard formula 2-ΔCt. The TaqMan™ probe IDs used were: (i) FTH1, Hs01694011_s1; and (ii) ACTB, Hs01060665_g1. All experiments were performed in triplicate.
[0052] As shown in Table 3-1, significant (>2-fold) upregulation of FTH1 gene expression was observed in fractions F2 and F3, whereas non-significant (<2-fold) upregulation was observed in fractions F7, F9, and F11. Table 3-1. Effect of HIEC-6 cell treatment with SPH fraction on FTH1 expression [Table 3-1]
[0053] Example 4 (Preparative reversed-phase chromatography of fractions F2 and F3) Orthogonal chromatographic separation of the mixture of fractions F2 and F3 was performed using a Dionex / Thermo UltiMate™ 3000 HPLC System (Thermo Fisher Scientific, Waltham, MA) as described in Example 2. A 1 ml aliquot of an aqueous solution containing equal weights of fractions F2 and F3 (100 mg / ml) was separated at 25° C. using a BetaSil™ C18 column (Thermo Fisher Scientific, Waltham, MA), 250 mm×10 mm internal diameter, 10 micron particle size.
[0054] The mobile phase was water (solvent A) and acetonitrile (solvent B), both acidified with 0.05% TFA, with a flow rate of 4 ml / min. Gradient elution was performed as follows: 0 min, 0% B; 10 min, 0% B; 45 min, 40% B; 50 min, 100% B; 60 min, 100% B.
[0055] The separation was monitored at 214 nm and 12 fractions (FRP12-FRP34) were collected from 12 to 36 min and assessed for their FTH1 modulating activity as described in Example 3.
[0056] Only two early eluting fractions (at 18 and 20 min retention times) and one late eluting fraction (at 30 min retention time) showed significant FTH1 gene upregulation as shown in Table 4-1. These three active fractions were designated FRP18, FRP20 and FRP30. Table 4-1. Effect of treatment of HIEC-6 cells with SPH fractions on FTH1 expression [Table 4-1]
[0057] Example 5 (HPLC-HRMS analysis of FRP18, FRP20 and FRP30 fractions) Bioactive oligopeptides were identified using high performance liquid chromatography-high resolution mass spectrometry (HPLC-HRMS) analysis of lyophilized FRP18, FRP20 and FRP30 redissolved in 50% methanol. A reversed-phase Luna® Omega Polar C18 column (Phenomenex, Torrance, CA) (250 mm×4.6 mm, 5 mm particles, 100 Å pore size) with an injection volume of 10 μl was placed in an Agilent 1290 chromatograph consisting of a G1340A degasser, a G1311A quaternary pump, a thermostatted column compartment and a photodiode array detector (Santa Clara, CA, USA), which was then attached to a Bruker micrOTOF-Q II mass spectrometer equipped with an electrospray ionization interface.
[0058] The flow rate was maintained at 0.5 ml / min. The gradient elution profile of mobile phase A (water / acetonitrile 95:5 (vol / vol)) and mobile phase B (water / acetonitrile, 5:95 (vol / vol)), both acidified with 0.1% formic acid, was as follows: 0 min, 0% B; 5 min, 0% B; 25 min, 100% B; 35 min, 100% B; 37 min, 0% B.
[0059] Automated MS / MS spectra were acquired in positive ion mode using a drying temperature of 200° C. and a drying gas flow of 8 l / min. Structural identification was database-assisted using MaxQuant software Version 2.0.3.0 and automated [M+H]n+ fragment matching analysis.
[0060] Eight major oligopeptides were identified from the three bioactive fractions FRP18, FRP20 and FRP30. The retention times, MS / MS results and oligopeptide sequences are shown in Table 5-1. Table 5-1. Identification of biologically active oligopeptides [Table 5-1-1] [Table 5-1-2]
[0061] Example 6 (Effect of oligopeptides on human skeletal muscle cells (HSkMC)) A human skeletal muscle derived cell line was selected to evaluate the effects of SPH and oligopeptides on gene expression. HSkMCs (PCS-950-010) obtained from ATCC (Manassas, VA) were grown in 100 mm cell culture dishes in Mesenchymal Stem Cell Basal Medium (ATCC) serum-reduced medium supplemented with L-glutamine (10 mM), dexamethasone (10 μM), rh epidermal growth factor (5 ng / ml), rh FGF-b (5 ng / mL), rh insulin (25 μg / mL), and fetal bovine serum (4%) from the Primary Skeletal Cell Muscle Growth Kit (ATCC). For this assay, HSkMC cells were grown in 24-well plates at a cell density of 1 × 10 4 cells / cm 2 The cells were seeded at 37° C. in a humidified 5% CO2 atmosphere and maintained at 37° C. After approximately 24 hours, the cells were incubated with SPH (100 μM) or synthetic oligopeptides (10 μM) for approximately 12 hours.
[0062] Total RNA was extracted using UPzol reagent on the cell pellets, followed by DNAse treatment (DNAse TURBO) according to the manufacturer's protocol. Complementary DNA (cDNA) was synthesized using random hexamers with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Gene expression levels were measured by qRT-PCR.
[0063] One μl of cDNA corresponding to 50 ng of reverse transcribed RNA was amplified by Qpcr (QuantStudio™ 6 Flex Real-Time PCR System) using TaqMan™ Universal PCR Master Mix (catalog no. 4304437) and TaqMan™ assays (Roche Molecular Systems, Inc., Pleasanton, CA).
[0064] FTH1 gene expression was estimated relative to the expression of the housekeeping gene β-actin (ACTB) according to the standard formula 2-ΔCt. The TaqMan™ probe IDs used were: (i) FTH1, Hs01694011_s1; and (ii) ACTB, Hs01060665_g1. All experiments were performed in triplicate. Table 6-1. Effect of oligopeptides on FTH1 expression in HSkMCs [Table 6-1]
[0065] As shown in Table 6-1, a measurable (>2-fold) upregulation of FTH1 gene expression was observed when primary human muscle cells were incubated in the presence of FT-002, FT-004, FT-006, FT-007, and FT-008 peptides. Additionally, a dose-dependent effect on FTH1 gene expression was observed when HSkMCs were treated with increasing concentrations of oligopeptides, as shown in Table 6-2 below. Table 6-2. Dose-dependent effect of oligopeptides on FTH1 expression in HSkMCs. [Table 6-2]
[0066] Example 7 (Effects of oligopeptides on human astrocytes) This example describes the evaluation of the protective effects of SPH and oligopeptides against hemin-induced iron-dependent oxidative damage in human astrocytes in vitro.
[0067] Immortalized human astrocytes (P10251-IM) were obtained from Innoprot (Spain) and prepared under conditions recommended by the supplier. At 90% confluency, the P10251-IM cells were rinsed with 8 ml of DPBS and 2 ml of T / E solution (prepared according to Innoprot's procedure) and then added to an Erlenmeyer flask and gently shaken to completely cover the P10251-IM cells. The flask was then incubated for 2 minutes at 37°C. 5 ml of fetal bovine serum (FBS) and the T / E solution from the flask were then added to a 50 ml conical centrifuge tube. The flask was incubated for another 2 minutes and the P10251-IM cells were detached from the surface by gentle tapping. The P10251-IM cells were then transferred to a 50 ml conical centrifuge tube containing 5 ml of TNS solution. The tube was centrifuged at 1000 rpm for 5 minutes. The P10251-IM cells were then resuspended in culture medium, counted, and plated at 1×10 4 The cells were plated at a density of 100x1000 and incubated in vitro for 21 days before testing the cells.
[0068] Confluent P10251-IM cell cultures were washed and then pretreated with medium alone or medium supplemented with SPH (160 μM) or oligopeptide (10 μM) for 24 h at 37° C. A commercial collagen peptide (Vital Protein) at a concentration of 160 μM and sterile water were used as negative controls. The P10251-IM cells were then treated with 30 μM hemin in serum-free medium consisting of MEM with 10 mM glucose (MEM10) for 6 h.
[0069] P10251-IM astrocyte cultures pretreated with 30 μM hemin sustained extensive cell damage. Cell viability was quantified using a lactate dehydrogenase (LDH) release assay as previously described (Chen and Regan, Curr Neurovasc Res, 2:189-196, 2005). Briefly, quantification of the protective effects of SPH and oligopeptides was assessed by determining the mean percentage of LDH released relative to fully lysed control cultures treated with 0.1% Triton® X-100 (considered to release 100% of culture LDH). Table 7-1. Protection of human astrocytes from hemin-induced injury. [Table 7-1]
[0070] L-ferritin and H-ferritin gene expression was then quantified. Briefly, after 6 hours of incubation with hemin, the astrocytes were lysed and RNA was extracted using Qiagen lipid mini kit. Expression of both genes involved in iron homeostasis (L-ferritin and H-ferritin) was assessed by qRT-PCR. Fold changes were calculated using the ΔCt method using GAPDH as housekeeping gene. Fold changes were normalized to expression levels in control wells. Experiments were performed in triplicate. The primers used for amplification of the cDNA were: H-ferritin forward: TAAAGAACTGGGTGACCACGTGAC (SEQ ID NO: 10); H-ferritin reverse: AAGTCAGCTTAGCTCATCACCG (SEQ ID NO: 11); L-ferritin forward: TGGCCATGGAGAAGAACCTGAATC (SEQ ID NO: 12; and L-ferritin reverse: GCTTTCCAGGAAGTCACAGAGAT (SEQ ID NO: 13). (Table 7-2. Effect of oligopeptides on ferritin expression in astrocytes) [Table 7-2]
[0071] Ferritin overexpression and ferritin pretreatment were reported to reduce hemin-induced oxidative toxicity in endothelial cells and astrocytes (Balla et al., J. Biol Chem, 267:18148-18153, 1992; and Regan et al., Neuroscience, 113:985-994, 2002). It was now found that pretreatment of astrocytes with SPH produced a small improvement in the viability of hemin-injured astrocytes. Furthermore, it was found that all three oligopeptides FT-006, FT-007, and FT-008 (10 μM) provided substantial prophylactic protection of astrocytes from hemin-induced oxidative damage (i.e., 40% mortality, 36% mortality, and 29% mortality, respectively, compared to 48% mortality for collagen controls). Furthermore, all three oligopeptides showed selective upregulation of the H-ferritin gene, with little or no change in the expression of the L-ferritin gene.Specifically, oligopeptides FT-006, FT-007, and FT-008 caused a 3.0-fold, 3.3-fold, and 4.0-fold increase in H-ferritin gene expression, respectively.These results indicate that the protection of astrocytes from hemin-induced iron oxidation damage is at least partially caused by upregulation of H-ferritin gene expression.
[0072] Example 8 (Effect of oligopeptides on mouse macrophages) This example describes the evaluation of the effects of SPH and oligopeptides on H-ferritin protein expression and H-ferritin mRNA expression in murine bone marrow-derived macrophages (MBMM) under normal, iron-enriched and iron-depleted cell culture conditions.
[0073] Cell Cultures. MBMM (C57BL / 6 genetic background) were obtained from CellBiologics.net and prepared under conditions recommended by the supplier. Isolated MBMM were seeded in 10 cm diameter Petri dishes and grown in RPMI-GlutaMAX™ medium (Invitrogen) supplemented with 10% heat-inactivated FCS (Gibco), 10% L-cell conditioned medium (source of colony-stimulating factor 1), 2 mM L-glutamine, 50 U / mL penicillin, and 50 mg / mL streptomycin. Four days after seeding, adherent MBMM were rinsed twice with Hank's Balanced Salt Solution (HBSS) and the medium was replaced for 7 days. At that time, the MBMM were fully differentiated into macrophages and were ready for downstream experiments.
[0074] (Cell Treatment). SPH (average molecular weight approximately 1100 Daltons) and oligopeptide were dissolved in sterile water to obtain a 0.1 mM stock solution. The SPH and oligopeptide were further diluted in cell culture medium to obtain a final concentration of 160 μM SPH and 10 μM oligopeptide per Petri dish.
[0075] Mouse macrophages were incubated with SPH or oligopeptides in the presence or absence of iron-nitrilotriacetate solution (Fe-NTA; FeCl3 (100 μM)-NTA (400 μM)) for 8 h at 37°C to increase cellular iron concentration. Mouse macrophages were also incubated with SPH or oligopeptides in the presence or absence of desferrioxamine mesylate (DFO; 100 μM) for 16 h at 37°C to decrease cellular iron concentration. Commercially available collagen peptide (Vital Protein) at a concentration of 10 μM and sterile water were used as negative controls.
[0076] (Quantification of H-ferritin). Macrophages were washed with cold saline and lysed in 400 μl of a solution containing 50 mM HEPES (Gibco), 1% IGEPAL C-630 (Sigma) and 1% protease inhibitor cocktail P840 (Sigma). H-ferritin concentrations in the lysates were determined by ELISA using polyclonal antibodies raised against mouse recombinant H-ferritin subunits and calibrated with the corresponding recombinant homopolymers. The specificity of the antibodies and the absence of cross-reactivity of the antibodies are described. The results are expressed in Table 8-1 as (ng ferritin) per (mg total protein) in the cell lysate and shown as the average of triplicate readings. Total protein content was measured using a BCA protein assay kit (Pierce).
[0077] Measurement of gene expression. Total RNA was extracted from macrophages using the Qiagen miRNeasy Mini Kit for purification of total RNA from animal and human cells and tissues according to the manufacturer's instructions. Approximately 2 μg of total RNA was transcribed into cDNA after performing an RT2 RNA QC PCR Array to confirm the quality of the RNA samples, followed by gene expression analysis using an RT2 Profiler PCR array.
[0078] The primers used for amplification of the cDNA were: HPRT1 forward: 5'-GTAATGATCAGTCAACGGGGGAC-3' (SEQ ID NO: 14); HPRT1 reverse: 5'-CCAGCAAGCTTGCAACCTTAACCA-3' (SEQ ID NO: 15); FTH1 forward: 5'-GGAGTTGTATGCCTCCTAC-3' (SEQ ID NO: 16); and FTH1 reverse: 5'-GAGATATTCTGCCATGCC-3' (SEQ ID NO: 17).
[0079] These primers do not co-amplify genomic DNA. All reactions were performed with iQ™ SYBR® Green Supermix (Bio-Rad) in a total reaction volume of 20 μl and run on an iQ™ 5 instrument (Bio-Rad). The baseline threshold was calculated by the Bio-Rad iQ5 program, and the threshold cycle (Ct) was used to normalize the Ct value for the Fth1 gene to the expression level of the Hprt1 (housekeeping) gene. The results are shown in Table 8-2 as n-fold difference compared to the control sample. (Table 8-1. H-ferritin protein levels in mouse macrophages ∧ Effect of oligopeptides on [Table 8-1] Table 8-2. Effect of oligopeptides on FTH1 levels in mouse macrophages [Table 8-2]
[0080] The three most active oligopeptides were FT-008, FT-007, and FT-006. Treatment of mouse macrophages with each of these peptides resulted in a substantial increase in FTH1 mRNA expression levels and intracellular H-ferritin protein levels in both normal and iron-depleted conditions. The increase in H-ferritin protein was most pronounced in the iron-depleted cellular environment, whereas little or no change in FTH1 mRNA expression levels and H-ferritin protein levels was observed in the iron-replete cellular environment.
[0081] Example 9 Analysis of Ferritin Concentrations and Motility in Oligopeptide-Treated Mice This example describes a mouse model of restless legs syndrome (RLS) and its use to evaluate the effect of oligopeptide treatment on serum and cerebrospinal fluid ferritin concentrations. This model is also suitable for evaluating the effect of oligopeptide treatment on locomotion.
[0082] Animal Model and Treatment. C57 / BL6 mice are fed an iron-deficient ID diet (TD 80396, Harlan, WI, USA) containing only 3.5mg iron / kg. One month after starting the ID diet, 6-hydroxydopamome (6-OHDA) lesions are created in the A11 nucleus bilaterally. Briefly, the animals are anesthetized, and then 1μl of 0.2% 6-OHDA in 0.01% ascorbic acid saline is stereotaxically injected into the A11 nucleus bilaterally (mediolateral 0.35mm, dorsal / ventral 4.5mm, anterior-posterior -1.95mm) as previously described (Qu et al., J Neuropathol Exp Neurol, 66:383-388, 2007; and Luo et al., Sleep Medicine, 12:41-46, 2011).
[0083] Mice are then randomly assigned to various treatment groups (n=5-10 mice per group): (i) vehicle control, (2) SPH, (3) oligopeptide FT-006, (iv) oligopeptide FT-007, and (v) oligopeptide FT-008. Additional groups may be included to test one or more of FT-002, FT-004, and other oligopeptides consistent with consensus number 1. Oligopeptide doses for this study may range from about 1 mg to about 1000 mg, or about 10 mg to about 100 mg per kg of body weight of the mouse. After the first treatment by intraperitoneal injection on day 1, subsequent treatments are administered orally in mouse chow. The study may continue for up to 4, 8, or 12 weeks.
[0084] Locomotor activity measurements. Locomotor activity measurements are performed using an Accu-Scan Digiscan system (Acuscan Instruments, Columbus, OH, USA). Computer-collected data include Total Distance traveled (cm / 60 min) and Moving Time (sec / 60 min). The measurements are performed from 9AM to 11AM in a dark room. Each mouse is placed in the test chamber for 30 minutes for acclimation and then recorded for 60 minutes using a computer-generated automated analysis system. The locomotor activity is measured in mice before treatment begins on day 0 (baseline activity level) and periodically thereafter throughout the course of the study.
[0085] Blood samples are collected (tail vein or cheek puncture) every 2 weeks for analysis of iron and biomarker levels. At the end of the study, mice are humanely sacrificed. Spinal cord tissue is immediately dissected and placed on ice. Lumbar spinal cord is then isolated and processed as follows: homogenization and digestion for assessment of iron levels; RNA isolation for assessment of FTH1 gene expression; and fixation for immunohistochemistry analysis. Blood is collected by cardiac puncture for iron and biomarker analysis. Skeletal muscle, spleen, heart, and liver samples are also collected at sacrifice for measurement of gene expression and immunohistochemistry analysis. Spleens are divided in half: the first half is snap frozen for immunohistochemistry analysis, and the second half is processed to isolate macrophages using the EasySep Mouse F4 / 80 Immunomagnetic Positive Selection Kit (StemCell Technologies), from which RNA is isolated for gene expression analysis.
[0086] (Iron measurement in lumbar spinal cord). At necropsy, lumbar spinal cord is collected, weighed, and digested in concentrated hydrochloric acid. Tissue iron concentration (micrograms of iron per gram of tissue) is determined spectrophotometrically using a kit from Diagnostic Chemical Limited (Charlotteown, PE, Canada) modified for a microtiter plate assay.
[0087] Gene Expression. RNA isolation and gene expression analysis are performed as described in Example 8 above.
[0088] (Immunohistochemistry Analysis). Organ samples are embedded in OCT compound and snap frozen. Frozen samples are sectioned on a cryostat and then stained for H-ferritin and L-ferritin. Sections are also stained with H&E to assess inflammation.
[0089] Statistical analysis. Data are presented as mean ± standard error of the mean (SEM) or mean ± standard deviation (SD). Differences between vehicle-treated ID+6OHDA-lesioned mice and ID+6OHDA-lesioned mice treated with oligopeptide FT-006, oligopeptide FT-007, and oligopeptide FT-008 are analyzed using the original data or transformed data normalized to vehicle controls (% of control). Outliers per group are analyzed by setting an outer fence at 2 standard deviations. To correct for multiple testing, one-way Bonferroni multiple comparison tests for normal distribution and Kruskal-Wallis nonparametric tests for small numbers of animal samples are applied. A p-value of <0.05 is considered significant.
[0090] Although the present disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be apparent to those skilled in the art that certain changes and modifications may be implemented in light of the above teachings. Therefore, the above examples should not be construed as limiting the scope of the present disclosure, which is clearly indicated by the appended claims.
Claims
1. An isolated oligopeptide consisting of an amino acid sequence of Xm(R / D)EES(G / D)(E / K)Xn (consensus number 1), wherein m and n are integers independently selected from the range of 0 to 10, and each X, if present, is independently selected from any amino acid. (i) the amino acid sequence of REESGEP (SEQ ID NO: 2); or (ii) the amino acid sequence of REESDKPMY (SEQ ID NO: 6); or (iii) the amino acid sequence of PREESDKP (SEQ ID NO: 7); or (iv) the amino acid sequence of REESGEL (SEQ ID NO: 8); or (v) the amino acid sequence of KEEDEESGE (SEQ ID NO: 3); or (vi) the amino acid sequence of KPREESGE (SEQ ID NO: 4); or (vii) the amino acid sequence of LDEESGEP (SEQ ID NO: 5); or (viii) an amino acid sequence of XjREESDKPXk (SEQ ID NO: 18), where j is an integer selected from the range of 0 to 10, k is an integer selected from the range of 0 to 9, and each X, if present, is independently selected from any amino acid. Including, Optionally, the isolated oligopeptide comprises the amino acid sequence of XgREESDKP(XhXi) (SEQ ID NO: 19), wherein Xg is proline or absent, and XhXi is methionine and tyrosine or absent.
2. The isolated oligopeptide of claim 1.
3. 3. The isolated oligopeptide of claim 2, which is capable of increasing expression of ferritin heavy chain 1 (FTH1) mRNA by a mammalian cell contacted with the oligopeptide.
4. 10. A formulation comprising the isolated oligopeptide of claim 2 and at least one pharmaceutically acceptable excipient.
5. 10. A formulation comprising the isolated oligopeptide of claim 2 and an oral delivery agent, Optionally, the oral delivery agent comprises an absorption enhancer, a fatty acid, an enzyme inhibitor, polyethylene glycol, a mucoadhesive polymer, a cell-penetrating peptide, or a combination thereof; Optionally, the formulation further comprises an enteric coating, liposomes, microspheres, and / or microparticles / nanoparticles.
6. An isolated nucleic acid encoding the oligopeptide of claim 2.
7. An expression vector comprising the nucleic acid of claim 6 operably combined with a promoter.
8. A host cell comprising the isolated nucleic acid of claim 6 or the expression vector of claim 7.
9. A medicament comprising the formulation of claim 4 or 5.
10. 6. The formulation of claim 4 or 5 for use in a method for increasing expression of ferritin heavy chain 1 (FTH1) mRNA by mammalian cells, the method comprising: contacting said mammalian cells with said formulation to increase FTH1 expression. Including, Optionally, the mammalian cell is an intestinal epithelial cell, a skeletal muscle cell, an astrocyte, or a macrophage; Optionally, the contacting is performed in vivo. formulation.
11. 6. The formulation of claim 4 or 5 for increasing ferritin heavy chain 1 (FTH1) expression in a mammalian subject in need thereof.
12. 6. The formulation of claim 4 or 5 for increasing serum ferritin levels in a mammalian subject in need thereof.
13. 6. The formulation of claim 4 or 5 for treating or preventing a disease or condition in a mammalian subject in need thereof, comprising: Optionally, the disease or condition is associated with iron deficiency; Optionally, the disease or condition is associated with anemia; Optionally, the disease or condition is restless legs syndrome. formulation.
14. The preparation is orally administered; Optionally, the formulation is enterally administered; Optionally, the formulation is administered by the buccal, sublabial, or sublingual route. The formulation of claim 13.
15. The formulation of claim 4 or 5 for increasing ferritin heavy chain 1 (FTH1) expression in a mammalian subject in need thereof, for increasing serum ferritin levels in a mammalian subject in need thereof, or for treating or preventing a disease or condition in a mammalian subject in need thereof, wherein the mammalian subject is a human subject; Optionally, the human subject is cancer-free. formulation.