Omicron coronavirus vaccine constructs and methods of making and using same

Abstract

Provided herein are adenoviral vectors encoding spike protein mutants of the SARS-CoV2 coronavirus, and compositions comprising said vectors. Methods of preventing and treating SARS-CoV2 using the provided compositions are also provided.

Description

[Technical field]

[0001] Government assistance This invention was made with government support under CA211096 awarded by the National Institutes of Health. The United States Government has certain rights in this invention.

[0002] The present disclosure relates generally to the fields of biotechnology and medicine, and more specifically to nucleic acid constructs, polypeptides, and vectors that can be used in vaccines for enhanced treatment against respiratory viral infections, and methods of their use.

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 434,815, filed December 22, 2022, which claims the benefit of U.S. Provisional Patent Application No. 63 / 384,075, filed November 16, 2022, which claims the benefit of U.S. Provisional Patent Application No. 63 / 375,803, filed September 15, 2022, and which claims the benefit of U.S. Provisional Patent Application No. 63 / 305,979, filed February 2, 2022, the disclosures of which are incorporated herein by reference in their entireties. [Background technology]

[0004] Viral infections are responsible for hundreds of thousands of deaths each year. However, treatment options for many viruses are limited. Furthermore, viral carriers can be asymptomatic, resulting in high rates of transmission from infected but asymptomatic individuals. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the etiological agent of coronavirus disease 2019 (COVID-19), which can rapidly progress to pneumonia, respiratory failure, and systemic inflammatory disease. SARS-CoV-2 is a positive-sense single-stranded RNA virus that was first isolated in late 2019 from a patient with severe respiratory disease in Wuhan, China. As a betacoronavirus, SARS-CoV-2 is related to two other highly pathogenic respiratory viruses, SARS-CoV and Middle East respiratory syndrome coronavirus (MERS-CoV). SARS-CoV-2 infection results in a clinical syndrome that can progress to respiratory failure and present with cardiac involvement, gastrointestinal disease, blood coagulation disorders, and a highly inflammatory syndrome. The elderly, immunocompromised individuals, and those with coexisting medical conditions (e.g., obesity, diabetes, and hypertension) are at greatest risk of death from COVID-19. Since the start of this epidemic, over 669 million infections and 6.8 million deaths have been recorded worldwide. Summary of the Invention [Problem to be solved by the invention]

[0005] The enormous morbidity, mortality, and destabilizing socioeconomic consequences of COVID-19 underscore the urgent need for the deployment of an effective SARS-CoV-2 vaccine to reduce the severity of infection, suppress transmission, end the epidemic, and prevent its recurrence. [Means for solving the problem]

[0006] One embodiment of the technology encompasses an adenoviral vector comprising the genome of a non-human adenovirus, the genome of the adenovirus being modified such that the vector lacks the native E1 locus, and optionally lacks the E3 or E3B locus, and includes a nucleic acid sequence encoding a SARS-CoV-2 spike (S) protein having an amino acid sequence at least 80% identical to any of SEQ ID NOs: 10, 12, 20, or 21, or an immunogenic portion or fragment thereof.

[0007] Another embodiment of the present technology includes an adenovirus vector comprising a nucleic acid sequence encoding an amino acid sequence at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to any of SEQ ID NOs: 10-12, 20, and 21, or an immunogenic portion or fragment thereof.

[0008] Further aspects of the present technology include adenoviral vectors comprising or consisting of a nucleic acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to any one of SEQ ID NOs: 13-19.

[0009] Yet another embodiment of the present technology is directed to a method for the treatment of a tumor comprising administering to the subject a tumor necrosis factor (TNE) gene or a tumor necrosis factor (TNF) gene, comprising administering to the subject a tumor necrosis factor (TNF) gene or ... In one embodiment, the present invention includes an adenoviral vector comprising a nucleic acid sequence encoding an amino acid sequence at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to SEQ ID NO:3, including at least 15, or at least 20, or at least 25, or at least 30 mutations.

[0010] Yet another aspect includes a pharmaceutical composition comprising the adenoviral vector described herein.Similarly, an aspect includes an immunogenic composition comprising the adenoviral vector described herein.

[0011] Some aspects of the present technology include host cells transduced with the adenoviral vectors described herein or packaging cell lines that produce the adenoviral vectors described herein.

[0012] Other aspects of the technology include kits. Generally, the kits include (i) one or more of the host cells described herein, the packaging cell lines described herein, the adenoviral vectors described herein, the pharmaceutical compositions described herein, or the immunogenic compositions described herein, and (ii) instructions for use.

[0013] Certain embodiments of the present technology include a coronavirus vaccine comprising an adenoviral vector as described in detail herein. In certain embodiments, the present technology includes a composition comprising serum from a first subject previously administered an adenoviral vector as described herein, a pharmaceutical composition as described herein, or an immunogenic composition as described herein. The present technology further includes a method of treating a second subject with a coronavirus infection, comprising administering to the second subject an immunogenically effective amount of a composition comprising serum from the first subject.

[0014] In yet another aspect, the technology encompasses a method of inducing an immune response against a coronavirus in a subject in need thereof, the method comprising administering to the subject an immunogenically effective amount of a composition comprising an adenoviral vector described herein, a pharmaceutical composition described herein, or an immunogenic composition described herein.

[0015] Other aspects and iterations are described in more detail below.

[0016] Those skilled in the art will understand that the drawings described below are for illustrative purposes only and are not intended to limit the scope of the present teachings in any way.

[0017] This application contains at least one drawing executed in color. Copies of this patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0018] [Figure 1A] A schematic representation of the transgene cassette is shown: ChAd control has no transgene insert; ChAd-SARS-CoV-2-S encodes the SARS-CoV-2 S protein containing the two indicated proline mutations.

[0019] [Figure 1B]Binding of ChAd-SARS-CoV-2-S transduced 293 cells with anti-S mAb. (Left) Summary: +, ++, +++, - indicate <25%, 25-50%, >50% binding and no binding, respectively. (Right) Representative flow cytometry histograms of two experiments.

[0020] [Figure 1C] Four-week-old female BALB / c mice were immunized with ChAd control or ChAd-SARS-CoV-2-S via the intramuscular route and boosted 4 weeks later. Antibody responses were assessed in the serum of immunized mice 21 days after priming or boosting.

[0021] [Figure 1D] ELISA-measured anti-S and RBD IgG levels are shown.

[0022] [Figure 1E] FRNT-determined neutralizing activity is shown. Data are pooled from two experiments (n = 15 to 30; Mann-Whitney test: ****, P < 0.0001).

[0023] [Figure 1F] Cell-mediated responses were analyzed 7 days after booster immunization following restimulation with an S protein peptide pool. Splenocytes were assayed for IFNγ and granzyme B expression in CD8+ T cells by flow cytometry, and for granzyme B alone in CD4+ T cells.

[0024] [Figure 1G] An overview of the frequency and number of positive cell populations is shown (n = 5; Mann-Whitney test: *, P < 0.05; **, P < 0.01; ***, P < 0.001). Bars indicate median values ​​and dotted lines are the limit of detection (LOD) of the assay.

[0025] [Figure 1H]Spleens were harvested 7 days after the boost and SARS-CoV-2 spike-specific IgG+ antibody-secreting cell (ASC) frequencies were measured by ELISPOT (Mann-Whitney test: ****, P<0.0001). Bars and columns indicate median values ​​and dotted lines indicate the limit of detection (LOD) of the assay.

[0026] [Figure 2A] Sera collected 21 days after priming or boosting (as described in FIG. 1) from mice immunized with ChAd-control were assayed for S-specific IgG responses by ELISA. Four-week-old female BALB / c mice were primed or primed and boosted with ChAd-control or ChAd-SARS-CoV-2-S via the intramuscular route.

[0027] [Figure 2B] Serum samples from ChAd control or ChAd-SARS-CoV-2 vaccinated mice were collected 21 days after priming. Four-week-old female BALB / c mice were primed or primed and boosted with ChAd control or ChAd-SARS-CoV-2-S via the intramuscular route.

[0028] [Figure 2C] Serum samples from ChAd control or ChAd-SARS-CoV-2 vaccinated mice were collected 21 days after boosting and assayed for neutralizing activity by FRNT. Serum neutralization curves corresponding to individual mice are shown for the indicated vaccines (n = 15–30 per group). Each point represents the mean of two technical replicates with error bars indicating standard deviation (SD). The ChAd-SARS-CoV-2-S vaccine elicits neutralizing antibodies as measured by the focus reduction neutralization test (FRNT).

[0029] [Figure 2D]ELISA-measured anti-SARS-CoV-2 NP IgG responses in paired sera obtained 5 days before and 8 days after SARS-CoV-2 challenge of ChAd-control or ChAd-SARS-CoV-2-S mice vaccinated by the intramuscular route are shown (n=5: ** P<0.01; *** P<0.001; paired t-test). The dotted line represents the mean IgG titer from naive sera.

[0030] [Diagram 3] Gating strategy for analysis of T cell responses is shown. Four-week-old female BALB / c mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S and boosted 4 weeks later. T cell responses were analyzed 7 days after boost in splenocytes. Cells were gated for lymphocytes (FSC-A / SSC-A), singlets (SSC-W / SSC-H), live cells (Aqua-), CD45+, CD19-, followed by CD4+ or CD8+ cell populations expressing IFNγ or granzyme B.

[0031] [Figure 4A] Neutralizing activity of Hu-AdV5-hACE2 in serum from the indicated vaccine groups was determined by FRNT after prime only. Four-week-old female BALB / c mice were primed or primed and boosted. Serum samples were collected 1 day before Hu-AdV5-hACE2 transduction.

[0032] [Figure 4B] Neutralizing activity of Hu-AdV5-hACE2 in sera from the indicated vaccine groups was determined by FRNT after prime and boost. Each symbol represents one animal; each point represents two technical replicates, and the bars indicate the range. A positive control (anti-Hu-Adv5 serum) is included as a frame of reference.

[0033] [Figure 5A]Vaccination and challenge plan to study the protective efficacy of intramuscularly delivered ChAd-SARS-CoV-2-S against SARS-CoV-2 infection. Four-week-old BALB / c female mice were immunized with ChAd control or ChAd-SARS-CoV-2-S. Some mice received a booster dose of the homologous vaccine. 35 days after immunization, mice were challenged with SARS-CoV-2 as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the intranasal route. Five days later, mice were challenged with 4 × 105 focus-forming units (FFU) of SARS-CoV-2 via the intranasal route.

[0034] [Figure 5B] Tissues were taken at 4 and 8 dpi for analysis. Infectious virus in the lungs was measured by plaque assay.

[0035] [Figure 5C] Viral RNA levels were measured by RT-qPCR (C) in lung, spleen, and heart at 4 and 8 dpi (n = 3–7, Mann-Whitney test: *** P < 0.001).

[0036] [Figure 5D] Viral RNA in situ hybridization using a SARS-CoV-2 probe (brown) in lungs harvested at 4 dpi. Images are shown at low (top; scale bar, 100 μm) and medium (middle; scale bar, 100 μm) power magnification with high power magnification insets (representative images from n=3 per group).

[0037] [Figure 5E]Fold changes in gene expression of the indicated cytokines and chemokines from lung homogenates at 4 dpi were determined by RT-qPCR after normalization to Gapdh levels and comparison with naive unvaccinated, unchallenged controls (n=7; Mann-Whitney test: ***, P<0.001).

[0038] [Figure 5F] Mice that received prime-boost immunization were challenged 35 days after booster immunization. Tissues were collected 4 dpi for analysis. Infectious virus in the lungs was determined by plaque assay.

[0039] [Figure 5G] Mice that received prime-boost immunizations were challenged 35 days after the booster immunization, and viral RNA was measured using RT-qPCR (G) in the lungs, spleen, and heart (n = 6–7; Mann-Whitney test: **, P < 0.01). (B–C and E–G) Columns indicate median values, and dotted lines indicate the LOD of the assay.

[0040] [Figure 6] We show that a single-dose intramuscular vaccination with ChAd-SARS-CoV-2-S protects mice from SARS-CoV-2-induced inflammation in the lungs. Four-week-old female BALB / c mice were immunized with ChAd control and ChAd-SARS-CoV-2-S and challenged according to the scheme described in Figure 5. Lungs were harvested 8 dpi. Sections were stained with hematoxylin and eosin and imaged at magnifications of 40x (left; scale bar, 250 μm), 200x (middle; scale, 50 μm) and 400x (right; scale bar, 25 μm). Each image is representative of a group of 3 mice.

[0041] [Figure 7A]Experimental design to study immune responses after intranasal immunization with ChAd-SARS-CoV-2-S. Five-week-old BALB / c female mice were immunized via the intranasal route with ChAd-control or ChAd-SARS-CoV-2-S.

[0042] [Figure 7B] Antibody responses in the serum of immunized mice were assessed one month after priming. ELISA measured SARS-CoV-2 S- and RBD-specific IgG.

[0043] [Figure 7C] ELISA-measured SARS-CoV-2 S- and RBD-specific IgA levels are shown.

[0044] [Figure 7D] Neutralizing activity determined by FRNT is shown. Data are pooled from two experiments with n = 10–25 mice per group (Mann-Whitney test: ****, P < 0.0001).

[0045] [Figure 7E] Mice that received a booster dose were sacrificed one week later to assess mucosal and cell-mediated immune responses. SARS-CoV-2 S- and RBD-specific IgG.

[0046] [Figure 7F] SARS-CoV-2 S- and RBD-specific IgA levels in BAL fluid were determined by ELISA.

[0047] [Figure 7G] Shows that the neutralizing activity of BAL fluid against SARS-CoV-2 was measured by FRNT.

[0048] [Figure 7H]FIG. 1 shows that CD8+ T cells in the lungs were assayed for IFNγ and Granzyme B expression by flow cytometry after restimulation with S protein peptide pools.

[0049] [Figure 7I] FIG. 1 shows that CD8+ T cells in the lungs were phenotyped for expression of CD103 and CD69.

[0050] [Figure 7J] SARS-CoV-2 spike-specific IgG+ and IgA+ antibody-secreting cell (ASC) frequencies in spleens harvested 1 week after boost were measured by ELISPOT. Data for mucosal and cell-mediated responses are pooled from two experiments (E–I: n=7–9 per group; Mann-Whitney test: ***, P<0.001; J: n=5 per group; Mann-Whitney test: **, P<0.01; ***, P<0.001). (B–J) Bars and columns indicate median values ​​and dotted lines indicate the LOD of the assay.

[0051] [Figure 8A] Serum samples from ChAd-control or ChAd-SARS-CoV-2-S vaccinated mice were tested for neutralizing activity with SARS-CoV-2 strain 2019 n-CoV / USA_WA1 / 2020 (n=8–10 per group). Five-week-old female BALB / c mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S via the intranasal inoculation route. Serum samples collected one month after immunization were assayed for neutralizing activity by FRNT. Mice were boosted 30 days after priming and sacrificed one week later to assess the immune response.

[0052] [Figure 8B]Serum samples from ChAd-SARS-CoV-2-S vaccinated mice were tested for neutralization of recombinant luciferase-expressing SARS-CoV-2 viruses [wild-type (left) and D614G mutant (center)]. (Right) Paired EC50 values ​​are shown (n=5; ns not significant, paired t-test).

[0053] [Figure 8C] Figure 1 shows that BAL fluid was collected from ChAd control or ChAd-SARS-CoV-2-S vaccinated mice and neutralization of SARS-CoV-2 strain 2019 n-CoV / USA_WA1 / 2020 was measured using the FRNT assay (n = 8–10 per group). Each point represents the mean of two technical replicates with error bars indicating SD.

[0054] [Figure 9A] Tissues and nasal washes were collected for analysis at 4 and 8 dpi. Infectious virus in the lungs was measured by plaque assay. Five-week-old BALB / c female mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S via the intranasal route. 35 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the intranasal route. Five days later, mice were challenged with 4 × 105 FFU of SARS-CoV-2 via the intranasal route.

[0055] [Figure 9B]Viral RNA levels in lungs, spleen, heart, nasal turbinates and nasal washes were measured by RT-qPCR at 4 and 8 dpi. Five-week-old BALB / c female mice were immunized with ChAd control or ChAd-SARS-CoV-2-S via the intranasal route. 35 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the intranasal route. Five days later, mice were challenged with 4 × 105 FFU of SARS-CoV-2 via the intranasal route.

[0056] [Figure 9C] Fold changes in gene expression of the indicated cytokines and chemokines in lung homogenates at 4 dpi were determined by RT-qPCR, normalized to Gapdh, and compared to untreated controls (2 experiments, n = 6–9; medians are shown: *, P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001; Mann-Whitney test). Columns indicate medians and dotted lines indicate the LOD of the assay. Five-week-old BALB / c female mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S via the intranasal route. 35 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the intranasal route. Five days later, mice were challenged with 4 × 105 FFU of SARS-CoV-2 via the intranasal route.

[0057] [Figure 9D]Lungs are shown harvested at 8 dpi. Sections were stained with hematoxylin and eosin and imaged at median 40× (left; scale bar, 250 μm), 200× (middle; scale, 50 μm) and 400× (right; scale bar, 25 μm). Each image is representative of a group of 3 mice. Five-week-old BALB / c female mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S via the intranasal route. 35 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the intranasal route. Five days later, mice were challenged with 4×105 FFU of SARS-CoV-2 via the intranasal route. [Figure 9E] ELISA-measured anti-SARS-CoV-2 NP IgM (left) and IgG (right) antibody responses in paired sera obtained 5 days before and 8 days after SARS-CoV-2 challenge of ChAd-control or ChAd-SARS-CoV-2-S mice vaccinated by the intranasal route are shown (n=6: ns; not significant; **P<0.01, ****P<0.0001; paired t-test). Dotted lines represent mean IgM and IgG titers from naive sera (n=6). Five-week-old BALB / c female mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S via the intranasal route. On day 35 after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and transduced 1 day later with Hu-AdV5-hACE2 via the intranasal route. Five days later, mice were challenged with 4 × 105 FFU of SARS-CoV-2 via the intranasal route.

[0058] [Figure 10A] Immunization schedule: Five-week-old female BALB / c mice were vaccinated with 1010 viral particles of ChAd control or decreasing doses (1010, 109 and 108 vp) ​​of ChAd-SARS-CoV-2-S via the IN or IM route.

[0059] [Figure 10B] Humoral responses in the serum of immunized mice were assessed (n=6–14). Anti-S and RBD IgG levels measured by ELISA from IN-immunized mice at 100 days are provided. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0060] [Figure 10C] Humoral responses in serum of immunized mice were evaluated (n=6-14). IgA levels measured by ELISA from IN immunized mice at 100 days are provided. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001). One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001). One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0061] [Figure 10D] Neutralizing activity of sera determined by FRNT from IN immunized mice 100 days post-vaccination. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0062] [Figure 10E] Anti-S and RBD IgG levels measured by ELISA from IN-immunized mice at 100 days post-vaccination or from IM-immunized mice at 100 days post-vaccination are shown. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0063] [Figure 10F]Anti-S and RBD IgA levels measured by ELISA from IN-immunized mice at 100 days post-vaccination or from IM-immunized mice at 100 days are shown. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0064] [Figure 10G] Neutralizing activity of sera determined by FRNT from IM immunized mice 100 days post-vaccination. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0065] [Figure 10H] Humoral responses in the serum of immunized mice were assessed (n=6–14). Anti-S and RBD IgG levels measured by ELISA from IN-immunized mice at day 200 are provided. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0066] [Figure 10I] Humoral responses in the serum of immunized mice were assessed (n = 6–14). Anti-S and RBD IgA levels measured by ELISA from IN-immunized mice at day 200 are provided. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P < 0.01; ****, P < 0.0001).

[0067] [Figure 10J] Neutralizing activity of sera determined by FRNT from IN immunized mice 200 days post-vaccination. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0068]

[0069] [Figure 10K] Anti-S and RBD IgG levels measured by ELISA from IN-immunized mice at 200 days or from IM-immunized mice at 100 days post-vaccination are shown. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0070] [Figure 10L] Anti-S and RBD IgA levels measured by ELISA from IN-immunized mice at 200 days or from IM-immunized mice at 100 days post-vaccination are shown. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0071] [Figure 10M] Neutralizing activity of sera determined by FRNT from IM immunized mice 200 days post-vaccination. One-way ANOVA with Dunnett's post-test comparing vaccine and control groups: ns, not significant; **, P<0.01; ****, P<0.0001).

[0072] [Figure 10N] The frequency of S-specific IgG- or IgA-producing LLPC in bone marrow measured by ELISPOT assay is shown (n = 4). Mann-Whitney test: *, P < 0.05. B–N, bars indicate median values, dotted lines indicate the limit of detection (LOD) of the assay.

[0073] [Figure 11A] Serum samples from ChAd-SARS-CoV-2-S vaccinated mice were collected on day 100. Five-week-old female BALB / c mice were immunized with a single 1010, 109 or 108 dose of ChAd-SARS-CoV-2-S via the IN or IM route.

[0074] [Figure 11B] Serum samples from ChAd-SARS-CoV-2-S vaccinated mice were collected 200 days after immunization and assayed for neutralizing activity by FRNT. Five-week-old female BALB / c mice were immunized with a single 1010, 109 or 108 dose of ChAd-SARS-CoV-2-S via the IN or IM route. Serum neutralization curves corresponding to individual mice are shown for the indicated vaccines (n=6–14 per group). Each point represents the mean of two technical replicates.

[0075] [Figure 12A] Sera from mice inoculated intranasally with ChAd-SARS-CoV-2-S were analyzed by the Luminex platform to quantify the amount of anti-SARS-CoV-2 (WA1 / 2020 D614G) spike and RBD IgG1. Bars represent the mean values.

[0076] [Figure 12B] Serum was analyzed by Luminex to quantify the amount of anti-SARS-CoV-2 IgG1 against different SARS-CoV-2 protein variants. Polar plots represent the median IgG1 percentile ranks for each SARS-CoV-2 protein and variant.

[0077] [Figure 12C] Heat maps showing IgG titers and FcγR binding titers against SARS-CoV-2 spike or RBD proteins for each vaccine regimen are shown. Each box represents the mean within-group z-score for a condition.

[0078] [Figure 12D]Serum was incubated with primary mouse neutrophils (mADNP) or J774A.1 cells (mADCP) and SARS-CoV-2 spike-coated beads, and phagocytosis was measured after 1 h. Bars indicate the mean and error bars indicate the standard deviation.

[0079] [Figure 12E] Serum was incubated with primary mouse neutrophils (mADNP) or J774A.1 cells (mADCP) and WA1 / 2020 D614G, B.1.1.7 or B1.351 spike-coated beads, and phagocytosis was measured after 1 h. Polar plots represent mADNP or mADCP percentile rank median values ​​for each SARS-CoV-2 protein and variant. For (A and D): One-way ANOVA with Dunnett's post-test comparing vaccine to control group: **, P<0.01; ***, P<0.001; ****, P<0.0001) (A and D): Bars indicate median values.

[0080] [Figure 13A]We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109 and 108 vp of ChAd-SARS-CoV-2-S via the IN route. On day 100, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 100 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0081] [Figure 13B] We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109 and 108 vp of ChAd-SARS-CoV-2-S via the IN route. 100 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 100 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0082] [Figure 13C] We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109 and 108 vp of ChAd-SARS-CoV-2-S via the IN route. 100 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 100 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0083] [Figure 13D]We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010 vp of ChAd-control via the IM route. On day 100, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 100 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0084] [Figure 13E] We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109 and 108 vp of ChAd-SARS-CoV-2-S via the IM route. 100 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 100 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0085] [Figure 13F] We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109 and 108 vp of ChAd-SARS-CoV-2-S via the IM route. 100 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 100 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0086] [Figure 13G]We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109 and 108 vp of ChAd-SARS-CoV-2-S via the IN route. On day 200, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 200 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0087] [Figure 13F] We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109 and 108 vp of ChAd-SARS-CoV-2-S via the IN route. 200 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 200 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0088] [Figure 13I] We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109 and 108 vp of ChAd-SARS-CoV-2-S via the IN route. 200 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 200 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0089] [Figure 13J]We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010 vp of ChAd-control via the IM route. On day 200, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 200 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0090] [Figure 13K] We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109, and 108 vp of ChAd-SARS-CoV-2-S via the IM route. 200 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 200 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0091] [Figure 13L] We show the durability of protective efficacy of ChAd-SARS-CoV-2-S against SARS-CoV-2 infection in BALB / c mice. Five-week-old female BALB / c mice were immunized with 1010 vp of ChAd-control or 1010, 109, and 108 vp of ChAd-SARS-CoV-2-S via the IM route. 200 days after immunization, mice were challenged as follows: animals were treated with anti-Ifnar1 mAb and 1 day later transduced with Hu-AdV5-hACE2 via the IN route. Five days later, mice were inoculated with 5x104 FFU of SARS-CoV-2 WA1 / 2020 via the intranasal route. Tissues shown in the figure were harvested 4 dpi and viral RNA levels were measured by RT-qPCR from mice challenged 200 days after immunization (n = 6–14; Kruskal-Walls with Dunn's posttest: ns, not significant; **, P<0.01; *, P<0.1; ***, P<0.001 ****, P<0.0001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0092] [Figure 14A] IgG levels specific for SARS-CoV-2 S and RBD measured by ELISA. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S. Antibody responses were evaluated in the serum of mice 6 weeks after immunization. Mann-Whitney test: ***, P<0.001; ****, P<0.0001.

[0093] [Figure 14B]IgA levels specific for SARS-CoV-2 S and RBD measured by ELISA. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S. Antibody responses were evaluated in the serum of mice 6 weeks after immunization. Mann-Whitney test: ***, P<0.001; ****, P<0.0001.

[0094] [Figure 14C] Neutralizing activity determined by FRNT in serum of mice at 6 weeks. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S. Paired analysis of serum neutralizing activity against WA1 / 2020 and Wash-B.1.351 from immunized mice collected at 6 weeks is provided. Two-tailed Wilcoxon matched-pairs signed rank test: *, P<0.05; ****, P<0.0001.

[0095] [Figure 14D] Neutralizing activity determined by FRNT in serum of mice at 6 weeks. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S. Paired analysis of serum neutralizing activity against WA1 / 2020 and Wash-B.1.1.28 from immunized mice collected at 6 weeks is provided. Two-tailed Wilcoxon matched-pairs signed rank test: *, P<0.05; ****, P<0.0001.

[0096] [Figure 14E] IgG levels specific for SARS-CoV-2 S and RBD measured by ELISA. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109vp ChAd control or ChAd-SARS-CoV-2-S. Antibody responses were assessed in the serum of mice 9 weeks after immunization. Mann-Whitney test: ***, P<0.001; ****, P<0.0001.

[0097] [Figure 14F] IgA levels specific for SARS-CoV-2 S and RBD measured by ELISA. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S. Antibody responses were evaluated in the serum of mice 9 weeks after immunization. Mann-Whitney test: ***, P<0.001; ****, P<0.0001.

[0098] [Figure 14G] Neutralizing activity determined by FRNT in serum of mice at 6 weeks. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S. Paired analysis of serum neutralizing activity against WA1 / 2020 and Wash-B.1.351 from immunized mice collected at 9 weeks is provided. Two-tailed Wilcoxon matched-pairs signed rank test: *, P<0.05; ****, P<0.0001.

[0099] [Figure 14H] Neutralizing activity determined by FRNT in serum of mice at 6 weeks. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S. Paired analysis of serum neutralizing activity against WA1 / 2020 and Wash-B.1.1.28 from immunized mice collected at 9 weeks is provided. Two-tailed Wilcoxon matched-pairs signed rank test: *, P<0.05; ****, P<0.0001.

[0100] [Figure 15A] Experimental design: Five-week-old K18-hACE2 female mice were immunized with 1010 vp of ChAd control or ChAd-SARS-CoV-2-S via the IN route.

[0101] [Figure 15B]Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. A plot of body weight change over time is shown. Data are mean ± SEM comparing vaccine groups with control groups (n = 6–9 for each group; unpaired t-test for area under the curve, **** P < 0.0001).

[0102] [Figure 15C] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the lungs were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0103] [Figure 15D] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the heart were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0104] [Figure 15E]Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in nasal washes were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0105] [Figure 15F] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the brain were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0106] [Figure 15G] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.1.28. A plot of body weight change over time is shown. Data are mean ± SEM comparing vaccine groups with control groups (n = 6–9 for each group; unpaired t-test for area under the curve, **** P < 0.0001).

[0107] [Figure 15H]Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.1.28. Viral RNA levels in the lungs were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0108] [Figure 15I] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.1.28. Viral RNA levels in the heart were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0109] [Figure 15J] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.1.28. Viral RNA levels in nasal washes were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0110] [Figure 15K]Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.1.28. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the brain were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0111] [Figure 15L] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 WA1 / 2020. A plot of body weight change over time is shown. Data are mean ± SEM comparing vaccine groups with control groups (n = 6–9 for each group; unpaired t-test for area under the curve, ****P<0.0001).

[0112] [Figure 15M] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 WA1 / 2020. Viral RNA levels in the lungs were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0113] [Figure 15N]Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 WA1 / 2020. Viral RNA levels in the heart were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0114] [Figure 15O] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 WA1 / 2020. Viral RNA levels in nasal washes were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0115] [Figure 15P] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Nine months after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. A plot of body weight change over time is shown. Data are mean ± SEM comparing vaccine groups with control groups (n = 6–9 for each group; unpaired t-test for area under the curve, **** P < 0.0001).

[0116] [Figure 15Q]Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Six weeks after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the lungs were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0117] [Figure 15R] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Nine months after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the heart were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0118] [Figure 15S] Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Nine months after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in nasal washes were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0119] [Figure 15T]Five-week-old K18-hACE2 female mice were immunized via the IN route with 1010vp of ChAd-control or ChAd-SARS-CoV-2-S. Nine months after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Nine months after immunization, mice were challenged with 104FFU of SARS-CoV-2 Wash-B.1.351. Viral RNA levels in the brain were measured by RT-qPCR at 6 dpi (n=6–9; Mann-Whitney test: **P<0.01, ***P<0.001). Bars indicate median values ​​and dotted lines indicate the LOD of the assay.

[0120] [Figure 16A] Figure 1 shows that the ChAd-SARS-CoV-2-S vaccine elicits neutralizing activity against WA1 / 2020, Wash-B.1.351, or Wash-B.1.1.28 as measured by FRNT. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S and serum samples were collected at 6 weeks. Serum neutralization curves corresponding to individual mice are shown for the indicated vaccines (n = 7–20 per group). Each point represents the mean of two technical replicates.

[0121] [Figure 16B] Figure 1 shows that the ChAd-SARS-CoV-2-S vaccine elicits neutralizing activity against WA1 / 2020, Wash-B.1.351, or Wash-B.1.1.28 as measured by FRNT. Five-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S and serum samples were collected at 9 months. Serum neutralization curves corresponding to individual mice are shown for the indicated vaccines (n = 7–20 per group). Each point represents the mean of two technical replicates.

[0122] [Figure 17]Sequence alignment of the stabilized mutant of SARS-Cov2-Omicron S protein with the SARS-CoV2 Wuhan S protein is shown.

[0123] [Figure 18] 1 shows the evaluation of SARS-CoV-2 spike gene expression mediated by ChAd vector derivatives, including omicronBA.5.

[0124] [Figure 19A] The schedule and timing of vaccinations, blood sampling, virus challenge, and necropsy are shown.

[0125] [Figure 19B] Binding of anti-SARS-CoV-2 IgG to SARS-CoV-2 Wuhan 1S protein. Kruskal-Walls with Dunn's post-test: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0126] [Figure 19C] Binding of anti-SARS-CoV-2 IgA to SARS-CoV-2 Wuhan 1S protein. Kruskal-Walls with Dunn's post-test: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0127] [Figure 19D] Binding of anti-SARS-CoV-2 IgG to BA.5 S protein. Kruskal-Walls with Dunn's post-test: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0128] [Figure 19E]Binding of anti-SARS-CoV-2 IgA to BA.5 S protein. Kruskal-Walls with Dunn's post-test: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0129] [Figure 19F] Binding of anti-SARS-CoV-2 IgG to SARS-CoV-2 BQ.1.1 S protein. Kruskal-Walls with Dunn's post-test: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0130] [Figure 19G] Binding of anti-SARS-CoV-2 IgA to SARS-CoV-2 BQ.1.1 S protein. Kruskal-Walls with Dunn's post-test: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0131]

[0132] [Figure 20A] Neutralizing activity against WA1 / 2020 by FRNT. Seven-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine and sera were obtained 28 days later. Each point represents data from an individual mouse and is the average of two technical replicates.

[0133] [Figure 20B] Neutralizing activity against BA.5 by FRNT. Seven-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine and sera were obtained 28 days later. Each point represents data from an individual mouse and is the average of two technical replicates.

[0134] [Figure 20C] Neutralizing activity against BF.7 by FRNT. Seven-week-old K18-hACE2 female mice were immunized with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine via the IN route and sera were obtained 28 days later. Each point represents data from an individual mouse and is the average of two technical replicates.

[0135] [Figure 20D] Neutralizing activity against BQ.1.1 by FRNT. Seven-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine and sera were obtained 28 days later. Each point represents data from an individual mouse and is the average of two technical replicates.

[0136] [Figure 20E] Neutralizing activity against XBB.1.1 by FRNT. Seven-week-old K18-hACE2 female mice were immunized via the IN route with 109 vp of ChAd-control or ChAd-SARS-CoV-2-S vaccine and sera were obtained 28 days later. Each point represents data from an individual mouse and is the average of two technical replicates.

[0137] [Figure 20F] Neutralization data are shown plotted as a head-to-head comparison for a given vaccine (ChAd-SARS-CoV-2 S(Wuhan 1) against the indicated SARS-CoV-2 strain used for infection.

[0138] [Figure 20G] Neutralization data are shown plotted as a head-to-head comparison for a given vaccine (ChAd-SARS-CoV-2 S(BA.5) against the indicated SARS-CoV-2 strains used for infection.

[0139] [Figure 20H]Neutralization data are shown plotted as a direct comparison for a given vaccine (ChAd-SARS-CoV-2 S(bivalent) against the indicated SARS-CoV-2 strains used for infection.

[0140] [Figure 21A] Viral RNA levels in lungs at 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right). Animals were either unvaccinated (control) or immunized with a single dose (109 viral particles total) of ChAd-control, ChAd-SARS-CoV-2 S(Wuhan1), ChAd-SARS-CoV-2-S(BA.5), or bivalent (ChAd-SARS-CoV-2 S(Wuhan1)+ChAd-SARS-CoV-2-S(BA.5)) via the intranasal route. Kruskal-Walth with Dunn's post-test: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0141] [Figure 21B] Viral RNA levels in nasal turbinates (Figure 21B) and nasal washes at 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right). Animals were either unvaccinated (control) or immunized with a single dose (109 viral particles total) of ChAd-control, ChAd-SARS-CoV-2 S(Wuhan1), ChAd-SARS-CoV-2-S(BA.5), or bivalent (ChAd-SARS-CoV-2 S(Wuhan1)+ChAd-SARS-CoV-2-S(BA.5)) via the intranasal route. Kruskal-Walth with Dunn's post-test: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0142] [Figure 21C]Viral RNA levels in nasal washes at 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right) are shown. Animals were either unvaccinated (control) or immunized with a single dose (109 viral particles total) of ChAd-control, ChAd-SARS-CoV-2 S(Wuhan1), ChAd-SARS-CoV-2-S(BA.5), or bivalent (ChAd-SARS-CoV-2 S(Wuhan1)+ChAd-SARS-CoV-2-S(BA.5)) via the intranasal route. Kruskal-Walls with Dunn's post-test: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0143] [Figure 22] Heatmaps of cytokine induction in vaccinated mice 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right). At the bottom, vaccination status of mice is indicated (unvaccinated, ChAd-Control, ChAd-SARS-CoV-2 S, ChAd-SARS-CoV-2-S, or bivalent (ChAd-SARS-CoV-2 S(Wuhan1)+ChAd-SARS-CoV-2-S(BA.5)). Map colors reflect log2 fold change compared to naive mice.

[0144] [Figure 23] 1 shows the sequence alignment of the stabilized mutant of BA.5 S protein against the Wuhan strain. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0145] The present disclosure is based, at least in part, on the development of recombinant non-human adenovirus vector compositions and immunogenic compositions thereof for treating or preventing coronavirus infection. Additionally, the present disclosure provides methods of administering the compositions disclosed herein that provide sustained cellular and humoral mediated immunity against coronavirus infection.

[0146] Severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1), which was involved in the SARS epidemic of 2002-2004, Middle East respiratory syndrome coronavirus (MERS-CoV), which caused MERS, first described in 2012, and SARS-CoV-2, which is involved in the more recent coronavirus disease 2019 (Covid-19) pandemic, all bind to angiotensin-converting enzyme 2 (ACE2) on the cell surface to infect cells. Essentially, ACE-2 is the functional receptor for SARS-CoV-1, SARS-CoV-2, and MERS-COV, as well as most likely future SARS-COV variants. ACE-2 is a key component of the renin-angiotensin-aldosterone system (RAAS). ACE-2 converts angiotensin 2 to angiotensin 1-7. Elevated angiotensin 2 is associated with vasoconstriction, inflammation, and acute lung injury. ACE2 is expressed in various organs, including the lungs, heart, kidneys, liver, intestine, and other tissues. The SARS-CoV virus binds to ACE-2 to enter cells.

[0147] The SARS-CoV-2 RNA genome is nearly 30,000 nucleotides long. The 5' two-thirds encodes nonstructural proteins that allow genome replication and viral RNA synthesis. The remaining one-third encodes structural proteins such as spike (S), envelope, membrane, and nucleoprotein (NP) that form the spherical virion, as well as accessory proteins that regulate cellular responses. The S protein forms homotrimeric spikes on the virion and interacts with the cell surface receptor angiotensin-converting enzyme 2 (ACE2) to facilitate coronavirus entry into human cells. SARS-CoV and SARS-CoV-2 S proteins are sequentially cleaved during the entry process to generate S1 and S2 fragments, followed by further processing of S2 to generate the smaller S2' protein (Hoffmann et al., 2020). The S1 protein contains the receptor-binding domain (RBD), and the S2 protein promotes membrane fusion. The structure of a soluble, stabilized prefusion form of the SARS-CoV-2 S protein has been solved by cryo-electron microscopy and reveals considerable similarity to the SARS-CoV S protein. This form of the S protein is recognized by strongly neutralizing monoclonal antibodies and may serve as a promising vaccine target.

[0148] The release of the SARS-CoV-2 genome sequence inspired academic, government, and industry groups to immediately begin developing vaccine candidates that would primarily target the viral S protein. Improved genome sequencing capabilities have also provided a wealth of information on SARS-CoV-2 variants circulating at any given time. SARS-CoV-2 mutates over time, leading to the emergence of new variants that differ in sequence, infectivity, and severity of infection. Various SARS-CoV-2 variants have emerged. The original form of SARS-CoV-2 identified in December 2019 is often referred to as the "original" or "Wuhan" strain. Subsequently, variants including alpha (B.1.1.7), beta (B.1.351), gamma (P.1), and delta (B.1.617.2 and AY sublineage) emerged between December 2020 and April 2021. However, the predominant variant at present is the Omicron variant (B.1.1.529 and BA sublineage), which emerged around November 2021. As used herein, the term "variant" in reference to a virus is a viral genome (genetic code) that may contain one or more mutations. In some cases, a group of variants may emerge with similar genetic changes, e.g., a lineage or a group of lineages. As used herein, a "lineage" is a group of closely related viruses that have a common ancestor. As used herein, the term "sublineage" or "subvariant" is a group of similar viruses within a lineage. Sublineages or subvariants of Omicron and other variants continue to emerge.

[0149] Numerous platforms have been developed to deliver the SARS-CoV-2 S protein, including DNA plasmids, lipid nanoparticle-encapsulated mRNA, inactivated virions, and viral vectored vaccines. Some vaccines have entered clinical trials to evaluate safety, and some have progressed to trials to evaluate immunogenicity and efficacy. Due to the urgency of the epidemic, most vaccines have progressed to human testing without substantial efficacy data in animals. This situation has arisen in part because vaccine design and development has been faster than the generation of accessible preclinical disease models of SARS-CoV-2 infection and pathogenesis.

[0150] Adenovirus (Ad)-based vaccines against betacoronaviruses have already been evaluated. A single dose of a chimpanzee Ad-vectored vaccine encoding the full-length S protein of MERS-CoV protected human dipeptidyl peptidase 4 (hDPP4) transgenic mice from infection, reduced viral shedding, enhanced survival in camels, and was safe and immunogenic in human phase 1 clinical trials. A human Ad-based vaccine expressing a MERS S1-CD40L fusion protein was also protective in transgenic hDPP4 mice. An Ad-based SARS-CoV vaccine expressing the full-length S protein prevented pneumonia after challenge in ferrets and was highly immunogenic in rhesus macaques. A chimpanzee Ad vector (Y25, monkey Ad-23) encoding the wild-type SARS-CoV-2 S protein (ChAdOx1 nCoV-19) is currently being evaluated as a single intramuscular injection in humans (NCT04324606). Preliminary preprint analyses suggest that the vaccine protects against lung infection and pneumonia, but not against upper respiratory tract infection and viral shedding in the nose (doi.org / 10.1101 / 2020.05.13.093195), but it failed as an intranasal vaccine.

[0151] Disclosed herein are compositions, methods, and treatment regimens for treating individuals at risk of having, having mild symptoms of, or having severe symptoms of, a respiratory viral infection. The compositions of the disclosure may be used to treat, prevent, or reduce the infectivity of a respiratory viral infection. The treatment regimen may include administering a composition of the disclosure to an individual at risk of having, or having, a viral infection, thereby preventing or treating the viral infection. In some embodiments, viral transmission may be prevented or reduced by reducing viral infection in the upper respiratory tract. The compositions and methods of the disclosure provide robust antigen-specific antibody, neutralizing antibody, and B cell and T cell responses. This confers protection against infection with a significant reduction in viral production, inflammation, and lung pathology. The compositions and methods of the disclosure generate robust mucosal immunity, including high levels of neutralizing and anti-RBD IgA and IgG in serum and lungs, and SARS-CoV-2-specific resident memory T cells in the lungs. The disclosed compositions and methods provide complete protection against SARS-CoV-2 infection in the nasal passages, upper respiratory tract, lung tissue, and all other sites of potential dissemination. Based on measurements of anti-NP and anti-ORF8 responses, a single intranasal dose of the disclosed composition confers sterilizing immunity, which has not previously been described for any COVID-19 vaccine, let alone a single dose.

[0152] The compositions of the present disclosure may be formulated and administered locally, e.g., intranasally (e.g., as a nasal spray or inhalation), or systemically (e.g., intravenously or intraperitoneally) to treat or prevent a respiratory viral infection (e.g., a coronavirus infection, such as SARS-CoV-2). The compositions of the present disclosure (e.g., compositions formulated for nasal delivery or inhalation) may be administered to a subject who may be at risk of suffering from a viral (e.g., SARS-CoV-2) infection. For example, the compositions of the present disclosure may be administered to individuals in high-risk environments (e.g., healthcare workers), individuals who have been exposed to or suspected of being exposed to a virus (e.g., SARS-CoV-2), or individuals who have tested positive for a viral infection. The compositions of the present disclosure may be administered to individuals who are symptomatic of a respiratory infection (e.g., SARS-CoV-2 infection) or who are asymptomatic at the time of administration. In some embodiments, the compositions of the present disclosure may be self-administered by an individual (e.g., as a nasal spray or inhalation) or may be administered outside of a healthcare facility (e.g., at home).

[0153] The methods and compositions disclosed herein may be used to treat, prevent, or reduce the infectivity of respiratory viral infections. In some embodiments, the viral infection may be a coronavirus infection. Pathogens with long incubation periods, such as SARS-CoV-2, which has a median incubation period of about 5 days, may have a high risk of transmission, as many infected individuals are unaware of their infection. In addition, coronavirus carriers are often asymptomatic or have mild symptoms, resulting in unwitting contact between hosts of the virus and other members of the population. Subjects at risk for coronavirus infection may come into contact with asymptomatic carriers of coronavirus infection, thereby unknowingly contracting the coronavirus infection. There is a need for methods and compositions to prevent coronavirus infection in at-risk individuals (e.g., individuals who have come into contact with or may come into contact with coronavirus carriers). In some embodiments, the compositions, methods, or treatment regimens disclosed herein may treat or prevent SARS-CoV-2 infection (e.g., COVID-19).

[0154] The components to be used to prepare the disclosed compositions, as well as the compositions to be used themselves in the methods disclosed herein, are discussed below. These and other materials are disclosed herein, and combinations, subsets, interactions, groups, etc. of these materials are disclosed, with the understanding that each of the various individual and collective combinations and permutations of these compounds are specifically contemplated and described herein, even if specific reference to each may not be explicitly disclosed. For example, if a particular compound is disclosed and discussed, and several modifications that can be made to some molecules of that compound are discussed, any and all combinations and permutations of the compounds, as well as possible modifications, unless specifically indicated to the contrary, are specifically contemplated. That is, if a class of molecules A, B, and C is disclosed, and an example of a class of molecules D, E, and F and a combination molecule AD are also disclosed, each is individually and collectively intended to mean that the combinations AE, AF, BD, BE, BF, CD, CE, and CF are considered to be disclosed, even if each is not individually listed. Similarly, any subset or combination of these is also disclosed. That is, for example, the subgroups AE, BF, and CE are considered to be disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions, i.e., if there are various additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed method.

[0155] Various aspects of the invention are described in further detail in the following sections.

[0156] I. Definition In order to make the present invention easier to understand, certain terms are defined first.Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention relates.Many methods and materials similar to, modified, or equivalent to those described herein can be used in the practice of the present invention without undue experimentation, and preferred materials and methods are described herein.In describing and claiming the present invention, the following terms are used according to the definitions described below.

[0157] The expressions and terms employed herein are for the purpose of explanation and should not be considered as limiting. For example, the use of singular forms such as "a" is not intended to limit the number of items. Also, the use of related terms including but not limited to "top", "bottom", "left", "right", "upper", "lower", "lower", "upper", and "side" are used in the description for clarity, particularly with reference to the figures, and are not intended to limit the concept of the present invention or the scope of the appended claims.

[0158] Any degree of degree, such as but not limited to "substantially" as used herein and in the appended claims, should be understood to include exact or similar configurations, but not exact configurations. For example, a "substantially flat surface" means having an exact or similar surface, but not an exact flat surface. Similarly, the terms "about" or "approximately" as used herein and in the appended claims should be understood to include the stated value or a value three times or one third of the stated value. For example, about 3 mm includes all values ​​from 1 mm to 9 mm, and approximately 50 degrees includes all values ​​from 16.6 degrees to 150 degrees. For example, these may mean ±5% or less, such as ±2% or less, such as ±1% or less, such as ±0.5% or less, such as ±0.2% or less, such as ±0.1% or less, such as ±0.05% or less.

[0159] The terms "comprising," "including," and "having" are used interchangeably in this disclosure. The terms "comprising," "including," and "having" mean including, but not necessarily limited to, what is so described.

[0160] The terms "or" and "and / or" as used herein should be construed as being inclusive or meaning any one or any combination. Thus, "A, B, or C" or "A, B, and / or C" means any of the following: "A", "B", or "C", "A and B", "A and C", "B and C", "A, B, and C". Exceptions to this definition occur only when combinations of elements, features, steps, or acts are in some way inherently mutually exclusive.

[0161] Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which this invention belongs. The following references provide those skilled in the art with general definitions of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). All of these are incorporated herein by reference. As used herein, unless otherwise specified, the following terms have the meanings ascribed to them below.

[0162] The phrases and terms employed herein are for the purpose of explanation and should not be considered as limiting. When introducing elements of the present disclosure or preferred embodiments thereof, the articles "a", "an", "the" and "said" are intended to mean that there are one or more of the elements. The terms "comprising" and "having" are inclusive and intend that there may be additional elements other than the listed elements. Whenever the term "comprising" or "including" is used, it should be understood that the present disclosure also expressly contemplates and encompasses additional embodiments "consisting of" the disclosed elements, and does not include additional elements other than the listed elements.

[0163] The term "about" or "approximately" as used herein means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, "about" can mean within or more than one standard deviation, according to convention for a given value. When a particular value is described in this application and claims, unless otherwise stated, the term "about" can mean an acceptable error range for that particular value, e.g., 10% of the value modified by the term "about". As used herein, the term "about" can mean ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% with respect to the referenced value, e.g., amount, dosage, temperature, time, percentage, etc.

[0164] Furthermore, since the inventive concept is open to many different forms of "aspects" or "embodiments" that are used interchangeably, the present disclosure should be considered as an example of the principles of the inventive concept, and is not intended to limit the inventive concept to the specific aspects shown and described. Any one of the features of the inventive concept may be used individually or in combination with any other feature. Reference to the term "aspect" and / or similar terms herein means that the referenced feature is included in at least one aspect of the present specification. Individual references to the term "aspect" and / or similar terms herein do not necessarily refer to the same aspect, and are not mutually exclusive, unless so described and / or as would be readily apparent to one of ordinary skill in the art from the present specification. For example, features, structures, processes, steps, acts, etc. described in one aspect may, but are not necessarily, included in other aspects. That is, the inventive concept may include various combinations and / or integrations of the aspects described herein. Furthermore, all aspects of the present disclosure described herein are not required for its practice. Similarly, other systems, methods, features, and advantages of the inventive concepts will become apparent to one with skill in the art upon examination of the figures and description, and all such additional systems, methods, features, and advantages are intended to be included herein, be within the scope of the inventive concepts, and be encompassed by the claims.

[0165] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in single-stranded or double-stranded form and polymers thereof. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have the same binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the explicitly indicated sequence. Specifically, degenerate codon substitutions are achieved by generating sequences in which the third position of one or more selected (or all) codons is replaced by mixed base and / or deoxyinosine residues. See, for example, Batzer et al., Nucleic Acid Res. 19:5081 (1991), the disclosure of which is incorporated herein in its entirety. In some aspects, a nucleic acid sequence can code for a polypeptide sequence.

[0166] As used herein, the term "encode" broadly refers to any process by which information in a polymeric macromolecule is used to direct the production of a second molecule that is different from the first molecule. The second molecule may have a chemical structure that is different from the chemical nature of the first molecule. For example, in some embodiments, the term "encode" describes the process of semi-conservative DNA replication in which one strand of a double-stranded DNA molecule is used as a template by a DNA-dependent DNA polymerase to code for a newly synthesized complementary sister strand. In other embodiments, a DNA molecule can encode an RNA molecule (e.g., by the process of transcription using a DNA-dependent RNA polymerase enzyme). An RNA molecule can also encode a polypeptide, as in the process of translation. When used to describe the process of translation, the term "encode" also extends to triplet codons that code for amino acids. In some embodiments, an RNA molecule can encode a DNA molecule, for example, by the process of reverse transcription incorporating an RNA-dependent DNA polymerase. In another embodiment, the DNA molecule can encode a polypeptide, where "encode" as used herein is understood to incorporate both the processes of transcription and translation.

[0167] A nucleic acid is "operably linked" when it is placed into a structural or functional relationship with another nucleic acid sequence. For example, one segment of DNA can be operably linked to another segment of DNA if they are positioned relative to each other on the same contiguous DNA molecule and have a structural or functional relationship, such as a promoter or enhancer positioned relative to a coding sequence to facilitate transcription of the coding sequence, a ribosome binding site positioned relative to a coding sequence to facilitate translation, or a presequence or secretory leader positioned relative to a coding sequence to facilitate expression of a preprotein (e.g., a preprotein that contributes to the secretion of the encoded polypeptide). In other examples, operably linked nucleic acid sequences are not contiguous but are positioned in such a way that they have a functional relationship to each other as nucleic acids or as proteins expressed by them. For example, enhancers need not be contiguous. Linkage can be accomplished by ligation at convenient restriction sites or by use of synthetic oligonucleotide adaptors or linkers.

[0168] In some aspects, a nucleic acid encoding a polypeptide can be operably linked to an expression control sequence.

[0169] Expression control sequence refers to a nucleic acid sequence that regulates the expression of a heterologous nucleic acid sequence to which it is operably linked. An expression control sequence is operably linked to a nucleic acid sequence when it controls and regulates the transcription and, where appropriate, the translation of the nucleic acid sequence. That is, an expression control sequence may include a suitable promoter, enhancer, transcription terminator, a start codon (ATG) in front of a protein-coding gene, splicing signals for introns, maintaining the correct reading frame of the gene to allow proper translation of mRNA, and a stop codon. The term "control sequence" is intended to include, at a minimum, components whose presence may affect expression, and may also include additional components whose presence is advantageous, such as leader sequences and fusion partner sequences. An expression control sequence may include a promoter.

[0170] A promoter is a minimal sequence sufficient to direct transcription. Also included are promoter elements sufficient to render promoter-dependent gene expression controllable, cell type-specific, tissue-specific, or inducible by an external signal or agent. Such elements may be located in the 5' or 3' region of the gene. Both constitutive and inducible promoters are included (see, e.g., Bitter et al., Methods in Enzymology 153:516-544, 1987). For example, when cloning in bacterial systems, inducible promoters such as pL from bacteriophage lambda and plac, ptrp, ptac (ptrp-lac hybrid promoter) can be used. In one embodiment, when cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., retroviral long terminal repeat; adenoviral late promoter; vaccinia virus 7.5K promoter) can be used. Promoters produced by recombinant DNA or synthetic techniques may also be used to provide transcription of nucleic acid sequences. Expression vector: A vector containing a recombinant polynucleotide that includes an expression control sequence operably linked to the nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression. Other elements for expression are supplied by the host cell or by an in vitro expression system. Expression vectors include all expression vectors known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.

[0171] The term "heterologous" means originating from a different genetic source. A nucleic acid molecule heterologous to a cell originates from a genetic source other than the cell in which it is expressed. In one specific, non-limiting example, a heterologous nucleic acid molecule encoding a recombinant coronavirus S protein is expressed in a cell, such as a mammalian cell. Methods for introducing heterologous nucleic acid molecules into a cell or organism, including, for example, electroporation, lipofection, particle gun acceleration, and transformation with nucleic acid, including homologous recombination, are well known in the art.

[0172] The terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to compounds consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that may make up a protein or peptide sequence. A polypeptide includes any peptide or protein that contains two or more amino acids bound to each other by peptide bonds. As used herein, the term refers to both short chains, also commonly referred to in the art as peptides, oligopeptides, and oligomers, for example, and longer chains, of which there are many varieties, commonly referred to in the art as proteins. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, mutants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof.

[0173] In the context of this application, a protein is represented by an amino acid sequence and correspondingly a nucleic acid molecule or polynucleotide represented by the nucleic acid sequence. Identity and similarity between sequences: Throughout this application, whenever a specific amino acid sequence sequence is referenced, for example SEQ ID NO: Y, it can be replaced with a polypeptide represented by the amino acid sequence comprising a sequence having at least 60% sequence identity or similarity with the amino acid sequence of SEQ ID NO: Y. Another preferred level of sequence identity or similarity is 65%. Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 75%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 85%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 98%. Another preferred level of sequence identity or similarity is 99%.

[0174] Each amino acid sequence described herein by its percentage of identity or similarity with a given amino acid sequence, in further preferred embodiments, has at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 110%, at least 111%, at least 112%, at least 113%, at least 114%, at least 115%, at least 116%, at least 117%, at least 118%, at least 119%, at least 120%, at least 121%, at least 122%, at least 123%, at least 124%, at least 125%, at least 126%, at least 127%, at least 128%, at least 129%, at least 130%, at least 131%, at least 132%, at least 133%, at least 134%, at least 13 , at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity. The terms "homology", "sequence identity", and others are used interchangeably herein. Sequence identity is described herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In a preferred embodiment, sequence identity is calculated based on the full length of the two given SEQ ID NOs, or a portion thereof. The part preferably means at least 50%, 60%, 70%, 80%, 90% or 100% of both SEQ ID NOs. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, determined by the match between a series of such sequences. The degree of sequence identity between two sequences can be determined by comparing the two sequences using a computer program commonly employed for this purpose, such as a global or local alignment algorithm. Non-limiting examples include BLASTp, BLASTn, Clustal W, MAFFT, Clustal Omega, AlignMe, Praline, GAP, BESTFIT, or another suitable method or algorithm.The Needleman and Wunsch global alignment algorithm can be used to align two sequences over their entire length or a portion (wherein a portion can mean at least 50%, 60%, 70%, 80%, 90% of the length of the sequence) to maximize the number of matches and minimize the number of gaps. Default settings can be used, with the preferred programs being Needle (in one embodiment, EMBOSS needle: 6.6.0.0, gap open penalty: 10, gap extent penalty: 0.5, end gap penalty: false, end gap open penalty: 10, end gap extent penalty: 0.5) for pairwise alignments and MAFFT (in one embodiment, MAFFT v7 default values ​​are used: BLOSUM62 [bl62], gap open: 1.53, gap extension: 0.123, order: aligned, number of tree rebuilds: 2, guide tree output: ON [true], max iterations: 2, perform FFTS: none) for multiple sequence alignments.

[0175] The "similarity" between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutions with the sequence of a second polypeptide. Similar algorithms used for determining sequence identity can be used for determining sequence similarity. When determining the degree of amino acid similarity, those skilled in the art may take into account so-called conservative amino acid substitutions. As used herein, "conservative" amino acid substitution refers to the interchangeability of residues with similar side chains.

[0176] For example, the group of amino acids with aliphatic side chains includes glycine, alanine, valine, leucine, and isoleucine. The group of amino acids with aliphatic hydroxyl side chains includes serine and threonine. The group of amino acids with amide-containing side chains includes asparagine and glutamine. The group of amino acids with aromatic side chains includes phenylalanine, tyrosine, and tryptophan. The group of amino acids with basic side chains includes lysine, arginine, and histidine. The group of amino acids with sulfur-containing side chains includes cysteine ​​and methionine. Preferred conservative amino acid substitution groups include valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid changes are conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser;Arg to Lys;Asn to Gln or His;Asp to Glu;Cys to Ser or Ala;Gln to Asn;Glu to Asp;Gly to Pro;His to Asn or Gln;Ile to Leu or Val;Leu to Ile or Val;Lys to Arg, Gln, or Glu;Met to Leu or Ile;Phe to Met, Leu, or Tyr;Ser to Thr;Thr to Ser;Trp to Tyr;Tyr to Trp or Phe; and Val to Ile or Leu.

[0177] Adjuvant refers to a medium used to enhance antigenicity. In some embodiments, the adjuvant may include a suspension of minerals (alum, aluminum hydroxide, or phosphate) onto which the antigen is adsorbed, or a water-in-oil emulsion in which an antigen solution is emulsified in mineral oil (Freund's incomplete adjuvant), which may contain killed mycobacteria to further enhance antigenicity (to inhibit antigen degradation and / or induce macrophage influx) (Freund's complete adjuvant). In some embodiments, the adjuvant used in the disclosed immunogenic compounds is a combination of lecithin and carbomer homopolymer (e.g., ADJUPLEX™ adjuvant available from Advanced BioAdjuvants, LLC; see also Wegmann, Clin Vaccine Immunol, 22(9): 1004-1012, 2015). Further adjuvants for use in the disclosed immunogenic compositions include QS21 purified plant extract, Matrix M, AS01, MF59, and ALFQ adjuvants. Immunostimulatory oligonucleotides (such as those containing CpG motifs) can also be used as adjuvants. Adjuvants include biological molecules ("biological adjuvants") such as costimulatory molecules. Exemplary adjuvants include IL-2, RANTES, GM-CSF, TNF-a, IFN-γ, G-CSF, LFA-3, CD72, B7-1, B7-2, OX-40L, 4-1BBL, and Toll-like receptor (TLR) agonists, such as TLR-9 agonists. Further description of adjuvants can be found, for example, in Singh (ed.) Vaccine Adjuvants and Delivery Systems. Wiley-Interscience, (2007). Adjuvants can be used in combination with the disclosed compositions.

[0178] The term "antibody" refers to an immunoglobulin, antigen-binding fragment, or derivative thereof that specifically binds and recognizes an analyte (antigen), such as a coronavirus S protein, an antigenic fragment thereof, or an antigen dimer or multimer. The term "antibody" is used herein in the broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired antigen-binding activity. Non-limiting examples of antibodies include, for example, intact immunoglobulins, as well as variants and fragments thereof that retain binding affinity for an antigen. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments. Antibody fragments include antigen-binding fragments produced by the modification of whole antibodies or synthesized de novo using recombinant DNA technology (see, e.g., Kontermann and Dubel (Ed), Antibody Engineering, Vols. 1-2, 2nd Ed., Springer Press, 2010).

[0179] Coronaviruses are a family of positive-sense single-stranded RNA viruses known to cause severe respiratory disease. Within the coronavirus family, viruses currently known to infect humans are from the genera Alphacoronavirus and Betacoronavirus. In addition, it is believed that the genera Gammacoronavirus and Deltacoronavirus may infect humans in the future.

[0180] Non-limiting examples of betacoronaviruses include Middle East Respiratory Syndrome Coronavirus (MERS-CoV), Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV), Human Coronavirus HKU1 (HKUl-CoV), Human Coronavirus OC43 (OC43-CoV), Mouse Hepatitis Virus (MHV-CoV), Bat SARS-like Coronavirus WIV1 (WIVl-CoV), and Human Coronavirus HKU9 (HKU9-CoV). Non-limiting examples of alphacoronaviruses include Human Coronavirus 229E (229E-CoV), Human Coronavirus NL63 (NL63-CoV), Porcine Epidemic Diarrhea Virus (PEDV), and Transmissible Gastroenteritis Coronavirus (TGEV). Non-limiting examples of deltacoronaviruses include Porcine Deltacoronavirus (SDCV).

[0181] The viral genome is capped, polyadenylated, and covered by the nucleocapsid protein. Coronavirus virions contain a viral envelope that contains a type I fusion glycoprotein called the spike (S) protein. Most coronaviruses share a common genome organization with the replicase gene contained in the 5' portion of the genome and the structural genes contained in the 3' portion of the genome.

[0182] Coronavirus spike (S) protein: Class I fusion glycoprotein that is synthesized early as a precursor protein. Individual precursor S polypeptides form homotrimers that are glycosylated in the Golgi apparatus and processed to remove the signal peptide and cleaved by cellular proteases to generate individual S1 and S2 polypeptide chains. These remain associated in the homotrimer as S1 / S2 protomers, thus a trimer of heterodimers. The S1 subunit is distal to the viral membrane and contains the receptor binding domain (RBD) that mediates attachment of the virus to its host receptor. The S2 subunit contains the fusion protein machinery, such as the fusion peptide, two heptad repeats (HR1 and HR2) and the central helix typical of fusion glycoproteins, a transmembrane domain, and a cytoplasmic tail domain.

[0183] The pre-fusion conformation of the coronavirus spike (S) protein is the structural conformation adopted by the extracellular domain of the coronavirus S protein following processing into the mature coronavirus S protein in the secretion system and prior to the induction of a fusion event that results in the transition to the post-fusion conformation of coronavirus S. The three-dimensional structure of an exemplary coronavirus S protein (HKU1-CoV) in the pre-fusion conformation is disclosed herein and provided in Kirchdoerfer et al., "Pre-fusion structure of a human coronavirus spike protein," Nature, 531:118-121, 2016 (incorporated herein by reference).

[0184] A coronavirus S ectodomain trimer "stabilized in a prefusion conformation" comprises one or more amino acid substitutions, deletions, or insertions compared to a native coronavirus S sequence, which provides increased retention of the prefusion conformation compared to a coronavirus S ectodomain trimer formed from a corresponding native coronavirus S sequence. The "stabilization" of the prefusion conformation by one or more amino acid substitutions, deletions, or insertions can be, for example, energetic stabilization (e.g., reducing the energy of the prefusion conformation relative to the postfusion open conformation) and / or kinetic stabilization (e.g., reducing the transition rate from the prefusion conformation to the postfusion conformation). Additionally, stabilization of a coronavirus S ectodomain trimer in a prefusion conformation can include increased resistance to denaturation compared to the corresponding native coronavirus S sequence. Methods for determining whether a coronavirus S ectodomain trimer is in a prefusion conformation are provided herein and include, but are not limited to, negative stain electron microscopy and antibody binding assays using antibodies specific for the prefusion conformation.

[0185] Degenerate variant: In the context of this disclosure, a "degenerate variant" refers to a polynucleotide encoding a polypeptide that contains a degenerate sequence as a result of the genetic code. There are 20 naturally occurring amino acids, most of which are specified by more than one codon. Thus, all degenerate nucleotide sequences encoding a peptide are included, as long as the amino acid sequence of the peptide encoded by the nucleotide sequence is unchanged.

[0186] In one example, the desired response is to inhibit, reduce, or prevent CoV (e.g., SARS-CoV-2) infection. CoV infection does not need to be completely eliminated or reduced or prevented for the method to be effective. For example, administration of an effective amount of an immunogen can elicit an immune response that reduces CoV infection (e.g., as measured by infection of cells or by the number or percentage of subjects infected with CoV) by a desired amount, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% (elimination or prevention of detectable CoV infection) compared to a suitable control. Epitope: Antigenic determinant. These are specific chemical groups or peptide sequences on a molecule that are antigenic and therefore elicit a specific immune response. For example, epitopes are regions of an antigen to which B cells and / or T cells respond. An antibody can bind to a specific antigenic epitope, e.g., an epitope on a coronavirus S ectodomain, such as the SARS-CoV S ectodomain. Epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein.

[0187] Expression refers to the transcription or translation of a nucleic acid sequence. For example, a gene is expressed when its DNA is transcribed into RNA or an RNA fragment, which in some instances is processed into mRNA. A gene may also be expressed when its mRNA is translated into an amino acid sequence, such as a protein or protein fragment. In certain instances, a heterologous gene is expressed when it is transcribed into RNA. In other instances, a heterologous gene is expressed when its RNA is translated into an amino acid sequence. The term "expression" is used herein to refer to transcription or translation. Regulation of expression may include control in transcription, translation, transport and processing of RNA, degradation of intermediate molecules such as mRNA, or by activation, inactivation, compartmentalization, or degradation after a particular protein molecule is produced.

[0188] The term "host cell" refers to a cell into which exogenous nucleic acid has been introduced, including the progeny of such a cell. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and their progeny derived therefrom regardless of the number of passages. Host cells include cells within a subject, e.g., a mammalian subject (e.g., a human), into which exogenous nucleic acid has been introduced.

[0189] "Immunogen" means any polypeptide that is capable of eliciting an immune response in a subject upon administration. In some embodiments, the immunogen is encoded by a nucleic acid molecule that is incorporated, e.g., into a polynucleotide or vector, for subsequent expression of the immunogen (e.g., a gene product of interest or a fragment thereof (e.g., a polypeptide)).

[0190] The term "immunogenic composition" as used herein is defined as a material used to elicit an immune response, which confers immunity after the immunogenic composition is administered to a subject.

[0191] The term "immunostimulants" refers to substances (e.g., drugs and nutrients) that stimulate the immune system by inducing the activation or increasing the activity of any of its components. Immunostimulants include cytokines (e.g., granulocyte-macrophage colony-stimulating factor) and interferons (e.g., IFN-α and / or IFN-γ).

[0192] "Pharmaceutical composition" preferably means any composition containing a therapeutic or biologically active agent, such as an immunogenic composition or vaccine, suitable for administration to a subject and comprising a nucleotide sequence encoding an antigenic gene product of interest or a fragment thereof that treats or prevents a disease (e.g., CoV infection) or reduces or ameliorates one or more symptoms of the disease (e.g., CoV viral titer, viral spread, infection, and / or cell fusion). For purposes of the present invention, pharmaceutical compositions include vaccines, and pharmaceutical compositions suitable for delivering therapeutic or biologically active agents may include, for example, tablets, gelcaps, capsules, pills, powders, granules, suspensions, emulsions, solutions, gels, hydrogels, oral gels, pastes, eye drops, ointments, creams, plasters, drenches, delivery devices, suppositories, enemas, injections, implants, sprays, or aerosols. Any of these formulations may be prepared by methods well known and accepted in the art. See, for example, The Science and Practice of Pharmacy (21st ed.), ed. AR Gennaro, Lippincott Williams & Wilkins, 2005, and Encyclopedia of Pharmaceutical Technology, ed. J. Swarbrick, Informa Healthcare, 2006, each of which is incorporated herein by reference. An immune response is a response of a cell of the immune system, such as a B cell, a T cell, or a monocyte, to a stimulus. In one embodiment, the response is specific for a particular antigen (an "antigen-specific response"). In one embodiment, the immune response is a T cell response, such as a CD4+ response or a CD8+ response. In another embodiment, the response is a B cell response, resulting in the production of a specific antibody.

[0193] Prime-boost vaccination is an immunotherapy that includes administering a first immunogenic composition (primary vaccine) to a subject followed by administration of a second immunogenic composition (booster vaccine) to elicit an immune response. The priming vaccine and / or booster vaccine include a vector (e.g., a viral vector, an RNA or a DNA vector) that expresses an antigen against which an immune response is directed. The booster vaccine is administered to a subject after the priming vaccine. Examples of suitable time intervals and such time frames between administration of the priming vaccine and the booster vaccine are disclosed herein. In some embodiments, the priming vaccine, the booster vaccine, or both the primer vaccine and the booster vaccine further include an adjuvant.

[0194] A vaccine is a pharmaceutical composition that induces a preventive or therapeutic immune response in a subject. In some cases, the immune response is a protective immune response. Typically, a vaccine induces an antigen-specific immune response to an antigen of a pathogen, e.g., a viral pathogen, or to a cellular component associated with a pathological condition. A vaccine may include a polynucleotide (e.g., a nucleic acid encoding a disclosed antigen), a peptide or polypeptide (e.g., a disclosed antigen), a virus, a cell, or one or more cellular components. In a non-limiting example, a vaccine induces an immune response that reduces the severity of symptoms associated with a coronavirus infection (e.g., SARS-CoV or MERS-CoV infection) and / or reduces the viral load compared to a control. In another non-limiting example, a vaccine induces an immune response that reduces and / or prevents a coronavirus infection (e.g., SARS-CoV or MERS-CoV infection) compared to a control. In some aspects, the vaccines of the present disclosure can be referred to as "bivalent" or "multivalent" because they can simultaneously elicit an immune response against two or more viral pathogens, e.g., two isolates of a coronavirus, as a single vector.

[0195] A vector is an entity that contains a DNA or RNA molecule that is operably linked to a coding sequence of an antigen of interest and has a promoter that can express the coding sequence. Non-limiting examples include naked or packaged (lipid and / or protein) DNA, naked or packaged RNA, a component of a virus or bacteria or other microorganism that may be replication incompetent, or a virus or bacteria or other microorganism that may be replication competent. A vector is sometimes referred to as a construct. A recombinant DNA vector is a vector that has recombinant DNA. A vector may contain a nucleic acid sequence that allows the vector to replicate in a host cell, such as an origin of replication. A vector may also contain one or more selectable marker genes and other genetic elements known in the art. A viral vector is a recombinant nucleic acid vector that has at least some nucleic acid sequence derived from one or more viruses.

[0196] Virus-like particles (VLPs) are non-replicating viral shells derived from any of several viruses. VLPs are generally composed of one or more viral proteins, including but not limited to proteins referred to as capsid, coat, shell, surface and / or envelope proteins, or particle-forming polypeptides derived from these proteins. VLPs may form naturally upon recombinant expression of proteins in a suitable expression system. Methods for producing specific VLPs are known in the art. The presence of VLPs following recombinant expression of viral proteins can be detected using conventional techniques known in the art, such as by electron microscopy, biophysical characterization, etc. Additionally, VLPs can be isolated by known techniques, such as density gradient centrifugation, and identified by characteristic density banding. See, e.g., Baker et al. (1991) Biophys. J. 60: 1445-1456, and Hagensee et al. (1994) / . Virol. 68:4503-4505; Vincente, J Invertebr Pathol., 2011; Schneider-Ohrum and Ross, Curr. Top. Microbiol. Immunol, 354: 53073, 2012.

[0197] II. Composition The composition of the present disclosure may include one or more active agents. In some embodiments, the active agent may be an agent that prevents, treats, or reduces the infectivity of a viral infection. In some embodiments, treating a viral infection may include reducing the infectivity and / or transmission of the virus. In some embodiments, preventing a viral infection may include reducing the infectivity and / or transmission of the virus. The composition of the present disclosure may include an active agent that prevents a viral infection, an active agent that treats a viral infection, an active agent that reduces the infectivity of a viral infection, or a combination thereof. The composition of the present disclosure may further include a pharma-ceutically acceptable excipient, carrier, or diluent. In addition, the composition of the present disclosure may include a preservative, a solubilizer, a stabilizer, a wetting agent, an emulsifier, a sweetener, a colorant, a flavoring agent, a salt (the substance of the present invention may itself be provided in the form of a pharma-ceutically acceptable salt), a buffer, a coating agent, or an antioxidant.

[0198] The present disclosure relates to non-human adenoviral vector compositions and methods of using immunogenic compositions comprising an adenoviral vector and optionally one or more additional active ingredients, pharma- ceutically acceptable carriers, diluents, excipients, or adjuvants for treating or preventing respiratory viral infections. The applicant has discovered that the use of simian adenoviral vectors overcomes the challenge of heterologous vector cross-immunity seen in the human adenoviral vector platform (PMID:32450106). The applicant has constructed chimpanzee adenoviral vectors expressing SARS-CoV-2 antigens, such as stabilized forms of the SARS-CoV-2 "S" protein, and shown that they can protect against COVID-19 in animal models of the disease. SARS-CoV-2 antigens, or immunogenic portions thereof, when expressed in adenoviral vectors, can stimulate an immune response upon human infection, thereby conferring immunity to COVID-19 disease. Applicants have further discovered that this adenoviral vector platform can be successfully used to deliver variants of SARS-CoV-2 antigens that are effective in generating immunogenic responses against sub-lineages or sub-variants of SARS-CoV-2.

[0199] Other aspects of the invention are described in more detail below.

[0200] a) Adenoviral Vectors The present disclosure provides adenoviral vectors for delivery of DNA encoding a SARS-CoV-2 antigen, such as a stabilized form of the SARS-CoV-2 "S" protein. The nucleotide sequence of a transgene encoding the SARS-CoV2 Wuhan S protein is provided as SEQ ID NO: 1, and the nucleotide sequence of an exemplary adenoviral vector comprising a transgene encoding the SARS-CoV2 Wuhan S protein is provided in SEQ ID NO: 2. The protein coding sequence for the SARS-CoV2 Wuhan S protein is provided in SEQ ID NO: 3.

[0201] Adenoviruses are non-enveloped viruses, approximately 90-100 nm in diameter, containing a nucleocapsid and a linear, double-stranded DNA genome. The viral nucleocapsid contains penton and hexon capsomeres. Unique fibers are attached to each penton base and aid in viral attachment to host cells via the coxsackie adenovirus receptor on the host cell surface. Over 50 adenovirus serotypes and strains have been identified, the majority of which cause respiratory infections, conjunctivitis, and gastroenteritis in humans. Rather than integrating into the host genome, adenoviruses usually replicate as episomal elements in the nucleus of the host cell. The adenovirus genome contains four early transcription units (E1, E2, E3, and E4), which have primarily regulatory functions and prepare the host cell for viral replication. The genome also contains five late transcription units (L1, L2, L3, L4, and L5), which encode structural proteins including penton (L2), hexon (L3), scaffold protein (L4), and fiber protein (L5), all under the control of a single promoter. Each end of the genome contains an inverted terminal repeat (ITR) required for viral replication.

[0202] Recombinant adenoviruses were initially developed for gene therapy, but the strong and sustained transgene-specific immune responses elicited by these gene delivery agents prompted their use as vaccine carriers. In addition to their high degree of immunogenicity, adenoviruses present many other advantages for clinical vaccine development. The adenovirus genome is relatively small (26-45 kbp), well characterized, and easy to manipulate. Deletion of a single transcription unit, E1, renders the virus replication-incompetent, which increases its predictability and reduces side reactions in clinical applications. Recombinant adenoviruses can accommodate relatively large transgenes, up to 8 kb in some cases, allow versatility in subunit design, and have a relatively broad tropism that facilitates transgene delivery to a wide variety of cells and tissues. Important for clinical applications, methods for scaled-up production and purification of recombinant adenoviruses to high titers are well established. So far, subgroup C serotypes AdHu2 and AdHu5 have been used primarily as vectors. However, first generation vaccine vectors based on the prototypic human adenovirus AdHu5 showed poor efficacy in clinical trials despite promising preclinical data. Subsequently, it was discovered that a large proportion of adults have significant titers of neutralizing antibodies against common human serotypes such as AdHu2 and AdHu5 as a result of natural infection. Neutralizing antibodies may reduce the efficacy of viral vector vaccines by blocking viral entry into host cells and thereby blocking delivery of targeted transgenes.

[0203] The compositions described herein include vectors that deliver heterologous molecules to cells for therapeutic or vaccine purposes. As used herein, vectors can include any genetic element, including, without limitation, naked DNA, phage, transposon, cosmid, episome, plasmid, or virus. In some embodiments, such vectors include simian adenovirus DNA (e.g., SAdV-36) and a transgene or nucleic acid sequence encoding a protein (e.g., S protein). As used herein, "transgene" refers to the combination of a selected heterologous gene (a nucleic acid sequence encoding a heterologous polypeptide) with other regulatory elements or expression control sequences necessary to drive the translation, transcription, and / or expression of the gene product in a host cell. In some embodiments, the viral vector can include an adenoviral vector that expresses a transgene encoding a coronavirus S protein. Adenoviruses from various origins, subtypes, or mixtures of subtypes can be used as the source of viral genomes for adenoviral vectors. Non-human adenoviruses (e.g., monkey, chimpanzee, gorilla, avian, canine, ovine, or bovine adenoviruses) can be used to generate adenoviral vectors. For example, simian adenoviruses can be used as the source of the viral genome of adenoviral vectors. The simian adenoviruses can be of serotype 1, 3, 7, 11, 16, 18, 19, 20, 27, 33, 36, 38, 39, 48, 49, 50, or any other simian adenovirus serotype. The simian adenoviruses can be referred to by using any suitable abbreviation known in the art, such as, for example, SV, SAdV, SAV, or sAV. In some examples, the simian adenovirus vector is a simian adenovirus vector of serotype 36.

[0204] Typically, SAdV-derived adenoviral vectors are designed such that a transgene is located in a nucleic acid molecule that includes other adenoviral sequences in a region derived from a selected adenoviral gene. If desired, a transgene may be inserted into an existing gene region to disrupt the function of that region. Alternatively, a transgene may be inserted into a site of a partially or completely deleted adenoviral gene. For example, a transgene may be located at a site such as a site of a functional E1 deletion and / or a functional E3 deletion (i.e., E3B) and / or a complete E3 deletion, among other sites that may be selected. The term "functionally deleted" or "functional deletion" means that a sufficient amount of a gene region has been removed or otherwise damaged, for example, by mutation or modification, such that the gene region can no longer produce a functional product of gene expression. If desired, the entire gene region may be removed. In one embodiment, a useful adenoviral vector according to the present disclosure is the simian adenovirus SAd36, which has deletions in the E1 and E3B genes. In some aspects, the vector comprises a complete E3 deletion. In one embodiment, the adenoviral vector has a nucleic acid sequence of SEQ ID NO: 4. In another embodiment, the adenoviral vector has a nucleic acid sequence having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to SEQ ID NO:4.

[0205] For example, for production vectors useful for generating recombinant viruses, the vector may contain a transgene and the 5' end of the adenoviral genome or the 3' end of the adenoviral genome, or both the 5' and 3' ends of the adenoviral genome. The 5' end of the adenoviral genome contains the 5' cis elements necessary for packaging and replication, i.e., the 5' inverted terminal repeat (ITR) sequence (which serves as the origin of replication) and the natural 5' packaging enhancer domain (which contains the sequences necessary for packaging the linear Ad genome and enhancer elements for the E1 promoter). The 3' end of the adenoviral genome contains the 3' cis elements (including the ITRs) necessary for packaging and encapsidation. Preferably, the recombinant adenovirus contains both the 5' and 3' adenoviral cis elements, and the transgene is located between the 5' and 3' adenoviral sequences. Simian adenoviral vectors (e.g., SAdV-36) may also contain additional adenoviral sequences.

[0206] Advantageously, these simian adenovirus vectors comprise one or more adenovirus elements derived from the adenovirus genome. In one embodiment, the vector comprises adenovirus sequences derived from a different adenovirus serotype from the serotype that provides the ITRs. As defined herein, pseudotyped adenovirus refers to an adenovirus whose capsid protein is derived from a different adenovirus from the adenovirus that provides the ITRs. Chimeric or hybrid adenoviruses may be constructed using the adenoviruses described herein using techniques known to those skilled in the art. See, for example, U.S. Patent No. 7,291,498.

[0207] A transgene is a nucleic acid sequence that is heterologous to the vector sequences that flank it and that encodes a polypeptide, protein, or other product of interest. The nucleic acid coding sequence is operably linked to regulatory components in a manner that allows for the transcription, translation, and / or expression of the transgene in a host cell.

[0208] In some embodiments, the transgene encodes a SARS-CoV-2 antigen, such as a stabilized form of the SARS-CoV-2 "S" protein. In some embodiments, the transgene encodes at least a portion or immunogenic fragment of the coronavirus spike (S) protein, or a portion of the coronavirus spike protein of SEQ ID NO:3 (or an immunogenic portion or variant thereof) at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%. 9.9% sequence identity; or SEQ ID NO:3 with a K986P or V987P mutation; or SEQ ID NO:3 with a D614G mutation. In some embodiments, the transgene encodes a spike protein of a SARS-CoV-2 mutant, in non-limiting examples, the spike protein has a D80G, 144del, F157S, L5F, T95I, A67V, S477N, 144del, Q677H, A701V, F888L, T791I, T859N, D950H, E484Q, D614G, E484K, N501Y, Δ69-70, L452R, or a K417N or RBD E484K mutation relative to SEQ ID NO:3. In some embodiments, the transgene encodes a spike protein from a WA1 / 2020, B.1.1.7, B.1.351, B.1.1.28, P.1, B.1.427, B.1.526, B.1.526.1, B.1.525, P.2, B.1.617, B.1.617.1, B.1.617.2, B.1.617.3, B.1.429, B.1.429, or B.1.529 variant.In each of the above embodiments, the spike protein is further modified to be in a pre-fusion stabilized form (e.g., having a double proline substitution between residues 1050-1069, or between residues 981-999).

[0209] Omicron (B.1.1.529), a variant with multiple spike protein mutations, was initially detected in Botswana. In particular, the genomes of several omicron mutants encode S proteins with the following mutations: A67V, Δ69-70, T95I, G142D / A143-145, A211 / L212I, 214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493K, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, and L981F. In some embodiments, this exemplary strain, as well as other emerging strains (e.g., additional variants of concern), are candidates for the methods and formulations disclosed herein. Thus, in some embodiments, the present disclosure also encompasses recombinant adenoviral vectors comprising transgenic stabilized spike protein sequences derived from the Omicron B.1.1.529 strain or variants thereof. Non-limiting examples of sub-variants of the Omicron strain include BA1.1, BA.2, BA.3, BA.4, and BA.5. In exemplary embodiments, the BA.5 variant may have the following mutations: T19I, L24S, del25-27, 69-70del, G142D, V213G, G339D, S371F, S373P, S375F, T376A, K417N, N440K, S477N, T478K, E484A, Q493R, L452R, F486V, Q498R, N501Y, D614G, H655Y, N679K, P681H, R682G, R683S, R685S, N764K, D796Y, Q954H, N969K.

[0210] Thus, in some embodiments, the transgene nucleic acid encodes a stabilized SARS-CoV2-omicron spike protein (SARS-CoV2-omicron-S2P) provided in SEQ ID NO:10, or a nucleic acid sequence encoding a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to SEQ ID NO:10 (SARS-CoV2-omicron-S2P).

[0211] In some embodiments, the transgene nucleic acid encodes the SARS-CoV2-omicron spike protein (SARS-CoV-2-omicron-S6P) of SEQ ID NO:11, or a nucleic acid sequence encoding a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to SEQ ID NO:11 (SARS-CoV-2-omicron-S6P).

[0212] In some embodiments, the transgene nucleic acid is a nucleic acid sequence encoding the SARS-CoV2-omicron spike protein of SEQ ID NO: 12 (SARS-CoV-2-omicron-S6PδF) or a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to SEQ ID NO: 12 (SARS-CoV-2-omicron-S6PdF).

[0213] In some embodiments, the transgene nucleic acid encodes the SARS-Cov2-omicron spike protein of SEQ ID NO:20 (SARS-CoV-2-omicron-S6PdF) or a nucleic acid sequence encoding a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4% 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to SEQ ID NO:20 (bivalent BA.5-S6PdF).

[0214] In some embodiments, the transgene nucleic acid encodes the SARS-Cov2-omicron spike protein (SARS-CoV-2-omicron-S6P) of SEQ ID NO:21, or a nucleic acid sequence encoding a protein having at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to SEQ ID NO:21 (bivalent BA.5-S6P).

[0215] In some embodiments, the adenoviral vector comprises a nucleic acid sequence (transgene), the nucleic acid sequence having any of the following mutations: T19I, L24S, del25-27, 69-70del, G142D, V213G, G339D, S371F, S373P, S375F, T376A, K417N, N440K, S477N, T478K, E484A, Q493R, L452R, F486V, Q498R, N501Y, D614G, H655Y, N679K, P681H, R682G, R683S, R685S, N764K, D796Y, A942P At least 5, or at least 10, or at least 15, or at least 20, or at least 25, or at least 30 or more of Q954H, N969K, K988P, and V989P, and at least 2, or at least 3, or at least 4, or at least 5, or 6 stable amino acids provided in F819P, A894P, A901P, A944P, K988P, and V989P. In one embodiment, the amino acid sequence of SEQ ID NO:3 is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to SEQ ID NO:3 or a variant thereof further comprising a modifying mutation. In some embodiments, the adenoviral vector comprises a nucleic acid sequence identical to SEQ ID NO:3 at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99 0.7%, 99.8%, or 99.9% identical proteins or omicron variants provided in SEQ ID NOs: 10-11 and 20-21 that contain at least two, or at least three, or at least four, or at least five, or six stabilizing mutations provided in F819P, A894P, A901P, A944P, K988P, and V989P.The alignment of sequences of SEQ ID NOs: 10, 11, 20, and 21 to the Wuhan sequence is provided in FIG.

[0216] In some embodiments, the disclosure also encompasses adenoviral vectors comprising a nucleic acid sequence encoding two or more coronavirus spike protein variants or immunogenic fragments thereof. In some embodiments, the disclosure also encompasses adenoviral vectors comprising a nucleic acid sequence encoding at least a portion or immunogenic fragment of a coronavirus spike (S) protein having a sequence at least 80% identical to SEQ ID NO: 3, 10, 11, 20, or 21, or an immunogenic fragment or variant thereof, and a nucleic acid sequence encoding at least a portion or an immunogenic fragment or variant thereof having a sequence at least about 80% identical to one or more additional proteins derived from SARS-Cov2. In some aspects, the one or more additional proteins may be selected from nonstructural proteins 1-16 (nsp1-16), structural proteins including S protein, envelope (E), membrane (M), and nucleocapsid (N), and eleven accessory proteins: ORF3a, ORF3b, ORF3c, ORF3d, ORF6, ORF7a, ORF7b, ORF8, ORF9b, ORF9c, and ORF10. In some embodiments, the disclosure also encompasses adenoviral vectors comprising a nucleic acid sequence encoding at least a portion or immunogenic fragment of a coronavirus spike (S) protein having a sequence at least 80% identical to SEQ ID NO:3, 10, 11, 20, or 21, or an immunogenic fragment or variant thereof, and a nucleic acid sequence encoding at least a portion or immunogenic fragment of a protein derived from another virus, such as, for example, rabies, measles, RSV, or influenza. Examples of suitable proteins include, but are not limited to, influenza hemagglutinin, influenza nucleoprotein, influenza M2, tetanus toxin C fragment, anthrax protective antigen, anthrax lethal factor, anthrax germination factor, rabies glycoprotein, HBV surface antigen, HIV gp120, HIV gp160, human carcinoembryonic antigen, malaria CSP, malaria SSP, malaria MSP, malaria pfg, botulinum toxin A, and Mycobacterium tuberculosis HSP.In some embodiments, the adenoviral vectors are said to express bivalent, trivalent, or multivalent immunogenic proteins, which elicit an immune response against two or more viruses or two or more lineages, variants, sub-lineages, or sub-variants of SARS-CoV2.

[0217] In some embodiments, the present disclosure also encompasses plasmids and adenoviral vectors comprising a nucleic acid sequence encoding the S protein sequence disclosed herein. In some aspects, the nucleic acid is at least 80% identical to SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:6. In some embodiments, the adenoviral vector or plasmid comprises or consists of a nucleic acid sequence at least about 80% identical to SEQ ID NO:2, 5, or 6. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO:2, 5, or 6.

[0218] In one embodiment, the vector comprises or consists of a nucleic acid sequence provided in SEQ ID NO: 13 (ChAd-S6PdF529). In some embodiments, the vector comprises or consists of a nucleic acid sequence that is at least about 80% identical to SEQ ID NO: 13. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 13.

[0219] In some embodiments, the vector comprises / consists of a nucleic acid sequence provided in SEQ ID NO: 14 (ChAd-S2P529). In some embodiments, the vector comprises or consists of a nucleic acid sequence that is at least about 80% identical to SEQ ID NO: 14. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 14.

[0220] In some embodiments, the vector comprises or consists of a nucleic acid sequence provided in SEQ ID NO: 15 (ChAd-S6P529). In some embodiments, the vector comprises or consists of a nucleic acid sequence that is at least about 80% identical to SEQ ID NO: 15. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 15.

[0221] In some embodiments, the plasmid comprises or consists of a nucleic acid sequence provided in SEQ ID NO: 16 (pSAd36E3E1stS), in which the entire E3 gene has been deleted. In some embodiments, the vector comprises or consists of a nucleic acid sequence that is at least about 80% identical to SEQ ID NO: 16. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 16.

[0222] In some embodiments, the vector comprises or consists of a nucleic acid sequence provided in SEQ ID NO: 17 (SAd36E3E1stS), wherein the entire E3 gene has been deleted. In some embodiments, the vector comprises or consists of a nucleic acid sequence that is at least about 80% identical to SEQ ID NO: 17. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 17.

[0223] In some embodiments, the vector comprises or consists of a nucleic acid sequence provided in SEQ ID NO: 18 (ChAd.BA.5-S6PdF). In some embodiments, the vector comprises or consists of a nucleic acid sequence that is at least about 80% identical to SEQ ID NO: 18. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 18.

[0224] In some embodiments, the vector comprises or consists of a nucleic acid sequence provided in SEQ ID NO: 19 (ChAd.BA.5-S6P). In some embodiments, the vector comprises or consists of a nucleic acid sequence that is at least about 80% identical to SEQ ID NO: 19. In some embodiments, the nucleic acid sequence has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 19.

[0225] In addition to the major elements identified above for the transgene, the vector may also include conventional control elements operably linked to the transgene in a manner that allows its transcription, translation, and / or expression in cells transfected with the plasmid vector or infected with the virus produced by the present invention. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Expression control sequences include appropriate transcription start, stop, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and sequences that enhance secretion of the encoded product, if desired.

[0226] Numerous expression control sequences, including natural, constitutive, inducible, and / or tissue-specific promoters, are known in the art and may be utilized. Examples of constitutive promoters include, without limitation, retroviral Rous sarcoma virus (RSV) LTR promoter (which may include the RSV enhancer), cytomegalovirus (CMV) promoter (which may include the CMV enhancer) [see, for example, Boshart et al., Cell, 41:521-530 (1985)], SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, phosphoglycerol kinase (PGK) promoter, and EF-Ia promoter (Invitrogen).

[0227] Inducible promoters allow for the regulation of gene expression and can be regulated by externally supplied compounds, environmental factors such as temperature, or the presence of certain physiological conditions, such as the acute phase, a certain differentiation state of cells, or only in replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including, but not limited to, Invitrogen, Clontech, and Ariad. Many other systems have been described and can be readily selected by those skilled in the art. For example, inducible promoters include the zinc-inducible sheep metallothionine (MT) promoter and the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter. Other inducible systems include the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter [No et al, Proc. Natl. Acad. Sci USA, 93:3346-3351 (1996)], the tetracycline-repressible system [Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)], and the tetracycline-inducible system [Gossen et al, Science, 268:1766-1769 (1995); see also Harvey et al, Curr. Opin. Chem. Biol., 2:512-518 (1998)]. Other systems include FK506 dimers, VP 16 or p65 using castradiol, diphenol murislerone, RU486 inducible systems [Wang et al, Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther., 4:432-441 (1997)], and rapamycin inducible systems [Magari et al, J. Clin. Invest., 100:2865-2872 (1997)]. The effectiveness of some inducible promoters increases over time. In such cases, the effectiveness of such systems can be enhanced by inserting multiple repressors in tandem, for example TetR linked to TetR by an IRES.Alternatively, one may wait at least 3 days before screening for the desired function. Expression of the desired protein can be enhanced by known means to enhance the effectiveness of this system, for example, using the Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (WPRE).

[0228] In another embodiment, the native promoter for the transgene is used. When it is desired that the expression of the transgene should mimic the native expression, the native promoter is preferred. The native promoter can be used when the expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimulus. In further embodiments, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, may also be used to mimic the native expression. Another embodiment of the transgene includes the transgene operably linked to a tissue-specific promoter. For example, when expression in skeletal muscle is desired, a promoter active in muscle should be used. This includes promoters derived from genes encoding skeletal β-actin, myosin light chain 2A, dystrophin, muscle creatine kinase, as well as synthetic muscle promoters that have higher activity than naturally occurring promoters [see Li et al, Nat. Biotech., 17:241-245 (1999)].Examples of tissue-specific promoters include, inter alia, for liver [albumin, Miyatake et al, J. Virol., 71:5124-32 (1997); hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); alpha-fetoprotein (AFP), Arbuthnot et al, Hum. Gene Ther., 7:1503-14 (1996)], bone osteocalcin [Stein et al, MoI. Biol Rep., 24:185-96 (1997)]; bone sialoprotein [Chen et al, J. Bone Miner. Res., 11:654-64 (1996)], lymphocyte [CD2, Hansal et al, J. Immunol, 161: 1063-8 (1996)], and IL-16 [IL-2, Hansal et al, J. Immunol, 161: 1063-8 (1996)]. (1998); immunoglobulin heavy chain; T cell receptor chain], neuronal systems such as the neuron-specific enolase (NSE) promoter [Andersen et al, Cell. MoI Neurobiol, 13:503-15 (1993)], neurofilament light chain gene [Piccioli et al, Proc. Natl Acad. ScL USA, 88:561 1-5 (1991)], and neuron-specific vgf gene [Piccioli et al, Neuron, 15:373-84 (1995)] are known. Vectors carrying transgenes encoding therapeutically useful or immunogenic products may contain selectable marker or reporter genes, which may include sequences encoding geneticin, hygromycin, or purimycin resistance, among others. Such selectable reporter or marker genes (preferably located outside the viral genome packaged into the viral particle) can be used to indicate the presence of the plasmid in bacterial cells, such as ampicillin resistance. Other components of the vector include an origin of replication. Selection of these and other promoter and vector elements is conventional, and many such sequences are available (see, e.g., Sambrook et al. and references therein).These vectors are generated using the techniques and sequences provided herein in conjunction with techniques known to those of skill in the art, including traditional cDNA cloning techniques such as those described in textbooks (Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY), the use of overlapping oligonucleotide sequences of the adenoviral genome, the polymerase chain reaction, and any suitable method that provides the desired nucleotide sequence.

[0229] In some embodiments, the present disclosure provides virus-like particles (VLPs) comprising the disclosed recombinant adenoviral vectors. VLPs lack viral components necessary for viral replication and therefore represent a highly attenuated, replication-incompetent form of the virus. Virus-like particles and methods for their production are well known to those skilled in the art and include those for human papillomavirus, HIV [Kang et al., Biol. Chem. 380: 353-64 (1999)], Semliki Forest virus [Notka et al., Biol. Chem. 380: 341-52 (1999)], human polyomavirus [Goldmann et al., J. Virol. 73: 4465-9 (1999)], rotavirus [Jiang et al., Vaccine 17: 1005-13 (1999)], parvovirus [Casal, Biotechnology and Applied Biochemistry, Vol 29, Part 2, pp 141-150 (1999)], canine parvovirus [Hurtado et al., J. Virol. 70: 5422-9 (1999)], and the like. Viral proteins from several viruses, including Hepatitis E virus [Li et al, J. Virol. 71:7207-13 (1997)], and Newcastle disease virus, are known to form VLPs. The formation of such VLPs can be detected by any suitable technique. Examples of suitable techniques known in the art for the detection of VLPs in culture media include, for example, electron microscopy techniques, dynamic light scattering (DLS), selective chromatographic separation (e.g., ion exchange, hydrophobic interaction, and / or size exclusion chromatographic separation of VLPs), and density gradient centrifugation.

[0230] b) Ingredients of the composition The present disclosure also provides a pharmaceutical composition, which comprises an adenovirus composition of the present disclosure as an active ingredient, and at least one pharma- ceutically acceptable excipient.

[0231] The pharma- ceutically acceptable excipient may be a diluent, binder, filler, buffer, pH modifier, disintegrant, dispersion medium, preservative, lubricant, taste masking agent, flavoring agent, or coloring agent. The amounts and types of excipients utilized to form a pharmaceutical composition may be selected according to known principles of pharmaceutical science.

[0232] In each of the embodiments described herein, the composition of the present invention may include one or more additional drugs or therapeutically active agents in addition to the adenoviral composition of the present disclosure. That is, in addition to the therapies described herein, other therapies known to be effective in treating viral infections may be provided to the subject. In some embodiments, the secondary agent is selected from corticosteroids, nonsteroidal anti-inflammatory drugs (NSAIDs), intravenous immunoglobulins, kinase inhibitors, fusion or recombinant proteins, monoclonal antibodies, or combinations thereof. In some embodiments, agents suitable for combination therapy include, but are not limited to, inhaled bronchodilators and inhaled steroids.

[0233] (i) Diluent In one embodiment, the excipient may be a diluent. The diluent may be compressible (i.e., plastically deformable) or abrasively vulnerable. Non-limiting examples of suitable compressible diluents include microcrystalline cellulose (MCC), cellulose derivatives, cellulose powder, cellulose esters (i.e., acetate butyrate mixed esters), ethyl cellulose, methyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose, corn starch, phosphorylated corn starch, pregelatinized corn starch, rice starch, potato starch, tapioca starch, starch-lactose, starch-calcium carbonate, sodium starch glycolate, glucose, fructose, lactose, lactose monohydrate, sucrose, xylose, lactitol, mannitol, malitol, sorbitol, xylitol, maltodextrin, and trehalose. Non-limiting examples of suitable abrasion sensitive diluents include dibasic calcium phosphate (anhydrous or dihydrate), tribasic calcium phosphate, calcium carbonate, and magnesium carbonate.

[0234] (ii) Binder In another embodiment, the excipient may be a binder. Suitable binders include, but are not limited to, starch, pregelatinized starch, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamide, polyvinyloxoazolidone, polyvinyl alcohol, C 12 -C 18 Included are fatty acid alcohols, polyethylene glycols, polyols, sugars, oligosaccharides, polypeptides, oligopeptides, and combinations thereof.

[0235] (iii) Filler In another embodiment, the excipient can be a filler.Suitable fillers include, but are not limited to, carbohydrates, inorganic compounds, and polyvinylpyrrolidone.As non-limiting examples, the filler can be dibasic and tribasic calcium sulfate, starch, calcium carbonate, magnesium carbonate, microcrystalline cellulose, dibasic calcium phosphate, magnesium carbonate, magnesium oxide, calcium silicate, talc, modified starch, lactose, sucrose, mannitol, or sorbitol.

[0236] (iv) Buffer In yet another embodiment, the excipient may be a buffer. Representative examples of suitable buffers include, but are not limited to, phosphate, carbonate, citrate, Tris buffer, and buffered saline salts (e.g., Tris buffered saline or phosphate buffered saline).

[0237] (v) pH modifier In various embodiments, the excipient may be a pH modifier. By way of non-limiting example, the pH modifier may be sodium carbonate, sodium bicarbonate, sodium citrate, citric acid, or phosphoric acid.

[0238] (vi) disintegrant In further embodiments, the excipient may be a disintegrant. The disintegrant may be non-effervescent or effervescent. Suitable examples of non-effervescent disintegrants include, but are not limited to, starches such as corn starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays such as bentonite, microcrystalline cellulose, alginates, sodium starch glycolate, gums such as agar, guar, carob, karaya, pecitin, and tragacanth. Non-limiting examples of suitable effervescent disintegrants include sodium bicarbonate in combination with citric acid, and sodium bicarbonate in combination with tartaric acid.

[0239] (vii) Dispersion medium In yet another embodiment, the excipient may be a dispersion medium or dispersion enhancer. Suitable dispersion mediums include, but are not limited to, starch, alginic acid, polyvinylpyrrolidone, guar gum, kaolin, bentonite, refined wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose.

[0240] (viii) excipients In another alternative embodiment, the excipient may be a preservative.Non-limiting examples of suitable preservatives include antioxidants such as BHA, BHT, vitamin A, vitamin C, vitamin E, or retinyl palmitate; citric acid, sodium citrate; chelating agents such as EDTA or EGTA; and antimicrobial agents such as parabens, chlorobutanol, or phenol.

[0241] (ix) Lubricants In a further embodiment, the excipient may be a lubricant. Non-limiting examples of suitable lubricants include minerals, such as talc or silica; and fats, such as vegetable stearin, magnesium stearate, or stearic acid.

[0242] (x) Flavor masking agents In yet another embodiment, the excipient may be a flavor masking material. Flavor masking materials include cellulose ethers; polyethylene glycol; polyvinyl alcohol; copolymers of polyvinyl alcohol and polyethylene glycol; mono- or triglycerides; acrylic polymers; mixtures of acrylic polymers and cellulose ethers; cellulose acetate phthalate; and combinations thereof.

[0243] (xi) Flavoring agents In an alternative embodiment, the excipient may be a flavoring agent, which may be selected from synthetic flavor oils and flavoring aromatics and / or natural oils, plant extracts, leaves, flowers, fruits, or combinations thereof.

[0244] (xii) Coloring agent In yet a further embodiment, the excipient may be a colorant. Suitable color additives include, but are not limited to, food, drug, and cosmetic colors (FD&C), drug and cosmetic colors (D&C), or topical drug and cosmetic colors (Ext. D&C).

[0245] (xiii) adjuvant In a further embodiment, the formulation may include an adjuvant. Adjuvants are known in the art to further increase the immune response to the applied antigenic determinant, and pharmaceutical compositions comprising adenovirus and suitable adjuvants are disclosed, for example, in WO 2007 / 110409, which is incorporated herein by reference. Examples of suitable adjuvants include aluminum salts, such as aluminum hydroxide and / or aluminum phosphate, oil emulsion compositions (or oil-in-water compositions) including squalene / water emulsions, such as MF59 (see, for example, WO 90 / 14837), saponin preparations, such as QS21 and immunostimulating complexes (ISCOMS), bacterial or microbial derivatives, examples of which are monophosphoryl lipid A (MPL), 3-O-deacylated MPL (3dMPL), CpG motif-containing oligonucleotides, ADP-ribosylating bacterial toxins or derivatives thereof, such as E. coli heat-labile enterotoxin LT, cholera toxin, and others. It is also possible to use vector-encoded adjuvants, for example by using heterologous nucleic acids encoding a fusion of the oligomerization domain of C4 binding protein (C4bp) with an antigen of interest. In certain embodiments, the compositions of the invention contain aluminum as an adjuvant, for example in the form of aluminum hydroxide, aluminum phosphate, aluminum potassium phosphate, or combinations thereof, for example at a concentration of 0.05-5 mg, e.g., 0.075-1.0 mg, of aluminum content per dose.

[0246] The weight fraction of the excipient or combination of excipients in the composition can be about 99% or less, about 97% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2%, or about 1% or less of the total weight of the composition.

[0247] The agents and compositions described herein can be formulated in any conventional manner using one or more pharma- ceutically acceptable carriers or excipients, for example, as described in Remington's Pharmaceutical Sciences (AR Gennaro, Ed.), 21st edition, ISBN: 0781746736 (2005), which is incorporated herein by reference in its entirety. Such formulations will contain a therapeutically effective amount of a bioactive agent described herein, which may be in purified form, together with an amount of carrier suitable to provide the form for proper administration to a subject.

[0248] The term "formulation" means preparing a pharmaceutical agent in a form suitable for administration to a subject, such as a human. That is, a "formulation" can include pharma- ceutically acceptable excipients, including diluents or carriers.

[0249] The term "pharmaceutical acceptable" as used herein can describe a substance or ingredient that does not cause unacceptable loss of pharmacological activity or unacceptable side reactions. Examples of pharmaceutical acceptable ingredients can be those listed in the United States Pharmacopeia (USP29) and National Formulary (NF24) ("USP / NF") of the United States Pharmacopeial Convention, Inc, Rockville, Maryland, 2005, or those with articles in more recent editions, and in the FDA's Inactive Ingredient Search online database, which is continuously updated. Other useful ingredients not listed in the USP / NF, etc., can also be used.

[0250] The term "pharmaceutically acceptable excipient" as used herein may include any solvent, dispersion medium, coating, antibacterial and antifungal agents, isotonicity agents, or absorption delaying agents. The use of such media and agents for pharmaceutically active ingredients is well known in the art [see generally Remington's Pharmaceutical Sciences (AR Gennaro, Ed.), 21st edition, ISBN: 0781746736 (2005)]. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in therapeutic compositions is intended. Complementary active ingredients can also be incorporated into the composition.

[0251] A "stable" formulation or composition can mean a composition that has sufficient stability to permit storage at a convenient temperature, e.g., from about 0° C. to about 60° C., for a commercially reasonable period of time, e.g., at least about 1 day, at least about 1 week, at least about 1 month, at least about 3 months, at least about 6 months, at least about 1 year, or at least about 2 years.

[0252] The formulation must be compatible with the mode of administration. The agents for use according to the present disclosure can be formulated by known methods for administration to a subject using several routes, including, but not limited to, parenteral, pulmonary, oral, topical, mucosal, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, intraocular, buccal, and rectal. Individual agents may be administered in combination with one or more additional agents, or with biologically active or biologically inactive agents. Such biologically active or inactive agents may be fluidly or mechanically linked to the agent, or may be bound to the agent by ionic, covalent, van der Waals, hydrophobic, hydrophilic, or other physical forces.

[0253] In some embodiments, the present disclosure encompasses formulations for intranasal delivery. Formulations containing compositions for intranasal delivery may have a pH that corresponds to a physiologically acidic nasal pH. A physiologically acidic nasal pH may depend on the function of an intact nasal mucosa. The compositions may have a pH of about 6.5±0.5 (5.9-7.3) or a pH of about 6.7±0.6 (5.3-7.6). The compositions may have a pH of about 3.8-7.7 (mean±SD 5.7±0.9). Compositions for intranasal delivery may be in the mildly acidic range. The mean pH may have an acidity of pH 5.7.

[0254] Effective delivery of therapeutic agents via intranasal administration must take into account the reduced transport rate across the protective mucus lining of the nasal mucosa, in addition to drug loss due to binding to glycoproteins in the mucosal layer. Normal mucus is a viscoelastic, gel-like substance composed of water, electrolytes, mucin, macromolecules, and sloughed epithelial cells. It serves primarily as a cytoprotective and lubricating coating for the underlying mucosal tissue. Mucus is secreted by randomly distributed secretory cells located in the nasal epithelium and other mucosal epithelia. The structural unit of mucus is mucin. This glycoprotein is primarily responsible for the viscoelastic properties of mucus, although other macromolecules may also contribute to this property. In airway mucus, such macromolecules include locally produced secretory IgA, IgM, IgE, lysozyme, and bronchial transferrin, which also play important roles in host defense mechanisms.

[0255] The coordinated administration methods of the present disclosure may incorporate effective mucolytic or mucus-clearing agents, which act to break down, thin, or remove mucus from the nasal mucosal surface, facilitating the absorption and / or adsorption of biotherapeutic agents administered intranasally. Within these methods, mucolytic or mucus-clearing agents are coordinately administered as adjunct compounds to enhance intranasal delivery of biologically active agents. Alternatively, an effective amount of a mucolytic or mucus-clearing agent is incorporated as a treatment agent within the multiple treatment methods of the present invention, or as an additive within the combination formulations of the present invention, to provide improved formulations that enhance intranasal delivery of biotherapeutic compounds by reducing the barrier effect of nasal mucus.

[0256] A variety of mucolytic or mucus-clearing agents are available for incorporation into the methods and compositions of the present invention. Based on their mechanism of action, mucolytic and mucus-clearing agents can often be classified into the following groups: proteases (e.g., pronase, papain) that cleave the protein core of mucin glycoproteins; sulfhydryl compounds that split mucoprotein disulfides; and detergents (e.g., Triton X-100, Tween 20) that break non-covalent bonds in mucus. Additional compounds in this context include, but are not limited to, bile salts and detergents, such as sodium deoxycholate, sodium taurodeoxycholate, sodium glycocholate, and lysophosphatidylcholine.

[0257] The effectiveness of bile salts in causing structural breakdown of mucus is in the order deoxycholate > taurocholate > glycocholate. Other effective agents that reduce mucus viscosity or adhesion and enhance intranasal delivery by the methods of the invention include, for example, short chain fatty acids, and mucolytic agents that act by chelation, such as N-acyl collagen peptides, bile acids, and saponins (mucolytic agents that act by chelation are due in part to the release of Ca2+, which plays an important role in maintaining the structure of the mucus layer). 2+ and / or Mg 2+ (It works by chelating

[0258] Additional mucolytic agents for use in the methods and compositions of the invention include N-acetyl-L-cysteine ​​(ACS), a potent mucolytic agent that has been reported to reduce the viscosity and adhesion of bronchopulmonary mucus and to modestly increase the nasal bioavailability of human growth hormone in anesthetized rats (from 7.5% to 12.2%). These and other mucolytic and mucus-clearing agents, in coordination with the administration of a biologically active agent, are contacted with the nasal mucosa, typically in a concentration range of about 0.2-20 mM, to reduce the polar viscosity and / or elasticity of the nasal mucosa.

[0259] Still other mucolytic or mucus-clearing agents may be selected from a range of glycosidase enzymes, which are capable of cleaving glycosidic bonds in mucus glycoproteins. Alpha-amylase and beta-amylase represent this class of enzymes, but their mucolytic effect may be limited. In contrast, bacterial glycosidases allow these microorganisms to penetrate the mucus layer of their host.

[0260] For use in combination with the adenoviral compositions of the present disclosure, non-inorganic detergents are also generally useful as mucolytic or mucus-clearing agents, which typically do not alter or substantially impair the activity of the adenoviral compositions.

[0261] c) Administration (i) Dosage Form The composition can be formulated into various dosage forms and administered by several different means that deliver therapeutically effective amounts of active ingredients.Such compositions can be administered by suitable routes, such as oral, parenteral, pulmonary, topical, mucosal, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, intraocular, intrabuccal, and rectal, in dosage unit formulations that contain conventional non-toxic pharmacologic carriers, adjuvants, and vehicles as required.Local administration can also include the use of transdermal administration, such as transdermal patches or iontophoresis devices.The term "parenteral" as used herein includes subcutaneous, intravenous, intramuscular, intraarterial, or intrasternal injection or infusion techniques. Drug formulations are discussed, for example, in Gennaro, AR, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (18th ed, 1995) and Liberman, HA and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Dekker Inc., New York, NY (1980). In certain embodiments, the composition may be a food supplement or the composition may be a cosmetic.

[0262] For parenteral administration (including subcutaneous, intraocular, intradermal, intravenous, intramuscular, intraarterial, and intraperitoneal), the preparation may be an aqueous or oil-based solution. Aqueous solutions may contain a sterile diluent, such as water, saline solution, pharma- ceutically acceptable polyols, such as glycerol, propylene glycol, or other synthetic solvents; benzyl alcohol, methylparaben, chlorobutanol, phenol, thimerosal, or other antibacterial and / or antifungal agents; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates, or phosphates; and / or agents for adjusting the osmolarity, such as sodium chloride, dextrose, or mannitol or sorbitol. The pH of the aqueous solution may be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. Oil-based solutions or suspensions may further contain sesame oil, peanut oil, olive oil, or mineral oil. The compositions may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid carrier, for example water for injection, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets.

[0263] When nasal or respiratory (mucosal) administration is desired, the composition may be dispensed in the form of a squeeze spray dispenser, a pump dispenser, or an aerosol dispenser. Such dispensers may also be employed to deliver the composition to the oral or buccal (e.g., buccal or sublingual) mucosa, or the nasal cavity. Aerosols are usually pressurized by hydrocarbons. Pump dispensers can preferably dispense metered doses or doses with specific particle sizes.

[0264] In certain embodiments, the vector compositions disclosed herein are co-formulated, e.g., mixed together, as a single composition for administration, e.g., with pharma- ceutically acceptable buffers, carriers, excipients, and / or adjuvants, and administered to a subject simultaneously together.In other embodiments, the vector and protein are formulated, e.g., with pharma-ceutically acceptable buffers, carriers, excipients, and / or adjuvants, as separate compositions, and administered to a subject within 24 hours, e.g., within 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, or within 1 hour or less.

[0265] In general, a safe and effective amount of adenovirus composition is administered, for example, an amount that induces a desired therapeutic effect in a subject while minimizing undesirable side reactions.In various embodiments, an effective amount of the adenovirus composition described herein can substantially reduce the infectivity of the virus in a subject suffering from a viral infection.In some embodiments, an effective amount is an amount that can treat respiratory virus infection.In some embodiments, an effective amount is an amount that can treat one or more symptoms associated with respiratory virus infection.

[0266] The amount of the compositions described herein that can be combined with a pharma- ceutically acceptable carrier to produce a single dosage form will vary depending on the host treated and the particular mode of administration. Those skilled in the art will recognize that the unit content of the drug contained in the individual doses of each dosage form need not constitute a therapeutically effective amount in itself, since the required therapeutically effective amount can be reached by administration of several individual doses.

[0267] The dosage of the adenoviral vector depends primarily on factors such as the condition to be treated, the age, weight, and health of the patient, and may therefore vary between patients. For example, a therapeutically effective dosage of a viral vector for an adult or animal is generally about 1×10 6 ~Approx. 1×10 15 particles, approximately 1×10 7 ~1×10 13particles, or approximately 1×10 9 ~1×10 12 The dosage ranges from about 100 μL to about 100 mL of carrier containing a concentration of virus of 10 particles. Dosages will vary depending on the size of the animal and the route of administration. For example, a suitable human or animal dosage for intramuscular injection (for an animal of about 80 kg) is about 1×10 per mL for a single site. 9 ~Approx. 5×10 12 In another example, a suitable human or animal dosage for an oral formulation is about 1×10 11 ~Approx. 1×10 15 The dosage may be in the range of 100 to 2000 mg / kg. Those skilled in the art can adjust these dosages depending on the route of administration and the therapeutic or vaccine application for which the recombinant vector is employed. The level of expression of the transgene, or for immunogens, the level of circulating antibodies, can be monitored to determine the frequency of dosage administration. Still other methods for determining the timing of frequency of administration will be readily apparent to those skilled in the art.

[0268] An optional method step includes co-administration to the patient of a suitable amount of a short-acting immunomodulatory agent, either simultaneously with, or prior to or after administration of the viral vector. The selected immunomodulatory agent is defined herein as an agent capable of inhibiting the formation of neutralizing antibodies directed against the recombinant vector of the invention or an agent capable of inhibiting the elimination of the vector by cytolytic T lymphocytes (CTLs). An immunomodulatory agent may be an agent capable of inhibiting the formation of neutralizing antibodies directed against the recombinant vector of the invention or an agent capable of inhibiting the elimination of the vector by cytolytic T lymphocytes (CTLs). H Alternatively, immunomodulators may block the formation of neutralizing antibodies by interfering with the interaction of T (i) or T^) with B cells. H The interaction between i-cells and CTLs can be inhibited to reduce the occurrence of vector elimination by CTLs.Various useful immunomodulatory agents and the dosages of their use are disclosed, for example, in Yang et al., J. Virol., 70(9) (September, 1996); International Patent Application Publication No. WO 96 / 12406, published May 2, 1996; and International Patent Application No. PCT / US96 / 03035, all of which are incorporated herein by reference.

[0269] The particular therapeutically effective dosage level for any particular subject will depend upon a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the particular compound employed; the particular composition employed; the age, weight, general health, sex, and diet of the subject; the timing of administration; the route of administration; the rate of excretion of the composition employed; the duration of treatment; drugs used in combination with or concomitantly with the particular compound employed; and similar factors well known in the medical arts [see, e.g., Koda-Kimble et al. (2004) Applied Therapeutics: The Clinical Use of Drugs, Lippincott Williams & Wilkins, ISBN 0781748453; Winter (2003) Basic Clinical Pharmacokinetics, 4th ed., Lippincott Williams & Wilkins, ISBN 0781741475; Sharqel (2004) Applied Biopharmaceutics & Pharmacokinetics, McGraw-Hill / Appleton & Lange, ISBN 0071375503]. For example, it is well within the skill of the art to start with a dose of the composition at a level lower than that required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose may be divided into multiple doses for purposes of administration. As a result, a single-dose composition may contain such an amount or a fraction thereof to make up a daily dose. However, it will be understood that the total daily dosage of the compounds and compositions of the present disclosure will be determined by the attending physician within the scope of sound medical judgment.

[0270] The administration of the viral composition can occur as a single event or over a time course of treatment. For example, one or more of the nanoparticle compositions can be administered daily, weekly, biweekly, or monthly. For the treatment of acute conditions, the time course of treatment will usually be at least several days. Some conditions may extend the treatment from several days to several weeks. For example, the treatment may extend for one, two, or three weeks. For more chronic conditions, the treatment may extend from several weeks to several months or even a year or more.

[0271] Treatment with the methods described herein can be administered prior to, simultaneously with, or following conventional treatment measures against respiratory viruses.

[0272] The present disclosure encompasses pharmaceutical compositions comprising the compounds disclosed above, which facilitates administration of active agents and promotes their stability.For example, the compounds disclosed herein can be mixed with at least one pharma-ceutically acceptable carrier or excipient, which results in a pharmaceutical composition that can be administered (given) successfully and effectively to a living subject, for example, a suitable subject (i.e., a "subject in need of treatment" or a "subject in need of it").For the purposes of the aspects and embodiments of the present invention, the subject can be a human or any other animal.

[0273] II. Method The present disclosure encompasses methods of treating, preventing, or reducing the infectivity or transmission of a virus in a subject in need thereof. In some embodiments, the method prevents or reduces the infectivity of a viral infection by preventing internalization of the virus into the subject's cells, or by preventing internalization of the viral genome into the subject's cells. In some embodiments, administration of a composition provided herein, such as a composition described in Section II, can create an immune response in the subject that disrupts or prevents the interaction of a viral surface protein (e.g., spike protein or envelope protein) with a host receptor protein (e.g., epithelial angiotensin-converting enzyme (ACE)). Administering a composition of the present disclosure to a subject at risk of viral infection can reduce the risk of coronavirus infection in the subject.

[0274] The disclosed compositions can be administered to a subject to elicit an immune response against the corresponding coronavirus spike protein in the subject. In a particular example, the subject is a human. The immune response can be a protective immune response, e.g., a response that inhibits subsequent infection with the corresponding coronavirus. Eliciting an immune response can also be used to treat or inhibit infection and disease associated with the corresponding coronavirus.

[0275] For example, a subject who is at risk for or is at risk for developing an infection with a coronavirus corresponding to the S protein in the immunogen due to exposure or potential exposure to the coronavirus can be selected for treatment. Following administration of the disclosed immunogens, the subject can be monitored for infection or symptoms associated with the coronavirus, or both.

[0276] Typical subjects intended for treatment with the therapeutic agents and methods of the present disclosure include humans as well as non-human primates and other animals. To identify subjects for prevention or treatment with the methods of the present disclosure, accepted screening methods are employed to determine risk factors associated with the targeted or suspected disease or condition, or to determine the status of the disease or condition present in the subject. These screening methods include, for example, conventional tests to determine environmental, familial, occupational, and other such risk factors that may be associated with the targeted or suspected disease or condition, as well as diagnostic methods such as various ELISA and other immunoassay methods to detect and / or characterize coronavirus infection. These and other routine methods allow clinicians to select patients in need of therapy using the methods and pharmaceutical compositions of the present disclosure. According to these methods and principles, the compositions can be administered as a stand-alone prevention or treatment program, or as a follow-up, adjunct, or coordinated treatment regimen for other treatments, according to the teachings herein or other conventional methods.

[0277] Administration of the disclosed compositions may be for prophylactic or therapeutic purposes. When provided prophylactically, the disclosed therapeutics are provided prior to any symptoms, e.g., prior to infection. Prophylactic administration of the disclosed therapeutics serves to prevent or ameliorate any subsequent infection. When provided therapeutically, the disclosed therapeutics are provided at or after the onset of disease or infection symptoms, e.g., after the onset of symptoms of infection with a coronavirus corresponding to the S protein in the composition, or after diagnosis of coronavirus infection. That is, the therapeutics can be provided prior to expected exposure to coronavirus, after exposure or suspected exposure to the virus, or after the actual onset of infection to attenuate the expected severity, duration, or extent of infection and / or associated disease symptoms.

[0278] The compositions described herein are provided to a subject in an amount effective to induce or enhance an immune response to coronavirus S protein in the subject, preferably a human. The actual dosage of the disclosed compositions will vary according to factors such as the indications of the disease and the particular condition of the subject (e.g., the subject's age, size, compatibility, extent of symptoms, susceptibility factors, etc.), the timing and route of administration, other drugs or treatments administered concomitantly, and the particular pharmacology of the composition to elicit a desired activity or biological response in the subject. Dosage regimens can be adjusted to provide an optimal prophylactic or therapeutic response.

[0279] The compositions according to the present disclosure can be used in coordinated vaccination protocols or combination formulations. In certain embodiments, the compositions and coordinated immunization protocols employ separate transgenes or formulations, each directed to elicit an anti-viral immune response, such as an immune response against coronavirus S protein. Separate immunogenic compositions that elicit anti-viral immune responses can be combined into a multivalent immunogenic composition administered to a subject in a single immunization step, or they can be administered separately (in a monovalent immunogenic composition) in a coordinated (or prime-boost) immunization protocol.

[0280] There may be several boosts, each of which may be a different disclosed transgene. In some cases, a boost may be the same transgene as another boost or prime. The prime and boost may be administered as a single dose, or may be administered to a subject as multiple doses, e.g., two, three, four, six, or more doses, over the course of days, weeks, or months. Multiple boosts may also be given, e.g., one to five (e.g., one, two, three, four, or five boosts) or more. Different dosages may be used in a series of sequential immunizations, e.g., a relatively large dose in a primary immunization, followed by a boost with a relatively small dose.

[0281] In some embodiments, the boost can be administered about 2 weeks, about 3-8 weeks, or about 4 weeks after the prime, or several months after the prime. In some embodiments, the boost can be administered about 5 months, about 6 months, about 7 months, about 8 months, about 10 months, about 12 months, about 18 months, about 24 months after the prime, or about around the same time after the prime. Periodic additional boosts can also be used at appropriate times to enhance the "immune memory" of the subject. The appropriateness of the selected vaccination parameters, e.g., formulation, dose, regimen, etc., can be determined by taking serum aliquots from the subject and assaying antibody titers over the course of the immunization program. Additionally, the subject's clinical status can be monitored for the desired effect, e.g., prevention of infection or amelioration of disease state (e.g., reduction of viral load). If such monitoring indicates that vaccination is suboptimal, the subject can be boosted with additional doses of the immunogenic composition, and vaccination parameters can be modified in a manner expected to enhance the immune response.

[0282] In some embodiments, the compositions of the present disclosure are administered in a single dose.

[0283] Upon administration of the disclosed compositions of the present disclosure, the subject's immune system typically responds to the composition by producing antibodies specific to the coronavirus S protein contained in the composition, such a response indicating that an effective immunological dose has been delivered to the subject.

[0284] In some embodiments, the subject's antibody response will be determined in terms of evaluating an effective dosage / immunization protocol. In most cases, it will be sufficient to evaluate the antibody titer in serum or plasma obtained from the subject. The decision as to whether to administer a booster vaccination and / or change the amount of therapeutic agent administered to the individual may be based at least in part on the antibody titer level. The antibody titer level may be based, for example, on an immune binding assay that measures the concentration of antibodies in the serum that bind to an antigen, including, for example, a recombinant coronavirus S protein contained in the immunogen.

[0285] The method does not need to completely eliminate or reduce or prevent coronavirus infection to be effective. For example, eliciting an immune response to coronavirus by one or more of the disclosed compositions can reduce or inhibit (eliminate or prevent detectable infected cells) coronavirus infection by a desired amount, such as at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100%, compared to coronavirus infection in the absence of the composition. In a further example, the disclosed method can reduce or inhibit coronavirus replication. The method does not need to completely eliminate coronavirus replication to be effective. For example, an immune response elicited using one or more of the disclosed compositions can reduce replication of the corresponding coronavirus (eliminate or prevent detectable coronavirus replication) by a desired amount, e.g., at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100%, compared to coronavirus replication in the absence of an immune response.

[0286] In some embodiments, the disclosed composition is administered to subject at the same time as administering adjuvant.Adjuvant is known in the art to further increase the immune response to applied antigenic determinant, and pharmaceutical compositions comprising adenovirus and suitable adjuvant are disclosed, for example, in WO 2007 / 110409, which is incorporated herein by reference.The examples of suitable adjuvants are provided herein.

[0287] In some embodiments, administration of a therapeutically effective amount of one or more of the disclosed compositions to a subject elicits a neutralizing immune response in the subject. To assess neutralizing activity following immunization of the subject, serum can be collected from the subject at appropriate time points, frozen, and stored for neutralization testing. Methods for assaying neutralizing activity are known to those skilled in the art and are further described herein. These methods include, but are not limited to, plaque reduction neutralization (PRNT) assays, microneutralization assays, flow cytometry-based assays, and single cycle infection assays. In some embodiments, serum neutralizing activity can be assayed using a panel of coronavirus pseudoviruses. For example, a pseudotyped reporter virus neutralization assay has already been developed (Wand et al., Nat Commun, 6:7712, 2015) similar to methods previously developed for SARS-CoV (Martin et al., Vaccine 26, 6338, 2008; Yang et al., Nature 428, 561, 2004; Naldini et al., PNAS 93, 11382, 1996; Yang et al., PNAS 102, 797, 2005) to test the immunogenicity of vaccine candidates against multiple MERS-CoV strains without the need for a biosafety level 3 facility.

[0288] In other embodiments, the disclosure provides a method of treating, preventing, or reducing the infectivity of a respiratory viral infection. In some embodiments, the viral infection may be a coronavirus infection. The coronavirus may be SARS-CoV, SARS-CoV-2, MERS-CoV, HKU1, OC43, or 229E. The coronavirus may be a beta-coronavirus. A subject at risk of coronavirus infection may come into contact with an asymptomatic carrier of a coronavirus infection, thereby unknowingly contracting the coronavirus infection.

[0289] Certain methods of the present disclosure include the method of producing adenovirus described herein.Such method may include transfecting cells with the adenovirus vector described herein, culturing the cells under conditions such that the cells produce recombinant adenovirus, and harvesting the recombinant adenovirus.Suitable cells are known in the art.In some embodiments, the cells may be HEK, Vero, or PER cells.

[0290] The present disclosure also encompasses a method of treating a second subject with serum from a first subject. Specifically, the present disclosure encompasses a composition comprising serum from a first subject previously administered with an adenoviral vector as detailed herein, a pharmaceutical composition as detailed herein, or an immunogenic composition as detailed herein. Methods for collecting such serum are known in the art. A method of treating a second subject with serum from a first subject generally comprises administering to the second subject an immunogenically effective amount of a composition comprising serum from the first subject. Methods for administering serum to a subject are known, and determining the amount of serum to be administered is within the skill of a person of ordinary skill in the art.

[0291] Generally, the methods described herein include administering a therapeutically effective amount of a nanoparticle composition of the present disclosure to a subject. The methods described herein are generally performed on a subject in need thereof. The subject may be a rodent, a human, a livestock animal, a companion animal, or a zoo animal. In one embodiment, the subject may be a rodent, such as a mouse, a rat, a guinea pig, etc. In another embodiment, the subject may be a livestock animal. Non-limiting examples of suitable livestock animals may include pigs, cows, horses, goats, sheep, llamas, and alpacas. In yet another embodiment, the subject may be a companion animal. Non-limiting examples of companion animals may include pets, such as dogs, cats, rabbits, and birds. In yet another embodiment, the subject may be a zoo animal. As used herein, "zoo animal" refers to an animal found in a zoo. Such animals may include non-human primates, big cats, wolves, and bears. In a preferred embodiment, the subject is a human.

[0292] IV. Kit Kits are also provided. Such kits may include an agent or composition as described herein, and in certain embodiments, instructions for administration. The components include, but are not limited to, one or more of: (i) a host cell as described herein, a packaging cell as described herein, an adenoviral vector as described herein, a pharmaceutical composition as described herein, or an immunogenic composition as described herein, and (ii) instructions for use. In some embodiments, the kits of the present disclosure may include a composition as detailed in section II above. Such kits may facilitate the implementation of the methods described herein. When supplied as a kit, the different components of the composition may be packaged in separate containers and mixed immediately prior to use. Such packaging of the components may be presented individually in a pack or dispenser device that may contain one or more unit dosage forms containing the composition, if desired. The pack may include, for example, a metal or plastic foil, such as a blister pack. In certain cases, such packaging of the components may also allow for long-term storage without loss of activity of the components individually.

[0293] The kit may also contain drugs in separate containers, such as sterile water or saline to be added to the individually packaged lyophilized active ingredients. For example, a sealed glass ampoule may contain the lyophilized ingredients, and another may contain sterile water, sterile saline, each packaged under a neutral, non-reactive gas, such as nitrogen. The ampoules may be made of any suitable material, such as glass, organic polymers, such as polycarbonate, polystyrene, ceramic, metal, or any other material typically employed to hold drugs. Other examples of suitable containers include bottles, which may be made from similar materials as the ampoules, and envelopes with foil-lined interiors, such as aluminum or alloys. Other containers include test tubes, vials, flasks, bottles, syringes, and the like. The container may have a sterile access port, such as a bottle with a stopper that can be punctured by a hypodermic needle. Other containers may have two compartments separated by a readily removable membrane that allows the ingredients to mix when removed. The removable membrane may be glass, plastic, rubber, and the like.

[0294] In certain embodiments, the kit may be supplied with instructional materials. The instructions may be printed on paper or other substrate and / or may be supplied as an electronically readable medium, such as a floppy disk, a mini CD-ROM, a CD-ROM, a DVD-ROM, a zip disk, videotape, audiotape, etc. The detailed instructions may not physically accompany the kit, but may instead direct the user to an internet website identified by the manufacturer or distributor of the kit.

[0295] The compositions and methods described herein utilizing molecular biology protocols can follow a variety of standard techniques known in the art [e.g., Sambrook and Russel (2006) Condensed Protocols from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10: 0879697717; Ausubel et al. (2002) Short Protocols in Molecular Biology, 5th ed., Current Protocols, ISBN-10: 0471250929; Sambrook and Russel (2001) Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Laboratory Press, ISBN-10: 0879695773; Elhai, J. and Wolk, CP 1988. Methods in Enzymology 167, 747-754; Studier (2005) Protein Expr Purif. 41(1), 207-234; Gellissen, ed. (2005) Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems, Wiley-VCH, ISBN-10: 3527310363; Baneyx (2004) Protein Expression Technologies, Taylor & Francis, ISBN-10: 0954523253].

[0296] Certain embodiments disclosed herein may be further limited in the claims using the language "consisting of" or "consisting essentially of" rather than "comprising." When used in the claims, whether as filed or added by amendment, the transitional term "consisting of" excludes any element, step, or ingredient not specified in the claim. The transitional term "consisting essentially of" limits the claim to the materials or steps specified and those materials or steps that do not materially affect the basic and novel characteristics. The embodiments of the invention so claimed are essentially or explicitly described and enabled herein.

[0297] Since various modifications can be made in the materials and methods described above without departing from the scope of the invention, it is intended that all matter contained in the above description and following examples be interpreted in an illustrative and not a limiting sense. EXAMPLES

[0298] The following examples are included to demonstrate various embodiments of the present disclosure. It should be understood by those skilled in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors to function well in the practice of the present invention, and thus may be considered to constitute preferred modes for the practice of the invention. However, in light of this disclosure, those skilled in the art should understand that many modifications may be made to the specific embodiments disclosed and still obtain the same or similar results without departing from the spirit and scope of the present invention. [Example 1]

[0299] A single-dose chimpanzee adenovirus-vectored vaccine protects against SARS-CoV-2 infection and pneumonia in mice expressing the human ACE2 receptor This example provides a chimpanzee Ad (simian AdV-36)-based SARS-CoV-2 vaccine (ChAd-SARS-CoV-2-S) encoding a prefusion stabilized spike (S) protein after introducing two proline substitutions into the S2 subunit. Intramuscular administration of ChAd-SARS-CoV-2-S elicited robust systemic humoral and cell-mediated immune responses against the S protein. One or two vaccine doses protected against pulmonary infection, inflammation and pathology after SARS-CoV-2 challenge in mice transiently expressing the human ACE2 (hACE2) receptor. Despite eliciting high levels of neutralizing antibodies in serum, substantial levels of viral RNA were still detected in the lungs, so none of the dosing regimens fully protected against SARS-CoV-2 infection. In comparison, when a single dose of ChAd-SARS-CoV-2-S was administered by the intranasal route, high levels of neutralizing antibodies and anti-SARS-CoV-2 IgA and complete protection against infection in both the upper and lower respiratory tract were detected. Furthermore, in contrast to the control ChAd vaccine, 8 days after SARS-CoV-2 challenge, serum antibody responses against SARS-CoV-2 NP protein were absent in animals immunized with ChAd-SARS-CoV-2-S via intranasal delivery. Thus, ChAd-SARS-CoV-2-S has the potential to confer sterilizing immunity at the site of inoculation that would prevent both virus-induced disease and transmission.

[0300] result Chimpanzee Ad-vectored vaccine induces robust antibody responses against SARS-CoV-2: Two replication-incompetent ChAd vectors based on the simian Ad-36 virus were constructed. The ChAd-SARS-CoV-2-S vector encodes the full-length sequence of the SARS-CoV-2 S protein as a transgene, including the ectodomain, transmembrane domain, and cytoplasmic domain (GenBank: QJQ84760.1), stabilized in the prefusion form by two proline substitutions at residues K986 and V987. The ChAd control does not carry a transgene. The S protein transgene is transcriptionally controlled by the cytomegalovirus promoter. To render the vector replication-incompetent and enhance packaging capacity, the E1A / B genes were replaced and a deletion was introduced in the E3B gene, respectively (Figure 1A). To confirm that the S protein was expressed and antigenically intact, it was transduced into 293T cells and the binding of a panel of 22 neutralizing monoclonal antibodies to the S protein was confirmed by flow cytometry (Fig. 1B ).

[0301] To evaluate the immunogenicity of ChAd-SARS-CoV-2-S, groups of 4-week-old BALB / c mice were immunized intramuscularly with 1010 viral particles of ChAd-SARS-CoV-2-S or ChAd control. Some mice received a booster dose 4 weeks later. Serum samples were collected 21 days after the primary or booster immunization (Figure 1C), and IgG responses against purified S and RBD proteins were evaluated by ELISA. Meanwhile, ChAd-SARS-CoV-2-S elicited high levels of S- and RBD-specific IgG, while low, if any, levels were detected in ChAd control-immunized mice (Figure 1D and Figure 2A). Serum samples were assayed in vitro for neutralization of infectious SARS-CoV-2 using the focus-reduction neutralization test (FRNT). As expected, sera from ChAd control-immunized mice did not block SARS-CoV-2 infection after priming or boosting. In contrast, sera from ChAd-SARS-CoV-2-S vaccinated animals potently neutralized SARS-CoV-2 infection, and boosting enhanced this inhibitory activity (Figure 1E and Figures 2B-2C).

[0302] Vaccine-induced memory CD8+ T cell and antigen-specific B cell responses: Because optimal vaccine immunity often consists of both humoral and cellular responses, we measured the levels of SARS-CoV-2-specific CD4+ and CD8+ T cells after vaccination. Four-week-old BALB / c mice were immunized with ChAd-SARS-CoV-2-S or ChAd control and boosted 3 weeks later. To assess vaccine-induced SARS-CoV-2-specific CD4+ and CD8+ T cell responses, splenocytes were harvested 1 week after boosting and stimulated ex vivo with a pool of 253 overlapping 15 amino acid long S peptides. Quantification of intracellular IFNγ and granzyme B expression was subsequently determined by flow cytometry. After ex vivo peptide restimulation, splenic CD8+ T cells expressed IFNγ and both splenic CD4+ and CD8+ T cells expressed granzyme B in mice immunized with ChAd-SARS-CoV-2-S, but not with ChAd control vector (Figures 1F-1G and 3). To evaluate antigen-specific B cell responses, splenocytes were harvested and subjected to ELISPOT analysis with S protein. In the spleen, the ChAd-SARS-CoV-2-S vaccine induced S protein-specific IgG antibody-secreting cells, but the control vaccine did not (Figure 1H).

[0303] Intramuscular immunization with ChAd-SARS-CoV-2-S vaccine protects against SARS-CoV-2 infection in the lung: The protective activity of the ChAd vaccine was examined in a recently developed SARS-CoV-2 infection model in which BALB / c mice express hACE2 in the lung after intranasal delivery of vectored human Ad (Hu-Ad5-hACE2). Endogenous mouse ACE2 does not support viral entry, and this system allows productive SARS-CoV-2 infection in mouse lungs. Four-week-old BALB / c mice were first immunized with ChAd control or ChAd-SARS-CoV-2-S vaccine via the intramuscular route. Approximately 30 days later, mice were administered 10 mg of ChAd-SARS-CoV-2 vaccine and 10 mg of ChAd-SARS-CoV-2 vaccine. 8Plaque-forming units (PFU) of Hu-Ad5-hACE2 and anti-Ifnar1 monoclonal antibody (mAb) were administered via the intranasal and intraperitoneal routes, respectively. A single dose of anti-Ifnar1 mAb was also administered to enhance pulmonary pathogenesis in this model. We confirmed the absence of cross-immunity between ChAd and Hu-Ad5 vectors. Serum from ChAd-immunized mice did not neutralize Hu-Ad5 infection (Figures 4A-4B).

[0304] Five days after Hu-Ad5-hACE2 transduction, mice were administered 4 × 10 5 Mice were challenged with focus-forming units (FFU) of SARS-CoV-2 (Figure 2A). Four days post-infection (dpi), the peak of viral load in this model, mice were euthanized and lungs, spleens and hearts were harvested for viral load and cytokine analysis. Of note, there was no detectable infectious virus in the lungs of mice immunized with ChAd-SARS-CoV-2-S, as determined by plaque assay, while high levels were present in mice vaccinated with the ChAd control (Figure 5B). Consistent with this result, reduced viral RNA levels were observed in the lungs, heart and spleens of ChAd-SARS-CoV-2-S vaccinated animals compared to mice that received the ChAd control vector (Figure 5C). In situ hybridization staining for viral RNA in lungs harvested at 4 dpi revealed a substantial reduction in SARS-CoV-2 RNA in lung cells of animals immunized with ChAd-SARS-CoV-2-S compared to the ChAd control (Figure 5D). A subset of immunized animals was euthanized 8 dpi and tissues were harvested for evaluation. At this time point, viral RNA levels were again low or absent in the lungs and spleens of ChAd-SARS-CoV-2-S immunized mice compared to the control ChAd vector (Figure 5C). Together, these data indicate that a single intramuscular immunization with ChAd-SARS-CoV-2-S resulted in a marked reduction, but not inhibition, of SARS-CoV-2 infection in the lungs of challenged mice.

[0305] We next evaluated the effect of the vaccine on lung inflammation and disease. Several proinflammatory cytokine and chemokine mRNA levels, including CXCL10, IL1β, IL-6, CCL5, IFNβ, and IFNγ, were lower in lung tissue from animals immunized with ChAd-SARS-CoV-2-S compared to ChAd controls (Figure 5E). Furthermore, mice immunized with the ChAd control vaccine and challenged with SARS-CoV-2 showed evidence of viral pneumonia characterized by accumulation of immune cells at perivascular and alveolar sites, vascular congestion, and interstitial edema. In contrast, animals immunized with ChAd-SARS-CoV-2-S showed a marked attenuation of the inflammatory response in the lungs that developed in ChAd control-immunized mice (Figure 6). Thus, immunization with Ch-Ad-SARS-CoV-2 reduces both viral infection and the resulting lung inflammation as well as the injury associated with SARS-CoV-2 infection.

[0306] The improvement of protection using a prime-boost vaccine regimen was next evaluated. BALB / c mice were immunized with ChAd-control or ChAd-SARS-CoV-2-S via the intramuscular route and received a homologous booster dose 4 weeks later. On day 29 after boost, mice were treated with a single dose of anti-Ifnar1 antibody followed by Hu-Ad5-hACE2 and challenged with SARS-CoV-2 5 days later. As expected, the prime-boost regimen protected against SARS-CoV-2 challenge with no infectious virus detected in the lungs (Figure 5F). Although a significant reduction in viral RNA in the lungs, spleen and heart was detected at 4 dpi, residual levels of viral RNA were still present, suggesting that protection was not complete even after boosting (Figure 5G).

[0307] A single intranasal immunization with ChAd-SARS-CoV-2-S induces sterilizing immunity against SARS-CoV-2: Mucosal immunization via the nasopharyngeal route can induce local immune responses, including secretory IgA antibodies, that confer protection at or near the site of inoculation with respiratory pathogens. To evaluate the immunogenicity and protective efficacy of mucosal vaccination, 5-week-old BALB / c mice were immunized with 10 viral particles of ChAd control or ChAd-SARS-CoV-2-S. 10 Mice were inoculated via the intranasal route with ChAd-SARS-CoV-2 (Figure 7A). Serum samples were collected 4 weeks after immunization to assess humoral immune responses. Intranasal immunization with ChAd-SARS-CoV-2-S elicited high levels of S- and RBD-specific IgG and IgA (Figures 7B-7C) as well as SARS-CoV-2 neutralizing antibodies in serum (geometric mean titer 1 / 1, 574), whereas ChAd control did not (Figure 7D and Figure 8A). Serum antibodies from mice immunized with ChAd-SARS-CoV-2-S comparably neutralized a recombinant, luciferase-expressing variant of SARS-CoV-2 encoding a D614G mutation in the S protein (Figure 8B); this finding is important as a large number of circulating viruses carry this substitution and are associated with greater infectivity in cell culture (doi.Org / 10.1101 / 2020.06.12.148726). We also assessed SARS-CoV-2-specific antibody responses in bronchoalveolar lavage (BAL) fluid from immunized mice. BAL fluid from ChAd-SARS-CoV-2-S vaccinated mice showed high levels of S- and RBD-specific IgG and IgA antibodies (Figures 7E-7F), including those with neutralizing activity, but not from ChAd control vaccinated mice (Figures 7G and 8C).

[0308] To evaluate T cell responses activated via mucosal immunization, mice were vaccinated with either ChAd-SARS-CoV-2-S or ChAd control via the intranasal route and boosted similarly 4 weeks later. Lungs were harvested 1 week after boosting, and T cells were analyzed by flow cytometry. Ex vivo restimulation with a pool of S peptides also resulted in a marked increase in IFNγ- and granzyme B-producing CD8+ T cells in the lungs of mice that received the ChAd-SARS-CoV-2-S vaccine (Figure 7H). Specifically, in the lungs, we observed IFNγ-secreting, antigen-specific CD103 T cells phenotypically consistent with vaccine-induced resident memory T cells. + CD69 + CD8 + We identified a population of T cells (Figure 7I). In the spleen, antibody-secreting plasma cells producing IgA or IgG against the S protein were detected after intranasal immunization with ChAd-SARS-CoV-2-S (Figure 7J). Of note, anti-S IgA-secreting B cells were observed at a frequency approximately 5-fold higher than IgG.

[0309] The protective efficacy of the ChAd vaccine after single-dose intranasal immunization was evaluated. Mice were administered 10 8 PFU of Hu-Ad5-hACE2 and anti-Ifnar1 mAb were administered as described above. Five days later, mice were 5Mice were challenged with FFU of SARS-CoV-2. At 4 and 8 dpi, lungs, spleen, heart, nasal turbinates, and nasal washes were collected and assessed for viral load. Intranasal delivery of the ChAd-SARS-CoV-2-S vaccine demonstrated remarkable protective efficacy as judged by the absence of infectious virus in the lungs (Figure 9A) and almost no measurable viral RNA in the lungs, spleen, heart, nasal turbinates, or nasal washes (Figure 9B). The very low viral RNA levels in the lungs and nasal turbinates at 4 dpi likely reflect the input non-replicating virus, as similar levels were measured at this time point in C57BL / 6 mice lacking hACE2 receptor expression. Cytokine and chemokine mRNA levels in lung homogenates were also substantially lower in mice immunized with ChAd-SARS-CoV-2-S than in the ChAd control vaccine, with the potential for residual expression due to the human Ad vector hACE2 delivery system (Figure 9C). Finally, histopathological analysis of lung tissue from animals vaccinated with ChAd-SARS-CoV-2-S by the intranasal route and challenged with SARS-CoV-2 showed little, if any, perivascular and alveolar infiltrates compared to the extensive inflammation observed in ChAd control-vaccinated animals at 8 dpi (Figure 9D).

[0310] To determine whether sterilizing immunity is achieved using intranasal delivery of ChAd-SARS-CoV-2-S, anti-NP antibodies were measured 8 dpi and compared to responses 5 days prior to SARS-CoV-2 infection. The induction of a humoral immune response against NP after SARS-CoV-2 exposure suggests viral protein translation and active infection, as the NP gene is absent from the vaccine vector. After SARS-CoV-2 challenge, anti-NP antibody responses were detected in ChAd control mice vaccinated by the intranasal route or in ChAd control and ChAd-SARS-CoV-2-S mice vaccinated by the intramuscular route (Figure 9E and Figure 2D). Strikingly, none of the mice immunized with ChAd-SARS-CoV-2-S via the intranasal route showed a significant increase in anti-NP antibody responses after SARS-CoV-2 infection. These data, together with our virological analyses, suggest that a single intranasal immunization with ChAd-SARS-CoV-2-S induces robust and likely sterile mucosal immunity that protects against SARS-CoV-2 infection in the upper and lower respiratory tract of mice expressing the hACE2 receptor.

[0311] Consideration In this example, intramuscular and intranasal administration of replication-incompetent ChAd vectors as a vaccine platform for SARS-CoV-2 was evaluated. Single-dose immunization with a stabilized S protein-based vaccine via the intramuscular route elicited S- and RBD-specific binding and neutralizing antibodies. Vaccination with one or two doses protected mice expressing human ACE2 against SARS-CoV-2 challenge, as evidenced by the absence of infectious virus in the lungs and a substantial reduction in viral RNA levels in the lungs and other organs. Mice immunized with ChAd-SARS-CoV-2-S also showed a significant reduction, though not an absence, in pulmonary pathology, pulmonary inflammation, and evidence of pneumonia compared to the control ChAd vaccine. However, intramuscular vaccination with ChAd-SARS-CoV-2-S did not confer sterilizing immunity, as evidenced by detectable viral RNA levels in several tissues, including the lungs, and the elicitation of anti-NP antibody responses. Mice immunized with a single dose of ChAd-SARS-CoV-2-S via the intranasal route were also protected against SARS-CoV-2 challenge. However, intranasal vaccination generated robust IgA and neutralizing antibody responses that protected against SARS-CoV-2 infection of both the upper and lower respiratory tracts and blocked infection with both wild-type and D614G mutant viruses. In the context of challenge, the very low viral RNA in upper respiratory tract tissues and the absence of serological responses to NP strongly suggest that the majority of animals receiving a single intranasal dose of ChAd-SARS-CoV-2-S achieve sterilizing immunity.

[0312] Although several vaccine candidates (e.g., lipid-encapsulated mRNA, DNA, inactivated and viral vectored) have progressed rapidly into human clinical trials in an expedited effort to control the pandemic, few studies have demonstrated efficacy in preclinical models. Rhesus macaques immunized with two or three doses of a DNA plasmid vaccine encoding the full-length SARS-CoV-2 S protein elicited neutralizing antibodies in serum and reduced viral loads in BAL and nasal mucosal fluids. Furthermore, three immunizations over a two-week period with purified inactivated SARS-CoV-2 elicited neutralizing antibodies and provided rhesus macaques with partial or complete protection against infection and viral pneumonia depending on the dose administered. One limitation of these challenge models is that rhesus macaques develop mild interstitial pneumonia following SARS-CoV-2 infection compared to some humans and other non-human primate species. This example in hACE2-expressing mice showed that a single intramuscular or intranasal dose of the ChAd-SARS-CoV-2-S vaccine conferred substantial and possibly complete protection against viral replication, inflammation and pulmonary disease.

[0313] This disclosure supports the use of non-human Ad-vectored vaccines against emerging RNA viruses, including SARS-CoV-2. Previous studies have shown efficacy of single-dose or two-dose regimens of gorilla Ad encoding the prM-E genes of Zika virus (ZIKV) in several mouse challenge models, including in the context of pregnancy. Others have evaluated ChAd or rhesus macaque Ad vaccine candidates against ZIKV and shown efficacy in mice and non-human primates. A variety of ChAds encoding the wild-type SARS-CoV-2 S protein (ChAdOx1) are currently in clinical trials in humans (NCT04324606). Although data from human trials have not yet been reported, studies in rhesus macaques suggest that a single intramuscular dose protects against infection in the lungs but not the upper respiratory tract (biorxiv.org / content / 10.1101 / 2020.05.13.093195v1). Vaccines evaluated against SARS-CoV-2 have not shown evidence of immune enhancement in any preclinical or clinical studies, a theoretical risk based on studies with other human and animal coronaviruses. Indeed, in contrast to data with SARS-CoV vaccines or antibodies, no enhancement of infection, immunopathology or disease was observed in animals immunized with ChAd encoding the SARS-CoV-2 S protein or administered passively transferred monoclonal antibodies.

[0314] After ex vivo S peptide restimulation, ChAd-SARS-CoV-2-S elicited SARS-CoV-2-specific CD8+ cells, including a high percentage and number of IFNγ- and granzyme-expressing cells. + The ChAd-SARS-CoV-2-S vaccine induced a robust CD8 T cell response. + The induction of T cell responses is consistent with reports using other simian Ad vectors. The ChAd vaccine vector not only overcomes the problem of pre-existing immunity to human adenoviruses, but also has immunological advantages since it does not induce exhausted T cell responses.

[0315] A single intranasal dose of ChAd-SARS-CoV-2-S conferred better immunity against SARS-CoV-2 challenge than one or two intramuscular immunizations of the same vaccine and dose. Given that serum neutralizing antibody responses were comparable, it is hypothesized that the greater protection observed after intranasal delivery is due to the generation of a mucosal immune response. Indeed, high levels of anti-SARS-CoV-2 IgA were detected in serum and lungs, and IgA-secreting B cells were detected in the spleen. Furthermore, intranasal vaccination also elicited a significant increase in CD103 expression in the lungs, a potential residual memory phenotype. + CD69 + To the best of our knowledge, there are no SARS-CoV-2 vaccine platforms using an intranasal delivery approach in current clinical trials. There is great interest in using intranasal delivery for influenza A virus vaccines due to their ability to induce local humoral and cellular immune responses. Indeed, sterilizing immunity against influenza A virus reinfection requires local adaptive immune responses in the lungs, which are optimally elicited by intranasal but not intramuscular inoculation. Although there are concerns about administering live attenuated virus vaccines via the intranasal route, subunit-based or replication-incompetent vectored vaccines hold promise for generating mucosal immunity in a safer manner, especially with advances in formulation.

[0316] In summary, this example demonstrates that immunization with ChAd-SARS-CoV-2-S induces neutralizing antibodies and antigen-specific CD8 +We establish that a single intramuscular immunization with ChAd-SARS-CoV-2-S confers protection against SARS-CoV-2 infection and inflammation in the lungs, whereas intranasal delivery of ChAd-SARS-CoV-2-S induces mucosal immunity, provides superior protection, and appears to promote sterilizing immunity, at least in mice transiently expressing the hACE2 receptor. Thus, this example supports intranasal delivery of ChAd-SARS-CoV-2-S as a platform for managing SARS-CoV-2 infection, disease, and transmission. method

[0317] Viruses and cells: Vero E6 (CRL-1586, American Type Culture Collection (ATCC), Vero CCL81 (ATCC) and HEK293 cells were cultured at 37°C in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES pH 7.3, 1 mM sodium pyruvate, 1X non-essential amino acids and 100 U / ml penicillin-streptomycin.

[0318] SARS-CoV-2 strain 2019 n-CoV / USA_WA1 / 2020 was obtained from the Centers for Disease Control and Prevention (kind gift from Natalie Thornburg). Virus was passaged once in Vero CCL81 cells and titrated in Vero E6 cells by focus-forming assay (FFA). Recombinant luciferase-expressing full-length SARS-CoV-2 reporter virus (strain 2019 n-CoV / USA_WA1 / 2020) was previously reported (Zost et al., 2020) and the D614G mutant has been described elsewhere. All studies with infectious SARS-CoV-2 were performed in Institutional Biosafety Committee-approved BSL3 and A-BSL3 facilities using appropriate positive-pressure air masks and protective equipment.

[0319] Mouse experiments: Animal studies were performed in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee of the Washington University School of Medicine (certification number A3381-01). Virus inoculation was performed under anesthesia induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering.

[0320] Female BALB / c mice were purchased from The Jackson Laboratory (catalogue 000651). Animals aged 4 to 5 weeks were immunized with 1010 viral particles (vp) of ChAdV-empty or ChAd-SARS-CoV-2-S in 50 μl PBS via intramuscular injection in the hind leg or via intranasal inoculation. A subset of immunized animals was boosted 4 weeks after the primary immunization using the same route as for the primary immunization. Vaccinated mice (10 to 11 weeks old) were given 10 8 One day before intranasal administration of PFU of Hu-AdV5-hACE2, mice were given a single intraperitoneal injection of 2 mg of anti-Ifnar1 mAb (MAR1-5A3, Leinco). Five days after Hu-AdV5 transduction, mice were given 4 × 10 5 FFU of SARS-CoV-2 was inoculated via the intranasal route. Animals were euthanized at 4 or 8 dpi and tissues were harvested for virological, immunological and pathological analyses.

[0321] Construction of chimpanzee adenovirus vector: The simian Ad36 vector (ChAd) was obtained from the Penn Vector Core of the University of Pennsylvania. The ChAd genome was engineered to contain deletions of the E1 and E3B regions (GenBank: FJ025917.1; nucleotides 455-3026 and 30072-31869, respectively). A modified human cytomegalovirus major immediate early promoter sequence was integrated into the complementary DNA strand in a counterclockwise orientation at the location of the E1 gene. The CMV modification included the addition of two copies of the tet operator 2 (TetO2) sequence (GenBank: MN920393, nucleotides 174211-174212) inserted in tandem between the TATA box and the mRNA start (5'-TCT CTA TCA CTG ATA GGG AGA TCT CTA TCA CTG ATA GG GA-3') (SEQ ID NO: 7). SARS-CoV-2 S (encoding a prefusion stabilized mutant containing two proline substitutions at residues K986 and V987, which stabilize the prefusion form of S) was cloned into the pSAd36 genome plasmid under the control of the CMV-tetO2 promoter into a unique PmeI site to generate pSAd36-S. Similarly, mutant SAR-CoV-2S proteins disclosed in SEQ ID NOs: 10, 11, 20, and 21 were cloned in the same manner. In parallel, a pSAd36 control carrying an empty CMV-tetO2 cassette without a transgene was also generated. pSAd36-S and pSAd control plasmids were linearized using PacI restriction enzyme to release the viral genome for transfection into T-Rex293-HEK cells (Invitrogen). The rescued replication-incompetent ChAd-SARS-CoV-2-S and ChAd control vectors were scaled up in 293 cells and purified by CsCl density gradient ultracentrifugation. The viral particle concentration in each vector preparation was determined by spectrophotometry at 260 nm.

[0322] Construction of human adenovirus vector expressing human ACE2: The codon-optimized hACE2 sequence was cloned into a shuttle vector (pShuttle-CMV, Addgene 240007) to generate pShuttle-hACE2. pShuttle-hACE2 was linearized with PmeI and subsequently co-transformed with the HuAdv5 backbone plasmid (pAdEasy-1 vector; Addgene 240005) into E. coli strain BJ5183 to generate pAdV5-ACE2 by homologous recombination. The pAdEasy-1 plasmid containing the HuAdV5 genome has deletions in the E1 and E3 genes. hACE2 is under the transcriptional control of the cytomegalovirus promoter and is flanked at its 3' end by an SV40 polyadenylation signal. pAd-hACE2 was linearized with PacI restriction enzyme before transfection into T-Rex293HEK cells (Invitrogen) to generate HuAdv5-hACE2. Recombinant HuAdv5-hACE2 was produced in 293-HEK cells and purified by CsCl density gradient ultracentrifugation. Viral titers were determined by plaque assay in 293-HEK cells.

[0323] In situ RNA hybridization and histology: RNA in situ hybridization was performed using RNAscope 2.5 HD (Brown) (Advanced Cell Diagnostics) according to the manufacturer's instructions. Left lung tissue was collected at necropsy, inflated with 10% neutral buffered formalin (NBF), and then immersion fixed in 10% NBF for 7 days before processing. Paraffin-embedded lung sections were deparaffinized by incubation at 60°C for 1 h, and endogenous peroxidase was quenched with H2O2 for 10 min at room temperature. Slides were boiled in RNAscope Target Retrieval Reagents for 15 min and incubated in RNAscope Protease Plus reagent for 30 min prior to SARS-CoV2 RNA probe (Advanced Cell Diagnostics 848561) hybridization and signal amplification. Sections were counterstained with Gill's hematoxylin and visualized by brightfield microscopy. Some lung sections were processed for histological examination after hematoxylin and eosin staining.

[0324] SARS-CoV-2 Neutralization Assay: Heat-inactivated serum samples were serially diluted to 10 2The cells were incubated with FFU of SARS-CoV-2 for 1 h at 37 °C. The virus-serum mixture was added to a Vero cell monolayer in a 96-well plate and incubated for 1 h at 37 °C. The cells were then overlaid with 1% (w / v) methylcellulose in MEM supplemented with 2% FBS. The plates were incubated at room temperature for 30 h before fixation with 4% PFA in PBS for 1 h. The cells were then washed and incubated sequentially with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg / mL) and HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w / v) saponin (Sigma) and 0.1% BSA. TrueBlue peroxidase substrate (KPL) was used to develop the plates before counting foci on a BioSpot analyzer (Cellular Technology Limited). For neutralization experiments with luciferase-expressing SARS-CoV-2, serum samples were diluted 3-fold starting at 1:50 and mixed with 85 PFU of each recombinant virus (wild type and D614G). Vero E6 cells plated in clear-bottom, black-walled 96-well plates (Corning) were inoculated with the serum-virus mixture, and cells were cultured at 37°C for 48 h. Cells were then lysed, and luciferase activity was measured using the Nano-Glo Luciferase Assay System (Promega) according to the manufacturer's specifications.

[0325] Hu-AdV5 neutralization assay: One day before Hu-AdV5-hACE2 transduction, serum samples were collected from mice intramuscularly immunized with ChAd control or ChAd-SARS-CoV-2-S. 2Serum was heat inactivated and serially diluted before incubation with FFU of HuAdV5 for 1 h at 37°C. Virus-serum mixtures were added to HEK293 cell monolayers in 96-well plates and incubated for 1 h at 37°C. Cells were then overlaid with 1% (w / v) methylcellulose in MEM supplemented with 5% FBS. Plates were incubated at 37°C for 48 h before fixation with 2% PFA in PBS for 1 h at room temperature. Plates were then washed with PBS and incubated overnight at 4°C with biotinylated anti-HuAdV5-hexon antibody (2 μg / mL; Novus Biologicals NB600413) diluted in permeabilization buffer (PBS supplemented with 0.1% (w / v) saponin and 0.1% BSA). Plates were washed again and incubated with streptavidin-HRP (1:3000; Vector Laboratories SA-5004) in permeabilization buffer for 30 min at room temperature. After a final washing series, plates were developed using TrueBlue peroxidase substrate (KPL) and foci were counted on a BioSpot analyzer (Cellular Technology Limited).

[0326] Protein expression and purification: Purified RNA from the 2019-nCoV / USA-WA1 / 2020 SARS-CoV-2 strain was reverse transcribed into cDNA and used as a template for recombinant gene cloning. Full-length SARS-CoV-2 NP (NP-FL) was cloned into pET21a containing a hexahistidine tag and recombinantly expressed using BL21(DE3)-RIL E. coli in Terrific Broth (bioWORLD). Following overnight induction at 25°C with isopropyl β-d-1-thiogalactopyranoside (Goldbio), cells were lysed for nickel affinity purification in 20 mM Tris-HCl pH 8.5, 1 M NaCl, 5 mM β-mercaptopethanol and 5 mM imidazole. After elution into pre-buffer supplemented with 500 mM imidazole, proteins were purified to homogeneity using size exclusion and, optionally, cation exchange chromatography. The SARS-CoV-2 RBD and S ectodomain (which disrupted the S1 / S2 furin cleavage site, introduced a double proline mutation into the S2 subunit, and incorporated a foldon trimerization motif) were cloned into pFM1.2 with a C-terminal hexahistidine or octahistidine tag, transiently transfected into Expi293F cells, and purified by cobalt-charged resin chromatography (G-Biosciences) as previously described (Alsoussi et al., 2020).

[0327] ELISA: Purified antigens (S, RBD or NP) were coated onto 96-well Maxisorp clear plates at 2 μg / mL in 50 mM Na2CO3 pH 9.6 (70 μL) overnight at 4°C. Coating buffer was aspirated and wells were blocked with 200 μL of 1X PBS + 0.05% Tween-20 + 1% BSA + 0.02% NaN3 (blocking buffer, PBSTBA) either for 1 hour at 37°C or overnight at 4°C. Heat-inactivated serum samples were diluted in PBSTBA into separate 96-well polypropylene plates. Plates were then washed 3 times with 1X PBS + 0.05% Tween-20 (PBST) followed by the addition of 50 μL of each serum dilution. Sera were incubated in the blocked ELISA plates for at least 1 hour at room temperature. The ELISA plates were again washed three times with PBST, followed by the addition of 50 μL of 1:2000 anti-mouse IgG-HRP (Southern Biotech Cat. No. 1030-05) in PBST or 1:10000 biotinylated anti-mouse IgG, anti-mouse IgM or anti-mouse IgA (SouthernBiotech) in PBSTBA. The plates were incubated for 1 hour at room temperature, washed three times in PBST, and then a 1:5000 dilution of streptavidin-HRP (ThermoFisher) was added to the wells. Following incubation for 1 hour at room temperature, the plates were washed three times with PBST and 50 μL of 1-Step Ultra TMB-ELISA was added (ThermoFisher Cat. No. 34028). Following a 12-15 minute incubation, the reaction was stopped with 50 μL of 2M sulfuric acid. The absorbance of each well at 450 nm was read within 2 min of adding sulfuric acid (Synergy H1). Optical density (450 nm) measurements were determined using a microplate reader (Bio-Rad).

[0328] ELISpot assay: MultiScreen-HA filter 96-well plates (Millipore) plates were pre-coated with 3 μg / ml SARS-CoV-2 S protein overnight at 4 °C. After rinsing with PBST, plates were blocked with culture medium (RPMI, 10% FBS, penicillin-streptomycin, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 10 mM HEPES and 50 mM β-mercaptoethanol) for 4 h at 37 °C. Single cell suspensions of splenocytes in culture medium were added to the S protein-coated plates and incubated at 37 °C. 、 Plates were incubated for 4 hours at 5% humidified CO2. After washing with PBS and PBST, plates were incubated with biotinylated anti-IgG or anti-IgA (Southern Biotech), followed by incubation with streptavidin-conjugated horseradish peroxidase (Jackson ImmunoResearch), 1 hour each at room temperature. After additional washing with PBS, 3-amino-9-ethylcarbazole (Sigma) substrate solution was added for spot development. The reaction was stopped by rinsing with water. Spots were counted using a Biospot plate reader (Cellular Technology).

[0329] Measurement of viral load: SARS-CoV-2-infected mice were euthanized using a ketamine and xylazine cocktail and organs were collected. Tissues were weighed and bead-homogenized using a MAgNA Lyser (Roche) in 1 ml of Dulbecco's modified Eagle's medium (DMEM) containing 2% fetal bovine serum (FBS). RNA was extracted from clarified tissue homogenates using a MagMax mirVana Total RNA Isolation Kit (Thermo Scientific) and a KingFisher Duo Prime Extractor (Thermo Scientific). SARS-CoV-2 RNA levels were measured by one-step quantitative reverse transcriptase PCR (qRT-PCR) TaqMan assay as previously described (Hassan et al., 2020). A SARS-CoV-2 nucleocapsid (N)-specific primer and probe set was used: [L primer: ATGCTGCAATCGTGCTACAA (SEQ ID NO: 8); R primer: GACTGCCGCCTCTGCTC (SEQ ID NO: 9)]. Viral RNA was expressed as (N) gene copies per milligram on a log10 scale. For some samples, viral titers were determined by plaque assay on Vero E6 cells. Cytokine and chemokine mRNA measurements. RNA was extracted from lung homogenates, which were DNAse treated and used to synthesize cDNA using the High-Capacity cDNA Reverse Transcription kit (Thermo Scientific) with the addition of RNase inhibitor according to the manufacturer's protocol.Cytokine and chemokine expression was measured using TaqMan Fast Universal PCR Master Mix (Thermo Scientific) IFN-γ (IDT:Mm.PT.58.41769240), IL-6 (Mm.PT.58.10005566), IL-1β (Mm.PT.58.41616450), TNF-α (Mm.PT.58.12575861), CXCL10 (Mm.PT.58 .43575827), CCL2 (Mm.PT.58.42151692), CCL5 (Mm.PT.58.43548565), CXCL11 (Mm.PT.58.10773148.g), IFN-β (Mm.PT.58.30132453.g) and IFNγ-2 / 3 (Thermo Scientific Mm04204156_gH) using a commercially available primer / probe set specific for GAPDH (Mm.PT.39a.1) and results were normalized to GAPDH (Mm.PT.39a.1) levels. Fold changes are compared between treated mice and untreated controls. -ΔΔCt was determined using the method.

[0330] Peptide restimulation and intracellular cytokine staining: Splenocytes from intramuscularly vaccinated mice were incubated for 12 hours at 37°C in cultures containing a pool of 253 overlapping 15 amino acid long SARS-CoV-2 S peptides 4 hours before treatment with Brefeldin A (BioLegend, 420601). Following blocking with FcγR antibodies (BioLegend, clone 93), cells were stained on ice with CD45 BUV395 (BD BioSciences clone 30-F11); CD44 PE-Cy7, CD4 PE-Cy5, CD8b PreCP-Cy5.5 and CD19 APC-Cy7 (BioLegend clones IM7, GK1.5, YTS156.7.7 and 6D5, respectively) and Fixable Aqua Dead Cell Stain (Invitrogen, L34966). Stained cells were fixed and permeabilized with Foxp3 / Transcription Factor Staining Buffer Set (eBiosciences, 00-5523). Subsequent intracellular staining was performed with anti-IFN-γ Alexa 647 (BD Biosciences, clone XMG1.2), anti-TNFα BV605 (BioLegend, clone MP6-XT22) and anti-GrB PE (Invitrogen, GRB04). Lungs from intranasally immunized mice were harvested and digested for 1 h at 37°C in digestion buffer consisting of RPMI medium supplemented with (167 μg / ml) Liberase DH (Sigma) and (100 μg / ml) DNase I (Sigma). Lung cells were incubated with a pool of 253 overlapping 15 amino acid long SARS-CoV-2 S peptides described above at 37°C in the presence of Brefeldin A for 5 h at 37°C. Lung cells were then stained as described above, except that CD4-PE-Cy5 was replaced with CD4-BV421 (BioLegend clone GK1.5), CD19 staining was omitted, and CD103-FITC and CD69-BV711 (BioLegend clones 2E7 and H1.2F3, respectively) were added. Analysis was performed on a BD LSRFortessa X-20 cytometer using FlowJo X 10.0 software.

[0331] Flow cytometry-based antigen characterization: HEK-293T cells were transduced with ChAd-SARS-CoV-2-S for 24 h before cell transduction. 6 The cells were seeded at 10 cells / well in a 6-well plate (MOI, 5). After 20 h, cells were harvested, fixed, permeabilized using Foxp3 Transcription Factor Staining Buffer Set (Thermo Fisher) and stained for viral antigens after incubation with the following anti-SARS-CoV-2 neutralizing mouse mAbs: SARS2-01, SARS2-02, SARS2-07, SARS2-11, SARS2-12, SARS2-16, SARS2-18, SARS2-20, SARS2-21, SARS2-22, SARS2-23, SARS2-29, SARS2-31, SARS2-32, SARS2-34, SARS2-38, SARS2-39, SARS2-50, SARS2-55, SARS2-58, SARS2-66 and SARS2-71 (L. VanBlargan and M. Diamond, unpublished results). H77.39, an isotype-matched anti-HCV E2 mAb, was used as a negative control. Cells were washed, incubated with Alexa Fluor 647-conjugated goat anti-mouse IgG (Thermo Fisher) and analyzed by flow cytometry using a MACSQuant Analyzer10 (Miltenyi Biotec). The percentage of cells positive for a given mAb was compared to cells stained with a saturating amount of an oligoclonal mixture of anti-SARS-CoV-2 mAbs. [Example 2]

[0332] Intranasal vaccination confers durable protection against SARS-CoV-2 mutants in mice SARS-CoV-2 variants that attenuate antibody neutralization may jeopardize vaccine efficacy and the end of the COVID-19 pandemic. Example 1 shows the protective activity of a chimpanzee adenovirus-vectored vaccine based on the spike protein (ChAd-SARS-CoV-2-S) administered intranasally in a single dose in animals and advanced to human clinical trials. This example provides sustained, dose-responsive cross-protective activity in mice. A single intranasal dose of ChAd-SARS-CoV-2-S induced sustained, high neutralizing and Fc effector antibody responses in serum and S-specific IgG- and IgA-secreting long-lived plasma cells in bone marrow. Protection against historical SARS-CoV-2 strains was observed over a 100-fold vaccine dose range for 200 days. Six weeks or nine months after vaccination, serum antibodies neutralized SARS-CoV-2 strains bearing the B.1.351 and B.1.1.28 spike proteins and conferred almost complete protection in the upper and lower respiratory tract after challenge, demonstrating that in mice, intranasal immunization with ChAd-SARS-CoV-2-S provides sustained protection against historical and emerging SARS-CoV-2 strains.

[0333] The spike (S) protein of the SARS-CoV-2 virion is the primary target for antibody-based and vaccine countermeasures. The S protein acts as the initial viral attachment and entry factor to facilitate SARS-CoV-2 entry into human cells and associates with the cell surface receptor angiotensin-converting enzyme 2 (ACE2). The SARS-CoV-2 S protein is cleaved to yield S1 and S2 fragments, where the S1 protein contains the receptor binding domain (RBD) and the S2 protein facilitates membrane fusion and viral entry into the cytoplasm. The prefusion form of the SARS-CoV-2 S protein is recognized by potently neutralizing monoclonal antibodies or protein inhibitors.

[0334] Numerous vaccine candidates targeting the SARS-CoV-2 S protein have been developed using DNA plasmid, lipid nanoparticle-encapsulated mRNA, inactivated virion, protein subunit or viral vectored vaccine platforms. Several vaccines administered by intramuscular (IM) injection (e.g., Pfizer / BioNTech BNT162b2 and Moderna 1273 mRNA and Johnson & Johnson Ad26.COV2 and AstraZeneca ChAdOx1 nCoV-19 adenovirus platforms) have been granted emergency use authorization in many countries and hundreds of millions of doses have been given worldwide (covid19.who.int).

[0335] While vaccines administered by IM injection induce robust systemic immunity that protects against severe disease and mortality, questions remain as to their ability to curtail SARS-CoV-2 transmission, particularly upper respiratory tract infection. Indeed, numerous IM-administered vaccines have shown variable protection against upper respiratory tract infection and transmission in preclinical studies and failed to induce substantial mucosal (IgA) immunity. This challenge is significant given the emergence of more transmissible SARS-CoV-2 variants, including B.1.1.7, B.1.351 and B.1.1.28, which have substitutions in the spike protein. Experiments with pseudoviruses and standard SARS-CoV-2 strains also suggest that neutralization by vaccine-induced sera is reduced for variants expressing mutations in the spike gene at positions L452, E484 and elsewhere. Beyond the potential adverse effects on protection, the combination of reduced immunity to certain variants in the respiratory mucosa and naturally low anti-S IgG levels could create the conditions for further selection for resistance in the upper respiratory tract and transmission to the general population.

[0336] As described herein, a single-dose, intranasally (IN) delivered chimpanzee adenovirus (simian Ad-36)-based SARS-CoV-2 vaccine encoding a prefusion stabilized S protein (ChAd-SARS-CoV-2-S) elicited robust humoral, cell-mediated and mucosal immune responses and limited upper and lower respiratory tract infection in K18-hACE2 transgenic mice, hamsters and non-human primates. This vaccine, which has progressed into human clinical trials (BBV154, clinical trial NCT04751682), is distinct from ChAdOx1 nCoV-19, a SARS-CoV-2 vaccine based on chimpanzee Ad-23, currently approved for emergency use in several countries. Herein, as a further step to evaluate the potential utility of ChAd-SARS-CoV-2-S, we evaluated its dose response, durability and cross-protective activity, including its effect on upper and lower respiratory tract infection in mice. Approximately 9 months after IN immunization, neutralizing antibody and anti-S protein IgA levels in the sera of ChAd-SARS-CoV-2-S vaccinated animals remained high and prevented infection with SARS-CoV-2 strains bearing the B.1.351 and B.1.1.28 spike proteins. At this time point, susceptible K18-hACE2 transgenic mice were fully protected against upper and lower respiratory tract infection following challenge with SARS-CoV-2 viruses displaying the B.1.351 spike protein.

[0337] result Single ChAd-SARS-CoV-2-S immunization induces sustained anti-spike and neutralizing responses at various doses: dose-escalating ChAd-SARS-CoV-2-S (10 8 , 10 9 and 10 10 virus particles [vp]) or 10 10We evaluated the persistence of humoral immune responses in BALB / c mice 100 or 200 days after IM or IN immunization with vp ChAd control vaccine (Figure 10A). First, anti-S and anti-RBD IgG and IgA levels were measured by ELISA. Consistent with previous results, IN immunization with ChAd-SARS-CoV-2-S induced superior antibody responses than IM immunization or vaccination with ChAd control at 30, 100 or 200 days, 1 month after vaccination (Figures 10B-10M and Figure 11). Anti-S and anti-RBD specific binding IgG levels in serum were greater after IN than IM immunization at 100 or 200 days. 10 10 , 10 9 and 10 8 One hundred days after IN immunization with vp ChAd-SARS-CoV-2-S, the geometric mean titers (GMTs) of S-specific IgG responses were 1.1 × 10 6 , 4.8×10 5 and 2.6 × 10 5 and RBD-specific IgG was 3.2 × 10 5 , 1.8×10 5 and 8.7 × 10 4 (Fig. 10B). In comparison, 10 , 10 9 and 10 8 S- and RBD-specific IgG responses 100 days after IM immunization with vp ChAd-SARS-CoV-2-S showed an S-specific IgG titer of 2.1 × 10 5 , 1.1×10 5 and 4.5 × 10 4 and RBD-specific IgG titer of 5.1 × 10 4 , 2.9×10 4 , and 2.3 × 10 4 and RBD-specific IgG titers were 4- to 6-fold lower, respectively (P<0.0001) (Figure 10E). Similar dose responses were observed for S- and RBD-specific IgG titers 200 days after IN or IM immunization (Figures 10H and 10K). 10 , 10 9 and 10 8Twenty-two days after IN immunization with vp ChAd-SARS-CoV-2-S, the GMT of S-specific IgG was 2.8 × 10 6 , 2.4×10 6 and 1.2 × 10 6 and RBD-specific IgG was 1.1 × 10 6 , 6.1×10 5 and 3.2 × 10 5 (Figure 10H). 10 , 10 9 and 10 8 Twenty-two days after IM immunization with vp ChAd-SARS-CoV-2-S, the S-specific IgG GMT was 8.1 × 10 5 , 6.9×10 5 and 2.6 × 10 5 , RBD-specific IgG GMT was 1.4 × 10 5 , 1.3×10 5 and 8.0×10 4 (FIG. 10K). Thus, anti-S and anti-RBD IgG levels were higher after IN than IM immunization and continued to be elevated in serum even months after single-dose vaccination.

[0338] We next evaluated the induction and persistence of serum IgA responses. IM immunization failed to induce S- or RBD-specific IgA (Fig. 1F and L), whereas substantial levels of anti-S and RBD IgA were detected after IN immunization at 100 or 200 days after immunization (Fig. 1C and I). 100 days after IN immunization with 1010, 109, and 108 vp of ChAd-SARS-CoV-2-S, the GMTs for S-specific IgA were 4.8×103, 1.2×103, and 8.4×102, and for RBD-specific IgA were 2.2×103, 4.6×102, and 2.9×102, respectively (Fig. 1C). Similar to what was seen with IgG, IgA levels continued to increase over time such that 200 days after IN immunization with 10, 10, and 10 vp of ChAd-SARS-CoV-2-S, the GMTs for S-specific IgA were 1.1 × 10, 7.4 × 10, and 5.4 × 10, and for RBD-specific IgA were 5.2 × 10, 3.8 × 10, and 9.8 × 10, respectively (Figure 1I).

[0339] Next, functional correlates of serological responses were evaluated by assaying neutralizing activity using the focus reduction neutralization test (FRNT) (Figures 10D, 10G, 10J, 10M, and 11). As expected, no neutralizing activity was detected in sera from ChAd control-treated mice. 10 , 10 9 and 10 8 100 days after IN immunization with vp ChAd-SARS-CoV-2-S, the mean effective half-maximal inhibitory titers [EC50] were 39,449, 9,989, and 7,270, respectively (Figure 10D). 10 , 10 9 and 10 8 At this time point after IM immunization with vp ChAd-SARS-CoV-2-S, the EC50 values ​​were 8- to 20-fold lower at 4,988, 2,017, and 391, respectively (P < 0.0001) (Figure 10G). 10 , 10 9 and 10 8Consistent with high anti-S and RBD titers, 200 days after IN immunization with vp ChAd-SARS-CoV-2-S, EC50 values ​​were 45,591, 22,769, and 23,433, respectively (Figure 10J). 10 , 10 9 and 10 8 After 200 days of IM immunization with vp ChAd-SARS-CoV-2-S, the EC50 values ​​were even lower at 2,524, 940, and 716, respectively (Figure 10M).

[0340] Long-lived plasma cells (LLPCs) reside in the bone marrow and constitutively secrete high levels of antibodies that correlate with serum levels. 10 10 To assess the levels of antigen-specific LLPCs 200 days after IM or IN immunization with vp ChAd-SARS-CoV-2-S, CD138 + Cells were isolated from bone marrow and assayed for S-specific IgG or IgA production using an ELISPOT assay. We observed approximately four-fold higher frequency of LLPC secreting S-specific IgG after IN immunization than after IM immunization (Figure 10N). Additionally, more LLPC producing S-specific IgA were detected after IN immunization that were not present after IM immunization (Figure 10N). Furthermore, these data establish that: (a) single-dose IN immunization promotes better humoral immunity than IM immunization; (b) a 100-fold lower inoculum dose of ChAd-SARS-CoV-2-S induces robust neutralizing antibody responses in mice; (c) IN immunization, but not IM immunization, induces serum IgA responses and IgA-specific LLPC against SARS-CoV-2 S protein; and (d) humoral immunity induced by ChAd-SARS-CoV-2-S is durable and occurs for up to 6 months after vaccination.

[0341] IN vaccination of ChAd-SARS-CoV-2-S elicits broad antibody responses, including Fc effector function capabilities: To further characterize humoral responses, antibody binding to SARS-CoV-2 mutant proteins and Fc effector function were analyzed 90 days after IN or IM vaccination using sera from BALB / c mice. Our panel of SARS-CoV-2 proteins included spike (D614G, E484K, N501Y, Δ69-70, K417N) and RBD (E484K) antigens corresponding to WA1 / 2020, B.1.1.7, B.1.351, and B.1.1.28 strains. First, anti-SARS-CoV-2 specific antibody responses for several isotypes (IgG1, IgG2a, IgG2b, IgG3, IgM and IgA) and their ability to bind to Fcγ receptors (mouse FcγRIIB, FcγRIII, FcγRIV) were measured using the Luminex platform. In agreement with the data obtained by ELISA (Figure 10B and Figure 10E), IN vaccination with ChAd-SARS-CoV-2-S elicited higher levels of IgG1 against the D614G spike and WA1 / 2020 RBD proteins than IM immunization, and as expected, decreasing vaccine doses resulted in lower antibody titers (Figure 12A). Anti-SARS-CoV-2 IgG1 titers after IN immunization were also higher than after IM immunization against all spike and RBD mutants, and titers decreased with vaccine dose (Figure 12B). As shown in the heatmap, this trend was observed for all anti-SARS-CoV-2 specific antibody isotypes and correlated with the FcγR binding patterns (Figure 12C). These data suggest that IN vaccination induces greater and broader antibody subclass responses against SARS-CoV-2 than IM vaccination.

[0342] Antibody effector functions, such as opsonization, are mediated in part by Fcγ receptor engagement. To determine whether the observed differences in antibody titers and FcγR binding titers result in differences in effector functions, antibody-dependent neutrophil (ADNP) and cell-mediated phagocytosis (ADCP) assays were performed (Figures 12D-12E). Sera from IN-vaccinated mice stimulated substantially more ADNP than those obtained from IM-vaccinated mice. However, minor differences in ADCP were evident from antibodies induced after IN and IM vaccination (Figures 12D-12E). These data demonstrate that IN vaccination with ChAd-SARS-CoV-2-S elicits more and more functional antibody responses than after IM vaccination.

[0343] Intranasally administered ChAd-SARS-CoV-2-S induces durable protection against SARS-CoV-2 challenge in BALB / c mice: To evaluate the efficacy of the ChAd-SARS-CoV-2-S vaccine, immunized BALB / c mice given the dosing regimen described in Figure 10A were challenged with SARS-CoV-2. Viral challenge was preceded by intranasal introduction of Hu-Ad5-hACE2, which allows ectopic expression of hACE2 and productive infection of SARS-CoV-2 in BALB / c mice with historical SARS-CoV-2 strains. Animals were immunized for 10 min via the IN or IM route. 10 ChAd control or 10 in vp 8 , 10 9 Or 10 10 Mice were immunized once with ChAd-SARS-CoV-2-S vp. At 95 or 195 days post-vaccination, 8 Plaque-forming units (PFU) of Hu-Ad5-hACE2 and anti-Ifnar1 mAb were administered; the latter attenuates innate immunity and enhances pathogenesis in this model. Five days later, BALB / c mice were cultured with 5 × 10 4Mice were challenged via the IN route with focus-forming units (FFU) of SARS-CoV-2 (WA1 / 2020 strain). Lungs, spleens and hearts were harvested 4 days post-infection (dpi) from mice challenged 100 days post-immunization, and lungs, nasal turbinates and nasal washes were collected from a second cohort challenged 200 days post-immunization. Tissues were assessed for viral load by quantitative reverse transcription PCR (qRT-PCR) using primers against subgenomic RNA (N gene). IN immunization with all three doses induced significant protection 100 days post-vaccination as revealed by the virtual absence of viral RNA in lungs, spleen and heart compared to animals receiving the ChAd control vaccine (Figures 13A-13C). At 200 days post-immunization, the protection conferred by IN-delivered ChAd-SARS-CoV-2-S remained robust in the upper and lower respiratory tract compared to ChAd control-immunized mice. Nevertheless, the lowest 10% viral load was observed in the upper and lower respiratory tract compared to ChAd control-immunized mice. 8 In animals immunized with a vp dose of ChAd-SARS-CoV-2-S, limited infection breakthrough was observed in the lungs and nasal turbinates (Figures 13G and 13I). In comparison, protection after 100 days of IM immunization was less than after IN immunization at the same challenge time point. Viral RNA was not detectable in the heart and spleen (Figures 13E-13F), whereas at least 1,000- to 30,000-fold (P<0.0001) higher levels were measured in the lungs of mice immunized with ChAd-SARS-CoV-2-S by comparing the IM route with the IN route (Figures 13A and 13D). 8 A greater impact of dosing by the IM route was also observed, since the reduction in viral RNA load in the lungs with the vp dose was already different from that in ChAd control vaccinated mice (Figure 13D). After 200 days of IM immunization, a lower protection against SARS-CoV-2 infection was observed in the lungs, nasal washes and nasal turbinates than after IN immunization (Figures 13G-13L).

[0344] ChAd-SARS-CoV-2-S induces long-lasting immunity in hACE2 transgenic mice: We next evaluated the immunogenicity of ChAd-SARS-CoV-2-S delivered intranasally in K18-hACE2 C57BL / 6 mice, which are more vulnerable to SARS-CoV-2 infection than BALB / c mice. Five-week-old K18-hACE2 mice were injected with ChAd-SARS-CoV-2-S via the IN route for 10 min. 9 vp of ChAd control or ChAd-SARS-CoV-2-S. Serum samples were collected 6 weeks later to evaluate humoral immune responses. IN immunization with ChAd-SARS-CoV-2-S, but not ChAd control, elicited high levels of S- and RBD-specific IgG and IgA (Figures 14A-14B). Neutralizing antibody titers against WA1 / 2020 and two other SARS-CoV-2 strains harboring spike proteins from the B.1.351 and B.1.1.28 mutants were measured by FRNT assay (Figures 14C-14D and Figure 16). High levels of neutralizing antibodies against WA1 / 2020 were elicited after a single IN dose of ChAd-SARS-CoV-2-S (EC50 of 9,591). As seen with vaccine-induced human sera, reduced neutralizing titers were observed against Wash-B.1.351 (~5-fold, P<0.0001; Figure 14C) and Wash-B.1.1.28 (~3-fold, P<0.0001; Figure 4D) SARS-CoV-2 strains compared to WA1 / 2020. To assess the durability of humoral responses, separate cohorts of K18-hACE2 mice were immunized via the IN route and serum samples were collected at 9 months. ChAd-SARS-CoV-2-S induced high levels of S- and RBD-specific IgG and IgA as well as neutralizing antibodies against WA1 / 2020 (EC50 of 12,550) at this time point (Figures 14E-14H and Figure 16). When tested against Wash-B.1.351 and Wash-B.1.1.28 viruses, a decrease in neutralization titers was also observed compared to WA1 / 2020 (approximately 6- to 8-fold, P<0.05; Figures 14G-14H), although they remained high (EC50 of 1,627 and 1,918, respectively).

[0345] ChAd-SARS-CoV-2-S confers cross-protection to hACE2 transgenic mice against Wash B.1.351 and Wash-B.1.1.28 challenge: We examined the protective efficacy of ChAd-SARS-CoV-2-S against WA1 / 2020 and two chimeric viruses (Wash-B.1.351 and Wash-B.1.1.28) carrying spike genes corresponding to variants of concern (Figure 15A). Five-week-old K18-hACE2 mice were immunized with a single 10-fold dose via the IN route. 9 Mice were immunized with a vp dose of ChAd control or ChAd-SARS-CoV-2-S. Six weeks later, mice were immunized with 10 4 Mice were challenged with FFU of Wash-B.1.351, Wash B.1.1.28 or WA1 / 2020. All mice immunized with ChAd-SARS-CoV-2 showed no weight loss, while most ChAd control vaccinated mice experienced substantial weight loss from 3 to 6 dpi (Figure 15B, Figure 15G and Figure 15L). Strikingly, vaccination with ChAd-SARS-CoV-2-S resulted in almost no detectable SARS-CoV-2 RNA in the upper and lower respiratory tract, heart and brain at 6 dpi (Figure 15C-15F, Figure 15H-15K and Figure 15M-15O). As a further test of the durability of the cross-protective response, 5-week-old K18-hACE2 mice were immunized with a single 10-μL immunization via the IN route. 10 Mice were immunized with a vp dose of ChAd control or ChAd-SARS-CoV-2-S. Nine months later, mice were immunized with 10 4 FFU of Wash-B.1.351 were used to challenge mice. In contrast to ChAd control-treated mice, ChAd-SARS-CoV-2-S-vaccinated mice maintained their body weight (Figure 15P). Moreover, substantial virological protection was observed, as only trace amounts of Wash-B.1.351 SARS-CoV-2 RNA were detected in the upper and lower respiratory tract, heart, and brain in some mice (Figures 15Q-15T).

[0346] Consideration Persistence of vaccine-induced immune responses is important to provide sustained protection against SARS-CoV-2 infection and to curb the current pandemic. Herein, we show that a single IN immunization with ChAd-SARS-CoV-2-S elicited S- and RBD-specific binding and neutralizing antibodies that remained elevated for months, reminiscent of the maintenance of germinal center responses. LLPCs in bone marrow secreted SARS-CoV-2-specific IgG and IgA that were detected 6 months after IN vaccination and likely contributed to the persistent antiviral antibody levels in the circulation. In comparison, IM immunization with ChAd-SARS-CoV-2-S elicited lower levels of serum neutralizing antibodies, fewer spike-specific IgG-secreting LLPCs, and virtually no serum or cellular IgA responses. At least in mice, a single IN dose immunization with ChAd-SARS-CoV-2-S resulted in sustained humoral immunity that was observed over a 100-fold dose range. These preclinical immunogenicity results compare favorably with studies in humans using mRNA vaccines against SARS-CoV-2 that have demonstrated humoral immune responses lasting at least several months. In comparison, the durability of antibody responses following natural SARS-CoV-2 infection can be quite variable.

[0347] A single immunization with ChAd-SARS-CoV-2-S conferred durable protection against SARS-CoV-2 (WA1 / 2020 strain) challenge in hACE2-transduced BALB / c mice or K18-hACE2 transgenic C57BL / 6 mice at multiple time points throughout a 6-month period. Notably, IN immunization conferred virtually complete virological protection against upper and lower respiratory tract infection, with only limited infection breakthrough seen with 100-fold lower vaccine doses. The abrogation of infection in the upper respiratory tract suggests that IN vaccination can prevent transmission. In comparison, IM immunization reduced viral RNA levels in the lungs but showed substantially less protection against the homologous WA1 / 2020 strain in samples from the upper respiratory tract. Although numerous SARS-CoV-2 vaccine candidates from various platforms have demonstrated immunogenicity and protective efficacy in animal models, to our knowledge, none have established persistence or protection against mutant viruses. The long-term protection conferred by IN immunization even with a 100-fold lower inoculum dose is promising. If the results in mice are replicated, the dose-sparing strategy could allow for the production of large vaccine doses capable of curtailing SARS-CoV-2 infection and transmission.

[0348] The emergence of SARS-CoV-2 S variants (e.g., B.1.351 and B.1.1.28) with amino acid mutations in the receptor binding motif is of concern due to their resistance to the inhibitory activity of many neutralizing antibodies. Indeed, human sera from subjects vaccinated with BNT162b2 mRNA or ChAdOx1 nCoV-19 (AZD1222) vaccines show reduced neutralization against B.1.351. Of concern, IM-administered ChAdOx1 nCoV-19 (AZD1222) showed a mild to moderate reduction in protective efficacy against B.1.351 infection in humans. When we compared the immunogenicity of IN-delivered ChAd-SARS-CoV-2-S against chimeric SARS-CoV-2 strains expressing WA1 / 2020 and B.1.1.28 or B.1.351 spike proteins in K18-hACE2 transgenic mice, reduced neutralization of mutant viruses (3- to 8-fold) was observed, even though titers remained >1,000. Six weeks after IN immunization with ChAd-SARS-CoV-2-S, K18-hACE2 mice were fully protected against weight loss and infection of the upper and lower respiratory tract and brain by WA1 / 2020, Wash-B.1.351 and Wash-B.1.1.28. Remarkably, in a separate cohort of K18-hACE2 mice challenged 9 months after a single IN immunization, animals were fully protected against Wash-B.1.351 challenge. Although correlates of protection have not been fully established for SARS-CoV-2 vaccines, high levels of cross-neutralizing antibodies against mutant viruses are associated with robust virus-specific systemic and mucosal CD8 + Combined with T cell responses, this may contribute to protection. Beyond this, antibody effector functions may also contribute to prevent SARS-CoV-2 infection and disease. Indeed, enhanced Fc effector functions against SARS-CoV-2 mutant proteins were observed in sera from IN-delivered ChAd-SARS-CoV-2-S, including robust induction of ADNP and ADCP responses.

[0349] In summary, this example shows that IN immunization with ChAd-SARS-CoV-2-S elicits robust, persistent binding IgG and IgA antibody, neutralizing antibody, Fc effector function, and LLPC responses against SARS-CoV-2. In mice, a single IN immunization with ChAd-SARS-CoV-2-S confers cross-protection against SARS-CoV-2 strains displaying spike proteins corresponding to the B.1.351 and B.1.1.28 variants, even 9 months after vaccination. Given the efficacy of preclinical evaluations in multiple animal models30,31,32 and the persistent protective immunity against variants of concern, IN delivery of ChAd-SARS-CoV-2-S is a promising platform for preventing SARS-CoV-2 infection and inhibiting transmission.

[0350] method Viruses and cells: Vero E6 (CRL-1586, American Type Culture Collection (ATCC), Vero-TMPRSS2 57, Vero (CCL-81, ATCC) and HEK293 (CRL-1573, ATCC) cells were cultured at 37°C in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES pH 7.3, 1 mM sodium pyruvate, 1X non-essential amino acids and 100 U / ml penicillin-streptomycin. Vero-TMPRSS2 cells were also supplemented with 5 μg / mL blasticidin.

[0351] SARS-CoV-2 strain 2019 n-CoV / USA_WA1 / 2020 (WA1 / 2020) was obtained from the Centers for Disease Control and Prevention. Viruses were passaged once in Vero CCL81 cells and titrated in Vero E6 cells by focus-forming assay (FFA). Wash-B.1.351 and Wash-B.1.1.28 chimeric viruses carrying mutant spike genes were previously described. All viruses were passaged in Vero-TMPRSS2 cells and subjected to next-generation sequencing to confirm the introduction and stability of substitutions. All virus experiments were performed in an approved biosafety level 3 (BSL-3) facility.

[0352] Mouse experiments: Animal studies were performed in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Protocols were approved by the Institutional Animal Care and Use Committee of the Washington University School of Medicine (certification number A3381-01). Virus inoculations were performed under anesthesia induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering.

[0353] Female BALB / c (cat. 000651) and K18-hACE2 C57BL / 6 (cat. 034860) mice were purchased from The Jackson Laboratory. Animals aged 4 to 5 weeks were injected with 10 10 vp ChAdV control or 10 8 , 10 9 Or 10 10 Vaccinated BALB / c mice (10 to 11 weeks old) were immunized with ChAd-SARS-CoV-2-S from 10 to 15 days after vaccination with a single intraperitoneal injection of 2 mg of anti-Ifnar1 mA (MAR1-5A3 59 (Leinco)) for 10 min. 81 day before IN administration of PFU of Hu-Ad5-hACE2 37. Five days after Hu-Ad5-hACE2 transduction, mice were given 4 × 10 5 K18-hACE2 mice were inoculated with FFU of WA1 / 2020 SARS-CoV-2 via the IN route. 4 Animals were challenged via the IN route with FFU of SARS-CoV-2 (WA1 / 2020, Wash-B.1.351 or Wash-B.1.1.28). Animals were euthanized 6 dpi and tissues were harvested for virological analysis.

[0354] Chimpanzee and human adenoviral vectors: ChAd-SARS-CoV-2 and ChAd-control vaccine vectors were derived from the simian Ad36 backbone60, construction and validation are described herein. Rescued replication-incompetent ChAd-SARS-CoV-2-S and ChAd-control vectors were scaled up in HEK293 cells and purified by CsCl density gradient ultracentrifugation. Viral particle concentrations in each vector preparation were determined by spectrophotometry at 260 nm. Hu-AdV5-hACE2 vectors were also described above and produced in HEK293 cells. Viral titers were determined by plaque assay in HEK293 cells.

[0355] SARS-CoV-2 Neutralization Assay: Heat-inactivated serum samples were serially diluted to 10 2The cells were incubated with FFU of different SARS-CoV-2 strains for 1 h at 37 °C. The virus-serum mixture was added to Vero cell monolayers in 96-well plates and incubated for 1 h at 37 °C. The cells were then overlaid with 1% (w / v) methylcellulose in MEM supplemented with 2% FBS. The plates were incubated for 30 h before fixation with 4% PFA in PBS for 1 h at room temperature. The cells were then washed and incubated successively with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57 and SARS2-71 62 anti-S antibodies, and HRP-conjugated goat anti-mouse IgG (Sigma, 12-349) in PBS supplemented with 0.1% (w / v) saponin and 0.1% bovine serum albumin. TrueBlue peroxidase substrate (KPL) was used to develop the plates before counting foci on a BioSpot analyzer (Cellular Technology Limited).

[0356] Protein expression and purification: Cloning and production of purified S and RBD proteins corresponding to the WA1 / 2020 SARS-CoV-2 strain were previously described. Briefly, prefusion stabilized S and RBD were cloned into a pCAGGS mammalian expression vector containing a hexahistidine tag and transiently transfected into Expi293F cells. Proteins were purified by cobalt-charged resin chromatography (G-Biosciences).

[0357] ELISA: Purified antigen (S or RBD) was coated onto 96-well Maxisorp clear plates at 2 μg / mL in 50 mM Na2CO3 pH 9.6 (70 μL) overnight at 4°C. Coating buffer was aspirated and wells were blocked with 200 μL of 1X PBS + 0.05% Tween-20 + 1% BSA + 0.02% NaN3 (blocking buffer, PBSTBA) overnight at 4°C. Heat-inactivated serum samples were diluted in PBSTBA in separate 96-well polypropylene plates. Plates were then washed 3 times with 1X PBS + 0.05% Tween-20 (PBST) followed by the addition of 50 μL of each serum dilution. Serum was incubated in the blocked ELISA plates for at least 1 hour at room temperature. The ELISA plates were again washed three times in PBST, followed by the addition of 50 μL of 1:1,000 anti-mouse IgG-HRP in PBST (Southern Biotech Catalog No. 1030-05) or 1:1000 anti-mouse IgA-HRP in PBSTBA (SouthernBiotech). The plates were incubated for 1 h at room temperature, washed three times in PBST, and then 100 μL of 1-Step Ultra TMB-ELISA was added (ThermoFisher Catalog No. 34028). Following a 10-12 min incubation, the reaction was stopped with 50 μL of 2 M sulfuric acid. Optical density (450 nm) readings were determined using a microplate reader (Bio-Rad).

[0358] ELISPOT assay: To quantify S-specific plasma cells in bone marrow, femurs and tibias were ground in RPMI 1640 using a mortar and pestle, filtered through a 100 μm strainer, and subjected to ACK lysis. + Cells were enriched by positive selection and magnetic beads according to the manufacturer's instructions (EasySep Mouse CD138 Positive Selection, STEMCELL). +Cells were incubated overnight in RPMI 1640 supplemented with 10% FBS in MultiScreen-HA Filter Plates (Millipore) precoated with SARS-CoV-2 S protein. Following sequential incubation with anti-mouse IgG-biotin or anti-mouse IgA-biotin and streptavidin-HRP, foci were developed using TruBlue substrate (KPL). Plates were imaged using a BioSpot instrument and foci were counted manually.

[0359] Measurement of viral load: SARS-CoV-2-infected mice were euthanized using a ketamine and xylazine cocktail and organs were collected. Tissues were weighed and bead-homogenized using a MagNA Lyser (Roche) in 1 ml of Dulbecco's modified Eagle's medium (DMEM) containing 2% fetal bovine serum (FBS). RNA was extracted from clarified tissue homogenates using the MagMax mirVana Total RNA Isolation Kit (Thermo Scientific) and KingFisher Flex extraction system (Thermo Scientific). SARS-CoV-2 RNA levels were measured by one-step quantitative reverse transcriptase PCR (qRT-PCR) TaqMan assay as previously described37. SARS-CoV-2 nucleocapsid (N)-specific primer and probe sets were used as described above. Viral RNA was expressed as (N) gene copies per milligram on a log10 scale.

[0360] Luminex analysis: Luminex analysis was performed as previously described. Briefly, proteins (spike: D614G, E484K, N501Δ69-70, K417N, B.1.1.7, B.1.351; receptor binding domain (RBD) (ImmuneTech): WT, E484K, B.1.1.7, B.1.351, B.1.128) were carboxy-coupled to magnetic Luminex microplex carboxylated beads (Luminex Corporation) using NHS-ester linkage with Sulfo-NHS and EDC (Thermo Fisher) and then incubated with serum (IgG1, FcγRIIb, FcγRIII 1:3000; IgG2a, G2b, G3, A, FcγRIV 1:1000, IgM 1:500) for 2 hours at 37°C. Isotype analysis was performed by incubating immune complexes with secondary goat anti-mouse-PE antibodies for each isotype (IgG1 1070-09, IgG2a 1080-09S, IgG2b 1090-09S, IgG3 1100-09, IgM 1020-09, IgA 1040-09 Southern Biotech). FcγR binding was quantified by incubating immune complexes with biotinylated FcγRs (FcγRIIB, FcγRIII and FcγRIV, kindly provided by Duke Protein Production Facility) conjugated to streptavidin-PE (Prozyme). Flow cytometry was performed using IQue (Intellicyt) and analysis was performed with IntelliCyt ForeCyt (v8.1).

[0361] Antibody-dependent neutrophil or cellular phagocytosis: Antibody-dependent neutrophil phagocytosis (ADNP) and cellular phagocytosis (ADCP) assays were performed as previously described. Briefly, spike proteins were carboxyl-coupled to blue, yellow-green or red FluoSphere™ carboxylic acid-modified microspheres, 0.2 μm (ThermoFisher) using NHS-ester linkage with Sulfo-NHS and EDC (Thermo Fisher). Spike-coated beads were incubated with diluted serum (1:150 ADNP, 1:100 ADCP) for 2 h at 37°C. For ADNP assays, bone marrow cells were collected from BALB / c mice and red blood cells were subjected to ACK lysis. The remaining cells were washed with PBS and aliquoted into 96-well plates (5 × 10 cells per well). 4 The bead-antibody complex was added to the cells and incubated for 1 hour at 37°C. After washing, the cells were stained with the following antibodies: CD11b APC (BioLegend 101212), CD11c A700 (BioLegend 117320), Ly6G Pacific Blue (127628), Ly6C BV605 (BioLegend 128036), Fcblock (BD Bioscience 553142) and CD3 PE / Cy7 (BioLegend 100320). The cells were fixed with 4% PFA and treated with BD LSRFortessa (BD Biosciences). Neutrophils were stained with CD3 - , CD11b + , Ly6G +Neutrophil phagocytosis score was calculated as (%FITC+) × [geometric mean of FITC fluorescence intensity] / 10000. For the ADCP assay, J774A.1 (ATCC TIB-67) mouse monocyte cells were incubated with spike-coated bead-antibody conjugates for 1 h at 37°C. Cells were washed with 5 mM EDTA PBS, fixed with 4% PFA, and analyzed on a BD LSRFortessa (BD Biosciences). Cellular phagocytosis score was calculated as (%FITC+) × (geometric mean of FITC fluorescence intensity) / 10000. [Example 3]

[0362] Expression of SARS-CO-V2 spike gene (BA.5) mutants from CHAD vectors Adenoviral vectors (bivalent) containing the S6P and S6PdF mutants of SAR-CoV2-Omicron-BA.5 were constructed and tested for expression as previously discussed in the construction of chimpanzee adenoviral vectors. These constructs are designated ChAd.BA.5-S6P and ChAd.BA.5-S6PdF, respectively. Monolayers of human A549 cells were inoculated with 3×10 3vp / cell were infected with the newly generated ChAd.BA.5-S6P (derived from the omicron mutant BA.5 and containing S6P) and ChAd.BA.5-S6PdF vectors, or with the ChAd-SARS-CoV-2-S (WA1 / 2020-S2P) and ChAd.BA.1-S6PdF vectors, or with a ChAd vector carrying no transgene. Expression of the SARS-CoV-2 spike gene was detected 48 h postinfection by flow cytometry using a cocktail of primary mAbs binding to different epitopes of the spike glycoprotein. As provided in FIG. 18, infection with the ChAd.BA.5-S6P and ChAd.BA.5-S6PdF vectors resulted in 90% and 92% of cells expressing the spike gene, respectively, which is very close to the expression levels achieved by ChAd-SARS-CoV-2-S(WA1 / 2020-S2P) (93%) and ChAd.BA.1-S6PdF (96%). Infection with the ChAd negative control showed a background expression level of 5%, similar to control uninfected cells (4.2%) incubated with Alexa Fluor 594-conjugated F(ab')2 fragments of primary and secondary donkey anti-mouse IgG. These data suggest that both the ChAd.BA.5-S6P and ChAd.BA.5-S6PdF vectors induce efficient spike expression and result in a robust immune response comparable to that achieved by the ChAd-SARS-CoV-2-S and ChAd.BA.1-S6PdF vaccine vectors. [Example 4]

[0363] Intranasal vaccination with CHAD-Wuhan-S and CHAD.BA.5-S or CHAD-bivalent confers sustained protection against SARS-CoV-2 variants in mice. Ch-Ad-control, ChAD-Wuhan-S, ChAd-BA.5, and ChAD-bivalent intranasal vaccines were tested for their efficacy in vivo using the methods provided herein. Figure 23 provides an alignment of the relevant S protein sequences. Figure 19A provides a schematic of the timing of vaccination, blood sampling, virus challenge, and autopsy. In early experiments, binding of anti-SARS-CoV-2 IgG (Figures 19B, 19D, 19F) or IgA (Figures 19C, 19E, 19G) to SARS-CoV-2 Wuhan-1 (Figures 19B-C), BA.5 (Figures 19D-E), or BQ.1.1 (Figures 21F-G) S proteins was tested. Intranasal immunization with bivalent ChAd-CoV-2 S(Wuhan) and ChAd-CoV-2-S(BA.5) provided a greater breadth of IgA and IgG responses against the Wuhan-1, BA.5, and BQ.1.1 spike proteins compared with the respective monovalent vaccine components, based on ELISA testing with sera obtained 28 days after vaccination.

[0364] Next, the neutralizing activity of intranasal immunization with Ch-AD-control, ChAD-Wuhan-S, ChAd-BA.5, and ChAD-bivalent against WA1 / 2020 was tested using FRNT. Figure 20A shows the neutralizing activity of FRNT against WA1 / 2020. Figure 20B shows the neutralizing activity of FRNT against BA.5. Figure 20C shows the neutralizing activity of FRNT against BF.7. Figure 20D shows the neutralizing activity of FRNT against BQ.1.1. Figure 20E shows the neutralizing activity of FRNT against XBB.1.1. Each point represents data from an individual mouse and is the average of two technical replicates. Figures 20F-H show neutralization data plotted as a head-to-head comparison for a given vaccine (ChAd-SARS-CoV-2 S(Wuhan-1, Figure 20F), ChAd-SARS-CoV-2-S(BA.5, Figure 20G), or bivalent (ChAd-SARS-CoV-2 S(Wuhan-1)+ChAd-SARS-CoV-2-S(BA.5), Figure 20H) against the indicated SARS-CoV-2 strain used for infection.

[0365] The data provided show that intranasal immunization with bivalent ChAd-CoV-2 S(Wuhan) and ChAd-CoV-2-S(BA.5) provided greater serum neutralizing antibody responses against Wuhan-1, BA.5, and BQ.1.1 viruses than the respective monovalent vaccines.

[0366] Finally, we analyzed viral RNA levels in the lungs (Figure 21A), nasal turbinates (Figure 21B), and nasal washes (Figure 21C) 6 dpi after challenge with SARS-CoV-2 WA1 / 2020 D614G (left) or Omicron BQ.1.1 (right). Intranasal immunization with bivalent ChAd-CoV-2 S(Wuhan) and ChAd-CoV-2-S(BA.5) provided greater protection against lung infection with WA1 / 2020 D614G and BQ.1.1 viruses than the respective monovalent vaccines. This corresponded with improved protection against lung inflammation and as measured by cytokine levels (Figure 22).

[0367] Equivalent Although several inventive embodiments have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing the functions and / or obtaining the results and / or one or more advantages described herein, and each such change and / or modification is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the specific application or applications in which the teachings of the present invention are used. Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific inventive embodiments described herein. Thus, it will be understood that the foregoing embodiments are presented only by way of example, and that within the scope of the appended claims and their equivalents, the inventive embodiments may be practiced other than as specifically described and claimed. The inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more of such features, systems, articles, materials, kits and / or methods is included within the inventive scope of the present disclosure, unless such features, systems, articles, materials, kits and / or methods are mutually inconsistent.

[0368] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may include the entire document.

[0369] The phrase "and / or" as used herein in the specification and claims should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjointly present in some cases and non-conjointly present in other cases. Multiple elements listed with "and / or" should be interpreted in a similar manner, i.e., "one or more" of the elements so conjoined. Other elements may be present other than the elements specifically identified by the "and / or" clause, whether or not related to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and / or B", when used in conjunction with an open-ended term such as "comprising", may refer in one embodiment to only A (which may include elements other than B); in another embodiment to only B (which may include elements other than A); in yet another embodiment to both A and B (which may include other elements); and so forth.

[0370] As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and / or" defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as being inclusive, i.e., the inclusion of not only at least one of a number or list of elements, but also more than one, and additional items not listed as appropriate. Only when the term clearly indicates otherwise, e.g., "only one of" or "exactly one of" or, when used in the claims, "consisting of", refers to the inclusion of exactly one element of a number or list of elements. In general, as used herein, the term "or" should be interpreted as indicating exclusive alternatives (i.e., "one or the other, but not both") only when preceded by an exclusive term, e.g., "either," "one of," "only one of," or "exactly one of." When used in the claims, "consisting essentially of" should have its ordinary meaning as used in the field of patent law.

[0371] As used herein in the specification and in the claims, the phrase "at least one" referring to a list of one or more elements should be understood to mean at least one element selected from any one or more elements in the list of elements, but not necessarily including at least one of each and every element specifically listed in the list of elements, and not excluding any combination of elements in the list of elements. This definition allows for elements to be present other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether or not related to the specifically identified elements. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B" or, equivalently, "at least one of A and / or B") can refer, in one embodiment, to at least one, and optionally more than one, A, in the absence of B (and optionally including elements other than B); in another embodiment, to at least one, and optionally more than one, B, in the absence of A (and optionally including elements other than A); in yet another embodiment, to at least one, and optionally more than one, A, and at least one, and optionally more than one, B (and optionally including other elements); etc.

[0372] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. As used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural references unless the context clearly indicates otherwise. References to "or" in this specification are intended to include "and / or" unless otherwise stated.

Claims

1. A composition comprising a first adenoviral vector comprising the genome of a non-human adenovirus encoding a SARS-CoV-2 spike (S) protein, an immunogenic portion or fragment thereof, comprising an amino acid sequence at least 80% identical to SEQ ID NO:

20.

2. The composition of claim 1 , wherein the non-human adenovirus is a simian adenovirus (SAdV).

3. 3. The composition of claim 1 or 2, comprising a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:

18.

4. 2. The composition of claim 1, wherein the spike protein of the first adenoviral vector is a prefusion stabilized spike protein.

5. 5. The composition of claim 4, wherein the pre-fusion stabilized spike protein comprises six proline substitutions in the S2 domain of the spike protein.

6. 10. The composition of claim 1 or 4, wherein the spike protein of the first adenoviral vector further comprises a disruption of the S1 / S2 furin cleavage site.

7. 7. The composition of claim 6, wherein the disruption further comprises a substitution of RRARS with GSASS at the S1 / S2 furin cleavage site.

8. 10. The composition of claim 1, further comprising a second adenoviral vector encoding a SARS-CoV-2 spike (S) protein, an immunogenic portion or fragment thereof, comprising an amino acid sequence at least 80% identical to SEQ ID NO:

3.

9. The composition of claim 8, wherein the second adenoviral vector comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:

2.

10. 9. The composition of claim 8, wherein the first and second adenoviral vectors have a functional deletion of the E1 gene and optionally a functional deletion of the E3 or E3B gene.

11. (a) a first adenoviral vector encoding a SARS-CoV-2 spike protein, an immunogenic portion or fragment thereof, comprising an amino acid sequence at least 80% identical to SEQ ID NO: 20 or 21; (b) a second adenoviral vector encoding a SARS-CoV-2 spike (S) protein comprising an amino acid sequence at least 80% identical to SEQ ID NO:3, or an immunogenic portion or fragment thereof.

12. (a) the first adenoviral vector comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 18 or 19; 12. The composition of claim 11, wherein (b) the second adenoviral vector comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:

2.

13. The composition of claim 8 or 11, wherein at least one of the first and second adenoviral vectors is a simian adenoviral vector.

14. The composition of claim 13, which is chimpanzee adenoviral vector 36.

15. 12. The composition of any one of claims 1, 8, and 11, further comprising a pharmaceutically acceptable carrier, diluent, excipient, or adjuvant.

16. 16. The composition of claim 15, formulated for intranasal or intramuscular administration.

17. A composition comprising the adenoviral vector of any one of claims 1, 8, and 11 for inducing an immune response against coronavirus or for treating or preventing coronavirus infection.

18. The composition of claim 17, wherein the pharmaceutical composition is administered intranasally.

19. 18. The composition of claim 17, wherein the pharmaceutical composition is administered intramuscularly.

20. 20. The composition of claim 17, further comprising one or more additional administrations of the composition.

21. 18. The composition of claim 17, wherein the coronavirus is SARS-CoV-2 virus or a mutant thereof.

22. 22. The composition of claim 21, wherein the coronavirus is an alpha, beta, gamma, delta, or omicron variant or a subvariant thereof.

23. 22. The composition of claim 21, wherein the coronavirus is an Omicron strain or a subvariant thereof.

24. A kit comprising a composition comprising a first adenoviral vector encoding a SARS-CoV-2 spike protein, an immunogenic portion or fragment thereof, comprising an amino acid sequence at least 80% identical to SEQ ID NOs: 20, 21.

25. 25. The kit of claim 24, further comprising a second adenoviral vector encoding a SARS-CoV-2 spike protein, an immunogenic portion or fragment thereof, comprising an amino acid sequence at least 80% identical to SEQ ID NO:

3.

26. 25. The kit of claim 24, wherein the first adenoviral vector comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:18 or SEQ ID NO:

19.

27. 26. The kit of claim 25, wherein the second adenoviral vector comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:2.

Images