Methods for identifying proximal effector polypeptides and uses thereof - Patents.com

Abstract

Disclosed herein is a method for identifying a near effector polypeptide, the method comprising the steps of: transducing a plurality of cells with an ORFeome library, the ORFeome library encoding a plurality of ORFs, each of which is fused to a targeting moiety that directly or indirectly binds to, or can be induced to bind to, a target polypeptide; expressing the plurality of ORFs of the ORFeome library in the plurality of transduced cells under conditions for the targeting moiety to interact with the target polypeptide; and determining whether any of the plurality of ORFs is a near effector polypeptide by measuring abundance, wherein an ORF encodes a near effector polypeptide if the ORF increases or decreases the abundance of the target polypeptide compared to a control, or is depleted or increased in the plurality of transduced cells compared to a control.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 331,078, filed April 14, 2022, the contents of which are incorporated herein by reference in their entirety.

[0002] Incorporating sequence tables The computer readable form of the sequence listing "2223-P67134PC00_Sequence_Listing" (37,186 bytes), created on April 13, 2023, is incorporated by reference into this specification.

[0003] Field The present disclosure relates to proximity effectors, e.g., for targeted protein degradation and stabilization, and in particular to methods for identifying proximity effector polypeptides and using those proximity agents in screens and methods, e.g., for targeted protein degradation or stabilization. [Background technology]

[0004] background Targeted protein degradation (TPD) has emerged as one of the most promising innovations in drug discovery (Burslem and Crews, 2020). The idea of ​​TPD is to selectively induce the degradation of a target protein, rather than simply inhibiting or activating the target. TPD can be delivered by heterobifunctional molecules known as PROteolysis-TArgeting Chimeras (PROTACs) or “molecular glues”. PROTACs consist of two covalently linked protein-binding moieties, one that binds to the target protein and the other that binds to an E3 ubiquitin ligase, bringing the target protein in close proximity to the ligase. This allows the target protein to be ubiquitinated and subsequently undergoes proteasome-dependent degradation. Molecular glues work in a similar way, but they directly contact both the E3 ligase and the target protein, inducing a non-native protein / protein interaction, leading to the degradation of the target.

[0005] The concept of PROTACs and molecular glues exploits the promiscuity of many (but not all) E3 ligases, whose substrate specificity is determined mostly by their physical proximity to the substrate, rather than by intrinsic features of the substrate. TPDs have several advantages over traditional small molecule inhibitors, including increased drug potency, as one molecule can degrade multiple protein molecules. In addition, they can target any druggable domain of a protein, not just the enzymatically active domain, thus expanding the target space for small molecules.

[0006] Despite the high therapeutic potential of PROTACs and molecular glues, a major barrier in their development is that only a handful of known E3 ligases have been used in this approach. Indeed, current glues and PROTACs only utilize two E3s (i.e., E3 ligases), namely, the thalidomide target cereblon (CRBN) and the tumor suppressor VHL. Compounds utilizing these two E3s are quite challenging, as they act on some target proteins but not others in a highly unpredictable manner. Identifying novel proteins that can act more robustly and predictably would remove this obstacle in the development of novel degraders and facilitate drug discovery in many therapeutic areas.

[0007] Although many groups are actively attempting to characterize E3 ligases suitable for the development of PROTACs and molecular glues, most approaches rely on a limited number of E3s that have been well characterized to date, rather than the full range of over 600 ubiquitin ligases in the human genome (Burslem and Crews, 2020). Furthermore, this may be an underestimate, as annotation of E3s is based on characteristic protein domains (e.g., RING finger, F-box) rather than molecular function. For example, kinases, G proteins, and metabolic enzymes may also function as substrate adaptors for E3s and other ubiquitin-modifying complexes. Many other unexpected proteins that functionally act as E3s exist, potentially expanding the toolkit for targeted protein degradation.

[0008] It is also possible that other protein quality control pathways can be exploited. Protein turnover is controlled by multiple other mechanisms, including selective macroautophagy, mitophagy, chaperone-mediated autophagy, general proteases, and even extracellular secretion. Their specificity is in part regulated by receptors that determine the fate of substrate proteins, making them potential routes for targeted protein degradation. However, these pathways remain to be fully elucidated.

[0009] More broadly, induced proximity-based therapeutics are not limited to protein degradation. Indeed, much of biology is driven by dynamically coupled protein / protein interactions, and many natural compounds, such as plant hormones, function by inducing specific protein / protein interactions (Gerry and Schreiber, 2020). Thus, compounds that rewire protein / protein interactions have great potential in next-generation therapeutics. Indeed, several proof-of-concept studies have shown the potential to induce protein stabilization by deubiquitinating enzymes (DUBTACs), protein dephosphorylation by phosphatases (PhoRCs), and autophagy-inducing compounds by AUTACs (Henning et al., 2021; Takahashi et al., 2019; Yamazoe et al., 2020). Summary of the Invention [Problem to be solved by the invention]

[0010] However, one of the major obstacles to developing inductive proximity drugs is the “protein-pair problem”: if one wants to modulate the function of a target, how do one identify the ideal effector protein, given that there are more than 600 E3 ligases, more than 500 kinases, more than 100 deubiquitinases, and thousands of other proteins that may have beneficial functional outcomes? [Means for solving the problem]

[0011] overview Provided herein are polypeptide proximity effectors that promote the degradation or stabilization of target proteins in a proximity-dependent manner.

[0012] One aspect of the disclosure is a method for identifying a near effector polypeptide, comprising: transducing a plurality of cells with an ORFeome library, said ORFeome library encoding a plurality of ORFs, each of said ORFs fused to a targeting moiety that can bind, or be induced to bind, directly or indirectly to a target polypeptide; expressing a plurality of ORFs of said ORFeome library in said plurality of transduced cells under conditions for said targeting moiety to interact with said target polypeptide; and determining whether any of said ORFs is a proximal effector polypeptide by measuring the abundance, optionally total abundance, cell surface abundance or intracellular abundance, of said target polypeptide in cells expressing any of said ORFs compared to a control, and / or detecting whether any of said ORFs is depleted or increased in said transduced cells compared to a control. Including, said plurality of transduced cells recombinantly express said target polypeptide, and optionally express a first fluorescent polypeptide, said target polypeptide being a second fluorescent polypeptide, an endogenous protein, or a fusion polypeptide fused to a second fluorescent polypeptide epitope tag, an antibiotic resistance protein, and / or a negative selection marker; The ORF includes methods where the ORF encodes a proximity effector polypeptide, where the ORF increases or decreases the abundance of said target polypeptide compared to a control, or is depleted or increased in said plurality of transduced cells compared to a control.

[0013] In some embodiments, measuring the abundance of a target polypeptide comprises i) determining whether the target polypeptide expressed in said plurality of cells is decreased or increased (e.g., in total abundance or in a subcellular fraction) compared to a control, or ii) determining whether any of said plurality of ORFs increases cell surface levels of a target polypeptide compared to a control.

[0014] In some embodiments, the proximity effector polypeptide is a degrader of the target polypeptide if the target polypeptide is decreased compared to the control, or a stabilizer of the target polypeptide if the target polypeptide is increased compared to the control. In some embodiments, the proximity effector polypeptide is a lethal polypeptide if it is depleted or decreased in the plurality of transduced cells compared to the control, or a growth-inducing polypeptide if it is increased in the plurality of transduced cells. In some embodiments, the proximity effector polypeptide is a protein transporter polypeptide if the proximity effector increases cell surface levels of the target polypeptide compared to the control.

[0015] In some embodiments, the target polypeptide is a second fluorescent polypeptide or is fused to a second fluorescent polypeptide, and determining comprises isolating a fraction of said plurality of cells having a selected second fluorescent polypeptide:first fluorescent polypeptide ratio and sequencing one or more of the plurality of ORFs in the fraction; if the target polypeptide is fused to an epitope tag, determining comprises measuring the abundance of the target polypeptide using an epitope tag binding protein, optionally an antibody; if the target polypeptide is an endogenous target, determining comprises measuring the abundance of the target polypeptide using a target polypeptide binding protein, optionally an antibody. determining the abundance, optionally total abundance, cell surface abundance or intracellular abundance, of the target polypeptide using an antibody; if the target polypeptide is fused to an antibiotic selection protein, determining comprises isolating a fraction of said plurality of cells that survived antibiotic treatment and sequencing one or more of the ORFs in the fraction; or if the target polypeptide is fused to a negative selection marker, optionally thymidine kinase, determining comprises isolating a fraction of said plurality of cells that survived negative selection treatment and sequencing one or more of the ORFs in the fraction.

[0016] In some embodiments, the plurality of cells is a cell line, and the method further comprises generating the cell line by introducing a nucleic acid encoding a target polypeptide and, optionally, a first fluorescent polypeptide, optionally in a construct comprising an IRES or cleavage site therebetween. In some embodiments, the ratio of the second fluorescent polypeptide to the first fluorescent polypeptide is determined using a method comprising flow cytometry. In some embodiments, the first or second fluorescent polypeptide is RFP, YFP, mCherry, mCitrine, mNeonGreen, mScarlet, BFP and / or GFP. In some embodiments, the first fluorescent polypeptide is GFP and the second fluorescent polypeptide is BFP, or the first fluorescent polypeptide is BFP and the second fluorescent polypeptide is GFP. In some embodiments, the target polypeptide is fused to an antibiotic resistance protein or a negative selection marker. In some embodiments, the negative selection marker is thymidine kinase, mutant deoxycytodine kinase or thymidylate kinase. In some embodiments, the negative selection marker is thymidine kinase, and the method comprises treating the plurality of cells with ganciclovir during the step of expressing a plurality of ORFs of the ORFeome library under conditions for the targeting moiety to interact with the target polypeptide, and survival of the cells upon exposure to ganciclovir indicates reduced levels of the target polypeptide.

[0017] In some embodiments, the ORF identified in the cells that survive antibiotic treatment is a proximal effector polypeptide. In some embodiments, the antibiotic resistance protein is puromycin acetyltransferase, neomycin phosphotransferase, blasticidin deaminase, or hygromycin kinase. In some embodiments, the method comprises treating the plurality of cells with puromycin during the step of expressing the plurality of ORFs of the ORFeome library under conditions for the targeting moiety to interact with the target polypeptide.

[0018] In some embodiments, determining comprises measuring proliferation of the plurality of transduced cells, and ORFs identified in cells of the plurality of transduced cells that increase or decrease cell proliferation compared to a control are proximal effector polypeptides. In some embodiments, the plurality of cells are transduced to maintain >300x, >400x, or >500x coverage of the ORFeome library.

[0019] In some embodiments, the method further comprises assaying the identified proximity effector polypeptides in a respective proximity effector assay, and optionally, if the proximity effector polypeptide has been identified as a stabilizer or degrader, expressing the putative proximity effector polypeptide identified as a stabilizer or degrader in an assay cell expressing the target polypeptide, and determining whether the level of the target polypeptide in the assay cell is decreased or increased.

[0020] In some embodiments, the near effector polypeptide is a plurality of near effector polypeptides.

[0021] In some embodiments, the methods described herein are for identifying a near effector polypeptide that is a lethal or proliferation-inducing polypeptide, wherein determining comprises determining whether the ORF caused death or induced proliferation of at least one cell of the plurality of transduced cells and / or is depleted or increased in the plurality of transduced cells compared to a control, wherein if the near effector polypeptide causes death in at least one cell of the plurality of transduced cells and / or is depleted in the plurality of transduced cells, the near effector polypeptide is a lethal polypeptide, and if the near effector polypeptide induces proliferation in at least one cell of the plurality of transduced cells and / or is increased compared to a control, the putative near effector polypeptide is a proliferation-inducing polypeptide.

[0022] In some embodiments, determining comprises identifying ORFs that are depleted in the plurality of cells, and optionally sequencing the plurality of ORFs in the surviving plurality of transduced cells, and comparing the plurality of ORFs to a reference in an ORFeome library to determine the presence or absence of the ORF.

[0023] In some embodiments, the target polypeptide is an oncogenic polypeptide, an apoptosis regulator, an autophagy regulator, or a mitophagy regulator.In some embodiments, the target polypeptide is a RAS polypeptide, optionally KRAS, MYC, or EWSR-FLI1.

[0024] In some embodiments, the methods described herein are for identifying a proximal effector polypeptide that is a protein transporting polypeptide, and determining comprises measuring a cell surface level of a target polypeptide, and the proximal effector polypeptide is a protein transporting polypeptide if it increases the cell surface level of the target polypeptide. In some embodiments, the target polypeptide is an MHC class I polypeptide. In some embodiments, the target polypeptide is a mutant cell surface polypeptide, preferably CFTRΔ508, optionally as shown in Table 2.

[0025] In some embodiments, the target polypeptide comprises EGFP-AB1, Rluc, FUS S525L, NRAS, DNAJA3, BRAF, LAMP1, TDP43 Q311K, CD63, H2B, EGFR, DNAJB11, WDR5, RAS, MYC, or EWSR-FLI1, EWSR1, SMARCA2 / 4, or PARP1, PD1 / PD-L1, JAK, FUS, TDP43, a-synuclein, amyloid beta precursor protein, HTT, prion protein, p53, PTEN, CFTR mutant, and / or dystrophin mutant.

[0026] In some embodiments, the targeting moiety is a nanobody, a ligand, an interacting peptide, or an antibody that binds to the target polypeptide. In some embodiments, the targeting moiety is a nanobody. In some embodiments, the targeting moiety is an interacting peptide (or a complementary interacting peptide) selected from ABI1, FKBP, FRB, mutant FRB, GID1, GAI, and / or PYR1. In some embodiments, the targeting polypeptide is a fusion polypeptide comprising an interacting peptide that interacts with the targeting moiety. In some embodiments, the fusion polypeptide comprises ABI1, FKBP, FRB, mutant, FRB, GID1, GAI, PYL1, Alfa tag, and / or PYR1.

[0027] In some embodiments, the method comprises the use of a chemical inducer. In some embodiments, when the target polypeptide comprises ABI1, the targeting moiety comprises PYR1 or PYL1, and the chemical inducer is mandipropamide or abscisic acid. In some embodiments, when the target polypeptide comprises PYR1, the targeting moiety comprises ABI1, and the chemical inducer is mandipropamide or abscisic acid. In some embodiments, when the target polypeptide comprises ABI1, the targeting moiety comprises PYL1, and the chemical inducer is abscisic acid. In some embodiments, when the target polypeptide comprises FKBP, the targeting moiety comprises FRB, and the chemical inducer is rapamycin. In some embodiments, when the target polypeptide comprises FKBP, the targeting moiety comprises FKBP, and the chemical inducer is rapamycin. In some embodiments, when the target polypeptide comprises FKBP, the targeting moiety comprises a mutant FRB, and the chemical inducer is a rapalog, optionally AP21967. In some embodiments, when the target polypeptide comprises a mutant FRB, the targeting moiety comprises FKBP and the chemical inducer is a rapalog, optionally AP21967. In some embodiments, when the target polypeptide comprises GID1, the targeting moiety comprises GAI and the chemical inducer is gibberellic acid. In some embodiments, the target polypeptide comprises a mutant GAI, the targeting moiety comprises GID1 and the chemical inducer is gibberellic acid.

[0028] In some embodiments, the method further comprises performing a screening assay to identify a ligand, optionally a small molecule binder, for the identified at least one recombinant proximity effector polypeptide.

[0029] Another aspect of the disclosure is a screening assay for identifying a ligand, optionally a small molecule binder, of at least one recombinant proximity effector polypeptide, comprising: contacting at least one recombinant proximity effector polypeptide with a small molecule library, optionally in a high throughput screening assay, wherein said proximity effector polypeptide is selected from Tables 4, 5, 6 or 7; assessing whether binding has occurred between said recombinant proximity effector polypeptide and one or more small molecules of said library of small molecules. comprising the one or more molecules bound to said at least one recombinant proximity effector polypeptide are ligands, optionally small molecule binding agents, of said at least one recombinant proximity effector polypeptide; Preferably, the near effector polypeptide is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, or RNF126, or selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, UBE2B, or KLHL40. Includes screening assays.

[0030] In some embodiments, the assay further comprises contacting a target polypeptide with the small molecule library and determining whether binding has occurred between the target polypeptide and one or more small molecules of the small molecule library. In some embodiments, the evaluating step is performed using surface plasmon resonance (SPR), nuclear magnetic resonance (NMR) spectroscopy, differential scanning fluorimetry (DSF), thermal shift assay (TSA), isothermal titration calorimetry (ITC), microscale thermophoresis (MST), biolayer interferometry (BLI), X-ray crystallography, a DNA-encoded library (DEL) screen, affinity selection-mass spectrometry (AS-MS), or a covalent fragment screen.

[0031] In some embodiments, the assay further comprises identifying whether the small molecule binder of the recombinant proximity effector polypeptide is a molecular glue by determining whether the recombinant proximity effector and target polypeptides interact in the presence of the small molecule binder. In some embodiments, the determining step is performed using luciferase complementation, yeast two-hybrid assay, AlphaScreen, yeast mating-based interaction assay, fluorescence resonance energy transfer microscopy (FRET), or time-resolved FRET (TR-FRET), and the small molecule binder is a molecular glue if it interacts or is capable of interacting with the recombinant proximity effector polypeptide and the target polypeptide simultaneously.

[0032] In some embodiments, the at least one recombinant proximity effector polypeptide was identified using the methods described herein.

[0033] Another aspect of the disclosure is a method of making a heterobifunctional molecule, comprising: Identifying a ligand for the effector polypeptide, optionally a small molecule binding agent, and a ligand for the target polypeptide, optionally a small molecule binding agent, using the methods described herein; and linking the small molecule binding agent of the effector polypeptide to the small molecule binding agent of the target polypeptide, optionally via a linker; The method includes the method comprising:

[0034] In some embodiments, the method further comprises assessing whether the effector polypeptide and the target polypeptide interact in the presence of the heterobifunctional molecule. In some embodiments, the assessing step is carried out using luciferase complementation, yeast two-hybrid assay, Alpha Screen, yeast mating-based interaction assay, fluorescence resonance energy transfer microscopy (FRET), or time-resolved FRET (TR-FRET).

[0035] Another embodiment of the present disclosure is a process for modulating a target polypeptide in at least one cell, comprising expressing in said at least one cell a proximity effector polypeptide as set forth in Tables 4, 5, 6 or 7, wherein at least one proximity effector polypeptide is fused to a targeting moiety, preferably the proximity effector polypeptide is selected from the group consisting of GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF18, and the like. 5, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, or RNF126, or selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, UBE2B, or KLHL40.

[0036] In some embodiments, the proximity effector polypeptide is at least one degrading agent. In some embodiments, the proximity effector polypeptide is at least one stabilizing agent. In some embodiments, the at least one degrading agent polypeptide is selected from UBE2B, UBE2A, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, ZER1 and / or KLHDC2. In some embodiments, the at least one degrader is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, ZER1, and / or RNF126. In some embodiments, the at least one degrader polypeptide is selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, and / or UBE2B. In some embodiments, the at least one stabilizer polypeptide is selected from KLHL40, KLHL41, DDI1, and / or PRPS2, preferably KLHL40.

[0037] In some embodiments, the target polypeptide is an oncogenic polypeptide, an oncogenic fusion polypeptide, a synthetic lethal target, an immunological / oncogenic immunological target, a dominant gain-of-function disease mutant, a tumor suppressor, or an unstable disease mutant. In some embodiments, the oncogenic polypeptide or oncogenic fusion polypeptide is or comprises RAS, MYC, or EWSR-FLI1. In some embodiments, the synthetic lethal target is EWSR1, SMARCA2 / 4, or PARP1. In some embodiments, the immunological / oncogenic immunological target is PD1 / PD-L1 or JAK. In some embodiments, the dominant gain-of-function disease mutant is FUS, TDP43, a-synuclein, amyloid beta precursor protein, HTT, or prion protein. In some embodiments, the tumor suppressor is p53 or PTEN. In some embodiments, the unstable disease mutant is a CFTR mutation or a dystrophin mutant.

[0038] In some embodiments, the proximal effector is KLHL40 or KLHL41, and the target polypeptide is a loss-of-stability mutant of muscular dystrophy. In some embodiments, the target polypeptide is BCR-ABL. In some embodiments, the targeting moiety is a nanobody, a ligand, an interacting peptide, or an antibody.

[0039] Another embodiment of the disclosure includes a fusion polypeptide comprising a near effector polypeptide selected from Tables 4, 5, 6 or 7, and a targeting moiety that binds to a target polypeptide, preferably the near effector polypeptide is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, or RNF126, or selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, UBE2B, or KLHL40. In some embodiments, the near effector polypeptide is selected from ZER1 FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, UBE2B, or KLHL40. In some embodiments, the near effector polypeptide is selected from UBE2B, UBE2A, ZER1, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, KLHDC2, KLHL40, KLHL40 fusion, KLHL6 fusion, or PRNP fusion. In some embodiments, the effector polypeptide is UBE2B, ZER1 KLHL40, KLHL41, DDI1, or PRPS2.

[0040] In some embodiments, the fusion polypeptide comprises a proximal effector polypeptide that is a degrading agent. In some embodiments, the proximal effector polypeptide is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, ZER1, or RNF126. In some embodiments, the proximal effector polypeptide is selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, or UBE2B. In some embodiments, the proximal effector polypeptide is a stabilizing agent, preferably KLHL40.

[0041] In some embodiments, the targeting moiety is a nanobody, a ligand, an interacting peptide or an antibody that binds to the target polypeptide. In some embodiments, the targeting moiety is a nanobody, optionally a vhhGFP or an alpha tag nanobody.

[0042] In some embodiments, the target polypeptide is selected from an oncogenic polypeptide, an oncogenic fusion polypeptide, a synthetic lethal target, an immunological / oncogenic immunological target, a dominant gain-of-function disease mutant, a tumor suppressor, or an unstable disease mutant. In some embodiments, the oncogenic polypeptide or the oncogenic fusion polypeptide is RAS, MYC, or EWSR-FLI1. In some embodiments, the synthetic lethal target is EWSR1, SMARCA2 / 4, or PARP1. In some embodiments, the immunological / oncogenic immunological target is PD1 / PD-L1 or JAK. In some embodiments, the dominant gain-of-function disease mutant is FUS, TDP43, a-synuclein, amyloid beta precursor protein, HTT, or prion protein. In some embodiments, the tumor suppressor is p53 or PTEN. In some embodiments, the unstable disease mutant is a CFTR mutant or a dystrophin mutant. In some embodiments, the target polypeptide is selected from EGFP-AB1, ABI1, Rluc, FUS S525L, NRAS, DNAJA3, BRAF, LAMP1, TDP43, Q311K, CD63, H2B, EGFR, DNAJB11, or WDR5.

[0043] Another aspect of the present disclosure includes the fusion polypeptide described herein for use in making a drug.In some embodiments, the fusion polypeptide comprises the close effector KLHL40 or KLHL41, the target polypeptide is a loss-of-stability mutant, and the drug is for treating muscular dystrophy.In some embodiments, the target polypeptide is BCR-Abl.

[0044] Another aspect of the disclosure includes a nucleic acid encoding any of the fusion polypeptides described herein.Another aspect of the disclosure includes a vector comprising any of the nucleic acids described herein.

[0045] Hereinafter, embodiments of the present disclosure will be described with reference to the drawings. [Brief description of the drawings]

[0046] [Figure 1A] FIG. 1A is a schematic diagram of the method described herein. [Figure 1B] FIG. 1B is a schematic diagram of the method described herein. [Diagram 2] FIG. 2 is an image showing the results of the decomposition and stabilization screen described herein. [Figure 3A] FIG. 3A is a schematic diagram showing the structures of prion protein (PRNP) and FCGR3B. [Figure 3B] FIG. 3B shows a schematic diagram of the structure of recombinant and fusion PRNP and FCGR3B polypeptides and a graph showing the relative GFP intensity of each polypeptide. [Figure 3C] 3C is a schematic diagram showing the amino acid sequences of recombinant FCGR3B polypeptides and a graph showing the relative GDP intensity of each polypeptide. SEQ ID NOs: 6 to 24 are shown. [Figure 4A] FIG. 4A is a schematic diagram of fusion polypeptides exhibiting degradation in trans and a graph showing the relative fluorescence intensity of each polypeptide. [Figure 4B] FIG. 4B is a schematic diagram of fusion polypeptides exhibiting degradation in cis and a graph showing the relative fluorescence intensity of each polypeptide. [Figure 5A] FIG. 5A is a graph showing relative GFP intensity of Renilla wild-type UBE2B and mutant UBE2B comprising a Cys88 to alanine mutation. [Figure 5B] FIG. 5B is a schematic diagram of the structure of UBE2B and a graph showing relative GFP intensity of Renilla wild-type UBE2B and mutants of UBE2B. [Figure 5C] FIG. 5C is a graph showing the median fluorescence intensity of the putative effector polypeptide EGFP. [Figure 6A] FIG. 6A is a graph showing the results of a degradation assay including EGFP and Renilla luciferase, KLHL40, DDI1, and PRPS2, with or without vhhGFP. [Figure 6B]FIG. 6B is a series of schematic diagrams of the structures of DDI1 polypeptides and recombinant DDI1 polypeptides, as well as a graph showing the relative GFP intensity of each polypeptide. [Figure 6C] FIG. 6C is a graph showing the relative GFP intensity of PRS2 and mutant PRPS2. [Figure 6D] FIG. 6D is a series of schematic diagrams of the structures of KLHL40 polypeptides and recombinant KLHL40 polypeptides, as well as a graph showing the relative GFP intensity of each polypeptide. [Figure 6E] FIG. 6E is a series of schematic diagrams of the structures of KLHL40 and KLHL6 polypeptides and recombinant polypeptides comprising domains derived from KLHL40 and KLHL6, respectively, and a graph showing the relative GFP intensity of each polypeptide. [Figure 6F] 6F is an image showing the amino acid sequences of several polypeptides. SEQ ID NOs: 25 to 39 are shown. [Figure 7] FIG. 7 is an image showing the results of an assay measuring the activity of several polypeptides tagged with either a C-terminal vhhGFP or an N-terminal vhhGFP. [Figure 8] FIG. 8 is an image showing the results of screening to identify putative effector polypeptides as degrader or stabilizer polypeptides of various target polypeptides. [Figure 9] FIG. 9 is a schematic diagram of the structure of a target fusion polypeptide comprising an unstable mutant and GFP, a schematic diagram of the structure of a putative effector polypeptide fused to vhhGFP, and an image showing the activity of each effector against each target polypeptide. [Figure 10A] FIG. 10A is an image showing the results of an assay measuring the activity of an effector polypeptide. [Figure 10B] FIG. 10B is a graph showing Western blot quantification of effector polypeptides. [Figure 10C] FIG. 10C is an image showing the results of an assay measuring the activity of an effector polypeptide. [Figure 11A] FIG. 11A is a schematic diagram of the structure of the vhhGFP fusion polypeptide used in the degradation and stability screens described herein. [Figure 11B] FIG. 11B is an image showing the results of the decomposition and stabilization screen described herein. [Figure 12A] FIG. 12A is a schematic diagram of the structures of the GNMT H176N-GFP and vhhGFP fusion polypeptides used in the stability screen described herein. [Figure 12B] FIG. 12B is an image showing the results of a stabilization screen described herein. [Figure 13A] FIG. 13A is a graph depicting the results of a stabilization assay described herein showing deubiquitinase function, and in particular, the requirement for USP13. [Figure 13B] FIG. 13B is a graph depicting the results of a stabilization assay described herein demonstrating the requirement for deubiquitinase function, and in particular, USP38. [Figure 13C] FIG. 13C is a graph depicting the results of a stabilization assay described herein demonstrating deubiquitinase function, and in particular, the requirement for USP39. [Figure 13D] FIG. 13D is a graph depicting the results of a stabilization assay described herein demonstrating the requirement for deubiquitinase function, and in particular, OTUB1. [Figure 14A] FIG. 14A shows a graph depicting a schematic, image, and graphical representation of band intensities of Western blot results for effector polypeptides described herein in the presence or absence of doxycycline. [Figure 14B] FIG. 14B is a series of line graphs showing the relative proliferation of effectors described herein over time in the presence or absence of doxycycline. [Figure 15A] FIG. 15A is a schematic and image of Western blotting results for ARAF, the effectors described herein, and Hsp90. [Figure 15B]FIG. 15B shows a graph depicting a schematic, image, and graphical representation of band intensities of Western blot results for effector polypeptides described herein in the presence or absence of doxycycline. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0047] Detailed Description Unless otherwise specified, scientific and technical terms used in the present disclosure shall have the meanings that are commonly understood by those skilled in the art. Furthermore, unless otherwise required by context, singular terms shall include plural, and plural terms shall include singular. For example, the term "cell" includes a single cell as well as a plurality of cells or cell populations. In general, the nomenclature utilized in connection with and in connection with the cell and tissue culture, molecular biology, and protein and oligonucleotide or polynucleotide chemistry and hybridization techniques described herein is that which is well known and commonly used in the art (see, for example, Green and Sambrook, 2012).

[0048] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, a composition containing a "compound" includes a mixture of two or more compounds. It should also be noted that the term "or" is generally used in its sense to include "and / or" unless the content clearly dictates otherwise.

[0049] As used herein and in the claims, the phrase "at least one" in reference to a list of one or more elements should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed in the list of elements, and not excluding any combination of elements in the list of elements. This definition also allows for the possibility that elements other than those specifically identified in the list of elements to which the phrase "at least one" refers may optionally be present, whether related or unrelated to the elements specifically identified.

[0050] As used in this application and the claims, the term "consisting of" and its derivatives are intended to be close-ended terms specifying the presence of stated features, elements, components, groups, integers, and / or steps, and excluding the presence of other features, elements, components, groups, integers, and / or steps that are not stated.

[0051] As used herein, the terms "about," "substantially," and "approximately" refer to a reasonable amount of deviation from the modified term such that the end result is not materially altered. These terms of degree should be interpreted as including a deviation of at least ±5% or at least ±10% of the modified term, unless this deviation would negate the meaning of the word it modifies.

[0052] It is intended that the definitions and embodiments described in particular sections apply to other embodiments described herein where they are appropriate, as would be understood by one of ordinary skill in the art.

[0053] The recitation of numerical ranges by endpoints herein includes all numbers and fractions subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to be understood that all numerical values ​​and fractions thereof are assumed to be modified by the term "about." For ranges described herein, subranges are also contemplated, such as, for example, increments of 0.1 therebetween. For example, if a range is 80% to about 90%, then 80.1% to about 90%, 80% to about 89.9%, 80.1% to about 89.9%, etc. are also contemplated.

[0054] The term "cell", as used herein, refers to a single cell or multiple cells.

[0055] In understanding the scope of the present disclosure, the terms "comprising" and its derivatives (e.g., "comprises" and "comprises"), "having" (and any form of having, e.g., "have" and "has"), "including" (and any form of including, e.g., "include" and "includes") or "containing" (and any form of containing, e.g., "contain" and "contains"), as used herein, are intended to be open-ended terms specifying the presence of stated features, elements, components, groups, integers, and / or steps, but not excluding the presence of other features, elements, components, groups, integers, and / or steps that are not stated. The above also applies to words having similar meanings, such as the terms "including" and "having" and their derivatives.

[0056] It is intended that the definitions and embodiments described in particular sections apply to other embodiments described herein where they are appropriate, as would be understood by one of ordinary skill in the art.

[0057] As used herein, the terms "peptide," "polypeptide," and "protein" refer to a chain of two or more natural or non-natural amino acid residues, regardless of post-translational modification (e.g., glycosylation or phosphorylation). Includes proteins that are a single polypeptide chain and multi-subunit proteins (e.g., composed of two or more polypeptides).

[0058] The term "antibody" as used herein is intended to include monoclonal, polyclonal, single chain, humanized and other chimeric, or fully human antibodies, as well as binding fragments thereof, such as nanobodies. Antibodies may be from recombinant sources and / or produced in transgenic animals. Also included are antibodies that can be produced using biochemical techniques or isolated from a library.

[0059] As used herein, the term "putative proximal effector polypeptide" or "putative effector polypeptide" refers to a polypeptide that is screened, e.g., in an assay or method described herein, for the ability to degrade or stabilize a target polypeptide, to cause cell death in a cell containing the target polypeptide, or to promote membrane localization of a cell surface polypeptide. For example, an ORF of an ORFeome library expressed in a cell is a putative proximal effector polypeptide.

[0060] As used herein, the term "proximal effector polypeptide" or "effector polypeptide" refers to a polypeptide that is capable of inducing a biological effect when in proximity to a target polypeptide, e.g., a polypeptide that degrades or stabilizes a target polypeptide, a polypeptide that is capable of causing cell death in a cell containing the target polypeptide, or a polypeptide that is capable of promoting membrane localization of a cell surface polypeptide.

[0061] The term "effector" can be used to refer to a putative proximal effector polypeptide or a proximal effector polypeptide or both.

[0062] The term "fluorescent polypeptide" refers to a fluorescent polypeptide that can be attached or introduced to a peptide, antibody or other compound described herein and that can generate, either directly or indirectly, a detectable fluorescent signal.

[0063] As used herein, the term "target polypeptide" refers to a polypeptide of interest that is targeted in a proximity-induced interaction with a putative nearby effector polypeptide that is screened, e.g., in an assay or method described herein, to determine whether it is a nearby effector, e.g., whether it degrades or stabilizes the target polypeptide, or, e.g., if the target polypeptide is degraded or stabilized, with a degrader or stabilizer polypeptide. A target polypeptide can be brought into proximity with another polypeptide, e.g., by using a targeting moiety fused to an effector polypeptide, e.g., a degrader or stabilizer polypeptide that binds to the target polypeptide. The target polypeptide can be in a fusion polypeptide comprising a peptide interaction tag, such as ABI1, e.g., EGFP-ABI1. The target polypeptide can be a multi-subunit protein. The target polypeptide can be any species, including mammals, preferably humans. The target polypeptide can be an endogenous or recombinantly expressed polypeptide.

[0064] As used herein, the term "degrader polypeptide" (sometimes simply referred to as "degrader") refers to a polypeptide that, when placed in close proximity to a target polypeptide in a cell, degrades or causes the degradation of the target polypeptide, for example by at least 10% compared to a control. The degrader polypeptide can be placed in close proximity to the target polypeptide using a targeting moiety fused to the degrader polypeptide, which binds directly or indirectly to the target polypeptide, for example, using the SpyTag / SpyCatcher, SnoopTag / SnoopCatcher, HiBiT / LgBit, or GFP11 / GFP1-10 system. The degrader polypeptide can reduce the half-life of the target polypeptide and / or reduce the level of the target polypeptide in the cell. Depending on the context, degrader polypeptide or degrader may refer to a nucleic acid sequence encoding the degrader polypeptide.

[0065] As used herein, the term "stabilizer polypeptide" (or sometimes simply referred to as "stabilizer") refers to a polypeptide that stabilizes or causes stabilization of a target polypeptide when placed in close proximity to the target polypeptide in a cell. The stabilizer polypeptide can be placed in close proximity to the target polypeptide, for example, by using a targeting moiety fused to the stabilizer polypeptide that binds to the target polypeptide. The stabilizer polypeptide can, for example, increase the half-life of the target polypeptide and / or increase the level of the target polypeptide in the cell, when compared to a control. Depending on the context, stabilizer polypeptide or stabilizer can also refer to a nucleic acid sequence that encodes a degrader polypeptide.

[0066] As used herein, a "lethal polypeptide" includes a polypeptide that induces cell death when brought into proximity with a target polypeptide.

[0067] As used herein, the term "protein transport polypeptide" includes polypeptides that promote membrane localization of cell surface polypeptides, including mutant cell surface polypeptides.

[0068] As used herein, the term "targeting moiety" includes a polypeptide that binds to a target polypeptide, such as an antibody, an antibody-binding fragment, a nanobody, a ligand, or an interacting peptide of an optional fusion polypeptide. The targeting moiety can be fused to an effector, such as a degrader or stabilizer polypeptide. In some cases, the targeting moiety can constitutively bring a putative nearby effector polypeptide or a nearby effector polypeptide into close proximity, such as when the targeting moiety is an antibody, or optionally a binding protein such as a nanobody. In some cases, the targeting moiety binds to the target polypeptide only upon induction via chemical dimerization in the presence of, for example, another molecule, such as a chemical inducer such as abscisic acid (e.g., resulting in the interaction of proteins comprising the interacting ABI1 and PYL1 domains). Such chemical inducers and the domains through which they induce chemical dimerization are described herein, for example, in Ziegler et al., Mandipropamid as a chemical inducer of proximity for in vivo applications. Nat Chem Biol 18, 64-69 (2022), which is incorporated herein by reference. The targeting moiety may be capable of binding affinity assays of up to 10e, optionally by SPR. -4 k lower than M d The target polypeptide may be any molecule that binds to the target polypeptide at the

[0069] "Interaction peptide" as used herein may include, for example, a peptide that specifically interacts with another interaction peptide (sometimes referred to as complementary interaction peptide) or can be induced to interact or dimerize. Examples of interaction peptides (and complementary interaction peptides) include, but are not limited to, ABI1 and PYL1, ABI1 and PYR, GID1 and GAI, or FKBP and FRB, which bind to each other in the presence of a chemical inducer. It should be understood that examples of interaction peptides are also examples of complementary interaction peptides.

[0070] As used herein, a "negative selection marker" includes a selection marker that eliminates or inhibits the growth of a host organism upon selection. Examples of negative selection markers are thymidine kinase in the presence of ganciclovir, or modified deoxycytidine kinase (DCK) in the presence of 2-bromovinyldeoxyuridine or L-deoxythymidine. * ).

[0071] As used herein, the term "synthetic lethal target" includes a polypeptide that, when inhibited or activated, causes cell death only under certain conditions. For example, SMARCA2 is a synthetic lethal target when present in SMARCA4 mutant tumors.

[0072] One aspect of the disclosure includes a fusion polypeptide comprising one or at least one proximity effector polypeptide selected from Table 4 and one or at least one targeting moiety that binds to one or at least one target polypeptide. In some embodiments, the one or at least one proximity effector polypeptide is selected from Table 5 or Table 6 or Table 7.

[0073] In some embodiments, the one or at least one near effector polypeptide is selected from those in Figure 12B. In some embodiments, the one or at least one near effector polypeptide is selected from those in Figure 11B.

[0074] In some embodiments, the one or at least one proximal effector polypeptide is selected from UBE2B, UBE2A, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, KLHDC2, KLHL40 (optionally a KLHL40 fragment), a KLHL40 fusion, ZER1, or a PRNP fusion.

[0075] In one embodiment, the KLHL40 is a KLHL40 fragment, for example a fragment listed in Table 4.

[0076] In some embodiments, the one or at least one proximal effector polypeptide is selected from UBE2B, FBXL12, FBXL14, FBXL15, KLHL6, KBTBD7, KLHDC2, KLHL40, KLHL40 fusions, or KLHL6. As shown in the Examples, many of the identified proximal effectors had greater activity than the known proximal degraders CRBN and VHL.

[0077] Thus, in one embodiment, the one or at least one proximal effector polypeptide is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, or RNF126.

[0078] In some embodiments, the one or at least one effector polypeptide is selected from UBE2B, KLHL40, KLHL41, DDI1, or PRPS2. In some embodiments, the one or at least one targeting moiety is a nanobody, a ligand, an interacting peptide, or an antibody that binds to at least one target polypeptide. The targeting moiety can directly or indirectly bind to an endogenous target polypeptide. The targeting moiety can also bind to a tag or an interacting peptide that is fused to an endogenous target polypeptide. In some embodiments, the one or at least one targeting moiety is a nanobody, optionally a binding protein (antibody or nanobody) for vhhGFP or an epitope tag binding protein, such as an ALFA tag, a myc tag, a Flag tag, an HA tag, or a V5 tag. When the targeting moiety is or comprises an interacting peptide, the effector can also comprise an interacting peptide that is complementary to the targeting moiety interacting peptide.

[0079] In some embodiments, the or at least one target polypeptide is selected from an oncogenic polypeptide, an oncogenic fusion protein, a synthetic lethal target, an immunological / oncological immunological target, a dominant gain-of-function disease mutant, a tumor suppressor protein, or an unstable disease mutant.

[0080] In some embodiments, the oncogenic polypeptide or oncogenic fusion protein is RAS, MYC, or EWSR-FLI1.

[0081] In some embodiments, the synthetic lethal target is EWSR1, SMARCA2 / 4, or PARP1. In some embodiments, the synthetic lethal target is SMARCA2 in the presence of SMARCA4 mutants, SMARCA4 in the presence of SMARCA2 mutants, PARP1 in BRCA1 / 2-deficient cells, and / or PRMT5 in cells with loss of MTAP.

[0082] Immunological / cancer immunological targets include, for example, proteins involved in T cell-mediated tumor cell killing. In some embodiments, the immunological / cancer immunological target is PD1 / PD-L1 or JAK.

[0083] In some embodiments, the dominant gain-of-function disease mutant is a FUS, TDP43, a-synuclein, amyloid beta precursor protein, HTT, or prion protein gain-of-function disease mutant. In some embodiments, the dominant gain-of-function disease mutant is selected from Table 1. Dominant gain-of-function disease mutants include proteins with mutations that result in a gain of function (i.e., toxicity) that causes a disease phenotype.

[0084] [Table 1] TIFF2025512531000003.tif208169

[0085] In some embodiments, the tumor suppressor protein is p53 or PTEN.

[0086] Unstable disease mutants include proteins that cause protein misfolding and / or degradation, which causes disease phenotypes.In some embodiments, unstable disease mutants are CFTR mutants or dystrophin mutants.In some embodiments, unstable disease mutants are CFTRΔ508, ACTB E364K, ALDOA E206K, AMHR2 R54C, AMPD3 A320V, CBS L456P, GNMT H176N, PIKLR F132L, SCARB H363N, or TPMT A80P.

[0087] In some embodiments, the or at least one target polypeptide is selected from EGFP-ABI1, Rluc, FUS S525L, NRAS, DNAJA3, BRAF, LAMP1, TDP43 Q311K, CD63, H2B, EGFR, DNAJB11, or WDR5.

[0088] In some embodiments, the at least one target polypeptide is a human polypeptide.

[0089] The fusion polypeptide may comprise a proximity effector selected from any group or subgroup of any group described herein, and may be combined with any targeting moiety or group of targeting moieties described herein.

[0090] The fusion polypeptide may comprise one or at least one proximal effector polypeptide selected from Tables 4, 5, 6, or 7 at the C-terminus of the one or at least one targeting moiety that binds to the one or at least one target polypeptide and / or at the N-terminus of the one or at least one targeting moiety that binds to the one or at least one target polypeptide. For example, PRR20A, MYLIP, KLHL22, MAP1LC3A, GABARAPL2, GABARAP, FBXL15, TRIM39, NHLRC1, MAP1LC3B, KLHL6, DCAF15, KLHDC2, RNF166, RTL8C, SPOP, LY6D, ASB6, or PRNP may be at the C-terminus of the one or at least one targeting moiety that binds to the one or at least one target polypeptide.

[0091] Reference to a proximal effector includes reference to its active fragment. For example, as shown herein, various KLHL40 fragments containing the BTB domain act as stabilizing effectors. KLHL40 fragments lacking the BTB domain act as decomposition effectors. Reference to KLHL40 can refer to the whole protein, for example, the sequence shown in accession number Q2TBA0, or to its active fragment. For example, reference to KLHL40 fusion refers to KLHL40 in which the BTB domain of KLHL40 is replaced with the BTB domain of KLHL6. Effector fusions that can be included in fusion polypeptides are described herein, for example, in Tables 4, 5, 6 and 7, and in the Examples. Reference to such fusions includes, for example, the portions described in these tables.

[0092] The fusion polypeptide may comprise a linker that connects one or at least one effector and one or at least one targeting moiety, such as nanobody.Various linkers can be used.Short and long linkers have been evaluated with various effectors.Linker length does not affect the effectiveness of effectors in assays in which effector-targeting moiety fusion polypeptides are expressed together with targeting polypeptides.

[0093] Another aspect of the disclosure includes a nucleic acid encoding any of the fusion polypeptides described herein.

[0094] Another aspect of the disclosure includes one or at least one target polypeptide comprising or selected from EGFP-AB1, Rluc, FUS, optionally FUS S525L, NRAS, DNAJA3, BRAF, LAMP1, TDP43, optionally TDP43 Q311K, CD63, H2B, EGFR, DNAJB11, WDR5, RAS, MYC, or EWSR-FLI1, EWSR1, SMARCA2 / 4, or PARP1, PD1 / PD-L1, JAK, a-synuclein, amyloid beta precursor protein, HTT, prion protein, p53, PTEN, CFTR mutant, or dystrophin mutant; a first fluorescent polypeptide, and optionally a nucleic acid encoding an IRES or cleavage site therebetween (e.g., between the target polypeptide and the fluorescent protein), for use in a method, process, assay, kit or as otherwise described herein.

[0095] Another aspect of the disclosure is a kit comprising one or more components described herein. In one embodiment, the kit is for use in the methods described herein. In one embodiment, the kit comprises any of the nucleic acids described herein. In some embodiments, the kit comprises any of the fusion polypeptides described herein. In one embodiment, the kit comprises a cell line described herein. The nucleic acid may comprise a vector, including a vector described herein. The kit comprises, in some embodiments, a fusion polypeptide described herein. In some embodiments, the kit further comprises, for example, a vial or other housing comprising the nucleic acid or fusion polypeptide. In some embodiments, the kit further comprises a set of instructions or one or more reagents for carrying out the assays described herein. In some embodiments, the kit comprises any of the libraries described herein, optionally an ORFeome library, comprising at least one putative effector polypeptide fused to a targeting moiety that binds to at least one target polypeptide.

[0096] In some embodiments, at least one target polypeptide is fused to a second fluorescent polypeptide.

[0097] In some embodiments, the first fluorescent polypeptide is RFP, YFP, mCherry, mCitrine, mNeonGreen, mScarlet, BFP or GFP.

[0098] In some embodiments, the second fluorescent polypeptide is RFP, YFP, mCherry, mCitrine, mNeonGreen, mScarlet, BFP or GFP, and the fluorescent signals emitted by the first and second fluorescent polypeptides are distinguishable using flow cytometry.

[0099] In some embodiments, the at least one effector polypeptide is a plurality of effector polypeptides.

[0100] Fusion polypeptides can be used to make drugs.As described herein, fusions comprising KLHL40 can be particularly useful for targeting unstable mutants found in muscular dystrophy.Also, it has been shown herein that BCR-Abl, a fusion protein involved in leukemia, can be targeted by the effectors described herein.

[0101] Another aspect of the disclosure is a vector comprising any of the nucleic acids described herein.

[0102] Further aspects include recombinant cells comprising the nucleic acids or expressing the fusion proteins described herein.

[0103] The fusion polypeptides, nucleic acids, vectors, kits, uses and cells may be used in one or more of the methods, processes or assays described herein.

[0104] Provided herein is an unbiased approach to carry out proximity screening.As demonstrated, the method employed identifies a number of proximity effectors that can degrade or stabilize target polypeptide.Such method can be used to identify other effectors in addition to stabilizers and / or decomposers.

[0105] One aspect includes a method for identifying a near effector polypeptide, the method comprising: transducing a plurality of cells with an ORFeome library, said ORFeome library encoding a plurality of ORFs, each of said ORFs fused to a targeting moiety that can bind, or be induced to bind, directly or indirectly to a target polypeptide; expressing a plurality of ORFs of said ORFeome library in said plurality of transduced cells under conditions for said targeting moiety to interact with said target polypeptide; and determining whether any of said ORFs is a proximal effector polypeptide by measuring the abundance, optionally total abundance, cell surface abundance or intracellular abundance, of said target polypeptide in cells expressing any of said ORFs compared to a control, and / or detecting whether any of said ORFs is depleted or increased in said transduced cells compared to a control. Including, said plurality of transduced cells recombinantly express said target polypeptide, and optionally express a first fluorescent polypeptide, said target polypeptide being a second fluorescent polypeptide, an endogenous protein, or a fusion polypeptide fused to a second fluorescent polypeptide epitope tag, an antibiotic resistance protein, and / or a negative selection marker; An ORF encodes a proximity effector polypeptide if the ORF increases or decreases the abundance of said target polypeptide compared to a control, or is depleted or increased in said plurality of transduced cells compared to a control.

[0106] The first fluorescent polypeptide can act as an internal normalizer and can increase the sensitivity of the screening. In some embodiments, the plurality of cells expresses the first fluorescent polypeptide.

[0107] In particular, these methods can be used to identify stabilizers and degraders.

[0108] Accordingly, another aspect of the disclosure includes a method for identifying one or at least one putative effector polypeptide as a degrader or stabilizer of a target polypeptide, the method comprising: transducing the ORFeome library into a plurality of cells; expressing one or at least one putative effector polypeptide of said ORFeome library, said at least one putative effector polypeptide being fused to a targeting moiety that binds to at least one target polypeptide; and determining whether the level of said at least one target polypeptide in said at least one cell is decreased or increased relative to a control. comprising each of the plurality of cells recombinantly expresses the at least one target polypeptide fused to a first fluorescent polypeptide and a second fluorescent polypeptide, or the target polypeptide is fused to an antibiotic resistance protein or a negative selection marker; If the level of the target polypeptide is decreased, the at least one putative effector polypeptide is a degrader of the target polypeptide, and if the level of the target polypeptide is increased, the at least one effector polypeptide is a stabilizer of the target polypeptide.

[0109] Measuring the abundance or level of a target polypeptide may comprise determining whether the target polypeptide is decreased or increased compared to a control, or whether the cell surface level of the target polypeptide is increased or decreased compared to a control, or whether the organelle level of a particular subcellular fraction or target organelle is increased or decreased compared to a control. Depending on the combination of the sensor and tag used and the type of proximal effector identified, various methods can be used to assess the polypeptide level. For example, as shown in the examples, in the case of a fluorescent tag, the fluorescence level of the desired fraction can be measured and compared to unsorted cells.

[0110] Alternatively, in some embodiments, determining can comprise monitoring the level of said one or at least one target polypeptide using antibody specific for the target polypeptide.For example, when fluorescent tag is not used, target polypeptide such as cell surface target polypeptide can be directly or indirectly detected by immunoaffinity technology using tagged binding protein such as fluorescently labeled antibody or immunomagnetic beads, and separated by FACS or magnetic separation.

[0111] The increase or decrease can be, for example, at least 10 percent, or, for example, "decreased" refers to a statistically significant decrease compared to a control, for example, at p<0.05, or, for example, "increased" refers to a statistically significant increase compared to a control, for example, at p<0.05.

[0112] Controls can be, for example, unsorted cells if fluorescence is used, or untreated cells if antibiotic resistance or negative selection is used.

[0113] In another embodiment, the targeting moiety is a nanobody, ligand, or antibody that binds to the target polypeptide. -4 Lower, e.g., 10e -5 or 10e -6 kd The targeting moiety is any molecule that binds to at least one target polypeptide at a specific site. In some embodiments, the targeting moiety is HaloTag™ (haloalkane dehalogenase). For example, HaloTag™ can be used as a targeting moiety when at least one target polypeptide has a known ligand and a chloroalkane derivative of such ligand is synthesized. For example, if the target polypeptide is BRD4, the ligand can be JQ1-chloroalkane that binds to BRD4, and the effector polypeptide is fused to HaloTag. In this example, BRD4 levels can be tracked with fluorescence-activated cell sorting (FACS) using a BRD4-specific antibody conjugated to a fluorophore. Alternatively, cell viability can be used as a readout since BRD4 is an essential gene in many cell lines, and cell viability is used as a readout when degradation of BRD4 is identified by cell death. In some embodiments, the control includes cells (e.g., cell lines) expressing at least one target polypeptide that are not transduced with an ORFeome library or at least one putative effector polypeptide. In some embodiments, the control is a cell that does not express the effector. In some embodiments, the control is a cell that expresses an inactive putative effector (e.g., luciferase) linked to a targeting moiety. In some embodiments, the genetic construct, such as a fusion protein comprising an antibody, nanobody or other targeting moiety, can be delivered via a viral vector, such as an AAV, adenovirus, herpes virus vector, or using a liposome or lipid nanoparticle.

[0114] In some embodiments, the method further comprises producing a cell line expressing a target polypeptide that is a second fluorescent polypeptide or is fused with two fluorescent polypeptides, and / or is fused with an epitope tag, an antibiotic resistance protein, and / or a negative selection marker. The target polypeptide may also be an unlabeled or untagged polypeptide (e.g., a recombinantly expressed endogenous polypeptide). In some embodiments, the cell line further comprises a first fluorescent polypeptide. The cell line can be produced using, for example, HEK293 cells, 293T cells, HeLa cells, HCT116 cells, SH-SY5Y cells, Hap1 cells, HepG2 cells, MiaPaCa cells, A549 cells, THP-1 cells, Jurkat cells, or K562 cells. In one embodiment, the cell line is a cell line disclosed herein. In some embodiments, making a cell line comprises introducing a nucleic acid encoding a target polypeptide, optionally any of the nucleic acids disclosed herein or encoding a polypeptide described herein, into cells, selecting stably transduced cells, and producing a clonal cell line. This method may include selecting clones in which the target polypeptide is expressed at a desired level. This method may include the steps described in the examples. In some embodiments, the nucleic acid encodes a target polypeptide and optionally a first fluorescent polypeptide, and optionally the target polypeptide is fused with a second fluorescent polypeptide or an antibiotic resistance protein or a negative selection marker. In some embodiments, the nucleic acid encodes a target polypeptide selected from EGFP-AB1, Rluc, FUS S525L, NRAS, DNAJA3, BRAF, LAMP1, TDP43 Q311K, CD63, H2B, EGFR, DNAJB11, WDR5, RAS, MYC, or EWSR-FLI1, EWSR1, SMARCA2 / 4, or PARP1, PD1 / PD-L1, JAK, FUS, TDP43, a-synuclein, amyloid beta precursor protein, HTT, prion protein, p53, PTEN, CFTR mutant, or dystrophin mutant; a first fluorescent polypeptide, and an IRES.In some embodiments, the cell line is a 293T cell line, optionally expressing an ABI1-GFP fusion, in other embodiments, any cell line can be used.

[0115] In some embodiments, the decrease or increase in the target polypeptide level is determined by calculating the ratio of the second fluorescent polypeptide to the first fluorescent polypeptide using flow cytometry. In some embodiments, the fluorescent polypeptide is any fluorescent protein known in the art, for example, any fluorescent protein listed in the public database. fpbase.org In some embodiments, the first or second fluorescent polypeptide is RFP, YFP, mCherry, mCitrine, mNeonGreen, mScarlet, BFP, GFP, or any variant thereof (e.g., EGFP). In one embodiment, the first fluorescent polypeptide is GFP and the second fluorescent polypeptide is BFP.

[0116] In methods, processes, screening assays, etc. involving a target polypeptide fused to an antibiotic resistance polypeptide or a negative selection marker, the proximal effector may be a degrader or stabilizer or other effector. For example, after isolating surviving cells, a plurality of transduced cells treated with an antibiotic or negative selection drug can be evaluated for the abundance of each ORF (e.g., putative proximal effector). ORFs that are depleted in a plurality of transduced cells compared to a control (e.g., non-selected cells) indicate that those ORFs are degrader effectors, and ORFs that are enriched in a plurality of transduced cells compared to a control indicate that those ORFs are stabilizers.

[0117] Thus, in some embodiments, the target polypeptide is fused to an antibiotic resistance protein or a negative selection marker. In some embodiments, the decrease or increase in the level of the target polypeptide compared to the control is determined by measuring the relative abundance of each ORF in surviving cells of the plurality of transduced cells compared to the control. In some embodiments, the antibiotic resistance protein is puromycin acetyltransferase, and the method further comprises adding puromycin to the plurality of transduced cells. In some embodiments, cell survival of the plurality of transduced cells upon exposure to puromycin may indicate that the level of the target polypeptide has increased compared to the control, and / or cell death of the plurality of transduced cells upon exposure to puromycin may indicate that the level of the target polypeptide has decreased compared to the control. In some embodiments, an increase in cell proliferation of the plurality of transduced cells upon exposure to puromycin compared to the control indicates that the level of the target polypeptide has increased compared to the control (e.g., the effector is a stabilizer), and a lower degree of cell proliferation of the plurality of transduced cells upon exposure to puromycin compared to the control indicates that the level of the target polypeptide has decreased compared to the control (e.g., the effector is a degrader). Other antibiotic resistance proteins can also be used, such as, for example, neomycin phosphotransferase, blasticidin deaminase, or hygromycin kinase. The antibiotic used would be, for example, neomycin, blasticidin, or hygromycin, respectively.

[0118] Depending on the negative selection marker used, cell proliferation, lack of proliferation, or death may indicate an increase or decrease compared to the control. In some embodiments, the negative selection marker is thymidine kinase, and the method further comprises adding ganciclovir to the plurality of transduced cells. In some embodiments, cell survival of the plurality of cells upon exposure to ganciclovir indicates that the level of the target polypeptide is decreased compared to the control, and cell death of the plurality of transduced cells upon exposure to ganciclovir indicates that the level of the target polypeptide is increased compared to the control. In some embodiments, increased cell proliferation of the plurality of cells upon exposure to ganciclovir compared to the control indicates that the level of the target polypeptide is decreased compared to the control, and a lower degree of cell proliferation of the plurality of transduced cells upon exposure to ganciclovir compared to the control indicates that the level of the target polypeptide has been increased compared to the control.

[0119] In some embodiments, determining comprises assessing proliferation of the plurality of transduced cells, and ORFs identified in cells of the plurality of transduced cells that increase or decrease cell proliferation compared to a control are proximal effector polypeptides. Proliferation can be assessed by measuring the relative abundance of each ORF in the plurality of transduced cells after selection compared to before selection (e.g., a control). ORFs that promote proliferation will be enriched and ORFs that inhibit proliferation will be depleted.

[0120] In some embodiments, the plurality of cells is transduced to maintain an average of >about 300, >400, or >about 500-fold coverage of the ORFeome library.

[0121] In some embodiments, controls include cells (eg, cell lines) expressing at least one target polypeptide that have not been transduced with either the ORFeome library or the at least one putative effector polypeptide.

[0122] In some embodiments, the method, process or screening assay further comprises expressing at least one of the effector polypeptides identified as a stabilizer or degrader in the above-mentioned method in at least one cell expressing the target polypeptide, where the target polypeptide is optionally in a fusion polypeptide, and the at least one effector polypeptide is fused to a targeting moiety, and determining whether the level of the target polypeptide in the at least one cell is decreased or increased compared to a control. For example, these additional steps can be used to confirm that the effector polypeptide identified as a degrader or stabilizer of the target polypeptide in the above-mentioned method, process and screening assay degrades or stabilizes the target polypeptide. In some embodiments, the control is a cell or a plurality of cells expressing the target polypeptide that have not been transduced with an effector polypeptide, have not been induced, for example by chemical dimerization, have not been sorted, and / or have not been subjected to selection (e.g., antibiotic or negative selection).

[0123] In some embodiments, the library is a lentivirus pool library derived from ORFeome.Many different types of libraries are known in the art and can be used in the methods and processes of the present disclosure.Examples of libraries that can be used in the present disclosure include synthetic libraries of viral or bacterial proteins, protein domain libraries (human proteins or other proteomes), fragment libraries (derived from human proteins or other proteomes) or use insertional mutagenesis to randomly insert proximity-induced tags into genomes with splice acceptor sequences, for example, to fuse with gene fragments.

[0124] In some embodiments, the targeting moiety brings the putative proximal effector or proximal effector polypeptide into proximity with the target polypeptide via chimeric dimerization, and the method further comprises administering a chemical inducer. In some embodiments, the effector polypeptide is fused to the targeting moiety, and the targeting moiety is a nanobody. Other affinity binding agents, such as single chain antibodies, can also be used.

[0125] In some embodiments, the target polypeptide is in a fusion polypeptide comprising ABI1. In some embodiments, the putative effector polypeptide or the effector polypeptide is a fusion polypeptide fused with a targeting moiety, and the targeting moiety is PYL1. For example, PYL1 can bind to ABI1 in the presence of abscisic acid. In some embodiments, the target polypeptide is in a fusion polypeptide comprising ABI1, and the targeting moiety is PYL1, and the method comprises administering abscisic acid as a chemical inducer.

[0126] In some embodiments, the target polypeptide is within a fusion polypeptide comprising FKBP, and the putative effector polypeptide or effector polypeptide is a fusion polypeptide fused to a targeting moiety, and the targeting moiety is an FRB, e.g., FKBP and FRB bind in the presence of rapamycin. In some embodiments, the target polypeptide is within a fusion polypeptide comprising FKBP, and the targeting moiety is an FRB, and the method comprises administering rapamycin as a chemical inducer.

[0127] In some embodiments, the target polypeptide is in a fusion polypeptide comprising an FRB, and the putative effector polypeptide or effector polypeptide is in a fusion polypeptide fused to a targeting moiety, and the targeting moiety is FKBP, e.g., FKBP and FRB bind in the presence of rapamycin. In some embodiments, the target polypeptide is in a fusion polypeptide comprising an FRB, and the targeting moiety is FKBP, and the method comprises administering rapamycin as a chemical inducer.

[0128] In some embodiments, the target polypeptide is within a fusion polypeptide comprising FKBP, and the putative effector polypeptide or effector polypeptide is a fusion polypeptide fused to a targeting moiety, and the targeting moiety is a mutant FRB, e.g., FKBP and mutant FRB bind in the presence of a rapalog, such as AP21967. In some embodiments, the target polypeptide is within a fusion polypeptide comprising FKBP, and the targeting moiety is FRB, and the method comprises administering AP21967 as a chemical inducer.

[0129] In some embodiments, the target polypeptide is in a fusion polypeptide comprising a mutant FRB, and the putative effector polypeptide or effector polypeptide is in a fusion polypeptide fused to a targeting moiety, and the targeting moiety is FKBP, e.g., FKBP and the mutant FRB bind in the presence of a rapalog, such as AP21967. In some embodiments, the target polypeptide is in a fusion polypeptide comprising a FRB, and the targeting moiety is FKBP, and the method comprises administering AP21967 as a chemical inducer.

[0130] In some embodiments, the target polypeptide is in a fusion polypeptide comprising GID1, and the putative effector polypeptide or effector polypeptide is in a fusion polypeptide fused to a targeting moiety, and the targeting moiety is GAI, e.g., Gibberellin insensitive dwarf 1 (GID1) and GA insensitive (GAI) bind in the presence of gibberellic acid. In some embodiments, the target polypeptide is in a fusion polypeptide comprising GID1, and the targeting moiety is GAI, and the method comprises administering gibberellic acid as a chemical inducer.

[0131] In some embodiments, the target polypeptide is in a fusion polypeptide comprising GAI, and the putative effector polypeptide or effector polypeptide is in a fusion polypeptide fused to a targeting moiety, and the targeting moiety is GID1, e.g., GID1 and GAI bind in the presence of gibberellic acid. In some embodiments, the target polypeptide is in a fusion polypeptide comprising GAI, and the targeting moiety is GID1, and the method comprises administering gibberellic acid as a chemical inducer.

[0132] In some embodiments, the target polypeptide is within a fusion polypeptide comprising ABI1, and the putative effector polypeptide or effector polypeptide is within a fusion polypeptide fused to a targeting moiety, and the targeting moiety is PYR1, e.g., ABI1 and PYR1 bind in the presence of mandipropamide. In some embodiments, the target polypeptide is within a fusion polypeptide comprising ABI1, and the targeting moiety is PYR1, and the method comprises administering mandipropamide as a chemical inducer.

[0133] In some embodiments, the target polypeptide is within a fusion polypeptide comprising PYR1, and the putative effector polypeptide or effector polypeptide is a fusion polypeptide fused to a targeting moiety, and the targeting moiety is ABI1, e.g., ABI1 and PYR1 bind in the presence of mandipropamide. In some embodiments, the target polypeptide is within a fusion polypeptide comprising PYR1, and the targeting moiety is ABI1, and the method comprises administering mandipropamide as a chemical inducer.

[0134] Also provided in another embodiment is a process for modulating a target polypeptide in at least one cell, the method comprising expressing in at least one cell a proximity effector polypeptide as set forth in Tables 4, 5, or 7, wherein the at least one proximity effector polypeptide is fused to a targeting moiety. The process can be for targeted degradation or targeted stabilization.

[0135] For example, in some embodiments, the process is for targeted degradation of at least one target polypeptide in at least one cell, the method comprising expressing in at least one cell at least one degrading agent set forth in Table 4, wherein the at least one degrading agent polypeptide is fused to a targeting moiety. In some embodiments, the at least one degrading agent is set forth in Tables 5, 6, or 7. In some embodiments, the at least one degrading agent is set forth in Figure 11B.

[0136] In some embodiments, at least one target polypeptide is an oncogene polypeptide or an oncogenic fusion protein, optionally RAS, MYC, and / or EWSR-FLI1, and the degrader polypeptide is selected from UBE2B, UBE2A, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, PRR20A, or KLHDC2.

[0137] In some embodiments, at least one target polypeptide is a synthetic lethal target, optionally SMARCA2 in the presence of a SMARCA4 mutant, SMARCA4 in the presence of a SMARCA2 mutant, PARP1 in BRCA1 / 2-deficient cells, and / or PRMT5 in cells with loss of MTAP, and the degrader polypeptide is selected from UBE2B, UBE2A, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, PRR20A, or KLHDC2.

[0138] In some embodiments, at least one target polypeptide is an immunological / cancer immunological target, optionally PD1 / PD-L1 or JAK, and the degrader polypeptide is selected from UBE2B, UBE2A, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, PRR20A, or KLHDC2.

[0139] In some embodiments, the or at least one target polypeptide is a dominant gain-of-function disease mutant, optionally FUS, TDP43, a-synuclein, amyloid beta precursor protein, HTT, or a prion protein gain-of-function disease mutant, optionally selected from Table 1, and the degrader polypeptide is selected from UBE2B, UBE2A, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, PRR20A, or KLHDC2.

[0140] Another aspect of the present disclosure includes a process for targeted stabilization of at least one target polypeptide in at least one cell, the method comprising expressing at least one stabilizer shown in Table 4 in one or at least one cell, wherein the one or at least one degrader polypeptide is fused to a targeting moiety. In some embodiments, the one or at least one stabilizer is shown in Tables 5, 6, or 7. In some embodiments, the one or at least one stabilizer is shown in Figure 11B. In some embodiments, the one or at least one stabilizer is shown in Figure 12B.

[0141] Subcombinations of any of the effectors in Tables 5, 6 or 7, or as described in the Figures or Examples, are contemplated.

[0142] In some embodiments, the near effector polypeptide is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, or RNF126, or selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, UBE2B, or KLHL40.

[0143] In some embodiments, the or at least one target polypeptide is a tumor suppressor protein, optionally selected from Table 3, optionally p53 or PTEN, and the stabilizer polypeptide is selected from FBXL8, FBXO2, CDCA3, SKP1, ASB9, ELOB, KLHL40, ZFP161, KCTD17, ZBTB18, ZBTB7B, KCTD5, ZBTB20, ZBTB43, KEAP1, ZBTB10, UCHL1, OTUB1, USP39, USP38, USP14 or USP13, KLHL41, DDI1, and / or PRPS2.

[0144] In some embodiments, the or at least one target polypeptide is a tumor suppressor protein, optionally selected from Table 3, optionally p53 or PTEN, and the stabilizer polypeptide is selected from KLHL40, KLHL41, DDI1, PRPS2, UCHL1, OTUB1 or USP13.

[0145] In some embodiments, the one or at least one target polypeptide is an unstable disease mutant, optionally CFTR Δ508, ACTB E364K, ALDOA E206K, AMHR2 R54C, AMPD3 A320V, CBS L456P, GNMT H176N, PIKLR F132L, SCARB H363N, or TPMT A80P, and the stabilizer polypeptide is selected from FBXL8, FBXO2, CDCA3, SKP1, ASB9, ELOB, KLHL40, ZFP161, KCTD17, ZBTB18, ZBTB7B, KCTD5, ZBTB20, ZBTB43, KEAP1, ZBTB10, UCHL1, OTUB1, USP39, USP38, USP14, USP13, KLHL41, DDI1, and / or PRPS2.

[0146] In some embodiments, the or at least one target polypeptide is an unstable disease mutant, optionally CFTR Δ508, ACTB E364K, ALDOA E206K, AMHR2 R54C, AMPD3 A320V, CBS L456P, GNMT H176N, PIKLR F132L, SCARB H363N, or TPMT A80P, and the stabilizer polypeptide is selected from KLHL40, KLHL41, DDI1, PRPS2, UCHL1, OTUB1, or USP13.

[0147] In some embodiments, the target polypeptides and effector polypeptides are those disclosed in the Examples and Figures, e.g., FIG. 8. In some embodiments, the target polypeptides and effector polypeptides are used in the combinations shown in the Examples and Figures, e.g., FIG. 8. In some embodiments, the target polypeptides are combined / used with effector polypeptides shown in the Examples and Figures, e.g., FIG. 8, to degrade them. In other embodiments, the target polypeptides are combined with effector polypeptides shown in the Examples and Figures, e.g., FIG. 8, to stabilize them.

[0148] In some embodiments, the one or at least one degrader polypeptide is selected from UBE2B, UBE2A, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, and / or KLHDC2. UBE2B is a potent degrader, especially unexpected because it is an E2 conjugating enzyme. E2 conjugating enzymes have never been used to target polypeptide degradation and are often thought to require E3 ligase to function. The results shown in the examples suggest that UBE2B can function without E3 and directly ubiquitinate targets in a proximity-dependent manner.

[0149] In some embodiments, the or at least one degrader polypeptide is UBE2B.

[0150] In some embodiments, the one or at least one degrader polypeptide is a GPI-anchored polypeptide comprising a signal peptide, a soluble domain, and the C-terminal residues 194-223 of FCGR3B (Uniprot O75015-1). In some embodiments, the one or at least one degrader polypeptide is a PRNP fusion polypeptide, the PRNP fusion polypeptide comprising a PRNP signal peptide, a PRNP soluble domain, and the C-terminal residues 194-223 of FCGR3B (Uniprot O75015-1). In some embodiments, the one or at least one degrader polypeptide is an ER-resident soluble polypeptide comprising a signal peptide, a soluble domain that allows it to progress along the secretory pathway, and the C-terminal residues 194-223 of FCGR3B (Uniprot O75015-1).

[0151] In some embodiments, the or at least one degrader polypeptide is LY6D or LYPD3. The C-terminal residues of LY6D and LYPD3 are also shown herein to be degraders and can be added to polypeptides, optionally GPI-anchored proteins, to induce degradation.

[0152] In some embodiments, the degrader polypeptide is or comprises the C-terminal residues of LY6D, for example, residues AAPTRTALAHSALSLGLALSLLAVILAPSL (SEQ ID NO: 40).

[0153] In some embodiments, the or at least one degrader polypeptide is a GPI-anchored polypeptide comprising the signal peptide, the solubility domain, and the C-terminal residues of LY6D. In some embodiments, the degrader polypeptide comprises a GPI-anchored polypeptide and AAPTRTALAHSALSLGLALSLLAVILAPSL (SEQ ID NO: 40).

[0154] In some embodiments, the degrader polypeptide is or comprises the C-terminal residues of LYPD3, for example, the residues VAPTAGLAALLLAVAAGVLL (SEQ ID NO:41).

[0155] In some embodiments, the or at least one degrader polypeptide is a GPI-anchored polypeptide comprising a signal peptide, a soluble domain, and the C-terminal residues of LYPD3. In some embodiments, the degrader polypeptide comprises a GPI-anchored polypeptide and VAPTAGLAALLLAVAAGVLL (SEQ ID NO:41).

[0156] In some embodiments, the one or at least one stabilizer polypeptide is selected from FBXL8, FBXO2, CDCA3, SKP1, ASB9, ELOB, KLHL40, ZFP161, KCTD17, ZBTB18, ZBTB7B, KCTD5, ZBTB20, ZBTB43, KEAP1, ZBTB10, KLHL41, DDI1, and / or PRPS2.

[0157] In some embodiments, the one or at least one stabilizer polypeptide is selected from KLHL40, KLHL41, DDI1, and / or PRPS2.

[0158] In some embodiments, the or at least one stabilizer polypeptide is KLHL40 or KLHL41. KLHL40 and KLHL41 are particularly unexpected stabilizers because they belong to a group of proteins canonically associated with proteolysis (the BTB-BACK-Kelch family).

[0159] In some embodiments, the or at least one target polypeptide is an oncogene polypeptide, an oncogenic fusion polypeptide, a synthetic lethal target, an immunological / oncological immunological target, a dominant gain-of-function disease mutant, a tumor suppressor, and / or an unstable disease mutant.

[0160] In some embodiments, the oncogene / tumor suppressor polypeptide or oncogenic fusion polypeptide is RAS, MYC, or EWSR-FLI1. In some embodiments, the oncogene / tumor suppressor polypeptide or oncogenic fusion polypeptide is set forth in Table 3.

[0161] In some embodiments, the synthetic lethal target is EWSR1, SMARCA2 / 4, PARP1, WRN, ARID1A / 1B, MTAP, PKMYT1, CIP2A, APEX2, POLQ, SKP2, or ATR.

[0162] In some embodiments, the immunological / cancer immunological target is PD1 / PD-L1 JAK, or PTPN2.

[0163] In some embodiments, the dominant gain of function disease mutant is FUS, TDP43, a-synuclein, amyloid beta precursor protein, HTT, or prion protein.

[0164] In some embodiments, the tumor suppressor is p53 or PTEN. In some embodiments, the tumor suppressor polypeptide is set forth in Table 3.

[0165] In some embodiments, the unstable disease variant is a mutant CFTR or a dystrophin variant.

[0166] In some embodiments, the targeting moiety is fused to one or at least one stabilizer or degrader polypeptide.

[0167] In some embodiments, the targeting moiety is a nanobody, a ligand, or an antibody that binds to a target polypeptide.

[0168] In some embodiments, the target polypeptide is a human polypeptide. In some embodiments, the or at least one cell is a human cell.

[0169] Another aspect of the disclosure includes a method of identifying at least one putative effector polypeptide as a lethal polypeptide, the method comprising: transducing the ORFeome library into a plurality of cells; expressing at least one putative effector polypeptide of the ORFeome library, wherein the one or at least one putative effector polypeptide is fused to a targeting moiety that binds to the one or at least one target polypeptide; and determining whether said one or at least one putative effector polypeptide caused cell death of said plurality of transduced cells. comprising If said putative effector polypeptide causes cell death, it is a lethal polypeptide.

[0170] In some embodiments, determining whether one or at least one putative effector polypeptide causes cell death comprises identifying one or more putative effector polypeptides disappearing from the plurality of transduced cells during a screening assay. In some embodiments, identifying one or more putative effector polypeptides disappearing from the plurality of transduced cells during a screening assay comprises sequencing DNA encoding one or at least one putative effector polypeptide in the surviving cells, and comparing the effector genes present in the ORFeome library with the effector genes present in the cells after screening to determine whether the putative effector polypeptide is present or absent. In some embodiments, identifying one or more putative effector polypeptides disappearing from the plurality of transduced cells over time comprises sequencing DNA barcodes mapped to one or at least one putative effector polypeptide in the surviving cells, and comparing the effector genes present in the ORFeome library with the effector genes present in the cells after screening to determine whether the putative effector polypeptide is present or absent.

[0171] In some embodiments, the target polypeptide is any polypeptide that may be involved in cell survival or death. In some embodiments, the target polypeptide is an oncogenic polypeptide. In some embodiments, the target polypeptide is a RAS polypeptide, optionally KRAS. In some embodiments, the target polypeptide is a regulator of apoptosis. In some embodiments, the target polypeptide is a regulator of autophagy. In some embodiments, the target polypeptide is a regulator of mitophagy. In some embodiments, the target polypeptide is a regulator of other essential cellular processes known in the art.

[0172] Another aspect of the disclosure includes a method of identifying at least one putative effector polypeptide as a protein transport polypeptide, the method comprising: transducing the ORFeome library into a plurality of cells; expressing at least one putative effector polypeptide of the ORFeome library, wherein the one or at least one putative effector polypeptide is fused to a targeting moiety that binds to the one or at least one target polypeptide; and determining whether said one or at least one putative effector polypeptide increases cell surface localization of said one or at least one target polypeptide. comprising Said putative effector polypeptide is a protein transport polypeptide if it increases the cell surface localization of said one or at least one target polypeptide.

[0173] In some embodiments, the target polypeptide is any cell surface polypeptide. In some embodiments, the cell surface polypeptide is an MHC class I polypeptide. In some embodiments, the target polypeptide is a mutant cell surface polypeptide. In some embodiments, the mutant cell surface polypeptide is shown in Table 2. In some embodiments, the mutant cell surface polypeptide is CFTRΔ508.

[0174] [Table 2] TIFF2025512531000005.tif231169TIFF2025512531000006.tif117169

[0175] In some embodiments, whether one or at least one putative effector polypeptide increases the cell surface localization of one or at least one target polypeptide is determined using fluorescence-activated cell sorting (FACS) and sequencing of the putative effector polypeptide identified as a protein transport polypeptide.In some embodiments, FACS is performed using an antibody that binds to the extracellular epitope of one or at least one target polypeptide.In some embodiments, one or at least one target polypeptide is fused with a FLAG tag.

[0176] Another embodiment of the present disclosure includes a method of treating muscular dystrophy, comprising administering to a subject KLHL40 or KLHL41 fused with a targeting moiety that binds to a target polypeptide. KLHL40 and KLHL41 are specific to skeletal muscle, making them particularly useful for targeting loss-of-stability mutants, for example, in muscular dystrophy. In some embodiments, the targeting moiety is a nanobody, ligand or antibody that binds to a target polypeptide, and the target polypeptide is a stability-loss mutant such as those in NEB, RYR1, DMD, SGCA, SGCB, SGCG, SGCD, DAG1, LAMA2, COL6A1, COL6A2, COL6A3, FLMNC, MYH7, MYH2, DES, MYOT, TTN, ACTA1, KLHL40, KLHL41, KBTBD13, TNPO3, LMNA, EMD, SYNE1, SYNE2, CAV3, BIN1, DNM2, MTM1, STIM1, STAC3, CACNA15, SPEG, CAPN3, DYSF, BIN1, ANO5, SIL1, DNAJB6, BAG3, HSPB5, TRIM32, LAMP2, VMA21, EPG5, SQSTM1, TRIM63.

[0177] In some embodiments, the target polypeptide is a human polypeptide. In some embodiments, the or at least one cell is a human cell.

[0178] Also contemplated herein is the use of any of the methods, processes, screening assays, fusion polypeptides, cells, nucleic acids, kits, or other articles of manufacture described herein.

[0179] [Table 3] TIFF2025512531000008.tif229168TIFF2025512531000009.tif229168TIFF202 5512531000010.tif229168TIFF2025512531000011.tif229168TIFF20255125310 00012.tif229168TIFF2025512531000013.tif233168TIFF2025512531000014.t if233168TIFF2025512531000015.tif233168TIFF2025512531000016.tif233168 TIFF2025512531000017.tif233168TIFF2025512531000018.tif233168TIFF202 5512531000019.tif233168TIFF2025512531000020.tif233168TIFF20255125310 00021.tif233168TIFF2025512531000022.tif233168TIFF2025512531000023.t if233168TIFF2025512531000024.tif233168TIFF2025512531000025.tif114167

[0180] The effectors described herein can also be used to conduct screens to identify small molecule binding agents, such as PROTACs, molecular glues and other heterobifunctional molecules.

[0181] Thus, another embodiment includes a screening assay for identifying ligands, optionally small molecule binders, of at least one recombinant proximity effector polypeptide, the screening assay comprising: contacting said one or at least one recombinant proximity effector polypeptide with a small molecule library, optionally in a high throughput screening assay, wherein said proximity effector polypeptide is selected from Tables 4, 5, 6 or 7; assessing whether binding has occurred between said recombinant proximity effector polypeptide and one or more small molecules of said library of small molecules. comprising The one or more molecules bound to said one or at least one recombinant proximity effector polypeptide are small molecule binders of said one or at least one recombinant proximity effector polypeptide.

[0182] Ligand, as used herein, refers to any compound or composition of matter, including small molecules, eg, molecules having a molecular weight of about 1000 Da or less.

[0183] In some embodiments, the ligand, optionally a small molecule binding agent, is a PROTAC. In some embodiments, the ligand, optionally a small molecule binding agent, is a molecular glue.

[0184] In some embodiments, the method further comprises making a product, optionally a therapeutic product.

[0185] Any of the groups or subgroups of effector and fusion polypeptides described herein can be used. Recombinant polypeptides can be produced using a variety of expression systems, including bacterial, mammalian, or insect systems. They can be fused with signal peptides so that they are secreted to facilitate purification.

[0186] Any of the methods described herein, including that described in Example 6, can be used.

[0187] Methods, processes and / or screening assays can be combined. For example, a method for identifying a close-proximal effector polypeptide as described herein can be performed. An effector can be selected and a screening assay as described herein can be performed to identify a small molecule binder. In another aspect, a method for making a heterobifunctional molecule is provided, comprising linking a ligand, such as a small molecule binder, of a close-proximal effector polypeptide and a ligand, such as a small molecule binder, of a target polypeptide via a linker, optionally a linker as described herein.

[0188] The identified ligands can be used for the preparation of a product, optionally a therapeutic product. In some embodiments, the method further comprises making the product, optionally a therapeutic product.

[0189] Moreover, the definitions and embodiments described in a particular section are intended to apply to other embodiments described herein where they are appropriate, as understood by those skilled in the art.For example, the following defines different aspects of the present disclosure in more detail.Each aspect thus defined can be combined with any other one or more aspects, unless otherwise specified.In particular, any feature indicated as being preferred or advantageous can be combined with any other one or more features indicated as being preferred or advantageous.

[0190] The above disclosure generally describes the present application. A more complete understanding can be obtained by reference to the following specific examples. These examples are set forth merely for illustrative purposes and are not intended to limit the scope of the present application. Changes in form and substitution of equivalents are contemplated where circumstances may suggest or render expedient. Although specific terms have been used herein, such terms are intended in a descriptive sense and not for purposes of limitation.

[0191] The following non-limiting examples illustrate the present disclosure. EXAMPLES

[0192] Example 1 material and method cell line HeLa Kyoto cells and all HEK293T cell lines, including the ABI1-EGFP-IRES-TagBFP reporter cell line used for screening, were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Cells were maintained in a humidified incubator at 37°C and 5% CO2 and routinely tested for mycoplasma contamination.

[0193] Lentivirus production Pooled ORFeome Lentiviral particles containing pLX301-[ORF]-PYL1 or pLX301-[ORF]-vhhGFP, psPAX2 (Addgene #12260) and pVSV-G (Addgene #8454) were produced by transfecting 293T cells in a ratio of 8:8:1. Transfections were performed in 15 cm dishes using Lipofectamine 2000 (Thermo Fisher Scientific, 11668019) according to the manufacturer's protocol. The medium was changed 24 hours after transfection. Supernatants were filtered (0.45 μM), pooled and harvested 72 hours after transfection. Small-scale virus production during the establishment of individual stable cell lines was also followed in 6-well plates using Lipofectamine 2000 reagent.

[0194] Generation of cell lines Clonal lines of the ABI1-EGFP reporter line expressing ABI1-EGFP-IRES-TagBFP (blasticidin, 6 μg / mL) were generated. Single cells were sorted and expanded, and clones showing high EGFP and TagBFP expression were selected for subsequent experiments. To generate 293T cells expressing doxycycline-inducible EGFP-tagged proteins, entry clones were picked from the hORFeome collection and subcloned into the Gateway-compatible pSTV6-TetO-ccdB-EGFP lentiviral plasmid. 293T cells were infected in the presence of 8 μg / mL polybrene and selected with 2 μg / mL puromycin 24 hours after infection. EGFP cell lines were induced with 1 μg / mL doxycycline and the highest GFP population was sorted (BD FACS Melody).

[0195] Plasmid cloning The unstable mutant targets were cloned into the pcDNA3.1-ccdB-GSlinker-EGFP-P2A-DsRed destination vector using gateway cloning technology.

[0196] For degradation assays, effectors were cloned into pcDNA3.1-ccdB-GSlinker-vhhGFP-SV40-TagBFP, pcDNA3.1-ccdB-GSlinker-vhhGFP, pcDNA3.1-vhhGFP-ccdB and pcDNA3.1-ccdB-GSlinker-PYL1 destination vectors.

[0197] For WDR5 endogenous protein expression, the effector coding sequences were cloned into the pcDNA3.4-ccdB-Mb(S4)WDR5-HA vector, allowing expression of each protein bearing a C-terminal monobody that recognizes WDR5 with high affinity ( Gupta et al., 2018 ).

[0198] For expression of exogenous KRas proteins, KRas was cloned into the pcDNA3.1-3xFLAG-ccdB destination vector. Effector coding sequences were cloned into the pcDNA3.4-ccdB-iDab-KRas-HA and pcDNA3.1-ccdB-iDab-LMO2-HA vectors, allowing expression of each protein with a C-terminal monobody that recognizes KRas or another protein, respectively (Tanaka et al., 2007 and 2011). Effectors were also cloned into the pcDNA3.4-ccdB-DARPinK19-HA and pcDNA3.1-ccdB-DARPinK19mutated-HA vectors, allowing expression of each protein with a C-terminal monobody that selectively binds to KRas or a mutant monobody that has lost the interaction, respectively (Bery et al., 2019).

[0199] For the generation of point mutations (UBE2B, FCGR3B and PRPS2 mutations), Quick-change site-directed mutagenesis was used, with standard point PCR procedures.

[0200] Generation of pooled ORFeome libraries Entry clones from the human ORFeome collection (v8.1) were collected into 40 normalized subpools containing ~384 ORFs each and cloned into lentiviral Gateway-compatible destination vectors pLX301-DEST-PYL1 or pLX301-DEST-vhhGFP. LR reactions were set up in duplicate with 150ng of each entry ORF subpool, combined with 1μl of Gateway LR clonase II in a total reaction volume of 5μl, and incubated overnight at room temperature in TE buffer. For the next 2 days, 1μl of LR enzyme was added to 4μl of TE, and 150ng of destination vector was added to each reaction. Subpools were transformed into chemically competent Stbl3 E. coli and plated on LB agar plates containing ampicillin (100μg / μl) and left at 30°C overnight. Colonies were counted to give >200x coverage, harvested into SOC on ice, pelleted, and maxiprepped on multiple columns based on dry pellet weight.

[0201] Pooled activation screening ORFeome libraries tagged with PYL1 or vhhGFP at the C-terminus were packaged into retiviral particles. A clonal GFP reporter cell line stably co-expressing ABI1-GFP was transduced at a low multiplicity of infection (MOI), with approximately 30% of cells surviving after puromycin (1 μg / mL) selection. Untransduced cells were completely eliminated under the same conditions. Enough cells were transduced to maintain >500-fold coverage of the library. For ORFeome-PYL1 libraries, mobilization was induced by treating cells with 100 μM abscisic acid (ABA, Sigma) for 48 h. In parallel, control cell batches were treated with the same total volume of DMSO. Next, cells were washed with PBS, treated with dissociation buffer (1 mM EDTA, 10 mM KCl, 150 mM NaCl, 5 mM sodium bicarbonate, 0.1% glucose) and resuspended in flow buffer (5 mM EDTA, 25 mM HEPES pH 7, 1% BSA, PBS). For each library, high GFP populations (top 10%) and low GFP populations (bottom 10%) were sorted (in duplicate) using BD FACS Melody (Stagljar lab, CCBR) and their genomic DNA was directly extracted using QIAmp DNA Blood Mini Kit (QIAGEN).

[0202] ORFeome sequencing Nested PCR was performed using total genomic DNA purified from the sorted population or at least 5 μg of genomic DNA from the unsorted population. Target ORFeome regions were amplified from genomic DNA using a primer targeting the T7 promoter (SEQ ID NO: 1: CGACTCACTATAGGGAGACCCAAG) and a primer targeting PYL1 (SEQ ID NO: 2: ATTCATCTTGCGTTGGTGCTCC) or a primer targeting vhhGFP (SEQ ID NO: 3: GCCACCAGACTCCACCAGTTGGAC). The products of this reaction were pooled per sample and further amplified for 10 more cycles with primers targeting outside the Gateway attB site (SEQ ID NO: 4: CAGTGTGGTGGAATTCTGCAG and SEQ ID NO: 5: CCGCCACTGTGCTGGATATC). Amplicons were then separated on a 1% agarose gel and visible PCR products excluding primer dimers were gel purified. DNA was quantified using the Quant-iT 1X dsDNA HS kit (Thermo Fisher Scientific, Q33232) and then 50ng per sample was processed for 6 cycles of amplification using the Illumina DNA Prep, (M) Tagmentation kit (Illumina, 20018705). 2μl of each purified final library was run on an Agilent TapeStation HS D1000 ScreenTape (Agilent Technologies, 5067-5584). Libraries were quantified using the Quant-iT 1X dsDNA HS kit (Thermo Fisher Scientific, Q33232) and pooled in equimolar ratios after size adjustment. Final pools were quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs, E7630L) and paired-end sequenced on an Illumina MiSeq.

[0203] Analysis of sequencing data from pooled activation screens The ORFeome reference sequence was indexed using STARaligner v2.7.8a. Reads from the ORFeome library were aligned with STAR aligner, allowing up to 3 mismatches. To identify degraders and stabilizers, the log2 fold change, p-value, and false discovery rate (FDR) were calculated for each ORF by comparing the change in counts between sorted samples and unsorted cells using the edgeR package (Robinson et al., 2010).

[0204] Degradation assays for individual effectors Degradation assays with individual effectors were performed in a 48-well cell culture format by transiently transfecting a clonal GFP reporter cell line stably co-expressing ABI1-GFP with 15 ng of a transfection control plasmid expressing triple FLAG-tagged DsRed and 200 ng of effector fused to vhhGFP or PYL1 using Lipofectamine 2000 (Life Technologies). For stabilization experiments of unstable mutants, 293T were co-transfected with 100 ng of effector fused to vhhGFP and 100 ng of target fused to GFP. For effector-PYL1 constructs, mobilization was induced by treating cells with 100 μM abscisic acid (ABA, Sigma) for 48 h. In parallel, a control batch of cells was treated with the same total volume of DMSO. 48 h after transfection, cells were washed with PBS, treated with dissociation buffer and resuspended in flow buffer. Cells were spun down in a microcentrifuge at 1000 rpm for 5 min, and cell pellets were resuspended in flow buffer and analyzed using a BD LSR Fortessa or BD LSR Fortessa X20 (BD Biosciences; University of Toronto Faculty of Medicine Flow Cytometry Facility).

[0205] Western blot HeLa cells (24-well plates) were transfected with 0.8 μg of effector fused to Mb(S4)WDR5 monobody. HeLa cells (12-well plates) were transfected with 0.4 μg of 3xFLAG-KRas and 0.4 μg of effector fused to iDab or DARPin K-RAS nanobody. 48 h after transfection, cells were harvested and lysed in 50 μL of CKS lysis buffer (20 mM Hepes-KOH pH 7.9, 100 mM NaCl, 1 mM MgCl2, 1 mM EDTA, 300 mM sucrose, 1 mM DTT, 0.1% Triton X-100, benzonase and protease inhibitor cocktail). After centrifugation at 16000g for 5 min at 4°C, cell lysates were analyzed by gel electrophoresis and Western blot using anti-WDR5 (D9E1I) antibody (Cell Signaling #13105), anti-HSP90a / b (F-8) antibody (Santa Cruz Biotechnology), and anti-HA antibody (Sigma H3663) as primary antibodies. Goat HRP-conjugated anti-rabbit IgG (Cell Signaling #7074S) or anti-mouse (Cell Signaling #7076S) were used as secondary antibodies.

[0206] Inhibitor treatment Cells were treated with 1 μM MLN4924 (Chemiteck) for 24 h, 100 nM bortezomib (Calbiochem) for 6 h, 20 μM cycloheximide (Sigma) for 6 h, 2.5 μM CB-5083 (Selleckchem) for 6 h, or 0.01% DMSO (Fisher bioreagents) for 6 or 24 h.

[0207] result Using functional proteomics screening, we identified a collection of human proteins that degrade or stabilize other proteins with high efficiency in a proximity-dependent manner. These proteins could potentially be exploited for induced proximity therapeutics such as targeted protein degradation (TPD) or targeted protein stabilization using heterobifunctional molecules (e.g., PROTACs) or molecular glues. The identified proteins possess characteristics that make them attractive for such development, including sensitivity to the shape of the induced complex as well as potency across multiple targets and compartments within the cell.

[0208] ORFeome-wide inductive proximity screening of protein stability effectors An unbiased approach to discover proximity-dependent effectors on a proteome scale was developed. In this approach, target and effector proteins are co-expressed in cells with tags that allow induction of their interaction. As proof of principle, proteins were identified that degrade or stabilize GFP fusion proteins in a proximity-dependent manner. A stable 293T cell line (Figure 1) expressing an internal ribosome entry site (IRES) and BFP following ABI1-GFP fusions was generated. This cell line was then transformed with an ORFeome-derived lentiviral pool library expressing 18,937 open reading frames (ORFs) fused to either vhhGFP, a nanobody that binds GFP (Caussinus et al., 2012; Saerens et al., 2005), or PYL1, a domain that binds ABI1 in the presence of abscisic acid (ABA) (Liang et al., 2011). This design allowed each protein in the ORFeome to be brought into close proximity to GFP-ABI1, either constitutively (vhhGFP) or by chemical dimerization (PYL1). Sorting cells with low or high GFP / BFP ratios followed by ORF sequencing identified proteins that degrade or stabilize GFP-ABI1, respectively (Figure 1B). Unexpectedly, there were many proteins present that were not regulators of ubiquitination, autophagy, or lysosomal degradation, suggesting that the proteome contains a previously unidentified reservoir of proximity-dependent regulators of protein stability. Effector proteins identified as degrading or stabilizing GFP-ABI1 are included in Table 4.

[0209] [Table 4] TIFF2025512531000027.tif223168TIFF2025512531000028.tif223168TIFF2025512531000029.tif223168TIFF2025512531000030.tif223168TIFF2025512531000031.tif223168TIFF2025512531000032.tif225168TIFF2025512531000033.tif225168TIFF2025512531000034.tif225168TIFF2025512531000035.tif225168TIFF2025512531000036.tif225168TIFF2025512531000037.tif225168TIFF2025512531000038.tif225168TIFF2025512531000039.tif225168TIFF2025512531000040.tif16168

[0210]

Table 5

[0211] Screen Hit Verification Hits selected from the screen were first validated by individually transfecting them as vhhGFP fusions into the original ABI1-GFP cell line and assessing their impact on reporter stability. Most degradation screen hits robustly degraded the reporter, but two hits assayed in the stability screen (DDI1 and PRPS2) both increased GFP signal (Figure 2). We next assessed the impact of several inhibitors of protein homeostasis pathways on effector function. Treatment of cells with the proteasome inhibitor bortezomib inhibited most degradation effectors, consistent with their dependence on proteasome function (Figure 2). In contrast, inhibition of translation with cycloheximide resulted in an overall increase in the degradation activity of the hits assayed (Figure 2). We next assayed two compounds that target more specific aspects of protein degradation: the neddylation inhibitor MLN4924 and the VCP / p97 inhibitor CB-5083 (REF). MLN4924, which specifically interferes with the function of cullin-RING type E3 ligases (CRLs), inhibited some CRL adaptor degraders but had little effect on others (Figure 2). Interestingly, not all CRLs were equally affected by MLN4924 treatment. For example, FBXL14 was less affected by MLN4924 than the related F-box proteins FBXL12 and FBXL15. CB-5083 also interfered with the degradation activity of some effectors but not others (Figure 2). CB-5083 did not generally affect the ability of E3 ligases to degrade the reporter, but it did inhibit the function of CRBN. CB-5083 inhibited the activity of LC3A, GABARAP, and GABARAPL2, three central regulators of autophagy.

[0212] Unexpected decomposer Although the screen hits were enriched for E3 ligases, they also contained unexpected factors and incompletely identified proteins. Several GPI-anchored proteins were identified and confirmed to be potent degraders, for example FCGR3B, LY6D, and LYPD3 (Figure 3A). In contrast, the prion protein (PRNP), a well-characterized GPI-anchored protein, was not detected in the screen hits or ABI1-GFP degradation when assayed individually (Figure 3A). To identify the molecular determinants of this difference, we focused on FCGR3B (also known as CD16b) and PRNP. Both proteins have a signal peptide followed by a folded domain and a GPI anchor signal, which consists of a hydrophilic linker, a cleavage site, and a hydrophobic tail (Figure 3B). We first replaced the folded domains of PRNP and FCGR3B with TagRFP, leaving the signal sequence and GPI anchor signal intact. These constructs behaved the same as the unmodified protein, suggesting that the folding domain is not involved in the degradation of GFP-ABI1 (Figure 3B). In contrast, when we then swapped the C-terminal hydrophobic tails of FCGR3B and PRNP, their activities were reversed: FCGR3B with a PRNP tail did not degrade the reporter, whereas PRNP with a FCGR3B tail did (Figure 3B). Thus, the C-terminal hydrophobic tail is responsible for the difference between PRNP and FCGR3B in the degradation assay.

[0213] We further defined the degradation-promoting region of FCGR3B using deletion constructs. Deletion of five amino acids immediately following the ω cleavage site abolished the activity of FCGR3B (Figure 3C). The C-terminus of the hydrophobic tail was more tolerant to deletion, with deletion of the last 10 amino acids having no notable effect on activity. However, deletion of amino acids 219–223 or substitution of aa221–225 with alanine significantly reduced reporter resolution of FCGR3B, suggesting that the central residues of the hydrophobic tail are functionally important. Finally, we asked whether preventing cleavage and processing of the C-terminal tail was functionally relevant. Mutating Ser201, which is immediately adjacent to the putative cleavage site, abolished activity (Figure 3A). Together, these results indicate that proper processing of the GPI anchor and the central core of the hydrophobic tail are required for the ability of FCGR3B to degrade the cytoplasmic GFP-ABI1 reporter.

[0214] Degron-mediated degradation in trans In the screen, several unidentified proteins were identified as potent degraders. One of these was the unidentified proline-rich protein PRR20A. Because PRR20A lacks a globular domain (as predicted by AlphaFold2), it was hypothesized that it might function by recruiting E3 ligases or other factors via a degron sequence. This hypothesis was supported by the observation that another vhhGFP screen hit was EID1 (Watanabe et al., 2015; Zhang et al., 2015), a protein that contains a degron that binds the E3 ligase adaptor FBXO21. Degrons can induce degradation of stable proteins in cis when fused to those proteins, whereas “canonical” degraders such as E3 ligases cannot. We therefore investigated whether EID1 and PRR20A (or fragments thereof) could induce degradation in both trans and cis. For trans degradation, we used a vhhGFP fusion targeting the ABI1-GFP reporter (Figure 4A). For cis degradation, we used fragments of PRR20A and EID1 fused to GFP in a vector that also expresses DsRed under the control of an internal ribosome entry site (IRES). In this case, the fluorescence ratio of the GFP fusion to the DsRed control serves as the stability reporter (Figure 4B). As expected, fusion of GFP to the C-terminus of EID1, which contains the FBXO21 degron, resulted in low GFP fluorescence, whereas fusing the N-terminus of EID1 to GFP was stable (Figure 4B). Full-length PRR20A fused to GFP was also unstable. Using multiple overlapping fragments of PRR20A, we identified the C-terminal residues 189–221 as the region that confers low stability to the GFP fusion (Figure 4B). Remarkably, this fragment was also able to degrade GFP-ABI1 when fused to vhhGFP, indicating that the same region retains both cis and trans degradation activity (Figure 4A). More generally, these results demonstrate that guided proximity screens can identify degraders that operate via multiple mechanisms.

[0215] UBE2B is an extremely potent degrader One of the most potent degraders identified was the E2-conjugating enzyme UBE2B. UBE2B was a hit in both the vhhGFP and PYL1 fusion screens (Figure 2). UBE2B was a particularly interesting effector because E2 enzymes have not previously been utilized for targeted protein degradation. To further characterize UBE2B, we investigated whether its catalytic activity is required for degradation. The active site of UBE2B contains Cys88, which transiently binds ubiquitin via a transthiolation reaction before ubiquitin is transferred to a substrate or a HECT-type E3 ligase (Stewart et al., 2016). Mutation of Cys88 to alanine (UBE2B C88A) completely abolished activity, indicating that transthiolation is required for proximity-induced degradation by UBE2B (Figure 5A).

[0216] Because E2s always function in tandem with E3 ligases to ubiquitinate their targets, we next asked whether UBE2B requires an E3 partner to promote proximity-dependent degradation. UBE2B interacts with the E3 ligase RAD18 through two interfaces on opposite sides of the protein. We introduced disruptive mutations in the interface that interacts with the RAD18 RING finger (N65R, T99R), in the interface that contacts the R6BD domain of RAD18 (S25R, V39Q), or a combination of all four of these mutations. All mutants were still active in the degradation assay, indicating that unexpectedly, E3 binding is not required for the ability of UBE2B to degrade targets in a proximity-dependent manner (Figure 5B).

[0217] To examine whether E2-conjugating enzymes are generally potent degraders, we measured the activity of 30 of 38 human E2s in a degradation assay (Figure 5C). Only a few E2s showed high activity in this assay. UBE2B, together with its paralog UBE2A, which is 95% identical in sequence, was the most potent degrader (Figure 5C). In addition, the related E2s UBE2D1 and UBE2D4 were also highly active in the assay. Of note, UBE2D4 can also ubiquitinate substrate proteins in vitro in an E3-independent manner (David et al., 2010). These results indicate that despite the highly conserved fold, there are inherent functional differences between E2 family members. More generally, these results suggest that some (but not all) E2s can be utilized for targeted protein degradation.

[0218] Identification of proximity-dependent stabilizers Several stabilizers were also discovered in the screen. For example, the deubiquitinase OTUB1 was a hit in the PYL1 / ABI1 proximity screen. OTUB1 has been used as an effector of deubiquitinase targeting chimeras (DUBTACs) (Henning et al., 2021), indicating that this screen identified relevant proximity-dependent effectors. Notable hits in the vhhGFP screen were the ubiquitin-dependent protease DDI1 (Yip et al., 2020) and the pyrophosphokinase PRPS2. Furthermore, while optimizing the large-scale screen and assaying multiple E3 ligase fusions with vhhGFP, we noticed that the putative ubiquitin ligase KLHL40 did not degrade the reporter, but rather stabilized it (Figure 2A). Thus, DDI1, PRPS2 and KLHL40 were focused on as putative stabilizing effectors.

[0219] We first investigated whether these proteins stabilize the reporter through indirect effects on protein homeostasis or whether they require proximity to the reporter. Removal of the vhhGFP tag abolished activity in the degradation assay, indicating that these proteins do not affect protein degradation nonspecifically (Figure 6A). To identify the regions required for the activity of these proteins, we examined deletion and mutation constructs. DDI1 contains an N-terminal ubiquitin-like domain and a C-terminal retrovirus-like aspartic protease domain (Figure 6B). Unexpectedly, multiple fragments of DDI1 were able to stabilize the reporter, indicating that its activity is not restricted to a single region (Figure 6B). For PRPS2, we examined constructs with mutations in the catalytic site to examine whether its enzymatic activity is required for stabilization. Mutant PRPS2 stabilized the reporter as well as the wild-type construct. This indicates that PRPS2 likely functions noncatalytically as a stabilizer (Figure 6C).

[0220] KLHL40 belongs to a large BTB-BACK-Kelch domain family, and deletion constructs showed that the BTB domain is sufficient and necessary to stabilize the reporter in a proximity-dependent manner (Fig. 6D). Furthermore, replacement of the BTB domain of KLHL40 with the same domain from a closely related family member, KLHL6, which is a robust degrader, resulted in KLHL40 becoming a degrader and KLHL6 becoming a stabilizer (Fig. 6E). In many BTB-BACK-Kelch domain proteins, the BTB domain interacts with CUL3, enabling them to function as substrate adaptors for the CUL3-RING E3 ligase (CRL) complex. However, in KLHL40, the Cul3-interacting motif is not conserved (Fig. 6F), suggesting that it does not function as part of the CRL complex. Interestingly, deletion of KLHL40 in mice destabilizes the muscle intermediate filament proteins nebulin and LMOD3 (Garg et al., 2014; Ravenscroft et al., 2013), findings that, taken together with these results, strongly suggest that the endogenous function of KLHL40 is protein stabilization and that this activity can be retargeted to non-physiological substrates by induced proximity.

[0221] Sensitivity of effectors to tag position To examine whether the effectors identified in the screen were restricted to a particular geometry, we tagged 38 effectors with either an N- or C-terminal vhhGFP tag and assayed their activity in the original reporter cell line. Some effectors (such as KLHL22) only functioned as C-terminal fusions, whereas others (such as UBE2B, FBXL12 and FBXL14) were equally potent regardless of tag position (Figure 7). Similarly, DDI1 and KLHL40 stabilized the reporter as both C- and N-terminal fusions.

[0222] Effector specificity for different substrates We also addressed whether the top effectors were specific to the original reporter construct or were equally efficient with multiple different GFP-tagged proteins. To this end, we generated 11 stable cell lines expressing diverse GFP-tagged proteins localized to different cellular compartments and assayed the activity of the YY effectors as vhhGFP fusions. These effectors showed strikingly different patterns, some extremely potent against multiple targets, while others acted on only a limited number of targets (Figure 8). Figure 8 (bottom bar) shows that in this assay, effectors on the right side of the parental representation, from GET4 to KLHL40, are stabilizers, whereas effectors on the left side of the parental representation, from RNF166 to TMEM204, are degraders. These results confirm that this screen did not only reveal effectors targeting the GFP portion of the reporter. Interestingly, CRBN was a potent degrader of almost all targets (except GFP-FUS and GFP-NRAS), whereas VHL showed extremely limited effects beyond the original GFP-ABI1 reporter. Notably, each target identified a unique complement of effectors that functioned, including constructs that localized to the same compartment (e.g., GFP-ABI1 and GFP-RLuc). These results indicate that proteins have strikingly different “preferences” for degraders and stabilizers, suggesting that expanding the toolbox of degraders will be extremely beneficial for the development of next-generation PROTACs and molecular glues. However, there are also effectors with various targets (e.g., UBE2B is a degrader of various target polypeptides). It is reasonable to expect that robust effectors such as UBE2B will act as effectors with various target polypeptides.

[0223] We found that KLHL40, PRPS2, and DDI1 exhibited stabilizing effects on almost all of the targets assayed (Figure 8). We therefore investigated whether these effectors could stabilize proteins that are intrinsically unstable due to pathogenic mutations. We selected five different unstable mutants representing different cellular compartments and fused them with GFP-P2A-DsRed. The P2A motif induces ribosomal skipping during translation, facilitating the use of DsRed as an internal control for protein stability. All three effectors stabilized the mutants more efficiently than Renilla luciferase (Figure 9). Thus, these effectors represent a novel class of proximity-dependent stabilizers that can be exploited to stabilize targeted proteins.

[0224] Targeting non-GFP-tagged and endogenous proteins with novel effectors Previously, all experiments were performed with GFP-tagged proteins, leaving open the possibility that the screens identified effectors that targeted the GFP moiety and not the protein fused to it. We therefore investigated whether effectors would still function if they reached their target by alternative means. To do so, we used two previously developed RAS binders: an intracellular single-domain antibody (iDab) and a designed ankyrin repeat protein (DARPin), both of which bind KRAS with high affinity (Bery et al., 2019, 2020; Tanaka and Rabbitts, 2003). Due to the difficulty in detecting endogenous Ras, we co-transfected 3xFLAG-V5-tagged KRAS with effectors fused to binders. Renilla luciferase fused to binders did not affect KRAS levels, whereas most degradative effectors downregulated KRAS as iDab and DARPin fusions (Figures 10A and 10B). Notably, KLHL40 stabilizes KRAS, consistent with its function with a GFP-tagged protein. These results confirm that effectors do not simply target GFP but can accommodate multiple different strategies for induced proximity.

[0225] Finally, to examine whether the effectors can target endogenous proteins, we fused several effectors to monobodies that bind the chromatin regulator WDR5 (Gupta et al., 2018). UBE2B, FBXL12, and KBTBD7 effectively reduced the levels of endogenous WDR5, indicating that these effectors can also target native proteins (Figure S10C).

[0226] In summary, we have identified a collection of effector proteins that can be utilized for therapeutic targeted protein degradation and stabilization approaches. These results show that these effectors (e.g., UBE2B) are more potent and less sensitive to shape than existing TPD effectors, suggesting that they offer greater versatility. Many of the newly identified effectors are not E3 ligases, suggesting that TPD may be expanded beyond this class of proteins.

[0227] Systematic analysis of E3 ligases Because many of the degraders and stabilizers were canonical E3 ligases, we decided to examine a large panel of E3 ligases by individually transfecting them as vhhGFP fusions into the original GFP-ABI1 cell line and assessing their effect on reporter stability (Figure 11A).

[0228] Currently, two major E3 ligases utilized in targeted protein degradation (TPD), namely, the thalidomide target cereblon (CRBN) and the tumor suppressor VHL, appear to be robust degraders (Figure S11B) and were included in the top 20 degraders. Other Cullin-RING ubiquitin ligase (CRL) adaptor proteins also strongly induced GFP degradation (Figure S11B). In addition to several SOCS-box domain proteins such as CISH and SOCS5, the degrader hits included the factor F-box domain proteins FBXL15, FBXO3, FBXO40, FBXO11, FBXW5, FBXL12, BTRC and FBXL14. Other prominent CRL adaptor-type degraders included the BTB (POZ) domain proteins GMCL1, KBTBD7, KLHL12, GAN, KBTBD2, RHOBTB1 and KLHL6. Conversely, transfection of the F-box domain proteins FBXL8, FBXO2, CDCA3, or SKP1 led to robust GFP stabilization, as did the SOCS-box domain proteins ASB9 and ELOB, and some BTB (POZ) domain proteins, such as KLHL40, ZFP161, KCTD17, ZBTB18, ZBTB7B, KCTD5, ZBTB20, ZBTB43, KEAP1, ZBTB10, and KLHL41.

[0229] Of 137 E3s assayed, 24 effectors, including TRIM31, RCHY1, and RNF166, reduced GFP intensity by at least half (relative GFP intensity <0.5) (Fig. 1B). In contrast, none of the nine HECT (Homologous to E6AP C-Terminus)-type E3s assayed induced GFP degradation. HECT family E3 ligases are often autoinhibited in the absence of natural substrates, which may explain the lack of activity in the induced proximity context.

[0230] Systematic analysis of DUBs In addition to E3 ligases, we also systematically analyzed the impact of deubiquitinases on the stability of target proteins. To identify potent DUBs, we assayed them against the unstable disease mutant GNMT H176N fused to GFP. Forty-seven DUBs as vhhGFP fusions were individually co-transfected with the GNMT H176N-GFP construct and their impact on the stability of the fusion protein was assessed (Figure S12A). These DUBs represented all major families, including ubiquitin-specific proteases (USPs), ubiquitin C-terminal hydrolases (UCHs), ovarian tumor proteases (OTUs), Machado-Josephine domain (MJD) proteases, zinc-dependent metalloenzymes (JAMMs) and SUMO proteases. Interestingly, robust stabilizers across several different DUB families were found (Figure S12B). The ubiquitin C-terminal hydrolases USP13, USP39, USP38 and USP14, along with the ubiquitin C-terminal hydrolase UCHL1 and the ovarian tumor protease OTUB1, were particularly potent in stabilizing the mutant constructs.

[0231] Identification of proximity-dependent stabilizers We next investigated whether DUB catalytic activity is required for stabilization. Inactivating the catalytic cysteine ​​of USP13 (USP13C345A) reduced its stabilizing effect on USP13, whereas disrupting the two ubiquitin-binding domains of USP13 (USP13M664E / M739E) abolished its activity towards GNMTH176N (Figure S13A). A catalytically inactive mutant of USP3815 (USP38C454S / H857A / D918N) was similarly inactive in the assay (Figure S13B). Thus, these two DUBs appear to function via a mechanism that requires catalytic activity and ubiquitin binding. In contrast, USP39 is a pseudoenzyme that has no deubikinase activity in vitro. Moreover, mutating its ubiquitin-binding domain (USP39C136A / C139A) did not affect activity (Fig. S13C), suggesting that USP39 functions in a different way in this case. Similarly, the catalytic activity of OTUB1 was negligible (Fig. S13D). However, OTUB1 also has additional noncatalytic functions, as it can stoichiometrically inhibit the activity of E2. A triple mutant construct defective in E2 binding and inhibition was assayed, which predicted that it would also be defective in binding K48-linked ubiquitin chains. This mutant was unable to stabilize GNMTH176N (Fig. S13F), strongly suggesting that OTUB1 acts in this case through its E2 inhibitory function or its ability to bind K48-linked ubiquitin chains.

[0232] Figure 13A-D shows the requirements for deubiquinase function. For example, the catalytic cysteine ​​C91 is not required for OTUB1-mediated target protein stabilization, which was highly unexpected. Mutants of USP13 (Figure 13A), USP38 (Figure 13B), USP39 (Figure 13C), and OTUB1 (Figure 13D) were fused with vhhGFP and tested in stabilization assays using GNMTH176N-EGFP. Statistical significance was calculated by one-way ANOVA with Dunnett's multiple comparison correction. * , p < 0.05; ** , p < 0.01; *** , p<0.001.

[0233] Effector recruitment via diverse affinity tags Recently, a comprehensive study revealed striking differences in the sensitivity of kinases to 91 diverse PROTACs. Some kinases, such as ARAF and IKBKE, were not degraded by any of the compounds that engage VHL or CRBN. These two kinases were tagged with 13-aa ALFA tags, and selected effectors were tagged with NbALFA nanobody tags. Consistent with the chemical proteomics approach, it was observed that VHL-NbALFA was unable to degrade either kinase in this assay (Figure 15A). In contrast, many novel effectors were much more efficient. For example, FBXL12, FBXL15, KLHDC2 and the GPI-anchored protein FCGR3B potently reduced the levels of ARAF, whereas KLHL40 increased the levels (Figure 15A).

[0234] The indicated effectors fused with Nb(ALFA)-Myc were co-transfected with ALFA-3xFLAG-ARAF into 293T cells, followed by Western blotting for ARAF (anti-FLAG), effectors (anti-Myc), and Hsp90 (Figure 15A). Stable HCT116 cell lines expressing doxycycline-inducible effectors fused with WDR5-targeting monobody Mb(WDR5) were treated with or without doxycycline (Figure 15B). Endogenous WDR5 levels and effector expression were assessed by Western blotting (Figure 15B top). Quantification of WDR5 levels after doxycycline induction (Figure 15B bottom). Statistical significance was calculated with an unpaired t-test with false discovery rate correction for multiple hypotheses. This provides further evidence that top effectors can degrade cellular targets that are difficult to degrade (such as ARAF) or endogenous proteins (such as WDR5).

[0235] Targeting endogenous proteins with novel effectors Finally, we evaluated the potency of the effectors against two endogenous proteins, WDR5 and BCR-ABL. Selected effectors were cloned into inducible lentiviral vectors fused at their C-terminus to specific WDR5 and BCR-ABL monobodies to generate stable HCT116 (for WDR5) and K562 (for BCR-ABL) cells. While VHL was unable to degrade endogenous WDR5 and CRBN was only slightly effective, several novel effectors robustly degraded WDR5 in a doxycycline-dependent manner (Figure 15B). Notably, FBXL12 and FBXL15 were also very efficient in this case. Results with BCR-ABL in K562 cells were similar: FBXL12, FBXL15, KBTBD7, KLHDC2, and KLHL6 degraded BCR-ABL very potently, whereas CRBN and VHL showed no significant effect (Figure 14A).

[0236] Since BCR-ABL is an essential protein in K562 cells, we next assessed the effect of degrader fusions on cell proliferation. The monobody alone inhibited the function of BCR-ABL101, but when fused to the inactive control, RLuc, K562 cell proliferation was only partially inhibited (Figure 14B). However, when the monobody was fused to a novel effector, cells stopped proliferating completely or proliferated significantly slower (Figure 14B). In contrast, CRBN had no further effect on proliferation (Figure 14B). Thus, many effectors identified in the unbiased ORFeome screen are significantly better at degrading and inhibiting the function of BCR-ABL, the hallmark oncogenic fusion of chronic myeloid leukemia.

[0237] Figure 14A-B shows the results of benchmarking novel effectors using multiple recruitment strategies and therapeutically relevant targets. In particular, Figure 14A-B shows the potency of top effectors to degrade endogenous BCR-ABL and inhibit cell proliferation. Stable K-562 cell lines expressing doxycycline-inducible effectors fused to monobodies that bind to the SH2 domain of BCR-ABL were treated with doxycycline or left untreated (Figure 14A). Endogenous BCR-ABL levels and expression of effectors were assessed by Western blotting (Figure 14A top). Figure 14A bottom shows quantification of BCR-ABL levels after doxycycline induction. Statistical significance was calculated with an unpaired t-test with false discovery rate correction for multiple hypotheses. Figure 14B shows the proliferation of K562 cells after doxycycline induction of the indicated effector fusion constructs. The monobody itself affects cell proliferation (compare the scale of the top left graph for RLuc-vhhGFP with the top right graph (Figure 14B)).

[0238] Example 2: Viability screening assay First, a target polypeptide of interest (such as KRAS) is tagged with GFP or ABI1 (or other tag) to make it the only source of that protein in the cell. This is accomplished by tagging the endogenous locus or ectopically expressing a tagged version to knock out the endogenous copy. Then, putative effector polypeptides contained in a collection, e.g., a library (e.g., ORFeome), fused to a targeting moiety that binds the target polypeptide or the tag fused to the target polypeptide (e.g., vhhGFP, PYL1 or other antibody), are screened. Putative effector polypeptides that disappear from the collection over time are then identified. Identification of putative effectors that disappear during the screening assay is performed, for example, by sequencing DNA encoding putative effector polypeptides present in surviving cells and determining which putative effector polypeptides are present or absent in such cells by comparing the effector genes present in the original collection with those present after screening. This indicates that the interaction of the putative effector polypeptide with the target polypeptide is lethal to the cell. These factors may include not only effector polypeptides that degrade the target, but also other effector polypeptides that inhibit the function of the target by other means.

[0239] Alternatively, the method can be performed without adding a tag to the target polypeptide, and the putative effector polypeptide can be fused to a nanobody or other targeting moiety that binds to the target polypeptide, and screening is performed against the untagged endogenous target polypeptide.

[0240] Example 3: Protein trafficking screening assay First, a cell surface protein (such as CFTR delta508) is tagged with GFP, ABI1 or other tag. The putative effector polypeptides in the collection, e.g., library, are then screened for putative effector polypeptides that increase cell surface localization of the target polypeptide (cell surface protein). This can be done by FACS using an antibody against an extracellular epitope of the protein or by adding another epitope (such as a FLAG tag) to the extracellular portion of the protein. FACS sorting followed by sequencing of clones with high surface expression identifies putative effector polypeptides that enhance transport.

[0241] Alternatively, the method can be performed without adding a tag to the target polypeptide, and the putative effector polypeptide can be fused to a nanobody or other targeting moiety that binds to the target polypeptide, and screening is performed against the untagged endogenous target polypeptide.

[0242] Example 4: Indirect proximity interaction screening The effector does not have to be directly fused to a proximity-inducing protein such as vhhGFP or PYL1. For example, it can be fused to a small tag that facilitates interaction with a secondary factor that interacts with the target. Such examples include SpyTag / SpyCatcher, SnoopTag / SnoopCatcher, HiBiT / LgBit, or GFP11 / GFP1-10. SpyCatcher and SnoopCatcher are proteins that form covalent bonds with SpyTag and SnoopTag peptides, respectively. LgBit and GFP1-10 are fragments of Nanoluc luciferase and GFP, which bind with high affinity to HiBiT and GFP11 peptides, respectively. The effector can be brought into proximity with the target by fusing with SpyTag in cells expressing SpyCatcher fused with PYL1 or another moiety that induces interaction with the target. Thus, the effector is induced to interact with the target with the help of a secondary factor (in this case the SpyCatcher-PYL1 fusion).

[0243] Separate readout (not a fluorescent protein fusion) In addition to fluorescent proteins, targets can be fused with small epitope tags (such as FLAG, V5, Myc, ALFA or HA) and their abundance detected with epitope tag antibodies. Alternatively, completely untagged (endogenous) targets can be detected with antibodies against the targets using a flow cytometer. In these cases, the effector is brought into close proximity to the target using nanobodies, ScFv fragments, monobodies, affibodies or similar affinity reagents against the epitope tag or the target itself.

[0244] For antibiotic selection screens, targets are tagged with antibiotic resistance markers (e.g., puromycin N-acetyltransferase or blasticidin deaminase) or negative selection markers (e.g., thymidine kinase or deoxycytidine kinase DCK). *In the first case, effectors that increase the levels of the target increase the levels of an antibiotic resistance marker. These cells are then more resistant to the antibiotic, facilitating the discovery of stabilizing effectors. In the second case, effectors that decrease the levels of the target also decrease the levels of a negative selection marker. Cells expressing thymidine kinase are sensitive to ganciclovir, whereas mutant deoxycytidine kinase (DCK * ) are sensitive to 2-bromovinyldeoxyuridine (BVdU); treatment of cell populations with these compounds selects for effectors that degrade their targets.

[0245] Example 5: Strong effector A number of robust degraders and stabilizers were identified by the methods described in Examples 1 and 2. For example, the following groups were identified with equivalent or increased activity compared to CRBN or VHL: GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, RNF126. ZER1 also had higher activity compared to CRBN or VHL.

[0246] [Table 6] TIFF2025512531000054.tif163169

[0247] Example 6: Discovery of small molecule ligands / binders for effector proteins and their targets There are several options for identifying binders for effectors or targets. In most cases, recombinant effector and / or target proteins are first purified and then chemically screened.

[0248] To identify small molecule binders without considering the mechanism of action (e.g., inhibition or activation), several screening methods can be used. These methods typically focus on measuring binding interactions or changes in protein properties upon binding to a ligand. These techniques include:

[0249] Surface Plasmon Resonance (SPR): SPR measures the binding affinity and kinetics of small molecules interacting with target proteins in a label-free manner, without the need for information about their mechanism of action.

[0250] Nuclear Magnetic Resonance (NMR) Spectroscopy: NMR can detect changes in the spectrum of proteins upon binding to small molecules, allowing identification of binding agents without the need to know their mechanism of action.

[0251] Differential scanning fluorimetry (DSF) or thermal shift assay (TSA): By monitoring the thermal stability of small molecule binding to a target protein, binders can be identified without prior knowledge of their functional effect.

[0252] Isothermal titration calorimetry (ITC): ITC measures the heat generated or absorbed upon interaction between small molecules and their target proteins, providing binding affinity and stoichiometry data without identifying the mechanism of action.

[0253] Microscale thermophoresis (MST): MST detects the change in the movement of a fluorescently labeled target protein in a temperature gradient when it binds to a small molecule, providing information about the interaction without considering the mode of action.

[0254] Biolayer Interferometry (BLI): This label-free optical technique measures changes in interference patterns caused by the binding of small molecules to immobilized target proteins, without the need for information about the mechanism of action.

[0255] X-ray crystallography: This method can determine the three-dimensional structure of protein-small molecule complexes, providing insight into intermolecular interactions and binding modes, regardless of mechanism of action.

[0256] DNA-encoded library (DEL) screen: an innovative screening method in which a unique DNA barcode is covalently attached to each small molecule in a library, allowing parallel screening of large compound libraries and identifying binders by amplifying and sequencing the DNA barcodes of bound molecules.

[0257] Affinity Selection-Mass Spectrometry (AS-MS): This technique involves incubating a target protein with a compound library, followed by affinity purification to isolate small molecules that bind to the protein. The bound molecules are then identified using mass spectrometry. AS-MS can detect binders without prior knowledge of their mechanism of action.

[0258] Covalent fragment screen: A specialized form of fragment-based screening that focuses on identifying small molecules that form covalent bonds with a target protein. This approach primarily detects covalent interactions rather than functional effects, and therefore can identify binders regardless of mechanism of action.

[0259] These techniques focus on detecting binding events or changes in protein properties upon ligand binding and can identify binders without prior knowledge of the functional effect. After potential binders are identified, further assays can be performed to characterize their mechanism of action, such as activation or inhibition.

[0260] If neither the effector nor the target has a ligand, two separate screens will be performed to find them, followed by a medicinal chemistry effort to link the identified binders with various linkers and characterize these heterobifunctional molecules for their ability to induce the interaction between the target and the effector.

[0261] Several approaches for de novo discovery of molecular glues can be used, for example, luciferase complementation (each protein has half of a luciferase and interaction results in luminescence), yeast two-hybrid assays with reporter genes, AlphaScreen (a proximity-based luminescence / fluorescence assay), yeast mating-based interaction assays (SynAg), FRET or TR-FRET.

[0262] Example 7 material and method Materials and methods are as described in Example 1 or as described herein.

[0263] cell line HeLa Kyoto, HCT116, and all 293T cells, including the EGFP-ABI1-IRES-TagBFP reporter cell line used in screening, were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. K562 cells were cultured in RPMI supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. 293T, K562, and HCT116 Tet-inducible cell lines were maintained in their respective regular media supplemented with 10% Tet system approved FBS (Gibco A47363-01) and 1% penicillin-streptomycin. Cells were maintained in a humidified incubator at 37°C and 5% CO2 and routinely tested for mycoplasma contamination.

[0264] Plasmids Unstable mutant targets were cloned into the pcDNA3.1-[ORF]-GSlinker-EGFP-P2A-DsRed destination vector using Gateway cloning technology. For vhhGFP and PYL1 degradation assays, entry clones were picked from the hORFeome collection and subcloned into the pcDNA3.1-[ORF]-GSlinker-vhhGFP-SV40-TagBFP, pcDNA3.1-[ORF]-GSlinker-vhhGFP, pcDNA3.1-vhhGFP-ORF and pcDNA3.1-[ORF]-GSlinker-PYL1 destination vectors. For WDR5 endogenous protein degradation, effector coding sequences were cloned into the pSTV6-TetO-[ORF]-Mb(S4)WDR5-HA lentiviral plasmid, allowing expression of each protein with the terminal monobody Mb(S4) that recognizes WDR5 with high affinity. For BCR-ABL endogenous protein degradation, effector coding sequences were cloned into the pSTV6-TetO-[ORF]-AS25-HA lentiviral vector, allowing expression of each protein with the C-terminal high affinity monobody AS25 directed at the Src homology 2 (SH2)-kinase domain interaction interface. To generate ALFA-tagged ARAF or IKBKE, their open reading frames were cloned into the Gateway-compatible pcDNA3.4-ALFA-3xFLAG-ORF and pcDNA3.4-[ORF]-3xFLAG-ALFA vectors, respectively. ALFA nanobody-fused effectors were generated by subcloning each effector gene into the Gateway-compatible pcDNA3.4-[ORF]-NbALFA-Myc plasmid.

[0265] For ectopic K-Ras expression, KRAS cDNA was cloned into the pcDNA3.1-3xFLAG-ORF destination vector. Effector coding sequences were cloned into the pcDNA3.4-[ORF]-Ras iDab-HA and pcDNA3.1-[ORF]-LMO2 iDab-HA vectors, allowing expression of each protein with a C-terminal monobody recognizing K-Ras or a control protein (LMO2), respectively.

[0266] Point mutants were generated by site-directed mutagenesis and deletion constructs were generated by PCR.

[0267] Generation of stable cell lines Monoclonal 293T cell lines expressing EGFP-ABI1-IRES-TagBFP were generated by sorting single cells by FACS after lentiviral infection and blasticidin (6 μg / ml) selection. Clones showing high EGFP and TagBFP expression were selected for further assays. To generate inducible doxycycline-inducible cell lines, effectors were subcloned into Gateway-compatible pSTV6-TetO-[ORF]-EGFP, pSTV6-TetO-[ORF]-AS25-HA or pSTV6-TetO-[ORF]-Mb(S4) WDR5-HA lentiviral plasmids. 293T and HCT116 cells were infected in the presence of 8 μg / mL polybrene and selected with 3 μg / ml puromycin 24 h postinfection. K562 cells were infected in the presence of 8 μg / ml polybrene by spinning at 3000 rpm for 90 min and selected with 3 μg / ml puromycin 24 h postinfection.

[0268] To increase the abundance of high EGFP expression associated with the fusion protein, high density infected with pSTV6-TetO-[ORF]-EGFP lentivirus was induced with 1 μg / ml doxycycline and the high EGFP population was selected.

[0269] Analysis of sequencing data from pooled activation screens STAR aligner v2.7.8a was used to index the ORFeome reference sequence. Reads from the ORFeome library were aligned with STAR aligner, allowing up to 3 mismatches. To identify degrader and stabilizer effectors, the edgeR package was used to calculate log2 fold change, p-value, and false discovery rate (FDR) for each ORF by comparing the change in counts between sorted samples and unsorted cells. For the degradation screen, a 5% false discovery rate cutoff was used, with a 4-fold change in normalized read counts between the bottom 10% and unsorted cells. For the stabilization screen, a 1% FDR cutoff was used, with a 4-fold change in normalized read counts.

[0270] K-Ras degradation assay HeLa cells were seeded in 12-well plates (100,000 cells / well) and transfected 24 hours later with 200 ng of 3xFLAG-KRAS and 400 ng of Ras iDab or LMO2 iDab fusion effectors. Cells were harvested 48 hours post-transfection and subjected to Western blot analysis.

[0271] Endogenous protein degradation assay K562 and HCT116 stable cell lines were seeded in 12-well plates (1 × 10 6 K562 cells were incubated with 1 μg / ml doxycycline or 1% DMSO for 48 h. HCT116 cells were incubated for 24 h to allow cells to acclimate, and then treated with 1 μg / ml doxycycline or 1% DMSO for an additional 24 h. Cells were then harvested and subjected to Western blot analysis.

[0272] ALFA-tag kinase degradation assay ALFA tag kinase degradation assays were performed in a 12-well cell culture format (100,000 cells / well). After 24 hours, 293T cells were transiently transfected with 1 μg of pcDNA3.4-ALFA-3xFLAG-TEV-ARAF or pcDNA3.4-IKBKE-3xFLAG-ALFA using Lipofectamine 2000 (Life Technologies) according to the manufacturer's instructions. Cells were harvested 16 hours post-transfection and subjected to Western blot analysis.

[0273] Western blot Cells were lysed in CSK lysis buffer (20 mM Hepes-KOH pH 7.9, 100 mM NaCl, 1 mM MgCl2, 1 mM EDTA, 300 mM sucrose, 1 mM DTT, 0.1% Triton X-100, benzonase, and protease inhibitor cocktail). For BCR-ABL, WDR5, ARAF, and IKBKE degradation assays, cells were lysed in NP40 lysis buffer (50 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP40, and protease inhibitor cocktail). After centrifugation at 16,000g for 5 min at 4°C, equal amounts of each cell lysate were analyzed by gel electrophoresis and Western blot using anti-WDR5 (D9E1I; Cell Signaling #13105), anti-HSP90 (F-8; Santa Cruz Biotechnology), anti-HA (Sigma #H6908), anti-c-ABL (Cell Signaling #2862T), anti-MYC (BioLegend #626802), and anti-FLAG (DSHB #12C6c) as primary antibodies. Goat HRP-conjugated anti-rabbit IgG (Cell Signaling #7074S) or anti-mouse IgG (Cell Signaling #7076S) were used as secondary antibodies. MonoRabTM HRP rabbit anti-camelid VHH antibody (GenScript #A01861) was used to detect vhhGFP fusion proteins. Chemiluminescent signals were generated using Immobilon Western Chemiluminescent HRP Substrate (Millipore) and detected with MicroChemi4.2 (FroggaBio).

[0274] Proliferation assay of stable K562 cell lines Proliferation assays were performed in a 96-well culture format (1,000 cells / well). Cells were grown in the presence of 1 μg / ml doxycycline or 1% DMSO for the indicated times. Doxycycline or DMSO was freshly added after 72 h. Cell viability was measured using CellTiter Glo (Promega) according to the manufacturer's instructions. Luminescence intensity was measured using a multimode microplate reader (Biotek).

[0275] Immunofluorescence HeLa Kyoto cells were seeded at 4,500–5,000 cells / well in opaque black, clear-bottom 96-well plates. The next day, cells were transfected using XtremeGENE 9 (Roche) according to the manufacturer's instructions. 48 h after transfection, cells were washed with 1× PBS and then fixed with 4% paraformaldehyde in DMEM containing 10% FBS for 15 min at room temperature. After fixation, cells were washed three times with 1× PBS, permeabilized with 0.1% Triton X-100 / 1× PBS, and then blocked with blocking buffer (0.1% Triton X-100 / 1× PBS / 1% BSA) for 30 min at room temperature. After blocking, fixed cells were incubated with MonoRabTM iFluor 647 rabbit anti-camelid VHH antibody (GenScript A01994) and Hoechst 33342 diluted in blocking buffer for 1 h at room temperature. Finally, cells were washed three times with 1× PBS and imaged at 63× using a Phenix high-content microscope (Perkin Elmer).

[0276] result Characterization of proximity-dependent stabilizers We next investigated whether DUB catalytic activity is required for stabilization. Inactivating the catalytic cysteine ​​of USP13 (USP13C345A) reduced the stabilizing effect of USP13, whereas disrupting the two ubiquitin-binding domains of USP13 (USP13M664E / M739E) abolished its activity towards GNMTH176N (Figure S13A). A catalytically inactive mutant of USP3815 (USP38C454S / H857A / D918N) was also inactive in the assay (Figure S13B). Thus, these two DUBs appear to function by a mechanism that requires catalytic activity and ubiquitin binding. In contrast, USP39 is a pseudoenzyme that has no deubiquitinase activity in vitro. Moreover, mutating its ubiquitin-binding domain (USP39C136A / C139A) did not affect activity (Figure S13C), suggesting that USP39 functions in a different way in this case. Similarly, OTUB1 catalytic activity was similarly negligible (Figure S13D). However, OTUB1 also has additional non-catalytic functions, as it can stoichiometrically inhibit the activity of E2s. A triple mutant construct defective in E2 binding and inhibition was assayed, which predicted that it would also be defective in binding K48-linked ubiquitin chains. This mutant was unable to stabilize GNMTH176N (Figure S13F), strongly suggesting that here OTUB1 acts via its E2 inhibitory function or its ability to bind K48-linked ubiquitin chains.

[0277] Figure 13A-D shows the requirements for deubiquinase function. For example, the catalytic cysteine ​​C91 is not required for OTUB1-mediated target protein stabilization, which was highly unexpected. Mutants of USP13 (Figure 13A), USP38 (Figure 13B), USP39 (Figure 13C), and OTUB1 (Figure 13D) were fused with vhhGFP and tested in stabilization assays using GNMTH176N-EGFP. Statistical significance was calculated by one-way ANOVA with Dunnett's multiple comparison correction. * , p < 0.05; ** , p < 0.01; *** , p<0.001.

[0278] Effector recruitment via diverse affinity tags Recently, a comprehensive study revealed striking differences in the sensitivity of kinases to 91 diverse PROTACs. Several kinases, such as ARAF and IKBKE, were not degraded by any of the compounds that engage VHL or CRBN. These two kinases were tagged with 13-aa ALFA tags, and selected effectors were tagged with NbALFA nanobody tags. Consistent with the chemical proteomics approach, it was observed that VHL-NbALFA was unable to degrade either kinase in this assay (Figure 15A). In contrast, many novel effectors were much more efficient. For example, FBXL12, FBXL15, KLHDC2 and the GPI-anchored protein FCGR3B potently reduced the levels of ARAF, whereas KLHL40 increased the levels (Figure 15A).

[0279] The indicated effectors fused with Nb(ALFA)-Myc were co-transfected with ALFA-3xFLAG-ARAF into 293T cells, followed by Western blotting for ARAF (anti-FLAG), effectors (anti-Myc), and Hsp90 (Figure 15A). Stable HCT116 cell lines expressing doxycycline-inducible effectors fused with WDR5-targeting monobody Mb(WDR5) were treated with or without doxycycline (Figure 15B). Endogenous WDR5 levels and effector expression were assessed by Western blotting (Figure 15B top). Quantification of WDR5 levels after doxycycline induction (Figure 15B bottom). Statistical significance was calculated with an unpaired t-test with false discovery rate correction for multiple hypotheses. This provides further evidence that top effectors can degrade cellular targets that are difficult to degrade (such as ARAF) or endogenous proteins (such as WDR5).

[0280] Targeting endogenous proteins with novel effectors Finally, we evaluated the potency of the effectors against two endogenous proteins, WDR5 and BCR-ABL. Selected effectors were cloned into inducible lentiviral vectors fused at their C-terminus to specific WDR5 and BCR-ABL monobodies to generate stable HCT116 (for WDR5) and K562 (for BCR-ABL) cells. While VHL was unable to degrade endogenous WDR5 and CRBN was only slightly effective, several novel effectors robustly degraded WDR5 in a doxycycline-dependent manner (Figure 15B). Notably, FBXL12 and FBXL15 were also very efficient in this case. Results with BCR-ABL in K562 cells were similar: FBXL12, FBXL15, KBTBD7, KLHDC2, and KLHL6 degraded BCR-ABL very potently, whereas CRBN and VHL showed no significant effect (Figure 14A).

[0281] Since BCR-ABL is an essential protein in K562 cells, we next assessed the effect of degrader fusions on cell proliferation. The monobody alone inhibited the function of BCR-ABL101, but when fused to the inactive control, RLuc, K562 cell proliferation was only partially inhibited (Figure 14B). However, when the monobody was fused to a novel effector, cells stopped proliferating completely or proliferated significantly slower (Figure 14B). In contrast, CRBN had no further effect on proliferation (Figure 14B). Thus, many effectors identified in the unbiased ORFeome screen are significantly better at degrading and inhibiting the function of BCR-ABL, the hallmark oncogenic fusion of chronic myeloid leukemia.

[0282] Figure 14A-B shows the results of benchmarking novel effectors using multiple recruitment strategies and therapeutically relevant targets. In particular, Figure 14A-B shows the potency of top effectors to degrade endogenous BCR-ABL and inhibit cell proliferation. Stable K-562 cell lines expressing doxycycline-inducible effectors fused to monobodies that bind to the SH2 domain of BCR-ABL were treated with doxycycline or left untreated (Figure 14A). Endogenous BCR-ABL levels and expression of effectors were assessed by Western blotting (Figure 14A top). Figure 14A bottom shows quantification of BCR-ABL levels after doxycycline induction. Statistical significance was calculated with an unpaired t-test with false discovery rate correction for multiple hypotheses. Figure 14B shows the proliferation of K562 cells after doxycycline induction of the indicated effector fusion constructs. The monobody itself affects cell proliferation (compare the scale of the top left graph for RLuc-vhhGFP with the top right graph (Figure 14B)).

[0283] [Table 7]

[0284] While the present application has been described with reference to what are presently considered to be the preferred embodiments, it is to be understood that the present application is not limited to the disclosed embodiments, and further, the present application is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

[0285] All publications, patents, and patent applications are incorporated herein by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated herein by reference in its entirety. Specifically, the sequences associated with each accession number provided herein, including, for example, the accession numbers and / or biomarker sequences (e.g., proteins and / or nucleic acids) provided in the tables or elsewhere, are incorporated herein by reference in their entirety.

[0286] The scope of the claims should not be limited by the preferred embodiments and examples, but should be given the broadest interpretation consistent with the specification as a whole.

[0287] TIFF2025512531000056.tif208169TIFF2025512531000057.tif208169

Claims

1. A method for identifying a neighboring effector polypeptide, A step of transfecting a plurality of cells with an ORFeome library, wherein the ORFeome library encodes a plurality of ORFs, each of which is fused with a targeting moiety that can directly or indirectly bind to or be induced to bind to a target polypeptide; A step of expressing multiple ORFs of the ORFeome library in the multiple transduced cells under conditions that allow the targeted portion to interact with the target polypeptide; and A step to determine whether any of the ORFs is a proximity effector polypeptide by measuring the abundance of the target polypeptide in cells expressing any of the ORFs compared to a control, and / or detecting whether any of the ORFs are depleted or increased in the transduced cells compared to a control. Includes, The plurality of transduced cells express i) the target polypeptide, or ii) the target polypeptide and a first fluorescent polypeptide, wherein the target polypeptide is a fusion polypeptide fused with a second fluorescent polypeptide, an endogenous protein, or a second fluorescent polypeptide epitope tag, an antibiotic resistance protein, and / or a negative selection marker; ORF encodes a neighboring effector polypeptide if ORF increases or decreases the abundance of the target polypeptide compared to the control, or if it is depleted or increased in the multiple transduced cells compared to the control. method.

2. a) measuring the abundance of the target polypeptide comprises i) determining whether the amount of the target polypeptide expressed in the plurality of transduced cells is decreased or increased compared to a control, or ii) determining whether any of the plurality of ORFs increased the cell surface level of the target polypeptide compared to a control, and / or b) If the target polypeptide is reduced compared to the control, the adjacent effector polypeptide is a degrading agent for the target polypeptide, or if the target polypeptide is increased compared to the control, the adjacent effector polypeptide is a stabilizer for the target polypeptide. The proximity effector polypeptide is a lethal polypeptide if it is depleted or reduced in the multiple transduced cells compared to the control, or a proliferation-inducing polypeptide if it is increased in the multiple transduced cells compared to the control; The aforementioned quantity is the total quantity, the quantity on the cell surface, or the quantity inside the cell; or The method according to claim 1, wherein the proximity effector polypeptide is a protein transport polypeptide, in which case the proximity effector polypeptide increases the cell surface level of the target polypeptide compared to a control.

3. If the target polypeptide is a second fluorescent polypeptide or is fused with a second fluorescent polypeptide, the determination includes isolating fractions of the plurality of transduced cells having a selected second fluorescent polypeptide:first fluorescent polypeptide ratio, and performing ORF sequencing of one or more ORFs in the fractions; If the target polypeptide is fused to an epitope tag, the determination comprises measuring the abundance of the target polypeptide using an epitope tag-binding protein; If the target polypeptide is an endogenous target, the determination includes measuring the abundance of the target polypeptide using a target polypeptide-binding protein; If the target polypeptide is fused with the antibiotic-selective protein, the determination comprises isolating a fraction of the plurality of transdextrin cells that survived the antibiotic treatment and sequencing one or more ORFs in the fraction; or If the target polypeptide is fused with a negative selection marker, optionally with a thymidine kinase, the determination comprises isolating a fraction of the plurality of transduced cells that survived the negative selection treatment, and sequencing one or more ORFs in the fraction. The method according to claim 1 or 2.

4. The method according to claim 3, wherein the epitope tag-binding protein and / or target polypeptide-binding protein is an antibody, or the negative selection marker is thymidine kinase.

5. The plurality of cells constitute a cell line, and the method further comprises preparing a cell line by introducing the target polypeptide or a nucleic acid encoding the target polypeptide and a first fluorescent polypeptide; and / or The ratio of the second fluorescent polypeptide to the first fluorescent polypeptide is determined by a method comprising flow cytometry; and / or The first or second fluorescent polypeptide is RFP, YFP, mCherry, mCitrine, mNeonGreen, mScarlet, BFP and / or GFP; and / or The target polypeptide is fused with the antibiotic resistance protein or the negative selection marker; and / or ORFs identified in cells that survived antibiotic treatment are effectors; and / or The method according to claim 1, wherein determining comprises measuring the proliferation of the plurality of transduced cells, wherein the ORF identified in one of the plurality of transduced cells that increased or decreased cell proliferation compared to a control is a proximity effector polypeptide.

6. The method according to claim 1, wherein the target polypeptide and the first fluorescent polypeptide are in a construct comprising an IRES or cleavage site between them, and / or the antibiotic resistance protein is puromycin acetyltransferase, or the negative selection marker is thymidine kinase, mutant deoxycytodine kinase, or thymidylate kinase.

7. The aforementioned multiple cells are transduced to maintain an average coverage of >300x, >400x, or >500x in the ORFeome library; and / or The process further comprises testing the identified proximity effector polypeptides in individual proximity effector assays, expressing the putative proximity effector polypeptides identified as stabilizers or degraders in test cells expressing the target polypeptide, and determining whether the levels of the target polypeptide in the test cells have decreased or increased; and / or The proximity effector polypeptide is a plurality of proximity effector polypeptides, and / or A method for identifying a neighboring effector polypeptide that is a lethal polypeptide or a proliferation-inducing polypeptide, and / or Determining whether the ORF caused death or proliferation of at least one of the plurality of transdextrins and / or whether it was depleted or increased in the plurality of transdextrins compared to a control, wherein if the proximity effector polypeptide caused death in at least one of the plurality of transdextrins and / or was depleted in the plurality of transdextrins, the proximity effector polypeptide is a lethal polypeptide, and if the proximity effector polypeptide induced proliferation in at least one of the plurality of transdextrins and / or was increased compared to a control, the putative proximity effector polypeptide is a proliferation-inducing polypeptide. The method according to claim 1.

8. The determination comprises identifying ORFs that are depleted in the plurality of transdextrins, sequencing the plurality of ORFs in the plurality of surviving transdextrins, and comparing the references of the plurality of ORFs in the ORFeome library to determine whether the ORFs are present or absent; or The method according to claim 7, wherein the target polypeptide is an oncogenic polypeptide, an apoptosis regulator, an autophagy regulator, or a mitophagy regulator.

9. The method according to claim 8, wherein the target polypeptide is RAS polypeptide, MYC, EWSR-FLI1, or KRAS.

10. A method according to claim 1 for identifying a nearby effector polypeptide that is a protein transport polypeptide, the method comprising determining the cell surface level of the target polypeptide, wherein the nearby effector polypeptide is a protein transport polypeptide if it increases the cell surface level of the target polypeptide, and (i) the target polypeptide is an MHC class I polypeptide; or (ii) the target polypeptide is a mutant cell surface polypeptide, a protein listed in Table 2, or CFTRΔ508.

11. The target polypeptide comprises EGFP-AB1, Rluc, FUS S525L, NRAS, DNAJA3, BRAF, LAMP1, TDP43 Q311K, CD63, H2B, EGFR, DNAJB11, WDR5, RAS, MYC, or EWSR-FLI1, EWSR1, SMARCA2 / 4, or PARP1, PD1 / PD-L1, JAK, FUS, TDP43, α-synuclein, amyloid-beta precursor protein, HTT, prion protein, p53, PTEN, CFTR variants, and / or dystrophin variants; and / or The targeting portion is a nanobody, ligand, interacting peptide, or antibody that binds to the target polypeptide; and / or The target portion is a nanobody; and / or The targeting portion is an interaction peptide selected from ABI1, FKBP, FRB, mutant FRB, GID1, GAI, and / or PYR1; The target polypeptide is a fusion polypeptide comprising an interacting peptide that interacts with the targeting moiety; and / or A method comprising the use of a chemical inducer, The method according to claim 1.

12. The fusion polypeptide comprises ABI1, FKBP, FRB, mutant FRB, GID1, GAI, PYL1, ALFA tag and / or PYR1; and / or The target polypeptide comprises ABI1, the targeting portion comprises PYR1 or PYL1, and the chemical inducer is mandipropamide or abscisic acid; or The target polypeptide comprises FKBP, the targeted portion comprises FRB, and the chemical inducer is rapamycin; or The target polypeptide comprises FRB, the targeted portion comprises FKBP, and the chemical inducer is rapamycin; or The target polypeptide comprises FKBP, the targeted portion comprises mutant FRB, and the chemical inducer is a rapalog; or The target polypeptide comprises a mutant FRB, the targeted portion comprises FKBP, and the chemical inducer is a rapalog; or The target polypeptide comprises GID1, the targeting portion comprises GAI, and the chemical inducer is gibberellic acid; or The method according to claim 11, wherein the target polypeptide comprises a mutant GAI, the targeted portion comprises GID1, and the chemical inducer is gibberellic acid.

13. A screening assay for identifying ligands for at least one recombinant neighboring effector polypeptide, A step of contacting at least one recombinant neighbor effector polypeptide with a small molecule library, wherein the neighbor effector polypeptide is selected from Tables 4, 5, 6, or 7; A step to evaluate whether binding has occurred between the recombinant proximity effector polypeptide and one or more low-molecular-weight molecules of the low-molecular-weight library. It includes, One or more molecules bound to the at least one recombinant neighbor effector polypeptide are ligands of the at least one recombinant neighbor effector polypeptide. Screening assay.

14. The ligand is a low molecular weight binder, and / or At least one proximity effector polypeptide is identified using the method described in claim 1, and / or The proximity effector polypeptide is a decomposition agent and is selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, UBE2B or KLHL40, or GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC or RNF126, or Selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, UBE2B or KLHL40, and / or The assay further comprises contacting a target polypeptide with the low-molecular-weight library and determining whether binding has occurred between the target polypeptide and one or more low-molecular-weight molecules in the low-molecular-weight library; and / or The evaluation steps are performed using surface plasmon resonance (SPR), nuclear magnetic resonance (NMR) spectroscopy, differential scanning fluorescence (DSF), thermal shift assay (TSA), isothermal titration calorimetry (ITC), microscale thermophoresis (MST), biolayer interference (BLI), X-ray crystallography, DNA-coding library (DEL) screen, affinity selection-mass spectrometry (AS-MS), or covalent fragment screen; and / or, The assay further comprises determining whether the low molecular weight binder for the recombinant proximity effector polypeptide is a molecular glue by determining whether the recombinant proximity effector and the target polypeptide interact in the presence of the low molecular weight binder; and / or If the low molecular weight binder interacts with or can interact with the recombinant proximity effector polypeptide and the target polypeptide simultaneously, then it is a molecular glue and / or The at least one recombinant proximity effector polypeptide is identified using the method described in claim 1; and / or The screening assay according to claim 13, wherein the method comprises preparing a product using a ligand.

15. The screening assay according to claim 14, wherein the product is a therapeutic product and / or the determination step is carried out using luciferase complementation, yeast two-hybrid assay, alphascreen, yeast conjugation-based interaction assay, fluorescence resonance energy transfer microscopy (FRET), or time-resolved FRET (TR-FRET).

16. A method for producing heterobifunctional molecules, A step of identifying the ligand of the effector polypeptide, optionally a low molecular weight binder and a low molecular weight binder of the target polypeptide, using the method of claim 11 or 12, and A step of binding the ligand of the effector polypeptide, optionally a low molecular weight binder, and the low molecular weight binder of the target polypeptide, optionally via a linker; Depending on the circumstances, a step of evaluating whether the effector polypeptide and the target polypeptide interact in the presence of the heterobifunctional molecule; and Furthermore, depending on the circumstances, the evaluation step may be carried out using luciferase complementation, yeast two-hybrid assay, alphascreen, yeast conjugation-based interaction assay, fluorescence resonance energy transfer microscopy (FRET), or time-resolved FRET (TR-FRET). A method that includes the following:

17. A process for modulating a target polypeptide in at least one cell, comprising expressing at least one proximity effector polypeptide shown in Table 4, 5, 6, or 7 in the at least one cell, wherein the at least one proximity effector polypeptide is fused to a targeting moiety, the targeting moiety being a nanobody, ligand, interacting peptide, or antibody.

18. The at least one proximity effector polypeptide is at least one decomposer selected from FBXL12, FBXL14, FBXL15, FBXO6, KBTBD7 or KLHL6; or The aforementioned at least proximity effector polypeptide is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, or RNF126, or selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, UBE2B, or KLHL40; or The at least one degrading polypeptide is selected from UBE2B, UBE2A, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, ZER1 and / or KLHDC2; or The at least one decomposing agent is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, ZER1 and / or RNF126; or The at least one degrading polypeptide is selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1 and / or UBE2B; or The at least one stabilizing polypeptide is selected from KLHL40, KLHL41, DDI1, and / or PRPS2; or The at least one stabilizing polypeptide is KLHL40; or The process according to claim 17, wherein the target polypeptide is an oncogene polypeptide, an oncogenic fusion polypeptide, a synthetic lethal target, an immunological / cancoimmunological target, a gain-of-function dominant disease variant, a tumor suppressor, or an unstable disease variant.

19. The oncogene polypeptide or oncogenic fusion polypeptide is RAS, MYC, or EWSR-FLI1, or comprises the same. The synthetic lethal target is EWSR1, SMARCA2 / 4, or PARP1, or The immunological / cancer immunological target is PD1 / PD-L1 or JAK, or The dominant gain-of-function disease variant is FUS, TDP43, α-synuclein, amyloid-beta precursor protein, HTT, or prion protein, or The tumor suppressor is p53 or PTEN, or The unstable disease variant is a CFTR variant or a dystrophin variant, or The proximity effector is KLHL40 or KLHL41, and the target polypeptide is a loss-of-stability variant of muscular dystrophy, or The target polypeptide is BCR-ABL. The process according to claim 18.

20. A fusion polypeptide comprising a proximity effector polypeptide selected from Tables 4, 5, 6, or 7, and a targeting moiety that binds to a target polypeptide.

21. (i) The proximity effector polypeptide is a decomposition agent selected from FBXL12, FBXL14, FBXL15, FBXO6, KBTBD7 or KLHL6; or The proximity effector polypeptide is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, or RNF126, or selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZER1, UBE2B, or KLHL40, or The proximity effector polypeptide is selected from ZER1 FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, UBE2B, or KLHL40, or The nearest effector polypeptide is selected from UBE2B, UBE2A, ZER1, FBXL12, FBXL14, FBXL15, GABARAP, GABARAPL2, MAP1LC3A, KLHL6, KBTBD7, KLHDC2, KLHL40, the KLHL40:BTB domain of the KLHL6 fusion, or PRNP:residues 194-223 of the FCGR3B fusion. Alternatively, the effector polypeptide may be selected from UBE2B, ZER1, KLHL40, KLHL41, DDI1, or PRPS2. The proximity effector polypeptide is selected from FBXL12, FBXL14, FBXL15, KLHDC2, KLHL6, KBTBD7, ZERB1, or UBE2B, or The proximity effector polypeptide is selected from GMCL1, FBXL15, PJA1, RNF115, DZIP3, RNF125, FBXO3, RNF185, RNF8, RNF183, RCHY1, KBTBD7, TRIM31, CISH, SOCS5, TRIM39, RNF144B, FBXO40, KLHL6, FBXO11, GAN, FBXL14, FBXW5, RNF111, FBXL12, BTRC, ZER1, or RNF126; or The proximity effector polypeptide is a stabilizer selected from DDI1, DNAJC14, KLHL40, KLHL41, PRPS2, ACOT1, ACOT2, CALM1, CALM2, CALM3, CALM3, or CALM5; and / or (ii) a nanobody, ligand, interacting peptide or antibody that binds to the target polypeptide; and / or (iii) The target polypeptide is selected from oncogene polypeptides, oncogenic fusion polypeptides, synthetic lethal targets, immunological / cancoimmunological targets, gain-of-function disease variants, tumor suppressors, or unstable disease variants; or The synthetic lethal target is EWSR1, SMARCA2 / 4, or PARP1; or The immunological / oncoimmunological target is PD1 / PD-L1 or JAK; or The dominant gain-of-function disease variant is FUS, TDP43, α-synuclein, amyloid-beta precursor protein, HTT, or prion protein; or The tumor suppressor is p53 or PTEN; or The unstable disease variant is a CFTR variant or a dystrophin variant; or The target polypeptide is selected from EGFP-AB1, ABI1, Rluc, FUS S525L, NRAS, DNAJA3, BRAF, LAMP1, TDP43, Q311K, CD63, H2B, EGFR, DNAJB11, or WDR5, and / or (iv) the fusion peptide is for use in the preparation of a drug; and / or (v) A nucleic acid molecule encoding the fusion polypeptide; or a vector containing the nucleic acid molecule encoding the fusion polypeptide. The fusion polypeptide according to claim 20.

22. The fusion polypeptide according to claim 21, wherein the antibody that binds to the target polypeptide is vhhGFP or an ALFA tag nanobody; and / or the oncogene polypeptide or oncogenic fusion polypeptide is RAS, MYC, or EWSR-FLI1; or the proximity effector is KLHL40 or KLHL41, and the target polypeptide is a loss-of-stability variant, and the agent is for the treatment of muscular dystrophy; or the target polypeptide is BCR-Abl.

Images