Trans-splicing RNA (tsRNA)

Abstract

The present invention relates to a trans-splicing RNA (tsRNA) molecule, which comprises at least one or more non-structural target binding domains complementary to at least one or more pre-messenger RNA (pre-mRNA) targets, and is further configured to prevent off-target trans-splicing by incorporating a safety domain.Furthermore, the present invention relates to a cell, vector, therapeutic agent, composition or pharmaceutical composition comprising the tsRNA of the present invention; and a method for killing cells, treating diseases, imaging or cosmetic application using the tsRNA of the present invention.The present invention is used in the medical, cosmetic and veterinary fields.

Description

[Technical field]

[0001] The present invention relates to a trans-splicing RNA (tsRNA) molecule, which comprises at least one or more non-structural target binding domains complementary to at least one or more pre-messenger RNA (pre-mRNA) targets, and is further configured to prevent off-target trans-splicing by incorporating a safety domain.Furthermore, the present invention relates to a cell, vector, therapeutic agent, composition or pharmaceutical composition comprising the tsRNA of the present invention; and a method for killing cells, treating diseases, imaging or cosmetic application using the tsRNA of the present invention.The present invention is used in the medical, cosmetic and veterinary fields. [Background technology]

[0002] Spliceosome-mediated RNA trans-splicing (SMaRT) is a process that combines two different messenger RNA precursors (pre-mRNAs) or other spliceable RNAs in trans to form a chimeric RNA molecule in the nucleus, which induces the formation of a chimeric protein in the cytoplasm after nuclear export. This technique can be used to repair defective RNAs, for example, by replacing a mutated exon with an intact exon or by adding a functional sequence to an endogenous message carrier. The functional sequence can also induce the expression of a death signal that kills the target cell, induce the expression of a fluorescent protein that can be used for imaging the target cell, induce the expression of a therapeutic or cosmetic protein that treats or cures the target cell, or induce the expression of a gene of interest that programs / reprograms the target cell.

[0003] Trans-splicing-based repair is difficult to achieve because sustained repair requires continuous delivery or endogenous expression of the trans-splicing RNA after integration into the genome, precise splicing of the desired splice site within the target, and sufficient efficiency to induce a therapeutic phenotype despite intense competition from canonical cis-splicing.

[0004] Labeling with functional sequences using trans-splicing concerns, for example, RNAs encoding fluorescent proteins for monitoring gene expression in living cells, or RNAs encoding death signals for the induction of selective death of cells expressing aberrant transcripts in suicide gene therapy. The aberrant transcripts may be biomarkers of diseased cells, such as transcripts of cancer-specific oncogenes or viral transcripts. Death signals can be induced by a) direct signals, such as toxins, e.g. diphtheria toxin or cholera toxin, b) apoptotic or necrotic genes, such as caspases, or c) enzymes, such as herpes simplex virus thymidine kinase (HSVtk), which induce death signals by co-delivery of drugs, such as ganciclovir (GCV). a) Direct toxins or b) apoptotic signals can induce cell death immediately, but unfortunately, there is also an increased risk of non-specific targeting and off-targeting. These issues make regulatory approval of such technologies difficult. In contrast, c) the combination of two components is a very safe method, since they are not toxic to cells by themselves.

[0005] As a therapy, trans-splicing-induced cell death is easier to achieve than trans-splicing-based repair, because the trans-splicing construct needs to be delivered to the target cell only once and long-term expression is not required. Furthermore, the alternative, on-target trans-splicing, i.e., trans-splicing that is precisely directed to the target but does not involve the splice site of the target, is not a disadvantage and contributes to a target-specific death signal, and trans-splicing does not need to be very efficient to induce a signal strong enough to kill the target cell.

[0006] Based on the aforementioned HSVtk / GCV system, the present inventors have developed an efficient trans-splicing-based suicide gene therapy method. Novel trans-splicing RNAs for 5' and 3' exon replacement (ER) were designed, i.e., the suicide gene, such as HSVtk, or a component of the suicide gene system is added to the 5' or 3' end of the target message. To improve the on-target activity and specificity of trans-splicing RNA (tsRNA), the design of RNA structure was investigated.

[0007] For example, the efficiency of methods such as gene therapy for congenital or acquired genetic diseases, genetic vaccination, stem cell programming, somatic cell reprogramming, immunotherapy, manipulation of protein expression, and in vivo suicide gene therapy based on trans-splicing depend on the delivery of recombinant DNA to primary cells ex vivo or in vivo to induce the expression of non-coding RNA or non-coding protein. In primary cells, the expression of recombinant foreign episomal DNA (e.g., plasmids) is silenced within 24 hours after delivery, independent of the delivery route. The mechanism of occurrence of this effect is not well understood. Only in combination with viral delivery vectors such as retroviral, lentiviral, and AAV vectors was it possible to successfully induce medium-term and long-term expression in primary cells. However, taking into account current Good Manufacturing Practice (cGMP) production standards, these vectors are expensive. It is believed that the production of viral vectors at cGMP standards would be several orders of magnitude more expensive than the production of the same amount of "naked" genetic material. In addition, viral vectors have safety risks and concerns, which are associated with (i) negative interference (e.g., disruption of gene function and regulation) due to the integration of foreign DNA into the integration locus, and (ii) the involvement of pathogenic virus-derived components. Alternatively, direct delivery of functional RNA into primary cells is rapidly degraded and only has a short-term effect. Therefore, the development of novel gene vectors that can avoid transgene silencing is highly desirable. Summary of the Invention [Problem to be solved by the invention]

[0008] The present disclosure allows for safe and sustained transgene expression in primary cells to overcome the problem of transgene silencing.

[0009] Novel vectors in the form of DNA minicircles or dumbbell-shaped vectors consist of only a transcription unit containing a promoter, a coding gene, and an RNA stabilizing sequence, and have the advantage of improved delivery to cells and diffusion in the nucleus due to their small size. Furthermore, these small vectors have a covalently closed structure, which makes them resistant to exonucleases. In contrast, plasmids often undergo single-strand breaks (so-called nicks) due to shear forces. In addition, they do not require bacterial sequences or resistance proteins, which means that they do not cause harmful side effects to the host. Furthermore, in vitro synthesis can be controlled, and fluorescent dyes, cell-penetrating peptides, or immune-stimulating peptides can be chemically linked to the loop structure, which allows for easy manipulation of the vector. Dumbbell-shaped DNA vectors, also known as "dumbbells," "doggybone DNA," or "closed circular DNA," contain (i) a double-stranded DNA core that contains one or more genes of interest for delivery and regulatory sequences such as promoters, enhancers, nuclear localization signals, transcription termination signals, and polyadenylation signals, and (ii) a single-stranded loop structure closed at both ends. As mentioned above, in plasmids, transgene silencing often occurs. It has been shown that DNA minicircles without extragenic spacers between the 5' and 3' ends of the transgene expression cassette can sustain transgene expression in mice. Compared with minicircles, dumbbell-shaped vectors can have molecular weights that are one order of magnitude smaller, and in particular, dumbbell-shaped vectors for small non-coding RNA expression have very small molecular weights. WO2012 / 032114 discloses that a DNA expression construct containing a dumbbell-shaped circle vector maintained expression for 7 days after injection into malignant melanoma. Unlike other gene vectors, dumbbell-shaped vectors are characterized by their ability to have helper functions such as targeted delivery, imaging, and immune sensing through their loop structure.

[0010] The present disclosure relates to a novel dumbbell-shaped vector complex for targeted delivery. The present disclosure provides a dumbbell-shaped vector conjugated to a three-branched N-acetylgalactosamine (GalNAc)3 for targeted delivery to asialoglycoprotein-positive cells such as hepatocytes. The present disclosure also provides an aptamer-conjugated dumbbell-shaped vector, i.e., a CD137-targeting aptamer or a prostate-specific membrane antigen (PSMA)-targeting aptamer. Both (GalNAc)3 and the aptamer are linked to the extended dumbbell loop structure by non-covalent bonds via complementary base pairs. [Means for solving the problem]

[0011] According to a first aspect of the present invention there is provided a trans-splicing RNA (tsRNA) molecule comprising: a) at least one (preferably multiple) binding domain specific for at least a portion of a gene associated with or which is a biomarker for a cell to be treated or a diseased cell; b) (i) an expressible suicide protein or an expressible protein that is a component of a suicide system; (ii) an expressible fluorescent protein, luciferase or another reporter protein, and (iii) an expressible therapeutic protein a nucleic acid encoding at least one of the following: c) at least one splice signal; and d) at least one safety domain specific to a splice signal within said trans-splicing RNA. A trans-splicing RNA molecule is provided, comprising: DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] In a preferred embodiment of the invention, the binding domain comprises a binding site comprising at least 25, more preferably 35, even more preferably 45, and most preferably 55 or more free-form contiguous nucleotides (nt), which binding site has no internal binding sequences and / or no self-complementary sequences; when the length of the binding domain is 44 nt or more, the binding domain has at least one or more mismatched nucleotides with respect to the gene.

[0013] In a preferred embodiment of the present invention, the tsRNA may contain one or more of the nucleic acids described in b) i to iii above (all or part of them), in any combination.

[0014] As used herein, a "safety domain" refers to an antisense binding domain specific for a splice site within the splice signal of a trans-splicing RNA. The safety domain is positioned to prevent off-target trans-splicing, since to allow on-target trans-splicing, the binding domain must bind to the target and release the safety domain from the splice signal, which is illustrated in detail in FIG. 5.

[0015] In a preferred embodiment of the present invention, the safety domain is a linear nucleic acid sequence or a folded nucleic acid sequence comprising one or more folds, wherein the linear nucleic acid sequence is referred to herein as a "contiguous safety domain" and the folded nucleic acid sequence is referred to herein as a "segmented safety domain."

[0016] Therefore, another preferred embodiment of the present invention relates to this novel safety domain, i.e., an antisense sequence to a trans-splicing RNA (tsRNA), which is complementary to at least a part of the splice signal domain of the tsRNA, or to the splice donor (SD) and polypyrimidine tract (PPY) of the tsRNA. The safety domain can prevent off-target trans-splicing, since the target binding domain must first bind to the target and release the safety domain from the splice donor and PPY to allow on-target trans-splicing. Two types of safety domain designs were developed and tested: 1. a continuous safety domain; and 2. a segmented safety domain. The segmented safety domain was separated by various target binding domains.

[0017] As used herein, a "trans-splicing RNA molecule" refers to a molecule that interacts with a target pre-mRNA molecule to mediate a trans-splicing event, which generates a novel chimeric mRNA that is processed in the cell to produce a protein product.

[0018] As used herein, a "gene associated with or which is a biomarker for a target or diseased cell to be treated" refers to a gene which is characteristic of a target or diseased cell and therefore is exclusively or selectively present or expressed in / by the target or diseased cell, or which is exclusively or selectively present or expressed when the disease develops.

[0019] As used herein, a "housekeeping gene" refers to a gene that is not associated with a disease and is ubiquitously and abundantly expressed in all cells.

[0020] One novel aspect or embodiment of the present invention is the generation of multi-targeted suicide RNAs that utilize trans-splicing to target pre-mRNAs from disease-specific genes and / or pre-mRNAs from housekeeping genes. Pre-mRNAs from housekeeping genes are constitutively expressed in all cells, unlike disease-specific pre-mRNA biomarkers. Housekeeping genes include, but are not limited to, genes involved in gene expression, metabolism, cell structure, cell surface, signal transduction, and the like. This novel design is applied to target cells with very low numbers and / or expression levels of disease-specific biomarkers. Under these circumstances, trans-splicing to the housekeeping sequence induces basal levels of expression of the death signal, but does not kill the cell. Only further trans-splicing to disease-specific pre-mRNA biomarkers or pre-mRNA biomarkers specific to a particular cell type will increase expression of the death signal above a threshold and kill the cell.

[0021] As used herein, a "protein that is a component of a suicide system" refers to a protein that interacts directly or indirectly with at least one other molecule to induce or cause the death of the cell in which the protein is expressed.

[0022] Those skilled in the art will appreciate that tsRNA has nucleotides complementary to the gene to which it is attached, and being RNA, contains the nucleotides adenosine, guanosine, cytidine, or uridine, including the respective bases adenine, guanine, cytosine, and uracil, as well as known chemical modifications thereof.

[0023] Moreover, those skilled in the art will be familiar with the fact that RNA is a chain of nucleotides, and unlike DNA, it often forms a single-stranded fold in nature, because the presence of self-complementary sequences allows a portion of the RNA to fold back on itself and form pairings to form highly structured molecules. Thus, in this specification, "unstructured" refers to a state in which the RNA nucleotide sequence exists as an unfolded chain within the binding site. The RNA chain can bend and fold, but does not fold, and therefore there are no internal binding sequences or self-complementary sequences.

[0024] Alternatively, an "unstructured state" can be described as the binding site containing a sequence that is predicted not to fold into a stable secondary structure with minimum free energy (Gibbs free energy of RNA secondary structure formation is ΔG≧0 kcal / mol) or is at least less structured than the average binding domain that can be formed (ΔG>ΔG average). Such structures are shown in RNAfold with open circles, whereas mfold does not show results for structures with ΔG≧0 kcal / mol.

[0025] In a preferred embodiment of the invention, the binding domain is not perfectly complementary to the target gene or pre-mRNA, and therefore does not form a perfect double strand with the target gene, and is typically 200 bp or less, most typically 100 bp or less.

[0026] In certain embodiments of the invention, the binding domain comprising the binding site is 25 nucleotides long, 26 nucleotides long, 27 nucleotides long, 28 nucleotides long, 29 nucleotides long, 30 nucleotides long, 31 nucleotides long, 32 nucleotides long, 33 nucleotides long, 34 nucleotides long, 35 nucleotides long, 36 nucleotides long, 37 nucleotides long, 38 nucleotides long, 39 nucleotides long, 40 nucleotides long, 41 nucleotides long, 42 nucleotides long, 43 nucleotides long, 44 nucleotides long, 45 nucleotides long, 46 nucleotides long, 47 nucleotides long, 48 nucleotides long, 49 nucleotides long, 50 nucleotides long, 51 nucleotides long, 52 nucleotides long, 53 nucleotides long, 54 nucleotides long, 55 nucleotides long, 56 nucleotides long, 57 nucleotides long, 58 nucleotides long, 59 nucleotides long, 60 nucleotides long, 61 nucleotides long, 62 nucleotides long, 63 nucleotides long, 64 nucleotides long, 65 nucleotides long, 66 nucleotides long, 67 nucleotides long, 68 nucleotides long, 69 nucleotides long, 70 nucleotides long, 71 nucleotides long, 72 nucleotides long, 73 nucleotides long, 74 nucleotides long, 75 nucleotides long, 76 nucleotides long, 77 nucleotides long, 78 nucleotides long, 79 nucleotides long, 80 nucleotides long, 81 nucleotides long, 82 nucleotides long, 83 nucleotides long, 84 nucleotides long, 85 nucleotides long, 86 nucleotides long, Nucleotide length, 48 nucleotides, 49 nucleotides, 50 nucleotides, 51 nucleotides, 52 nucleotides, 53 nucleotides, 54 nucleotides, 55 nucleotides, 56 nucleotides, 57 nucleotides, 58 nucleotides, 59 nucleotides, 60 nucleotides, 61 nucleotides, 62 nucleotides, 63 nucleotides, 64 nucleotides, 65 nucleotides, 66 nucleotides, 67 nucleotides, 68 nucleotides, 69 nucleotides, 70 nucleotides, 71 nucleotides, 72 nucleotides, 7 3 nucleotides, 74 nucleotides, 75 nucleotides, 76 nucleotides, 77 nucleotides, 78 nucleotides, 79 nucleotides, 80 nucleotides, 81 nucleotides, 82 nucleotides, 83 nucleotides, 84 nucleotides, 85 nucleotides, 86 nucleotides, 87 nucleotides, 88 nucleotides, 89 nucleotides, 90 nucleotides, 91 nucleotides, 92 nucleotides, 93 nucleotides, 94 nucleotides, 95 nucleotides, 96 nucleotides, 97 nucleotides, 98 nucleotides, 99 nucleotides, 100 nucleotides, 101 nucleotides, 102 nucleotides, 103 nucleotides, 104 nucleotides, 105 nucleotides, 106 nucleotides, 107 nucleotides, 108 nucleotides, 109 nucleotides, 110 nucleotides, 111 nucleotides, 112 nucleotides, 113 nucleotides, 114 nucleotides, 115 nucleotides, 116 nucleotides, 117 nucleotides, 118 nucleotides,119 nucleotides, 120 nucleotides, 121 nucleotides, 122 nucleotides, 123 nucleotides, 124 nucleotides, 125 nucleotides, 126 nucleotides, 127 nucleotides, 128 nucleotides, 129 nucleotides, 130 nucleotides, 131 nucleotides, 132 nucleotides, 133 nucleotides, 134 nucleotides, 135 nucleotides, 136 nucleotides, 137 nucleotides, 138 nucleotides, 139 nucleotides, 140 nucleotides, 141 nucleotides nucleotide length, 142 nucleotide length, 143 nucleotide length, 144 nucleotide length, 145 nucleotide length, 146 nucleotide length, 147 nucleotide length, 148 nucleotide length, 149 nucleotide length, 150 nucleotide length, 151 nucleotide length, 152 nucleotide length, 153 nucleotide length, 154 nucleotide length, 155 nucleotide length, 156 nucleotide length, 157 nucleotide length, 158 nucleotide length, 159 nucleotide length, 160 nucleotide length, 161 nucleotide length, 162 nucleotide length, 163 nucleotide length, 164 nucleotide length leotide length, 165 nucleotides, 166 nucleotides, 167 nucleotides, 168 nucleotides, 169 nucleotides, 170 nucleotides, 171 nucleotides, 172 nucleotides, 173 nucleotides, 174 nucleotides, 175 nucleotides, 176 nucleotides, 177 nucleotides, 178 nucleotides, 179 nucleotides, 180 nucleotides, 181 nucleotides, 182 nucleotides, 183 nucleotides, 184 nucleotides, 185 nucleotides, 186 nucleotides, 187 nucleotides, 189 nucleotides, 200 nucleotides, 201 nucleotides, 202 nucleotides, 203 nucleotides, 204 nucleotides, 205 nucleotides, 206 nucleotides, 207 nucleotides, 208 nucleotides, 209 nucleotides, 300 nucleotides, 310 nucleotides, 311 nucleotides, 312 nucleotides, 313 nucleotides, 314 nucleotides, 315 nucleotides, 316 nucleotides, 317 nucleotides, 318 nucleotides, 319 nucleotides, 320 nucleotides, 321 nucleotides, 322 nucleotides, 323 nucleotides, 324 nucleotides, 325 nucleotides, 326 nucleotides, 327 nucleotides, 328 nucleotides, 329 nucleotides, 330 nucleotides, 331 nucleotides, 332 nucleotides, 333 nucleotides, 334 nucleotides, 335 nucleotides, 336 nucleotides, 337 nucleotides, 7 nucleotides, 188 nucleotides, 189 nucleotides, 190 nucleotides, 191 nucleotides, 192 nucleotides, 193 nucleotides, 194 nucleotides, 195 nucleotides, 196 nucleotides, 197 nucleotides, 198 nucleotides, 199 nucleotides, 200 nucleotides, 201 nucleotides, 202 nucleotides, 203 nucleotides, 204 nucleotides, 205 nucleotides, 206 nucleotides, 207 nucleotides, 208 nucleotides, 209 nucleotides,210 nucleotides, 211 nucleotides, 212 nucleotides, 213 nucleotides, 214 nucleotides, 215 nucleotides, 216 nucleotides, 217 nucleotides, 218 nucleotides, 219 nucleotides, 220 nucleotides, 221 nucleotides, 222 nucleotides, 223 nucleotides, 224 nucleotides, 225 nucleotides, 226 nucleotides, 227 nucleotides, 228 nucleotides, 229 nucleotides, 230 nucleotides, 231 nucleotides, 232 nucleotides nucleotide length, 233 nucleotides, 234 nucleotides, 235 nucleotides, 236 nucleotides, 237 nucleotides, 238 nucleotides, 239 nucleotides, 240 nucleotides, 241 nucleotides, 242 nucleotides, 243 nucleotides, 244 nucleotides, 245 nucleotides, 246 nucleotides, 247 nucleotides, 248 nucleotides, 249 nucleotides, 250 nucleotides, 251 nucleotides, 252 nucleotides, 253 nucleotides, 254 nucleotides, 255 nucleotides, 256 nucleotides, 257 nucleotides, 258 nucleotides, 259 nucleotides, 260 nucleotides, 261 nucleotides, 262 nucleotides, 263 nucleotides, 264 nucleotides, 265 nucleotides, 266 nucleotides, 267 nucleotides, 268 nucleotides, 269 nucleotides, 270 nucleotides, 271 nucleotides, 272 nucleotides, 273 nucleotides, 274 nucleotides, 275 nucleotides, 276 nucleotides, 277 nucleotides nucleotide length, 278 nucleotides, 279 nucleotides, 280 nucleotides, 281 nucleotides, 282 nucleotides, 283 nucleotides, 284 nucleotides, 285 nucleotides, 286 nucleotides, 287 nucleotides, 288 nucleotides, 289 nucleotides, 290 nucleotides, 291 nucleotides, 292 nucleotides, 293 nucleotides, 294 nucleotides, 295 nucleotides, 296 nucleotides, 297 nucleotides, 298 nucleotides, 299 nucleotides,and a nucleotide sequence having a length selected from the list consisting of or including 300 nucleotides in length or more.

[0027] In yet another specific embodiment of the present invention, the binding domain comprises a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a portion of a gene associated with a biomarker for a disease or a biomarker selectively expressed in a cell to be treated, or a portion of a gene that is such a biomarker. The mismatch of the binding domain is ideally located to avoid a region of 44 nt or more that is completely complementary to the target, so as to include or exclude the binding site, and is ideally located at least 5 nucleotides from the 5' or 3' end. The inventors believe that such features are likely to suppress antisense effects, such as A to I editing caused by the formation of long double-stranded RNA in the nucleus. These features are believed to be particularly beneficial for 3' exon replacement.

[0028] In certain embodiments, when the binding domain is particularly short, i.e., less than 100 nucleotides long including the binding site, the binding domain is adjacent to a spacer sequence that helps the binding domain maintain its non-conformational property.Therefore, in this embodiment, tsRNA further comprises a spacer sequence adjacent to the binding domain, and such spacer sequence is known to those skilled in the art.

[0029] One skilled in the art will appreciate that the binding domains can be designed to bind to pre-mRNAs, such as disease biomarkers, and that these binding domains have the characteristics described herein, allowing efficient trans-splicing to occur. Thus, the suicide gene therapy constructs or sequences described herein can be easily reprogrammed to target different diseases or different diseased tissues by simply exchanging the target binding domain.

[0030] In yet another specific embodiment of the present invention, the trans-splicing RNA molecule comprises multiple binding domains that are complementary to the same or different parts of a gene that is related to a biomarker of the disease to be treated or is a biomarker of the disease to be treated.It has been found that when two or more binding domains are complementary to the same part of a gene, specific on-target trans-splicing is improved.It has also been found that when two or more binding domains are complementary to different parts of a gene or to different genes, trans-splicing activity is enhanced and trans-splicing phenotype is improved.

[0031] In certain further embodiments, the tsRNA is a 5' tsRNA or a 3' tsRNA.

[0032] Thus, in one aspect or embodiment of the present invention, cytotoxic tsRNA is provided, ideally cytotoxic tsRNA that utilizes a suicide gene therapy approach.

[0033] In another further preferred embodiment, a tsRNA containing tri-branched N-acetylgalactosamine (GalNAc)3 is provided for targeted delivery to asialoglycoprotein-positive cells, such as hepatocytes.

[0034] In yet another preferred embodiment, the tsRNA is a dumbbell-shaped RNA, more preferably comprising a tri-branched N-acetylgalactosamine (GalNAc)3 for targeted delivery to asialoglycoprotein-positive cells, such as hepatocytes.

[0035] In yet another preferred embodiment, the tsRNA is encoded by a dumbbell-shaped DNA vector. More preferably, the tsRNA is a dumbbell-shaped RNA containing three-branched N-acetylgalactosamine (GalNAc)3 for targeted delivery to asialoglycoprotein-positive cells, such as hepatocytes.

[0036] Another embodiment of the present invention is a dumbbell-shaped delivery vector for targeted delivery to hepatocytes, characterized by having a (GalNAc)3 residue, which contains at least one (GalNAc)3 residue, but ideally contains multiple (GalNAc)3 residues. GalNAc residues are often used to deliver oligomeric nucleic acids, such as antisense oligodeoxyribonucleotides (ASOs) and small interfering RNAs (siRNAs), to hepatocytes. The present inventors have been able to provide for the first time a gene expression vector having a (GalNAc)3 residue, i.e., a dumbbell-shaped vector having a (GalNAc)3 residue. To achieve this, an extended complementary dumbbell loop was created by hybridizing an antisense DNA oligo or antisense RNA oligo labeled with (GalNAc)3 to a complementary base pair (Figure 11). In the RNA complex, unlike the DNA complex, the endogenous enzyme RNaseH can cleave the RNA in the RNA-DNA heteroduplex to release the (GalNAc)3 residue within the cell, facilitating the diffusion of the dumbbell-shaped vector within the nucleus.

[0037] Another embodiment of the present invention is a suicide RNA targeting hepatoblastoma-derived cells using trans-splicing, the suicide RNA having multiple target binding domains complementary to each of alpha-fetoprotein (AFP), vascular endothelial growth factor (VEGF), gamma-glutamyltransferase (GGT), hepatocellular carcinoma-associated protein 2 (HCCA2), transforming growth factor beta 1 (TGF-β1), cluster of differentiation 24 (CD24), cyclin D1 (CCND1), glypican 3 (GPC3) and / or telomerase reverse transcriptase (TERT).

[0038] In addition to or in another embodiment, the tsRNA comprises at least one aptamer, such as a CD137 target aptamer and / or a prostate specific membrane antigen (PSMA) target aptamer. Preferably, either or both of (GalNAc)3 and the aptamer are linked to the tsRNA via a non-covalent or covalent bond.

[0039] In addition to or in another embodiment, the tsRNA is a dumbbell-shaped RNA that comprises at least one aptamer, for example, a CD137 target aptamer and / or a prostate-specific membrane antigen (PSMA) target aptamer. It is preferred that (GalNAc)3 and one or both of the aptamers are linked to an extended dumbbell loop structure by non-covalent bond via complementary base pairing.

[0040] In addition to or in another embodiment, the tsRNA is encoded by a dumbbell-shaped DNA vector that encodes / contains at least one aptamer, such as a CD137 target aptamer and / or a prostate-specific membrane antigen (PSMA) target aptamer. Preferably, one or both of the (GalNAc)3 and the aptamer are linked to an extended dumbbell loop structure by non-covalent bonds via complementary base pairs.

[0041] Another embodiment of the present invention is a dumbbell-shaped delivery vector for targeted delivery to CD137+ cells, characterized by having at least one aptamer, for example, CD137-binding aptamer.Another embodiment of the present invention is a dumbbell-shaped delivery vector characterized by having at least one aptCD137-2 residue, and ideally, comprising multiple aptCD137-2 residues.

[0042] Another embodiment of the present invention is a dumbbell-shaped delivery vector for targeted delivery to prostate cancer cells, characterized in that the dumbbell-shaped delivery vector has at least one prostate-specific membrane antigen (PSMA)-binding aptamer, which delivers a suicide RNA containing a prostate-specific antigen (PSA) pre-mRNA targeting domain.

[0043] In yet another embodiment of the invention, the tsRNA comprises or is characterized by any one or more of the sequences described herein, including any combination of the sequences described herein.

[0044] According to a second aspect of the invention there is provided a trans-splicing RNA (tsRNA) molecule comprising: a) at least one binding domain specific for at least a portion of a gene associated with or which is a biomarker for a cell to be treated or a diseased cell; b) at least one binding domain specific for at least a portion of a gene that is ubiquitously expressed in all cells; c) (i) an expressible suicide protein or an expressible protein that is a component of a suicide system; (ii) an expressible fluorescent protein, luciferase or other reporter protein, and (iii) an expressible therapeutic protein a nucleic acid encoding at least one of the following: d) at least one splice signal; and e) at least one safety domain specific to a splice signal within said trans-splicing RNA; Including, The gene is a housekeeping gene, which is ubiquitously expressed in all cells. A tsRNA molecule is provided.

[0045] Ideally, the binding domain comprises a binding site that is at least 25 nt, more preferably 35 nt, even more preferably 45 nt, and most preferably 55 nt or more in length and that comprises a stretch of free-form nucleotides, the binding site being devoid of internal binding sequences and / or self-complementary sequences, and if the binding domain is 44 nt or more in length, the binding domain has at least one or more mismatched nucleotides with respect to the gene.

[0046] In a preferred embodiment of the present invention, the tsRNA may contain one or more of the nucleic acids according to i) to iii) in c) above.

[0047] According to the present study by the inventors, when characterized as b(i) of the first aspect of the invention or c(i) of the second aspect of the invention, the optimized tsRNA efficiently induced the death of cells to which the tsRNA was delivered, such as hepatoblastoma-derived cells, HBV-positive cells, CD137-positive cells, nasopharyngeal carcinoma cells, epidermal cells, basal cells, hair follicle cells, senescent cells, etc.

[0048] Another embodiment of the present invention is a suicide RNA targeting HBV positive cells using trans-splicing, which has multiple target binding domains complementary to HBV pregenomic RNA (pgRNA), AFP and / or GPC3. The expression level of HBV pgRNA in cell culture is lower than that of other targets specific to HCC, so that the activity of HBV target RNA is low at low concentrations. However, HBV-derived RNA targets are expressed at very high levels in HBV-infected cells in vivo.

[0049] Another embodiment of the present invention is a suicide RNA targeting nasopharyngeal carcinoma cells using trans-splicing, the suicide RNA having multiple target binding domains complementary to each of the various tumorigenic pre-mRNAs described herein.

[0050] Another embodiment of the present invention is a suicide RNA targeting EBV positive cells using trans-splicing, the suicide RNA having a target binding domain complementary to Epstein-Barr virus pre-mRNA (i.e., BZLF1, EBNA-3B, LMP1 and LMP2A).

[0051] Another embodiment of the present invention is a trans-splicing RNA targeted to epidermal cells, the trans-splicing RNA having multiple target binding domains complementary to each of keratin 1 (KRT1), keratin 2 (KRT2), keratin 10 (KRT10), keratin 14 (KRT14), caspase 14 precursor (CASP14) and / or neuroblast differentiation associated protein 2 (AHNAK2). Another embodiment of the present invention is a trans-splicing RNA targeted to basal cells, the trans-splicing RNA having multiple target binding domains complementary to each of keratin 15 (KRT15), collagen XVII alpha 1 (COL17A1) and / or tumor protein 73 (TP73). Another embodiment of the present invention is a trans-splicing RNA targeted to hair follicle cells, the trans-splicing RNA having multiple target binding domains complementary to each of homeobox C13 (HOXC13) and fibroblast growth factor 7 (FGF-7). Another embodiment of the present invention is a trans-splicing RNA targeting senescent cells, which has multiple target binding domains complementary to forkhead box O4 (FOXO4) and cyclin-dependent kinase inhibitor 2A (p16), respectively. Both of these trans-splicing RNAs are characterized by carrying either a GFP gene for imaging or an HSVtk gene to induce cell death. These sequences were delivered by non-invasive topical application of dumbbell-shaped vectors to the epidermis of domestic pigs.

[0052] Another embodiment of the present invention is a suicide RNA that utilizes trans-splicing to code for a death signal other than HSVtk, such as a suicide RNA that codes for a death signal such as pre-mRNA for CYLD lysine 63 deubiquitinase (CYLD), pre-mRNA for tumor necrosis factor-like weak inducer of apoptosis (TWEAK), pre-mRNA for tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), or pre-mRNA for tumor necrosis factor alpha (TNF-α).

[0053] Therefore, spliceosome-mediated RNA trans-splicing is a promising therapeutic strategy for inducing cell death in suicide gene therapy methods.

[0054] In another preferred embodiment of the present invention, the biomarkers are HCC biomarkers alpha-fetoprotein (AFP), vascular endothelial growth factor (VEGF), gamma-glutamyltransferase (GGT), hepatocellular carcinoma-associated protein 2 (HCCA2), transforming growth factor beta 1 (TGF-β1), cluster of differentiation 24 (CD24), cyclin D1 (CCND1), glypican 3 (GPC3), telomerase reverse transcriptase (TERT), alpha-L-fucosidase (AFU), CD19, CD34, CD44, CD49E, CD51, CD105, type XV collagen alpha 1 (COL15A1), C-X-C motif chemokine receptor 4 (CXCR4), and Denticleless E3 ubiquitin protein ligase. DTL homolog, epithelial cell adhesion molecule (EPCAM), Golgi protein 73 (GP73), G protein signaling modulator 2 (GPSM2), hepatocyte growth factor (HGF), heat shock protein 70 (HSP70), insulin-like growth factor 2 (IGF2), immunoglobulin superfamily member 3 precursor (IGSF3), integrin subunit alpha 6 (ITGA6), Kell blood group glycoprotein (KEL), KIT proto-oncogene, receptor tyrosine kinase (KIT), minichromosome maintenance complex component 3 (MCM3), minichromosome maintenance complex component 7 (MCM7), PDZ-binding kinase (PBK), DNA polymerase delta 1, catalytic subunit (POLD1), Protein Regulator Of Cytokinesis 1 (PRC1), SRY box transcription factor 17 (SOX17), spermatogenesis-associated serine-rich protein 2 (SPATS2), translocon associated protein subunit β (SSR2), stathmin 1 (STMN1), thrombomodulin (THBD), ZW10 interacting kinetochore protein (ZWINT), HBV-derived RNA (including HBV pgRNA), and Epstein-Barr virus-derived RNA and pre-mRNA (BamHICancer markers including Epstein-Barr virus replication activator Z (BZLF1), Epstein-Barr virus nuclear antigen 3B (EBNA-3B), latent membrane protein 1 (LMP1) and latent membrane protein 2A (LMP2A); epidermal cell markers including keratin 1 (KRT1), keratin 2 (KRT2), keratin 10 (KRT10), keratin 14 (KRT14), caspase 14 precursor (CASP14) and neuroblastoma differentiation-associated protein 2 (AHNAK2); keratin 15 (KRT15), collagen XVII alpha 1 (COL17A1) and tumor protein 73 (TP73) basal cell markers; hair follicle cell markers including homeobox C13 (HOXC13) and fibroblast growth factor 7 (FGF-7); senescent cell markers including forkhead box O4 (FOXO4) and cyclin-dependent kinase inhibitor 2A (p16); stratum corneum markers including kallikrein-related peptidase 5 (KLK5), small proline-rich protein 4 (SPRR4) and arachidonate 12-lipoxygenase (ALOX12B); spinous layer (upper epidermis layer) markers including HOP homeobox (HOPX) and kallikrein 9 (KLK9); filaggrin (FLG) and premature a single biomarker or a combination of biomarkers selected from the group including granular layer markers including ovarian failure 1B protein (POF1B); melanocyte markers including melan A (MLANA) and tyrosinase (TYR); Langerhans cell markers including CD1A and CD207; fibroblast markers including periostin (POSTN) and phospholipase Cη2 protein (PLCH2); basal cell carcinoma markers including glioma 1 (GlI1), glioma 2 (GlI2), forkhead box protein (FOXM1), forkhead box protein (FOXO3A), desmoglein 2 (DSG2) and C3b; and basal cell carcinoma recurrence markers including cyclooxygenase (COX-2), ezrin (EZR), CD25, Maspin, glioma 3 (GlI3), and gremlin 1.

[0055] In another embodiment, the disease is cancer; a viral infection; a bacterial infection; or an acquired genetic disease caused by a mutation induced by a transposable element, radiation, a chemical, or an unknown inducer.

[0056] As a first example, the cancer is hepatocellular carcinoma (HCC), cervical cancer, vaginal cancer, vulvar cancer, penile cancer, skin cancer, melanoma (including malignant melanoma), squamous cell carcinoma, basal cell carcinoma, Merkel cell carcinoma, lung cancer, cellular bladder cancer, breast cancer, colon or rectal cancer, anal cancer, endometrial cancer, kidney cancer, leukemia, acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), chronic myelogenous leukemia (CMH), chronic myelogenous leukemia (CRL ... L), hairy cell leukemia (HCL), T-cell prolymphocytic leukemia (P-TLL), large granular lymphocytic leukemia, adult T-cell leukemia, lymphoma, myeloma, non-Hodgkin's lymphoma, pancreatic cancer, prostate cancer, thyroid cancer, nasopharyngeal cancer, oral or laryngeal cancer, oropharyngeal cancer, gastric cancer, brain tumor, bone cancer, and stem cell cancer, as well as other cancers that may benefit from the treatments disclosed herein.

[0057] In a second embodiment, the viral infection is selected from the group including papillomavirus, human papillomavirus type 16, human papillomavirus type 18, retrovirus, lentivirus, herpesvirus, adenovirus, adeno-associated virus, influenza virus, hepatitis virus, hepatitis B virus (HBV), hepatitis C virus (HCV), Epstein-Barr virus (EBV), human T-lymphotropic virus (HTLV), human immunodeficiency virus (HIV), human immunodeficiency virus type 1 (HIV-1), human immunodeficiency virus type 2 (HIV-2), and the like.

[0058] In a third example, the bacterial infection is selected from the group including Bartonella henselae, Francisella tularensis, Listeria monocytogenes, Salmonella spp., Salmonella typhi, Brucella spp., Legionella spp., Mycobacterium spp., Mycobacterium tuberculosis, Nocardia spp., Rhodococcus spp., Yersinia spp., Neisseria meningitidis, and the like.

[0059] As a fourth example, the acquired genetic disease is selected from the group including neurofibromatosis types 1 and 2, McCune-Albright syndrome, Duchenne muscular dystrophy (DMD), epidermolysis bullosa, Fanconi anemia types A and C, Philadelphia chromosome, hemophilia A and B, cystic fibrosis, Muckle-Wells syndrome, lipoprotein lipase deficiency, beta thalassemia, Gaucher disease types I to III (GBA gene), ornithine transcarbamylase (OTC) deficiency (OTC), phenylketonuria (PKU) (PAH gene), aspartylglucosaminuria (AGA gene), alpha-1 antitrypsin deficiency (AATD) (SERPINA1), pyruvate dehydrogenase complex deficiency, and the like.

[0060] In a further preferred embodiment of the present invention, a tsRNA is provided to which a helper function for targeted delivery is added using a peptide or sugar chain such as GalNAc3, and ideally, two or more GalNAc3 are attached to the dumbbell-shaped vector tsRNA, and ideally, two GalNAc3 residues are added to the HSVtk expression dumbbell-shaped vector via an RNA linker oligonucleotide, preferably to the circular terminal region of the HSVtk expression dumbbell-shaped vector.

[0061] In another aspect, there is provided a pharmaceutical comprising a tsRNA of the invention, characterized in b(i) of the first aspect of the invention or c(i) of the second aspect of the invention, optionally comprising at least one further component of a suicide system effective to induce death of cells expressing said trans-spliced ​​RNA.

[0062] In another aspect, there is provided a pharmaceutical composition comprising a tsRNA of the invention, characterized in b(i) of the first aspect of the invention or c(i) of the second aspect of the invention, and optionally also comprising at least one further component of a suicide system effective to induce death of cells expressing said trans-spliced ​​RNA, and a carrier suitable for use in human or veterinary medicine.

[0063] When at least one other component of the suicide system is included, the at least one other component of the suicide system may be, for example, ganciclovir, but other known components included in suicide systems for cell killing may also be used, such as cytosine deaminase-5-fluorocytosin, cytochrome P450 ifosfamide, cytochrome P450 cyclophosphamide, and nitroreductase-5-[aziridin-1-yl]-2,4-dinitrobenzamide.

[0064] In another embodiment, a cell or vector comprising said tsRNA is provided, ideally a dumbbell-shaped DNA expression vector comprising or consisting of said tsRNA.

[0065] In another aspect there is provided a method of killing a cell comprising transfecting, lipofecting, transducing, electroporating, nucleofecting or transforming a cell with a tsRNA of the invention or a vector comprising said tsRNA, characterized in (i) of the first aspect of the invention or (i) of the second aspect of the invention, which method may comprise exposing said cell to at least one further component of a suicide system effective to induce death of cells expressing said trans-spliced ​​RNA.

[0066] In another aspect, there is provided a method for the treatment of a disease comprising the step of transfecting, lipofecting, transducing, electroporating, nucleofecting or transforming, ex vivo or in vivo, a diseased cell with a tsRNA of the invention or a vector comprising said tsRNA, characterized in clause b(i) of the first aspect of the invention or clause c(i) of the second aspect of the invention, which method may comprise the step of exposing said cell to at least one further component of a suicide system effective to induce death of cells expressing said trans-spliced ​​RNA.

[0067] In another embodiment, there is provided a method of targeting diseased cells comprising topical application (including creams, gels, foams, lotions, ointments or aerosols), intranasal, intraalveolar, systemic, oral, intravenous, intramuscular, subcutaneous, dermal, intraperitoneal or intratumoral injection of a tsRNA of the invention or a vector comprising said tsRNA in vivo, characterized in (i) of the first embodiment of the invention or (i) of the second embodiment of the invention, which may comprise exposing said cells to another component of the suicide system effective to kill said cells.

[0068] In a particular method of the invention, the cell is a virus-transformed cell, usually transformed with a virus selected from the group including papillomavirus, human papillomavirus type 16, human papillomavirus type 18, retrovirus, lentivirus, herpesvirus, adenovirus, adeno-associated virus, influenza virus, hepatitis virus, hepatitis B virus (HBV), hepatitis C virus (HCV), Epstein-Barr virus (EBV), human T-lymphotropic virus (HTLV), human immunodeficiency virus (HIV), human immunodeficiency virus type 1 (HIV-1), and human immunodeficiency virus type 2 (HIV-2).

[0069] In yet another method of the invention, the cell is a hepatocellular carcinoma (HCC) cell, a cervical cancer cell, a vaginal cancer cell, a vulvar cancer cell, a penile cancer cell, a skin cancer cell, a melanoma cell (including malignant melanoma cell), a squamous cell carcinoma cell, a basal cell carcinoma cell, a Merkel cell carcinoma cell, a lung cancer cell, a cellular bladder cancer cell, a breast cancer cell, a colon or rectal cancer cell, anal cancer cell, an endometrial cancer cell, a renal cancer cell, a leukemia cell, an acute myeloid leukemia (AML) cell, an acute lymphoblastic leukemia (ALL) cell. , chronic myelogenous leukemia (CML) cells, chronic myelogenous leukemia (CML) cells, hairy cell leukemia (HCL) cells, T-cell prolymphocytic leukemia (P-TLL) cells, large granular lymphocytic leukemia cells, adult T-cell leukemia cells, lymphoma cells, myeloma cells, non-Hodgkin's lymphoma cells, pancreatic cancer cells, prostate cancer cells, thyroid cancer cells, nasopharyngeal cancer cells, oral or laryngeal cancer cells, oropharyngeal cancer cells, gastric cancer cells, brain tumor cells, bone cancer cells, stem cell cancer cells, etc. Ideally, the cells are mammalian cells, most typically human cells.

[0070] According to a third aspect or a further embodiment of the present invention there is provided a dumbbell-shaped DNA expression vector comprising: a) one or more linear or hairpin transcription cassettes comprising a nucleotide sequence encoding the nucleic acid molecule to be expressed; b) two single-stranded DNA loops; c) a minimal transcription promoter nucleotide sequence and a transcription termination sequence operably linked to the transcription cassette; d) a nucleotide sequence that includes a DNA sequence that functions as a nuclear targeting sequence; e) a nucleotide sequence containing a spliceable intron; and f) a residue or helper function for targeted delivery, covalently or non-covalently linked to at least one of said loops A dumbbell-shaped DNA expression vector is provided, comprising:

[0071] In a further preferred embodiment of the invention, the vector comprises at least one internal loop domain, preferably comprising an abasic site or a nucleotide mismatch.

[0072] In one preferred embodiment of the invention, the abasic site comprises one or more apurinic / apyrimidinic abasic sites.

[0073] In one preferred embodiment of the invention, the nucleotide mismatch comprises a tetrahydrofuran-based analog at the abasic site.

[0074] In one preferred embodiment of the invention, the expressed nucleic acid molecule encodes a therapeutic protein or peptide.

[0075] In a preferred embodiment of the invention, said therapeutic protein is Cas9, Cas9n, hSpCas9 or hSpCas9n.

[0076] In one preferred embodiment of the invention, said therapeutic protein or said therapeutic peptide induces a death signal.

[0077] Examples of proteins or peptides that induce cell death signals are known in the art. For example, bacterial toxins such as cholera or diphtheria toxin, alpha toxin, anthrax toxin, exotoxin, pertussis toxin, shiga toxin, shiga-like toxin, etc. are known to induce cell death. In addition, apoptosis signals / proteins such as Fas, TNF, caspases (initiator caspases caspase 2, caspase 8, caspase 9, caspase 10, caspase 11 and caspase 12, and effector caspases caspase 3, caspase 6, caspase 7, etc.) are also known. In addition, enzymes that can convert non-toxic drugs into toxic components are also known, for example, herpes simplex virus thymidine kinase (HSVtk) is known to convert the relatively non-toxic drug ganciclovir (GCV) into a toxic phosphate ester (HSVtk / GCV system). Yet another example is the E. coli purine nucleoside phosphorylase (PNP) / fludarabine suicide gene system.

[0078] In a further preferred embodiment of the invention, said therapeutic protein or peptide is HSVtk.

[0079] In another preferred embodiment of the invention, the expressed nucleic acid molecule is a therapeutic nucleic acid molecule.

[0080] In one preferred embodiment of the invention, the therapeutic nucleic acid is an siRNA or shRNA.

[0081] In another preferred embodiment of the invention, the therapeutic nucleic acid molecule is an antisense RNA oligonucleotide or an antisense miRNA.

[0082] In a further preferred embodiment of the invention, the therapeutic nucleic acid molecule is a miRNA.

[0083] In a further preferred embodiment of the invention, said therapeutic nucleic acid molecule is a trans-splicing RNA.

[0084] In a further preferred embodiment of the invention, the therapeutic nucleic acid molecule is a guide RNA, a single guide RNA, a crRNA or a tracrRNA.

[0085] In another preferred embodiment of the invention, the therapeutic nucleic acid molecule is a pre-mRNA or an mRNA.

[0086] In a further preferred embodiment of the invention, the minimal transcription promoter is derived from an RNA polymerase III promoter.

[0087] In a preferred embodiment of the invention, the RNA polymerase III promoter is a U6 promoter.

[0088] In another preferred embodiment of the invention, the RNA polymerase III promoter is an H1 promoter.

[0089] In another preferred embodiment of the invention, the RNA polymerase III promoter is a minimal H1 (mH1) promoter.

[0090] In yet another preferred embodiment of the invention, the RNA polymerase III promoter is the mH1 promoter modified to contain a restriction endonuclease cleavage site and / or an inverted polymerase III transcription terminator.

[0091] In a further preferred embodiment of the invention, the minimal transcription promoter is derived from an RNA polymerase II promoter.

[0092] In one preferred embodiment of the invention, the RNA polymerase II promoter is a CMV promoter comprising the nucleotide sequence shown in SEQ ID NO:240.

[0093] In a preferred embodiment of the invention, the transcription terminator nucleotide sequence is an RNA polymerase II or RNA polymerase III termination sequence.

[0094] In one preferred embodiment of the invention, the RNA polymerase III termination sequence comprises one or more motifs including the nucleotide sequence TTTTT.

[0095] In one preferred embodiment of the invention, the DNA nuclear targeting sequence comprises the nucleotide sequence shown in SEQ ID NO:1.

[0096] In a further preferred embodiment of the invention, the enhancer nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO: 1 (full length enhancer: 30 fSV40enh).

[0097] In a further preferred embodiment of the invention, the vector comprises the intron nucleotide sequence shown in SEQ ID NO:241.

[0098] In a further preferred embodiment of the invention, said moieties or helper functions for targeted delivery are glycans.

[0099] In a further preferred embodiment of the invention, said residue or helper function for targeted delivery is a (GalNAc)3 residue.

[0100] In another preferred embodiment of the invention, said moiety or helper function for targeted delivery is an aptamer.

[0101] In a further preferred embodiment of the invention, said aptamer is a CD137-binding aptamer or a PSMA-binding aptamer.

[0102] In a further preferred embodiment of the invention, the aptamer is non-covalently attached to the dumbbell loop via complementary base pairing using the sequence shown in SEQ ID NO:242.

[0103] In a further preferred embodiment of the invention, said enlarged dumbbell loop comprises the sequence shown in SEQ ID NO:5 or SEQ ID NO:6.

[0104] In a further preferred embodiment of the invention, said moiety or helper function for targeted delivery is an antibody.

[0105] In a further preferred embodiment of the invention, said moiety or helper function for targeted delivery is an antibody that binds to CD137.

[0106] In a further preferred embodiment of the invention, the moiety or helper function for targeted delivery is a peptide or sugar chain such as GalNAc3, ideally two or more GalNAc3 are attached to the dumbbell-shaped vector.

[0107] In a further preferred embodiment of the invention, said moiety or helper function for targeted delivery is a cell penetrating peptide.

[0108] In a further preferred embodiment of the invention, said vector further encodes a detectable marker.

[0109] In one preferred embodiment of the invention, the detectable marker is a fluorescent marker.

[0110] In one preferred embodiment of the invention, the fluorescent marker is a fluorescent reporter protein.

[0111] Analysis of promoter activity in tissues can be conveniently monitored by fusing the promoter to a nucleic acid encoding a "reporter" protein or polypeptide. Examples of "reporter" proteins or polypeptides are well known in the art and include enzymes such as β-glucuronidase. Proteinaceous fluorescent reporters are also known in the art. Green fluorescent protein (GFP) is a self-illuminating fluorescent protein isolated from coelenterates such as the Pacific jellyfish Aequoria victoria. Its role is to convert the blue chemiluminescence of another protein, aequorin, into green fluorescence by energy transfer. GFP can function as a protein tag, as it has been shown to tolerate fusion to the N- or C-terminus of a wide variety of proteins, many of which retain their native function when fused to GFP. It is most often used in the form of an enhanced GFP, with codon usage adapted to the human code. Other proteinaceous fluorescent dyes include yellow fluorescent protein, red fluorescent protein, and blue fluorescent protein. These are commercially available, for example, from Clontech (www.clontech.com). Yet another example is firefly luciferase.

[0112] In a preferred embodiment of the invention, the nucleotide sequence for targeted delivery having homology to a portion of a mammalian genome is incorporated into the double-stranded DNA portion of a dumbbell-shaped vector.

[0113] In another preferred embodiment of the present invention, the nucleotide sequence for targeted delivery having homology to a portion of a mammalian genome is incorporated into a single-stranded loop of a dumbbell-shaped vector.

[0114] According to a further aspect of the present invention, there is provided a pharmaceutical composition comprising the dumbbell-shaped vector according to the present invention and a suitable carrier.

[0115] The dumbbell-shaped vector composition of the present invention is administered in the form of a pharma- ceutically acceptable preparation. Such preparations may conventionally contain salts, buffers, preservatives, compatible carriers and auxiliary therapeutic agents in pharma- ceutically acceptable concentrations. The dumbbell-shaped vector composition of the present invention may be administered by conventional routes, such as injection or slow infusion over time. The route of administration may be, for example, intravenous, intraperitoneal, intramuscular, intracavitary, subcutaneous, transdermal, oral, topical, intratracheal, intranasal, intravaginal, or transepithelial. Alternatively, the dumbbell-shaped vector or dumbbell-shaped vector composition of the present invention is delivered by physical methods, such as, but not limited to, liquid jet injection, microinjection, microneedle, powder particle injection, gold particle injection, gene gun, electroporation, or hydrodynamic injection.

[0116] The dumbbell-shaped vector composition of the present invention is administered in an effective amount. An "effective amount" is an amount that is capable of obtaining a desired response when the dumbbell-shaped vector of the present invention is used alone or in combination with another dose. When treating a disease, the desired response is the inhibition of disease progression. Inhibition of disease progression may include only a temporary delay in disease progression, but more preferably includes a permanent halt in disease progression. This can be monitored by routine methods. It goes without saying that an effective amount depends on the particular condition being treated; the severity of the condition; individual patient parameters, including age, physical condition, height, and weight; the duration of treatment; the nature of the combination therapy (if combination therapy is being used); the specific route of administration; and similar factors as mentioned above within the knowledge and expertise of the medical practitioner. These factors are well known to those skilled in the art and can be addressed with no more than routine experimentation. In general, it is preferred to use the maximum dose of each component or combination thereof, i.e., the highest dose safe according to sound medical judgment. However, one of ordinary skill in the art will appreciate that a lower dose or a lower tolerance may be required by a patient for medical, psychological, or virtually any other reason.

[0117] The dumbbell-shaped vector composition used in the method is preferably sterile and preferably contains an effective amount of the dumbbell-shaped vector of the present invention to obtain the desired response in a weight or volume unit suitable for administration to a patient. The dose of the vector administered to the subject can be selected according to various parameters. Specifically, it can be selected according to the administration method used and the condition of the subject. Other factors include the desired duration of treatment. If the subject does not respond adequately to the initial dose applied, a higher dose (or an effective high dose via another, more localized delivery route) may be used within the range tolerated by the patient. Other protocols for administering the vector composition are known to those skilled in the art, and in other protocols, the dose, injection schedule, injection site, administration method, etc. differ from those described above. Administration of the composition to mammals other than humans (e.g., administration for testing purposes or veterinary treatment purposes) is carried out under substantially the same conditions as described above. In this specification, the subject is a mammal, preferably a human, including non-human primates, cows, horses, pigs, sheep, goats, dogs, cats, or rodents.

[0118] When the dumbbell-shaped vector composition of the present invention is administered, it is administered in a pharma- ceutically acceptable amount and in the form of a pharma- ceutically acceptable composition. "Pharmaceutically acceptable" refers to a non-toxic amount that does not interfere with the effectiveness of the biological activity of the active agent. Such preparations may include salts, buffers, preservatives, compatible carriers as conventionally used, and may include other therapeutic agents (e.g., those normally used to treat a particular disease symptom). When used in medicine, the salts should be pharma- ceutically acceptable, but pharma- ceutically unacceptable salts may be conveniently used to prepare pharma- ceutically acceptable salts, and such salts are not excluded from the scope of the present invention. Such pharmacologically and pharma- ceutically acceptable salts include, but are not limited to, those prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, and the like. In addition, pharma- ceutically acceptable salts may also be prepared as alkali metal or alkaline earth metal salts, such as sodium salts, potassium salts, calcium salts, and the like.

[0119] The pharmaceutical composition containing the dumbbell-shaped vector of the present invention may contain a suitable buffering agent such as acetate, citrate, borate, phosphate, etc. The pharmaceutical composition of the present invention may further contain a suitable preservative such as benzalkonium chloride, chlorobutanol, parabens, and thimerosal.

[0120] The dumbbell-shaped vector composition may be conveniently provided in unit dosage form and may be prepared by any method well known in the art of pharmacy. All methods include combining the dumbbell-shaped vector with one or more accessory ingredients. The composition containing the vector of the present invention may be administered as an aerosol or inhaled. Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of the vector of the present invention, such preparations being preferably isotonic with the blood of the recipient. Such preparations may also be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, such as a solution in 1,3-butanediol. Acceptable solvents that may be used include water, Ringer's solution, and isotonic saline. In addition, sterile fixed oils are commonly used as a solvent or suspending medium.

[0121] For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides.

[0122] Additionally, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulations suitable for oral, subcutaneous, intravenous, intramuscular, and the like administration are described in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

[0123] Preferred features of each aspect of the invention may be described in relation to other aspects of the invention.

[0124] Throughout the detailed description and claims of this specification, the singular includes the plural unless the context requires otherwise. Specifically, where an indefinite article is used, the description herein is to be construed as including the singular and the plural unless the context requires otherwise.

[0125] In the following claims and the foregoing detailed description of the invention, unless a more restrictive meaning is required by the context due to the wording or necessary implication, the term "comprise" or variations thereof such as "comprises" or "comprising" are used in their inclusive sense, i.e., used to specify the presence of stated features in various embodiments of the invention, but without excluding the presence or addition of further features.

[0126] All references cited in this specification, including patents and patent applications, are hereby incorporated by reference. References thereto do not constitute prior art. Moreover, prior art does not constitute part of the common general knowledge in the art.

[0127] Other features of the invention will become apparent from the following examples. Generally speaking, the invention encompasses any novel feature or combination of novel features disclosed herein (including the accompanying claims and drawings). Thus, any feature, integer, property, compound or chemical moiety described in conjunction with a particular aspect, embodiment or example of the invention is understood to be applicable to any other aspect, embodiment or example described herein, where compatible.

[0128] Moreover, unless stated otherwise, any feature disclosed in this specification may be replaced with an alternative feature serving the same, equivalent or similar purpose.

[0129] The invention will now be described, by way of example only, with particular reference to the accompanying drawings in which: [Brief description of the drawings]

[0130] [Figure 1]Design of a universal trans-splicing-based suicide RNA to induce cell type-specific HSVtk expression and cell death. A) Base design, B) Design with safety domain, and C) Design with safety domain and DNA nuclear localization signal are shown. NLS: DNA nuclear localization signal; CMV: CMV promoter; SD: safety domain; BD: target pre-mRNA binding domain; ISE: intronic splice enhancer; BP: branch point; PPY: polypyrimidine tract; AG: splice acceptor site; P2A: proteolytic cleavage site; ESE: exonic splice enhancer; HSVtk: herpes simplex virus thymidine kinase; TGA: translation termination codon; SV40 pA: simian virus 40 polyadenylation site.

[0131] [Diagram 2] In an alamarBlue cell viability assay, we show that multi-targeted suicide RNA induces higher levels of cell death activity in human hepatoblastoma-derived cells compared to single-targeted suicide RNA, even at a 300-fold lower GCV concentration.

[0132] [Diagram 3] 1 shows that suicide RNA targeting hepatocellular carcinoma (left panel) exhibits a lower EC50 value than the positive control (right panel), a vector constitutively expressing HSVtk.

[0133] [Figure 4] This shows that the safety domain does not inhibit the suicide activity of suicide RNA using trans-splicing. Left: Design of the safety domain. A continuous safety domain (upper panel) and a segmented safety domain (lower panel) are shown. Right: Results of an alamarBlue assay comparing the suicide activity of various vectors.

[0134] [Diagram 5]GFP reporter assay for monitoring off-target trans-splicing. GFP2 was shifted out of frame by splitting the GFP gene into two parts (GFP1 and GFP2) by inserting a functional mini-intron upstream of GFP. A) Transfection of the reporter vector into human cells leads to cis-splicing leading to the formation of functional mature GFP mRNA and GFP expression. B) Co-transfection of a trans-splicing vector could lead to off-target trans-splicing due to the close proximity of the trans-splicing RNA to the GFP pre-mRNA, resulting in reduced GFP signal. C) Off-target trans-splicing is suppressed by the safety domain, so no reduction in GFP signal occurs.

[0135] [Figure 6] Multi-target trans-splicing RNA featuring safety domains shows no off-target trans-splicing activity. Left: 500 ng of multi-target trans-splicing vector without safety domain, with continuous safety domain, or with segmented safety domain was co-transfected with 500 ng of GFP reporter vector into HepG2 cells. Vector without safety domain showed slightly reduced GFP expression, but not significantly. Vector with safety domain showed significantly higher GFP expression, indicating that the slight off-target activity induced by vector without safety domain was suppressed by safety domain.

[0136] [Figure 7]We show that suicide RNAs characterized by a binding domain targeting HCC-specific pre-mRNA (AFP) and an HBV-specific transcript exhibit similar cell-killing activity as HCC-targeted RNAs. Despite similar cell-killing activity, the HCC / HBV-targeted vector is expected to have higher specificity for HBV-positive liver cancer cells, as analyzed using the alamarBlue cell viability assay.

[0137] [Figure 8] We show that suicide RNAs characterized with binding domains targeting cancer-specific pre-mRNA biomarkers were shown to effectively kill nasopharyngeal carcinoma cell lines C666 and HONE-1, as analyzed using the alamarBlue cell viability assay.

[0138] [Figure 9] We show that dumbbell-shaped trans-splicing vectors can be delivered to porcine epidermis by non-invasive topical application and can induce specific GFP expression (imaging vector) or cell death (suicide vector) depending on the cell type. Left: GFP expression induced by various types of vectors. Dumbbell-shaped constitutive vector and dumbbell-shaped trans-splicing vector induce stronger GFP expression than 50-fold dose of GFP-expressing constitutive plasmid. Center: Cell type-specific GFP expression induced by dumbbell-shaped trans-splicing vector. Right: Specific killing of various epidermal cells induced by trans-splicing dumbbell-shaped vector.

[0139] [Figure 10]HEK293T cell killing induced by expression of apoptosis- or necrosis-inducing factors, including CYLD lysine 63 deubiquitinase (CYLD), tumor necrosis factor-like weak inducer of apoptosis (TWEAK), tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), and tumor necrosis factor alpha (TNF-α).NTC: no transfection control; pVAX1: empty cloning vector pVAX1.

[0140] [Figure 11] The dumbbell-shaped vector-(GalNAc)3 complex and the dumbbell-shaped vector-aptCD137-2 complex are shown. Antisense oligos labeled with (GalNAc)3 or aptCD137-2 were hybridized to the extended dumbbell loop via complementary base pairing. To optimize this hybridization, a loop was designed with a 21-nt (GalNAc)3 oligo-binding site and an 18-nt spacer sequence between them. The minimum free energy secondary structures of one GalNAc3 complex-forming loop and two GalNAc3 complex-forming loops (upper panel) and the minimum free energy secondary structures of GalNAc3 DNA linker oligonucleotide and GalNAc3 RNA linker oligonucleotide (lower panel) are shown, with the DNA or RNA folding forms predicted using mfold.

[0141] [Figure 12]The extended dumbbell loop does not inhibit the delivery and gene expression of the dumbbell-shaped vector. The dumbbell-shaped vectors produced using the gap primer PCR method (gp-db) show better activity than the conventional dumbbell-shaped vectors (c-db) produced using the ELAN method. Increasing the size of the complex formation loop (C-loop) does not inhibit the activity of the dumbbell-shaped vectors produced using the gap primer PCR (gpPCR). The left figure shows the design of the conventional dumbbell-shaped vectors (c-db) produced using only the ELAN method and the design of the advanced dumbbell-shaped vectors (gp-db) produced using gpPCR, each with various sizes of C-loop. Black: double-stranded dumbbell-shaped vector core with the gene of interest; Cyan: loops with the indicated loop sizes; Magenta: abasic positions to induce mismatches. The right figure shows that various dumbbell-shaped vectors with various C-loop sizes or the pMAX-GFP vector were transfected into HepG2 cells, and 48 hours after transfection, the expression of MaxGFP was monitored by flow cytometry. Mean ± SEM (n = 3). Significance was tested using unpaired Student's t test.

[0142] [Figure 13]The 3'-end of a free DNA or RNA oligo was labeled with (GalNAc)3 residues. The complexing loop of the dumbbell-shaped vector was non-covalently linked to GalNAc3 or aptCD137-2 residues via an antisense DNA or RNA oligonucleotide. A) Design of a single complexing loop containing a 21-nt complexing oligonucleotide binding site (blue) flanked by two 18-nt spacers (red). B) Schematic showing binding of DNA-GalNAc3, RNA-GalNAc3, or aptCD137-2 residues to the complexing loop of the dumbbell-shaped vector. C) Agarose gel electrophoresis analysis of MaxGFP-expressing dumbbell-shaped vector (dbGFP) before and after annealing a single DNA-1-GalNAc3 or RNA-1-GalNAc3 oligonucleotide in 10-fold molar excess (1:10) or 2-fold molar excess (1:2). Of note, the dumbbell-shaped vector-GalNAc3 complex was cleaved with AseI restriction endonuclease. The gel section shown shows only the extended complexation loop. The formation rate of the dumbbell-shaped vector-GalNAc3 complex was quantified using imageJ software version 1.53u. D) Agarose gel electrophoresis analysis of MaxGFP-expressing dumbbell-shaped vector (dbGFP) before or after annealing with a single aptCD137-2 homodimer in stoichiometric amounts (1:1) or in a two-fold molar excess (1:2). The formation rate of the dumbbell-shaped vector-aptSC137-2 complex was quantified using imageJ software version 1.53u. E) Agarose gel electrophoresis analysis of dbGFP-DNA-1-GalNAc3 complex or dbGFP-RNA-1-GalNAc3 complex after cleavage with RNaseH is shown.

[0143] [Figure 14]Uptake of GFP-dumbbell-shaped vector-(GalNAc)3 complex by HepG2 cells from culture medium. Left: Quantification of uptaken dumbbell-shaped vector DNA by qPCR. Both RNA oligo complex and DNA oligo complex were taken up into cells. Right: Quantification of expressed GFP mRNA by RT-qPCR. The results showed that the RNA oligo complex resulted in higher mRNA expression, presumably because cleavage of the (GalNAc)3 residue by RNase H promoted diffusion of the dumbbell-shaped vector in the nucleus.

[0144] [Figure 15]The dumbbell-shaped vector is exonuclease resistant. The dumbbell-shaped vector expressing MaxGFP was analyzed on a 1% agarose gel before and after treatment with exonuclease. In addition, the uptake and expression of the MaxGFP dumbbell-shaped vector-GalNAc3 complex from the culture medium by HepG2 cells is shown. A) The design of the MaxGFP dumbbell-shaped vector-GalNAc complex is shown. B) Wells of HepG2 cells exposed to DNA-linker-MaxGFP dumbbell-shaped vector (dbGFP-DNA-1-GalNAc3), RNA-linker-MaxGFP dumbbell-shaped vector (dbGFP-RNA-1-GalNAc3), or unlabeled MaxGFP dumbbell-shaped vector (dbGFP), or wells of HepG2 cells transfected with dbGFP are shown. After 24 hours, intracellular dumbbell-shaped vector DNA was isolated and quantified by qPCR. C) Wells of HepG2 cells exposed to DNA-linker-MaxGFP dumbbell vector (dbGFP-DNA-1-GalNAc3), RNA-linker-MaxGFP dumbbell vector (dbGFP-RNA-1-GalNAc3), or unlabeled MaxGFP dumbbell vector (dbGFP), or wells of HepG2 cells transfected with dbGFP. After 24 hours, RNA was isolated and quantified by RT-qPCR. D) Design of a dual complexation loop containing two 21 nt complexation oligonucleotide binding sites (blue), a 10 nt spacer (red) adjacent to each oligonucleotide binding site, and a 9 nt spacer (red) separating the two oligonucleotide binding sites. Left; Schematic of a dumbbell vector complex with two GalNAc3 residues bound to one complexation loop. E) The average number of GFP-positive cells quantified by flow cytometric analysis of HepG2 cells exposed for 48 h to dbGFP-GalNAc3 complexes added to the cell culture medium.NTC: no transfection control; Lipo + pGFP: cells transfected with pMaxGFP plasmid and Lipofectamine 3000; Lipo + dbGFP: cells transfected with MaxGFP-expressing dumbbell-shaped vector and Lipofectamine 3000; dbGFP-DNA-1-GalNAc3: MaxGFP-expressing dumbbell-shaped vector with one GalNAc3 residue linked via a DNA linker; dbGFP-RNA-1-GalNAc3: MaxGFP-expressing dumbbell-shaped vector with one GalNAc3 residue linked via an RNA linker; dbGFP-DNA-2-GalNAc3: MaxGFP-expressing dumbbell-shaped vector with two GalNAc3 residues linked via a DNA linker; dbGFP-RNA-2-GalNAc3: MaxGFP-expressing dumbbell-shaped vector with two GalNAc3 residues linked via an RNA linker. Mean ± SEM (n = 5). Significance was tested using unpaired Student's t-test.

[0145] [Figure 16]Flow cytometry analysis of HepG2 cells transfected with MaxGFP dumbbell vector-GalNAc3 complex. A) Representative 2D scatter plots gated on live HepG2 cells. B) Representative 2D scatter plots gated on HepG2 cell singlets. C) Representative histograms of flow cytometry analysis of HepG2 cells exposed to dbGFP-GalNAc3 complex added to cell culture medium for 48 hours. NTC: no transfection control; dbGFP-DNA-1-GalNAc3: dumbbell-shaped MaxGFP expression vector with one GalNAc3 residue linked via a DNA linker; dbGFP-RNA-1-GalNAc3: dumbbell-shaped MaxGFP expression vector with one GalNAc3 residue linked via an RNA linker; dbGFP-DNA-2-GalNAc3: dumbbell-shaped MaxGFP expression vector with two GalNAc3 residues linked via a DNA linker; dbGFP-RNA-2-GalNAc3: dumbbell-shaped MaxGFP expression vector with two GalNAc3 residues linked via an RNA linker.

[0146] [Figure 17]Figure 1 shows dbHSVtk-GalNAc3 complex-induced killing of HepG2 cells. A) Design of HSVtk dumbbell vector-GalNAc complex. B) Addition of dbHSVtk-GalNAc3 complex to cell culture medium in the presence (100 μM GCV) or absence (no GCV) of GCV induced killing of HepG2 cells as monitored by alamarBlue cell viability assay. HepG2 cells were transfected with Lipfectamine 3000 or exposed to HSVtk expression vector in cell culture medium and cell death was monitored on day 6. NTC: no transfection control; Lipo pHSVtk: HSVtk expression plasmid delivered by lipofection; Lipo dbHSVtk-RNA-2-GalNAc3: HSVtk expression dumbbell-shaped vector with two GalNAc3 residues linked via an RNA linker delivered by lipofection; dbHSVtk-RNA-1-GalNAc3: HSVtk expression dumbbell-shaped vector with one GalNAc3 residue linked via an RNA linker added to the medium; dbHSVtk-RNA-2-GalNAc3: HSVtk expression dumbbell-shaped vector with two GalNAc3 residues linked via an RNA linker added to the medium. Mean ± SEM (n = 3). Significance was tested using unpaired Student's t-test.

[0147] [Figure 18]This is a schematic diagram showing the concept of GalNAc3-mediated cellular uptake and expression of dumbbell-shaped vector DNA. A complex containing one GalNAc3 binds to one asialoglycoprotein receptor (ASGPR) and is transported into cells via clathrin-dependent endocytosis. A complex containing two GalNAc3s can bind to two ASGPR receptors to promote cellular uptake. The RNA-linker complex is cleaved by endogenous RNase H to release the GalNAc3 residue from the dumbbell-shaped vector DNA, but such cleavage does not occur in the DNA-linker complex. Uncomplexed dumbbell-shaped vectors are not bulky, which facilitates diffusion through the nuclear pore complex and results in high expression of the introduced gene.

[0148] [Figure 19] Relative GFP mRNA expression induced in mouse liver after intravenous injection of 10 μg of GFP-expressing dumbbell-shaped vector or dumbbell-shaped vector complex. The highest GFP mRNA expression was detected after injection of GFP-dumbbell-shaped vector-GalNAc3 complex. Hydrodynamic injection: Hydrodynamic injection of GFP-expressing dumbbell-shaped vector; Negative control: Uninjected mice; PBS iv: Mice injected with PBS; GalNAc iv: Mice injected intravenously with GFP-dumbbell-shaped vector-GalNAc3 complex; JetPEI-vivo iv: Mice injected intravenously with GFP-dumbbell-shaped vector-in vivo-JetPEI LNP; SAINT-vivo iv: Mice injected intravenously with GFP-dumbbell-shaped vector-SAINT-vivo LNP. Mean ± SEM (n=4).

[0149] [Figure 20] The sequence table of the constructs used in the present invention is shown below (all sequences are written from the 5' end to the 3' end). Sequences 57 to 68 show constructs including a safety domain, multiple binding domains, and an optional nuclear localization signal. EXAMPLES

[0150] method Methods and Materials RNA design: The trans-splicing construct was designed by combining various previously reported and novel molecular features to improve activity and target specificity. The trans-splicing construct with 3' exon replacement consisted of a CMV promoter (pEGFP-N1, Clontech, accession number U55762) and a downstream binding domain with 50 bases of complementarity to the target AFP intron 5. This binding domain contained two mismatches at positions 18 and 19, suppressing the antisense effect that may be induced by long double-stranded RNA in the cell nucleus. Using the "foldanalyze" software (HUSAR, DKFZ), we selected a short unstructured binding domain that could bind to intron 5 of AFP from within the complete antisense RNA structure space. The structure of the selected binding domain was confirmed by predicting the secondary structure (minimum free energy and center of gravity) of the RNA using the mfold and RNAfold software tools. The binding domain thus selected was then fused to the remainder of the trans-splicing RNA, taking care to maintain the unstructured nature of the binding domain and to ensure that it does not participate in base pairing, trans-splicing, or coding domains, which was achieved by incorporating an appropriate spacer. The selected 3' splice signal (3'ss) was designed to functionally compete with cellular cis-acting splice sites and consisted of an intronic splice enhancer (ISE) (McCarthy, et al., 1998; Konczak, et al., 2000; Yeo et al., 2004), a branch point (BP) (Eul, 2006), and a polypyrimidine tract (ppt) (Nobel, et al., 1998; Taggart, et al., 2012). By placing a sequence coding for the proteolytic cleavage site P2A ( Kim et al., 2011 ) upstream of the coding sequence of HSVtk, a trans-splicing process was allowed to occur, resulting in the endogenous release of native HSV-tk from the AFP-HSVtk fusion protein.The HSVtk gene lacks an initiation codon and can only be translated when trans-splicing occurs with the initiation of translation of the target message. An A / G-rich internal splice enhancer (ESE) was added to the HSVtk gene using degenerate codons to avoid altering the amino acid sequence of HSV-tk (Fairbrother, et al., 2002; Jin et al., 2003) (Figure 1). In addition, a 133-base long β-globin-derived mini-intron (pCMVTNT) was inserted at the splice site consensus motifs (3' ss CAG / G and 5'ss MAG) of the HSVtk gene. TM , accession number AF477200.1) was introduced into p3ER. For transcription termination, an SV40 polyA sequence (pcDNA3.1, Life Technologies) was used. The trans-splicing construct with the 5' exon replaced was designed to have the same molecular features as p3ER, but in a different orientation, and included a CMV promoter and translation signal motif. To ensure that all structural elements important for eukaryotic mRNA translation were included, the original cap site of AFP (Gibbs et al., 1987) and downstream consensus Kozak sequence GCCRGCCAUGG (Kozak, 1995, 1999, 2005) were included. The translation initiation signal was followed immediately by the coding domain of HSVtk, including an ESE and a mini-intron, followed by a 5' splice signal (Freund et al., 2005). The 5' binding domain was also designed to contain mismatches at positions 24 and 25 to avoid antisense effects, as in the 3' binding domain described above. Downstream of the binding domain, a hammerhead ribozyme (HHRz) (Saksmerprome et al., 2004) was incorporated to enhance the cleavage of the binding domain after delivery into the nucleus. Downstream of the hammerhead ribozyme, a long spacer was placed to separate the hammerhead ribozyme from the polyA, followed by SV40 polyA.

[0151] Splice site prediction: Splice site strength and properties were predicted using Alternative Splice Site Predictor (ASSP) software (Wang, 2006) (http: / / wangcomputing.com / assp / overview.html) and Berkeley Drosophila Genome Project Splice Site Prediction (BDGP SSP) (Reese et al., 1997) (http: / / www.fruitfly.org / seqtools / splice.html) with default cutoff values ​​for splice site prediction. To predict splice site properties in the HPV16 genome, the ASSP software output data on constitutive splice acceptor and donor sites and potential splice acceptor and donor sites based on the overall score and confidence level determined by the ASSP software. In addition to splice sites described in the literature (Johansson, 2013; Schmitt et al., 2011), alternative splice sites with a confidence level above 0.89 and a score above 5.5, and constitutive splice sites with a confidence level above 0.1 and a score above 7.7 were selected for the analysis of trans-splicing.

[0152] Plasmid construction Plasmid pGFP was cloned by inserting the maxGFP gene (CMV promoter and coding sequence and SV40 polyA site) from the pMAX-GFP vector (Lonza) between the restriction endonuclease cleavage sites NdeI and BbsI of the pVAX1 vector (Addgene). The SV40 enhancer, which functions as a DNA nuclear localization signal (dNLS), was inserted between the NdeI and BbsI sites upstream of the CMV promoter. The HSVtk positive control plasmid had the coding sequence of the codon-optimized HSV1 thymidine kinase inserted into the pVAX1 plasmid under the control of the CMV promoter.

[0153] Construction of dumbbell-shaped vector (db): The dumbbell-shaped vector for trans-splicing was prepared from the plasmid vector using the ELAN method for preparing dumbbell-shaped vectors. The Enzymatic Ligation Assisted by Nucleases (ELAN) method is a three-step method that includes digestion of the transcription cassette from the plasmid, ligation of the circular loops at both ends, and removal of the uncircularized dumbbell-shaped plasmid by exonuclease treatment.

[0154] (a) Phosphorylation of stem-loop primer Stem loops containing each restriction enzyme site were synthesised by AIT Biotech (Singapore) and phosphorylated using the reactions shown in Table 1 below. [Table 1]

[0155] The stem loop primers used were Stem loop-SpeI and Stem loop-BamHI.

[0156] (b) ELAN method In the ELAN loop ligation method, the gene expression cassette is directly excised from the parent plasmid. A 50-fold amount of stem-loop was added to the ligation reaction mixture to ensure that most of the gene expression cassette was capped. By-products such as loop dimers were cleaved with restriction enzymes and destroyed during exonuclease treatment. The detailed reaction setup is shown in Table 2 below. [Table 2]

[0157] The constructed dumbbell-shaped vector was run on a 1% agarose gel to confirm its integrity.

[0158] Gapped primer PCR As an alternative to the ELAN method, a dumbbell-shaped vector was generated using gap primer PCR (gpPCR). 1. Optional step: Linearize the plasmid DNA template by cleaving with a restriction endonuclease upstream or downstream of the PCR amplicon. 100 ng of plasmid template DNA was linearized by incubation for 2 hours with FastDigest BclI and FastDigest DraI endonuclease enzymes in 10x FastDigest buffer in a reaction volume of 100 μL. 2. Prepare a 10 µM working solution consisting of gap primers and dNTP mix (10 mM each) using nuclease-free water. Universal pVAX1 forward gap primer, 100 μM (PAGE purified): 5'-pATCCAGTTTTCTGGA / idSp / GACTCTTCGCGATGTACGGG-3' (SEQ ID NO: 243) Universal pVAX1 reverse gapped primer, 100 μM (PAGE purified): 5'-pAAGGTCTTTTGACCT / idSp / GAAGCCATAGAGCCCACCG-3' (SEQ ID NO: 244) Gap primer for binding one GalNAc3: 5'- / 5Phos / ATCCAGTTTTATTTTATTTTATTTTAGTTCTCATGCACACTTATAGCGGTTTGGTTTGGTTTGGTAACTGGA / idSp / GCGATGTACGGGCCAGATATA-3' (SEQ ID NO: 245) Gap primer for joining two GalNAc3: 5'- / 5Phos / ATCCAGTTTTATTTTATTTTATTTTAGTTCTCATGCACACTTATAGCGGGAAACCCGTTCTCATGCACACTTATAGCGGTTTGGTTTGGTTTGGTTTCTGGA / idSp / GCGATGTACGGGCCAGATATA-3' (SEQ ID NO: 246) 3. To prepare a 100 μL reaction, in a 0.2 mL PCR tube, mix 10 μL Q5® Reaction Buffer, 5 μL Taq Polymerase Reaction Buffer, 5 μL MgSO, 2 μL 10 mM dNTP Mix, 4 μL 10 μM Forward Gapped Primer, 4 μL 10 μM Reverse Gapped Primer, 0.1 μL (0.5 U) Taq DNA Polymerase, 0.1 μL (1 U) Q5 DNA Polymerase, and 10 ng DNA template, and add water to make 100 μL. 4. After pulse centrifugation, PCR the reaction mix by performing an initial denaturation at 98°C for 30 s followed by 25-30 cycles of a denaturation step at 98°C for 10 s, a primer annealing step at 64°C for 30 s, and a primer extension step at 72°C for 30 s / kb, with a final extension at 72°C for 2 min. 5. Verify PCR products by loading 5 μL of reaction with 1 μL of 6× loading dye onto a 1% agarose gel and running at 100 V for 1 hour.

[0159] Ligation of gp-dumbbell 1. To prepare a 150 μL ligation reaction, add 15 μL of 10x T4 DNA ligase buffer, 5 μL (20 U) of T4 DNA ligase, and 30 μL of nuclease-free water to the 100 μL PCR reaction in a 0.2 mL PCR tube, mix, and spin down. 2. Incubate at room temperature (20℃~25℃) for 1 hour.

[0160] Optional step: treatment with exonuclease 3. Transfer a 5 μL aliquot from the ligation reaction to a new 0.2 mL PCR tube for DNA gel electrophoresis. 4. Add 5 μL of T7 DNA polymerase to the ligation reaction and incubate at 37°C for 30 minutes, then heat to 85°C for 5 minutes to inactivate the ligase. 5. Load 5 μL of untreated sample and 5.2 μL of exonuclease-treated sample onto a 1% agarose gel. Run the gel at 100 V for 1 hour. Quantitate the conversion rate by quantifying and comparing the band intensities of the exonuclease-treated and untreated samples. 6. Purify using the QIAquick PCR Purification Kit. Add 5x the reaction volume of PB Binding Buffer, mix well and transfer to a QIAquick spin column. Centrifuge at 12,000 x g for 1 min. Discard the flow-through. Add 700 µL of PE Wash Buffer to the spin column and centrifuge at 12,000 x g for 1 min. Discard the flow-through and dry spin at 12,000 x g for 1 min. Transfer the spin column to a new 1.5 mL microtube and add 50 µL of nuclease-free water for elution. Centrifuge at 12,000 x g for 1 min. 7. Large volumes of ligation reactions can be purified by extraction with phenol-chloroform-isoamyl alcohol (PCI) (25:24:1), followed by re-extraction three times with chloroform-isoamyl alcohol (CI) (24:1), and ethanol precipitation. Specifically, an equal volume of PCI is added to the aqueous phase containing the DNA, vortexed at maximum speed for 2 min, and centrifuged at 12,000 × g for 10 min. The upper aqueous phase is then transferred to a new tube and re-extracted three times by adding an equal volume of CI. For re-extraction, the mixture is not vortexed but rather manually stirred vigorously for 30 s and centrifuged (12,000 × g, 30 s) to separate the phases. After the third re-extraction, the upper aqueous phase is transferred to a new tube and 0.1 volumes of 3 M ammonia, 0.1 volumes of sodium acetate or potassium acetate (pH 4.8-5.2), and 2.5 volumes of absolute alcohol (4 °C) are added. The resulting solution is mixed gently, incubated at -20°C for at least 20 min, and centrifuged (15 min, 4°C, 12,000 x g) to pellet the dumbbell-shaped DNA. The supernatant is discarded and the pellet is washed with 70% ethanol (4°C) and dried (air-dried or using a speedvac centrifuge).

[0161] Construction of superior dumbbell-shaped vectors High-purity production using a method named "1-2-3 gap primer PCR" This method is a one-tube, two-enzyme, three-hour procedure that includes PCR followed by ligation. The resulting dumbbell-shaped vector has a mismatch near the loop structure, which promotes diffusion in the nucleus and enhances gene expression. See Wolfgang Walther (ed.), Gene Therapy of Cancer: Methods and Protocols, Methods in Molecular Biology, vol. 2521, https: / / doi.org / 10.1007 / 978-1-0716-2441-8 18, Springer Science+Business Media, LLC, part of Springer Nature 2022. All procedures were performed at room temperature unless otherwise noted.

[0162] Gap Primer PCR 1 Universal pVAX1 forward gap primer, 100 μM (PAGE purified): 5'-pATCCAGTTTTCTGGA / idSp / GACTCTTCGCGATGTACGGG-3' (SEQ ID NO: 243) Universal pVAX1 reverse gapped primer, 100 μM (PAGE purified): 5'-pAAGGTCTTTTGACCT / idSp / GAAGCCATAGAGCCCACCG-3' (SEQ ID NO: 244) These gap PCR primers had a universal 5' domain containing a 5' phosphate that would not be substituted, a region designed to refold into a dumbbell loop, an abasic position, and a 3' domain (underlined) that binds to the DNA template. In this example, the 3' end is complementary to the cloning vector pVAX1. 1. Optional step: Linearize the plasmid DNA template by cleaving with a restriction endonuclease upstream or downstream of the PCR amplicon. 100 ng of plasmid template DNA was linearized by incubation for 2 hours with FastDigest BclI and FastDigest DraI endonuclease enzymes in 10x FastDigest buffer in a reaction volume of 100 μL. Linearizing the DNA template using endonuclease digestion increases PCR yields. 2. Prepare a 10 µM working solution consisting of gap primers and dNTP mix (10 mM each) using nuclease-free water. 3. To prepare a 100 μL reaction mixture, in a 0.2 mL PCR tube, mix 10 μL Q5 reaction buffer, 5 μL Taq polymerase reaction buffer, 5 μL MgSO4, 2 μL 10 mM dNTP mix, 4 μL 10 μM forward gap primer, 4 μL 10 μM reverse gap primer (see Note 3) (Figure 3), 0.1 μL (0.5 U) Taq DNA polymerase (see Notes 4 and 5), 0.5 μL (1 U) Q5 DNA polymerase, and 10 ng DNA template, and add water to make 100 μL. 4. After pulse centrifugation, PCR the reaction mix by performing an initial denaturation at 98°C for 30 s followed by 25-30 cycles of a denaturation step at 98°C for 10 s (Figure 6), a primer annealing step at 64°C for 30 s (see Note 7), and a primer extension step at 72°C for 30 s / kb (see Note 6), with a final extension at 72°C for 2 min. 5. Verify PCR products by loading 5 μL of reaction with 1 μL of 6× loading dye onto a 1% agarose gel and running at 100 V for 1 hour.

[0163] 3.2 Ligation 1. To prepare a 150 μL ligation reaction, add 15 μL of 10x T4 DNA ligase buffer, 5 μL (20 U) of T4 DNA ligase, and 30 μL of nuclease-free water to the 100 μL PCR reaction in a 0.2 mL PCR tube, mix, and spin down. 2. Incubate at room temperature (20-25°C) for 1 hour. Higher ligation efficiency can be achieved by incubating the ligation reaction solution at room temperature overnight.

[0164] 3.3 Optional steps: Exonuclease treatment 1. Transfer a 5 μL aliquot from the ligation reaction to a new 0.2 mL PCR tube for DNA gel electrophoresis. 2. Add 5 μL of T7 DNA polymerase to the remaining 145 μL ligation reaction and incubate at 37°C for 30 minutes, then heat to 85°C for 5 minutes to inactivate the ligase. 3. Load 5 μL of untreated sample (step 1) and 5.2 μL of exonuclease-treated sample (step 2) onto a 1% agarose gel. Run the gel at 100 V for 1 hour. Quantify the conversion rate by quantifying and comparing the band intensities of the exonuclease-treated and untreated samples (Figure 7). 4. Purify using the QIAquick PCR Purification Kit. Add 5x the reaction volume of PB Binding Buffer, mix well and transfer to a QIAquick spin column. Centrifuge at 12,000 x g for 1 min. Discard the flow-through. Add 700 µL of PE Wash Buffer to the spin column and centrifuge at 12,000 x g for 1 min. Discard the flow-through and dry spin at 12,000 x g for 1 min. Transfer the spin column to a new 1.5 mL microtube and add 50 µL of nuclease-free water for elution. Centrifuge at 12,000 x g for 1 min. 5. Large volumes of ligation reactions can be purified by extraction with phenol-chloroform-isoamyl alcohol (PCI) (25:24:1), followed by re-extraction three times with chloroform-isoamyl alcohol (CI) (24:1), and ethanol precipitation. Specifically, an equal volume of PCI is added to the aqueous phase containing the DNA, vortexed at maximum speed for 2 min, and centrifuged at 12,000 × g for 10 min. The upper aqueous phase is then transferred to a new tube and re-extracted three times by adding an equal volume of CI. For re-extraction, the mixture is not vortexed but rather manually stirred vigorously for 30 s and centrifuged (12,000 × g, 30 s) to separate the phases. After the third re-extraction, the upper aqueous phase is transferred to a new tube and 0.1 volumes of 3 M ammonia, 0.1 volumes of sodium acetate or potassium acetate (pH 4.8-5.2), and 2.5 volumes of absolute alcohol (4 °C) are added. The resulting solution is mixed gently, incubated at 20°C for at least 20 min, and centrifuged (15 min, 4°C, 12,000 x g) to pellet the dumbbell-shaped DNA. The supernatant is discarded and the pellet is washed with 70% ethanol (4°C) and dried (air-dried or using a speedvac centrifuge).

[0165] Formation of dumbbell-shaped vector complexes Dumbbell-shaped vector-GalNAc3 complex 3.5 pmol of GalNAc3-DNA or GalNAc3-RNA oligonucleotides were annealed to 3.5 pmol of dumbbell-shaped vector DNA in 20 μl of 10× hybridization buffer (1 M NaCl, 0.1 M MgCl2, 200 mM Tris-HCl, pH 7.4) in the presence of 20% v / v PEG4000. The resulting solution was denatured at 80°C for 5 min and incubated at 37°C for 1 h. The resulting dumbbell-shaped vector-GalNAc3 complex was cleaved with AseI (Thermo Fisher) and binding of GalNAc3 to the complex-forming loop was monitored by 1.5% agarose gel shift assay. Dumbbell-shaped vector complexes were purified using Sephadex gel filtration chromatography and ethanol precipitation.

[0166] The oligonucleotides GalNAc3-DNA: 5'-GCTATAAGTGTGCATGAGAAC-GalNAc3-3' and GalNAc-RNA: 5'- GC UAUAAGUGUGCAUGAGAAC-GalNAc3-3' was obtained from Microsynth (Switzerland). The underlined positions indicate deoxyribonucleotides. Primers for constructing dumbbell-shaped vectors were obtained from IDT.

[0167] Dumbbell-shaped vector-aptCD137-2 complex 3.5 pmol of aptCD137-2 homodimer was annealed to 3.5 pmol of the above-mentioned dumbbell-shaped vector DNA.

[0168] Cell culture: Human tissue culture cells, including HepG2, HEK293T, HONE-1, and C666 cells, were maintained in Dulbecco's modified Eagle's medium (HyClone, Thermo Scientific) supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin-streptomycin at 37°C in a humidified incubator with 5% CO. Cells were passaged every 3–4 days when they reached the desired density.

[0169] Transfection of human tissue culture cells with DNA vectors: Plasmids or dumbbell-shaped DNA minimal vectors were transfected into cells using Lipofectamine® 3000 according to the manufacturer's protocol. Briefly, 500 ng of DNA and 1 μl of P3000 were diluted in 25 μl of Opti-MEM and then mixed with 1.5 μl of Lipofectamine 3000 (diluted in 25 μl of Opti-MEM). The resulting mixture was incubated at room temperature for 5 minutes before being added to the cells.

[0170] Total RNA isolation: RNA was isolated 24 h after transfection using the RNeasy plus kit (Qiagen) according to the manufacturer's protocol. RNA concentration was measured with a NanoDrop 2000.

[0171] Conversion to cDNA and real-time RT-PCR: 500ng of RNA from each sample was converted to cDNA using 200ng of random hexamers and 10μM dNTPs with the First Strand SuperScript RTIII kit (Invitrogen). The reaction conditions were 25°C for 5min, followed by 50°C for 2h and heating at 70°C for 15min to inactivate the enzyme. Real-time RT-PCR was performed using 20ng of cDNA as template. Specific probe and primer sets were designed and cDNA was quantified by TaqMan assay using ABI 7900HT to detect cis- and trans-splicing. The cycle numbers for overexpression and endogenous tests were 40 and 50 cycles, respectively. RT-PCR: Reverse transcription PCR of cDNA samples was performed using Taq DNA polymerase (Fermentas) with 60 cycles of two-step PCR (30 cycles + 30 cycles or 35 cycles + 35 cycles) to detect 3' cis-splicing and 5' cis-splicing, as well as 3' trans-splicing and 5' trans-splicing, and bands were visualized on a 1% agarose gel.

[0172] In RT-qPCR, Fw_maxGFP (5'-ATCGAGTGCCGCATCACC-3') (SEQ ID NO: 247) and Rv_maxGFP (5'-ACTCATCGAGCTCGAGATCTGG-3') (SEQ ID NO: 248) were used. Fw-β-actin (5'-CTGGCACCCAGCACAATG-3') (SEQ ID NO: 249) and RP-β-actin (5'-GCCGATCCACACGGAGTACT-3') (SEQ ID NO: 250) were used as housekeeping genes.

[0173] Uptake of dumbbell-shaped vector-GalNAc3 complexes from tissue cell culture medium Uptake of MaxGFP dumbbell-shaped vector-GalNAc3 complex HepG2 cells were trypsinized and washed with 10 ml of DMEM, and then 0.05 × 10 6 HepG2 cells were resuspended in 30 μl of DMEM, and 3.5 pmol of MaxGFP dumbbell-shaped vector-GalNAc3 complex dissolved in 20 μl of water was added and incubated with HepG2 cells for 4 hours, and then HepG2 cells were reseeded. By adding the dumbbell-shaped vector complex to the suspension of HepG2 cells, it was found that the higher the concentration of the dumbbell-shaped vector complex in the medium, the stronger the expression of MaxGFP. Uptake of HSVtk dumbbell-shaped vector-GalNAc3 complex or HSVtk dumbbell-shaped vector-2GalNAc3 complex 0.05×10 6 HepG2 cells were seeded in 24 wells, and 24 hours later, 0.35 pmol of HSVtk dumbbell-shaped vector-GalNAc3 complex or HSVtk dumbbell-shaped vector-2GalNAc3 complex dissolved in 20 μl of water was added to the DMEM culture medium.

[0174] Quantification of incorporated MaxGFP dumbbell-shaped vector-GalNAc3 DNA by qPCR After exposing the cells to the dumbbell-shaped vector complex for 24 hours, the cells were harvested and episomal nucleic acids containing the incorporated dumbbell-shaped vector complex were isolated using the RNeasy® Plus kit according to the manufacturer's protocol. For SYBR Green detection of dumbbell-shaped vector DNA, 1x SYBR® Selection Master Mix for CFX and 0.5 μM each of forward and reverse primers were mixed with 1 μl of episomal nucleic acid sample in a 10 μl reaction. All reactions were performed in duplicate. Dumbbell-shaped vector DNA was quantified based on a standard curve made with dumbbell-shaped vector DNA using absolute qPCR quantification.

[0175] AlamarBlue Assay: To confirm the functional activity of trans-splicing, 24 hours after transfection, cells were either cultured without GCV (internal negative control) or treated with ganciclovir drug (GCV) (Sigma) at a concentration of 10 μM or 100 μM, followed by addition of alamarBlue® cell viability reagent (Thermo Scientific) 24 hours after drug addition for 6 days. Fresh medium and drug were replaced daily after each alamarblue measurement. Fluorescence was measured at 230 / 290 nm after 90 min of incubation at 37°C. Positive and negative controls for the assay were designed according to the manufacturer's protocol.

[0176] Flow cytometry: For FACS analysis, media was aspirated, cells were rinsed once with PBS, and trypsinized with 200 μl 1× Trypsin-EDTA. Trypsinized cells in 1 ml media were harvested by centrifugation at 4200 rpm for 6 min. Pelleted cells were resuspended in 500 μl 1× PBS. FACS was performed on 10,000 cells at NTC using an LSR Fortessa cell analyzer, with each sample being FACSed on >5,000 cells, and samples were acquired using FACSDiva software v6.1.3. Data analysis was performed using FlowJo software V7.6.1.

[0177] To confirm apoptosis, cells were harvested 48 hours after treatment with 100 μM GCV and stained with propidium iodide and Alexa Fluor 647 Annexin V (Life Technologies) in Annexin Binding Buffer according to the manufacturer's protocol. Samples were gated on a single live cell population positive for GFP. Final percentage of apoptosis was expressed as (early and late apoptosis + GCV) - (early and late apoptosis - GCV).

[0178] Preparation of ganciclovir working solution GCV was purchased from Sigma in ready-to-mix 100 mg powder form. To dissolve the master stock powder for cell culture experiments, 10 mg of GCV was dissolved in 1 ml of 0.1 N / 0.1 M HCl (final concentration: 10 mg / ml). To prepare a 10 mM working solution (for 1-100 μM conditions), 255 μl of the 10 mg / ml GCV master stock was diluted with 745 μl of 0.1 N HCl. To prepare a 1 mM working solution (for 0.1-0.3 μM conditions), 100 μl of the 10 mM working solution was further diluted with 900 μl of 0.1 N HCl.

[0179] AlamarBlue cell viability assay To induce the death of HepG2 cells transfected with the dumbbell-shaped vector complex, GCV was added to the cells at a concentration of 100 μM 24 hours after transfection. Cell killing activity was monitored every 24 hours using alamarBlue cell viability reagent, and this monitoring was continued for 6 days, with fresh medium and drugs added daily. Fluorescence was measured at 530 nm / 590 nm after 90 minutes of incubation.

[0180] Mouse tail vein injection For tail vein injection, 30 μg each of dumbbell-shaped vector-Nanoluc and dumbbell-shaped vector-maxGFP were prepared in 100 μl of solution by adding 0.14 μl / μg DNA of in vivo-JetPEI (Polyplus) or SAINT-Vivo (Synvolux) or PBS. 30 μg each of dumbbell-shaped vector-Nanoluc-RNA-1-GalNac3 or dumbbell-shaped vector-maxGFP-RNA-1-GalNac3 was diluted in 100 μl of PBS. For hydrodynamic injection, 30 μg each of dumbbell-shaped vector-Nanoluc or dumbbell-shaped vector-maxGFP was diluted in 1.5 mL of PBS. Each sample was administered to 4-6 week-old mice by intravenous injection. On the 6th day, organs were removed, organs were homogenized, and RNA was isolated by treatment with TRIzol. 5 μl of RNA was converted to cDNA and qPCR was performed.

[0181] statistical analysis Error bars indicate standard error of the arithmetic mean (±SEM) of three independent experiments. For comparisons of two groups, significance was examined using an unpaired Student's t-test. Statistical analysis was performed using GraphPad Prism 9 software. P values ​​are indicated on the graphs.

[0182] Results and Discussion The present invention will be described in detail below. (i) Design of RNAs using trans-splicing to obtain enhanced activity, ideally multiple target RNAs using trans-splicing, targeting pre-mRNAs derived from disease-specific genes and / or pre-mRNAs derived from housekeeping genes. (ii) Highly active, multi-target novel RNAs for novel targets using trans-splicing. (iii) Dumbbell-shaped DNA delivery vectors featuring helper functions, such as aptamers or triantennary GalNAc residues, for targeted delivery to various cell types, such as hepatocytes, CD137+ cells, and PSMA+ cells. (iv) Use of multiple helper functions, for example, the use of a dumbbell-shaped vector-GalNAc3 complex with two or more GalNAc3 residues (linked via two antisense oligonucleotide binding sites), which gave highly positive results (80.4%).

[0183] The present invention relates to novel and optimized RNA sequences and RNA structures designed to obtain higher trans-splicing activity and specificity. A parent trans-splicing RNA (tsRNA) molecule for labeling 3' exons was designed, which contains all or some of the following molecular features (Figure 1). As the first molecular feature, one or more binding domains (BDs) of 25-250 nt in length that are complementary to the pre-mRNA target and do not take a three-dimensional structure were computationally selected. To protect this selected binding domain structure on the tsRNA molecule, it is ideal to add a spacer. As the second molecular feature, a splicing signal or splicing domain consisting of an intronic splice enhancer (ISE), a consensus branch point (BP) sequence, an extensive polypyrimidine tract (PPT), and a consensus splice acceptor (SA) site (AG / G) was selected. As a third molecular feature, we selected a coding domain, such as the HSVtk gene, with an enhanced intra-exonic splice enhancer (ESE) and a mini-intron of β-globin. Ideally, a P2A proteolytic cleavage site is placed immediately downstream of the SA site of the tsRNA, so that the trans-splicing reaction results in the release of HSVtk from the chimeric fusion protein by proteolysis. In addition, the binding domain contains a target mismatch (ΔBD) so that binding to the target produces a long double-stranded nuclear RNA, which inhibits the trans-splicing strategy by inducing an antisense effect, such as an A to I edited by adenosine deaminase (ADAR) acting on the RNA. The trans-splicing RNA of the present invention is characterized by having a safety domain (SD) that binds to its own splice acceptor to suppress off-target trans-splicing. In addition, some of the constructs of the present invention are characterized by having a DNA nuclear localization sequence (NLS) (Figure 1).

[0184] In one embodiment, trans-splicing suicide RNA is delivered to cells and binds to each pre-mRNA target, inducing trans-splicing and specifically expressing HSVtk in the target cells. Co-delivery of the prodrug ganciclovir (GCV) results in phosphorylation by HSVtk with the assistance of intracellular phosphatases, inducing the formation of toxic GCV triphosphate, resulting in cell death (Poddar et al., 2018).

[0185] One aspect of the novel design is the creation of multi-targeted suicide RNAs that utilize trans-splicing to target pre-mRNAs from disease-specific genes and pre-mRNAs from housekeeping genes. Pre-mRNAs from housekeeping genes are constitutively expressed in all cells, unlike disease-specific pre-mRNA biomarkers. Housekeeping genes include, but are not limited to, genes involved in gene expression, metabolism, cell structure, cell surface, signal transduction, and the like. This novel design is applied to target cells with very low numbers and / or expression levels of disease-specific biomarkers. Under these circumstances, trans-splicing to the housekeeping sequence induces basal levels of expression of the death signal but does not result in cell killing. Only further trans-splicing to disease-specific pre-mRNA biomarkers or pre-mRNA biomarkers specific to a particular cell type will increase expression of the death signal above a threshold and result in cell killing.

[0186] Multitargeted suicide RNAs using trans-splicing induce higher levels of cell death at 300-fold lower GCV concentrations than single-targeted suicide RNAs Another embodiment of the present invention is a trans-splicing-based suicide RNA targeting hepatoblastoma-derived cells, which has multiple target-binding domains complementary to alpha-fetoprotein (AFP), vascular endothelial growth factor (VEGF), gamma-glutamyltransferase (GGT), hepatocellular carcinoma-associated protein 2 (HCCA2), transforming growth factor beta 1 (TGF-β1), cluster of differentiation 24 (CD24), cyclin D1 (CCND1), glypican 3 (GPC3) and / or telomerase reverse transcriptase (TERT). This multi-target suicide RNA induced a high level of cell death activity in human hepatoblastoma-derived cells at a 300-fold lower GCV concentration than single-target suicide RNA (Figure 2). In addition, the suicide RNA targeting five pre-mRNA biomarkers of hepatocellular carcinoma showed a lower EC20 activity than the positive control, a vector constitutively expressing HSVtk. 50 The values ​​are shown in Figure 3.

[0187] Antisense safety domains blocking splice sites of trans-splicing RNAs do not inhibit on-target but do suppress off-target trans-splicing Another embodiment of the present invention is a novel safety domain, an antisense sequence in a trans-splicing RNA, which is complementary to at least a portion of the splice signal or splice signal domain of the trans-splicing RNA, or to the splice donor (SD) and polypyrimidine tract (PPY) of the trans-splicing RNA. The safety domain can prevent off-target trans-splicing, since the target binding domain must first bind to the target and release the safety domain from the splice donor and PPY to allow on-target trans-splicing. Two safety domain designs were developed and tested: 1. a continuous safety domain; and 2. a segmented safety domain. The segmented safety domain was interrupted by various target binding domains (Figure 4). The safety domain did not inhibit the suicide activity of the suicide RNA that utilizes trans-splicing (Figure 4). To monitor off-target trans-splicing, a GFP reporter assay was developed (Figure 5). GFP reporter assays demonstrated that the trans-splicing suicide RNA featuring a safety domain did not induce off-target activity (Figure 6).

[0188] Dual-targeted suicide RNAs using trans-splicing to target HBV-derived and HCC-associated pre-mRNA targets efficiently kill HBV-RNA-positive hepatoblastoma-derived human tissue culture cells Another embodiment of the present invention is a suicide RNA targeting HBV positive cells using trans-splicing. The suicide RNA is characterized by having a target binding domain complementary to HBV pregenomic RNA and a target binding domain complementary to AFP or GPC3. Although the expression level of HBV pregenomic RNA in tissue culture cells is low, these HBV-targeted suicide RNAs induced cell killing activity comparable to that of dual HCC-targeted suicide RNAs (Figure 7). HBV-derived RNA targets are expressed at very high levels in HBV-infected cells in vivo.

[0189] Suicide RNA targeting the pre-mRNA of a common cancer biomarker via trans-splicing effectively kills nasopharyngeal carcinoma cells Another embodiment of the present invention is suicide RNAs that utilize trans-splicing to effectively kill nasopharyngeal carcinoma cells (Figure 8). These suicide RNAs are characterized by having multiple target binding domains that are complementary to each of a variety of tumorigenic pre-mRNAs, including alpha-fetoprotein (AFP) pre-mRNA, vascular endothelial growth factor (VEGF) pre-mRNA, gamma-glutamyltransferase (GGT) pre-mRNA, hepatocellular carcinoma-associated protein 2 (HCCA2) pre-mRNA, transforming growth factor beta 1 (TGF-β1) pre-mRNA, cluster of differentiation 24 (CD24) pre-mRNA, cyclin D1 (CCND1) pre-mRNA, glypican 3 (GPC3) pre-mRNA, and / or telomerase reverse transcriptase (TERT) pre-mRNA.

[0190] Another embodiment of the present invention is a suicide RNA targeting EBV positive cells using trans-splicing, the suicide RNA having a target binding domain complementary to Epstein-Barr virus pre-mRNA (i.e., BZLF1, EBNA-3B, LMP1 and LMP2A).

[0191] Dumbbell-shaped vectors expressing trans-splicing RNA can be efficiently delivered to various types of epidermal cells by non-invasive topical application and can induce specific GFP expression or cell death depending on the cell type. Another embodiment of the present invention is a trans-splicing RNA and a dumbbell-shaped delivery vector targeted to epidermal cells, the trans-splicing RNA and the dumbbell-shaped delivery vector having multiple target binding domains complementary to keratin 1 (KRT1), keratin 2 (KRT2), keratin 10 (KRT10), keratin 14 (KRT14), caspase 14 precursor (CASP14), and / or neuroblast differentiation associated protein 2 (AHNAK2). Another embodiment of the present invention is a trans-splicing RNA targeted to basal cells, the trans-splicing RNA and the dumbbell-shaped delivery vector having multiple target binding domains complementary to keratin 15 (KRT15), collagen XVII alpha 1 (COL17A1), and / or tumor protein 73 (TP73). Another embodiment of the present invention is a trans-splicing RNA targeted to hair follicle cells, which has multiple target binding domains complementary to homeobox C13 (HOXC13) and fibroblast growth factor 7 (FGF-7). Another embodiment of the present invention is a trans-splicing RNA targeted to senescent cells, which has target binding domains complementary to forkhead box O4 (FOXO4) and cyclin-dependent kinase inhibitor 2A (p16). Both of these trans-splicing RNAs are characterized by carrying either a GFP gene for imaging or an HSVtk gene for inducing cell death (FIG. 9). These sequences were delivered by non-invasive topical application of a dumbbell-shaped vector to the epidermis of domestic pigs.

[0192] The HSVtk / GCV system for suicide gene therapy can be replaced with proteins that induce apoptosis or necrosis. Another embodiment of the present invention is a suicide RNA using trans-splicing that encodes a death signal other than HSVtk, such as a pre-mRNA of CYLD lysine 63 deubiquitinase (CYLD), a pre-mRNA of tumor necrosis factor-like weak inducer of apoptosis (TWEAK), a pre-mRNA of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a pre-mRNA of tumor necrosis factor alpha (TNF-α), etc. When various plasmids expressing these cell death proteins were transfected into HEK293T cells, cell death was induced compared to the control (Figure 10).

[0193] Increasing the size of a single dumbbell-shaped vector loop does not inhibit gene expression The dumbbell-shaped DNA vector is unique in that it combines a double-stranded expression cassette with a single-stranded loop. Another embodiment of the present invention is a dumbbell-shaped vector with a residue for targeted delivery non-covalently bound to the loop via complementary base pairing (Figure 11). The targeting residue is covalently linked to an antisense oligonucleotide (DNA or RNA) that is complementary to one of the loops of the dumbbell-shaped vector. The antisense oligonucleotide complementary to one of the loops of the dumbbell-shaped vector is hereinafter referred to as the "complexation loop". To promote complex formation, the size of the complexation loop was expanded from the standard loop size of 4 nt to 41 nt or 71 nt using a sequence that was predicted not to fold into the native DNA secondary structure or that was predicted to fold little into the native DNA secondary structure (Figure 11). Next, the MaxGFP-expressing dumbbell-shaped vectors characterized by having a complexation loop of 4 nt, 41 nt or 71 nt were transfected into HEK293T cells, and the expression of MaxGFP was quantified (Figure 12). Increasing the size of the complexation loop did not inhibit gene expression, indicating that enlarging the loop does not impair vector diffusion in the nucleus. Notably, dumbbell-shaped vectors with mismatches in one or both terminal stem-loop structures, generated using gap primer PCR or a combination of ligation with enzymes using nucleases (ELAN) and gap primer PCR, induced significantly higher gene expression than dumbbell-shaped vectors with perfect base pairs and similar levels of expression induced by plasmids. Since a larger complexation loop was predicted to facilitate binding of antisense DNA or RNA oligonucleotides to form B- or H-helices, a 57-nt complexation loop was used to generate the residue complex.

[0194] Formation of non-covalent complexes between GalNAc3 or aptCD137-2 residues and dumbbell-shaped vector DNA via complementary base pairing A triantennary GalNAc residue (GalNAc3) or a CD137-binding aptamer homodimer (aptCD137-2) was attached as a residue. The GalNAc3 residue was attached to the 3' end of a DNA oligonucleotide or RNA oligonucleotide that had almost no conformation (Figure 13). AptCD137 was attached to the 5' and 3' ends of an RNA oligonucleotide. The complexing loop was designed to have no conformation or to have as little internal secondary structure as possible, and one of the loops at both ends was designed to have a centrally located 21-nt antisense oligonucleotide binding domain sandwiched between two adjacent 18-nt spacers (Figure 13A). To add the GalNAc3 or aptCD137-2 residue to the complexing loop of the dumbbell-shaped vector via a non-covalent bond, these residues were covalently linked to a loop-shaped antisense binding oligonucleotide (Figure 13B). DNA or RNA oligonucleotides labeled with GalNAc3 were prepared by chemical synthesis. The two aptamer domains of the aptCD137-2 homodimer were cross-linked with an RNA linker, and the aptCD137-2 sequence was generated by in vitro transcription. Then, oligonucleotides labeled with GalNAc3 or aptCD137-2 were annealed to the complex-forming loops of the HSVtk expression dumbbell-shaped vector and / or the MaxGFP expression dumbbell-shaped vector (Figure 13B). The molecular weights of the MaxGFP expression dumbbell-shaped vector and the HSVtk expression dumbbell-shaped vector were both 1.3 × 10 6 g / mol, and the molecular weight of the GalNAc3-labeled oligonucleotide (8.4 × 10 3g / mol). To confirm the complex formation using electrophoretic mobility shift assay, the dumbbell-shaped vector-GalNAc3 complex was digested with AseI restriction endonuclease, whereas the dumbbell-shaped vector-aptCD137-2 complex was not, and the resulting fragments were analyzed on an agarose gel (Fig. S13C, D). Annealing using a stoichiometric ratio of oligonucleotides and dumbbell-shaped vector resulted in incomplete binding of GalNAc3 to the dumbbell-shaped vector DNA. However, when RNA-GalNAc3 oligonucleotides or DNA-GalNAc3 oligonucleotides were used in a 2-fold or 10-fold molar excess, nearly 100% complex formation efficiency was achieved (Fig. S13C). For aptCD137-2 aptamer complex formation, the use of equimolar or 2-fold molar excess of the aptamer resulted in 80% or 81% complex formation efficiency, respectively (Fig. S13D).

[0195] RNase H can cleave the GalNAc3-RNA linker but not the GalNAc3-DNA linker. In the heteroduplex formed between complementary RNA and DNA, the RNA can be cleaved by endogenous RNaseH. This would allow the dumbbell-shaped RNA linker complex to release GalNAc3 residues from the dumbbell-shaped vector after delivery to the cytoplasm to facilitate diffusion of the dumbbell-shaped vector through the nuclear pore complex, but such release would not occur in the DNA linker complex. Next, an in vitro assay was used to examine the cleavability of the dumbbell-shaped vector-GalNAc3 complex by RNaseH. To do this, the complex was exposed to RNaseH for 120 min. To better visualize the release of the small GalNAc3 residues from the relatively large dumbbell-shaped vector DNA using a gel shift assay, the complex formation loop was cleaved with AseI before loading the sample on the gel. As expected, the gel shift assay showed the cleavage and release of GalNAc3 residues from the RNA linker dumbbell complex, but not from the DNA linker dumbbell complex (Figure 13E).

[0196] Dumbbell-shaped vector-GalNAc3 complexes are internalized by hepatoblastoma-derived human tissue culture cells and induce MaxGFP expression A dumbbell-shaped vector expressing MaxGFP was generated and proved to be exonuclease resistant (Figure 15). A MaxGFP-expressing dumbbell-shaped vector-GalNAc3 complex was generated (Figures 14 and 15), mixed with HepG2 cells that had been trypsinized and pelleted 4 hours before seeding, and the amount of DNA of the dumbbell-shaped vector that had been internalized was quantified using qPCR after 48 hours (Figures 14 and 15B). The experimental data showed that the dumbbell-shaped vector DNA-GalNAc3 complex and the dumbbell-shaped vector-RNA-GalNAc3 complex were internalized by HepG2 cells with similar efficiency (Figure 15B). However, the uptake of the dumbbell-shaped vector-GalNAc3 complex from the medium was significantly less efficient compared to delivery by lipofection. Since it was suggested that the dumbbell-shaped vector DNA was adsorbed to the cell surface or was not processed in the endosome, the amount of MaxGFP mRNA transcript was quantified using RT-qPCR (Figure 15C). The amount of maxGFP mRNA detected in the dumbbell-shaped vector RNA complex was slightly higher than that in the dumbbell-shaped vector DNA complex, but the difference was not significant. The signals indicating the presence of dumbbell-shaped vector DNA or maxGFP mRNA in the no-transfection control (NTC) were presumed to be background signals, possibly due to trace contaminants in RT-PCR / qPCR or nonspecific signals due to the SYBR Green quantification protocol. To further improve the uptake and subsequent expression of the dumbbell-shaped vector-GalNAc3 complex, two GalNAc3 residues were linked via an extended 71-nt complexation loop with two antisense oligonucleotide binding sites (Figure 15D). Next, dumbbell-shaped vectors with one or two GalNAc3s linked via an RNA or DNA linker were incubated with HepG2 cells as described above, and the expression of MaxGFP protein was quantified by flow cytometry after 48 hours (Figure 16).On average, the dumbbell-shaped vector-RNA-GalNAc3 complex induced a higher number of MaxGFP-positive cells (49.8%) compared with the dumbbell-shaped vector-DNA-GalNAc3 complex (28.8%) (Figure S15E). No difference in the expression level of MaxGFP was observed between the dumbbell-shaped vector complex with one GalNAc and the dumbbell-shaped vector complex with two GalNAcs.

[0197] A dumbbell-shaped HSVtk vector with two GalNAc3 residues in one complexation loop induced death of human hepatoblastoma tissue culture cells upon ganciclovir treatment To develop a dumbbell-shaped vector-GalNAc conjugate for suicide gene therapy of hepatocellular carcinoma (HCC), two GalNAc3 residues were linked to an HSVtk-expressing dumbbell-shaped vector via an RNA linker oligonucleotide (Figure 17A). To test the cell-killing activity of this dumbbell-shaped vector-GalNAc3 conjugate, the vector was added to the culture medium of HepG2 cells. The HSVtk dumbbell-shaped vector-2-GalNAc3 double complex induced significant killing of HepG2 cells, i.e., a 34.7% decrease in cell viability was shown in the alamarBlue cell viability assay on day 6 after 100 μM GCV treatment, whereas no such decrease was observed with the HSVtk dumbbell-shaped vector-1-GalNAc3 conjugate, which has only one GalNAc3 residue (Figure 17B). In a comparative study, HepG2 cells were transfected by lipofection with either an HSVtk expression plasmid or a dumbbell-shaped vector with two GalNAc3 residues attached, resulting in a 49.8% or 54.2% decrease in cell viability, respectively. These data indicate that the dumbbell-shaped vector complex with two GalNAc3 residues attached via an RNA linker does not inhibit gene expression compared to the uncomplexed dumbbell-shaped vector. Notably, no significant decrease in cell viability was observed in the absence of GCV treatment.

[0198] Dumbbell-shaped DNA vectors have increasingly attracted attention as promising universal delivery vector systems for naked DNA gene therapy and gene vaccination. Unlike plasmids and DNA minicircles, dumbbell-shaped vectors can be covalently or non-covalently linked to helper functions for imaging, immune sensing or targeted delivery via single-stranded loops. The single-stranded loops are formed by chemically synthesized oligodeoxyribonucleotides that may be chemically modified, directly ligated or modeled from primers used in PCR reactions. Binding of helper functions to the loops is not expected to inhibit the transcriptional activity of dumbbell-shaped vectors, but may affect targeting to cells and nuclei. Therefore, we investigated non-covalent attachment of GalNAc3 or aptCD137-2 residues for targeted delivery to hepatocytes and nasopharyngeal carcinoma cells. To investigate this, antisense oligonucleotides (DNA or RNA) were covalently attached to these residues and then annealed to the extended complexing loops via complementary base pairing. It was reasonably expected that extending the complexing loops would not inhibit gene expression using the dumbbell vector (Figure 12) or diffusion in the nucleus, even though no residues were attached. This effect could be explained by the design of the loops, which were chosen not to form internal secondary structures, which would make the dumbbell vector bulky and difficult to diffuse through the nuclear pore complex. Both RNA and DNA linker oligonucleotides were able to attach these residues to the complexing loops of the dumbbell vector. We observed some evidence that binding via the RNA linker is more efficient than binding via the DNA linker, as more complexes were obtained even with a smaller excess of RNA linker oligonucleotide added to the dumbbell vector.This finding may be explained by the fact that RNA:DNA base pairs are more stable than DNA:DNA base pairs, and therefore the nucleation process was accelerated under the condition that the number of RNA nucleation sites was not reduced by the formation of secondary structures. In the present example, the RNA and DNA complex-forming oligonucleotides were selected to be almost non-structural, which allows the problem of reduced nucleation sites to be excluded (Figure 11). Furthermore, the RNA linker, unlike the DNA linker, can be cleaved by RNaseH to separate the GalNAc3 residue from the dumbbell-shaped vector (Figure 13E). It is highly recommended to use a cleavable or stimuli-labile linker when linking large residues to gene vectors or effector molecules. In the present example, the GalNAc3 residue was rather small compared to the size of the dumbbell-shaped vector. However, the use of an RNaseH-cleavable RNA linker increased the average number of MaxGFP-positive cells, indicating that the dumbbell-shaped vector was released from the GalNAc3 residue and the uncomplexed dumbbell-shaped vector DNA could be more efficiently targeted to the nucleus (Figure 18). Although siRNA-GalNAc3 complexes have become the clinical standard for targeted delivery of siRNA to hepatocytes, the conjugation of GalNAc3 residues or aptamers to gene expression vectors, such as dumbbell-shaped vectors, to form complexes for targeted delivery has not been reported. In this study, we demonstrated that conjugation of GalNAc3 residues to a 2186 bp MaxGFP-expressing dumbbell-shaped vector to form a complex could enhance vector delivery to HepG2 cells, resulting in a rate of MaxGFP-positive cells of 29–51% as measured by flow cytometry analysis (Figure 15E). Based on the cellular uptake of a single GalNAc3 complex, an average of approximately 10 dumbbell-shaped vector-GalNAc3 complexes were delivered per cell in these experiments.Furthermore, a dumbbell-shaped HSVtk expression vector characterized by having two GalNAc3 residues in one complex-forming loop induced 34.7% death of HepG2 cells when added to cell culture medium in the presence of 100 μM GCV. On the other hand, a similar dumbbell-shaped vector complex, but with only one GalNAc3 residue, did not show any significant effect. The result that the complex with two GalNAc3 residues induced more cell death than the complex with one GalNAc3 residue indicates that multiple GalNAc3 residues can be conjugated to a single dumbbell-shaped vector to promote binding to multiple ASGPR receptors, which may further enhance uptake into cells (Figure 18). However, such an effect was not observed with the MaxGFP expression dumbbell-shaped vector, and further investigation is required.

[0199] These data indicate that gene expression vectors such as dumbbell-shaped vectors can be delivered in a targeted manner via GalNac3, and that the conjugation of two or more GalNac3 residues works even better. In principle, three or more GalNac3 residues can be conjugated per complex-forming loop of the dumbbell-shaped vector, and both dumbbell loops can be configured as complex-forming loops to further improve delivery to hepatocytes. The expression of MaxGFP induced by the uptake of the dumbbell-shaped vector-GalNAc3 complex into cells could be easily detected using flow cytometry, but was only faintly visualized under a fluorescent microscope, with only one cell showing bright fluorescence. Meanwhile, the uptake of the HSVtk dumbbell-shaped vector could effectively kill the target cells. This observation that the HSVtk-expressing suicide vector induced a stronger phenotype than the MaxGFP-expressing vector can be explained by one or both of the following reasons. 1. The cargo loading of the small dumbbell-shaped vector DNA may have been sufficient to kill cells, but not efficient enough to be stained with MaxGFP for detection. Alternatively, 2. Cells that were not the primary target of the dumbbell-shaped vector complex may have been killed by the bystander effect, which has been previously reported for the HSVtk / GCV gene-directed enzyme prodrug system. Notably, significantly less ASGPR is expressed on the surface of HepG2 cells than primary hepatocytes. Therefore, the dumbbell-shaped vector-GalNAc3 complex is expected to be taken up even more potently by primary hepatocytes ex vivo or in vivo. In summary, in this study, we were able to demonstrate that a helper function for targeted delivery can be efficiently linked to the dumbbell-shaped vector via a cleavable linker. The liver cancer-targeting GalNac3-labeled suicide vector of the present invention is currently being tested in HCC nude mouse models and humanized HCC mouse models implanted with patient-derived xenografts (PDX).Unlike LNPs, which can also bind helper functions such as GalNAc3, the naked dumbbell-shaped vector complex is significantly smaller, which is expected to improve diffusion in the extracellular matrix. In conclusion, the dumbbell-shaped vector complex of the present invention can be used to identify single cells, such as cancer cells and metastatic cells, and provides a more efficient and compact vector system that can complement or replace existing viral and non-viral carriers for gene therapy applications.

[0200] Dumbbell-shaped vector-GalNAc3 complex induces strong mRNA expression in mouse liver Mice were intravenously injected with naked GFP-expressing dumbbell-shaped vector (hydrodynamic injection), dumbbell-shaped vector-LNP, or dumbbell-shaped vector-GaNAc3 complex. RT-qPCR quantification showed that dumbbell-shaped vector-GalNAc3 complex induced the highest GFP mRNA expression in mouse liver (Figure 19).

[0201] References Eul, J. (2006). Method for the repair of mutated RNA from genetically defective DNA and for the specific destruction of tumor cells by RNA trans-splicing and a method for the detection of naturally trans-spliced ​​cellular RNA, United States Patent Application, US20060094675A1. Fairbrother, WG, Yeh, RF, Sharp, PA, and Burge, CB (2002). Predictive identification of exonic splicing enhancers in human genes. Science 297, 1007-1013. Gibbs, P.E., Zielinski, R., Boyd, C., and Dugaiczyk, A. (1987). Structure, polymorphism, and novel repeated DNA elements revealed by a complete sequence of the human alpha-fetoprotein gene. Biochemistry 26, 1332-1343. Johansson, C., and Schwartz, S. (2013). Regulation of human papillomavirus gene expression by splicing and polyadenylation. Nat Rev Microbiol 11, 239-251. Kozak, M. (1995). Adherence to the first-AUG rule when a second AUG codon follows closely upon the first. Proc Natl Acad Sci U S A 92, 2662-2666. Kozak, M. (1999). Initiation of translation in prokaryotes and eukaryotes. Gene 234, 187-208. McCarthy, E.M., and Phillips, J.A., 3rd. (1998). Characterization of an intron splice enhancer that regulates alternative splicing of human GH pre-mRNA. Hum Mol Genet 7, 1491-1496. Poddar S, Loh PS, Ooi ZH, Osman F, Eul J, Patzel V. RNA structure design improves activity and specificity of trans-splicing triggered cell death in a suicide gene therapy approach. Molecular Therapy: Nucleic Acids 11, 41-56, 2018. Reese, M.G., Eeckman, F.H., Kulp, D., and Haussler, D. (1997). Improved splice site detection in Genie. J Comput Biol 4, 311-323. Saksmerprome, V., Roychowdhury-Saha, M., Jayasena, S., Khvorova, A., and Burke, D.H. (2004). Artificial tertiary motifs stabilize trans-cleaving hammerhead ribozymes under conditions of submillimolar divalent ions and high temperatures. RNA 10, 1916-1924. Schmitt, M., and Pawlita, M. (2011). The HPV transcriptome in HPV16 positive cell lines. Mol Cell Probes 25, 108-113. Wang, M., and Marin, A. (2006). Characterization and prediction of alternative splice sites. Gene 366, 219-227.

Claims

1. A trans-splicing RNA (tsRNA) molecule comprising: a) at least one binding domain specific for at least a portion of a gene associated with or that is a biomarker for the cell or disease to be treated; b) (i) an expressible suicide protein or an expressible protein that is a component of a suicide system; (ii) an expressible fluorescent protein, luciferase or other reporter protein, and (iii) an expressible therapeutic protein A nucleic acid encoding at least one of the following: c) at least one splice signal; and d) at least one safety domain specific for a splice signal or splice site within said trans-splicing RNA; A trans-splicing RNA (tsRNA) molecule comprising:

2. 2. The trans-splicing RNA (tsRNA) molecule of claim 1, wherein the binding domain comprises a binding site that comprises at least 25, 35, 45, 55 or more consecutive free nucleotides (nt), and the binding site has no internal binding sequences and / or no self-complementary sequences; and when the length of the binding domain is 44 nt or more, the binding domain has at least one or more mismatched nucleotides with respect to the gene.

3. 3. The trans-splicing RNA (tsRNA) molecule of claim 1 or claim 2, wherein the safety domain is an antisense binding domain specific for the splice site of the splice signal, thereby preventing off-target trans-splicing.

4. The trans-splicing RNA (tsRNA) molecule of any one of claims 1 to 3, wherein the safety domain is a linear nucleic acid sequence (continuous safety domain) or a folded nucleic acid sequence comprising one or more folds (segmented safety domain).

5. The trans-splicing RNA molecule according to any one of claims 1 to 4, further comprising at least one binding domain specific for at least a part of a gene ubiquitously expressed in all cells.

6. The biomarkers are HCC biomarkers, including α-fetoprotein (AFP), vascular endothelial growth factor (VEGF), γ-glutamyltransferase (GGT), hepatocellular carcinoma-associated protein 2 (HCCA2), transforming growth factor β1 (TGF-β1), cluster of differentiation 24 (CD24), cyclin D1 (CCND1), glypican 3 (GPC3), telomerase reverse transcriptase (TERT), α-L-fucosidase (AFU), CD19, CD34, CD44, CD49E, CD51, CD105, type XV collagen α1 (COL15A1), CXC motif chemokine receptor 4 (CXCR4), and Denticleless E3 ubiquitin protein ligase. DTL homolog, epithelial cell adhesion molecule (EPCAM), Golgi protein 73 (GP73), G protein signaling modulator 2 (GPSM2), hepatocyte growth factor (HGF), heat shock protein 70 (HSP70), insulin-like growth factor 2 (IGF2), immunoglobulin superfamily member 3 precursor (IGSF3), integrin subunit alpha 6 (ITGA6), Kell blood group glycoprotein (KEL), KIT proto-oncogene, receptor tyrosine kinase (KIT), minichromosome maintenance complex component 3 (MCM3), minichromosome maintenance complex component 7 (MCM7), PDZ-binding kinase (PBK), DNA polymerase delta 1, catalytic subunit (POLD1), Protein Regulator Of Cytokinesis 1 (PRC1), SRY box transcription factor 17 (SOX17), spermatogenesis-associated serine-rich protein 2 (SPATS2), translocon-associated protein subunit beta (SSR2), stathmin 1 (STMN1), thrombomodulin (THBD), ZW10 Interacting Kinetochore Protein (ZWINT), HBV-derived RNA (including HBV pgRNA), and Epstein-Barr virus-derived RNA and pre-mRNA (BamHICancer markers including Epstein-Barr virus replication activator Z (BZLF1), Epstein-Barr virus nuclear antigen 3B (EBNA-3B), latent membrane protein 1 (LMP1) and latent membrane protein 2A (LMP2A); epidermal cell markers including keratin 1 (KRT1), keratin 2 (KRT2), keratin 10 (KRT10), keratin 14 (KRT14), caspase 14 precursor (CASP14) and neuroblastoma differentiation-associated protein 2 (AHNAK2); keratin 15 (KRT15), collagen XVII alpha 1 (COL17A1) and tumor protein 73 (TP73) Basal cell markers; hair follicle cell markers including homeobox C13 (HOXC13) and fibroblast growth factor 7 (FGF-7); senescent cell markers including forkhead box O4 (FOXO4) and cyclin-dependent kinase inhibitor 2A (p16); stratum corneum markers including kallikrein-related peptidase 5 (KLK5), small proline-rich protein 4 (SPRR4), and arachidonate 12-lipoxygenase (ALOX12B); spinous layer (upper epidermis layer) markers including HOP homeobox (HOPX) and kallikrein 9 (KLK9); filaggrin (FLG) and premature 10. The trans-splicing RNA molecule of any one of the preceding claims, which is a single biomarker or a combination of biomarkers selected from granular layer markers including ovarian failure 1B protein (POF1B); melanocyte markers including melan A (MLANA) and tyrosinase (TYR); Langerhans cell markers including CD1A and CD207; fibroblast markers including periostin (POSTN) and phospholipase Cη2 protein (PLCH2); basal cell carcinoma markers including glioma 1 (GlI1), glioma 2 (GlI2), forkhead box protein (FOXM1), forkhead box protein (FOXO3A), desmoglein 2 (DSG2) and C3b; and basal cell carcinoma recurrence markers including cyclooxygenase (COX-2), ezrin (EZR), CD25, Maspin, glioma 3 (GlI3), GalNAc3 and Gremlin 1.

7. 10. The trans-splicing RNA molecule of any one of the preceding claims, wherein the one or more suicide proteins or one or more proteins that are components of the suicide system are selected from the group comprising or consisting of HSVtk, CYLD lysine 63 deubiquitinase (CYLD), tumor necrosis factor-like weak inducer of apoptosis (TWEAK), tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), and tumor necrosis factor alpha (TNF-α).

8. 2. The trans-splicing RNA molecule of any one of the preceding claims, wherein the disease is cancer, a viral infection, a bacterial infection or a genetic disease.

9. The cancer is hepatocellular carcinoma (HCC), cervical cancer, vaginal cancer, vulvar cancer, penile cancer, skin cancer, melanoma (including malignant melanoma), squamous cell carcinoma, basal cell carcinoma, Merkel cell carcinoma, lung cancer, cellular bladder cancer, breast cancer, colon or rectal cancer, anal cancer, endometrial cancer, kidney cancer, leukemia, acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CML), chronic myelogenous leukemia (CML), hairy cell leukemia, ...

9. The trans-splicing RNA molecule of claim 8, wherein the trans-splicing RNA molecule is selected from the group including or consisting of hematopoietic leukemia (HCL), T-cell prolymphocytic leukemia (P-TLL), large granular lymphocytic leukemia, adult T-cell leukemia, lymphoma, myeloma, non-Hodgkin's lymphoma, pancreatic cancer, prostate cancer, thyroid cancer, nasopharyngeal cancer, oral or laryngeal cancer, oropharyngeal cancer, nasopharyngeal cancer, gastric cancer, brain tumor, bone cancer, and stem cell cancer.

10. 9. The trans-splicing RNA molecule of claim 8, wherein the viral infection is selected from the group including or consisting of infections with human T-lymphotropic virus (HTLV), lentivirus, and retroviruses including human immunodeficiency virus type 1 and human immunodeficiency virus type 2 (HIV-1 and HIV-2); human papillomaviruses including human papillomavirus type 16 and human papillomavirus type 18 (HPV-16 and HPV-18); hepadnaviruses including HAV, HBV, HCV, HDV and HEV; herpesviruses including herpes simplex virus (HSV); Epstein-Barr virus (EBV); cytomegalovirus (CMV); adenovirus; adeno-associated virus; influenza virus; chromosomally integrated virus; and nasopharyngeal virus.

11. 9. The trans-splicing RNA molecule of claim 8, wherein the bacterial infection is selected from the group comprising or consisting of infections caused by Bartonella henselae, Francisella tularensis, Listeria monocytogenes, Salmonella spp., Salmonella typhi, Brucella spp., Legionella spp., Mycobacterium spp., Mycobacterium tuberculosis, Nocardia spp., Rhodococcus spp., Yersinia spp., and Neisseria meningitidis.

12. 9. The trans-splicing RNA molecule of claim 8, wherein the genetic disease is selected from the group comprising or consisting of neurofibromatosis types 1 and 2, McCune-Albright syndrome, Duchenne muscular dystrophy (DMD), epidermolysis bullosa, Fanconi anemia types A and C, Philadelphia chromosome, hemophilia A and B, cystic fibrosis, Muckle-Wells syndrome, lipoprotein lipase deficiency, beta thalassemia, Gaucher disease types I to III (GBA gene), ornithine transcarbamylase (OTC) deficiency (OTC), phenylketonuria (PKU) (PAH gene), aspartylglucosaminuria (AGA gene), alpha-1 antitrypsin deficiency (AATD) (SERPINA1), and pyruvate dehydrogenase complex deficiency.

13. 2. The trans-splicing RNA molecule of any one of the preceding claims, which targets nasopharyngeal cells, epidermal cells, basal cells, senescent cells or hair follicles.

14. 2. The trans-splicing RNA molecule of any one of the preceding claims, wherein the targeting residue is non-covalently linked to at least a portion of the tsRNA molecule via an antisense oligonucleotide (DNA or RNA) complementary to said tsRNA molecule.

15. 2. The trans-splicing RNA molecule of any one of the preceding claims, wherein a targeting residue is covalently linked to at least a portion of the tsRNA molecule.

16. The trans-splicing RNA molecule of any one of the preceding claims, having at least one triantennary GalNAc residue (GalNA3) or at least one CD137-binding aptamer homodimer residue (aptCD137-2) attached thereto.

17. The trans-splicing RNA molecule of claim 16, having at least two GalNAc3 residues attached.

18. The trans-splicing RNA molecule of any one of the preceding claims, wherein the tsRNA molecule comprises, in a portion thereof, RNA that does not take a three-dimensional structure, the RNA that does not take a three-dimensional structure forming as little internal secondary structure as possible, and a 21 nt antisense oligonucleotide binding domain having at least one spacer at at least one end.

19. The trans-splicing RNA molecule of claim 18, wherein the binding domain is flanked by an 18 nt spacer.

20. 2. The trans-splicing RNA molecule of any one of the preceding claims, which is a 5' tsRNA or a 3' tsRNA.

21. 2. The trans-splicing RNA molecule of any one of the preceding claims, which is dumbbell-shaped.

22. 2. The trans-splicing RNA molecule of any one of the preceding claims, comprising at least one residue or helper function for targeted delivery covalently or non-covalently linked to at least one loop of the tsRNA.

23. The residue or helper function is a glycan, (GalNAc) 3 The trans-splicing RNA molecule of claim 22, selected from the group including residues, nucleic acids, RNA aptamers, DNA aptamers, peptide aptamers, CD137-binding RNA aptamers, PSMA-binding RNA aptamers, proteins, peptides, cell-penetrating peptides, antibodies, and CD137-binding antibodies.

24. A cell comprising the tsRNA according to any one of claims 1 to 23.

25. A vector comprising the tsRNA according to any one of claims 1 to 23.

26. 26. The vector of claim 25, which is a naked nucleic acid based vector, a non-viral vector, or a viral vector.

27. 27. The vector of claim 26, wherein the naked nucleic acid-based vector is selected from the group comprising or consisting of an RNA molecule, a plasmid, a DNA minicircle, and a dumbbell-shaped DNA vector.

28. 27. The vector of claim 26, wherein the non-viral vector is selected from the group comprising or consisting of a liposome vesicle, a nanoparticle, a polymer conjugate, an antibody conjugate, a cell penetrating peptide, and a polymer capsule.

29. 27. The vector of claim 26, wherein the viral vector is selected from the group including or consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes simplex viral vector, a vaccinia viral vector, a chimeric viral vector, a Sindbis viral vector, an alphavirus vector, a Semliki Forest viral vector, and a Venezuelan equine encephalitis viral vector.

30. A method for targeting diseased cells, comprising administering a vector comprising a tsRNA according to any one of claims 1 to 23, and optionally comprising exposing the diseased cells to at least one further component of a suicide system effective to kill the diseased cells, the route of administration being selected from the group consisting of topical application; intranasal application; intraalveolar application; systemic application; oral application; Intravenous application; intramuscular application; subcutaneous application; Skin application; intraperitoneal application; and intratumoral injection.

31. A method for killing a cell, comprising the step of transfecting, lipofecting, transducing, electroporating, nucleofecting or transforming, ex vivo or in vivo, a cell with a tsRNA according to any one of claims 1 to 23, or a vector comprising a tsRNA according to any one of claims 1 to 23, and optionally comprising the step of exposing the cell to at least one further component of a suicide system effective to kill the cell.

32. A method for treating a disease, comprising the step of transfecting, lipofecting, transducing, electroporating, nucleofecting or transforming, ex vivo or in vivo, diseased cells with a tsRNA according to any one of claims 1 to 23 or a vector comprising a tsRNA according to any one of claims 1 to 23, and optionally comprising the step of exposing said cells to at least one further component of a suicide system effective to kill said diseased cells.

33. 33. The method of any one of claims 30 to 32, wherein said components of said suicide system are selected from the group comprising or consisting of ganciclovir, cytosine deaminase-5-fluorocytosin, cytochrome P450 ifosfamide, cytochrome P450 cyclophosphamide, and nitroreductase-5-[aziridin-1-yl]-2,4-dinitrobenzamide.

34. The trans-splicing RNA molecule of any one of claims 1 to 23, the cell of claim 24, or the method of claims 30 to 33, wherein the cell is a mammalian cell.

35. The trans-splicing RNA molecule of any one of claims 1 to 23, the cell of claim 24, or the method of claims 30 to 33, wherein the cell is a human cell.

36. 30. A pharmaceutical product comprising a tsRNA according to any one of claims 1 to 23, or a vector according to claims 25 to 29, and optionally at least one further component of a suicide system effective to induce death of cells expressing the trans-spliced ​​RNA.

37. A pharmaceutical composition comprising a tsRNA according to any one of claims 1 to 23, or a vector according to claims 25 to 29, and optionally at least one further component of a suicide system effective for inducing the death of cells expressing the trans-spliced ​​RNA, and a carrier suitable for use in human or veterinary medicine.

38. 38. The pharmaceutical composition of claim 37, wherein at least one further component of the suicide system is selected from the group comprising or consisting of ganciclovir, cytosine deaminase-5-fluorocytosin, cytochrome P450 ifosfamide, cytochrome P450 cyclophosphamide, and nitroreductase-5-[aziridin-1-yl]-2,4-dinitrobenzamide.

39. A cosmetic composition comprising a tsRNA according to any one of claims 1 to 23, or a vector according to claims 25 to 29, and optionally at least one further component of a suicide system effective for inducing the death of cells expressing the trans-spliced ​​RNA, and a carrier suitable for human use.

40. A dumbbell-shaped DNA expression vector, a) one or more linear or hairpin transcription cassettes comprising a nucleotide sequence encoding the nucleic acid molecule to be expressed; b) two single-stranded DNA loops; c) a minimal transcription promoter nucleotide sequence and a transcription terminator operably linked to the transcription cassette; d) a nucleotide sequence comprising a DNA sequence that functions as a nuclear targeting sequence (NTS); e) a nucleotide sequence containing a splicable intron; and f) at least one residue or helper function for targeted delivery, covalently or non-covalently linked to at least one of said loops; A dumbbell-shaped DNA expression vector comprising:

41. The residue or helper function is a glycan, (GalNAc) 3 The dumbbell-shaped DNA expression vector of claim 40, selected from the group including residues, nucleic acids, RNA aptamers, DNA aptamers, peptide aptamers, CD137-binding RNA aptamers, PSMA-binding RNA aptamers, proteins, peptides, cell-penetrating peptides, antibodies, and CD137-binding antibodies.

42. The dumbbell-shaped DNA expression vector of claim 40 or 41, wherein the helper function is non-covalently linked to one or both loops of the dumbbell-shaped vector via a complementary antisense oligonucleotide (RNA or DNA) covalently linked to the 5' or 3' end.

43. 42. The dumbbell-shaped DNA expression vector of claim 40 or 41, wherein the helper function is covalently linked to one or both loops of the dumbbell-shaped vector.

44. The dumbbell-shaped DNA expression vector according to any one of claims 40 to 43, wherein the NTS comprises a binding site for a transcription factor.

45. The dumbbell-shaped DNA expression vector of any one of claims 40 to 44, wherein the NTS is an SV40 enhancer sequence, a minimal SV40 enhancer sequence, a smooth muscle cell gamma-actin (SMGA) promoter, or an oriP of the Epstein-Barr virus (EBV).

46. A pharmaceutical composition comprising the dumbbell-shaped DNA expression vector of any one of claims 40 to 45, and optionally at least one other component of a suicide system effective to induce death of cells expressing the dumbbell-shaped DNA expression vector, and a carrier suitable for use in human or veterinary medicine.

47. A cosmetic composition comprising the dumbbell-shaped DNA expression vector of any one of claims 40 to 46, and optionally comprising at least one other component of a suicide system effective in inducing death of cells expressing the dumbbell-shaped DNA expression vector, and a carrier suitable for use in human or veterinary medicine.

48. A dumbbell-shaped DNA expression vector comprising or encoding the trans-splicing RNA molecule according to any one of claims 1 to 23.

Images