P2RY2 activity regulator

Abstract

The present invention relates to a P2Y purinergic receptor 2 (P2RY2) activity modulator for use in T cell immunotherapy. The present invention further relates to a polynucleotide encoding a P2RY2 activity modulator for use in T cell immunotherapy, and to a host cell comprising a P2RY2 activity modulator. The present invention further relates to a method for identifying a subject suitable for T cell immunotherapy, comprising the steps of (A) determining the activity of P2RY2 in a sample from the subject, (B) comparing the activity determined in step (A) with a reference, and identifying a subject suitable for T cell immunotherapy based on the comparison in step (B), as well as a method for identifying a P2RY2 activity modulator, comprising the steps of (I) contacting a host cell with a candidate compound suspected to be a P2RY2 activity modulator, (II) determining the B7-H3 activity in the host cell, (III) comparing the B7-H3 activity determined in step (II) with a control, and (IV) identifying a P2RY2 activity modulator based on the comparison in step (III).

Description

[Technical field]

[0001] The present invention relates to a P2Y purinoceptor 2 (P2RY2) activity modulator for use in T cell immunotherapy. The present invention further relates to a polynucleotide encoding a P2RY2 activity modulator, and to a host cell comprising a P2RY2 activity modulator for use in T cell immunotherapy. The present invention further relates to a method for identifying a subject suitable for T cell immunotherapy, the method comprising the steps of: (A) determining the activity of P2RY2 in a sample from the subject; (B) comparing the activity determined in step (A) with a reference; and identifying the subject suitable for T cell immunotherapy based on the comparison in step (B); and a method for identifying a P2RY2 activity modulator, the method comprising the steps of: (I) contacting a host cell with a candidate compound suspected to be a P2RY2 activity modulator; (II) determining B7-H3 activity in the host cell; (III) comparing the B7-H3 activity determined in step (II) with a control; and (IV) identifying a P2RY2 activity modulator based on the comparison in step (III). [Background technology]

[0002] Therapies that promote the function or activity of immune cells to fight cancer have transformed cancer treatment in recent years. In particular, engineered T cell therapies, such as CAR-T and immune checkpoint blockade therapies, have been shown to produce more durable responses than traditional treatments (e.g., chemotherapy) in some cancer types. However, current cancer immunotherapies are only effective in a portion of patients, and identifying treatment strategies that benefit more patients remains a challenge.

[0003] The success of targeting the PD-1 / PD-L1 axis and the CTLA-4 immune checkpoint has stimulated interest in other molecules that may enhance the activity of existing cancer immunotherapies or may be active in tumor types in which blockade of the CTLA-4 and PD-1 / PD-L1 pathways shows less activity. A particularly interesting immune checkpoint ligand is the B7 family member B7-H3 (CD276). Like other B7 family members, B7-H3 has immune regulatory functions, but its receptor on immune cells remains unknown. B7-H3 was initially identified as a costimulatory molecule that increases T cell activation in vitro and in autoimmune disease models (Chen et al., J Immunol 189, 347-355 (2012)). However, subsequent studies demonstrated that B7-H3 suppresses the effector functions of both T cells and NK cells in vitro and in syngeneic mouse cancer models (Lee et al., Cell Res 27, 1034-1045 (2017); Cai et al., Cell Mol Immuno 17(3), 227-236 (2020)). Furthermore, immunosuppressive activity of B7-H3 has also been described in mouse models of graft-versus-host disease (Veenstra et al., Blood 125, 3335-3346 (2015)), cardiac allograft rejection (Ueno et al., Eur J Immunol 42, 2343-2353 (2012)), and autoimmune encephalomyelitis (Suh et al., Nat Immunol 4, 899-906 (2003); Prasad et al., J Immunol 73(4) 2500-2506 (2004)). Thus, targeting B7-H3 activity can be used to modulate immune cell (e.g., T cells and NK cells) function or activity.

[0004] Higher levels of B7-H3 expression in cancer cells compared to healthy tissues have been reported in many human solid tumor types, including non-small cell lung cancer (NSCLC), breast cancer, ovarian cancer, endometrial cancer, lung cancer, liver cancer, and gastric cancer, as well as in hematological tumors, including diffuse large B-cell lymphoma (DLBCL), acute myeloid leukemia (AML), and mantle cell lymphoma (MCL). In solid tumors, B7-H3 expression has also been detected on surrounding tumor vasculature and tumor-infiltrating immune cells, such as myeloid cells (Yim et al., Eur J Cancer 133, 74-85 (2020)).

[0005] P2RY2 has previously been identified as a receptor for extracellular ATP and UTP (Soltoff et al., J Biol Chem 273 (5) 2653-2660 (1998); Burnstock et al., Purigergic Signal 9, 491-540 (2013)). P2RY2 expression was also found to correlate with patient survival in pancreatic ductal adenocarcinoma (Hu et al., Clin Cancer Res 25 (4): 1318-1330 (2019)). Summary of the Invention [Problem to be solved by the invention]

[0006] Thus, there remains a need for improved cancer treatments that provide advantageous options for cancer detection, treatment, and management. The technical problem underlying the present invention can be seen as the provision of means and methods that meet the above-mentioned needs. This technical problem is solved by the embodiments characterized in the claims and herein below. [Means for solving the problem]

[0007] Thus, the present invention relates to P2Y purinoceptor 2 (P2RY2) activity modulators for use in T cell immunotherapy. [Brief description of the drawings]

[0008] [Figure 1] Identification of regulators of B7-H3 expression by flow cytometry-based genetic screening. Dots represent individual genes; y-axis shows Log10-transformed MAGeCK robust ranking aggregate (RRA) scores based on depletion or enrichment of sgRNAs in B7-H3high versus B7-H3low cell populations sorted from a genome-wide CRIPSR / Cas9 (Brunello) library of THP-1 cells. [Diagram 2] Flow cytometry analysis of B7-H3 expression in wild-type (WT) and P2RY2-deficient bulk THP-1, U937, KBM7, and K562 cells (P2RY2-3 KO and P2RY2-4 KO) in the absence or presence of ATP. Values ​​indicate MFI compared to untreated WT cells. [Diagram 3] Flow cytometry analysis of B7-H3 expression in THP-1 cells in the absence or presence of ATP. Values ​​indicate MFI compared to untreated cells. [Figure 4]Effects of genetic perturbation of P2RY2 and B7-H3 on T cell activity in T cell-cancer cell cocultures. CD33-specific CAR-transduced T cells (CAR-T) were cocultured with gene-edited THP-1 cells for 6–24 h. Control cells: THP-1 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: THP-1 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: THP-1 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: THP-1 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: THP-1 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: THP-1 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of the expression of CD25, CD69 and CD137 and the production of IFNγ, IL-2 and TNFα in the CD3+CD8+ cell population is shown (values ​​indicate the percentage of positive cells). [Diagram 5]Effects of genetic perturbation of P2RY2 and B7-H3 on T cell activity in T cell-cancer cell cocultures. CD33-specific CAR-transduced T cells (CAR-T) were cocultured with gene-edited THP-1 cells for 6–24 h. Control cells: THP-1 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: THP-1 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: THP-1 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: THP-1 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: THP-1 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: THP-1 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of the expression of CD25 and the production of IFNγ, IL-2 and TNFα in the CD3+CD8- cell population is shown (values ​​indicate the percentage of positive cells). [Figure 6]Effect of genetic perturbation of P2RY2 and B7-H3 on T cell activity in T cell-cancer cell cocultures. MART-1-specific TCR-transduced T cells (TCR-T) were cocultured with gene-edited MART-1+BxPC3 cells for 6–24 h. Control cells: BxPC3 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: BxPC3 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: BxPC3 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: BxPC3 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: BxPC3 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: BxPC3 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of the expression of CD25, CD69 and CD137 and the production of IFNg, IL-2 and TNFa in the CD8+ cell population is shown (values ​​indicate the percentage of positive cells). [Figure 7]Effect of genetic perturbation of P2RY2 and B7-H3 on cancer cell viability in T cell-cancer cell cocultures. T cells transduced with a CD33-specific CAR (CAR-T) were cocultured with gene-edited THP-1 cells for 6–24 h. T cells transduced with a MART-1-specific TCR (TCR-T) were cocultured with gene-edited or peptide-loaded cancer cells presenting the MART-1 epitope for 6–24 h (MART-1 epitope was loaded into THP-1 cells by incubation of the cells with MART-1 peptide; BxPC3 and MCF7 cells were transduced with the MART-1 epitope). Control cells: cancer cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: cancer cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: cancer cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: cancer cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: cancer cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: cancer cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. For THP-1 cells, the normalized number of viable cells after co-culture with CD33-specific CAR-T cells or MART-1-specific TCR-T cells is shown. The endpoint cell number was normalized to the number of THP-1 cells in the culture without T cells. For BxPC3 cells and MCF7 cells, the normalized cell viability of cancer cells was determined by CellTiter-Blue® Cell Viability (Promega) assay after co-culture with MART-1-specific TCR-T cells.Endpoint cell viability was normalized to BxPC3 or MCF7 cells in cultures without T cells, measured using the CellTiter-Blue® Cell Viability (Promega) assay. [Figure 8] Effects of P2RY2 antagonists on T cells and cancer cells in T cell-cancer cell cocultures. CD33-specific CAR-transduced T cells (CAR-T) were cocultured with gene-edited THP-1 cells in the absence or presence of 5 μM AR-C 118925XX (AR-C) for 6–24 h. Control cells: THP-1 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: THP-1 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: THP-1 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: THP-1 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: THP-1 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: THP-1 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of the expression of IFNγ and TNFα production in the CD3+CD8+ cell population (values ​​indicate the percentage of positive cells). Normalized cell counts of viable cells after co-culture with CD33-specific CAR-T cells for THP-1 cell viability. Endpoint cell counts were normalized to the number of THP-1 cells in cultures without T cells. [Figure 9]Effects of P2RY2 antagonists and agonists on cancer cells in T cell-cancer cell cocultures. CD33-specific CAR-transduced T cells (CAR-T) were cocultured with gene-edited THP-1 cells for 24 hours in the absence or presence of 5uM AR-C 118925XX (AR-C) or 100uM diquafosol. Control cells: THP-1 cells transduced with non-targeting sgRNA and Cas9 (Ctrl.); P2RY2-overexpressing cells: THP-1 cells transduced with the open reading frame of P2RY2 (P2RY2-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Normalized cell counts of viable cells after coculture with CD33-specific CAR-T cells are shown. Endpoint cell counts were normalized to the number of THP-1 cells in cultures without T cells. [Figure 10] Effects of P2RY2 inhibition and PD-L1 immune checkpoint inhibition on T cells in T cell-cancer cell cocultures. MART-1-specific TCR-transduced T cells (TCR-T) were cocultured with MART-1+BxPC3 cells for 6–24 h in the presence of 5 μM AR-C 118925XX (AR-C), 10 μg / ml atezolizumab, 10 μg / ml durvalumab, or their combinations. Untreated cells served as controls. Flow cytometry analysis of CD25, CD69, and CD137 expression within the CD8+ MART-1-specific TCR+ population is shown (values ​​indicate the percentage of positive cells). Data represent the mean ± sd of triplicates and were analyzed by one-way ANOVA with multiple comparisons, *p ≤ 0.0013. [Figure 11]Effects of P2RY2 inhibition and PD-L1 immune checkpoint inhibition on cancer cells in T cell-cancer cell cocultures. MART-1-specific TCR-transduced T cells (TCR-T) were cocultured with MART-1+BxPC3 cells for 6–24 h in the presence of 5 μM AR-C 118925XX (AR-C), 10 μg / ml atezolizumab, 10 μg / ml durvalumab, or a combination thereof. Untreated cells served as controls. Normalized cell viability of BxPC3 cells was determined by CellTiter-Blue® Cell Viability (Promega) assay after coculture with MART-1-specific TCR-T cells. Endpoint cell viability was normalized to BxPC3 cells in cultures without T cells. Data represent mean ± sd of triplicates and were analyzed by one-way ANOVA with multiple comparisons, *p ≤ 0.0013. [Figure 12]Effect of genetic perturbation of P2RY2 and B7-H3 on T cell activity in T cell-cancer cell cocultures. T cells transduced with a CEA-specific CAR (CAR-T) were cocultured with gene-edited SW480 cells for 24 hours. Control cells: SW480 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: SW480 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: SW480 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: SW480 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: SW480 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: SW480 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of the expression of CD25, CD69 and CD137 and the production of IFNγ, IL-2 and TNFα in the CD3+CD8+ cell population is shown (values ​​indicate the percentage of positive cells). [Figure 13]Effect of genetic perturbation of P2RY2 and B7-H3 on T cell activity in T cell-cancer cell cocultures. T cells transduced with a CEA-specific CAR (CAR-T) were cocultured with gene-edited SW480 cells for 24 hours. Control cells: SW480 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: SW480 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: SW480 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: SW480 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: SW480 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: SW480 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of the expression of CD25, CD69 and CD137 and the production of IFNγ, IL-2 and TNFα in the CD3+CD4+ cell population is shown (values ​​indicate the percentage of positive cells). [Figure 14]Effect of genetic perturbation of P2RY2 and B7-H3 on T cell activity in T cell-cancer cell cocultures. MART-1-specific TCR-transduced T cells (TCR-T) were cocultured with gene-edited MART-1+ MIA PaCa-2 cells for 16 h. Control cells: MIA PaCa-2 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: MIA PaCa-2 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: MIA PaCa-2 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: MIA PaCa-2 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: MIA transduced with the open reading frame of P2RY2 PaCa-2 cells (P2RY2-OE); B7-H3 overexpressing cells: MIA PaCa-2 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of CD25, CD69 and CD137 expression and IFNγ and IL-2 production in CD3+CD8+ cell population is shown (values ​​indicate the percentage of positive cells). [Figure 15]Effect of genetic perturbation of P2RY2 and B7-H3 on T cell activity in T cell-cancer cell cocultures. MART-1-specific TCR-transduced T cells (TCR-T) were cocultured with gene-edited MART-1+MIA PaCa-2 cells for 16 h. Control cells: MIA PaCa-2 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: MIA PaCa-2 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: MIA PaCa-2 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: MIA PaCa-2 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: MIA transduced with the open reading frame of P2RY2 PaCa-2 cells (P2RY2-OE); B7-H3 overexpressing cells: MIA PaCa-2 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of CD25 and CD69 expression and IFNγ and IL-2 production in CD3+CD4+ cell populations is shown (values ​​indicate the percentage of positive cells). [Figure 16]Effect of genetic perturbation of P2RY2 and B7-H3 on T cell activity in T cell-cancer cell cocultures. MART-1-specific TCR-transduced T cells (TCR-T) were cocultured with gene-edited MART-1+ MDA-MB-231 cells for 21 h. Control cells: MDA-MB-231 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: MDA-MB-231 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: MDA-MB-231 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: MDA-MB-231 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: MDA-MB-231 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: MDA-MB-231 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of CD25 and CD69 expression in CD3+CD8+ or CD3+CD4+ cell populations is shown (values ​​indicate the percentage of positive cells). [Figure 17]Effect of genetic perturbation of P2RY2 and B7-H3 on cancer cell viability in CAR-T cell-cancer cell co-cultures. T cells transduced with a CEA-specific CAR (CAR-T) were co-cultured with gene-edited SW480 cells for 48 h. Control cells: cancer cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: cancer cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: cancer cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: cancer cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: cancer cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: cancer cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Normalized cell viability of cancer cells was determined by CellTiter-Blue® Cell Viability (Promega) assay after co-culture with MART-1 specific TCR-T cells. End-point cell viability was normalized to SW480 cells, measured using CellTiter-Blue® Cell Viability (Promega) assay, in cultures without T cells. [Figure 18]Effect of genetic perturbation of P2RY2 and B7-H3 on cancer cell viability in TCR-T cell-cancer cell cocultures. T cells transduced with MART-1-specific TCR (TCR-T) were cocultured with gene-edited MART-1+ MDA-MB-231 / MIA PaCa-2 cells for 48 h. MIA PaCa-2 and MDA-MB-231 cells were transduced with the MART-1 epitope. Control cells: cancer cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: cancer cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: cancer cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: cancer cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: cancer cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: cancer cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Normalized cell viability of cancer cells was determined by CellTiter-Blue® Cell Viability (Promega) assay after co-culture with MART-1 specific TCR-T cells. End-point cell viability was normalized to MIA PaCa-2 cells and MDA-MB-231 cells in cultures without T cells, measured using CellTiter-Blue® Cell Viability (Promega) assay. [Figure 19]Effects of P2RY2 agonists and antagonists on T cell activity in T cell-cancer cell cocultures. CEA-specific CAR-transduced T cells (CAR-T) were cocultured with gene-edited SW480 cells in the absence or presence of 400 μM ATP, 200 μM ATPγS, 100 μM diquafosol, 50 μM denufosol and 10 μM AR-C 118925XX (AR-C) for 24 h. Control cells: SW480 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: SW480 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: SW480 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: SW480 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: SW480 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: SW480 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometry analysis of CD25 and CD69 expression and IFNγ production in CD3+CD8+ or CD3+CD4+ cell populations is shown (values ​​indicate the percentage of positive cells). [Figure 20]Effects of P2RY2 agonists and P2RY2 antagonists on cancer cell viability in T cell-cancer cell co-cultures. T cells transduced with a CEA-specific CAR (CAR-T) were co-cultured with gene-edited SW480 cells in the absence or presence of 400 μM ATP, 200 μM ATPγS, 100 μM diquafosol, 50 μM denufosol and 10 μM AR-C 118925XX (AR-C) for 48 h. Control cells: SW480 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: SW480 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: SW480 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: SW480 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2-overexpressing cells: SW480 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3-overexpressing cells: SW480 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected by antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Normalized cell viability of SW480 cells was determined by CellTiter-Blue® Cell Viability (Promega) assay after co-culture with CEA CAR-T cells. End-point cell viability was normalized to SW480 cells in cultures without T cells, measured using CellTiter-Blue® Cell Viability (Promega) assay. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] In general, the terms used herein shall be given their usual and customary meanings to those skilled in the art, and shall not be limited to special or customized meanings unless otherwise indicated. When used below, the terms "have", "comprise" or "include" or any grammatical variants thereof shall be used non-exclusively. That is, these terms may refer to both the situation where no further features are present in the entity described in this context, other than the features introduced by these terms, and the situation where one or more further features are present. As an example, the expressions "A has B", "A contains B" and "A includes B" may refer to both the situation where no other elements are present in A, other than B (i.e., the situation where A is solely and exclusively composed of B), and the situation where one or more further elements are present in entity A, other than B (such as element C, elements C and D, or further elements). Also, as will be appreciated by those skilled in the art, the phrases "comprising a" and "comprising an" preferably mean "comprising one or more," i.e., equivalent to "comprising at least one." Thus, a phrase referring to one item of a plurality, unless otherwise indicated, preferably refers to at least one such item, more preferably to a plurality of such items; thus, for example, identifying "a cell" refers to identifying at least one cell, preferably to identifying a plurality of cells.

[0010] Furthermore, when used below, the terms "preferably", "more preferably", "most preferably", "particularly", "more particularly", "particularly", "more particularly" or similar terms are used with optional features without further limiting the possibilities. That is, the features introduced by these terms are optional features and are not intended to limit the scope of the claims in any way. The invention can be implemented by using alternative features, as the skilled person will recognize. Similarly, features introduced by "in one embodiment" or similar expressions are intended to be optional features, without any limitations on further embodiments of the invention, without any limitations on the scope of the invention, and without any limitations on the possibility of combining the features introduced in such a way with other optional or non-optional features of the invention.

[0011] The method specified herein below is preferably an in vitro method.The steps of the method can be carried out in any order considered suitable by the skilled artisan, but are preferably carried out in the order shown; and one or more of the steps, preferably all of them, can be assisted or carried out by an automated device.Furthermore, the method can include steps in addition to those explicitly mentioned above.

[0012] As used herein, the term "standard conditions" refers to IUPAC standard ambient temperature and pressure (SATP) conditions, unless otherwise specified, i.e., preferably at a temperature of 25° C. and an absolute pressure of 100 kPa; also preferably, the standard conditions include a pH of 7. Furthermore, unless otherwise indicated, the term "about" refers to the indicated value with the technical precision generally accepted in the relevant field, preferably to the indicated value ±20%, more preferably ±10%, most preferably ±5%. Furthermore, the term "essentially" indicates that there is no deviation having an effect on the indicated result or use, i.e., possible deviations do not cause deviations of more than ±20%, more preferably ±10%, most preferably ±5% of the indicated result. In other words, "consisting essentially of" means including the specified components, but excluding other components, except for materials present as impurities, unavoidable materials present as a result of the process used to provide the components, and components added for purposes other than achieving the technical effect of the present invention. For example, a composition defined using the phrase "consisting essentially of" includes any known acceptable additives, excipients, diluents, carriers, etc. Preferably, a composition consisting essentially of a set of components will contain less than 5% by weight, more preferably less than 3% by weight, even more preferably less than 1% by weight, and most preferably less than 0.1% by weight of an unspecified component.

[0013] The degree of identity (e.g., expressed as "% identity") between two biological sequences, preferably DNA, RNA, or amino acid sequences, can be determined by algorithms well known in the art. Preferably, the degree of identity is determined by comparing two optimally aligned sequences over a comparison window, where the fragments of the sequences in the comparison window may contain additions or deletions (e.g., gaps or overhangs) compared to the sequences compared for optimal alignment. The percentage is calculated by determining the number of positions at which identical residues exist in both sequences, preferably over the entire length of the polynucleotide or polypeptide, to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Optimal alignment of sequences for comparison can be performed by the local homology algorithm of Smith and Waterman (1981), by the homology alignment algorithm of Needleman and Wunsch (1970), by the similarity search method of Pearson and Lipman (1988), by computer implementations of these algorithms (GAP, BESTFIT, BLAST, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI), or by visual inspection. Given that two sequences are specified for comparison, GAP and BESTFIT are preferably used to determine their optimal alignment, i.e., degree of identity. Preferably, default values ​​of 5.00 for gap weight and 0.30 for gap weight length are used. In the context of the biological sequences referred to herein, the term "essentially identical" denotes a percent identity value of at least 80%, preferably at least 90%, more preferably at least 98%, and most preferably at least 99%.As will be understood, the term "essentially identical" includes 100% identity. The above applies mutatis mutandis to the term "essentially complementary."

[0014] The term "fragment" of a biological macromolecule, preferably of a polynucleotide or polypeptide, is used herein in a broad sense for any subpart, preferably a subdomain, of the respective biological macromolecule, including the indicated sequence, structure and / or function. In other words, the term includes subparts generated by actual fragmentation of the biological macromolecule, but also subparts obtained from the respective biological macromolecule in an abstract way, for example in silico. In other words, as used herein, not only Fc or Fab fragments, but also, for example, single chain antibodies, bispecific antibodies and nanobodies can be referred to as fragments of immunoglobulins.

[0015] Unless otherwise indicated herein, the compounds specified, particularly polynucleotides and polypeptides, may be included in a larger structure, for example, covalently or non-covalently linked to additional sequences, carrier molecules, retarders, and other excipients.In particular, the polypeptides as specified may be included in a fusion polypeptide that includes additional peptides, which may serve, for example, as a tag for purification and / or detection, as a linker, or to extend the in vivo half-life of the compound.The term "detectable tag" refers to a stretch of amino acids that is added or introduced into the fusion polypeptide; preferably, the tag is added to the C-terminus or N-terminus of the fusion polypeptide.The stretch of amino acids preferably allows the detection of the polypeptide by an antibody that specifically recognizes the tag; or preferably allows the formation of a functional conformation, such as a chelator; or preferably allows visualization, for example in the case of a fluorescent tag.Preferred detectable tags are Myc tag, FLAG tag, 6-His tag, HA tag, GST tag, or fluorescent protein tag, for example GFP tag. These tags are all well known in the art.Other additional peptides that are preferably included in fusion polypeptide include additional amino acids or other modifications that can serve as secretion mediators, blood-brain barrier crossing mediators, cell-penetrating peptides, and / or immune stimulants.Additional polypeptides or peptides that can be fused to polypeptides are signal and / or transport sequences, such as IL-2 signal sequences, and linker sequences.

[0016] The term "polypeptide" as used herein means a molecule consisting of several, typically at least 20, amino acids covalently linked to each other by peptide bonds. Molecules consisting of less than 20 amino acids covalently linked by peptide bonds are usually considered to be "peptides". Preferably, a polypeptide is composed of 50-1000, more preferably 75-1000, even more preferably 100-500, and most preferably 110-400 amino acids. Preferably, the polypeptide is comprised in a fusion polypeptide and / or a polypeptide complex. Unless otherwise indicated, reference herein to a particular polypeptide preferably includes polypeptide variants.

[0017] As used herein, the term "polypeptide variant" refers to any chemical molecule that contains at least one polypeptide as specified herein and has the activity indicated, but differs in structure from the specified polypeptide.Preferably, the polypeptide variant comprises a polypeptide having a contiguous amino acid sequence that corresponds to at least 50%, preferably at least 75%, more preferably at least 85%, even more preferably at least 90%, and most preferably at least 95% of the amino acid sequence of the specifically specified polypeptide.Furthermore, it should be understood that the polypeptide variant as referred to in accordance with the present invention will have an amino acid sequence that differs by at least one amino acid substitution, deletion and / or addition, and the amino acid sequence of the variant is still preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and most preferably at least 99% identical to the amino acid sequence of the specified polypeptide.The degree of identity between two amino acid sequences can be determined by algorithms well known in the art and as described herein above. The polypeptide variants referred to above may be allelic variants or any other species-specific homologs, paralogs, or orthologs.Furthermore, the polypeptide variants referred to herein include fragments of a particular polypeptide, or polypeptide variants of the above-mentioned types, so long as these fragments and / or variants have the biological activity as specified.Such fragments may be, or may be derived from, for example, degradation products or splicing variants of the polypeptide.Furthermore, variants that differ by post-translational modifications such as phosphorylation, glycosylation, ubiquitination, sumoylation, or myristylation, by including unnatural amino acids, and / or by being peptidomimetics are included.

[0018] The term "polynucleotide" as used herein means a linear or circular nucleic acid molecule. The polynucleotide of the present invention will preferably be provided as an isolated polynucleotide (i.e., isolated from its natural context) or in a genetically modified form, preferably including at least one heterologous sequence. The term encompasses single-stranded polynucleotides as well as double-stranded polynucleotides. In addition, chemically modified polynucleotides, including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides, or artificially modified derivatives such as biotinylated polynucleotides, locked nucleic acids, are also included. The polynucleotide of the present invention has an activity of encoding a P2RY2 activity regulator or an activity of being a P2RY2 activity regulator. Methods for testing whether a given polynucleotide has the above-mentioned activity are known in the art. For example, a candidate polynucleotide of interest may preferably be introduced into a host cell, and the resulting amount and / or activity of P2RY2 is determined, preferably compared to a control. Unless otherwise indicated, a reference to a particular polynucleotide herein preferably includes a polynucleotide variant.

[0019] The term "polynucleotide variant" as used herein refers to a variant of the polynucleotides referred to herein, including a nucleic acid sequence characterized in that the sequence can be derived from the above-mentioned specific nucleic acid sequence by at least one nucleotide substitution, addition and / or deletion, and the polynucleotide variant will have an activity as specified for the specific polynucleotide. Preferably, the polynucleotide variant is an ortholog, paralog or other homolog of the specific polynucleotide. Also preferably, the polynucleotide variant is or is derived from a non-naturally occurring allele of the specific polynucleotide. Polynucleotide variants also encompass polynucleotides that comprise a nucleic acid sequence capable of hybridizing to the above-mentioned specific polynucleotide, preferably under stringent hybridization conditions. These stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. Those skilled in the art know how to determine the required hybridization conditions by referring to textbooks such as those mentioned above, or to the following textbooks: Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989; Hames and Higgins (Ed.) 1985, "Nucleic Acids Hybridization: A Practical Approach", IRL Press at Oxford University Press, Oxford; Brown (Ed.) 1991, "Essential Molecular Biology: A Practical Approach", IRL Press at Oxford University Press, Oxford.Alternatively, polynucleotide variants can be obtained by PCR-based techniques such as DNA amplification based on mixed oligonucleotide primers, i.e., using degenerate primers for the conserved domains of the polypeptides of the invention. The conserved domains of the polypeptides can be identified by sequence comparison of the nucleic acid sequence of the polynucleotides of the invention or the amino acid sequence of the polypeptides with sequences of other organisms. DNA or cDNA from bacteria, fungi, plants or preferably animals can be used as templates. Furthermore, variants include polynucleotides comprising nucleic acid sequences that are at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and most preferably at least 99% identical to the specifically indicated nucleic acid sequences. Furthermore, polynucleotides comprising nucleic acid sequences that encode amino acid sequences that are at least 70%, more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and most preferably at least 99% identical to the specifically indicated amino acid sequences are also encompassed. The identity percentage values ​​are preferably calculated over the entire amino acid or nucleic acid sequence region, preferably as specified herein above. The polynucleotide of the present invention consists of, essentially consists of, or comprises the above-mentioned nucleic acid sequence.That is, the polynucleotide of the present invention can also comprise additional nucleic acid sequence.Specifically, the polynucleotide of the present invention can code for a fusion protein, and one partner of the fusion protein is the polypeptide encoded by the above-mentioned nucleic acid sequence.The polynucleotide can also be included in a vector.

[0020] The term "vector" preferably includes phage, plasmid, viral or retroviral vectors as well as artificial chromosomes such as bacterial or yeast artificial chromosomes. Moreover, the term also relates to targeting constructs that allow random or site-specific integration of the targeting construct into genomic DNA. Such targeting constructs preferably contain DNA of sufficient length for either homologous or non-homologous recombination, as described in detail below. Vectors that include the polynucleotides of the present invention preferably further include a selectable marker for propagation and / or selection in a host. Vectors can be incorporated into host cells by various techniques well known in the art. For example, plasmid vectors can be introduced into precipitates such as calcium phosphate precipitates or rubidium chloride precipitates, or into complexes with charged lipids, or into carbon-based clusters such as fullerenes. Alternatively, plasmid vectors can be introduced by heat shock or electroporation techniques. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line before application to the host cell. Retroviral vectors may be replication-competent or replication-deficient. In the latter case, the proliferation of the virus will generally occur only in the complementary host / cell. More preferably, in the vector of the present invention, the polynucleotide is operably linked to an expression control sequence that allows expression in prokaryotic or eukaryotic cells or isolated fractions thereof, i.e., preferably, the polynucleotide is contained in an expression vector. The expression of the polynucleotide preferably comprises the transcription of the polynucleotide into RNA, as specified above. Regulatory elements that ensure expression in eukaryotic cells, preferably mammalian cells, are well known in the art. They preferably comprise a regulatory sequence that ensures the initiation of transcription, and optionally a polyA signal that ensures the termination of transcription and the stabilization of the transcript. Additional regulatory elements may include not only transcriptional enhancers, but also translational enhancers.Possible regulatory elements allowing expression in prokaryotic host cells include, for example, the lac, trp, or tac promoters in E. coli, and examples of regulatory elements allowing expression in eukaryotic host cells are the AOX1 or GAL1 promoters in yeast or the CMV, SV40, RSV promoters (Rous sarcoma virus), CMV enhancer, SV40 enhancer, or globin introns in mammalian and other animal cells. Furthermore, inducible expression control sequences can be used in the expression vectors encompassed by the present invention. Such inducible vectors can include tet or lac operator sequences, or sequences inducible by heat shock or other environmental factors. Suitable expression control sequences are well known in the art. Besides the elements responsible for initiation of transcription, such regulatory elements can also include transcription termination signals downstream of the polynucleotide, such as the SV40-polyA site or the tk-polyA site. In this context, suitable expression vectors are known in the art, such as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pBluescript (Stratagene), pCDM8, pRc / CMV, pcDNA1, pcDNA3 (InVitrogene) or pSPORT1 (GIBCO BRL).Preferably, the vector is an expression vector as well as a gene transfer or targeting vector.Expression vectors derived from viruses such as retrovirus, vaccinia virus, adeno-associated virus, herpes virus or bovine papilloma virus can be used to deliver polynucleotide or vector to targeted cell population.Methods well known to those skilled in the art can be used to construct recombinant viral vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) NY and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NY (1994).

[0021] The term "P2Y purinoceptor 2", which may be abbreviated as "P2RY2", is known to those skilled in the art to refer to a member of the group of G protein-coupled receptors that are responsive to both adenosine and uridine nucleotides.Preferably, P2RY2 is mammalian P2RY2, more preferably human P2RY2, and most preferably has the amino acid sequence shown in Genbank accession number: NP_002555.4, NP_788085.3, or NP_788086.3, and is preferably encoded by the nucleic acid sequence shown in Genbank accession number: NM_002564.4, NM_176071.3, or NM_176072.3.Preferably, P2RY2 is the P2RY2 expressed by cancer cells or by T cells that mediate autoimmune disease.

[0022] The term "activity modulator" is known to those skilled in the art to refer to any compound that causes the activity of a biomolecule or pathway to deviate, preferably significantly, from the activity in the absence of said activity modulator. Preferably, said deviation is at least 20%, more preferably at least 50%, even more preferably at least 75%, even more preferably at least 90% of the value of the activity parameter that can be determined in the absence of said activity modulator, especially when said activity modulator is an activity-reducing compound; however, said deviation may also be at least 2-fold, preferably at least 5-fold, more preferably at least 10-fold, especially when said activity modulator is an activity-increasing compound. However, as will be understood by those skilled in the art in view of the following description herein, modulation may also be a complete disappearance of the activity that exists in the absence of said modulator; or a new activity that does not exist in the absence of said modulator. The effect of an activity modulator may be temporary, for example over a time frame of hours or days, or may be permanent, especially depending on the specific selection of the modulator. Preferably, the effect is temporary, lasting from 1 day to 6 months, preferably from 2 days to 2 months, more preferably from 3 days to 4 weeks, and most preferably from 1 to 4 weeks. Also, as will be appreciated by those skilled in the art, the effect may be localized, i.e., localized at the site of administration, or may be systemic, for example after systemic administration of an activity modulator.

[0023] Preferably, the activity modulator is an activity-reducing compound; that is, preferably, the P2RY2 activity modulator is a P2RY2 activity-reducing compound, preferably a P2RY2 specific activity-reducing compound. Preferably, the P2RY2 specific activity-reducing compound inhibits non-P2RY2 specific activity by up to 50%, preferably up to 25%, more preferably up to 10% at a concentration that inhibits P2RY2 activity by 90%. The activity of the P2RY2 activity-reducing compound is preferably determined in vitro by assaying the amount and / or enzyme activity of P2RY2, as specified elsewhere herein, preferably as shown in the examples herein. Also preferably, the P2RY2 activity-reducing compound increases T cell anti-cancer activity in vitro and / or in vivo. Compounds that reduce the activity of known polypeptide gene products such as P2RY2 can be provided by those skilled in the art by standard methods of molecular biology, for example as specified herein below. Preferably, when the T cell immunotherapy is cancer T cell immunotherapy, the P2RY2 activity modulator is a P2RY2 activity-reducing compound.

[0024] Preferably, the P2RY2 activity reducing compound is a direct P2RY2 activity reducing compound, i.e., a compound that binds to P2RY2, preferably specifically binds to it, thereby inhibiting P2RY2. More preferably, the direct P2RY2 activity reducing compound is a small molecule inhibitor, an inhibitor polypeptide, an inhibitor polynucleotide, or a non-polypeptide non-polynucleotide inhibitor macromolecule. Preferably, the direct P2RY2 activity reducing compound is a compound that binds to at least one epitope in P2RY2, preferably an epitope that includes at least one amino acid of the interaction epitope and / or active center of P2RY2. Those skilled in the art know suitable methods for determining the binding of direct inhibitors to P2RY2, such as staining P2RY2-positive cells or extracts from said cells with direct inhibitor candidates (wherein the inhibitor is bound to a detectable label, preferably a colored and / or fluorescent dye); ELISA; surface plasmon resonance, etc.

[0025] The term "small molecule" as used herein refers to a chemical molecule with a molecular mass of up to 2.5 kDa, preferably up to 2 kDa, more preferably up to 1.5 kDa, most preferably up to 1 kDa. "Small molecule inhibitors" can in principle come from any chemical class of molecules. Preferably, small molecule inhibitors are organic molecules, i.e., they contain at least one carbon-carbon bond. Small molecule inhibitors of P2RY2 activity, in particular AR-C 118925XX (CAS number: 216657-60-2), are known in the art, for example from WO 1999 / 002501, and can be identified by the methods as specified herein below.

[0026] The term "inhibitor polypeptide" is used herein to refer to any polypeptide or peptide that binds to P2RY2 and inhibits its activity. That is, the inhibitor polypeptide is preferably an antagonist, more preferably a competitive antagonist or a non-competitive antagonist. Preferably, the inhibitor polypeptide is selected from the list consisting of an antibody, an aptamer, anticalin, and a designed ankyrin repeat protein (DARPin).

[0027] As used herein, the term "antibody" refers to a soluble immunoglobulin from any of the IgA, IgD, IgE, IgG, or IgM classes, or a fragment thereof, that interacts directly with P2RY2 and has the activity of inhibiting P2RY2 activity as specified herein above. Antibodies or fragments thereof against P2RY2 can be prepared by well-known methods using purified P2RY2 polypeptide or a suitable fragment derived therefrom as an antigen. Fragments suitable as antigens may be identified by antigenicity determination algorithms well-known in the art. Suitable fragments may also be obtained from P2RY2 polypeptide by proteolytic digestion, may be synthetic peptides, or may be recombinantly expressed. The suitability of the antibodies thus generated as inhibitors of P2RY2 can be tested by assays as described elsewhere herein. Preferably, the antibodies of the present invention are monoclonal, human, primatized, chimeric, or humanized antibodies, or fragments thereof. More preferably, the antibody is a single chain antibody, a single domain antibody, a nanobody, or an antibody fragment, such as Fab, scFab, etc. The antibody of the present invention also includes bispecific antibodies, synthetic antibodies, or chemically modified derivatives of any of the above-mentioned antibodies. Preferably, the antibody of the present invention will specifically bind to the P2RY2 polypeptide as specified above (i.e., will not cross-react with other polypeptides or peptides). Specific binding can be tested by various well-known techniques. The antibody or fragment thereof can be obtained, for example, by using the method described in Harlow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988. Monoclonal antibodies can be prepared by the technique first described in Kohler and Milstein, Nature. 1975. 256: 495 and Galfre, Meth. Enzymol. 1981, 73: 3, which involves the fusion of mouse myeloma cells to spleen cells from an immunized mammal.Preferably, the antibody is an antibody or a polypeptide derivative thereof as specified above; more preferably, the antibody is an antibody as specified above.

[0028] As used herein, the term "aptamer" refers to a polynucleotide or polypeptide that specifically binds to a target molecule due to its three-dimensional structure. Preferably, the aptamer is a peptide aptamer, and a "peptide aptamer" is preferably a peptide that specifically interacts with P2RY2 and thereby inhibits P2RY2 activity as specified herein above. A peptide aptamer is preferably a peptide that comprises 8-80 amino acids, more preferably 10-50 amino acids, and most preferably 15-30 amino acids. Peptide aptamers can be isolated, for example, from randomized peptide expression libraries in a suitable host system such as baker's yeast (see, for example, Klevenz et al., Cell Mol Life Sci. 2002, 59: 1993-1998). Peptide aptamer is preferably a free peptide; however, it is also intended that peptide aptamer is fused to a polypeptide that functions as a "scaffold", meaning that the covalent bond to the polypeptide serves to fix the three-dimensional structure of the peptide aptamer in a specific conformation.More preferably, peptide aptamer is fused to a trafficking signal, in particular a cell-penetrating peptide.Preferably, aptamer is the aptamer as specified above or its polypeptide or polynucleotide derivative; more preferably, aptamer is the aptamer as specified above.

[0029] As used herein, the term " anticalin " refers to an artificial polypeptide derived from lipocalin, which specifically binds to P2RY2 and inhibits P2RY2 activity.Similarly, " designed ankyrin repeat protein " or " DARPin " as used herein is an artificial polypeptide that contains several ankyrin repeat motifs, which specifically binds to P2RY2 and inhibits P2RY2 activity.Preferably, anticalin or DARPin is anticalin or DARPin as specified above or their polypeptide derivatives; more preferably, anticalin or DARPin is anticalin or DARPin as specified above.

[0030] The term "non-polypeptide non-polynucleotide inhibitor macromolecule" as used herein refers to any molecule that has the property of being a direct inhibitor of P2RY2 and is a macromolecule, preferably a biopolymer, and the term "macromolecule" as used herein refers to a molecule with a molecular mass of more than 1 kDa, preferably more than 1.5 kDa, more preferably more than 2 kDa, most preferably more than 2.5 kDa.As will be understood by those skilled in the art, non-polypeptide non-polynucleotide inhibitor macromolecule is preferably not a polypeptide and not a polynucleotide, but non-polypeptide non-polynucleotide inhibitor macromolecule may contain a substructure belonging to one of the above-mentioned molecular classes.Preferably, non-polypeptide non-polynucleotide inhibitor macromolecule is a polysaccharide and / or a lipid.

[0031] Also preferably, the P2RY2 activity reducing compound is a compound that does not directly inhibit P2RY2 activity, but still reduces, preferably significantly reduces, P2RY2 activity in target cells. Preferably, the indirect P2RY2 activity reducing compound is a compound that reduces the amount of P2RY2 in target cells. Preferably, the indirect P2RY2 activity reducing compound specifically binds to a polynucleotide encoding P2RY2, preferably thereby significantly reducing, more preferably preventing, P2RY2 expression. Also preferably, the indirect P2RY2 activity reducing compound is a transcription regulator of the P2RY2 gene, or binds, preferably specifically, to a transcription regulator of the P2RY2 gene, preferably thereby significantly reducing, more preferably preventing, P2RY2 transcription. That is, the indirect P2RY2 activity reducing compound may be a transcription repressor of P2RY2 transcription, or may be an inhibitor of a transcription activator of P2RY2 transcription. However, the indirect P2RY2 activity decreasing compound may also be a compound that accelerates the degradation of P2RY2 in a cell, or a compound that decreases the concentration of a P2RY2 activator, particularly a nucleotide; that is, the indirect P2RY2 activity decreasing compound is preferably an apyrase (EC 3.6.1.5), a nucleoside triphosphate phosphatase (EC 3.6.1.15), or a triphosphatase (EC 3.6.1.25).

[0032] Preferably, the indirect P2RY2 activity reducing compound is a polynucleotide, more preferably a polynucleotide that inhibits the expression or induces the degradation of P2RY2 mRNA.More preferably, the indirect P2RY2 activity reducing compound is selected from the group consisting of shRNA, siRNA, miRNA agent, ribozyme, antisense molecule / inhibitory oligonucleotide, and CRISPR / Cas oligonucleotide.It is understood by those skilled in the art that the inhibition of the expression or induction of the degradation of a specific RNA can be achieved in various ways.It is also understood by those skilled in the art that the exact embodiment of the polynucleotide that is the indirect P2RY2 activity reducing compound of the present invention will depend on the intended treatment.

[0033] Preferably, the indirect P2RY2 activity reducing compound is a ribozyme. The term "ribozyme" as used herein means a catalytic RNA molecule with a well-defined tertiary structure that allows it to catalyze either the hydrolysis of one of its own phosphodiester bonds (self-cleaving ribozyme) or the hydrolysis of bonds in other RNA, but they have also been found to catalyze the aminotransferase activity of ribosomes. The ribozymes contemplated according to the present invention are preferably those that specifically hydrolyze their target RNA, preferably P2RY2 mRNA, i.e., the RNA that is preferably transcribed from the P2RY2 gene. In particular, according to the present invention, hammerhead ribozymes are preferred. Methods for generating and using such ribozymes are well known in the art (see, for example, Hean & Weinberg (2008), RNA and the Regulation of Gene Expression: A Hidden Layer of Complexity, Chapter 1. Caister Academic Press).

[0034] More preferably, the indirect P2RY2 activity reducing compound is an antisense oligonucleotide.The term "antisense oligonucleotide" is known to those skilled in the art and refers to an oligonucleotide that hybridizes to target RNA and causes the formation of a DNA / RNA hybrid.The DNA / RNA hybrid is a substrate for RNase H, which degrades the RNA portion of the DNA / RNA hybrid.That is, the antisense oligonucleotide comprises at least 5, preferably at least 7, more preferably at least 9, and most preferably at least 10 DNA nucleotides.Preferably, the antisense oligonucleotide has a length of at least 15 nucleotides, preferably at least 18 nucleotides, and even more preferably at least 20 nucleotides, which is preferably complementary to the P2RY2 mRNA sequence as specified herein above.

[0035] Most preferably, the indirect P2RY2 activity reducing compound is a polynucleotide that induces RNA interference. As used herein, "RNA interference (RNAi)" refers to sequence-specific post-transcriptional gene silencing of a selected target gene by degradation of the RNA (target RNA) transcribed from the target gene. The target RNA is preferably P2RY2 mRNA, i.e., the RNA transcribed from the P2RY2 gene as specified herein above. It should be understood that silencing, as used herein, does not necessarily mean complete loss of expression. RNAi preferably reduces expression by at least 40%, more preferably at least 60%, even more preferably at least 80%, and most preferably at least 90%, compared to the expression level in a reference without RNAi. RNAi requires the presence of dsRNA in the target cell that is homologous in sequence to the target RNA. The term "dsRNA" refers to RNA that has a double-stranded structure that includes two complementary and antiparallel nucleic acid strands. The RNA strands that form dsRNA may have the same or different number of nucleotides, so that one of the strands of dsRNA can be target RNA.However, it is also contemplated by the present invention that dsRNA can be formed between two sequence extensions on the same RNA molecule, for example by forming a stem-loop structure.RNAi can be used to specifically inhibit the expression of the target RNA of the present invention in vivo.Thus, RNAi can be used for medical applications as specified elsewhere herein.In such a therapeutic approach, an expression construct for siRNA can be introduced into the target cell of the host.Thus, siRNA can be effectively combined with other therapeutic approaches.Methods for using RNAi to silence genes in animals, including mammals, are known in the art.

[0036] That is, the indirect P2RY2 activity reducing compound is preferably an RNAi agent.As used herein, the term "RNAi agent" refers to shRNA, siRNA agent or miRNA agent as specified below.The RNAi agent of the present invention is of sufficient length and complementarity to stably interact with target RNA, i.e., comprises at least 15, at least 17, at least 19, at least 21, at least 22 nucleotides complementary to target RNA."Stably interact" refers to the interaction of the RNAi agent or its product produced by target cell with target RNA, for example, by forming hydrogen bonds with complementary nucleotides in target RNA under physiological conditions.

[0037] The term "siRNA agent" as used herein includes: a) dsRNA consisting of at least 15, at least 17, at least 19, at least 21 consecutive nucleotides that are base-paired, i.e. form hydrogen bonds, with complementary nucleotides; b) small interfering RNA (siRNA) molecules, or molecules that contain siRNA molecules. siRNAs are single-stranded RNA molecules, preferably having a length of 15 or more nucleotides, preferably 15-49 nucleotides, more preferably 17-30 nucleotides, most preferably 17-30 nucleotides, preferably 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. According to the present invention, the term "molecule that contains siRNA molecules" includes RNA molecules from which siRNAs are processed by cells, preferably mammalian cells. That is, molecules that contain siRNA molecules are preferably small hairpin RNAs, also known as shRNAs. As used herein, the term "shRNA" refers to an RNA molecule, preferably artificial, that forms a stem-loop structure comprising at least 10, preferably at least 15, more preferably at least 17, most preferably at least 20 nucleotides ("stem") (i.e. as dsRNA) that are base-paired with a complementary sequence on the same mRNA molecule, separated by a stretch of non-base-paired nucleotides ("loop"). c) a polynucleotide that codes for a) or b), preferably the polynucleotide is operably linked to an expression control sequence. That is, the function of the siRNA agent to inhibit the expression of a target gene can be regulated by the expression control sequence. Preferred expression control sequences are those that can be regulated by exogenous stimuli, such as the tet operator (whose activity can be regulated by tetracycline), or a heat-inducible promoter. Alternatively or additionally, one or more expression control sequences that allow tissue-specific expression of the siRNA agent can be used.

[0038] However, it is also contemplated by the present invention that the RNAi agent is a miRNA agent. "miRNA agent" as used herein includes: a) pre-microRNA, i.e., an mRNA that comprises at least 30, at least 40, at least 50, at least 60, at least 70 nucleotides ("stem") (i.e., as a dsRNA) that are base-paired to a complementary sequence on the same mRNA molecule, separated by a stretch of non-base-paired nucleotides ("loop"). b) pre-microRNA, i.e., a dsRNA molecule that comprises a stretch (stem) of at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 base-paired nucleotides formed by nucleotides of the same RNA molecule, separated by a loop. c) microRNA (miRNA), i.e., a dsRNA that comprises at least 15, at least 17, at least 18, at least 19, at least 21 nucleotides on two separate RNA strands. d) a polynucleotide encoding a) or b), preferably said polynucleotide being operably linked to an expression control sequence as specified above.

[0039] Also preferably, the indirect P2RY2 activity reducing compound comprises at least one, preferably two CRISPR / Cas oligonucleotides. The CRISPR / Cas system has been known for several years as a convenient system for inducing knockout mutations, i.e. deletions, preferably of chromosomal genes. Those skilled in the art know how to design suitable oligonucleotides, preferably expressed from vectors, to induce deletions of DNA sequences of interest. Preferably, said deletions are partial deletions, more preferably deletions of parts of genes essential for function; most preferably, said deletions are complete deletions of at least the entire coding region. As known in the art, a single CRISPR / Cas oligonucleotide can be used to introduce short insertions, deletions, and / or frameshifts in coding sequences of interest, while two CRISPR / Cas oligonucleotides can be used to mediate larger deletions, or deletions of exons, coding regions, and / or entire genes. As referred to herein, two CRISPR / Cas oligonucleotides that together mediate such a partial or complete deletion of at least one exon, a coding region, and / or an entire gene are referred to as a "CRISPR / Cas oligonucleotide pair."

[0040] Also preferably, the indirect P2RY2 activity reducing compound is a polypeptide that contains a lysosomal degradation sequence, preferably a chaperone-mediated autophagy targeting motif (CTM). Preferably, the CTM-containing polypeptide specifically binds to P2RY2; for example, the CTM-containing polypeptide may further comprise an antibody that specifically binds to P2RY2. As the skilled artisan will understand, the CTM-conjugated antibody does not necessarily have to be an inhibitory P2RY2 antibody as specified herein above; however, the antibody is preferably a P2RY2-specific antibody. Preferably, the CTM-containing polypeptide that specifically binds to P2RY2 binds to P2RY2 with a KD value that is at least 10 times, preferably at least 20 times, more preferably at least 50 times, and most preferably at least 100 times higher than the KD value of the CTM-containing polypeptide for other G protein-coupled receptors. More preferably, the CTM-containing polypeptide that specifically binds to P2RY2 does not detectably bind to other cellular proteins, preferably including non-P2RY2 G protein-coupled receptors. As will be appreciated by those skilled in the art, when an indirect P2RY2 activity reducing compound is a CTM-containing polypeptide, the CTM-containing polypeptide need not be a direct P2RY2 activity reducing compound, but may be a direct P2RY2 activity reducing compound, i.e., preferably, the CTM-containing polypeptide is also a direct P2RY2 activity reducing compound.

[0041] Also preferably, the activity regulator is an activity increasing compound; that is, preferably, the P2RY2 activity regulator is a P2RY2 activity increasing compound, preferably a P2RY2 specific activity increasing compound. Preferably, the P2RY2 specific activity increasing compound activates non-P2RY2 specific activity by up to 50%, preferably up to 25%, more preferably up to 10% at a concentration that activates P2RY2 activity by 90%. The activity of the P2RY2 activity increasing compound is preferably determined in vitro by assaying the amount and / or enzyme activity of P2RY2 as specified elsewhere herein, preferably as shown in the examples herein. Also preferably, the P2RY2 activity increasing compound reduces T cell-mediated autoimmune activity in vitro and / or in vivo. Compounds that increase the activity of known polypeptide gene products, such as P2RY2, can be provided by those skilled in the art by standard methods of molecular biology, for example as specified herein below. Preferably, when the T cell immunotherapy is a therapy for a T cell mediated autoimmune disease as specified herein below, the P2RY2 activity modulator is a P2RY2 activity increasing compound.

[0042] Preferably, the P2RY2 activity increasing compound is a direct P2RY2 activity increasing compound that binds to P2RY2 and activates the activity of P2RY2, and more preferably is a small molecule activator, an activator polypeptide, an activator polynucleotide, or a non-polypeptide non-polynucleotide activator polymer.

[0043] The term "small molecule" is specified herein above.Therefore, the term "small molecule activator" as used herein relates to a small molecule compound that increases P2RY2 activity.Small molecule activators of P2RY2 are known in the art, and include, in particular, nucleotides and their derivatives. Thus, the small molecule activator of P2RY2 is preferably ATP or UTP or a derivative thereof, more preferably MRS 2768 (uridine-5'-tetraphosphate delta-phenyl ester, CAS number: 1047980-83-5), uridine-5'-(gamma-thio)-triphosphate (CAS number: 1266569-94-1), 4-thiouridine-5'-O-(beta,gamma-difluoromethylene)triphosphate (CAS number: 1657025-60-9), denufosol (CAS number: 211448-85-0), or diquafosol (CAS number: 59985-21-6).

[0044] The term "activator polypeptide" as used herein includes any polypeptide that has an activating effect on P2RY2. Preferably, the activator polypeptide is an activator antibody, preferably a P2RY2 agonist antibody.

[0045] Also preferably, the P2RY2 activity increasing compound is an indirect P2RY2 activity increasing compound, i.e., a compound that does not bind to P2RY2 but nevertheless increases P2RY2 activity. Preferably, the indirect P2RY2 activator is (i) a polypeptide comprising a P2RY2 polypeptide, (ii) a polynucleotide encoding a polypeptide comprising a P2RY2 polypeptide, (iii) a vector comprising the polynucleotide of (ii), (iv) a host cell comprising the polynucleotide of (ii) and / or the vector of (iii), or (v) any combination of (i)-(iv). However, the indirect P2RY2 activity increasing compound may also be an apyrase inhibitor, a nucleoside triphosphate phosphatase inhibitor, or a triphosphatase inhibitor.

[0046] Exemplary sequences of P2RY2 polypeptides and polynucleotides encoding P2RY2 are set forth hereinabove. Exemplary vectors, particularly expression vectors, suitable for containing a polynucleotide encoding a polypeptide, including a P2RY2 polypeptide, are also discussed hereinabove.

[0047] The term "T cell" is understood by those skilled in the art to refer to lymphocytes expressing at least one type of T cell receptor. Preferably, the T cell is a CD8+ T cell that recognizes MHC class I molecules on the surface of target cells, or a CD4+ T cell that recognizes MHC class II molecules on the surface of target cells, more preferably a CD8+ T cell. Preferably, the T cell is a cytotoxic T cell, more preferably a CD8+ cytotoxic T cell, which may also be called a "killer cell". Also preferably, the T cell is a regulatory T cell or a helper T cell, more preferably a regulatory T cell. Preferably, the T cell is reactive against cancer cells, i.e. a cancer-reactive T cell, or reactive against cells presenting T cell autoantigens, i.e. a T cell mediating an autoimmune disease. That is, preferably, the T cell expresses a TCR that recognizes a cancer antigen, preferably a cancer-specific antigen. Also preferably, the T cell expresses a TCR that recognizes an autoimmune T cell antigen, preferably a specific autoimmune T cell antigen. Preferably, the T cells are recombinant cells expressing a chimeric antigen receptor (CAR) and / or a recombinant T cell receptor. Methods for producing suitable recombinant T cells are known in the art.

[0048] The terms "treating" and "treatment" refer to the improvement of the disease or disorder referred to herein or symptoms associated therewith to a significant extent; as used herein, this term includes the prevention of the worsening of the disease, disorder, or symptoms associated therewith. As used herein, said treating also includes the complete restoration of health with respect to the disease or disorder referred to herein. As used herein, it should be understood that treating may not be effective in all subjects to be treated. However, this term will preferably require that a statistically significant portion of subjects suffering from the disease or disorder referred to herein can be successfully treated. Whether the portion is statistically significant can be determined by those skilled in the art without further ado using various well-known statistical evaluation tools, such as determining confidence intervals, determining p-values, Student's t-test, Mann-Whitney test, etc. Preferred confidence intervals are at least 90%, at least 95%, at least 97%, at least 98% or at least 99%. The p-value is preferably 0.1, 0.05, 0.01, 0.005, or 0.0001. Preferably, the treatment will be effective for at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the subjects of a given cohort or population. Preferably, treating comprises activating an immune response against disease-causing or mediating factors, i.e., against cancer cells; or in the case of autoimmune diseases, inhibiting an immune response against disease-causing or mediating host cells. Preferably, treating cancer is to reduce tumor and / or cancer cell burden in the subject. As will be understood by those skilled in the art, the effectiveness of a treatment, e.g., of cancer, depends on various factors, including, e.g., the stage of the cancer and the type of cancer. Also preferably, the cancer treatment further comprises at least one of surgery, chemotherapy, and radiation therapy.

[0049] The terms "preventing" and "prevention" refer to maintaining the health of a subject with respect to a disease or disorder as referred to herein for a certain period of time. It will be understood that the period of time may depend on the amount of drug compound administered and the subject's personal factors as discussed elsewhere herein. It should be understood that prevention may not be effective in all subjects treated with a compound according to the present invention. However, the term preferably requires that a statistically significant portion of the subjects of a cohort or population is effectively prevented from suffering from a disease or disorder as referred to herein or its associated symptoms. Preferably, in this context, a cohort or population of subjects is contemplated that would normally, i.e., develop a disease or disorder as referred to herein without the use of a preventive measure according to the present invention. Whether the portion is statistically significant can be determined without further ado by those skilled in the art using various well-known statistical evaluation tools as discussed elsewhere herein. In the context of cancer treatment, preventing particularly relates to preventing the occurrence of cancer, preventing the formation of metastases and / or preventing recurrence, preferably to preventing the formation of metastases and / or preventing recurrence.

[0050] The term "immunotherapy" as used herein relates to the treatment and / or prevention of disease, preferably cancer and / or autoimmune disease, by regulating the immune response of a subject. The regulation can be to induce, enhance or suppress the immune response, for example by administering a P2RY2 regulator, and optionally further at least one immune checkpoint regulator and / or cytokine, preferably an immune checkpoint inhibitor and / or cytokine. Preferably, in such a case, the cytokine is an interferon, an interleukin or a chemokine. The immunotherapy can also further comprise the administration of at least one T cell engager, i.e., a molecule that connects T cells to target cells; corresponding T cell engagers, such as bispecific T cell engagers (BiTEs), such as bispecific antibodies, are known in the art.

[0051] The term "T cell immunotherapy" relates to the therapy of diseases, including modulation of T cell activity, e.g. of cancer-specific T cells (cancer T cell immunotherapy); as used herein, the term modulation of T cell activity relates to modulation of the activity of T cells, preferably in a subject, which may involve modulation of the activity of T cells already present, e.g. in a subject, but may also include administration of enriched and / or genetically modified T cells to recognize a target of interest, preferably a cancer antigen. Thus, T cell immunotherapy may in particular be adoptive T cell immunotherapy, preferably including administration of tumor infiltrating lymphocytes (TIL), i.e. TIL therapy, and / or may include administration of genetically modified T cells, in particular genetically modified T cells expressing a chimeric antigen receptor (CAR) and / or a recombinant T cell receptor (TCR), i.e. engineered T cell immunotherapy. As will be understood by those skilled in the art from the disclosure herein, as specified herein, T cells are effector cells that mediate or contribute to T cell immunotherapy; however, the T cells are not necessarily target cells of the P2RY2 activity modulator; that is, the effect of the P2RY2 activity modulator may preferably be mediated via the effect of the P2RY2 activity modulator on the target cells of the T cells, e.g., cancer cells, and / or cells that present autoimmune T cell antigens.

[0052] Preferably, T cell immunotherapy further comprises at least one, preferably at least two, more preferably all three of administering an immune checkpoint inhibitor, administering a chemokine, and identifying the subject as suitable for T cell immunotherapy before treatment. More preferably, T cell immunotherapy comprises identifying the subject as suitable for T cell immunotherapy before treatment, or comprises identifying the subject as suitable for T cell immunotherapy before treatment and (i) administering an immune checkpoint inhibitor, (ii) administering a cytokine, and / or (iii) administering a T cell engager. However, T cell immunotherapy may also comprise in situ activation of the subject's existing T cells, thereby making administration of T cells unnecessary. Also, particularly in the case of cancer therapy, T cell immunotherapy may comprise isolating T cells, activating the T cells in vitro, and re-administering them to the same or different subject, preferably to the same subject (autologous treatment).

[0053] Preferably, the T cell immunotherapy is typically administered systemically, preferably orally or parenterally, for example by intravenous administration, or locally, preferably intratumorally, locally on the body surface, or by inhalation; in the case of cancer treatment, local administration may be localized within or around the tumor, and / or at the tumor resection site. However, administration may also be to a blood vessel, typically an artery, that is afferent to the intended site of action, such as a tumor. However, depending on the nature of the formulation and the desired therapeutic application, the medicament may also be administered by other routes. The T cell immunotherapy is preferably administered in a conventional dosage form, prepared by combining the drug with a standard pharmaceutical carrier according to conventional procedures. These procedures may include mixing, granulation, and compression, or dissolution of the ingredients to obtain the desired preparation, as appropriate.

[0054] The term "cancer" as used herein relates to a disease of animals, including humans, characterized by the uncontrolled growth of a group of somatic cells ("cancer cells"). This uncontrolled growth may involve invasion and destruction of surrounding tissues, and possibly the spread of cancer cells to other locations in the body. Preferably, the term cancer also includes recurrence of cancer. Thus, preferably, the cancer is a solid tumor, metastasis, or recurrence thereof. Preferably, the cancer is acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendiceal cancer, astrocytoma, atypical teratoid, or other tumor-associated tumors. teratoid), basal cell carcinoma, bile duct carcinoma, bladder cancer, brain stem glioma, breast cancer, Burkitt's lymphoma, carcinoid tumor, cerebellar astrocytoma, cervical cancer, chordoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct carcinoma, fibrosarcoma, gallbladder cancer, gastric cancer, gastrointestinal stromal tumor, gestational trophoblastic tumor, hairy cell leukemia, head and neck cancer, hepatocellular carcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic and optic tract glioma, intraocular melanoma, Kaposi's sarcoma, laryngeal cancer, medulloblastoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, multiple endocrine neoplasia syndrome, multiple myeloma, mycosis fungoides , nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, papillomatosis, paranasal and paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pituitary tumor, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sezary syndrome, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous cell cervical cancer, testicular cancer, throat cancer, thymic cancer, thymoma, thyroid cancer, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia, and Wilms' tumor. More preferably, the cancer is a solid tumor, a metastasis, or a recurrence thereof. More preferably, the cancer is glioblastoma, pancreatic ductal adenocarcinoma, osteosarcoma, or brain metastasis of a non-brain primary tumor.

[0055] The term "cancer antigen" relates to an antigen, preferably a polypeptide, expressed by cancer cells. Preferably, the cancer antigen is expressed at a rate at least 5-fold, preferably at least 10-fold, more preferably at least 25-fold lower in non-cancer cells. Preferably, the cancer antigen is not expressed in non-tumor cells of the same tissue in the subject, more preferably not expressed in non-cancer cells of the subject; that is, the cancer antigen is preferably a cancer-specific antigen. More preferably, the cancer antigen is a neoantigen and / or comprises a neoepitope expressed by the cancer cells. However, the cancer antigen may also be an antigen foreign to the subject, in particular a viral, bacterial or microbial antigen, preferably a cancer antigen. In particular viral cancer antigens are known in the art and include, for example, antigens derived from human papillomavirus E6 and E7 genes, Epstein-Barr virus LMP-1 protein, etc. Preferably, one or more peptides of a cancer antigen are presented via an MHC molecule, more preferably an MHC class I molecule, on the surface of a host cell that produces the cancer antigen as a "cancer epitope", which is preferably a cancer-specific epitope or, as specified above, a cancer-associated viral epitope and / or a cancer neoepitope.

[0056] The term "autoimmune T cell activation antigen" is known to those skilled in the art to refer to any antigen presented by the cells of a subject, the recognition of which causes, aggravates or contributes to an autoimmune disease, preferably a T cell-mediated autoimmune disease.T cell-mediated autoimmune diseases are known in the art; preferably, the T cell-mediated autoimmune disease is selected from the list consisting of multiple sclerosis, celiac disease, rheumatoid arthritis, type 1 diabetes, hypothyroidism and Addison's disease.

[0057] The definitions given above apply mutatis mutandis below. The additional definitions and explanations further given below also apply mutatis mutandis to all embodiments described herein.

[0058] Advantageously, in the research underlying the present invention, P2RY2 is found to be both a regulator of B7-H3 expression and an inhibitor of T cell activation, for example, against cancer cells.Therefore, it is found that the inhibition of P2RY2 improves the activity of T cells against cancer cells in both B7-H3-dependent and B7-H3-independent manners.In other words, it is found that the inactivation of P2RY2 removes two T cell inhibitory pathways and improves the efficacy of T cell immunotherapy.

[0059] The present invention also relates to a pharmaceutical composition comprising a P2RY2 activity modulator of the present invention for use in T cell immunotherapy.

[0060] The terms "medicament" and "pharmaceutical composition" are used essentially interchangeably herein and are known in principle to those skilled in the art. When referred to herein, these terms relate to any composition of matter that includes an active agent identified as a pharmacoactive compound and one or more excipients. The pharmacoactive compound may be present in liquid or dry form, for example in lyophilized form. It will be understood that the form and characteristics of an acceptable pharmaceutical excipient, such as a carrier or diluent, will be determined by the amount of active ingredient with which it will be combined, the route of administration, and other well-known variables. The excipient must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. The excipients used may include solids, gels, or liquids. Exemplary solid carriers are lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, stearic acid, and the like. Exemplary liquid carriers are phosphate buffered saline solution, physiological saline, Ringer's solution, dextrose solution, and Hank's solution, syrup, oil, water, emulsions, various kinds of wetting agents, and the like.Similarly, carriers or diluents can include time-delay materials known in the art, such as glyceryl monostearate or glyceryl distearate, alone or with wax.Suitable carriers include those mentioned above and others known in the art.See, for example, Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania.The excipient is selected so as not to affect the biological activity of the combination.However, the excipient may also be selected to improve the uptake of the active agent into host cells, particularly target cells.That is, the excipient may also be viral particles and / or lipid vesicles, preferably viral particles and / or lipid vesicles known to mediate entry into and / or fuse with the target cells of interest.

[0061] The medicament is preferably administered by the route as specified herein above. Therapeutically effective dose refers to the amount of effector polypeptide or expression construct encoding it to be used in the medicament to prevent, ameliorate or cure symptoms associated with the disease or condition referred to herein. The therapeutic efficacy and toxicity of a drug can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, such as ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index and can be expressed as the ratio LD50 / ED50. The dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical field, the dosage for any one patient depends on many factors, including the patient's size, age, the specific formulation of the medicament to be administered, sex, the time and route of administration, general health, and other drugs administered at the same time. The medicament referred to herein is preferably administered at least once, for example as a bolus. However, the medicament may be administered multiple times, preferably at least twice, for example, permanently or periodically after a specified time frame.Progress can be monitored by regular evaluation.Dosage recommendations can be indicated in prescriber or user instructions to anticipate dose adjustment according to the recipient considered.

[0062] In addition to the above-mentioned active agent, the medicament according to the present invention may also contain an additional active agent.Preferably, the pharmaceutical active compound according to the present invention should be applied together with at least one additional drug, that is, it may be formulated as a medicament together with this at least one additional drug.More preferably, in the case of cancer treatment, said at least one additional active agent is a chemotherapeutic agent or an additional immunotherapeutic agent, such as an immune checkpoint regulator; in the case of autoimmune disease treatment, said at least one additional active agent is preferably an anti-inflammatory agent.It should also be understood that the formulation of pharmaceutical composition is preferably carried out under GMP standardized conditions, etc., to ensure the quality, pharmaceutical safety and efficacy of the medicament.

[0063] The present invention further relates to the use of a P2RY2 activity modulator as identified herein above in the manufacture of a pharmaceutical composition for T cell immunotherapy.

[0064] The present invention also relates to a polynucleotide encoding the P2RY2 activity regulator of the present invention for use in T cell immunotherapy. As will be understood by those skilled in the art, the P2RY2 activity regulator encoded by the polynucleotide is preferably a polypeptide regulator or a polynucleotide regulator.

[0065] The present invention also relates to a vector comprising a polynucleotide encoding the P2RY2 activity regulator of the present invention for use in T cell immunotherapy.Suitable vectors are specified herein above, and expression vectors, particularly mammalian expression vectors, are preferred.

[0066] The present invention also relates to host cells comprising the P2RY2 activity modulators, polynucleotides, and / or vectors of the present invention for use in T cell immunotherapy.

[0067] As used herein, the term "host cell" refers to any cell capable of receiving and preferably maintaining a polynucleotide, vector, and / or P2RY2 activity modulator as specified herein above. Preferably, the host cell is capable of expressing a P2RY2 activity modulator encoded on an expression polynucleotide and / or expression vector as specified herein above. Also preferably, the host cell is a cell capable of providing a P2RY2 activity modulator, preferably to a target cell as specified herein below, for example by cell fusion, secretion, etc. That is, the host cell may also be a cell that produces a virus particle and / or liposome containing a P2RY2 activity modulator as specified herein. Preferably, the host cell is a eukaryotic cell, preferably an animal cell, such as an insect cell or a mammalian cell. More preferably, the host cell is a cell of a livestock, a companion animal, or an experimental animal. Most preferably, the host cell is a human cell. Preferred host cells for determining P2RY2 regulation of B7-H3 expression are the cell lines THP-1, U937, KBM7, and K562; preferred host cells for determining P2RY2 activity are the cell lines BxPC3, MCF7, and the host cells mentioned above for determining P2RY2 regulation of B7-H3; the above-mentioned cell lines are generally available from known commercial sources and line collections.

[0068] Preferably, the host cell is a target cell, and the term "target cell" as used herein refers to the host cell that is desired to regulate P2RY2 activity.The target cell can be any cell type that causes or contributes to disease, and in this case, it can also be called "disease-mediating cell"; that is, the target cell is preferably an immune cell, preferably a T cell, a monocyte, or a tissue macrophage.More preferably, the target cell is a cancer cell, and / or a cell that presents autoimmune T cell antigen.

[0069] The present invention also provides a method for identifying a subject suitable for T cell immunotherapy, comprising the steps of: (A) determining the activity of P2RY2 in a sample from the subject; (B) comparing the activity determined in step (B) to a reference; and (C) identifying a subject suitable for T cell immunotherapy based on the comparison of step (B). The present invention relates to a method comprising the steps of:

[0070] The method of the present invention is preferably an in vitro method.Moreover, the method can include steps in addition to those explicitly mentioned above.For example, further steps can be related to, for example, obtaining sample for step a) or determining the activity of P2RY2 in reference in step b).Moreover, one or more of the steps can be assisted or carried out by automated device.

[0071] The term "determining" as used herein means to quantitatively or semi-quantitatively determine an analyte by measuring at least one characteristic feature of the analyte to be determined in a sample. A characteristic feature according to the present invention is a feature that characterizes the physical and / or chemical properties, including biochemical properties, of the analyte. Such characteristics include molecular weight, for example determined by mass spectrometry; nucleic acid sequence, for example determined by sequencing; ability to react with other compounds, in particular hybridization to one or more probe or primer oligonucleotides, for example as specified herein below, or activation of downstream components in a signal transduction pathway; ability to trigger a response in a biological readout system (e.g. induction of a reporter gene), and the like. Values ​​for the above-mentioned characteristics may serve as characteristic features and can be determined by techniques well known in the art. Moreover, the determined value can be any value that can be obtained from the value of the physical and / or chemical property of the analyte by standard operations, for example mathematical calculations such as multiplication, division or logarithmic calculation methods. Preferably, the determined value for a is a normalized value, for example a value normalized to a control analyte.

[0072] The term "activity of P2RY2" refers to the activity of P2RY2 polypeptide in cells, preferably signal transduction, particularly G protein receptor signal transduction.Thus, the activity of P2RY2 may be determined by determining the activity and / or amount of P2RY2 in cells, but also by determining the activity and / or amount of activated signal transduction molecules downstream of P2RY2, particularly the product of, for example, phosphatidylinositol-calcium second messenger system, particularly the intracellular calcium concentration.Preferably, determining the activity of P2RY2 is determining the amount of P2RY2.

[0073] The method for identifying subjects suitable for T cell immunotherapy may further comprise determining the activity of B7-H3 (also called B7 homolog 3, CD276). Human B7-H3 preferably has the amino acid sequence of Genbank accession number NP_001019907.1 or a variant thereof, and is preferably encoded by a polynucleotide comprising the nucleic acid sequence of Genbank accession number NM_001024736.2 or a variant thereof. The activity of B7-H3 may be determined by determining its immune checkpoint activity and / or by determining the amount of B7-H3 in cells, and is preferably determined by determining the amount of B7-H3. As referred to herein, the method for identifying subjects suitable for T cell immunotherapy does not include the step of determining only B7-H3.

[0074] The term "comparing" as used herein includes comparing the activity contained in the sample with the activity in a suitable reference as specified elsewhere herein. Comparing may also include calculating a score. Comparing as referred to herein should be understood to mean the comparison of corresponding parameters or values, for example, the absolute amount of a polypeptide is compared to an absolute reference amount; the concentration of a polypeptide is compared to a reference concentration; or the activity is compared to the same type of activity in a reference, and the score is compared to a reference score, etc. The comparison referred to in the method of the present invention may be performed manually or may be computer-assisted. In the case of computer-assisted comparison, the determined value may be compared to the value corresponding to a suitable reference stored in a database by a computer program. The computer program may further evaluate the result of the comparison by a specialized system. Thus, the result of the identification referred to herein may be automatically provided in a suitable output format.

[0075] The term "reference", "reference value", "reference amount" or "reference score" as used herein means an activity, amount and / or value obtained therefrom that allows to evaluate whether the subject from which the sample is derived is suitable for T cell immunotherapy. A suitable reference may be determined from a reference subject, preferably a population of reference subjects, before, simultaneously with or after the sample. Preferably, the reference is a predefined reference that can be stored, for example, in a database. Also preferably, the reference is a fixed value or range of values ​​for all subjects to be tested.

[0076] References can be calculated for groups or cohorts of subjects as specified herein, in principle, based on the mean or median value for a given analyte, by applying standard methods of statistics. The accuracy of a test, such as a method that is particularly intended to predict whether an event will occur, is best described by its receiver operating characteristics (ROC) (see, in particular, Zweig (1993), Clin. Chem. 39:561). Preferably, reference amounts, as used herein, are derived from a sample of a population of subjects whose donors are known to be suitable for T-cell immunotherapy. This reference can be a discrete value or a range of values. The reference can preferably be derived from a subject or a group of subjects known to be suitable for T-cell immunotherapy; in such a case, preferably, P2RY2 activity that is essentially equal or decreased compared to the reference indicates a subject that is suitable for T-cell immunotherapy, while activity that is increased compared to the reference indicates a subject that is not suitable for T-cell immunotherapy. Reference may also preferably be derived from a subject or group of subjects that are later known to be unsuitable for T cell immunotherapy; in such a case, preferably, P2RY2 activity that is essentially equal or increased compared to the reference indicates a subject that is unsuitable for T cell immunotherapy, while activity that is decreased compared to the reference indicates a subject that is suitable for T cell immunotherapy. It should be understood that the above-mentioned activity may vary due to statistical and measurement errors. Deviation, i.e., decrease or increase in activity referred to herein, is preferably a statistically significant deviation, i.e., a statistically significant decrease or a statistically significant increase. On the other hand, the number of samples, especially from the subject under evaluation, and therefore under statistical evaluation, may not be possible or may be considered unnecessary.

[0077] The term "subject" as referred to herein relates to a vertebrate, preferably a mammal, in particular a livestock, companion animal, or laboratory animal. Most preferably, the subject is a human. Preferably, the subject has been diagnosed as suffering from cancer or an autoimmune disease as specified herein above.

[0078] The term "sample" refers to a sample of a body fluid, preferably a sample of blood, plasma, serum, saliva, sputum, urine, or a sample containing separated cells, or a sample from a tissue or organ, more preferably a cancer sample, in particular a tumor or metastasis sample, which may be obtained, for example, by biopsy. Separated cells may be obtained from a body fluid, such as lymph, blood, plasma, serum, liquor, etc., or from a tissue or organ by separation techniques such as centrifugation or cell sorting. Preferably, the sample is a tissue or body fluid sample, more preferably, the sample is a body fluid sample, preferably a blood sample, serum, or plasma sample, most preferably a serum sample. More preferably, the sample is a sample known to contain cancer cells or suspected to contain cancer cells. The sample may be obtained from a subject by routine techniques well known to those skilled in the art, such as venous or arterial puncture, or incisional biopsy, which includes aspiration of tissue or cellular material from the subject. For areas not easily accessible by incisional biopsy, surgery, preferably minimally invasive surgery, can be performed.

[0079] The present invention also provides a method of treating a subject suffering from an immune-compromising disease, comprising: (i) contacting the subject with a P2RY2 activity modulator; and (ii) thereby treating an immune-compromising disease. The present invention relates to a method comprising the steps of:

[0080] The term "immune-compromising disease" as used herein includes any disease in which immune response contributes to the severity of the disease, and the contribution of immune response may be, for example, in cancer, a decreased immune response compared to a reference, or, for example, in autoimmune disease, an increased immune response compared to a reference. Thus, those skilled in the art will select an appropriate P2RY2 activity modulator to achieve the desired effect in view of the description herein.

[0081] The present invention also provides a method for identifying a P2RY2 activity modulator, comprising the steps of: (I) contacting a host cell with a candidate compound suspected to be a P2RY2 activity modulator; (II) determining B7-H3 activity in the host cell; (III) comparing the B7-H3 activity determined in step (II) to a control; and (IV) identifying a P2RY2 activity modulator based on the comparison in step (III). The present invention relates to a method comprising the steps of:

[0082] The term "B7-H3 activity" refers to the activity, preferably signal transduction, of B7-H3 polypeptide in a cell. Thus, the activity of B7-H3 may be determined by determining the activity and / or amount of B7-H3 in a cell, but may also be determined by determining the activity and / or amount of activated signal transduction molecules downstream of B7-H3, as specified elsewhere herein. Preferably, determining B7-H3 activity is determining the amount of B7-H3.

[0083] The term "control" will be understood by those of skill in the art; preferably, the control is the determination of B7-H3 in host cells that have not been treated with a candidate compound suspected to be a modulator of P2RY2 activity, but which are preferably otherwise similarly treated. As will be understood by those of skill in the art, if the B7-H3 activity determined in host cells treated with a candidate compound suspected to be a modulator of P2RY2 activity differs from the B7-H3 activity determined in untreated (control) host cells, a modulator of P2RY2 activity is identified.

[0084] The present invention also relates to a P2RY2 activity modulator, and a kit comprising (i) a means for determining P2RY2 activity and / or B7-H3 activity in a sample, and (ii) a B7-H3 activity modulator.

[0085] The term "kit" as used herein means a collection of the above-mentioned compounds, means or reagents, which may or may not be packaged together. The components of the kit may be included by separate vials (i.e. as a kit of separate parts) or may be provided in a single vial, for example as a composition as specified herein above. The housing of the kit, in some embodiments, allows the transfer of the components of the kit, in particular a general transfer; that is, the housing may be a transportable container that includes all the components, in particular, as specified. Furthermore, it should be understood that the kit of the present invention may be used for the implementation of the methods mentioned herein above. In some embodiments, it is contemplated that all the components are provided in a ready-to-use format to implement the methods mentioned above. Furthermore, the kit preferably includes instructions for implementing the methods. The instructions may be provided by a user manual in paper or electronic form. For example, the manual may include instructions for interpreting the results obtained when implementing the above-mentioned methods using the kit. Preferably, the kit includes additional compounds such as reaction buffers, hybridization solutions, lysis buffers, etc. Preferably, the kit is adapted for use in the method of the invention, and more preferably is adapted to contain all the reagents required to carry out the method.

[0086] In view of the above, the following embodiments are specifically contemplated:

[0087] Embodiment 1: A P2Y purinergic receptor 2 (P2RY2) activity modulator for use in T cell immunotherapy.

[0088] Embodiment 2: A P2RY2 activity modulator for use according to embodiment 1, wherein said T cell immunotherapy is adoptive T cell immunotherapy, preferably tumor infiltrating lymphocyte (TIL) therapy, and / or engineered T cell immunotherapy, in particular chimeric antigen receptor (CAR) and / or recombinant T cell receptor immunotherapy.

[0089] Embodiment 3: A P2RY2 activity modulator for use according to embodiment 1 or 2, wherein the P2RY2 modulator is a P2RY2 activity reducing compound.

[0090] Embodiment 4: A P2RY2 activity modulator for use according to any one of embodiments 1 to 3, wherein the T cell immunotherapy is cancer T cell immunotherapy, preferably further comprising at least one of administration of an immune checkpoint inhibitor, administration of a cytokine, administration of a T cell engager, and identifying the subject as suitable for T cell immunotherapy, preferably according to any one of embodiments 28 to 30.

[0091] Embodiment 5: A P2RY2 activity modulator for use according to any one of embodiments 1 to 4, wherein the P2RY2 activity reducing compound increases T cell anticancer activity in vitro and / or in vivo.

[0092] Embodiment 6: A P2RY2 activity modulator for use according to any one of embodiments 1 to 5, wherein the P2RY2 activity reducing compound is a direct P2RY2 activity reducing compound that specifically binds to P2RY2 and inhibits P2RY2.

[0093] Embodiment 7: A P2RY2 activity modulator for use according to any one of embodiments 1 to 6, wherein the directly P2RY2 activity decreasing compound is a small molecule inhibitor, an inhibitor polypeptide, an inhibitor polynucleotide, or a non-polypeptide non-polynucleotide inhibitor polymer.

[0094] Embodiment 8: The P2RY2 activity modulator for use according to embodiment 7, wherein the small molecule inhibitor is AR-C 118925XX (CAS number: 216657-60-2).

[0095] Embodiment 9: A P2RY2 activity modulator for use according to embodiment 7, wherein said inhibitor polypeptide is selected from the list consisting of an antibody, an aptamer, anticalin, and a designed ankyrin repeat protein (DARPin).

[0096] Embodiment 10: A P2RY2 activity modulator for use according to embodiment 7, wherein the inhibitor polynucleotide is a polynucleotide aptamer.

[0097] Embodiment 11: A P2RY2 activity modulator for use according to any one of embodiments 1 to 5, wherein the P2RY2 activity reducing compound is an indirect P2RY2 activity reducing compound that reduces the amount of P2RY2 in a target cell.

[0098] Embodiment 12: The P2RY2 activity modulator for use according to embodiment 11, wherein the indirect P2RY2 activity reducing compound is selected from the list consisting of shRNA, siRNA, miRNA agent, antisense oligonucleotide, ribozyme, and CRISPR / Cas oligonucleotide, preferably a CRISPR / Cas oligonucleotide pair.

[0099] Embodiment 13: A P2RY2 activity modulator for use according to any one of embodiments 1 to 12, wherein the P2RY2 activity modulator is administered locally, preferably intratumorally.

[0100] Embodiment 14: A P2RY2 activity modulator for use according to any one of embodiments 1 to 3, wherein the P2RY2 modulator is a P2RY2 activity increasing compound.

[0101] Embodiment 15: A P2RY2 activity modulator for use according to embodiment 14, wherein the immunotherapy is immunotherapy for an autoimmune disease.

[0102] Embodiment 16: A P2RY2 activity modulator for use according to embodiment 14 or 15, wherein the P2RY2 activity increasing compound is a direct P2RY2 activity increasing compound that binds to P2RY2 and increases the activity of P2RY2.

[0103] Embodiment 17: A P2RY2 activity modulator for use according to any one of embodiments 14 to 16, wherein the P2RY2 activity increasing compound is a small molecule activator, an activator polypeptide, an activator polynucleotide, or a non-polypeptide non-polynucleotide activator macromolecule.

[0104] Embodiment 18: The P2RY2 activity modulator for use according to embodiment 17, wherein the small molecule activator is a nucleotide or a derivative thereof, preferably ATP or UTP or a derivative thereof, more preferably MRS 2768 (uridine-5'-tetraphosphate delta-phenyl ester, CAS number: 1047980-83-5), uridine-5'-(gamma-thio)-triphosphate (CAS number: 1266569-94-1), 4-thiouridine-5'-O-(beta,gamma-difluoromethylene)triphosphate (CAS number: 1657025-60-9), denufosol (CAS number: 211448-85-0), or diquafosol (CAS number: 59985-21-6).

[0105] Embodiment 19: A P2RY2 activity modulator for use according to embodiment 17, wherein the activator polypeptide is a P2RY2 agonist, preferably a P2RY2 agonist antibody.

[0106] Embodiment 20: A P2RY2 activity modulator for use according to embodiment 14 or 15, wherein the P2RY2 activator is an indirect P2RY2 activator that increases the amount of P2RY2 in a target cell.

[0107] Embodiment 21 : The indirect P2RY2 activator is (i) a polypeptide comprising a P2RY2 polypeptide, (ii) a polynucleotide encoding a polypeptide comprising a P2RY2 polypeptide; (iii) a vector comprising the polynucleotide of (ii), (iv) a host cell comprising the polynucleotide of (ii) and / or the vector of (iii); or (v) Any combination of (i) to (iv). A P2RY2 activity modulator for use according to embodiment 20, which is

[0108] Embodiment 22: The P2RY2 activity modulator for use according to embodiment 20, wherein the vector is a virus.

[0109] Embodiment 23: A pharmaceutical composition comprising a P2RY2 activity modulator as defined in any one of embodiments 5 to 22 for use in T cell immunotherapy.

[0110] Embodiment 24: Use of a P2RY2 activity modulator as defined in any one of embodiments 5 to 22 in the manufacture of a pharmaceutical composition for T cell immunotherapy.

[0111] Embodiment 25: A polynucleotide encoding a P2RY2 activity modulator as defined in any one of embodiments 5 to 22 for use in T cell immunotherapy.

[0112] Embodiment 26: A vector comprising the polynucleotide of embodiment 25 for use in T cell immunotherapy.

[0113] Embodiment 27: A host cell comprising a P2RY2 activity modulator as defined in any one of embodiments 5 to 22, a polynucleotide as defined in embodiment 25, and / or a vector as defined in embodiment 26, for use in T cell immunotherapy.

[0114] Embodiment 28: A method for identifying a subject suitable for T cell immunotherapy, comprising: (A) determining the activity of P2RY2 in a sample from the subject; (B) comparing the amount determined in step (B) to a reference; and (C) identifying a subject suitable for T cell immunotherapy based on the comparison of step (B). A method comprising:

[0115] Embodiment 29: The method of embodiment 28, wherein the reference is derived from (i) a subject or group of subjects known to be suitable for immunotherapy, or (ii) a subject or group of subjects known to be not suitable for immunotherapy.

[0116] Embodiment 30: The method of embodiment 28 or 29, wherein determining the activity comprises determining the amount of P2RY2, and / or the amount of at least one of its downstream signaling molecules, preferably intracellular calcium concentration.

[0117] Embodiment 31: A method of treating a subject suffering from an immune-compromising disease, comprising: (a) contacting the subject with a P2RY2 activity modulator; and (b) thereby treating an immune-compromising disease. A method comprising:

[0118] Embodiment 32: The method of embodiment 31, wherein the immune-compromising disease is cancer or an autoimmune disease.

[0119] Embodiment 33: A method for identifying a P2RY2 activity modulator, comprising: (I) contacting a host cell with a candidate compound suspected to be a P2RY2 activity modulator; (II) determining B7-H3 activity in the host cell; (III) comparing the B7-H3 activity determined in step (II) to a control; and (IV) identifying a P2RY2 activity modulator based on the comparison in step (III). A method comprising:

[0120] Embodiment 34: A kit comprising a P2RY2 activity modulator and (i) a means for determining P2RY2 activity and / or B7-H3 activity in a sample, and (ii) a B7-H3 activity modulator.

[0121] Embodiment 35: The subject matter of any one of embodiments 23 to 33, wherein the T cell immunotherapy is a T cell immunotherapy comprising administration of at least one P2RY2 activity modulator, preferably further comprising at least one of administration of an immune checkpoint inhibitor, administration of a cytokine, and administration of a T cell engager.

[0122] All references cited herein are incorporated herein by reference with respect to their entire disclosure content and the disclosure content specifically mentioned herein. EXAMPLES

[0123] The following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the present invention in any way.

[0124] Example 1: Flow cytometry-based CRISPR-Cas9 screening for modulators of B7-H3 To identify novel regulators of B7-H3, we used a forward genetics screening approach in human THP-1 cells, which spontaneously express B7-H3 on the cell surface at antibody-detectable levels.

[0125] We introduced a genome-wide CRISPR knockout library (Doench et al., Nat Biotechnol 34, 184-191 (2016)) into THP-1 cells by lentiviral transduction to generate pools of mutant cells, selected the transduced cells, expanded the cells, and incubated them with an antibody specific for the B7-H3 protein. The pools of cells incubated with the antibody give an approximately normal distribution of signal intensities when analyzed by flow cytometry. Using fluorescence-activated cell sorting (FACS), we separately isolated Cas9 / sgRNA-modified cells that showed particularly strong or particularly weak B7-H3 signals, and then compared the sgRNA abundance in both cell pools (Figure 1).

[0126] material and method To generate a genome-wide mutant library in THP-1 cells, Cas9-expressing THP-1 clones (cl35) were lentivirally transduced with the Human Brunello CRISPR Genome-Wide Knockout Library (Doench et al., Nat Biotechnol 34, 184-191 (2016)) in the lentiGuide-Puro vector at 1,500-2,000-fold coverage and approximately 40% infection rate, and cells were selected with 1.0 μg ml-1 puromycin for at least 10 days. To screen for regulators of B7-H3 expression on THP-1 cells, 3 × 10 8 Library cells were harvested, washed once with PBS, and stained with Near-IR Dead Cell Stain (ThermoFisher) in PBS for 10 min at 4° C. protected from light. After washing twice in PBS containing 0.5% (w / v) BSA (Sigma) and 0.2% (w / v) sodium azide (Sigma) (FACS buffer), cells were cultured at 1 × 10 cells / mL for 10 min at 4° C. protected from light. 7 0.1 μg ml in FACS buffer at a concentration of 10 cells / ml -1 After washing twice with FACS buffer, cells were stained with unconjugated anti-B7-H3 MIH42 (Biolegend) at a dilution of 2 μg ml in FACS buffer at 4° C., protected from light. -1 The cells were stained with AF488-conjugated goat anti-mouse IgG antibody (A28175, ThermoFisher) at a dilution of 1:1 for 30 min. After washing twice with FACS buffer, the cells were fixed using IC Fixation Buffer (eBioscience) according to the manufacturer's protocol. The cells were then passed through a 40 μm strainer (BD Falcon) and subjected to a FACS sorter to separately collect the cell populations exhibiting the highest and lowest B7-H3 signals, both of which constituted approximately 5–10% of the total cell pool.

[0127] The two sorted cell populations were pelleted by centrifugation (2,000 rpm, 10 min) and subjected to genomic DNA isolation using the Qiagen DNA mini kit (Qiagen). Since the cells were fixed, the cell pellets were resuspended in PBS to facilitate decrosslinking and incubated at 56°C on a Thermomixer (Eppendorf) for at least 12 h after addition of proteinase K and buffer AL (Qiagen). DNA was isolated according to the manufacturer's instructions and the concentration of DNA was determined by a Nanodrop2000 spectrophotometer (Thermo Fisher). The gRNA integrated into the genomic DNA of the sorted cell populations was amplified separately by two-step PCR using NEBnext High Fidelity Master Mix (New England Biolab) with the following primer sets:

[0128] Step #1 PCR: forward primer (ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAGCCGGCTTTATATATCTTGTGGAAAGGACG (SEQ ID NO: 1) or ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACAAGGGCTTTATATATCTTGTGGAAAGGACG (SEQ ID NO: 2)) and reverse primer (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACTGACGGGCACCGGAGCCAATTCC (SEQ ID NO: 3));

[0129] Step #2 PCR: Forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT SEQ ID NO: 4) and reverse primer (CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 5)).

[0130] Cycling conditions for PCR#1: 98°C for 30 sec, 18x (98°C for 10 sec, 60°C for 30 sec, 72°C for 30 sec), 72°C for 2 min, 4°C termination. PCR#1 products from each sorted cell population were pooled and 4x2 μl of the pooled PCR product was used as template in 4x50 μl PCR#2 reactions. Cycling conditions for PCR#2: 98°C for 30 sec, 12x (98°C for 10 sec, 60°C for 30 sec, 72°C for 30 sec), 72°C for 2 min, 4°C termination. PCR#2 products were purified using the QIAquick PCR purification kit (Qiagen) according to the manufacturer's instructions. The resulting PCR amplicons were analyzed by Bioanalyzer (Agilent) and samples were pooled in equimolar amounts and sequenced by HiSeq 2500 (Illumina, high output mode, single-read, 65 bp) and analyzed by MAGeCK (Li et al., Genome Biology. 2014).

[0131] result The results of the genetic screen for regulators of surface B7-H3 expression in THP-1 cells are shown in Figure 1. As expected, sgRNAs targeting the CD276 gene, which encodes B7-H3 itself, were highly enriched in B7-H3low cells, confirming the reliability of the genetic screen. Furthermore, the screen identified P2RY2, which encodes the purinergic receptor P2RY2, as a positive regulator of B7-H3.

[0132] Example 2: P2RY2 and B7-H3 Expression We set out to validate the involvement of P2RY2 in regulating surface B7-H3 levels by transducing various cell lines with a lentiviral vector encoding Cas9 and an sgRNA targeting the P2RY2 gene.

[0133] material and method THP-1, U937, K562, and KBM7 cells were transduced with a lentiviral vector encoding Cas9 together with a blasticidin S resistance cassette (blasticidin D deaminase). One day after transduction, cells were selected with 50 micrograms / milliliter of blasticidin S hydrochloride for 72 to 48 hours. Surviving cells were then transduced with one of the lentiviral vectors encoding sgRNAs targeting the sequences 5'-CTGGTCTATTACTACGCCCG-3' (SEQ ID NO: 6) and 5'-TGGGCTGTGTCTGAACGCCG-3' (SEQ ID NO: 7) on the coding strand of the P2RY2 gene together with a puromycin resistance cassette (puromycin N-acetyltransferase). One day after transduction, cells were selected with 2 micrograms / milliliter of puromycin dihydrochloride for 48 to 96 hours. Selected cells were expanded, subjected to genomic DNA isolation and analyzed for deleterious editing of the P2RY2 locus by PCR (using primers 5'-GATGAGCTGGGCTACAGGTG-3' (SEQ ID NO: 8) and 5'-GTCGTAAGACGCCCAGACAC-3' (SEQ ID NO: 9)) and Sanger sequencing of the PCR products using primers 5'-GATGAGCTGGGCTACAGGTG-3' (SEQ ID NO: 8) for sgRNA (5'-CTGGTCTATTACTACGCCCG-3', SEQ ID NO: 6) transduced cells and 5'-GTCGTAAGACGCCCAGACAC-3' (SEQ ID NO: 9) for sgRNA (5'-TGGGCTGTGTCTGAACGCCG-3', SEQ ID NO: 7) transduced cells.

[0134] Polyclonal cells transduced with Cas9 and sgRNA targeting P2RY2, and wild-type cells were cultured in the absence or presence of ATP or UTP (ligands for P2RY2, Sigma) for 24 h, stained with anti-B7-H3 antibody, and analyzed by flow cytometry.

[0135] result CRISPR / Cas9-mediated knockout of P2RY2 resulted in a decrease in B7-H3 surface levels in THP-1, U937, K562, and KBM7 cells (Figure 2). P2RY2 has previously been identified as a receptor for extracellular ATP and UTP (Burnstock et al., Purigergic Signal 9, 491-540 (2013)). We then stimulated P2RY2-proficient cells with ATP or UTP and observed a dose-dependent increase in B7-H3 expression (Figure 3). Notably, ATP is present in very high concentrations in the tumor stroma but at much lower concentrations in healthy tissues (Di Virgilio et al., Oncogene 36, 293-303 (2017);Kepp et al., Immunol Rev. 280(1): 83-92 (2017);Pellegatti et al., PLOS one 3(7): e2599 (2008)). We next tested whether P2RY2 regulates ATP-induced B7-H3 surface expression and observed that disrupting P2RY2 suppressed ATP-induced B7-H3 expression (Figure 2).

[0136] Example 3: P2RY2 and T cell activity material and method MART-1 specific T cells were generated as described (Mezzadra et al., Nature 549, 106-110 (2017); Jorritsma et al., Blood 110 (10): 3564-3572. (2007)). To generate CD33 specific chimeric antigen receptor (CAR) T cells, the CD33Hul95-CD28Z CAR (described in WO 2019 / 178382) cassette was cloned into a retroviral vector and the resulting virus was used to transduce T cells as described (Mezzadra et al., Nature 549, 106-110 (2017); Jorritsma et al., Blood 110 (10): 3564-3572. (2007)).

[0137] For cancer cells that endogenously express HLA-A2, including THP-1 and MCF7, the MART-1 epitope was loaded into the cancer cells by incubation of the modified MART-1 peptide (ELAGIGILTV, SEQ ID NO: 12) with the cells or by lentiviral transduction. In the latter case, a gene fragment encoding the MART-1 epitope (ELAGIGILTV, SEQ ID NO: 12) followed by P2A-RFP was cloned into a lentiviral vector and the resulting virus was used to transduce the cancer cells. For cancer cells that do not express endogenous HLA-A2, including BxPC3 cells, a gene fragment encoding the MART-1 epitope (ELAGIGILTV, SEQ ID NO: 12) followed by P2A-HLA-A2 / B2M was cloned into a lentiviral vector and the resulting virus was used to transduce the MART-1 epitope by transduction. + Cancer cells were generated.

[0138] Cas9 and sgRNAs targeting P2RY2 (5'-CTGGTCTATTACTACGCCCG-3' (SEQ ID NO: 6) and 5'-TGGGCTGTGTCTGAACGCCG-3' (SEQ ID NO: 7)), CD276 (5'-CACAGGGCAACGCATCCCTG-3', SEQ ID NO: 10), or both were introduced into cancer cells by lentiviral transduction as described in Example 2. An sgRNA (5'-GTATTACTGATATTGGTGGG-3', SEQ ID NO: 11) that does not recognize any sequence in the human genome served as a control. The open reading frames of the transcripts of P2RY2 (ENST00000393597.7) or CD276 (ENST00000318443.10) were ordered as codon-optimized gBlock Gene Fragments (Integrated DNA Technologies or Twist Bioscience) and cloned into lentiviral vectors containing a blasticidin selection cassette. The construct was verified by Sanger sequencing.

[0139] MART1-specific CD8+ T cells and MART1 epitope-expressing cancer cells were mixed at a ratio of 1:16 to 1:4. The cells were then centrifuged at 1,600 g for 3 min and incubated at 37°C and 5% CO2 for 12 to 72 h. T cell activation was assessed by surface staining with anti-CD137-BV421 (4-1BB, Biolegend), anti-CD69-APC / Fire™ 750 (FN50, Biolegend), anti-CD25-AF700 (BC96, Biolegend) antibodies, and intracellular staining with anti-IL-2-PE / Cy7 (MQ1-17H12, Biolegend), anti-IFN-γ-BV421 (4S.B3, Biolegend), anti-TNF-α-BV785 (MAb11, Biolegend) antibodies, followed by flow cytometry analysis. For intracellular staining, Brefeldin A (Biolegend) was added to cell culture medium 4 hours before harvesting the cells. Viability of cancer cells growing in suspension, including THP-1 cells, was assessed by flow cytometry-based absolute cell counting using AccuCount beads (Spherotech). For adherent cancer cells, including BxPC3 and MCF7, cell viability was quantified using the CellTiter-Blue Cell Viability Assay (Promega).

[0140] result To determine the effect of P2RY2 on T cells and cancer cells in an in vitro model of T cell-based immunotherapy, we engineered peripheral blood-derived human T cells with CD33-specific CAR or MART-1-specific TCR and assessed T cell activation in the presence of antigen-expressing cancer cells carrying Cas9 / sgRNA targeting P2RY, B7-H3, or both, or overexpressing P2RY2 or B7-H3. When CD33-specific CAR-transduced T cells were co-cultured with THP-1 cells that endogenously express CD33, P2RY2 and B7-H3 deletion in THP-1 cells led to increased T cell activation as evidenced by increased expression of T cell activation markers CD25, CD69, and CD137 in CD3+CD8+ T cells, and also increased production of the cytokines IFNγ, IL-2, and TNFα. In contrast, overexpression of either P2RY2 or B7-H3 in tumor cells impaired CD3+CD8+ T cell activation and cytokine production (Figure 4). Furthermore, in CD3+CD8- T cell populations, individual deletion of P2RY2- or B7-H3 in THP-1 cells led to increased expression of T cell activation markers, including CD25, IFNγ, IL-2, and TNFα, whereas overexpression of P2RY2 or B7-H3 reduced T cell activation (Figure 5).

[0141] Notably, simultaneous deletion of P2RY2 and B7-H3 in THP-1 increased the expression of these T cell activation markers (CD25, IFNγ, IL-2, and TNFα) to higher levels than individual deletion of P2RY2 or B7-H3 in both CD3+CD8+ and CD3+CD8- T cells (Figures 4, 5). Similar effects were observed in cocultures of MART-1-specific TCR-transduced T cells with MART-1 epitope-transduced BxPC3 cells (Figure 6).

[0142] Consistent with these data, disruption of P2RY2 or B7-H3 in cancer cells led to increased tumor cell killing by tumor-reactive CAR-T or TCR-T cells in myeloid leukemia cell (THP-1), pancreatic cancer cell (BxPC3), and breast cancer cell (MCF7) models. Furthermore, combined deletion of P2RY2 and B7-H3 significantly improved the tumor-killing efficacy of T cells. In contrast, overexpression of P2RY2 or B7-H3 in cancer cells conferred resistance to tumor-reactive T cells (Figure 7). These results suggest that P2RY2 suppresses T cell activation through both B7-H3-dependent and B7-H3-independent mechanisms and that combined deletion of P2RY2 and B7-H3 further improves T cell-mediated anticancer efficacy than deletion of either molecule alone.

[0143] Furthermore, we found that pharmacological inhibition of P2RY2 using an inhibitory tool compound (AR-C 118925XX) increased the production of IFNγ and TNFα by T cells and reduced the viability of P2RY2-proficient THP-1 cells when CD33-specific CAR-transduced T cells were co-cultured with THP-1 cells (Figure 8). Furthermore, upon deletion of P2RY2, AR-C 118925XX did not affect the production of IFNγ and TNFα in T cells or the viability of tumor cells in CAR-T cell-THP-1 cell co-culture assays, demonstrating that this compound functions through P2RY2. In contrast, a P2RY2 agonist (Diquafosol) confers resistance to T cell-mediated cytotoxicity in THP-1 cells (Figure 9).

[0144] In addition to simultaneous inhibition of P2RY2 and B7-H3 immune checkpoints, we tested the combination of P2RY2 inhibitors with blocking antibodies of the PD-L1-PD-1 immune checkpoint. When MART-1-specific TCR-transduced T cells were cultured in the presence of MART-1 epitope-transduced BxPC3 cells, inhibition of P2RY2 with AR-C 118925XX or blockade of the PD-L1-PD-1 immune checkpoint with atezolizumab or durvalumab increased the expression of CD137, CD69, and CD25 on T cells, while combined P2RY2 and PD-L1 inhibition further increased the expression of T cell activation markers (Figure 10). Consistent with this, P2RY2 inhibition with AR-C 118925XX or PD-L1 blockade with atezolizumab or durvalumab enhanced the tumoricidal effect of T cells as evidenced by reduced viability of BxPC3 cells, while combined P2RY2 and PD-L1 inhibition led to improved antitumor efficacy compared to both individual treatments (Figure 11).

[0145] Taken together, these data demonstrate that P2RY2 expression on cancer cells inhibits both T cell activation and T cell-mediated cytotoxicity, and that modulation of P2RY2 activity can be exploited to modulate T cell activity in immunotherapy.

[0146] Example 4: P2RY2 and T cell activity (Figures 12-20) material and method MART-1 specific T cells were generated as described (Mezzadra et al., Nature 549, 106-110 (2017); Jorritsma et al., Blood 110 (10): 3564-3572. (2007)). To generate CD33-specific chimeric antigen receptor (CAR) T cells and CEA-specific CAR-T cells, the CD33Hul95-CD28Z CAR (described in WO 2019 / 178382) cassette and the MFE-23 (described in US20050147614A1)-CD28Z CAR were cloned separately into retroviral vectors and the resulting viruses were used to transduce T cells as described (Mezzadra et al., Nature 549, 106-110 (2017); Jorritsma et al., Blood 110 (10): 3564-3572. (2007)).

[0147] For cancer cells that endogenously express HLA-A2, including THP-1, MDA-MB-231 and MCF7, the MART-1 epitope was loaded into the cancer cells by incubation of the modified MART-1 peptide (ELAGIGILTV, SEQ ID NO: 12) with the cells or by lentiviral transduction. In the latter case, a gene fragment encoding the MART-1 epitope (ELAGIGILTV, SEQ ID NO: 12) followed by P2A-RFP was cloned into a lentiviral vector and the resulting virus was used to transduce the cancer cells. For cancer cells that do not express endogenous HLA-A2, including BxPC3 and MIA PaCa-2 cells, a gene fragment encoding the MART-1 epitope (ELAGIGILTV, SEQ ID NO: 12) followed by P2A-HLA-A2 / B2M was cloned into a lentiviral vector and the resulting virus was used to transduce the MART-1 epitope by transduction. + Cancer cells were generated.

[0148] Cas9 and sgRNAs targeting P2RY2 (5'-CTGGTCTATTACTACGCCCG-3' (SEQ ID NO: 6) and 5'-TGGGCTGTGTCTGAACGCCG-3' (SEQ ID NO: 7)), CD276 (5'-CACAGGGCAACGCATCCCTG-3', SEQ ID NO: 10), or both were introduced into cancer cells by lentiviral transduction as described in Example 2. An sgRNA (5'-GTATTACTGATATTGGTGGG-3', SEQ ID NO: 11) that does not recognize any sequence in the human genome served as a control. The open reading frames of the transcripts of P2RY2 (ENST00000393597.7) or CD276 (ENST00000318443.10) were ordered as codon-optimized gBlock Gene Fragments (Integrated DNA Technologies or Twist Bioscience) and cloned into lentiviral vectors containing a blasticidin selection cassette. The construct was verified by Sanger sequencing.

[0149] MART1-specific CD8+ T cells and MART1 epitope-expressing cancer cells were mixed at a ratio of 1:16 to 1:1. CD33 CAR-T cells and CD33-expressing THP-1 cells were mixed at a ratio of 1:16 to 1:4. CEA CAR-T cells and CEA-expressing SW480 cells were mixed at a ratio of 1:1. The cells were then centrifuged at 1,600g for 3 min and incubated at 37°C and 5% CO2 for 12 to 72 h. T cell activation was assessed by surface staining with anti-CD137-BV421 (4-1BB, Biolegend), anti-CD137-PE / Cy7 (4-1BB, Biolegend), anti-CD69-APC / Fire™ 750 (FN50, Biolegend), anti-CD25-AF700 (BC96, Biolegend), anti-CD25-APC (BC96, Biolegend) antibodies, and intracellular staining with anti-IL-2-PE / Cy7 (MQ1-17H12, Biolegend), anti-IFN-γ-BV421 (4S.B3, Biolegend), anti-TNF-α-BV785 (MAb11, Biolegend), anti-TNF-α-APC (MAb11, Biolegend) antibodies, followed by flow cytometric analysis. For intracellular staining, Brefeldin A (Biolegend) was added to cell culture medium 4 h before harvesting cells. Viability of cancer cells growing in suspension, including THP-1 cells, was assessed by flow cytometry-based absolute cell counting using AccuCount beads (Spherotech). For adherent cancer cells, including BxPC3, MIA PaCa-2, MDA-MB-231 and MCF7, cell viability was quantified using the CellTiter-Blue Cell Viability Assay (Promega).

[0150] result To determine the effect of P2RY2 on T cells and cancer cells in an in vitro model of T cell-based immunotherapy, we engineered human T cells from peripheral blood with a CD33-specific CAR, a CEA-specific CAR, or a MART-1-specific TCR and assessed T cell activation in the presence of antigen-expressing cancer cells harboring Cas9 / sgRNA targeting P2RY, B7-H3, or both, or overexpressing P2RY2 or B7-H3.

[0151] Notably, simultaneous deletion of P2RY2 and B7-H3 in THP-1 increased the expression of these T cell activation markers (CD25, IFNγ, IL-2, and TNFα) to higher levels than individual deletion of P2RY2 or B7-H3 in both CD3+CD8+ and CD3+CD8- T cells (Figures 4, 5, see Example 3). Similar effects were observed in cocultures of CEA-specific CAR-transduced T cells with CEA+ SW480 cells (Figures 12, 13), as well as in cocultures of MART-1-specific TCR-transduced T cells with MART-1 epitope-transduced BxPC3 cells (Figure 6, see Example 3), MIA PaCa-2 (Figures 14, 15), or MDA-MB-231 cells (Figure 16).

[0152] Consistent with these data, disruption of P2RY2 or B7-H3 in cancer cells led to increased tumor cell killing by tumor-reactive CAR-T or TCR-T cells in myeloid leukemia (THP-1), colorectal cancer (SW480), pancreatic cancer (BxPC3 and MIA PaCa-2), and breast cancer (MCF7 and MDA-MB-231) models (Figures 7, 17, 18). Furthermore, combined deletion of P2RY2 and B7-H3 significantly improved the tumoricidal effect of T cells. In contrast, overexpression of P2RY2 or B7-H3 in cancer cells conferred resistance to tumor-reactive T cells (Figures 7, 17, 18). These results suggest that P2RY2 suppresses T cell activation through both B7-H3-dependent and -independent mechanisms and that combined deletion of P2RY2 and B7-H3 further improves T cell-mediated anticancer effects than deletion of either molecule alone.

[0153] Consistent with the results shown in Figures 8 and 9 above, the P2RY2 inhibitor AR-C 118925XX increased the expression of T cell activation markers CD25, CD69, and IFN-γ, while activation of P2RY2 with ATP, nonhydrolyzable ATP (adenosine-5'-(γ-thio)-triphosphate), diquafosol, or denufosol resulted in suppression of T cell activation in co-cultures of SW480 cells and CEA-specific CAR-transduced T cells (Figure 19). Furthermore, when P2RY2 was deleted in SW480 cells, P2RY2-targeting chemicals had little effect on T cell activation in the same SW480-CEA-specific CAR-T co-culture assay. Furthermore, a reduction in tumor cell viability was observed with AR-C 118925XX treatment in this assay, while P2RY2 agonists increased tumor cell survival. Again, this effect is mediated through P2RY2, as evidenced by the fact that all chemicals that target P2RY2 lost their effect when P2RY2 was depleted (Figure 20).

[0154] Taken together, these data demonstrate that P2RY2 expression on cancer cells inhibits both T cell activation and T cell-mediated cytotoxicity, and that modulation of P2RY2 activity can be exploited to modulate T cell activity in immunotherapy.

[0155] References TIFF2025514373000001.tif118140TIFF2025514373000002.tif31141

Claims

1. A composition containing a P2Y purine receptor 2 (P2RY2) activity regulator for use in T-cell immunotherapy.

2. The composition according to claim 1, wherein the T cell immunotherapy is adoptive T cell immunotherapy, preferably tumor-infiltrating lymphocyte (TIL) therapy and / or engineered T cell immunotherapy, particularly chimeric antigen receptor (CAR) and / or recombinant T cell receptor immunotherapy.

3. The composition according to claim 1, wherein the P2RY2 regulator is a P2RY2 activity-reducing compound, and preferably the P2RY2 activity-reducing compound increases T cell anticancer activity in vitro and / or in vivo.

4. The composition according to claim 3, wherein the P2RY2 activity-reducing compound is a direct P2RY2 activity-reducing compound that specifically binds to P2RY2 and inhibits P2RY2, and the direct P2RY2 activity-reducing compound is a small molecule inhibitor, an inhibitor polypeptide, an inhibitor polynucleotide, or a non-polynucleotide inhibitor polymer.

5. The composition according to claim 4, wherein the small molecule inhibitor is AR-C 118925XX (CAS number: 216657-60-2), the inhibitor polypeptide is selected from a list consisting of antibodies, aptamers, antikalin, and designed ankyrin repeat proteins (DARPin), and / or the inhibitor polynucleotide is a polynucleotide aptamer.

6. The composition according to claim 3, wherein the P2RY2 activity-reducing compound is an indirect P2RY2 activity-reducing compound that reduces the amount of P2RY2 in target cells, and the indirect P2RY2 activity-reducing compound is selected from a list consisting of shRNA, siRNA, miRNA agents, antisense oligonucleotides, ribozymes, and CRISPR / Cas oligonucleotides, preferably pairs of CRISPR / Cas oligonucleotides.

7. The composition according to claim 1, wherein the P2RY2 activity regulator is administered locally, preferably within the tumor.

8. The composition according to claim 1, wherein the P2RY2 regulator is a P2RY2 activity-increasing compound, and the T cell immunotherapy is T cell immunotherapy for an autoimmune disease.

9. The P2RY2 activity-enhancing compound is a direct P2RY2 activity-enhancing compound that binds to P2RY2 and activates its activity, and the P2RY2 activity-enhancing compound is a small molecule activator, an activator polypeptide, an activator polynucleotide, or a non-polynucleotide activator polymer; preferably, the small molecule activator is a nucleotide or a derivative thereof, preferably ATP or UTP or a derivative thereof, more preferably MRS The composition according to claim 8, wherein the phosphate group is 2768 (uridine-5'-tetraphosphate δ-phenyl ester, CAS number: 1047980-83-5), uridine-5'-(γ-thio)-triphosphate (CAS number: 1266569-94-1), 4-thiouridine-5'-O-(β,γ-difluoromethylene)triphosphate (CAS number: 1657025-60-9), denufosol (CAS number: 211448-85-0), or diquafosol (CAS number: 59985-21-6).

10. The P2RY2 activator is an indirect P2RY2 activator that increases the amount of P2RY2 in target cells, and the indirect P2RY2 activator is (i) Polypeptides containing P2RY2 polypeptide, (ii) Polynucleotides encoding polypeptides containing the P2RY2 polypeptide, (iii) A vector containing polynucleotides (ii), (iv) Host cells containing the polynucleotides of (ii) and / or the vector of (iii), or (v) Any combination of (i) to (iv) The composition according to claim 8.

11. A composition for use in T-cell immunotherapy, comprising a host cell comprising a polynucleotide encoding a P2RY2 activity regulator as specified in any one of claims 4 to 10, and / or a P2RY2 activity regulator as specified in any one of claims 4 to 10.

12. A method for identifying subjects suitable for T-cell immunotherapy, (A) A step of determining the activity (amount) of P2RY2 in the sample of the subject, (B) A step of comparing the quantity determined in step (B) with a reference, and (C) A step to identify subjects suitable for T-cell immunotherapy based on the comparison in step (C). A method comprising, preferably, the reference being derived from (i) a subject or group of subjects known to be suitable for immunotherapy, or (ii) a subject or group of subjects known to be unsuitable for immunotherapy.

13. The method according to claim 12, wherein determining the activity includes determining the amount of P2RY2 and / or the amount of at least one of its downstream signaling molecules, preferably intracellular calcium concentration.

14. A method for identifying P2RY2 activity regulators, (I) A step of contacting host cells with a candidate compound that is presumed to be a P2RY2 activity regulator, (II) A step of determining the B7-H3 activity in the host cell, (II) A step of comparing the B7-H3 activity determined in step (II) with a control, and (IV) Step to identify P2RY2 activity regulators based on the comparisons in step (IV) Methods that include...

15. The composition according to any one of claims 1 to 3, wherein the T cell immunotherapy is cancer T cell immunotherapy, and further comprises at least one of administering an immune checkpoint inhibitor, administering a cytokine, administering a T cell engager, and preferably identifying the subject as suitable for T cell immunotherapy according to the method of claim 12 or 13.

Images