Nucleic acid constructs and vectors for podocyte-specific expression
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- FUNDACIO HOSPITAL UNIVERSITARI BAR HEBRON-INST DE RECERCA
- Filing Date
- 2023-04-28
- Publication Date
- 2026-05-12
AI Technical Summary
Current gene therapy methods face challenges in selectively expressing genes in renal podocytes, particularly when targeting larger genes or damaged podocytes, due to limitations in vector size and inefficient expression strategies.
The use of a podocyte-specific hybrid promoter, combining a podocin gene enhancer with a super core promoter, allows for selective and enhanced expression of genes in podocytes, overcoming previous limitations in vector size and expression efficiency.
This approach enables efficient and selective expression of genes in podocytes, including larger genes, and stimulates higher expression in damaged or non-functional podocytes, improving the efficacy of gene therapy for kidney diseases.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] The present invention relates to the field of selective expression of genes in renal podocytes for gene therapy. [Background technology]
[0002] In the field of gene therapy, for example to replace a mutated gene that leads to a non-working or non-functional protein, one of the main concerns is to provide a copy of the gene to the cell of interest (i.e., the target) where it is expressed in the correct form to perform its function.
[0003] Gene therapy is one approach that has been proposed for many diseases, such as in the case of many kidney diseases.
[0004] This targeting of expression in a desired tissue or cells in a tissue is usually carried out using a genetic construct (i.e., a polynucleotide construct) that contains a gene of interest operably linked to an expression promoter that is specific or primarily operable in the target cells.
[0005] An example of this is disclosed in the international patent application WO2020148548 (The University of Bristol), which proposes adeno-associated virus vectors containing a nephrotic syndrome (NS) transgene under the control of the minimal nephrin promoter NPHS1 or under the control of the podocin promoter NPHS2. The aim of the authors was to selectively target podocytes in order to perform gene therapy there.
[0006] Therefore, a genetic construct that is translated into a functional protein is usually incorporated into an expression vector, such as the adeno-associated virus (AAV) described above.
[0007] One of the main problems with the use of this expression vector is that the genes or fragments that can be loaded are of low kilobases, due to the elements necessary to allow the expression and initial stability of the transcript (pre-mRNA or mRNA). Therefore, when gene therapy aims at replacing a non-functional gene of more than approximately 1 kb, several complementary constructs (i.e. constructs prepared for trans-splicing and linking of different fragments of the gene) are used, resulting in the complexity of the therapy.
[0008] In attempting to introduce higher kilobase genes, one of the most used strategies is to use minimal promoters and reduce the number or types of regulatory elements in AAV. However, this can mean that expression is significantly impaired. AAV vector genomes have been limited to 4.8 kilobases (kb) in length due to their packaging limitations. AAV vector genomes longer than 4.8 kb, regardless of the size or capsid type of plasmid-encoded vector, show truncated genomes and serious manufacturing / production problems.
[0009] Another literature example disclosing gene therapy for kidney disease (Alport syndrome) is disclosed in the international patent application WO2021181118 (University of Bristol et al). This document used a construct with a minimal nephrin promoter (of 265 bp), which allowed the authors to successfully transduce complete genes (i.e., COL4a3 and COL4a5) of over 5 kb into human podocytes. Although it is shown that expression was in podocytes, nothing is said about stimulated expression in damaged or non-functional podocytes, selectivity of the packaged virus, and genomic integrity.
[0010] An additional goal of gene therapy is to target defective cells within a cell population of the same tissue. In the field of kidney disease, this is still an unmet need, for example, even if expression may be predominant in podocytes, it is desirable for all podocytes to express the transgene, while stimulating expression to a higher degree in these damaged or non-functional podocytes.
[0011] Thus, although many efforts have been made, there are still unmet needs and a need for alternative methods for gene therapy that perform gene therapy successfully and efficiently. [Prior art documents] [Patent documents]
[0012] [Patent Document 1] International Publication No. 2020148548 (The University of Bristol) [Patent Document 2] International Publication No. 2021181118 (The University of Bristol et al.) [Patent Document 3] International Publication No. 2017153606 (Fundacio Institut de Recerca Biomedica (IRB Barcelona), et al.) [Non-patent literature]
[0013] [Non-Patent Document 1] Pique et al. “A Combinatorial Code for CPE-Mediated Translational Control” Cell 2008, 132(3):434-48 [Non-Patent Document 2] Juven-Gershon et al., “rational design of super core promoter that enhances gene expression”, Nature Methods-2006, vol.no.3(11), pp.917-922 [Non-Patent Document 3] Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453 [Non-Patent Document 4] EMBOSS:The European Molecular Biology Open Software Suite,Rice et al.,2000,Trends Genet.16:276-277 [Non-Patent Document 5] Altschul et al., “Basic local alignment search tool”, 1990, J. Mol. Biol, v. 215, pages 403-410 [Non-Patent Document 6] Harendza et al. [Non-Patent Document 7] Moeller et al. Summary of the Invention
[0014] The inventors have surprisingly found that a fragment known as the podocin gene enhancer containing the NPHS2 motif Lmx1b-FoxC2 (NPHS2 enhancer) in combination with the super core promoter containing the TATA box motif (i.e., SCP1) allows the selective expression of a gene of interest in podocytes and kidney cell lines much more than other promoters of the prior art. Similar results can be achieved with core promoters, in particular with a minimal promoter derived from the promoter of the cytomegalovirus.
[0015] Hybrid promoters containing enhancer elements and core regions are known, but their behavior with regard to cell specificity and expression potential is not predictable.
[0016] A minimal promoter, even a hybrid promoter, generally includes elements not distant from the start codon for transcription initiation.
[0017] Thus, a first aspect of the present invention provides a method for producing a method for treating a pulmonary circulation comprising the steps of: (a) a podocyte-specific enhancer sequence comprising SEQ ID NO: 13 (AAAAAACAGAAGTTAGACCAGACCCCTTCCTGCCTATGATTCTTCAAGAAGCATTGCATCATCAACATCAGGCATAAGCATTAATAAAGACCCTAAATAATAACAGAGACGAAACACATCGCAAAGAGAGTTTTCTTTTATCCCCTTTAAAATGTAAATACTCCCAGGAGGAATCAGCCAACATCATTAGGGGTTAATGCATATG), or a sequence having at least 85% identity percentage with SEQ ID NO: 13; (b) a core promoter sequence, (b1) a minimal core promoter sequence of 81 nucleotides in length having an identity percentage of 85 to 100% with SEQ ID NO: 2 (GTACTTATATAAGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCGAGCAGACGTGCCTACGGACCG); (b2) a 56 nucleotide long minimal core promoter having an identity percentage of 85 to 100% with SEQ ID NO: 20 (GGCGTTTACTATGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATC); A core promoter sequence selected from It is a podocyte-specific hybrid promoter comprising:
[0018] In fact, this podocyte-specific hybrid promoter (a) a podocyte-specific enhancer sequence comprising 200 to 250 nucleotides (or base pairs) isolated from a human coding podocin (NPHS2) gene promoter, the isolated sequence comprising SEQ ID NO: 7 (TTAATAAAGACCCTAAATA), which is a sequence comprising binding motifs for transcription factors Lmx1b and Foxc2 in the NPHS2 gene promoter; (b) a core promoter sequence in which a TATA box motif is separated from the last nucleotide of SEQ ID NO: 7 by 80 to 350 nucleotides (or base pairs), particularly 123 to 126 nucleotides, in the enhancer; SEQ ID NO:13 in the previous paragraph includes SEQ ID NO:7.
[0019] Without being bound by any theory, the inventors believe that the distance (in nucleotides or in the same base pairs) between the aforementioned SEQ ID NO: 7 and the TATA box is associated with induction of expression, and that the selection of a particular core promotes expression in a selective manner or to a higher extent in podocytes compared to other hybrid promoters or naturally occurring promoters of the prior art.
[0020] A second aspect of the present invention is a polynucleotide construct comprising an isolated podocyte-specific hybrid promoter as defined in the first aspect and a nucleotide sequence or fragment of a gene of interest (i.e. a polynucleotide of interest) operably linked to the podocyte-specific hybrid promoter.
[0021] A third aspect of the invention is a vector comprising a podocyte-specific hybrid promoter as defined in the first aspect, or a polynucleotide construct as defined in the second aspect.
[0022] A fourth aspect of the invention is a cell comprising a podocyte-specific hybrid promoter as defined in the first aspect or a polynucleotide construct as defined in the second aspect, or a vector according to the third aspect.
[0023] In a fifth aspect, the present invention encompasses a pharmaceutical composition comprising a therapeutically effective amount of a polynucleotide construct according to the second aspect, a vector according to the third aspect or a cell according to the fourth aspect, together with one or more pharma- ceutically acceptable excipients and / or carriers.
[0024] When the hybrid promoter, construct or cell of the invention comprises a gene operably linked to a promoter, said gene being e.g. a gene associated with a disease resulting from a certain mutation, all of the above listed aspects can be used as a medicament allowing expression of a functional protein from said gene operably linked to the hybrid promoter. Thus, in a sixth aspect, the present invention relates to a promoter as defined in the first aspect, a polynucleotide construct as defined in the second aspect, a vector as defined in the third aspect, a cell as defined in the fourth aspect or a pharmaceutical composition as defined in the fifth aspect for use as a medicament. [Brief description of the drawings]
[0025] [Figure 1] With reference to Example 1, schemes of polynucleotide constructs according to the invention and of prior art polynucleotide constructs are shown, all containing the gene for green fluorescent protein (GFP). [Diagram 2] FIG. 2 relates to Example 1 and shows confocal fluorescence emitted by green fluorescent protein (GFP) in cells transduced with the construct of FIG. 1. [Diagram 3] With reference to Example 1, expression of Lmx1b and Foxc2 transcription factors in selected cell lines is shown. [Figure 4]Schematic diagram of the promoter and luciferase gene for determining the expression of this protein in podocytes (relative luciferase units (RLU) in podocytes for each of the constructs assayed) in relation to Example 2. [Diagram 5] With reference to Example 3, a scheme of the elements (in boxes) of constructs of the invention (having a hybrid promoter of SEQ ID NO: 1) with different polyadenylation signals (i.e. SV40 polyA or CPE polyA) is shown. The figure shows expression in HEK293 cells under endoplasmic reticulum stress conditions (ER stress). Data are provided including protein expression (relative luciferase expression) and mRNA levels (relative mRNA expression) along the time of ER stress. [Figure 6] FIG. 6 is a bar graph of relative expression of the Crumbs cell polarity complex component 2 gene (CRB2, UniProtKB / Swiss-Prot:Q5IJ48, sequence version 2 (17 October 2006)) in HEK293 cells using a polynucleotide construct having the promoter of SEQ ID NO:1 compared to a construct carrying the cytomegalovirus promoter (CMV). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0026] All terms used herein in this application are to be understood in their ordinary meaning as known in the art, unless otherwise specified. Other, more specific definitions of certain terms used in this application are set forth below, and are intended to be applied uniformly throughout the specification and claims, unless a definition expressly set forth provides a broader definition.
[0027] As used herein, the indefinite articles "a" and "an" are equivalent to "at least one" or "one or more." Unless otherwise specified, definite articles such as "the" used herein also include the plural form of the noun.
[0028] The term "promoter" refers to a sequence of DNA to which a protein binds and initiates transcription of a single RNA from the downstream DNA. There are three main parts that make up a promoter: the core promoter, the proximal promoter, and the distal promoter. The core promoter region is located most proximal to the start codon and contains the RNA polymerase binding site, the TATA box, and the transcription start site (TSS). RNA polymerase can stably bind to this core promoter region and initiate transcription of the template strand. The TATA box is a DNA sequence (5'-TATAAA-3') within the core promoter region to which general transcription factor proteins and histones can bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding prevents transcription initiation, whereas transcription factors promote transcription initiation. The most 3' part of the core promoter (closest to the start codon of the gene) is the TSS, which is where transcription actually begins. However, only eukaryotes and archaea contain this TATA box. Most prokaryotes contain a sequence that is considered to be functionally equivalent, called the Pribnow box, which usually consists of the six nucleotides TATAAT. Further upstream from the core promoter, the proximal promoter can be found, which contains many of the primary regulatory elements. The proximal promoter is found approximately 250 base pairs upstream of the TSS and is the site where general transcription factors bind. The last part of the promoter region is called the distal promoter, which is upstream of the proximal promoter. The distal promoter also contains transcription factor binding sites, but most contain regulatory elements.
[0029] The term "minimal promoter" refers to the minimal sequence of a native promoter (mainly a core promoter) capable of expressing a downstream gene.
[0030] The expression "hybrid promoter" should be understood as a combination of elements derived from different promoters (i.e., naturally occurring promoters). For example, a hybrid promoter may contain proximal or distal promoter regions derived from one existing promoter and a core promoter derived from another existing promoter to achieve the desired transgene expression.
[0031] An "enhancer or enhancer sequence" is a short (15-1500 bp) region of DNA that can be bound by a protein (activator) to increase the likelihood that transcription of a particular gene will occur. These proteins are usually called transcription factors. Enhancers are cis-acting. They can be located up to 1 Mbp (1,000,000,000 bp) away from the gene, either upstream or downstream of the start site.
[0032] When sequences of polynucleotides are shown, they refer to useful molecules and only one strand is shown. Nevertheless, those skilled in the art will understand that they can be in the form of single-stranded or double-stranded nucleic acid polymers, for example in the case of desoxyribonucleic acid, including template and complementary strands, or single-stranded ribonucleic acid, such as messenger RNA. The sequences of polynucleotides shown herein are disclosed in terms of length in nucleotides, or in terms of nucleic acid bases or multiples thereof (e.g., kilobases, kb), but they are the same because bases are part of nucleotides. When the expression "base pair" is used, it refers to the basic unit of double-stranded nucleic acid, consisting of two nucleic acid bases bound to each other by hydrogen bonds. The number of base pairs is another equivalent way of indicating the length of a polynucleotide when it is referred to as a double-stranded molecule.
[0033] As indicated above, the first aspect of the present invention is (a) a podocyte-specific enhancer sequence comprising SEQ ID NO: 13 (AAAAAACAGAAGTTAGACCAGACCCCTTCCTGCCTATGATTCTTCAAGAAGCATTGCATCATCAACATCAGGCATAAGCATTAATAAAGACCCTAAATAATAACAGAGACGAAACACATCGCAAAGAGAGTTTTCTTTTATCCCCTTTAAAATGTAAATACTCCCAGGAGGAATCAGCCAACATCATTAGGGGTTAATGCATATG), or a sequence having at least 85% identity percentage with SEQ ID NO: 13; (b) a core promoter sequence, (b1) a minimal core promoter sequence of 81 nucleotides in length having an identity percentage of 85 to 100% with SEQ ID NO: 2 (GTACTTATATAAGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCGAGCAGACGTGCCTACGGACCG); (b2) a 56 nucleotide long minimal core promoter having an identity percentage of 85 to 100% with SEQ ID NO: 20 (GGCGTTTACTATGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATC); A core promoter sequence selected from It is a podocyte-specific hybrid promoter comprising:
[0034] In fact, this podocyte-specific hybrid promoter (a) a podocyte-specific enhancer sequence comprising 200 to 250 nucleotides (or base pairs) isolated from a human coding podocin (NPHS2) gene promoter, the isolated sequence comprising SEQ ID NO: 7 (TTAATAAAGACCCTAAATA), which is a sequence comprising binding motifs for transcription factors Lmx1b and Foxc2 in the NPHS2 gene promoter; (b) a core promoter sequence in which a TATA box motif is separated from the last nucleotide of SEQ ID NO: 7 by 80 to 350 nucleotides (or base pairs), particularly 123 to 126 nucleotides, in the enhancer; SEQ ID NO:13 in the previous paragraph includes SEQ ID NO:7.
[0035] In a particular embodiment of the podocyte-specific hybrid promoter, the podocyte-specific enhancer sequence is a 219 nucleotide sequence having 85-100% identity to SEQ ID NO: 3, which comprises SEQ ID NO: 13.
[0036] In a particular embodiment of the podocyte-specific hybrid promoter, it is (a) a podocyte-specific enhancer sequence comprising or consisting of SEQ ID NO:3; (b) a minimal core promoter of 81 nucleotides having 85-100% identity with SEQ ID NO:2 (SCP1) (GTACTTATATAAGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCGAGCAGACGTGCCTACGGACCG); Includes.
[0037] In a more particular embodiment, the podocyte-specific promoter comprises or consists solely of SEQ ID NO:1, or a nucleotide sequence having at least 85% identity percentage with said SEQ ID NO:1. AAAAACAGAAGTTAGACCAGACCCCTTCCTGCCTATGATTCTTCAAGAAGCATTGCATCATCAACATCAGGCATAAGCATTAATAAAGACCCTAAATAATAACAGAGACGAAACACATCGCAAAGAGGTTTTCTTTTATCCCCTTTAAAATGTAAATACTCCCAGGAGGAATCAGCCAACATCATTAGGGGTTAATGCATATGTAGAATAACTAGGGC GTACTTATATAAGGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCGAGCAGACGTGCCTACGGACCG (SEQ ID NO: 1 is also abbreviated herein as 0.3NPHS2-SFP1-300bp)
[0038] The isolated podocyte-specific hybrid promoter may also be defined as a polynucleotide having a length of 300 to 330 nucleotides (or base pairs) that comprises or consists solely of SEQ ID NO:1 or a sequence having at least 85% identity percentage with SEQ ID NO:1.
[0039] Detailed analysis of this sequence ID No. 1 reveals that the podocyte-specific hybrid promoter -Sequence number 2 a minimal core promoter of 81 nucleotides in length having 85-100% identity with TIFF2025515979000002.tif17170; -SEQ ID NO: 3(AAAAACAGAAGTTAGACCAGACCCCTTCCTGCCTATGATTCTTCAAGAAGCATTGCATCATCAACATCAGGCATAAGCA TTAATAAAGACCCTAAATA ATAACAGAGACGAAACACATCGCAAAGAGAGTTTTCTTTTATCCCCTTTAAAATGTAAATACTCCCAGGAGGAATCAGCCAACATCATTAGGGGTTAATGCATATGTAGAATAACTAGGGC) Includes.
[0040] In this SEQ ID NO:1, nucleotides 1-219 [1:219] correspond to the NPHS2 enhancer; nucleotides 80-98 [80:98] correspond to the motif Lmx1b-FoxC2 (i.e., underlined when transcription factors are bound); a minimal promoter known as super core minimal promoter 1 (SCC1) extends from nucleotides 220-300 [220:300], and the TATA box in this minimal promoter is located at nucleotides 225-231 [225:231] (double underlined). SCP1 is broadly defined in Juven-Gershon et al., "Rational design of super core promoter that enhances gene expression", Nature Methods-2006,vol.no.3(11),pp.917-922.
[0041] In yet another particular embodiment, the podocyte-specific hybrid promoter is (a) SEQ ID NO: 13 (AAAAAACAGAAGTTAGACCAGACCCCTTCCTGCCTATGATTCTTCAAGAAGCATTGCATCATCAACATCAGGCATAAGCA TTAATAAAGACCCTAAATA A podocyte-specific enhancer sequence comprising or consisting of: (b) SEQ ID NO: 20 ( GGCGTTTACTATGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATC ) having 85 to 100% identity with, more specifically, a 56 nucleotide long minimum core promoter sequence consisting only of SEQ ID NO: 20; Includes.
[0042] In a more particular embodiment, the podocyte-specific promoter comprises or consists of SEQ ID NO:4 [also labeled 0.2NPH2+minimal CMV in the present specification and drawings] (AAAAAACAGAAGTTAGACCAGACCCCTTCCTGCCTATGATTCTTCAAGAAGCATTGCATCATCAACATCAGGCATAAGCATTAATAAAGACCCTAAATAATAACAGAGACGAAACACATCGCAAAGAGAGTTTTCTTTTATCCCCTTTAAAATGTAAATACTCCCAGGAGGAATCAGCCAACATCATTAGGGGTTAATGCATATGGGCGTTTACTATGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATC).
[0043] Alternatively, the hybrid promoter of the first aspect may be defined by the identified functional subsequences which it contains (see above).
[0044] The sequence defining the promoter of the first aspect (e.g., SEQ ID NO: 1, SEQ ID NO: 4, or a sequence having at least 85% identity therewith, or any of those disclosed above in the embodiments) is the promoter sequence of a polynucleotide construct operably linked to the sequence of a gene of interest or a fragment thereof, or to the sequence of a polynucleotide of interest. Thus, as also indicated, the second aspect of the present invention is a polynucleotide construct comprising an isolated podocyte-specific hybrid promoter as defined in the first aspect and a nucleotide sequence or fragment of a gene of interest operably linked to the podocyte-specific hybrid promoter.
[0045] Protein variants are well understood by those skilled in the art and may include amino acid sequence modifications resulting from nucleotide modifications.For example, amino acid sequence modifications are typically classified into one or more of three classes: substitution variants, insertion variants, or deletion variants.Similarly, nucleotide sequence variants may also include nucleotide sequence modifications including deletion, insertion, and change of nucleotides, regardless of their stabilizing role (i.e., promoter of gene, coding gene sequence, etc.).
[0046] In the present invention, the term "identity" refers to the percentage of residues that are identical in two sequences when the sequences (either amino acid or nucleic acid) are optimally aligned. If, in optimal alignment, a position in the first sequence is occupied by the same amino acid or nucleotide residue as the corresponding position in the second sequence, the sequences show identity with respect to that position. The identity percentage determines the number of identical residues over a defined length in a given alignment. Thus, the level of identity between two sequences or ("percent sequence identity") is measured as the ratio of the number of identical positions shared by the sequences to the number of positions compared (i.e., percent sequence identity = (number of identical positions / total number of positions compared) x 100). Gaps, i.e., positions in the alignment where a residue is present in one sequence but not in the other, are considered positions with non-identical residues and are counted as compared positions.
[0047] Several mathematical algorithms are known for quickly obtaining optimal alignment and calculating identity between two or more sequences, and are incorporated into several available software programs. For the purposes of the present invention, the sequence identity between two amino acid sequences or two nucleotide sequences is preferably determined using a global alignment-based algorithm, such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), preferably implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277); or the BLAST Global Alignment tool (Altschul et al., "Basic local alignment search tool", 1990, J. Mol. Biol, v. 215, pages 403-410), using default settings. If the sequences to be compared are substantially the same length, local alignment can also be used.
[0048] In certain embodiments of the first aspect of the invention, optionally in combination with any one of the embodiments provided below, the percentage identity to any of the identified sequences (i.e. enhancer, core promoter) therein is at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, or at least 99.5% identical to the indicated sequence.
[0049] In certain embodiments of the first aspect of the invention, optionally in combination with any one of the embodiments provided below, the podocyte-specific hybrid promoter consists of the sequence of SEQ ID NO:1 or a functional variant thereof, said variant consisting solely of a sequence at least 85%, 86%, 87%, 88%, 88.5%, 89%, 89.5%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, or 99.5% identical to SEQ ID NO:1.
[0050] Disclosed is a podocyte-specific hybrid promoter consisting only of the sequence of SEQ ID NO:4 or a functional variant thereof that consists only of a sequence at least 85%, 86%, 87%, 88%, 88.5%, 89%, 89.5%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, or 99.5% identical to SEQ ID NO:4.
[0051] The term "nucleic acid construct" or "polynucleotide construct" refers to an artificial nucleic acid molecule resulting from the use of recombinant DNA technology. A nucleic acid construct is a nucleic acid molecule, either single-stranded or double-stranded, that has been modified to contain segments of nucleic acid, which are combined and juxtaposed in a manner that does not normally occur in nature. A nucleic acid construct is usually a "vector, i.e., a nucleic acid molecule used to deliver exogenously produced DNA to a host cell. It can also be named a "gene construct" or "expression cassette" when referring to a polynucleotide sequence that includes a sequence encoding a protein of interest operably linked to an expression promoter, said promoter controlling the expression of the protein-encoding sequence. By "operably linked" it is understood that the protein-encoding sequence is placed after the promoter sequence (in the 5'-3' direction) or near the promoter if restriction sites are included or other stabilizing elements of the gene construct are present. The expression cassette itself is also an expression system, a vector or plasmid that is further used to protect the gene construct or, in the case of viral vectors, to facilitate its entry into the cell. By "polynucleotide sequence" is meant to be understood a nucleic acid molecule (DNA or RNA) containing deoxyribonucleotides or ribonucleotides. The nucleic acid may be single-stranded or double-stranded, and includes, but is not limited to, a nucleotide sequence that encodes a polypeptide.
[0052] In certain embodiments of the second aspect, the polynucleotide construct comprises: (a) polyadenylation signal nucleotide sequence; (b) protein translation start site consensus nucleotide sequence; (c) the nucleotide sequence of a post-transcriptional regulatory element; and (d) 5' and 3' inverted terminal repeat nucleotide sequences The present invention further includes one or more of the following:
[0053] All of these elements (a)-(d) are sequences that allow for proper expression of a gene operably linked to the promoter.
[0054] In certain embodiments of the second aspect, the polynucleotide construct comprises a podocyte-specific hybrid promoter as defined in the first aspect, a nucleotide sequence of a gene or fragment of a gene of interest operably linked to the podocyte-specific hybrid promoter, and one or more of a polyadenylation signal nucleotide sequence; a protein translation start site consensus nucleotide sequence; and a nucleotide sequence of a post-transcriptional regulatory element.
[0055] A polyadenylation signal is a sequence that promotes transcription by stabilizing the transcript mRNA to be further translated. Polyadenylation is the addition of a poly(A) tail to messenger RNA. A poly(A) tail consists of only multiple adenosine monophosphates; in other words, it is a stretch of RNA with only adenine bases. The poly(A) tail is important for the nuclear export, translation, and stability of mRNA. Thus, the inclusion of a polyadenylation signal can enhance the expression of a gene of interest.
[0056] A protein translation start site is a nucleotide sequence that facilitates the initiation of translation by mediating ribosome assembly and translation initiation.
[0057] Post-transcriptional regulatory elements are sequences that enhance virus (i.e., vector) stability in packaging cells, resulting in higher titers of packaged virus and thus expression of the transgene (i.e., a gene of interest operably linked to a promoter).
[0058] 5' and 3' inverted terminal repeats (5'-ITR and 3'-ITR) are essentially identical regions of sequences present at both ends of the adeno-associated virus genome pointing in opposite directions that serve as the origin of viral genome replication. ITRs usually flank the desired gene together with the promoter and aid in the formation of concatemers in the nucleus after the single-stranded vector DNA is converted into double-stranded DNA by the host cell DNA polymerase complex. Those skilled in the art will know what types of sequences serve as 5'-ITR and 3'-ITR.
[0059] In a more particular embodiment of the second aspect, the polynucleotide construct comprises, in the 5' to 3' direction: (i) a 5' inverted terminal repeat nucleotide sequence; (ii) an isolated polynucleotide hybrid promoter as defined in the first aspect (claim 1), (iii) a protein translation start site consensus nucleotide sequence; and (iv) the nucleotide sequence of the gene or fragment of the gene of interest; and (v) the nucleotide sequence of a post-transcriptional regulatory element; and (vi) a polyadenylation signal nucleotide sequence; and (vii) a 3' inverted terminal repeat nucleotide sequence; Includes.
[0060] In a more particular embodiment of the polynucleotide construct according to the second aspect, the protein translation initiation site consensus nucleotide sequence is a Kozak consensus sequence.Kozak sequence is known to play a key role in the initiation of the translation process, and thus can enhance the expression of the gene of interest.Kozak consensus sequence (Kozak consensus or Kozak sequence) is a nucleic acid motif that functions as a protein translation initiation site in most eukaryotic mRNA transcripts.
[0061] In another particular embodiment of the polynucleotide construct, optionally in combination with any of the embodiments of this polynucleotide construct described above or below, the nucleotide sequence of the post-transcriptional regulatory element is a woodchuck hepatitis post-transcriptional regulatory element (WPRE). A WPRE is a DNA sequence that, when transcribed, creates a tertiary structure that enhances expression. Inclusion of a WPRE element can increase expression of a transgene delivered by a vector when this polynucleotide construct is in a vector. In a more particular embodiment, the WPRE is a WPRE3 of SEQ ID NO: 12 (GATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT). WPRE3 is shorter than WPRE, since WPRE contains 598 base pairs and WPRE3 contains 248 base pairs of 248 bp, but is equally efficient at increasing transgene expression.
[0062] In another particular embodiment of the polynucleotide construct, optionally in combination with any of the embodiments of this polynucleotide construct described above or below, the polyadenylation signal nucleotide sequence is (i) the bovine growth hormone (bGH) polyadenylation signal, (ii) the early SV40 polyadenylation signal, (iii) a synthetic polyadenylation signal (SpA), and (iv) an untranslated sequence 3' to the polynucleotide sequence of a gene or fragment of a gene of interest (3'-UTR) that contains at least two cytoplasmic polyadenylation elements (CPEs) that are separated by less than 50 nucleotides and a cytoplasmic polyadenylation signal that is separated by less than 100 nucleotides from a first or second cytoplasmic polyadenylation element; is selected from.
[0063] In a more specific embodiment of the polynucleotide construct, optionally in combination with any of the embodiments of this polynucleotide construct described above or below, the polyadenylation signal nucleotide sequence is an untranslated sequence comprising at least two cytoplasmic polyadenylation elements separated by less than 50 nucleotides and a cytoplasmic polyadenylation signal separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation elements.
[0064] The term "cytoplasmic polyadenylation element" or "CPE" as used herein refers to a sequence found in the 3'UTR of messenger RNA. CPEs usually have the sequence 5'-UUUUAi_2 U-3' (also called consensus sequence), but other variants are possible, such as non-consensus sequences: UUUUACU, UUUCAU and UUUUCCU. CPEs are bound by the CPE-binding protein (CPEB), which promotes the extension of existing polyadenylation tails and generally the translation of mRNA. Those skilled in the art can determine whether a particular sequence is a CPE by the methods described in Pique et al., "A Combinatorial Code for CPE-Mediated Translational Control," Cell 2008, 132(3):434-48.
[0065] In certain embodiments, when the nucleic acid construct is an RNA molecule, the first CPE has the consensus sequence 5'-UUUUAi_2 U-3'. When the nucleic acid construct is a DNA molecule, the CPE comprises a sequence that, when transcribed, results in the above sequence.
[0066] In certain embodiments, when the nucleic acid construct is an RNA molecule, the second CPE has the consensus sequence 5'-UUUUAi_2 U-3'. When the nucleic acid construct is a DNA molecule, the CPE comprises a sequence that, when transcribed, results in the above sequence.
[0067] In certain embodiments, when the nucleic acid construct is an RNA molecule, the first and second CPEs have the consensus sequence 5'-UUUUAi_2 U-3'. When the nucleic acid construct is a DNA molecule, the CPEs comprise a sequence that, when transcribed, results in the above sequence.
[0068] In a more particular embodiment, the first CPE has the consensus sequence 5'-UUUUUAA-3'.
[0069] In a more particular embodiment, the second CPE has the consensus sequence 5'-UUUAAU-3'.
[0070] In even more specific embodiments, when the nucleic acid construct is an RNA molecule or when the nucleic acid construct is a DNA molecule, the first CPE has the consensus sequence 5'-UUUUUAA-3' and the second CPE has the consensus sequence 5'-UUUUAAU-3', i.e., a sequence which, when transcribed, results in the above sequence.
[0071] In certain embodiments, the 3'UTR of the polynucleotide of the present invention further comprises a third CPE. In more particular embodiments, the third CPE has a non-consensus sequence. In even more particular embodiments, when the nucleic acid construct is an RNA molecule, or when the nucleic acid construct is a DNA molecule, the third CPE has a non-consensus sequence 5'-UUUACU-3', i.e., a sequence that, when transcribed, results in the above sequence.
[0072] In certain embodiments, the third CPE is 3' to the first CPE but 5' to the cytoplasmic polyadenylation signal. In another particular embodiment, the third CPE is 5' to the first CPE and the cytoplasmic polyadenylation signal. In another particular embodiment, the third CPE is between the first and second CPEs and 3' to the cytoplasmic polyadenylation signal.
[0073] In certain embodiments, when the nucleic acid construct is an RNA molecule or when the nucleic acid construct is a DNA molecule, the first CPE has the consensus sequence 5'-UUUUUAA-3', the second CPE has the consensus sequence 5'-UUUUAAU-3', and the 3'UTR further has a third CPE having the non-consensus sequence 5'-UUUUACU-3', i.e., sequences which, when transcribed, result in the above sequences.
[0074] When the nucleic acid construct is an RNA molecule, said nucleic acid construct further comprises a polyadenine tail.
[0075] The 3'UTR of the nucleic acid construct of the first aspect comprises a cytoplasmic polyadenylation signal that is less than 100 nucleotides away from the second CPE. As used herein, the term "cytoplasmic polyadenylation signal" refers to a nucleic acid sequence that is present in the 3'UTR of an mRNA and promotes the cytoplasmic polyadenylation of the mRNA. In certain embodiments, the cytoplasmic polyadenylation signal is the hexanucleotide AAUAAA.
[0076] The phrase "less than 100 nucleotides away from the first or second CPE" means that the number of nucleotides between the last nucleotide of the first or second CPE and the first nucleotide of the cytoplasmic polyadenylation signal is less than 100 nucleotides. In certain embodiments, the number of nucleotides between the first or second CPE and the cytoplasmic polyadenylation signal is less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, less than 10, less than 5 nucleotides. In more particular embodiments, the distance between the first or second CPE and the cytoplasmic polyadenylation signal is 25 nucleotides. In certain embodiments, there are no nucleotides between the second CPE and the cytoplasmic polyadenylation signal. In another particular embodiment, the second CPE and the cytoplasmic polyadenylation signal partially overlap.
[0077] In certain embodiments, the cytoplasmic polyadenylation signal is located 3' to the first and second CPEs.
[0078] In another embodiment, the second cytoplasmic polyadenylation element may overlap the cytoplasmic polyadenylation signal, hi certain embodiments, the second CPE overlaps with the cytoplasmic polyadenylation signal by at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 nucleotides.
[0079] In another specific embodiment, the 3'UTR comprises a third CPE and the cytoplasmic polyadenylation signal is located 3' to the third CPE.
[0080] These particular embodiments of polyadenylation signals containing CPE elements and cytoplasmic polyadenylation signals are extensively commented on in WO2017153606 (Fundacio Institut de Recerca Biomedica (IRB Barcelona), et al.), which proposes these 3'UTR sequences in constructs for selectively expressing genes of interest in cancer cells. However, the behavior of tumor cells is not directly transferable to any other diseased cells (i.e., kidney), and there is a bibliography with conflicting results.
[0081] As shown in the examples, the combination of the specific indicated hybrid promoter and polyadenylation signal containing the CPE element allows the desired gene therapy transgene to be expressed to a higher extent (i.e. stimulated) in all injured podocytes. If the gene therapy expression can restore a healthier state of the podocytes, the gene therapy transgene expression will still be expressed at a basal level, thus the transgene will be expressed in all podocytes, preferably more highly expressed in injured podocytes.
[0082] In another particular embodiment of the polynucleotide construct, optionally in combination with any of the above or below embodiments or this polynucleotide construct, the gene of interest or a fragment thereof operably linked to the podocyte-specific hybrid promoter is - one or more genes associated with kidney disease, and / or - Genes having a length of up to 5 kb, more specifically up to 4.5 kb, even more specifically up to 4.0 kb is selected from.
[0083] In more particular embodiments, the gene or fragment thereof is selected from the group consisting of the clamus cell polarity complex component 2 gene (CRB2), the neferin gene (NPHS1), the podocin gene (NPHS2), the aarF domain-containing kinase 4 (ADCK4) gene, the chitobiosyldiphosphodolichol β-mannosyltransferase gene (ALG1), the Rho GTPase-activating protein 24 gene (ARHGAP24), the ARGHDIA gene, and the like. CD151-CD2AP; coenzyme Q2, polyprenyltransferase gene (COQ2); coenzyme Q6, monooxygenase gene (COQ6); diacylglycerol kinase epsilon gene (DGKE); E2F transcription factor 3 gene (E2F3); epithelial membrane protein 2 gene (EMP2); KN motif and ankyrin repeat domain 2 gene (KANK2); L antigen family member 3 gene (LAGE3); LMNA gene (LMNA); LIM homeobox transcription factor 1-beta gene (LMX1B); transcription factor MafB gene (MAFB); nucleoporin 85 gene (NUP85); nucleoporin 93 gene (NUP93); nuclear RNA export factor 5 gene (NXF5); O-sialoglycoprotein endopeptidase gene (OSGEP); versus phosphomannomutase 2 gene (PMM2); podocalyxin-like gene (PODXL); scavenger receptor class B member 2 gene (SCARB2); sphingosine-1-phosphate lyase 1 gene (SGPL1); SMAD family member 7 gene (Smad7); TP53-regulated kinase gene (TP53RK); TP53RK-binding protein gene (TPRKB); vitamin D receptor gene (VDR); WD repeat domain 73 gene (WDR73); Wilms tumor 1 gene (WT1); zinc metallopeptidase gene (ZMPSTE2); apolipoprotein L1 gene (APOL1), type IV collagen α3 chain gene (COL4A3);Selected from one or more of the following: type IV collagen alpha 4 chain gene (COL4A4), type IV collagen alpha 5 chain gene (COL4A5), type IV collagen alpha 6 chain gene (COL4A6), Klotho protein gene (Klotho), fibroblast growth factor 23 gene (FGF23), bone morphogenetic protein 7 gene (BMP7), and vascular endothelial growth factor (VEGF) C gene. All of these genes, when included in the constructs of the invention, are in certain embodiments morphological or minigenes. Thus, they are gene fragments that contain one or more exons and control regions necessary for the gene to express itself in the same way as the wild-type gene.;
[0084] In certain embodiments, the polynucleotide construct comprises: SEQ ID NO:6 or a functionally equivalent variant having at least 85% identity to SEQ ID NO:6; SEQ ID NO: 18, or a functionally equivalent variant having at least 85% identity to SEQ ID NO: 18 (also labeled 0.3NPHS2-SCP1_Kco.hCRB2_minimalSV40pA herein), SEQ ID NO: 19 or a functionally equivalent variant having at least 85% identity to SEQ ID NO: 19 is selected from the group consisting of:
[0085] In another particular embodiment, the polynucleotide construct comprises: SEQ ID NO:8 or a functionally equivalent variant having at least 85% identity to SEQ ID NO:8 (0.3_Luc_Minimum SV40 [2375 bp] MiniHybrid NTX, see Example 2), SEQ ID NO: 9 or a functionally equivalent variant having at least 85% identity to SEQ ID NO: 9 (0.3_Luc_CPE[2309bp, 0.3_Luc_CPE[2309bp], see Example 3), SEQ ID NO: 10 or a functionally equivalent variant having at least 85% identity to SEQ ID NO: 10 (0.3NPHS2-SCP1_KTurboGFP_WPRE3_minimumSV40pA, see Example 1), SEQ ID NO: 11, (0.2NPHS2-minCMV_KTurboGFP_WPRE3_minSV40pA, see Example 1) and is selected from the group consisting of:
[0086] In a third aspect, the present invention relates to a vector comprising a podocyte-specific hybrid promoter as defined in the first aspect or a polynucleotide construct as defined in the second aspect.
[0087] The term "vector" as used herein refers to a construct that can deliver and preferably express one or more polynucleotides of interest into a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells. This term also relates to targeting constructs that allow random or site-specific integration of the targeting construct into genomic DNA. Such targeting constructs preferably contain DNA of sufficient length for either homologous recombination or heterologous integration.
[0088] In a particular embodiment of the vector, it is an expression vector.
[0089] The term "expression vector" refers to a replicative DNA construct used to express the nucleic acid construct of the present invention in a cell, preferably a eukaryotic cell, more preferably a mammalian cell. Expression vectors are basic tools in biotechnology for the production of proteins. Expression vectors have features that any vector may have, such as an origin of replication, a selectable marker, and a suitable site for inserting genes, such as a multiple cloning site. Expression vectors also preferably contain an origin of replication in prokaryotes, which is necessary for vector propagation in bacteria. In addition, expression vectors can also contain bacterial selection genes, such as genes encoding proteins that confer resistance to antibiotics, such as ampicillin, kanamycin, chloramphenicol, and the like. Expression vectors can also contain one or more multiple cloning sites.
[0090] In an even more particular embodiment of the vector of the invention, it is an adeno-associated viral vector (AAV), in particular selected from one or more of the serotypes AAV1, AAV2, AAV3B, AAV4, AAV8, AAV9, AAVrhlO, AAVLK03, AAV-DJ and AAV-DJ / 8, or any other AAV with tropism for kidney tissue, more particularly for podocytes or tubular cells.
[0091] The term "adeno-associated virus (AAV)" as used herein refers to viral vectors that infect both dividing and quiescent primate (and human) cells. Because they appear to lack pathogenic effects and usually integrate into the same location of the genome (the AAVS1 site on chromosome 19), the viral vectors can be safely used to transduce foreign DNA into human cells in gene therapy applications. In general, AAV serotypes have significant homology in genomic sequences at the amino acid and nucleic acid levels, provide an identical set of gene functions, produce essentially physically and functionally equivalent virions, and can be engineered to express transgenes that require tissue-specific regulation.
[0092] A fourth aspect of the invention is a cell comprising a podocyte-specific hybrid promoter as defined in the first aspect, or a polynucleotide construct as defined in the second aspect, or a vector according to the third aspect. The cell comprises one or more of these recited elements in such a manner that they are functional, i.e. that they allow the expression of a gene or fragment of interest.
[0093] In certain embodiments, the cell is an animal cell, more particularly a mammalian cell, and even more particularly a human cell.
[0094] Methods for the synthesis of constructs, vectors as well as all molecular biology tools for cell transfection or transduction are well known to those skilled in the art and are well established in molecular biology protocols, specific conditions are given in the examples.
[0095] The present invention also encompasses pharmaceutical compositions comprising a therapeutically effective amount of either a polynucleotide construct according to the invention, a vector according to the invention, or a cell according to the invention, together with one or more pharma- ceutically acceptable excipients and / or carriers.
[0096] The term "medicaments" also encompasses the notion of "veterinary compositions". They therefore relate to compositions which are therapeutically effective when administered by any desired or applicable route to any animal, including humans.
[0097] The term "therapeutically effective amount" as used herein refers to an amount of compound that is sufficient to prevent or alleviate to some extent one or more symptoms of the disease being addressed when administered. The specific dose of compound administered according to the present invention will of course be determined by the particular circumstances surrounding the case, including the compound being administered, the route of administration, the particular condition being treated, and similar considerations.
[0098] The expression "pharmaceutical acceptable excipient or carrier" refers to a pharmaceutical acceptable material, composition or vehicle. Each component must be pharmaceutical acceptable in the sense of being compatible with the other components of the pharmaceutical composition. It must also be suitable for use in contact with human and animal tissues or organs without excessive toxicity, irritation, allergic reaction, immunogenicity or other problems or complications commensurate with a reasonable benefit / risk ratio. Examples of suitable acceptable excipients are solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, solid binders, lubricants, and the like. The use of any conventional excipient medium is considered within the scope of the present invention, except insofar as it is incompatible with the substance or its derivatives, such as by producing any undesirable biological effects or otherwise interacting in a deleterious manner with any other components of the pharmaceutical composition.
[0099] Examples of suitable pharma- ceutically acceptable excipients are solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, solid binders, lubricants, etc. Except insofar as any conventional excipient medium is incompatible with the substance or its derivatives, such as by producing any undesirable biological effects or otherwise interacting in a deleterious manner with any other components of the pharmaceutical composition, its use is contemplated within the scope of the present invention.
[0100] The relative amounts of the active ingredient, pharma- ceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition of the present invention will vary depending on the identity, size, and / or condition of the subject being treated, as well as on the route by which the composition is administered.
[0101] Pharmaceutically acceptable excipients used in the manufacture of pharmaceutical compositions include, but are not limited to, inert diluents, dispersing and / or granulating agents, surfactants and / or emulsifying agents, disintegrating agents, binders, preservatives, buffers, lubricants and / or oils. Excipients such as colorants, coating agents, sweetening agents, and flavoring agents can be present in the composition, according to the judgment of the formulator.
[0102] Pharmaceutical compositions containing a polynucleotide construct according to the invention, a vector according to the invention, or a cell according to the invention can be presented in any dosage form, e.g. solid or liquid, and can be administered by any suitable route, e.g. oral, parenteral, rectal, topical, intranasal, intraocular, intraperitoneal or sublingual, for which they include pharma- ceutically acceptable excipients necessary for the formulation of the desired dosage form, e.g. topical preparations (ointments, creams, lipogels, hydrogels, etc.), eye drops, aerosol sprays, injectable hydrogels, injectable solutions, osmotic pumps, etc.
[0103] Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and combinations thereof.
[0104] Exemplary granulating and / or dispersing agents include, but are not limited to, potato starch, corn starch, tapioca starch, sodium starch glycolate, clays, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked polyvinylpyrrolidone (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethylcellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, and combinations thereof.
[0105] Exemplary binders include, but are not limited to, starches (e.g., corn starch and starch paste); gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic gums (e.g., acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage of isapol husk, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, cellulose acetate, polyvinylpyrrolidone), magnesium aluminum silicate (Veegum), larch arabogalactan; alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethacrylates; waxes; water; alcohols; and combinations thereof.
[0106] Exemplary preservatives may include antioxidants, chelating agents, antibacterial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives.Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, ascorbyl stearate, ascorbyl oleate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite.Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and trisodium edetate.
[0107] Exemplary buffering agents include, but are not limited to, citrate buffer, acetate buffer, phosphate buffer, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixture, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixture, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixture, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and combinations thereof.
[0108] Exemplary lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behanate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.
[0109] The preparation of all these pharmaceutical compositions follows general practices known to those skilled in the art.
[0110] All the above aspects of the invention and their respective embodiments may be used as a medicament, when the hybrid promoter, construct or cell of the invention comprises a gene operably linked to a promoter, said gene being e.g. a gene that is associated with a disease when mutated, allowing expression of a functional protein from said gene operably linked to the hybrid promoter. Thus, in a fifth aspect, the present invention relates to a promoter as defined in the first aspect, a polynucleotide construct as defined in the second aspect, a vector as defined in the third aspect or a cell as defined in the fourth aspect, or a pharmaceutical composition comprising one or more of them, for use as a medicament.
[0111] In a more particular embodiment, the hybrid promoter, the polynucleotide construct, the vector, the cell or the pharmaceutical composition for use according to the previous aspects, wherein the medicament is for use in the prevention and / or treatment of kidney disease.
[0112] This embodiment may also be formulated as the use of a hybrid promoter, a polynucleotide construct, a vector, a cell or a pharmaceutical composition as defined above for the manufacture of a medicament for preventing and / or treating renal disease. The present invention also relates to a method for the treatment and / or prevention of renal disease, comprising administering a therapeutically effective amount of a hybrid promoter, a polynucleotide construct, a vector, a cell or a pharmaceutical composition as defined above together with a pharma- ceutically acceptable excipient or carrier, in a subject, including a human, in need of such treatment and / or prevention of renal disease.
[0113] In more particular embodiments, the renal disease is selected from one or more of glomerular genetic disorders including autosomal recessive steroid-resistant nephrotic syndrome, autosomal dominant steroid-resistant nephrotic syndrome, Denys-Drash syndrome, Frasier syndrome, WAGR (Wilms' tumor, aniridia, genitourinary anomalies, retardation) syndrome, Pearson syndrome, Nail-patella syndrome, Schimke immuno-osseous dystrophy, mitochondrial disorder with steroid-resistant nephrotic syndrome, Fabry disease, Alport syndrome, benign familial hematuria (thin basement membrane nephropathy), Fechtner syndrome (Alport syndrome with macrothrombocytopenia), Alport syndrome with leiomyomatosis and familial amyloidosis, and other renal disorders such as IgA nephropathy, diabetic nephropathy, and Dent's disease.
[0114] The hybrid promoter, polynucleotide construct, vector, cell or pharmaceutical composition according to the invention is for use to be administered parenterally, e.g. intravenously or by infusion techniques. One or more of them are in certain embodiments administered in the form of a sterile aqueous solution, containing, for example, other substances, salts or glucose, to make the solution isotonic with blood. The aqueous solution is in particular buffered (preferably to a pH of 3 to 9). The pharmaceutical composition may be formulated accordingly. The preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well known to those skilled in the art. The hybrid promoter, polynucleotide construct, vector, cell or pharmaceutical composition according to the invention is for the indicated use and is adapted to be administered systemically, such as by intravenous injection.
[0115] In another particular embodiment, the hybrid promoter, polynucleotide construct, vector, cell or pharmaceutical composition according to the invention is adapted for the indicated use and is administered locally, for example by targeting administration to the kidney. Suitably, they are for use administered by injection into the renal artery or renal vein, or by ureteral or subcapsular injection. In an embodiment of the invention, the hybrid promoter, polynucleotide construct, vector, cell or pharmaceutical composition should be administered by injection into the renal artery. In an alternative embodiment of the invention, they should be administered by retrograde administration, for example via the ureter using a urinary catheter.
[0116] For specific administration into the renal vein of mice, we propose a method that allows the administration of low volumes (approximately 50 microliters), which avoids cell damage in the kidney.
[0117] A particular method of administration includes clamping of the hilum and ureter. In this case, about 50 μl of the vector of the invention, or the composition comprising the polynucleotide construct of the invention, or the cells, or any pharmaceutical composition comprising one or more of them, is injected into the renal vein. In particular, it is injected retrogradely into the renal vein. A particular dose in mice is 5*10E10 vector genome (vg) / mouse to 5*10E11 vg / mouse. These doses can be transferred to humans according to an equivalent scale.
[0118] This mode of administration allowed the inventors to administer the reporter gene of interest using a polynucleotide construct with a constitutive promoter (cytomegalovirus) as a reference example. As shown, the injection volume, usually about 100 μl, was reduced to 50 μl. Furthermore, despite the high pressure hazard to the kidney tissue, no cell damage was observed due to the low but effective dose (i.e., volume) (data not shown). The inventors detected that with this mode of administration and the constitutive promoter, expression was also effective in the liver. This proves that this mode of administration allows the injected construct, vector, cells, etc. to enter the systemic circulation. This is noteworthy because, as also demonstrated in the following examples, the construct, vector, or cell with the hybrid promoter of the present invention is highly selective for podocytes and expressed in hepatocytes to a lesser extent than other constructs of the prior art. Thus, the proposed promoter and derivative polynucleotide constructs, vectors, or cells are safe with respect to their tissue expression in the desired target when administered systemically. Furthermore, when specific polyadenylation signals are present in the construct associated with the hybrid promoter, expression in diseased cells is enhanced.
[0119] The hybrid promoter, polynucleotide construct, vector, cell or pharmaceutical composition, in certain embodiments, should be administered as a single dose, i.e., no subsequent doses are required. If repeated doses are required, in certain embodiments, different or the same AAV serotypes are used.
[0120] Optionally, the hybrid promoter, polynucleotide construct, vector, cell or pharmaceutical composition should be administered in combination with other therapeutic approaches, such as, in particular, temporary immunosuppressive therapy.Other therapeutic approaches to be considered in combination with the hybrid promoter, polynucleotide construct, vector, cell or pharmaceutical composition may include inhibition of the renin-angiotensin-aldosterone system (RAAS) using drugs such as angiotensin-converting enzyme inhibitors (ACEi), angiotensin receptor blockers (ARB), or aldosterone antagonist compounds (e.g., new drugs such as spironolactone and finenenone), or potentially in the near future, new promising therapies such as spasartan, sodium-glucose transport protein 2 (SGLT2) inhibitors, or other approved compounds to reduce proteinuria and progression to chronic kidney disease (CKD).
[0121] Throughout the specification and claims, the word "comprise" and variations of this word are not intended to exclude other technical features, additives, ingredients, or steps. Furthermore, the word "comprise" encompasses the case of "consisting of". Additional objects, advantages, and features of the present invention will become apparent to those skilled in the art upon examination of the specification or may be learned by practice of the present invention. The following examples are provided by way of illustration and are not intended to limit the present invention. Moreover, the present invention covers all possible combinations of the specific preferred embodiments described herein. EXAMPLES
[0122] Example 1. Expression of GFP by constructs with podocyte-specific hybrid promoters of the present invention and comparison with prior art constructs with other podocyte-specific promoters The polynucleotide construct defined by SEQ ID NO: 10 (also referred to herein as 0.3NPHS2-SCP1_KGFP_WPRE3_minimal SV40pA or hybrid-SCP1-GFP in FIG. 1), containing the podocyte-specific hybrid promoter of SEQ ID NO: 1 for expressing the reporter green fluorescent protein, was expressed by insertion into a plasmid in podocytes (E11 cell line), HEK293 cells (ATCC#CRL-11268), HepG2 cells (any commercially available), HeLa (#CCL-2) and renal proximal tubule cells_RPTEC cells (any commercially available). The same experiment was carried out with SEQ ID NO: 11 (also referred to herein as 0.2NPHS2-minimal CMV_KTurboGFP_WPRE3_minimal SV40pA or hybrid-CMV-GFP in FIG. 1).
[0123] As comparative examples, the same (plasmids) were loaded with polynucleotide constructs defined by SEQ ID NO: 14 and SEQ ID NO: 15, which correspond to the constructs assayed by Harendza et al. 2009 and Moeller et al. 2003, respectively, both of which contain a different promoter than that defined by SEQ ID NO: 1. SEQ ID NO: 14 is also referred to herein as 0.8NPHS2_KGFP_WPRE3_MinimalSV40pA or Midi-NHPS2-GFP in FIG. 1. SEQ ID NO: 15 is also referred to herein as 2.5NPHS2_KGFP_WPRE3_MinimalSV40pA or FL-NHPS2-GFP in FIG. 1).
[0124] As a control, SEQ ID NO: 16 (CMV_KGFP_WPRE3_minimalSV40pA or also referred to as CMV-GFP in FIG. 1).
[0125] Cells were transfected by transient transfection using Lipofectamine 3000 (Thermo Fisher #L3000008). Cells were cultured in DMEM (Gibco #42430082) supplemented with 10% FBS (Gibco #10270098), 1% sodium pyruvate [100 mM] (Gibco #11360039), 1% antibiotic / antimycotic (Gibco #15240-062), and 0.2% plasmocin (Invivogen #ant-mpp) at 37°C, 5% CO2, RH, Ta, and other culture media, and expression was determined 48 hours after transfection.
[0126] Fluorescence in cells, measured as green fluorescent cells, was detected by microscopy. A fluorescent microscopy confocal image of one replica of the assay is shown in Figure 2(A). In Figure 2(B), a graph shows the relative fluorescence per field of cells (Rel GFP cells / field) in each of the cell types assayed.
[0127] Finally, FIG. 3 shows the expression of Lmx1b and Foxc2 transcription factors in selected cell lines.
[0128] The data from this example make it possible to confirm that a higher expression in podocytes occurs with the construct of the invention.
[0129] Example 2: Confirmation of expression of the podocyte-specific hybrid promoter of the present invention by luciferase construct The promoter of the invention, SEQ ID NO: 1, was tested in a construct containing the luciferase gene as reporter gene. The construct, SEQ ID NO: 8, contained the early SV40 polyadenylation signal as polyadenylation signal.
[0130] The control in the assay was the construct of SEQ ID NO: 17 (CMV_Kluciferase_WPRE3_minimalSV40pA) containing the constitutive CMV promoter.
[0131] The data are shown in Figure 4, where a schematic of the promoter and luciferase gene are shown, and expression in podocytes is shown as relative luciferase units (RLU) in podocytes for each construct. Assays were performed using plasmids similar to those in Example 1.
[0132] Example 3: Selectivity of diseased cells The inventors surprisingly found that when the polyadenylation signal in the construct of the invention was a 3'-UTR sequence containing two CPEs and a cytoplasmic polyadenylation signal of the sequence AAUAAA (CPE polyA), expression was higher under sustained stress conditions (i.e. endoplasmic reticulum (ER) stress conditions).
[0133] This assay was performed using a kidney cell line (HEK293, ATCC#CRL-11268) and the data demonstrate that CPE polyA allowed expression of the luciferase gene under stress conditions, even with higher expression after prolonged stress, compared to the polyadenylation signal known as SV40 polyA. In contrast, the construct with SV40 polyA maintained expression over time, but to a lesser extent.
[0134] The two test versions of the construct containing the podocyte-specific promoter of sequence number 1 used in these assays were the construct of sequence number 8, which contains the early SV40 polyadenylation signal (SV40 polyA in Figure 5) as the polyadenylation signal; and the construct of sequence number 9, which contains an untranslated sequence at the 3' position (3'-UTR) relative to the luciferase gene and two cytoplasmic polyadenylation elements (CPE) as the polyadenylation signal (CPE polyA in Figure 5).
[0135] A scheme of the elements incorporated in the construct is also shown in Figure 5. This figure shows the expression under endoplasmic reticulum stress conditions (ER stress), respectively. This figure includes data on protein expression (relative luciferase expression) and mRNA levels (relative mRNA expression) provided along the time of ER stress. A person skilled in the art will know how to induce ER stress conditions and how to calculate the relative expression of protein and mRNA levels.
[0136] Thus, these data demonstrate a synergistic effect when certain elements in the polynucleotide constructs of the invention are combined with a podocyte-specific hybrid promoter.
[0137] Example 4: Expression of CRB2 protein in HEK293 cells The construct of SEQ ID NO: 18, containing the podocyte-specific hybrid promoter of SEQ ID NO: 1 and the gene for CRB2 (cohCRB2), was used for plasmid transfection of HEK293 cells. SEQ ID NO: 18 (as Hybrid-SCP1-CRB2-SV40pA in FIG. 6) contained the early SV40 polyadenylation signal as a polyadenylation signal.
[0138] As a comparative example, a construct of SEQ ID NO:5 having a constitutive cytomegalovirus promoter and CRB2 gene was also transfected. SEQ ID NO:5 contains a polyadenylation signal known as a synthetic polyadenylation signal (SpA). An empty vector was used as a control.
[0139] The data from this assay are shown in Figure 6, which shows that using the promoter of SEQ ID NO:1 (or one with 85% identity), expression of the Crb2 gene (a 3.8 kb gene) was a ratio of expression using the constitutive CMV promoter, which is known to be a strong promoter.
Claims
1. A podocyte-specific hybrid promoter that can enable the expression of functional proteins from genes operably linked to the hybrid promoter, (a) A podocyte-specific enhancer sequence containing SEQ ID NO: 13 (AAAAAACAGAAGTTAGAGACCACACCTCTCCTGTGCCTATGAGAAGCATTTGCCATCATCAACATCAGGCATATAAAGACCCCTAATAAAGACCCCTAATAAGAGAGAGAACACATCGCAAAAGAGAGTTTTTTCTTTTATCCCCCCTTTTAAAAAATGTTAAAAATACTCCCCCAGGGAAGCAACATCATAGGGGGTTTAATGCATATG), or a sequence having at least 85% identity with SEQ ID NO: 13, (b) A core promoter sequence, (b1) A minimum core promoter sequence of 81 nucleotides in length having an identity percentage of 85-100% with SEQ ID NO: 2 (GTACTTATATAAGGGGGGGGGGCGCGTTCCGTCCAGTTCGCGAATGAACACTCGAGCCCGAGCAGAAGGTGCCTACGGACCG), and (b2) A 56-nucleotide minimum core promoter having an 85-100% identity percentage with SEQ ID NO: 20 (GGCGTTTAACTATGGGAGGTCTATATAAGCAGAGCTCCGTTTAGTGAACCGTCAGATC) The core promoter sequence selected from and A podocyte-specific hybrid promoter, including...
2. The polynucleotide sequence of SEQ ID NO: 1, or the SEQ ID NO: 1 (AAAAAACAGAAGTTAGAGACCACAGACCCCTCTCCTGCCTATGAATTCTCTCCAAGAAGAAGCATTCGCCATAAGCATTAATAAAGACCCCTAATAAAAAGACCCTAATAAGAGAGAGAGAAAACACATCGCCAAAAGAGAGAGTTTTTTCTTTTATCCCCCCTTTTAAAAAATGTTAAAAATACTCCCCCAGGGA A podocyte-specific hybrid promoter according to claim 1, comprising only a nucleotide sequence having at least 85% identity percentage with (ATCAGCCAACATCATTAGGGGGTTAATGCCATATGTTAGAATAACTAGGGGCGTATACTATATATAAGGGGGGTGGGGGCGCGTTCTCTCTCCAGTGCGCGAATCGACACTCGAGCCCGAGCAGAAGAGGTGCCTACGGGCG).
3. A polynucleotide construct comprising an isolated polynucleotide hybrid promoter as defined in claim 1, and a nucleotide sequence of a target gene or gene fragment operably linked to the podsite-specific hybrid promoter.
4. (a) Polyadenylated signal nucleotide sequence; (b) Consensus nucleotide sequence of the protein translation initiation site; (c) The nucleotide sequence of the post-transcriptional regulatory element; and (d) 5' and 3' reverse terminal repeat nucleotide sequences The polynucleotide construct according to claim 3, further comprising one or more of the following.
5. From 5' to 3', (i) 5' reverse terminal repeat nucleotide sequence, (ii) an isolated polynucleotide hybrid promoter as defined in claim 1 or 2, (iii) Consensus nucleotide sequence of protein translation initiation site, (iv) The nucleotide sequence of the target gene or gene fragment, (v) Nucleotide sequences of post-transcriptional regulatory elements, (vi) Polyadenylated signal nucleotide sequence and (vii) 3' reverse terminal repeat nucleotide sequence and A polynucleotide construct according to claim 3 or 4, comprising:
6. The polynucleotide construct according to claim 3 or 4, wherein the protein translation initiation site consensus nucleotide sequence is a Kozak consensus sequence.
7. The polynucleotide construct according to claim 3 or 4, wherein the nucleotide sequence of the post-transcriptional regulatory element is the woodchuck hepatitis post-transcriptional regulatory element (WPRE).
8. The polynucleotide construct according to claim 3 or 4, wherein the polyadenylation signal nucleotide sequence is selected from a 3' (3'-UTR) untranslated sequence of a target gene or gene fragment polynucleotide sequence comprising a bovine growth hormone (bGH) polyadenylation signal, an initial SV40 polyadenylation signal, a synthetic polyadenylation signal (SpA), and at least two cytoplasmic polyadenylation elements separated by less than 50 nucleotides and a cytoplasmic polyadenylation signal separated by less than 100 nucleotides from a first or second cytoplasmic polyadenylation element.
9. The target gene, operably linked to the podocyte-specific hybrid promoter, - One or more genes associated with kidney disease, and / or - Genes with a maximum length of 4.0 to 5.0 kilobases (kb) A polynucleotide construct according to claim 3 or 4, selected from the above.
10. A vector comprising a podocyte-specific hybrid promoter as defined in either claim 1 or 2, or a polynucleotide construct as defined in claim 3 or 4.
11. The vector according to claim 10, which is an adeno-associated virus vector (AAV) having targeting properties for renal cells and podocytes, particularly selected from one or more serotypes AAV19, AAV2, AAV3B, AAV4, AAV8, AAV9, AAVrh10, AAV-LK03, AAV-DJ, and AAV-DJ / 8.
12. A cell comprising a podocyte-specific hybrid promoter as defined in claim 1 or 2, or a polynucleotide construct as described in claim 3 or 4.
13. A cell comprising the vector according to claim 10.
14. A pharmaceutical composition comprising a therapeutically effective amount of the polynucleotide construct according to claim 3 or 4, together with one or more pharmaceutically acceptable excipients and / or carriers.
15. A pharmaceutical composition comprising the vector according to claim 10 together with one or more pharmaceutically acceptable excipients and / or carriers.
16. A pharmaceutical composition comprising the cells described in claim 12 together with one or more pharmaceutically acceptable excipients and / or carriers.
17. A pharmaceutical product comprising a polynucleotide construct as defined in claim 3 or 4.
18. A pharmaceutical product comprising the vector described in claim 10.
19. A pharmaceutical product comprising cells as defined in claim 12.
20. The pharmaceutical product according to claim 17, for the prevention and / or treatment of kidney disease.
21. The pharmaceutical product according to claim 18, for the prevention and / or treatment of kidney disease.
22. The pharmaceutical product according to claim 19, for the prevention and / or treatment of kidney disease.