Pyrimidinone compounds for treating acute inflammation
The administration of a pyrimidinone compound addresses the inadequacies of current treatments for acute inflammatory conditions by reducing inflammatory cytokines and promoting healing through enhanced SIRT expression.
Patent Information
- Application Number
- JP2024569827
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-05-26
- Filing Date
- 2023-05-24
- Publication Date
- 2025-06-12
AI Technical Summary
Current treatments for acute inflammatory conditions are inadequate in effectively managing the inflammatory response and promoting healing.
Administration of a therapeutically effective amount of a pyrimidinone compound, specifically represented by formula (I), or its pharmaceutically acceptable salt or tautomer, to treat acute inflammatory conditions.
The pyrimidinone compound effectively reduces inflammatory cytokine secretion, restores NAD+ biosynthesis, and increases the expression of SIRT-1 and SIRT-3, thereby promoting an anti-inflammatory response and facilitating tissue healing.
Smart Images

Figure 2025518115000001_ABST
Abstract
Description
Technical Field
[0001] Cross - reference to Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 346,193, filed May 26, 2022, the contents of which are incorporated herein by reference in their entirety.
[0002] The present disclosure relates to a method of treating an acute inflammatory condition of a subject, comprising administering to the subject a therapeutically effective amount of a pyrimidinone compound.
Background Art
[0003] Inflammation is a complex of consecutive biological responses of body tissues to harmful stimuli such as pathogens, damaged cells, or irritants. When tissue damage occurs, whether it is caused by bacteria, trauma, chemicals, heat, or any other phenomenon, histamine, along with other humoral substances, is released into the surrounding body fluids by the damaged tissue, initiating the vascular phase of acute inflammation. This is a protective adaptation by the organism to remove the harmful stimulus and initiate the healing process.
[0004] There are two forms of inflammation, generally referred to as acute inflammation and chronic inflammation. Acute inflammation is the body's initial response to a harmful stimulus and is achieved by an increased movement of plasma and white blood cells from the blood to the damaged tissue. Acute inflammation can be divided into several stages. The initial event of the inflammatory response is a transient vasoconstriction, i.e., a narrowing of the blood vessels caused by the contraction of smooth muscle within the vessel wall, which can be seen as blanching (whitening) of the skin. This is followed by several stages that occur minutes, hours, and days later. The first is the acute vascular response that follows within seconds of tissue damage and lasts for several minutes. This results from changes in the vascular endothelium leading to vasodilation and increased capillary permeability, causing an increase in blood flow (hyperemia), redness (erythema), and the invasion of body fluid into the tissue (edema).
[0005] The main features of the vascular phase of the inflammatory response are vasodilation, i.e., the dilation of blood vessels to increase blood flow to the area of infection; increased vascular permeability to allow the entry of diffusible components to that site; chemotactic cell infiltration; or the directed movement of inflammatory cells, including neutrophils, through the blood vessel wall to the site of injury; changes in the biosynthetic, metabolic, and catabolic profiles of many organs; and the activation of cells of the immune system as well as the activation of complex enzyme systems in the plasma. This results in a cellular phase in which neutrophils are attracted to the site of injury by the presence of chemotactic factors and then recognize foreign substances and initiate phagocytosis. However, inflammation that proceeds without being recognized can lead to many diseases, including acute hepatitis, acute pancreatitis, acute kidney disease, inflammatory bowel disease, inflammatory liver disease, rheumatoid arthritis, autoimmunity, sepsis, SIRS, and atherosclerosis.
[0006] Following the acute vascular response, an acute cellular response can occur over the next few hours. The characteristics of this stage are the appearance of granulocytes, particularly neutrophils, in the tissue. These cells first attach to endothelial cells within the blood vessels (margination) and then enter the surrounding tissue (extravasation). During this stage, red blood cells may also leak into the tissue, and bleeding can occur. When blood vessels are damaged, fibrinogen and fibronectin are deposited at the site of injury, platelets aggregate and become activated, and red blood cells stack together in a so-called "rouleaux" formation to stop bleeding and assist in blood clot formation. Dead and dying cells contribute to pus formation. If the injury is sufficiently severe, a chronic cellular response may continue over the next few days. The characteristics of this stage of inflammation are the appearance of a mononuclear cell infiltrate composed of macrophages and lymphocytes. Macrophages are involved in the killing of microorganisms, the removal of cell and tissue debris, and the remodeling of tissue. SUMMARY OF THE INVENTION
[0007] The present disclosure relates to a method of treating an acute inflammatory condition of a subject, the method comprising administering a therapeutically effective amount of a compound represented by formula (I):
Chemical formula
[0008] This disclosure relates to
Chemical formula
Chemical formula
Chemical formula
[0009] This disclosure relates to [Chemistry] and [Chemistry] relates to the treatment of an acute inflammatory condition, comprising administering to a subject in need of treatment for an acute inflammatory condition a therapeutically effective amount of a compound selected from the group consisting of
[0010] This disclosure [Chemistry] and [Chemistry] relates to the treatment of an acute inflammatory condition, comprising administering to a subject in need of treatment for an acute inflammatory condition a therapeutically effective amount of a compound selected from the group consisting of
[0011] This disclosure [Chemistry] relates to the treatment of an acute inflammatory condition, comprising administering to a subject in need of treatment for an acute inflammatory condition a therapeutically effective amount of a compound of the formula
[0012] This disclosure [Chemistry] relates to the treatment of an acute inflammatory condition, comprising administering to a subject in need of treatment for an acute inflammatory condition a therapeutically effective amount of a compound of the formula
[0013] This disclosure [Chemical formula] Relates to the treatment of acute inflammatory conditions, comprising administering to a subject in need of treatment for an acute inflammatory condition a therapeutically effective amount of a compound of the formula, or a pharmaceutically acceptable salt or tautomer thereof.
[0014] The present disclosure [Chemical formula] Relates to the treatment of acute inflammatory conditions, comprising administering to a subject in need of treatment for an acute inflammatory condition a therapeutically effective amount of a compound of the formula, or a pharmaceutically acceptable salt or tautomer thereof.
[0015] In a further aspect, there is provided herein a pharmaceutical composition comprising a compound described herein, or a pharmaceutically acceptable salt or tautomers thereof, and a pharmaceutically acceptable excipient. The present disclosure relates to the treatment of acute inflammatory conditions, comprising administering the pharmaceutical composition of the present disclosure to a subject in need of treatment for an acute inflammatory condition.
[0016] The present disclosure provides a compound of the present disclosure, and a pharmaceutically acceptable salt or tautomer thereof, or the pharmaceutical composition of the present disclosure for use in the treatment of acute inflammatory conditions in a subject in need of treatment for an acute inflammatory condition.
[0017] The present disclosure provides the use of a compound of the present disclosure and a pharmaceutically acceptable salt or tautomer thereof for treating acute inflammatory conditions in a subject in need of treatment for an acute inflammatory condition.
[0018] The present disclosure provides the use of a compound of the present disclosure and a pharmaceutically acceptable salt or tautomer thereof in the manufacture of a medicament for treating acute inflammatory conditions. BRIEF DESCRIPTION OF THE DRAWINGS
[0019]
Figure 1
[0020]
Figure 2
[0021]
Figure 3
[0022]
Figure 4
[0023]
Figure 5
[0024]
Figure 6
[0025]
Figure 7
[0026]
Figure 8
[0027]
Figure 9
[0028]
Figure 10
[0029]
Figure 11
[0030]
Figure 12
[0031]
Figure 13
[0032]
Figure 14
[0033]
Figure 15
[0034]
Figure 16
[0035]
Figure 17
[0036]
Figure 18
[0037]
Figure 19
[0038]
Figure 20
[0039]
Figure 21
[0040]
Figure 22
[0041]
Figure 23
[0042]
Figure 24
[0043]
Figure 25
[0044]
Figure 26
[0045]
Figure 27
[0046]
Figure 28
[0047]
Figure 29
[0048]
Figure 30
[0049]
Figure 31
[0050]
Figure 32
Mode for Carrying Out the Invention
[0051] The following description sets forth numerous exemplary configurations, methods, parameters, etc. However, it should be recognized that such description is not intended to limit the scope of the present disclosure, but rather is provided as an explanation of exemplary embodiments.
[0052] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. In this specification, the singular form also includes the plural form unless the context clearly indicates otherwise. Methods and materials similar or equivalent to those described herein can be used in the practice and testing of the present disclosure, but the appropriate methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference. References cited herein are not admitted to be prior art to the claimed present disclosure. In case of conflict, the present specification, including definitions, will control. Further, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0053] Other features and advantages of the present invention will become apparent from the following detailed description and the claims.
[0054] The present disclosure relates to a method of treating an acute inflammatory condition of a subject, comprising administering to the subject a therapeutically effective amount of a pyrimidinone compound.
[0055] Compound The present disclosure relates to a compound of formula (I): [Chemical formula] or a pharmaceutically acceptable salt or tautomer thereof, wherein, X is O or OH; L is -(CH 2 ) m CH 2 CH 2 -, -(CH 2 ) m Y(CH 2 ) p -, -(CH 2 ) m C(O)(CH 2 ) p -, -(CH 2 ) m C(O)O(CH 2 ) p -, -(CH 2 ) m C(O)NR 2 (CH 2 ) p -, or -(CH 2 ) m NR 2 C(O)(CH 2 ) p ; Y is O, N or S(O) q ; R 1 is C 6 -C 10 aryl or heteroaryl, and aryl and heteroaryl are substituted with R a and R b and optionally substituted with one or more R e ; R 2 is H or C 1 -C 6 alkyl; R a and R b one of them is hydrogen and the other is -(CH 2 ) r CO2 R x 、 -OCH 2 CO 2 R x 、 -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazole, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol - 3 - ol, -(CH 2 ) r P(O)(OH)OR x 、 -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHS(O) 2 alkyl; R c is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x 、 -CO 2 R x or NO 2 ; R d is methyl, optionally substituted 5 - to 10 - membered aryl, optionally substituted 5 - or 6 - membered heteroaryl, or optionally substituted 5 - or 6 - membered carbocycle; Each R x is, in each occurrence, independently hydrogen or C 1 -C 6 alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -ORy , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; R f is H or absent; each R y and R z is independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; each m and p is independently 0, 1, or 2, and m + p < 3; q is 0, 1, or 2; r is 0 or 1; the dotted line is an optional double bond; provided that when X is O, L is -SCH 2 -, and R d is optionally substituted phenyl, R c is not hydrogen or -CN, when X is O, L is -SCH 2 -, and R d is methyl, R c is not C 1 -C 6 alkyl, when L is -SCH 2 -, and R d is 2-furyl, R c is not -CN.
[0056] In certain embodiments, the present disclosure relates to a compound of formula (I):
Chemical formula
[0057] In some embodiments of formula (I), X is O or OH. In other embodiments, X is O. In other embodiments, X is OH.
[0058] In some embodiments of formula (I), L is -(CH 2 ) m CH 2 CH 2 -, -(CH 2 ) m Y(CH 2 ) p -, -(CH 2 ) m C(O)(CH 2 ) p -, -(CH 2 ) m C(O)O(CH 2 ) p -, -(CH 2 ) m C(O)NR 2 (CH 2 ) p -, or -(CH 2 ) m NR 2 C(O)(CH 2 ) pis. In other embodiments, L is -CH 2 CH 2 -, -CH 2 CH 2 CH 2 -, -SCH 2 -, -SCH 2 CH 2 -, -CH 2 S-, -CH 2 SCH 2 -, -CH 2 CH 2 S-, -S(O)CH 2 -, -S(O)CH 2 CH 2 -, -CH 2 S(O)-, -CH 2 S(O)CH 2 -, -CH 2 CH 2 S(O)-, -S(O) 2 CH 2 -, -S(O) 2 CH 2 CH 2 -, -CH 2 S(O) 2 -, -CH 2 S(O) 2 CH 2 -, -CH 2 CH 2 S(O) 2 -, -OCH 2 -, -OCH 2 CH 2 -, -CH 2 O-, -CH 2 OCH 2 -, -CH 2 CH 2 O-, -NR 2 CH 2 -, -CH 2 NR 2 -, -CH 2 NR 2 CH 2 -, -CH 2 CH 2 NR 2 -, -NR 2 CH 2 CH 2 -, -C(O)CH 2-, -C(O)CH 2 CH 2 -, -C(O)O-, -C(O)OCH 2 -, -CH 2 C(O)O-, -C(O)NR 2 -, -C(O)NR 2 CH 2 -, -NR 2 C(O), -NR 2 C(O)CH 2 、 or CH 2 NR 2 C(O). In other embodiments, L is -CH 2 CH 2 -, -CH 2 CH 2 CH 2 -, -SCH 2 -, -SCH 2 CH 2 -, -S(O)CH 2 -, -S(O)CH 2 CH 2 -, -S(O) 2 CH 2 -, -S(O) 2 CH 2 CH 2 -, -OCH 2 -, -OCH 2 CH 2 -, -NR 2 CH 2 -, -NR 2 CH 2 CH 2 -, -C(O)CH 2 -, -C(O)CH 2 CH 2 -, -C(O)O-, -C(O)OCH 2 -, -CH 2 C(O)O-, -C(O)NR 2 -, -C(O)NR 2 CH 2 -, -NR 2 C(O) or -NR 2 C(O)CH 2 . In other embodiments, L is -CH 2 CH 2 -, -CH 2 C(O)-, -C(O)CH 2 -, -NR2 CH 2 -, -CH 2 N R2 -, -OCH 2 -, -CH 2 O-, -SCH 2 -, -CH 2 S-, -S(O)CH 2 -, -CH 2 S(O)-, -CH 2 S(O) 2 -, or -S(O) 2 CH 2 -.
[0059] In some embodiments of formula (I), R 1 is C 6 -C 10 aryl or heteroaryl, and the aryl and heteroaryl are substituted with R a and R b and optionally substituted with one or more R e . In other embodiments, R 1 is C a -C b aryl substituted with R e and R 6 -C 10 and optionally substituted with one or more R 1 . In other embodiments, R a is heteroaryl substituted with R b and R e and optionally substituted with one or more R 1 . In further embodiments, R a is phenyl substituted with R b and R e and optionally substituted with one or more R
[0060] In some embodiments of formula (I), R a is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x, -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazole, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x , -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHS(O) 2 alkyl. In some embodiments of formula (I), R a is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazole, -(CH 2 ) r dihydrotetrazole, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x , -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHS(O) 2is alkyl. In other embodiments, R a is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , tetrazole, -(CH 2 )tetrazole, oxadiazolone, -(CH 2 )oxadiazolone, tetrazolone, -(CH 2 )tetrazolone, thiadiazole, -(CH 2 )thiadiazole, isoxazol-3-ol, -(CH 2 )isoxazol-3-ol, -P(O)(OH)OR x , -(CH 2 )P(O)(OH)OR x , -S(O) 2 OH, -(CH 2 )S(O) 2 OH, -C(O)NHCN, -(CH 2 )C(O)NHCN, -C(O)NHS(O) 2 alkyl, or -(CH 2 )C(O)NHS(O) 2 alkyl. In other embodiments, R a is hydrogen, CO 2 R x , CH 2 CO 2 R x , tetrazole, or oxadiazolone. In further embodiments, R a is hydrogen, CO 2 H, CH 2 CO 2 H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one.
[0061] In some embodiments of formula (I), R b is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , -(CH2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazole, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x 、-(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHS(O) 2 alkyl. In other embodiments, R b is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x 、tetrazole, -(CH 2 )tetrazole, oxadiazolone, -(CH 2 )oxadiazolone, tetrazole, -(CH 2 )tetrazole, thiadiazole, -(CH 2 )thiadiazole, isoxazol-3-ol, -(CH 2 )isoxazol-3-ol, -P(O)(OH)OR x 、-(CH 2 )P(O)(OH)OR x 、-S(O) 2 OH, -(CH 2 )S(O) 2 OH, -C(O)NHCN, -(CH 2 )C(O)NHCN, -C(O)NHS(O) 2 alkyl, or -(CH 2 )C(O)NHS(O) 2 alkyl. In other embodiments, R b is hydrogen, CO2 R x 、 CH 2 CO 2 R x 、 tetrazole, or oxadiazolone. In a further embodiment, R b is hydrogen, CO 2 H, CH 2 CO 2 H, tetrazole, or 1,2,4 - oxadiazol - 5(4H) - one. In a further embodiment, R b is hydrogen.
[0062] In some embodiments of formula (I), R c is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x 、 -CO 2 R x or NO 2 . In other embodiments, R c is C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x 、 -CO 2 R x or NO 2 . In other embodiments, R c is halogen, -CN, -OR x or C 1 -C 6 alkyl. In other embodiments, R c is halogen, -CN, -OR x or C 1 -C 3 alkyl. In other embodiments, R c is H, -CN or halogen. In other embodiments, R c is -CN or halogen.
[0063] In some embodiments of formula (I), R dis methyl, an optionally substituted 5- to 10-membered aryl, an optionally substituted 5- or 6-membered heteroaryl, or an optionally substituted 5- or 6-membered carbocycle. In other embodiments, R d is methyl, optionally cyclohexyl, optionally substituted pyridinyl, optionally substituted thiazolyl, optionally substituted phenyl, or optionally substituted thienyl. In other embodiments, R d is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, each optionally substituted with one or more substituents independently selected from halogen, C 1 -C 6 alkyl, C 1 -C 6 hydroxyalkyl, C 1 -C 6 alkoxy, C 1 -C 6 haloalkyl, C 1 -C 6 haloalkoxy, -OH, CN and amino. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, each optionally substituted with one or more substituents independently selected from halogen, C 1 -C 6 alkyl, C 1 -C 6 hydroxyalkyl, C 1 -C 6 alkoxy, C 1 -C 6 haloalkyl, and C 1 -C 6 haloalkoxy. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl, or thienyl, each optionally substituted with one or more halogens. In still other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl. In other embodiments, R dis cyclohexyl, pyridinyl, thiazolyl, phenyl, 4-chlorophenyl, 4-methylphenyl or thienyl.
[0064] In some embodiments of formula (I), each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y 、C 1 -C 6 haloalkyl, -NHR z 、-OH or -CN. In other embodiments, C 1 -C 4 alkyl, C 2 -C 4 alkenyl, C 2 -C 4 alkynyl, halogen, -OR y 、C 1 -C 4 haloalkyl, -NHR z 、-OH or -CN.
[0065] In some embodiments of formula (I), R f is H or absent. In other embodiments, R f is H. In other embodiments, when the N to which R f is attached is involved in a double bond, R f is absent.
[0066] In some embodiments of formula (I), R x is hydrogen or C 1 -C 6 alkyl. In other embodiments, R x is hydrogen or C 1 -C 3 alkyl. In further embodiments, R x is hydrogen, methyl, ethyl, n-propyl or isopropyl.
[0067] In some embodiments of formula (I), R y is, independently, hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl. In other embodiments, R y is hydrogen or C 1 -C 3 alkyl, or C 1 -C 3 haloalkyl.
[0068] In some embodiments of formula (I), each R z is, independently, hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl. In other embodiments, R z is hydrogen or C 1 -C 3 alkyl, or C 1 -C 3 haloalkyl.
[0069] In some embodiments of formula (I), m is 0, 1 or 2. In other embodiments, m is 0. In other embodiments, m is 1. In still other embodiments, m is 2.
[0070] In some embodiments of formula (I), p is 0, 1 or 2. In other embodiments, p is 0. In other embodiments, p is 1. In still other embodiments, p is 2.
[0071] In some embodiments of formula (I), m + p < 3.
[0072] In some embodiments of formula (I), q is 0, 1, or 2. In other embodiments, q is 0. In other embodiments, q is 1. In other embodiments, q is 2.
[0073] In some embodiments of formula (I), r is 0 or 1. In other embodiments, r is 0. In other embodiments, r is 1.
[0074] In some embodiments of formula (I), the dotted line is a single bond. In other embodiments, the dotted line is a double bond.
[0075] In some embodiments of formula (I), R a and R b one of which is hydrogen and the other is CO 2 R x 、CH 2 CO 2 R x 、tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen and R a is CH 2 CO 2 H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).
[0076] In some embodiments of formula (I), R b is hydrogen, R c is -CN, R d is thienyl, R a is CH 2 CO 2 H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).
[0077] In some embodiments of formula (I), R c is halogen, R a is -CO 2 H, and R b is H. In other embodiments, R c is -Br, R a is -CO 2 H, and R b is H. In further embodiments, R c is -Cl, R a is -CO 2 H, and R b is H.
[0078] In some embodiments of formula (I), R c is halogen, R a is tetrazole, and R b is H. In other embodiments, R c is -Br, R a is tetrazole, and R b is H. In further embodiments, R c is -Cl, R a is tetrazole, and R b is H.
[0079] In some embodiments of formula (I), R c is halogen, R a is -CH 2 CO 2 H, and R b is H. In other embodiments, R c is -Br, R a is -CH 2 CO 2 H, and R b is H. In further embodiments, R c is -Cl, R a is -CH 2 CO 2 H, and R b is H.
[0080] In some embodiments of formula (I), R c is halogen, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c is -Br, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c is -Cl, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H.
[0081] In some embodiments of formula (I), R c is -CN, R a is -CO 2 H, and R b is H. In other embodiments, R c is -CN, R a is -CH 2 CO 2 H, and R b is H. In other embodiments, R c is -CN, R a is tetrazole, and R b is H. In still other embodiments, R c is -CN, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H.
[0082] In some embodiments of formula (I), R c is not hydrogen or -CN, X is O, L is -SCH 2 -, and R d is optionally substituted phenyl. In other embodiments, R c is C 1 -C 6 alkyl, X is O, L is -SCH 2 -, and R d is methyl. In other embodiments, R c is not -CN, X is O, L is -SCH 2 -, and R d is 2-furyl.
[0083] In some embodiments of formula (I), when X is O, L is -SCH 2 -, and R d is optionally substituted phenyl, R c is not hydrogen or -CN.
[0084] In some embodiments of formula (I), when X is O, L is -SCH 2 -, and R d is methyl, R c is C 1-C 6 is not alkyl.
[0085] In some embodiments of formula (I), X is O, L is -SCH 2 -, and when R d is 2-furyl, R c is not -CN.
[0086] In one embodiment, the compound of formula (I) is of formula (Ia):
Chemical formula
[0087] In some embodiments of formula (Ia), L is -CH 2 CH 2 -, -CH 2 C(O)-, -C(O)CH 2 -, -NR 2 CH 2 -, -CH 2 NR 2 -, -OCH 2 -, -CH 2 O-, -SCH 2-, -CH 2 S-, -S(O)CH 2 -, -CH 2 S(O)-, -CH 2 S(O) 2 -, or -S(O) 2 CH 2 -; Y is O, N or S(O) q -; R 1 is C 6 -C 10 aryl or heteroaryl, and aryl and heteroaryl are substituted by R a and R b and optionally substituted by one or more R e -; R 2 is H or C 1 -C 6 alkyl; R a and R b one of them is hydrogen and the other is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazolone, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x , -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r , -(CH 2 ) r C(O)NHS(O) 2 alkyl; R c is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x , -CO 2 R x or NO 2 and; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; each R x is, in each occurrence, independently hydrogen or C 1 -C 6 alkyl; each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; each R y and R z are independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; each m and p is independently 0, 1, or 2, and m + p < 3; q is 0, 1, or 2; r is 0 or 1; provided that when L is -SCH 2 -, and R d is optionally substituted phenyl, R c is not hydrogen or -CN, and when L is -SCH 2 -, and R d is methyl, R c is C 1 -C6 Rather than alkyl, L is -SCH 2 -, R d When is 2-furyl, R c is not -CN.
[0088] In some embodiments of formula (Ia), L is -(CH 2 ) m CH 2 CH 2 -, -(CH 2 ) m Y(CH 2 ) p -, -(CH 2 ) m C(O)(CH 2 ) p -, -(CH 2 ) m C(O)O(CH 2 ) p -, -(CH 2 ) m C(O)NR 2 (CH 2 ) p -, or -(CH 2 ) m NR 2 C(O)(CH 2 ) p is. In other embodiments, L is -CH 2 CH 2 -, -CH 2 CH 2 CH 2 -, -SCH 2 -, -SCH 2 CH 2 -, -CH 2 S-, -CH 2 SCH 2 -, -CH 2 CH 2 S-, -S(O)CH 2 -, -S(O)CH 2 CH 2 -, -CH 2 S(O)-, -CH 2 S(O)CH 2 -, -CH 2 CH 2 S(O)-, -S(O) 2 CH 2-,-S(O) 2 CH 2 CH 2 -,-CH 2 S(O) 2 -,-CH 2 S(O) 2 CH 2 -,-CH 2 CH 2 S(O) 2 -,-OCH 2 -,-OCH 2 CH 2 -,-CH 2 O-,-CH 2 OCH 2 -,-CH 2 CH 2 O-,-NR 2 CH 2 -,-CH 2 NR 2 -,-CH 2 NR 2 CH 2 -,-CH 2 CH 2 NR 2 -,-NR 2 CH 2 CH 2 -,-C(O)CH 2 -,-C(O)CH 2 CH 2 -,-C(O)O-,-C(O)OCH 2 -,-CH 2 C(O)O-,-C(O)NR 2 -,-C(O)NR 2 CH 2 -,-NR 2 C(O),-NR 2 C(O)CH 2 Or-CH 2 NR 2 C(O).In other embodiments,L is-CH 2 CH 2 -,-CH 2 CH 2 CH 2 -,-SCH 2 -,-SCH 2 CH 2 -,-S(O)CH 2 -,-S(O)CH 2 CH2 -,-S(O) 2 CH 2 -,-S(O) 2 CH 2 CH 2 -,-OCH 2 -,-OCH 2 CH 2 -,-NR 2 CH 2 -,-NR 2 CH 2 CH 2 -,-C(O)CH 2 -,-C(O)CH 2 CH 2 -,-C(O)O-,-C(O)OCH 2 -,-CH 2 C(O)O-,-C(O)NR 2 -,-C(O)NR 2 CH 2 -,-NR 2 C(O)or-NR 2 C(O)CH 2 is. In other embodiments, L is -CH 2 CH 2 -,-CH 2 C(O)-,-C(O)CH 2 -,-NR 2 CH 2 -,-CH 2 NR 2 -,-OCH 2 -,-CH 2 O-,-SCH 2 -,-CH 2 S-,-S(O)CH 2 -,-CH 2 S(O)-,-CH 2 S(O) 2 -or-S(O) 2 CH 2 -.
[0089] In some embodiments of formula (Ia), R 1 is C 6 -C 10 is aryl or heteroaryl, and aryl and heteroaryl are R a and R b are substituted, and one or more Re is optionally substituted in some cases. In other embodiments, R 1 is R a and R b substituted, and optionally one or more R e substituted C 6 -C 10 is aryl. In other embodiments, R 1 is R a and R b substituted, and optionally one or more R e substituted heteroaryl. In further embodiments, R 1 is R a and R b substituted, and optionally one or more R e substituted phenyl.
[0090] In some embodiments of formula (Ia), R a is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazolone, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x , -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHS(O) 2 alkyl. In other embodiments, R ais -(CH 2 ) r CO 2 R x 、 -OCH 2 CO 2 R x 、 tetrazole, -(CH 2 )tetrazole, oxadiazolone, -(CH 2 )oxadiazolone, tetrazolone, -(CH 2 )tetrazolone, thiadiazole, -(CH 2 )thiadiazole, isoxazol - 3 - ol, -(CH 2 )isoxazol - 3 - ol, -P(O)(OH)OR x 、 -(CH 2 )P(O)(OH)OR x 、 -S(O) 2 OH、 -(CH 2 )S(O) 2 OH、 -C(O)NHCN、 -(CH 2 )C(O)NHCN、 -C(O)NHS(O) 2 alkyl, or -(CH 2 )C(O)NHS(O) 2 alkyl. In other embodiments, R a is hydrogen, CO 2 R x 、 CH 2 CO 2 R x 、 tetrazole, or oxadiazolone. In further embodiments, R a is hydrogen, CO 2 H、 CH 2 CO 2 H、 tetrazole, or 1,2,4 - oxadiazol - 5(4H) - one.
[0091] In some embodiments of formula (Ia), R b is -(CH 2 ) r CO 2 R x 、 -OCH 2 CO 2 R x 、 -(CH 2 ) rTetrazole, -(CH 2 ) r Oxadiazolone, -(CH 2 ) r Tetrazolone, -(CH 2 ) r Thiadiazole, -(CH 2 ) r Isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x 、-(CH 2 ) r S(O) 2 OH、-(CH 2 ) r C(O)NHCN、 or -(CH 2 ) r C(O)NHS(O) 2 alkyl. In other embodiments, R b is, -(CH 2 ) r CO 2 R x 、-OCH 2 CO 2 R x 、Tetrazole, -(CH 2 )Tetrazole, Oxadiazolone, -(CH 2 )Oxadiazolone, Tetrazolone, -(CH 2 )Tetrazolone, Thiadiazole, -(CH 2 )Thiadiazole, Isoxazol-3-ol, -(CH 2 )Isoxazol-3-ol, -P(O)(OH)OR x 、-(CH 2 )P(O)(OH)OR x 、-S(O) 2 OH、-(CH 2 )S(O) 2 OH、-C(O)NHCN、-(CH 2 )C(O)NHCN、-C(O)NHS(O) 2 alkyl、 or -(CH 2 )C(O)NHS(O) 2 alkyl. In other embodiments, R b is hydrogen, CO 2 R x, CH 2 CO 2 R x , tetrazole, or oxadiazolone. In a further embodiment, R b is hydrogen, CO 2 H, CH 2 CO 2 H, tetrazole, or 1,2,4 - oxadiazol - 5(4H) - one. In a further embodiment, R b is hydrogen.
[0092] In some embodiments of formula (Ia), R c is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x , -CO 2 R x or NO 2 . In other embodiments, R c is C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x , -CO 2 R x or NO 2 . In other embodiments, R c is halogen, -CN, -OR x or C 1 -C 6 alkyl. In other embodiments, R c is halogen, -CN, -OR x or C 1 -C 3 alkyl. In other embodiments, R c is H, -CN or halogen. In other embodiments, R c is -CN or halogen.
[0093] In some embodiments of formula (Ia), R dis methyl, an optionally substituted 5- to 10-membered aryl, an optionally substituted 5- or 6-membered heteroaryl, or an optionally substituted 5- or 6-membered carbocycle. In other embodiments, R d is methyl, optionally cyclohexyl, optionally substituted pyridinyl, optionally substituted thiazolyl, optionally substituted phenyl, or optionally substituted thienyl. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, each of which is halogen, C 1 -C 6 alkyl, C 1 -C 6 hydroxyalkyl, C 1 -C 6 alkoxy, C 1 -C 6 haloalkyl, C 1 -C 6 haloalkoxy, -OH, CN and amino, and is optionally substituted with one or more substituents independently selected therefrom. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, each of which is halogen, C 1 -C 6 alkyl, C 1 -C 6 hydroxyalkyl, C 1 -C 6 alkoxy, C 1 -C 6 haloalkyl, and C 1 -C 6 haloalkoxy, and is optionally substituted with one or more substituents independently selected therefrom. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more halogens. In other embodiments, R d is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl. In yet other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl. In other embodiments, R dis cyclohexyl, pyridinyl, thiazolyl, phenyl, 4-chlorophenyl, 4-methylphenyl or thienyl.
[0094] In some embodiments of formula (Ia), each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y 、C 1 -C 6 haloalkyl, -NHR z 、-OH or -CN. In other embodiments, C 1 -C 4 alkyl, C 2 -C 4 alkenyl, C 2 -C 4 alkynyl, halogen, -OR y 、C 1 -C 4 haloalkyl, -NHR z 、-OH or -CN.
[0095] In some embodiments of formula (Ia), R x is hydrogen or C 1 -C 6 alkyl. In other embodiments, R x is hydrogen or C 1 -C 3 alkyl. In further embodiments, R x is hydrogen, methyl, ethyl, n-propyl or isopropyl.
[0096] In some embodiments of formula (Ia), R y is independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl. In other embodiments, R y is hydrogen or C 1 -C 3 alkyl, or C1 -C 3 is a haloalkyl.
[0097] In some embodiments of formula (Ia), each R z is independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl. In other embodiments, R z is hydrogen or C 1 -C 3 alkyl, or C 1 -C 3 haloalkyl.
[0098] In some embodiments of formula (Ia), m is 0, 1 or 2. In other embodiments, m is 0. In other embodiments, m is 1. In still other embodiments, m is 2.
[0099] In some embodiments of formula (Ia), p is 0, 1 or 2. In other embodiments, p is 0. In other embodiments, p is 1. In still other embodiments, p is 2.
[0100] In some embodiments of formula (Ia), q is 0, 1 or 2. In other embodiments, q is 0. In other embodiments, q is 1. In other embodiments, q is 2.
[0101] In some embodiments of formula (Ia), r is 0 or 1. In other embodiments, r is 0. In other embodiments, r is 1.
[0102] In some embodiments of formula (Ia), one of R a and R b is hydrogen and the other is CO 2 R x , CH 2 CO 2 R x , tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen and R ais CH 2 CO 2 H, tetrazole, or (1,2,4 - oxadiazol - 5(4H) - one).
[0103] In some embodiments of formula (Ia), R b is hydrogen, R c is - CN, R d is thienyl, R a is CH 2 CO 2 H, tetrazole, or (1,2,4 - oxadiazol - 5(4H) - one).
[0104] In some embodiments of formula (Ia), R c is halogen, R a is - CO 2 H, R b is H. In other embodiments, R c is - Br, R a is - CO 2 H, R b is H. In further embodiments, R c is - Cl, R a is - CO 2 H, R b is H.
[0105] In some embodiments of formula (Ia), R c is halogen, R a is tetrazole, R b is H. In other embodiments, R c is - Br, R a is tetrazole, R b is H. In further embodiments, R c is - Cl, R a is tetrazole, R b is H.
[0106] In some embodiments of formula (Ia), R c is halogen, R a is - CH 2 CO 2is H, and R b is H. In other embodiments, R c is -Br, and R a is -CH 2 CO 2 H, and R b is H. In further embodiments, R c is -Cl, and R a is -CH 2 CO 2 H, and R b is H.
[0107] In some embodiments of formula (Ia), R c is halogen, R a is (1,2,4 - oxadiazol - 5(4H) - one), and R b is H. In other embodiments, R c is -Br, R a is (1,2,4 - oxadiazol - 5(4H) - one), and R b is H. In other embodiments, R c is -Cl, R a is (1,2,4 - oxadiazol - 5(4H) - one), and R b is H.
[0108] In some embodiments of formula (Ia), R c is -CN, R a is -CO 2 H, and R b is H. In other embodiments, R c is -CN, R a is -CH 2 CO 2 H, and R b is H. In other embodiments, R c is -CN, R a is tetrazole, and R b is H. In still further embodiments, R c is -CN, R a is (1,2,4 - oxadiazol - 5(4H) - one), and R b is H.
[0109] In some embodiments of formula (Ia), R c is not hydrogen or -CN, L is -SCH 2 -, and R d is optionally substituted phenyl. In other embodiments, R c is not C 1 -C 6 alkyl, L is -SCH 2 -, and R d is methyl. In other embodiments, R c is not -CN, L is -SCH 2 -, and R d is 2-furyl.
[0110] In some embodiments of formula (Ia), when L is -SCH 2 - and R d is optionally substituted phenyl, R c is not hydrogen or -CN.
[0111] In some embodiments of formula (Ia), when L is -SCH 2 - and R d is methyl, R c is not C 1 -C 6 alkyl.
[0112] In some embodiments of formula (Ia), when L is -SCH 2 - and R d is 2-furyl, R c is not -CN.
[0113] In another embodiment, the compound of formula (I) is of formula (Ib):
Chemical formula
[0114] In some embodiments of formula (Ib), one of R a and R b is hydrogen and the other is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazolone, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x , -(CH 2 ) r S(O) 2 OH, -(CH 2 ) rC(O)NHCN, or -(CH 2 ) r C(O)NHS(O) 2 is alkyl; R c is C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x , -CO 2 R x or NO 2 ; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; Each R x is, independently in each occurrence, hydrogen or C 1 -C 6 alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; Provided that when R d is optionally substituted phenyl, R c is not hydrogen or -CN, and when R d is methyl, R c is not C 1 -C 6 alkyl, and when R d is 2-furyl, R c is not -CN.
[0115] In some embodiments of formula (Ib), R a and R b one of them is hydrogen and the other is CO 2 Rx -CH 2 CO 2 R x is tetrazole or oxadiazolone; R c is halogen, -CN, -OR x , or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; Each R y and R z are independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; n is 0, 1, 2 or 3; Provided that when R d is optionally substituted phenyl, R c is not -CN, and when R d is methyl, R c is not C 1 -C 6 alkyl, and when R d is 2-furyl, R c is not -CN.
[0116] In some embodiments of formula (Ib), Ra is -(CH 2 ) r CO 2 R x 、 -OCH 2 CO 2 R x 、 -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazole, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol - 3 - ol, -(CH 2 ) r P(O)(OH)OR x 、 -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHS(O) 2 alkyl. In other embodiments, R a is -(CH 2 ) r CO 2 R x 、 -OCH 2 CO 2 R x 、 tetrazole, -(CH 2 )tetrazole, oxadiazolone, -(CH 2 )oxadiazolone, tetrazole, -(CH 2 )tetrazole, thiadiazole, -(CH 2 )thiadiazole, isoxazol - 3 - ol, -(CH 2 )isoxazol - 3 - ol, -P(O)(OH)OR x 、 -(CH 2 )P(O)(OH)OR x 、 -S(O) 2 OH, -(CH 2 )S(O) 2 OH, -C(O)NHCN, -(CH2 )C(O)NHCN, -C(O)NHS(O) 2 alkyl, or -(CH 2 )C(O)NHS(O) 2 alkyl. In other embodiments, R a is hydrogen, CO 2 R x , CH 2 CO 2 R x , tetrazole, or oxadiazolone. In further embodiments, R a is hydrogen, CO 2 H, CH 2 CO 2 H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one.
[0117] In some embodiments of formula (Ib), R b is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazolone, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x , -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHS(O) 2 alkyl. In other embodiments, R b is -(CH 2 ) r CO2 R x 、 -OCH 2 CO 2 R x 、 tetrazole, -(CH 2 )tetrazole, oxadiazolone, -(CH 2 )oxadiazolone, tetrazolone, -(CH 2 )tetrazolone, thiadiazole, -(CH 2 )thiadiazole, isoxazol - 3 - ol, -(CH 2 )isoxazol - 3 - ol, -P(O)(OH)OR x 、 -(CH 2 )P(O)(OH)OR x 、 -S(O) 2 OH, -(CH 2 )S(O) 2 OH, -C(O)NHCN, -(CH 2 )C(O)NHCN, -C(O)NHS(O) 2 alkyl, or -(CH 2 )C(O)NHS(O) 2 alkyl. In other embodiments, R b is hydrogen, CO 2 R x 、 CH 2 CO 2 R x 、 tetrazole, or oxadiazolone. In further embodiments, R b is hydrogen, CO 2 H, CH 2 CO 2 H, tetrazole, or 1,2,4 - oxadiazol - 5(4H) - one. In further embodiments, R b is hydrogen.
[0118] In some embodiments of formula (Ib), R c is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x 、 -CO 2 R x or NO 2is. In other embodiments, R c is C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x -CO 2 R x or NO 2 is. In other embodiments, R c is halogen, -CN, -OR x or C 1 -C 6 alkyl. In other embodiments, R c is halogen, -CN, -OR x or C 1 -C 3 alkyl. In other embodiments, R c is H, -CN or halogen. In other embodiments, R c is -CN or halogen.
[0119] In some embodiments of formula (Ib), R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle. In other embodiments, R d is methyl, optionally cyclohexyl, optionally substituted pyridinyl, optionally substituted thiazolyl, optionally substituted phenyl, or optionally substituted thienyl. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, each of which is halogen, C 1 -C 6 alkyl, C 1 -C 6 hydroxyalkyl, C 1 -C 6 alkoxy, C 1 -C 6 haloalkyl, C 1 -C 6 haloalkoxy, -OH, CN and amino, optionally substituted with one or more substituents independently selected from. In other embodiments, Rd is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, each optionally substituted with one or more substituents independently selected from halogen, C 1 -C 6 alkyl, C 1 -C 6 hydroxyalkyl, C 1 -C 6 alkoxy, C 1 -C 6 haloalkyl, and C 1 -C 6 haloalkoxy. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl, or thienyl, each optionally substituted with one or more halogens. In other embodiments, R d is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl. In yet other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl, 4-chlorophenyl, 4-methylphenyl or thienyl.
[0120] In some embodiments of formula (Ib), each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN. In other embodiments, C 1 -C 4 alkyl, C 2 -C 4 alkenyl, C 2 -C 4 alkynyl, halogen, -OR y , C 1 -C4 haloalkyl, -NHR z , -OH or -CN.
[0121] In some embodiments of formula (Ib), R x is hydrogen or C 1 -C 6 alkyl. In other embodiments, R x is hydrogen or C 1 -C 3 alkyl. In further embodiments, R x is hydrogen, methyl, ethyl, n-propyl or isopropyl.
[0122] In some embodiments of formula (Ib), R y is independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl. In other embodiments, R y is hydrogen or C 1 -C 3 alkyl, or C 1 -C 3 haloalkyl.
[0123] In some embodiments of formula (Ib), each R z is independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl. In other embodiments, R z is hydrogen or C 1 -C 3 alkyl, or C 1 -C 3 haloalkyl.
[0124] In some embodiments of formula (Ib), n is 0, 1, 2 or 3. In other embodiments, n is 0 or 1. In further embodiments, n is 0.
[0125] In some embodiments of formula (Ib), R a and Rb One of them is hydrogen and the other is CO 2 R x , CH 2 CO 2 R x , tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen, R a is CH 2 CO 2 H, tetrazole, or (1,2,4 - oxadiazol - 5(4H) - one).
[0126] In some embodiments of formula (Ib), R b is hydrogen, R c is - CN, R d is thienyl, R a is CH 2 CO 2 H, tetrazole, or (1,2,4 - oxadiazol - 5(4H) - one).
[0127] In some embodiments of formula (Ib), R c is halogen, R a is - CO 2 H, R b is H. In other embodiments, R c is - Br, R a is - CO 2 H, R b is H. In further embodiments, R c is - Cl, R a is - CO 2 H, R b is H.
[0128] In some embodiments of formula (Ib), R c is halogen, R a is tetrazole, R b is H. In other embodiments, R c is - Br, R a is tetrazole, R b is H. In further embodiments, R c is - Cl, Ra is tetrazole, and R b is H.
[0129] In some embodiments of formula (Ib), R c is halogen, and R a is -CH 2 CO 2 H, and R b is H. In other embodiments, R c is -Br, and R a is -CH 2 CO 2 H, and R b is H. In further embodiments, R c is -Cl, and R a is -CH 2 CO 2 H, and R b is H.
[0130] In some embodiments of formula (Ib), R c is halogen, and R a is (1,2,4 - oxadiazol - 5(4H) - one), and R b is H. In other embodiments, R c is -Br, and R a is (1,2,4 - oxadiazol - 5(4H) - one), and R b is H. In other embodiments, R c is -Cl, and R a is (1,2,4 - oxadiazol - 5(4H) - one), and R b is H.
[0131] In some embodiments of formula (Ib), R c is -CN, and R a is -CO 2 H, and R b is H. In other embodiments, R c is -CN, and R a is -CH 2 CO 2 H, and R b is H. In other embodiments, R cis -CN, and R a is tetrazole, and R b is H. In yet other embodiments, R c is -CN, and R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H.
[0132] In some embodiments of formula (Ib), R c is not hydrogen or -CN, and R d is optionally substituted phenyl. In other embodiments, R c is C 1 -C 6 alkyl, and R d is methyl. In other embodiments, R c is not -CN, and R d is 2-furyl.
[0133] In some embodiments of formula (Ib), when R d is optionally substituted phenyl, R c is not hydrogen or -CN.
[0134] In some embodiments of formula (Ib), when R d is methyl, R c is C 1 -C 6 alkyl.
[0135] In some embodiments of formula (Ib), when R d is 2-furyl, R c is not -CN.
[0136] In another embodiment, the compound of formula (I) is of formula (II):
Chemical formula
[0137] In some embodiments of formula (II), R c is halogen, -CN, -OR x or C 1 -C 6 is alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 is alkyl, provided that when R d is methyl, R c is C 1 -C 6 is not alkyl, and when R d is 2-furyl, R c is not -CN.
[0138] In some embodiments of formula (II), R c is halogen, -CN, -OR x or C 1 -C 6 is alkyl. In other embodiments, R cis halogen, -CN, -OR x or C 1 -C 3 is alkyl. In a further embodiment, R c is -CN or halogen.
[0139] In some embodiments of formula (II), R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, each optionally substituted with one or more substituents independently selected from halogen, C 1 -C 6 alkyl, C 1 -C 6 hydroxyalkyl, C 1 -C 6 alkoxy, C 1 -C 6 haloalkyl, C 1 -C 6 haloalkoxy, -OH, CN and amino. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, each optionally substituted with one or more substituents independently selected from halogen, C 1 -C 6 alkyl, C 1 -C 6 hydroxyalkyl, C 1 -C 6 alkoxy, C 1 -C 6 haloalkyl, and C 1 -C 6 haloalkoxy. In other embodiments, R d is cyclohexyl, pyridinyl, thiazolyl, phenyl, or thienyl, each optionally substituted with one or more halogens. In a further embodiment, R d is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl.
[0140] In some embodiments of formula (II), R b is hydrogen, CO 2 R x 、CH 2 CO 2 R x 、tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen, CO 2 H, CH 2 CO 2 H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one. In further embodiments, R b is hydrogen.
[0141] In some embodiments of formula (II), R a is hydrogen, CO 2 R x 、CH 2 CO 2 R x 、tetrazole, or oxadiazolone. In further embodiments, R a is hydrogen, CO 2 H, CH 2 CO 2 H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one.
[0142] In some embodiments of formula (II), each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y 、C 1 -C 6 haloalkyl, -NHR z 、-OH or -CN.
[0143] In some embodiments of formula (II), each R y is independently hydrogen, C 1 -C 6 alkyl, or C1 -C 6 is a haloalkyl.
[0144] In some embodiments of formula (II), each R z is, independently, hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 is a haloalkyl.
[0145] In some embodiments of formula (II), n is 0, 1, 2 or 3. In other embodiments, n is 0 or 1. In further embodiments, n is 0.
[0146] In some embodiments of formula (II), one of R a and R b is hydrogen and the other is CO 2 R x CH 2 CO 2 R x tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen and R a is CH 2 CO 2 H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).
[0147] In some embodiments of formula (II), R b is hydrogen, R c is -CN, R d is thienyl, R a is CH 2 CO 2 H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).
[0148] In some embodiments of formula (II), R c is halogen, R a is -CO 2 H, and R b is H. In other embodiments, R c is -Br, Ra is -CO 2 is H, and R b is H. In a further embodiment, R c is -Cl, and R a is -CO 2 is H, and R b is H.
[0149] In some embodiments of formula (II), R c is halogen, R a is tetrazole, R b is H. In other embodiments, R c is -Br, R a is tetrazole, R b is H. In a further embodiment, R c is -Cl, R a is tetrazole, R b is H.
[0150] In some embodiments of formula (II), R c is halogen, R a is -CH 2 CO 2 is H, and R b is H. In other embodiments, R c is -Br, R a is -CH 2 CO 2 is H, and R b is H. In a further embodiment, R c is -Cl, R a is -CH 2 CO 2 is H, and R b is H.
[0151] In some embodiments of formula (II), R c is halogen, R a is (1,2,4 - oxadiazol - 5(4H) - one), R b is H. In other embodiments, R c is -Br, R a is (1,2,4 - oxadiazol - 5(4H) - one), Rb is H. In other embodiments, R c is -Cl, and R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H.
[0152] In some embodiments of formula (II), R c is -CN, and R a is -CO 2 H, and R b is H. In other embodiments, R c is -CN, and R a is -CH 2 CO 2 H, and R b is H. In other embodiments, R c is -CN, and R a is tetrazole, and R b is H. In still other embodiments, R c is -CN, and R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H.
[0153] In some embodiments of formula (I), (Ia), (Ib) and (II), one of R a or R b is a carboxylic acid or a biological equivalent of a carboxylic acid.
[0154] In some embodiments of formula (I), (Ia), (Ib) and (II), R a is -CO 2 H, -(CH 2 )CO 2 H or -OCH 2 CO 2 H. In other embodiments, R a is -CO 2 CH 3 、-CO 2 CH 2 CH 3 、-CO 2 CH 2 CH 2 CH 3, -CO 2 CH(CH 3 ) 2 , -(CH 2 )CO 2 CH 3 , -(CH 2 )CO 2 CH 2 CH 3 , -(CH 2 )CO 2 CH 2 CH 2 CH 3 , or -(CH 2 )CO 2 CH(CH 3 ) 2 .
[0155] In some embodiments of formulas (I), (Ia), (Ib) and (II), R a is -P(O)(OH)OH, -(CH 2 )P(O)(OH)OH, -P(O)(OH)OCH 3 , -P(O)(OH)OCH 2 CH 3 , -P(O)(OH)OCH 2 CH 2 CH 3 , -P(O)(OH)OCH(CH 3 ) 2 , -(CH 2 )P(O)(OH)OCH 3 , -(CH 2 )P(O)(OH)OCH 2 CH 3 , -(CH 2 )P(O)(OH)OCH 2 CH 2 CH 3 , or -(CH 2 )P(O)(OH)OCH(CH 3 ) 2 .
[0156] In some embodiments of formulas (I), (Ia), (Ib) and (II), R a is -S(O) 2 OH, -(CH 2 )S(O) 2OH, -C(O)NHCN, or -(CH 2 )C(O)NHCN.
[0157] In some embodiments of formulas (I), (Ia), (Ib), and (II), R a is -C(O)NHS(O) 2 CH 3 , -C(O)NHS(O) 2 CH 2 CH 3 , -C(O)NHS(O) 2 CH 2 CH 2 CH 3 , -C(O)NHS(O) 2 CH(CH 3 ) 2 , -(CH 2 )C(O)NHS(O) 2 CH 3 , -(CH 2 )C(O)NHS(O) 2 CH 2 CH 3 , -(CH 2 )C(O)NHS(O) 2 CH 2 CH 2 CH 3 , or -(CH 2 )C(O)NHS(O) 2 CH(CH 3 ) 2 .
[0158] In some embodiments of formulas (I), (Ia), (Ib), and (II), R a is
Chemical formula
Chemical formula
[0159] In some embodiments of formulas (I), (Ia), (Ib), and (II), R a is [Chemistry] or [Chemistry] is.
[0160] In some embodiments of formulas (I), (Ia), (Ib) and (II), R b is -CO 2 H, -(CH 2 )CO 2 H or -OCH 2 CO 2 H. In other embodiments, R b is -CO 2 CH 3 , -CO 2 CH 2 CH 3 , -CO 2 CH 2 CH 2 CH 3 , -CO 2 CH(CH 3 ) 2 , -(CH 2 )CO 2 CH 3 , -(CH 2 )CO 2 CH 2 CH 3 , -(CH 2 )CO 2 CH 2 CH 2 CH 3 , or -(CH 2 )CO 2 CH(CH 3 ) 2 is.
[0161] In some embodiments of formulas (I), (Ia), (Ib) and (II), R b is -P(O)(OH)OH, -(CH 2 )P(O)(OH)OH, -P(O)(OH)OCH 3 , -P(O)(OH)OCH2 CH 3 、 -P(O)(OH)OCH 2 CH 2 CH 3 、 -P(O)(OH)OCH(CH 3 ) 2 、 -(CH 2 )P(O)(OH)OCH 3 、 -(CH 2 )P(O)(OH)OCH 2 CH 3 、 -(CH 2 )P(O)(OH)OCH 2 CH 2 CH 3 、 or -(CH 2 )P(O)(OH)OCH(CH 3 ) 2 is.
[0162] In some embodiments of formula (I), (Ia), (Ib) and (II), R b is -S(O) 2 OH, -(CH 2 )S(O) 2 OH, -C(O)NHCN, or -(CH 2 )C(O)NHCN.
[0163] In some embodiments of formula (I), (Ia), (Ib) and (II), R b is -C(O)NHS(O) 2 CH 3 、 -C(O)NHS(O) 2 CH 2 CH 3 、 -C(O)NHS(O) 2 CH 2 CH 2 CH 3 、 -C(O)NHS(O) 2 CH(CH 3 ) 2 、 -(CH 2 )C(O)NHS(O) 2 CH 3 、 -(CH 2 )C(O)NHS(O) 2 CH 2 CH 3 、 -(CH2 )C(O)NHS(O) 2 CH 2 CH 2 CH 3 、 or -(CH 2 )C(O)NHS(O) 2 CH(CH 3 ) 2 is.
[0164] In some embodiments of Formulas (I), (Ia), (Ib) and (II), R b is
Chem.
Chem.
[0165] In some embodiments of Formulas (I), (Ia), (Ib) and (II), R b is
Chem.
Chem.
[0166] In some embodiments, the present disclosure
Chem.
Chem.
[0167] In some embodiments, the present disclosure [Chemical formula] [Chemical formula] [Chemical formula] and [Chemical formula] provide a compound selected from the group consisting of or a pharmaceutically acceptable salt thereof.
[0168] In some embodiments, the present disclosure [Chemical formula] and [Chemical formula] provide a compound selected from the group consisting of or a pharmaceutically acceptable salt or tautomer thereof.
[0169] In some embodiments, the present disclosure [Chemical formula] and [Chemical formula] provide a compound selected from the group consisting of or a pharmaceutically acceptable salt or tautomer thereof.
[0170] In some embodiments, the present disclosure provides a compound of the following formula or a pharmaceutically acceptable salt or tautomer thereof: [Chemical formula]
[0171] In some embodiments, the present disclosure provides a compound of the following formula or a pharmaceutically acceptable salt or tautomer thereof:
Chemical formula
[0172] In some embodiments, the present disclosure provides a compound of the following formula or a pharmaceutically acceptable salt or tautomer thereof:
Chemical formula
[0173] In some embodiments, the present disclosure provides a compound of the following formula or a pharmaceutically acceptable salt or tautomer thereof:
Chemical formula
[0174] The above definition of the compound of formula (I) is referred to herein by expressions such as "the compound of formula (I)" or simply "the compound of formula (I)" as defined herein. The above definition of the compound of formula (Ia) is referred to herein by expressions such as "the compound of formula (Ia)" or simply "the compound of formula (Ia)" as defined herein. The above definition of the compound of formula (Ib) is referred to herein by expressions such as "the compound of formula (Ib)" or simply "the compound of formula (Ib)" as defined herein. The above definition of the compound of formula (II) is referred to herein by expressions such as "the compound of formula (II)" or simply "the compound of formula (II)" as defined herein. It should be understood that these references are intended to include not only the above general formulas but also various embodiments described below. Unless otherwise stated, such references are also understood to include isomers, mixtures of isomers, pharmaceutically acceptable salts, solvates, and prodrugs of the compounds of formula (I), formula (Ia), formula (Ib), and formula (II).
[0175] As used herein, the term "alkyl" refers to a saturated straight-chain or branched hydrocarbon chain. The hydrocarbon chain preferably contains 1 to 8 carbon atoms (C 1-8 -alkyl), more preferably 1 to 6 carbon atoms (C 1-6 -alkyl), particularly 1 to 4 carbon atoms (C 1-4 -alkyl), and includes methyl, ethyl, propyl, isopropyl, butyl, isobutyl, secondary butyl, tertiary butyl, pentyl, isopentyl, neopentyl, tertiary pentyl, hexyl, isohexyl, heptyl, and octyl. In a preferred embodiment, "alkyl" represents a C 1-4 -alkyl group, particularly including methyl, ethyl, propyl, isopropyl, butyl, isobutyl, secondary butyl, and tertiary butyl. Correspondingly, the term "alkylene" means the corresponding biradical (-alkyl-).
[0176] As used herein, the term "cycloalkyl" or "carbocycle" preferably refers to a ring containing 3 to 10 carbon atoms (C 3-10-cycloalkyl or C 3-10 -carbocyclic ring), for example 3 to 8 carbon atoms (C 3-8 -cycloalkyl or C 3-10 -carbocyclic ring), preferably 3 to 6 carbon atoms (C 3-6 -cycloalkyl or C 3-10 -carbocyclic ring) refers to a cyclic alkyl group containing, including cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl. Further, as used herein, the term "cycloalkyl" may also include polycyclic groups such as bicyclo[2.2.2]octyl, bicyclo[2.2.1]heptanyl, decalinyl, and adamantyl. Correspondingly, the term "cycloalkylene" means the corresponding biradical (-cycloalkyl-). The alkyl group and the cycloalkyl group may optionally be substituted with 1 to 4 substituents. Examples of substituents on the alkyl group include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclic, hydroxyl, carbamoyl, oxo and -CN.
[0177] As used herein, the term "alkenyl" refers to a straight-chain or branched hydrocarbon chain or cyclic hydrocarbon containing one or more double bonds, including dienes, trienes and polyenes. Typically, the alkenyl group has 2 to 8 carbon atoms (C 2-8 -alkenyl), for example 2 to 6 carbon atoms (C 2-6 -alkenyl), especially 2 to 4 carbon atoms (C 2-4-alkenyl), and contains at least one double bond. Examples of alkenyl groups include ethenyl; 1- or 2-propenyl; 1-, 2- or 3-butenyl, or 1,3-butadienyl; 1-, 2-, 3-, 4- or 5-hexenyl, or 1,3-hexadienyl, or 1,3,5-hexatrieneyl; 1-, 2-, 3-, 4-, 5-, 6- or 7-octenyl, or 1,3-octadienyl, or 1,3,5-octatrieneyl, or 1,3,5,7-octatetraeneyl, or cyclohexenyl. Correspondingly, the term "alkenylene" means the corresponding biradical (-alkenyl-). The alkenyl group may optionally be substituted with 1 to 4 substituents. Examples of substituents on the alkenyl group include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclic, hydroxyl, carbamoyl, oxo and -CN.
[0178] As used herein, the term "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds, including diynes, triynes and polyynes. Typically, the alkynyl group contains at least one triple bond and has 2 to 8 carbon atoms (C 2-8 -alkynyl), for example 2 to 6 carbon atoms (C 2-6 -alkynyl), especially 2 to 4 carbon atoms (C 2-4-alkynyl). Examples of preferred alkynyl groups include ethynyl; 1- or 2-propynyl; 1-, 2- or 3-butynyl, or 1,3-butadiynyl; 1-, 2-, 3-, 4- or 5-hexynyl, or 1,3-hexadiynyl, or 1,3,5-hexatriynyl; 1-, 2-, 3-, 4-, 5-, 6-, or 7-octynyl, or 1,3-octadiynyl, or 1,3,5-octatriynyl, or 1,3,5,7-octatetrayl. Correspondingly, the term "alkynylene" means the corresponding biradical (-alkynyl-). The alkenyl group may optionally be substituted with 1 to 4 substituents. Examples of substituents on the alkynyl group include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclic, hydroxyl, carbamoyl, oxo and -CN.
[0179] As used herein, the terms "halo" and "halogen" refer to fluoro, chloro, bromo or iodo. Thus, a trihalomethyl group represents, for example, a trifluoromethyl group or a trichloromethyl group. Preferably, the terms "halo" and "halogen" refer to fluoro or chloro.
[0180] As used herein, the term "haloalkyl" refers to an alkyl group as defined herein that is substituted one or more times with one or more halogens. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, pentafluoroethyl, trichloromethyl, and the like.
[0181] As used herein, the term "alkoxy" refers to an "alkyl-O-" group, where alkyl is as defined above.
[0182] As used herein, the term "hydroxyalkyl" refers to an alkyl group (as defined above herein), which alkyl group is substituted one or more times with hydroxy. Examples of hydroxyalkyl groups include HO-CH 2 -, HO-CH 2 -CH 2 -, CH 3 -CH(OH)-.
[0183] As used herein, the term "oxy" refers to the "-O-" group.
[0184] As used herein, the term "oxo" refers to the "=O" group.
[0185] As used herein, the term "amine" refers to primary (R-NH 2 , R≠H), secondary ((R) 2 -NH, (R) 2 ≠H) and tertiary ((R) 3 -N, R≠H) amines. Substituted amines are intended to mean amines in which at least one of the hydrogen atoms is replaced by a substituent.
[0186] As used herein, the term "carbamoyl" refers to the "H 2 N(C=O)-" group.
[0187] As used herein, the term "aryl", unless otherwise specified, includes a carbocyclic aromatic ring system derived from an aromatic hydrocarbon by removal of a hydrogen atom. Aryl further includes bicyclic, tricyclic and polycyclic systems. Examples of preferred aryl moieties include phenyl, naphthyl, indenyl, indanyl, fluorenyl, biphenyl, indenyl, naphthyl, anthracenyl, phenanthrenyl, pentalenyl, azulenyl and biphenylenyl. Preferred "aryl", unless otherwise specified, is phenyl, naphthyl or indanyl, particularly phenyl. Any aryl used may optionally be substituted. Correspondingly, the term "arylene" means the corresponding diradical (-aryl-). The aryl group may optionally be substituted with 1 to 4 substituents. Examples of substituents on the aryl group include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclic, hydroxyl, and -CN.
[0188] As used herein, the term "heteroaryl" refers to an aromatic group containing one or more heteroatoms selected from O, S, and N, preferably 1 to 4 heteroatoms, more preferably 1 to 3 heteroatoms. Heteroaryl further includes bicyclic, tricyclic, and polycyclic groups, wherein at least one ring of the group is aromatic and at least one of the rings contains a heteroatom selected from O, S, and N. Heteroaryl also includes ring systems substituted with one or more oxo moieties. Examples of preferred heteroaryl moieties include N-hydroxy-tetrazolyl, N-hydroxy-triazolyl, N-hydroxy-imidazolyl, furanyl, triazolyl, pyranyl, thiadiazinyl, benzothiophenyl, dihydro-benzo[b]thiophenyl, xanthenyl, isoindanyl, acridinyl, benzisoxazolyl, quinolinyl, isoquinolinyl, pteridinyl, azepinyl, diazepinyl, imidazolyl, thiazolyl, carbazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, oxazolyl, isothiazolyl, pyrrolyl, indolyl, benzimidazolyl, benzofuranyl, cinnolinyl, indazolyl, indolizinyl, phthalazinyl, triazinyl, isoindolyl, purinyl, oxadiazolyl, thiadiazolyl, furazanyl, benzofurazanyl, benzothiophenyl, benzotriazolyl, benzothiazolyl, benzoxazolyl, quinazolinyl, quinoxalinyl, naphthyridinyl, dihydroquinolyl, tetrahydroquinolyl, dihydroisoquinolyl, tetrahydroisoquinolyl, benzofuryl, furopyridinyl, pyrrolopyrimidinyl, azaindolyl, pyrazolinyl, 1,2,4-oxadiazol-5(4H)-one, and pyrazolidinyl. Non-limiting examples of partially hydrogenated derivatives are 1,2,3,4-tetrahydronaphthyl, 1,4-dihydronaphthyl, and 1-octalin. Correspondingly, the term "heteroarylene" means the corresponding biradical (-heteroaryl-). The heteroaryl group may optionally be substituted with 1 to 4 substituents.Examples of substituents on the heteroaryl group include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclic, hydroxyl, and -CN.
[0189] As used herein, the term "heterocyclyl" refers to a cyclic non-aromatic group containing one or more heteroatoms selected from O, S, and N, preferably 1 to 4 heteroatoms, more preferably 1 to 3 heteroatoms. Heterocyclyl further includes bicyclic, tricyclic, and polycyclic non-aromatic groups, and at least one of the rings contains a heteroatom selected from O, S, and N. Heterocyclyl also includes ring systems substituted with one or more oxo moieties. Examples of heterocyclic groups include oxetane, pyrrolidinyl, pyrrolyl, 3H-pyrrolyl, oxolanyl, furanyl, thiolanyl, thiophenyl, pyrazolyl, pyrazolidinyl, imidazolyl, imidazolidinyl, 3H-pyrazolyl, 1,2-oxazolyl, 1,3-oxazolyl, 1,2-thiazolyl, 1,3-thiazolyl, 1,2,5-oxadiazolyl, piperidinyl, pyridinyl, oxanyl, 2-H-pyranyl, 4-H-pyranyl, thianyl, 2H-thiopyranyl, pyridazinyl, 1,2-diazinanil, pyrimidinyl, 1,3-diazinanil, pyrazinyl, piperazinyl, 1,4-dioxinyl, 1,4-dioxanyl, 1,3-diazinanil, 1,4-oxazinyl, morpholinyl, thiomorpholinyl, 1,4-oxathianyl, benzofuranyl, isobenzofuranyl, indazolyl, benzimidazolyl, quinolinyl, isoquinolinyl, chromanyl, isochromanyl, 4H-chromenyl, 1H-isochromenyl, cinnolinyl, quinazolinyl, quinoxalinyl, phthalazinyl, purinyl, naphthyridinyl, pteridinyl, indolizinyl, 1H-pyrrolidinyl, 4H-quinolizinyl, and aza-8-bicyclo[3.2.1]octane. Correspondingly, the term "heterocyclylene" means the corresponding biradical ( -heterocyclyl-). The heterocyclyl group may optionally be substituted with 1 to 4 substituents. Examples of substituents on the heterocyclyl group include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclic, hydroxyl, and -CN.
[0190] As used herein, the term "N - heterocycle" refers to a heterocyclyl or heteroaryl as defined above herein that has at least one nitrogen atom and is bonded through the nitrogen atom. Examples of such N - heterocycles are pyrrolidinyl, pyrrolyl, 3H - pyrrolyl, pyrazolyl, pyrazolidinyl, imidazolyl, imidazolidinyl, 3H - pyrazolyl, 1,2 - oxazolyl, 1,2 - thiazolyl, 1,3 - thiazolyl, piperidinyl, pyridinyl, pyridazinyl, pyrazinyl, piperazinyl, morpholinyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazolyl, pyrazinyl, tetrazolyl, and the like.
[0191] In this specification, the structural formula of a compound may, for convenience, represent a certain isomer, but the present disclosure includes all isomers such as geometric isomers, optical isomers based on asymmetric carbons, stereoisomers, tautomers, and the like. Thus, it should be understood that the definitions of the compounds of formulas (I), (Ia), (Ib) and (II) include cis - trans isomers, stereoisomers and tautomers, and racemic mixtures of these and their pharmaceutically acceptable salts, including all individual isomers corresponding to formulas: formulas (I), (Ia), (Ib) and (II). Thus, the definitions of the compounds of formulas (I), (Ia), (Ib) and (II) are also intended to encompass all R - and S - isomers of the chemical structure in any ratio, for example, an enrichment of one of the possible isomers (i.e., enantiomeric excess or diastereomeric excess) and the corresponding smaller ratio of the other isomers. Also, for the compounds represented by formulas (I), (Ia), (Ib), (II), there may be crystal polymorphs. Note that any crystalline form, a mixture of crystalline forms, or their anhydrides or hydrates are included within the scope of the present disclosure. Also, so - called metabolites produced by the in - vivo degradation of the present compounds are included within the scope of the present disclosure.
[0192] "Isomers" means compounds that have the same molecular formula but differ in the order of bonding of their atoms or in the arrangement of those atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers". Stereoisomers that are not mirror images of each other are called "diastereoisomers", and stereoisomers that are mirror images that cannot be superimposed on each other are called "enantiomers" or sometimes optical isomers. A mixture containing equal amounts of the individual enantiomeric forms of opposite chirality is called a "racemic mixture".
[0193] A carbon atom bonded to four different substituents is called a "chiral center".
[0194] "Chiral isomers" means compounds having at least one chiral center. Compounds having two or more chiral centers can exist as individual diastereomers or as a mixture of diastereomers called a "mixture of diastereomers". When there is one chiral center, the stereoisomers can be characterized by the absolute configuration (R or S) of that chiral center. The absolute configuration refers to the spatial arrangement of the substituents bonded to the chiral center. The substituents bonded to the chiral center under consideration are ranked according to the sequence rules of Cahn, Ingold and Prelog. (Cahn et al., Angew. Chem. Inter. Edit. 1966, 5, 385; errata 511; Cahn et al., Angew. Chem. 1966, 78, 413; Cahn and Ingold, J. Chem. Soc. 1951 (London), 612; Cahn et al., Experientia 1956, 12, 81; Cahn, J. Chem. Educ. 1964, 41, 116).
[0195] Diastereoisomers, i.e., stereoisomers that cannot be superimposed, can be separated by conventional means such as chromatography, distillation, crystallization or sublimation. Optical isomers can be obtained by resolution of a racemic mixture by conventional methods, for example, by formation of diastereoisomeric salts by treatment with an optically active acid or base. Examples of suitable acids include, but are not limited to, tartaric acid, diacetyl tartaric acid, dibenzoyl tartaric acid, ditoluoyl tartaric acid and camphorsulfonic acid. The mixture of diastereomers can be separated by crystallization, followed by liberation of the optically active base from these salts. Alternative processes for the separation of optical isomers include the use of a chiral chromatography column optimally selected to maximize the separation of enantiomers. Yet another available method involves the synthesis of covalent diastereoisomeric molecules by reacting a compound of formula (I), (Ia), (Ib) or (II) with an optically pure acid or an optically pure isocyanate in an activated form. The synthesized diastereoisomers can be separated by conventional means such as chromatography, distillation, crystallization or sublimation and then hydrolyzed to obtain enantiomerically pure compounds. The optically active compounds of formula (I), (Ia), (Ib) and (II) can likewise be obtained by utilizing optically active starting materials and / or by utilizing chiral catalysts. These isomers can be in the form of the free acid, free base, ester or salt. Examples of chiral separation techniques are given in "Chiral Separation Techniques, A Practical Approach, 2nd ed" Subramanian, Wiley-VCH, 2001.
[0196] "Geometric isomers" means diastereomers whose existence is due to hindrance to rotation about a double bond. These configurations are distinguished by the prefixes cis and trans or Z and E, which indicate whether the groups are on the same or opposite sides of the double bond in the molecule according to the Cahn-Ingold-Prelog rules.
[0197] Furthermore, the structures and other compounds discussed in this disclosure include all of their atropisomers. "Atropisomers" are a type of stereoisomer in which the atoms of two isomers are spatially differently arranged. The existence of atropisomers results from restricted rotation caused by hindrance to the rotation of large groups around the central bond. Such atropisomers typically exist as a mixture, but as a result of recent advances in chromatography techniques, it has become possible to separate a mixture of two atropisomers when selected.
[0198] A "tautomer" is one of two or more structural isomers that exist in equilibrium and are readily convertible from one isomeric form to another. This conversion results in a formal shift of a hydrogen atom accompanied by the switching of adjacent conjugated double bonds. Tautomers exist as a mixture of a tautomeric set in solution. In the solid form, usually one tautomer is dominant. In a solution where tautomerization is possible, a chemical equilibrium of tautomers is reached. The exact ratio of tautomers depends on several factors including temperature, solvent, and pH. The concept of tautomers that are interconvertible by tautomerization is called tautomerism.
[0199] Of the various types of tautomerism that are possible, two are generally observed. In keto-enol tautomerism, a simultaneous shift of an electron and a hydrogen atom occurs. Ring-chain tautomerism results from the reaction of an aldehyde group (-CHO) in a sugar molecule with one of the hydroxy groups (-OH) in the same molecule, giving a cyclic (ring-shaped) form as shown by glucose.
[0200] Common tautomeric pairs are keto-enol, amide-nitrile, lactam-lactim, amide-imino acid tautomerism in heterocycles (e.g., in nucleobases such as guanine, thymine, and cytosine), amine-enamine, and enamine-enamine. It should be understood that the compounds of the present disclosure may be shown as different tautomers. When a compound has tautomeric forms, it is intended that all tautomeric forms are included within the scope of the present disclosure, and it should also be understood that the naming of the compound does not exclude any tautomeric form.
[0201] The terms "crystalline polymorph", "polymorph", or "crystalline form" mean that a compound (or its salt or solvate) can crystallize in different crystal packing arrangements and all of them have crystal structures with the same elemental composition. Different crystalline forms usually have different X-ray diffraction patterns, infrared spectra, melting points, densities, hardness, crystal shapes, optical and electrical properties, stability, and solubility. Depending on the recrystallization solvent, crystallization rate, storage temperature, and other factors, one crystalline form may become dominant. The crystalline polymorphs of a compound can be prepared by crystallization under different conditions.
[0202] Furthermore, the compounds of the present disclosure, such as salts of the compounds, can exist in hydrated or non-hydrated (anhydrous) forms, or as solvates with other solvent molecules. Non-limiting examples of hydrates include monohydrates, dihydrates, etc. Non-limiting examples of solvates include ethanol solvates, acetone solvates, etc.
[0203] "Solvate" means a solvent addition form containing a stoichiometric or non-stoichiometric amount of a solvent. Some compounds tend to trap a certain molar ratio of solvent molecules in the crystalline solid state and thus form solvates. When the solvent is water, the solvate formed is a hydrate, and when the solvent is an alcohol, the solvate formed is an alcoholate. Hydrates are formed by the combination of one or more molecules of water with one of the substances that retains its molecular state as H 2 O.
[0204] This disclosure is intended to cover all isotopes of atoms that are present in the compounds. Isotopes include atoms having the same atomic number but different mass numbers. General examples, without limitation, include tritium and deuterium as isotopes of hydrogen, and C-13 and C-14 as isotopes of carbon.
[0205] Throughout the description and claims of this specification, the terms "comprise" and "contain" and their variations, such as "comprising" and "comprises", mean "including but not limited to", and do not exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, unless the context requires otherwise, the singular form encompasses the plural. In particular, when an indefinite article is used, the specification should be understood as contemplating both the plural and the singular, unless the context requires otherwise.
[0206] All references, including any patents or patent applications cited herein, are hereby incorporated by reference into this specification. No admission is made that any reference constitutes prior art. Further, no admission is made that any prior art forms part of the common general knowledge in the art.
[0207] Process for preparing the compounds of formula (I), (Ia), (Ib) and (II) The compounds of the present disclosure (e.g., the compounds of formula (I), formula (Ia), formula (Ib) and formula (II)) can be prepared by several methods well known to those skilled in the art of organic synthesis. By way of example, the compounds of the present disclosure can be synthesized using the methods described below, together with synthetic methods known in the field of synthetic organic chemistry or variations thereof recognized by those skilled in the art. Preferred methods include, but are not limited to, the methods described below. The final products of the reactions described herein can be isolated by conventional techniques, such as extraction, crystallization, distillation, chromatography, etc.
[0208] The compounds of the present disclosure can be synthesized according to the procedures outlined in General Schemes A - E, which involve different sequences for assembling intermediates Ia - Ih and Ij - Io. The starting materials are either commercially available or prepared by known procedures reported in the literature or as exemplified. Useful procedures that can be employed in the preparation of the compounds are known to those skilled in the art. The following methods are provided as non - limiting examples of how the compounds can be prepared. General Scheme A
Chemical formula
[0209] A general method for preparing the compounds of formula (I) by using intermediates Ia and Ib is outlined in General Scheme A. In a solvent, namely acetonitrile (CH 3 CN), optionally at elevated temperature, with a base, namely potassium carbonate (K 2 CO 3 ), coupling of Ia and Ib gives the desired product of formula (I). Bases that can be used include, but are not limited to, sodium carbonate (Na 2 CO 3 ), potassium carbonate (K 2 CO 3) Examples include N,N - diisopropylethylamine (DIPEA) and triethylamine. The solvent used in the coupling reaction can be a polar solvent or a non - polar solvent. For example, the solvent can be acetonitrile (CH 3 CN), acetone or dimethyl sulfoxide (DMSO). General Scheme B
Chemical formula
[0210] Alternatively, the compound of formula (I) can be prepared using intermediates Ic and Id outlined in General Scheme B. Among solvents such as methanol (MeOH), ethanol (EtOH), water (H 2 O), etc., and bases such as sodium hydroxide (NaOH), potassium hydroxide (KOH), etc., amination of intermediate Ic with Ie provides the compound of formula (I). General Scheme C
Chemical formula
[0211] The compound of formula (I) can also be prepared using intermediates Ie and If outlined in General Scheme C. Solvents such as methanol (MeOH), ethanol (EtOH), water (H2 In the intermediate If using a base such as sodium hydroxide (NaOH), potassium hydroxide (KOH), etc., amidation of Ie provides the compound of formula (I). General Scheme D
Chemical formula
[0212] Alternatively, the compound of formula (I) can also be prepared using intermediates Ig, Ih, Ij, Ik and Im outlined in General Scheme D. Olefination of intermediate Ig in a solvent such as tetrahydrofuran (THF), water (H 2 CO 3 ) using a base, i.e., potassium carbonate (K 2 ) and diethyl (cyanomethyl)phosphonate, gives intermediate Ih. Hydrogenation of Ih using a metal catalyst such as palladium on carbon (Pd / C), platinum dioxide (PtO 2 ) etc., and hydrogen (H 2 ) gas in a solvent such as ethanol (EtOH) and / or tetrahydrofuran (THF) gives intermediate Ij. Intermediate Ik is obtained by treating intermediate Ij with an acid, i.e., hydrochloric acid (HCl), and then treating it with a base, i.e., ammonia (NH 2 Cl 2 ) in a solvent such as ethanol (EtOH), dichloromethane (CH 3 ). Cyclization of intermediates Ik and Im using a base such as sodium hydroxide (NaOH), potassium hydroxide (KOH), etc. in a solvent such as dimethylacetamide (DMA) at a high temperature gives the compound of formula (I). General Scheme E
Chemical formula
[0213] Alternatively, the compound of formula (I) can be prepared using the intermediates In and Io outlined in general scheme D. In a solvent, i.e., methanol (MeOH), ethanol (EtOH), water (H 2 O), etc., acylation of In with intermediate Io using a base, i.e., sodium hydroxide (NaOH), potassium hydroxide (KOH), etc., provides the compound of formula (I).
[0214] A mixture of enantiomers, diastereomers, cis / trans isomers obtained from the above process can be separated into their single components by chromatography using chiral salt technology, normal phase, reverse phase or chiral columns, depending on the nature of the separation.
[0215] In the above description and formulas, various groups R 1 , R 2 , X, L, Y, R a , R b , R c , R d , R e , R f , R x , R y , R z , m, n, p, q, r, and other variables are to be understood as defined above in this specification, unless otherwise indicated. Further, for synthetic purposes, the compounds of general schemes A - E are merely representative examples having radicals selected to illustrate the general synthetic methodology of the compounds of formula (I) defined herein.
[0216] Treatment method The present disclosure provides a method for treating an acute inflammatory condition of a subject, comprising administering a compound of formula (I), formula (Ia), formula (Ib) or formula (II).
[0217] Inflammation is a complex of a series of changes that express the response to damage of cells and neovascularized tissues. When tissue damage occurs, whether it is caused by bacteria, trauma, chemicals, heat, or any other phenomenon, the substance histamine, along with other humoral substances, is released into the surrounding body fluids by the damaged tissue. It is a protective attempt by organisms to remove harmful stimuli and initiate the healing process.
[0218] The main features of the inflammatory response are vasodilation, that is, the dilation of blood vessels to increase blood flow to the area of infection; an increase in vascular permeability that allows the entry of diffusible components to that site; cell infiltration by chemotaxis; or the directed movement of inflammatory cells through the blood vessel wall to the site of injury; changes in the biosynthesis, metabolism, and catabolism profiles of many organs; and the activation of cells of the immune system as well as the activation of complex enzyme systems in plasma. However, inflammation that progresses without being recognized can lead to many diseases including acute hepatitis, acute pancreatitis, acute kidney disease, inflammatory bowel disease, inflammatory liver disease, rheumatoid arthritis, autoimmunity, sepsis, SIRS, and atherosclerosis.
[0219] Acute inflammation is the body's initial response to a harmful stimulus and is achieved by an increase in the movement of plasma and white blood cells from the blood to the damaged tissue. Acute inflammation can be divided into several stages. The initial event of the inflammatory response is a transient vasoconstriction, that is, the narrowing of blood vessels caused by the contraction of smooth muscle in the blood vessel wall, which can be seen as the decolorization (blanching) of the skin. This is followed by several stages that occur minutes, hours, and days later. The first is the acute vascular response that follows within seconds of tissue damage and lasts for several minutes. This results from vasodilation and an increase in capillary permeability due to changes in the vascular endothelium, leading to an increase in blood flow (hyperemia), causing redness (erythema) and the entry of body fluid into the tissue (edema).
[0220] Following the acute vascular response, an acute cellular response can occur over the next few hours. The hallmark of this stage is the appearance of granulocytes, particularly neutrophils, in the tissue. These cells first adhere to the endothelial cells within the blood vessels (margination) and then enter the surrounding tissue (extravasation). During this stage, red blood cells may also leak into the tissue, and bleeding can occur. When a blood vessel is damaged, fibrinogen and fibronectin deposit at the site of injury, platelets aggregate and become activated, and red blood cells stack together in a so-called "rouleaux" formation to stop bleeding and aid in blood clot formation. Dead and dying cells contribute to pus formation. If the injury is sufficiently severe, a chronic cellular response may continue over the next few days. The hallmark of this stage of inflammation is the appearance of a mononuclear cell infiltrate composed of macrophages and lymphocytes. Macrophages are involved in the killing of microorganisms, the removal of cell and tissue debris, and the remodeling of tissue.
[0221] Acute inflammation occurs immediately after injury and is a relatively short-term process that lasts for up to several days. Here, cytokines and chemokines promote the migration of neutrophils and macrophages to the site of inflammation.
[0222] Resident liver macrophages (Kupffer cells) are the first innate immune cells and protect the liver from bacterial infection. Under pathological conditions, they can be activated by different components and differentiate into M1-like (inflammatory) or M2-like (anti-inflammatory) macrophages.
[0223] Kupffer cells are activated to produce various cytokines, eicosanoids, nitric oxide, and oxygen radicals and can play diverse roles in tissue injury and tissue repair. When acute injury is controlled, Kupffer cells and other macrophages suppress inflammation and initiate wound repair by removing debris and producing growth factors and mediators that provide nutritional support to the existing tissue.
[0224] Activation of Kupffer cells is involved in the liver's response to infection or injury; the subsequent inflammatory response protects against infection and limits cell and organ damage to the host organism.
[0225] However, in other types of injury to the liver, Kupffer cells are unable to appropriately control or resolve their activated state. The appropriately controlled resolution of inflammation is an essential feature of the innate immune response. The inability to resolve Kupffer cell activation contributes to many chronic inflammatory diseases in the liver.
[0226] M1 and M2 macrophage populations differ in their ability to respond to different stimuli and repertoires of chemokines / cytokines and receptors expressed after activation. However, both of them become activated macrophages with high synthesis and secretion of inflammatory mediators including cytokines, superoxide, nitric oxide, eicosanoids, chemokines as well as lysosomal and proteolytic enzymes. Furthermore, they exhibit high phagocytic and secretory activities.
[0227] Under physiological conditions, Kupffer cells are the first innate immune cells and protect the liver from bacterial infection. Under pathological conditions, they can be activated by different components and differentiate into M1-like (classical) or M2-like (alternative) macrophages. The metabolism of classically or alternatively activated Kupffer cells will determine their functions in liver injury.
[0228] Kupffer cells are derived from monocytes and differentiate into liver resident macrophages.
[0229] Liver resident Kupffer cells initiate inflammation and help mobilize blood-derived monocytes; both differentiate into pro-inflammatory macrophages and further promote the progression of NAFLD.
[0230] Kupffer cells exhibit M1-like characteristics in acute liver injury with long-term chronic inflammation due to M1-like macrophages and immune cell exhaustion. However, M2-like macrophages emerge and secrete protective cytokines during chronic cytotoxic stimuli such as IL-4, IL-10, and TGF-β.
[0231] The immediate effect of liver injury is an increase in hepatocyte necrosis, which is one of the main sources of Kupffer cell activators.
[0232] Chronic inflammation is inflammation that persists for months or years. In contrast to neutrophils, which are dominant in acute inflammation, macrophages, lymphocytes, and plasma cells are dominant in chronic inflammation. Examples of diseases mediated by chronic inflammation include diabetes, cardiovascular disease, allergies, and chronic obstructive pulmonary disease (COPD).
[0233] Inflammatory cytokines can be divided into two groups: those involved in acute inflammation and those involved in chronic inflammation. Examples of those involved in acute inflammation include IL-1, TNF-α, IL-6, IL-11, IL-8, and other chemokines, G-CSF, and GM-CSF. Cytokines in chronic inflammation can be further subdivided into cytokines that mediate humoral responses, such as IL-4, IL-5, IL-6, IL-7, and IL-13, and cytokines that mediate cellular responses, such as IL-1, IL-2, IL-3, IL-4, IL-7, IL-9, IL-10, IL-12, interferons, transforming growth factor-β, and tumor necrosis factor α and β. Some cytokines contribute to both acute and chronic inflammation.
[0234] As used herein, "cytokine" is a molecule released by cells in response to an infection or injury that stimulates an inflammatory or healing response. Cytokines are produced by various cells of the body. The cytokine superfamily includes interleukins, chemokines, colony-stimulating factors (CSF), interferons, as well as the transforming growth factor (TNF) and tumor necrosis factor (TGF) families.
[0235] Cytokines are small secreted proteins released by cells and have specific effects on cell-cell interactions and communication. Subclasses of cytokines include lymphokines (cytokines made by lymphocytes), monokines (cytokines made by monocytes), chemokines (cytokines with chemotactic activity), and interleukins (cytokines made by one leukocyte and acting on another leukocyte). Cytokines can act on the cells that secrete them (autocrine action), nearby cells (paracrine action), or in some cases distant cells (endocrine action). There are both pro-inflammatory and anti-inflammatory cytokines.
[0236] Various cytokines that induce chemotaxis are known. One subgroup of cytokines is known as chemokines. These factors represent a family of low molecular weight secreted proteins that function primarily in the activation and migration of leukocytes, although some of them also have various other functions. Chemokines have conserved cysteine residues, which allows them to be assigned to four groups: C-C chemokines (RANTES, monocyte chemoattractant protein or MCP-1, monocyte inflammatory protein or MIP-1α, and MIP-1β), C-X-C chemokines (IL-8 is also called growth-related oncogene or GRO / KC), C chemokines (lymphotactin), and CXXXC chemokines (fractalkine).
[0237] The net effect of the inflammatory response can be determined by the balance between pro-inflammatory cytokines and anti-inflammatory cytokines. Pro-inflammatory cytokines are cytokines that promote inflammation. Pro-inflammatory cytokines are mainly produced by activated macrophages and are involved in the upregulation of the inflammatory response. Anti-inflammatory cytokines are a series of immunomodulatory molecules that control the pro-inflammatory cytokine response. Cytokines act in concert with specific cytokine inhibitors and soluble cytokine receptors to regulate the human immune response.
[0238] Pro-inflammatory cytokines are cytokines that promote inflammation. The main pro-inflammatory cytokines that play a role in the initial response are IL-1α, IL-1β, IL-6 and TNF-α. Other pro-inflammatory mediators include members of the IL-20 family, IL-33, LIF, IFN-γ, OSM, CNTF, TGF-β, GM-CSF, IL-11, IL-12, IL-17, IL-18, IL-8, and various other chemokines that chemoattract inflammatory cells. These cytokines either act as endogenous pyrogens (IL-1, IL-6, TNF-α), upregulate the synthesis of secondary mediators and pro-inflammatory cytokines by both macrophages and mesenchymal cells (including fibroblasts, epithelial cells and endothelial cells), stimulate the production of acute-phase proteins, or attract inflammatory cells.
[0239] Anti-inflammatory cytokines are a series of immunomodulatory molecules that control the pro-inflammatory cytokine response. The main anti-inflammatory cytokines include interleukin (IL)-1 receptor antagonist, IL-4, IL-10, IL-11 and IL-13. Under various circumstances, leukemia inhibitory factor, interferon-α, IL-6 and TGF-β are classified as either anti-inflammatory cytokines or pro-inflammatory cytokines.
[0240] Among anti-inflammatory cytokines, IL-10 is a cytokine with anti-inflammatory properties that suppresses the expression of inflammatory cytokines such as TNF-α, IL-6, and IL-1 by activated macrophages. Furthermore, IL-10 can upregulate endogenous anti-cytokines and downregulate pro-inflammatory cytokine receptors.
[0241] IL-6 is produced at the site of inflammation and plays a role in the acute-phase response defined by various clinical and biological features such as the production of acute-phase proteins. In addition, IL-6, in combination with its soluble receptor sIL-6Rα, can direct the transition from acute to chronic inflammation by changing the nature of leukocyte infiltrates (from polymorphonuclear neutrophils to monocytes / macrophages).
[0242] In certain embodiments, the method decreases a pro-inflammatory cytokine or increases an anti-inflammatory cytokine.
[0243] In certain embodiments, the pro-inflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α or TGF-β. In certain embodiments, the pro-inflammatory cytokine is IL-18 or TNF-α. In certain embodiments, the pro-inflammatory cytokine is IL-6. In certain embodiments, the pro-inflammatory cytokine is TGF-β or TNF-α. In certain embodiments, the pro-inflammatory cytokine is IL-1β, IL-6 or TNF-α.
[0244] M1 macrophages, also known as classically activated macrophages, can respond to stimuli such as LPS or IFN-γ and are producers of pro-inflammatory cytokines. M2 macrophages, also known as alternatively activated macrophages, can respond to stimuli such as IL-4 or IL-13 and are producers of anti-inflammatory cytokines.
[0245] In certain embodiments, the pro-inflammatory cytokine is MCP-1, TNF-α or IL-1β, and the pro-inflammatory cytokine decreases.
[0246] In certain embodiments, the pro-inflammatory cytokine is IL-6 and the pro-inflammatory cytokine is decreased.
[0247] In certain embodiments, the anti-inflammatory cytokine is IL-10 (interleukin 10) and the anti-inflammatory cytokine is increased.
[0248] SIRT1, a known important metabolic regulator, can reprogram inflammation by altering histones as well as transcription factors such as NFκB and AP1. Further evidence supports that inflammation continuously links immunity, metabolism, and the mitochondrial bioenergetic network; sirtuins are essential regulators of these networks.
[0249] In certain embodiments, the expression of sirtuin-1 regulatory genes is increased. In certain embodiments, the expression of sirtuin-1 regulatory genes is increased in the liver. In certain embodiments, the expression of sirtuin-1 regulatory genes sod2, tfam, or dda1 is increased. In certain embodiments, the expression of sirtuin-1 regulatory genes sod2, tfam, or dda1 is increased in the liver.
[0250] Inflammation is a cascade of events involving many cellular and humoral mediators. On the one hand, suppression of the inflammatory response can leave the subject immunodeficient. However, if left untreated, inflammation can lead to serious complications including chronic inflammatory diseases (such as asthma, psoriasis, arthritis, rheumatoid arthritis, and multiple sclerosis), septic shock, and multiple organ failure. These diverse conditions share common inflammatory mediators such as cytokines, chemokines, inflammatory cells, and other mediators secreted by these cells.
[0251] Inflammation can be systemic or affect tissues.
[0252] In certain embodiments, the acute inflammatory condition is a systemic inflammatory condition. A systemic inflammatory condition refers to a disease or condition involving at least two organ systems.
[0253] In one embodiment, systemic inflammatory conditions include SIRS and sepsis. In certain embodiments, the systemic inflammatory condition is one or more of SIRS and sepsis. In certain embodiments, the systemic inflammatory condition is one or more of SIRS, abdominal sepsis, and pulmonary sepsis. In certain embodiments, the systemic inflammatory condition may be associated with various infectious diseases, including bacterial, viral, or fungal infections. In certain embodiments, the systemic inflammatory condition may be associated with viral infections such as COVID.
[0254] Systemic inflammatory response syndrome (SIRS) refers to a systemic inflammatory response syndrome without signs of infection. This condition may also be referred to as "non-infectious SIRS" or "SIRS without infection". SIRS may be characterized by the presence of at least two of the following four clinical symptoms: fever or hypothermia (body temperature of 38.0°C (100.4°F) or higher, or body temperature of 36.0°C (96.8°F) or lower); tachycardia (at least 90 beats per minute); tachypnea (at least 20 breaths per minute or PaCO2 less than 4.3 kPa (32.0 mmHg) or the need for mechanical ventilation); and abnormal white blood cell (WBC) count of 12 x 10 6 cells / mL or more, or abnormal WBC count of 4 x 10 6 cells / mL or less, or the presence of more than 10% band forms (immature neutrophils).
[0255] Sepsis refers to a systemic inflammatory condition that occurs as a result of infection. The defined focus of the infection is indicated by either (i) an organism growing in the blood or a sterile site; or (ii) an abscess or infected tissue (e.g., pneumonia, peritonitis, urinary tract, vascular system infection, soft tissue). In one embodiment, the infection can be a bacterial infection. The presence of sepsis is also characterized by the presence of at least two (of the four) systemic inflammatory response syndrome (SIRS) criteria defined above.
[0256] Cytokine storm or hypercytokinemia is a potentially fatal immune reaction, involving a positive feedback loop between cytokines and immune cells, and causing very high levels of various cytokines in the body. Cytokine storm typically involves an increase in the concentration of cytokines such as interferons, interleukins, chemokines, colony-stimulating factors, and tumor necrosis factors. Such immunomodulatory deficiencies can be factors underlying the mortality associated with many infectious diseases.
[0257] The catastrophic antiphospholipid syndrome is a potentially life-threatening condition characterized by diffuse vascular thrombosis and the development of multiple organ failure in a short period in the presence of positive antiphospholipid antibodies (aPL). It has an acute onset, and most cases develop thrombocytopenia, less frequently hemolytic anemia, and disseminated intravascular coagulation. This syndrome is caused by antiphospholipid antibodies that target a group of proteins in the body related to phospholipids. These antibodies activate endothelial cells, platelets, and immune cells, ultimately causing a large inflammatory immune response and extensive coagulation.
[0258] Graft-versus-host disease (GVHD) is a syndrome characterized by inflammation in different organs, with specificity for epithelial cell apoptosis and crypt loss. GVHD is generally associated with bone marrow transplantation, stem cell transplantation, and other forms of transplanted tissue, such as solid organ transplantation. The donor white blood cells of the immune system remaining in the provided tissue (the graft) recognize the recipient (the host) as foreign (non-self). The white blood cells present in the transplanted tissue then attack the recipient's body cells, causing GVHD.
[0259] In certain embodiments, the acute inflammatory condition is systemic inflammatory response syndrome (SIRS), shock, sepsis, cytokine storm, or hypercytokinemia, catastrophic antiphospholipid syndrome, or graft-versus-host disease (GVHD).
[0260] Inflammatory conditions include inflammatory lung conditions. Certain inflammatory lung conditions include infection-induced lung conditions associated with viral, bacterial, fungal, parasitic, or prion infections. Inflammatory conditions include community-acquired pneumonia, hospital-acquired pneumonia, ventilator-associated pneumonia, sepsis, viral pneumonia, influenza infection, parainfluenza infection, rotavirus infection, human metapneumovirus infection, respiratory syncytial virus infection, and aspergillus or other fungal infections. Certain infection-related inflammatory diseases may include viral or bacterial pneumonia, including severe pneumonia, and acute respiratory distress syndrome (ARDS). Such infection-related conditions may include multiple infections such as primary viral infections and secondary bacterial infections.
[0261] In certain embodiments, the acute inflammatory condition is acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), viral infection, bacterial infection, fungal infection, influenza, or pneumonia.
[0262] In certain embodiments, the acute inflammatory condition is cytokine storm or hypercytokinemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.
[0263] In certain embodiments, the acute inflammatory condition is an organ-specific or tissue-specific condition. Certain affected tissues are the pancreas, liver tissue, airways, lungs, gastrointestinal tract, small intestine, large intestine, colon, rectum, cardiovascular system, heart tissue, blood vessels, joints, bone and synovial tissue, cartilage, epithelium, endothelium, or adipose tissue.
[0264] In certain embodiments, the acute inflammatory condition is acute pancreatitis, hepatitis, respiratory condition, or enteritis.
[0265] Pharmaceutical composition The compounds of formula (I), formula (Ia), formula (Ib) or formula (II) can be provided in any form suitable for the intended administration, including in particular pharmaceutically acceptable salts, solvates and prodrugs of the compounds of formula (I), formula (Ia), formula (Ib) or formula (II).
[0266] Pharmaceutically acceptable salts refer to salts of the compounds of formula (I), formula (Ia), formula (Ib) or formula (II) that are considered acceptable for clinical and / or veterinary use. Typical pharmaceutically acceptable salts include salts prepared by the reaction of the compounds of formula (I), formula (Ia), formula (Ib) or formula (II) with inorganic or organic acids or organic or inorganic bases. Such salts are known as acid addition salts and base addition salts, respectively. It will be recognized that the specific counterions forming part of any salt are not of critical importance so long as the salt as a whole is pharmaceutically acceptable and the counterion as a whole does not impart undesirable qualities to the salt. These salts can be prepared by methods known to those skilled in the art. Pharmaceutically acceptable salts are described and discussed, for example, in "Remington's Pharmaceutical Sciences", 17th Ed., Alfonso R. Gennaro (Ed.), Mack Publishing Company, Easton, PA, U.S.A., 1985 and more recent editions, as well as in the "Encyclopedia of Pharmaceutical Technology".
[0267] Examples of pharmaceutically acceptable addition salts include inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, hydroiodic acid, metaphosphoric acid or phosphoric acid; organic acids such as succinic acid, maleic acid, acetic acid, fumaric acid, citric acid, tartaric acid, benzoic acid, trifluoroacetic acid, malic acid, lactic acid, formic acid, propionic acid, glycolic acid, gluconic acid, camphorsulfonic acid, isothionic acid, mucic acid, gentisic acid, isonicotinic acid, saccharinic acid, glucuronic acid, phthalic acid, glutamic acid, ascorbic acid, anthranilic acid, salicylic acid, phenylacetic acid, mandelic acid, embonic acid (pamoic acid), ethanesulfonic acid, pantothenic acid, stearic acid, sulfinic acid, alginic acid and galacturonic acid; acid addition salts formed with arylsulfonic acids such as benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid or naphthalenesulfonic acid; base addition salts formed with alkali metals, alkaline earth metals and organic bases such as N,N-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine), lysine and procaine; and internally formed salts. It is to be understood that all references to pharmaceutically acceptable salts include the solvate addition forms (solvates) or crystalline forms (polymorphs) of the same salts as defined herein.
[0268] The compounds of formula (I), formula (Ia), formula (Ib) or formula (II) or pharmaceutically acceptable salts thereof can be provided in soluble or insoluble forms together with pharmaceutically acceptable solvents such as water, ethanol, etc. Soluble forms can also include hydrated forms such as monohydrate, dihydrate, hemihydrate, trihydrate, tetrahydrate, etc.
[0269] The compounds of formula (I), formula (Ia), formula (Ib) or formula (II), or pharmaceutically acceptable salts thereof, may be provided as prodrugs. As used herein, the term "prodrug" is intended to mean a compound that, when exposed to certain physiological conditions, releases a compound of formula (I), formula (Ia), formula (Ib), or formula (II), or a pharmaceutically acceptable salt thereof, and can then exhibit the desired biological activity. A typical example is an unstable carbamate of an amine.
[0270] Since prodrugs are known to enhance many desirable qualities of pharmaceuticals (e.g., solubility, bioavailability, manufacture, etc.), the compounds of the present disclosure can be delivered in prodrug form. Accordingly, the present disclosure is intended to encompass prodrugs of the presently claimed compounds, methods of delivery thereof, and compositions containing the same. "Prodrug" is intended to include any covalently bonded carrier that releases the active parent drug of the present disclosure in vivo when such prodrug is administered to a subject. Prodrugs of the present disclosure are prepared by modifying a functional group present in the compound such that the modification is cleaved to the parent compound either by normal operation or in vivo. Prodrugs include the compounds of the present disclosure, and hydroxy, amino, sulfhydryl, carboxy or carbonyl groups are bonded to any group and cleaved in vivo to form free hydroxyl, free amino, free sulfhydryl, free carboxy or free carbonyl groups, respectively.
[0271] Examples of prodrugs include esters of hydroxy functional groups (e.g., acetate, dialkylaminoacetate, formate, phosphate, sulfate and benzoate derivatives) and carbamates (e.g., N,N-dimethylaminocarbonyl), esters of carboxyl functional groups (e.g., C 1-6Alkyl esters, such as methyl ester, ethyl ester, 2-propyl ester, phenyl ester, 2-aminoethyl ester, morpholinoethanol ester, etc., N-acyl derivatives (e.g., N-acetyl), N-Mannich bases, Schiff bases of amino functional groups and enaminones, oximes, acetals, ketals and enol esters of ketone and aldehyde functional groups in the compounds of the present disclosure, etc. are included, but not limited thereto. See Bundegaard, H "Design of Prodrugs" p1-92, Elesevier, New York-Oxford (1985).
[0272] The compound or a pharmaceutically acceptable salt, ester or prodrug thereof is administered orally, nasally, transdermally, by the pulmonary, inhalation, buccal, sublingual, intraperitoneal, subcutaneous, intramuscular, intravenous, rectal, intrapleural, intrathecal and parenterally. In one embodiment, the compound is administered orally. Those skilled in the art will recognize the advantages of a particular route of administration.
[0273] The dosing regimen using the present compound is selected according to various factors including the type, species, age, weight, sex and medical condition of the patient: the severity of the condition being treated, the route of administration, the renal or hepatic function of the patient, and the particular compound or its salt being used. A physician or veterinarian skilled in the art can readily determine and prescribe an effective amount of the drug necessary to prevent, counteract or arrest the progression of the condition.
[0274] The techniques for the formulation and administration of the disclosed compounds of the present disclosure are described in "Remington: the Science and Practice of Pharmacy" 19 thIt can be found in the 21st edition, Mack Publishing Co., Easton, PA (1995). In one embodiment, the compounds described herein and their pharmaceutically acceptable salts are used in pharmaceutical formulations in combination with a pharmaceutically acceptable carrier or diluent. Suitable pharmaceutically acceptable carriers include inert solid fillers or diluents and sterile aqueous or organic solutions. The compound is present in such pharmaceutical compositions in an amount sufficient to provide the desired dosage within the ranges described herein.
[0275] In one aspect of the present disclosure, there is provided a pharmaceutical composition comprising at least one compound of formula (I), formula (Ia), formula (Ib) or formula (II) as defined herein, or a pharmaceutically acceptable salt thereof, and optionally one or more pharmaceutically acceptable excipients, diluents and / or carriers as an active ingredient. The compounds of formula (I), formula (Ia), formula (Ib) or formula (II) or their pharmaceutically acceptable salts can be administered either alone or in combination with a pharmaceutically acceptable carrier, diluent or excipient, either as a single dose or as multiple doses. Suitable pharmaceutically acceptable carriers, diluents and excipients include inert solid diluents or fillers, sterile aqueous solutions and various organic solvents.
[0276] A "pharmaceutical composition" is a formulation containing the compounds of the present disclosure in a form suitable for administration to a subject. The pharmaceutical composition can be formulated in accordance with conventional techniques as disclosed in "Remington: the Science and Practice of Pharmacy", 21st Edition, 2000, Lippincott Williams & Wilkins, with a pharmaceutically acceptable carrier or diluent, and any other known adjuvants and excipients.
[0277] As used herein, the phrase "pharmaceutically acceptable" means a compound, material, composition, carrier, and / or dosage form that, within the scope of sound medical judgment, is suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications, and that provides a reasonable benefit / risk ratio without such issues.
[0278] "Pharmaceutically acceptable excipient" means an excipient that is generally safe, non-toxic, and not biologically or otherwise undesirable, and that is useful for preparing pharmaceutical compositions. It includes excipients that are acceptable for veterinary use and human pharmaceutical use. As used herein and in the claims, "pharmaceutically acceptable excipient" includes one and both of two or more such excipients.
[0279] A pharmaceutical composition formed by combining a compound of formula (I), formula (Ia), formula (Ib), or formula (II) as defined herein, or a pharmaceutically acceptable salt thereof, with a pharmaceutically acceptable carrier, diluent, or excipient can be readily administered in various dosage forms such as tablets, powders, lozenges, syrups, suppositories, injection solutions, etc. In a powder, the carrier is a finely divided solid such as talc or starch mixed with the finely divided active ingredient. In a tablet, the active ingredient is mixed with a carrier having the necessary binding properties in an appropriate ratio and compressed into the desired shape and size.
[0280] The pharmaceutical composition can be specifically prepared for administration by any suitable route, such as oral and parenteral (including subcutaneous, intramuscular, intrathecal, intravenous, and intradermal) routes. It will be understood that the preferred route depends on the general condition and age of the subject being treated, the nature of the condition being treated, and the active ingredient selected.
[0281] Examples of pharmaceutical compositions for oral administration include solid dosage forms such as capsules, tablets, dragees, pills, lozenges, powders and granules. Where appropriate, they can be prepared using coatings such as enteric coatings, or can be prepared to provide controlled release of the active ingredient such as sustained release or long-term release according to methods well known in the art.
[0282] For oral administration in the form of tablets or capsules, the compounds of formula (I), formula (Ia), formula (Ib) or formula (II) as defined herein or pharmaceutically acceptable salts thereof can be suitably combined with oral, non-toxic pharmaceutically acceptable carriers such as ethanol, glycerol, water and the like. Furthermore, suitable binders, lubricants, disintegrants, flavoring agents, and coloring agents can be added to the mixture as needed. Examples of suitable binders include, for example, lactose, glucose, starch, gelatin, gum acacia, gum tragacanth, sodium alginate, carboxymethyl cellulose, polyethylene glycol, waxes and the like. Lubricants include, for example, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. Examples of disintegrants include, for example, starch, methyl cellulose, agar, bentonite, xanthan gum, sodium starch glycolate, crospovidone, croscarmellose sodium and the like. Further excipients for capsules include macrogels or lipids.
[0283] For the preparation of solid compositions such as tablets, the active compounds of formula (I), formula (Ia), formula (Ib) or formula (II) or pharmaceutically acceptable salts thereof are mixed with one or more excipients such as those mentioned above and other pharmaceutical diluents such as water to produce a solid pre - formulation composition containing a homogeneous mixture of the compound of formula (I), formula (Ia), formula (Ib) or formula (II) or a pharmaceutically acceptable salt thereof. The term "homogeneous" is understood to mean that the compound of formula (I), formula (Ia), formula (Ib) or formula (II) or a pharmaceutically acceptable salt thereof is uniformly dispersed throughout the composition so that the composition can be readily subdivided into equally effective unit dosage forms such as tablets or capsules.
[0284] Liquid compositions for either oral or parenteral administration of the compound of formula (I), formula (Ia), formula (Ib) or formula (II) or a pharmaceutically acceptable salt thereof include, for example, aqueous solutions, syrups, elixirs, aqueous or oily suspensions, and emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil, or peanut oil. Suitable dispersing or suspending agents for aqueous suspensions include synthetic or natural gums such as tragacanth, alginate, acacia, dextran, sodium carboxymethylcellulose, gelatin, methylcellulose or polyvinylpyrrolidone.
[0285] Pharmaceutical compositions for parenteral administration include sterile aqueous and non - aqueous injections, dispersions, suspensions or emulsions, and sterile powders which are reconstituted in sterile injection or dispersion media before use.
[0286] For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL (trademark) (BASF, Parsippany, N.J.), or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy injectability exists. It must be stable under the conditions of manufacture and storage and must be protected from the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycols, etc.) and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by the use of coatings such as lecithin, by maintaining the particle size required in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it is preferable to include in the composition isotonic agents such as sugars, polyhydric alcohols such as mannitol, sorbitol, and sodium chloride. Prolonged absorption of the injectable composition can be brought about by including in the composition agents that delay absorption, such as aluminum monostearate and gelatin.
[0287] The preparation of all these solutions under sterile conditions can be readily achieved by standard pharmaceutical techniques well known to those skilled in the art.
[0288] For example, sterile injectable solutions can be prepared by incorporating the required amount of the active compound into a suitable solvent with one or a combination of the ingredients enumerated above as required, followed by filtration sterilization. In general, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the other ingredients required from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation are vacuum drying and lyophilization, whereby powders of the active ingredient and any additional desired ingredients are obtained from their previously sterile-filtered solutions. Depot injectable compositions are also contemplated within the scope of the present disclosure.
[0289] For parenteral administration, a solution containing a compound of formula (I), formula (Ia), formula (Ib) or formula (II) or a pharmaceutically acceptable salt thereof in sesame oil or peanut oil, an aqueous propylene glycol solution or a sterile aqueous solution can be used. Such aqueous solutions should be appropriately buffered if necessary, and the liquid diluent should be made isotonic initially with sufficient physiological saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. The oily solutions are suitable for the purposes of intra-articular, intramuscular and subcutaneous injections.
[0290] In addition to the foregoing ingredients, a composition of a compound of formula (I), formula (Ia), formula (Ib) or formula (II) or a pharmaceutically acceptable salt thereof may contain one or more additional ingredients such as a diluent, a buffer, a flavoring agent, a coloring agent, a surfactant, a thickening agent, a preservative such as methyl hydroxybenzoate (including an antioxidant), an emulsifying agent, etc.
[0291] As used herein, the term "therapeutically effective amount" refers to the amount of a pharmaceutical agent that is used to treat, ameliorate or prevent a specified disease, disorder or condition, or to exhibit a detectable therapeutic or inhibitory effect. The effect can be detected by any assay method known in the art. The exact effective amount for a subject depends on the subject's weight, size, and health status; the nature and extent of the condition; and the therapeutic agent or combination of therapeutic agents selected for administration. The therapeutically effective amount for a given situation can be determined by routine experimentation within the skill and judgment of the clinician. In a preferred embodiment, the disease or disorder being treated is a disease or disorder associated with α-amino-β-carboxymuconic acid-ε-semialdehyde decarboxylase (ACMSD) dysfunction. In a preferred embodiment, the disease or disorder being treated is treated by inhibition of α-amino-β-carboxymuconic acid-ε-semialdehyde decarboxylase (ACMSD). In certain embodiments, the disease or disorder is an acute inflammatory condition.
[0292] For any compound, a therapeutically effective amount can first be estimated in cell culture assays, such as in vitro or animal models, usually rats, mice, rabbits, dogs or pigs. Animal models can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful dosages and routes of administration in humans. Therapeutic / preventive efficacy and toxicity are determined by standard pharmaceutical procedures in cell culture or experimental animals, such as ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD 50 / ED 50 . Pharmaceutical compositions showing a large therapeutic index are preferred. The dosage can vary within this range depending on the dosage form used, the sensitivity of the patient, and the route of administration.
[0293] Dosage and administration are adjusted to provide a sufficient level of the active agent or to maintain the desired effect. Factors that may be considered include the severity of the disease state, the general health of the subject, the age, weight and gender of the subject, diet, time and frequency of administration, drug combination, response sensitivity, and tolerance / response to treatment. Long-acting pharmaceutical compositions can be administered once every 3 to 4 days, once a week, or once every 2 weeks depending on the half-life and clearance rate of the particular formulation.
[0294] The appropriate dosage of the compound of formula (I), formula (Ia), formula (Ib) or formula (II) or a pharmaceutically acceptable salt thereof depends on the age and condition of the patient, the severity of the disease being treated, and other factors well known to the practitioner. The compound can be administered according to different dosing schedules, for example daily, or at intervals, for example at intervals of one week, for example orally, parenterally or topically. Generally, a single dose ranges from 0.01 to 500 mg / kg body weight, preferably about 0.05 to 100 mg / kg body weight, more preferably 0.1 to 50 mg / kg body weight, and most preferably 0.1 to 25 mg / kg body weight. The compound can be administered as a bolus (i.e., administering the entire daily dose at once) or in divided doses more than once a day. Variations based on the aforementioned dosage ranges can be made by those skilled in the art taking into account known considerations such as the weight, age and condition of the person being treated, the severity of the pain, and the particular route of administration.
[0295] As used herein, "subject" or "subject in need thereof" is a subject having a disease or disorder that is an acute inflammatory condition. In other embodiments, the subject has a disease or disorder associated with the regulation of α-amino-β-carboxymuconate-ε-semialdehyde decarboxylase (ACMSD). In other embodiments, the subject has a disease or disorder associated with the regulation of NAD + levels. "Subject" includes mammals. The mammal can be, for example, any mammal, for example, a human, a primate, a bird, a mouse, a rat, a poultry, a dog, a cat, a cow, a horse, a goat, a camel, a sheep or a pig. More preferably, the mammal is a human.
[0296] A compound of formula (I), (Ia), (Ib) or (II) or a pharmaceutically acceptable salt thereof may also be prepared in a pharmaceutical composition containing one or more additional active substances either alone or in combination with a pharmaceutically acceptable carrier, diluent or excipient, in either single or multiple doses. Suitable pharmaceutically acceptable carriers, diluents and excipients are as described above herein, and the one or more additional active substances may be any active substance or, preferably, an active substance as described in the "Combined Treatments" section below herein.
[0297] Exemplary embodiments Embodiment I-1. A method of treating an acute inflammatory condition of a subject, comprising administering to the subject a therapeutically effective amount of a compound represented by formula (I):
Chemical formula
[0298] Embodiment I-1a. A method for treating an acute inflammatory condition of a subject, comprising administering to the subject a therapeutically effective amount of a compound represented by formula (I):
Chemical formula
[0299] Embodiment I-2. The compound is of formula (Ia):
Chemical formula
[0300] Embodiment I-3. The compound is of formula (Ib):
Chemical formula
[0301] Embodiment I-4. R a and R b One of them is hydrogen and the other is CO 2 R x , -CH 2 CO 2 R x , tetrazole, or oxadiazolone; R c is halogen, -CN, -OR x , or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; Each R y and R z are independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; n is 0, 1, 2 or 3; However, when R d is phenyl which may be substituted, R c is not hydrogen or -CN, and when R d is 2-furyl, R c is not -CN, The method according to any one of Embodiments I-1 to I-3.
[0302] Embodiment I-5. The compound is of formula (II):
Chemical formula
[0303] Embodiment I-6. R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl, the method according to Embodiment I-5.
[0304] Embodiment I-7. R c is -CN or halogen, the method according to any one of Embodiments I-1 to I-6.
[0305] Embodiment I-8. R d is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, the method according to any one of Embodiments I-1 to I-7.
[0306] Embodiment I-9. R dThe method according to any one of Embodiments I-1 to I-7, wherein is methyl, cyclohexyl, pyridinyl, thiazolyl, thienyl or optionally substituted phenyl.
[0307] Embodiment I-10.R a is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the method according to any one of Embodiments I-1 to I-4.
[0308] Embodiment I-11.R b is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the method according to any one of Embodiments I-1 to I-4.
[0309] The method according to any one of Embodiments I-1 to I-4, wherein n in Embodiment I-12 is 0.
[0310] Embodiment I-13. The compound is
Chemical formula
Chemical formula
[0311] Embodiment I-14. The compound is
Chemical formula
Chemical formula
[0312] Embodiment I-15. The compound is
Chemical formula
Chemical formula
[0313] Embodiment I-16. The compound is
Chemical formula
[0314] Embodiment I-17. The compound is
Chemical formula
[0315] Embodiment I-18. The compound is
Chemical formula
[0316] Embodiment I-19. The compound is
Chemical formula
[0317] Embodiment I-20. The method according to any one of Embodiments I-1 to I-19, wherein the acute inflammatory state is a systemic inflammatory state.
[0318] Embodiment I-21. The method according to any one of Embodiments I-1 to I-19, wherein the acute inflammatory state is an organ-specific state.
[0319] Embodiment I-22. The method according to any one of Embodiments I-1 to I-19, wherein the acute inflammatory state is a cytokine storm or hypercytokinemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.
[0320] Embodiment I-23. The method according to any one of Embodiments I-1 to I-19, wherein the acute inflammatory state is acute pancreatitis, hepatitis, respiratory condition, or enteritis.
[0321] Embodiment I-24. The method according to any one of Embodiments I-1 to I-23, wherein the method reduces a pro-inflammatory cytokine or increases an anti-inflammatory cytokine.
[0322] Embodiment I-25. The method according to Embodiment I-24, wherein the pro-inflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.
[0323] Embodiment I-26. The method according to Embodiment I-24, wherein the pro-inflammatory cytokine is MCP-1, TNF-α, or IL-1β.
[0324] Embodiment I-27. The method according to Embodiment I-24, wherein the pro-inflammatory cytokine is IL-6.
[0325] Embodiment I-28. The method according to Embodiment I-24, wherein the anti-inflammatory cytokine is IL-10.
[0326] Embodiment I-29. The method according to any one of Embodiments I-1 to I-23, wherein the expression of the searchin-1 regulatory genes sod2, tfam, and dda1 is increased in the liver.
[0327] Embodiment I-30. Formula (I):
Chemical formula
[0328] Embodiment I-31. The compound is of formula (Ia):
Chemical formula
[0329] Embodiment I-32. A compound is of formula (Ib):
Chemical formula
[0330] Embodiment I-33. One of R a and R b is hydrogen, and the other is CO 2 R x , -CH 2 CO 2 R x , tetrazole, or oxadiazolone; R c is halogen, -CN, -OR x , or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; Each R y and R zis independently hydrogen, C 1 -C 6 -alkyl, or C 1 -C 6 -haloalkyl; n is 0, 1, 2 or 3; provided that when R d is optionally substituted phenyl, R c is not hydrogen or -CN, and when R d is 2-furyl, R c is not -CN, A compound for use according to any one of Embodiments I-30 to I-32.
[0331] Embodiment I-34. The compound is of formula (II):
Chemical formula
[0332] Embodiment I-35. R c is halogen, -CN, -OR x or C 1 -C 6 -alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 -alkyl, a compound for use according to Embodiment I-34.
[0333] Embodiment I-36. R c is -CN or halogen, a compound for use according to any one of Embodiments I-30 to I-35.
[0334] Embodiment I-37. R dA compound for use according to any one of embodiments I-30 to I-36, wherein is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl.
[0335] Embodiment I-38.R d A compound for use according to any one of embodiments I-30 to I-36, wherein is methyl, cyclohexyl, pyridinyl, thiazolyl, thienyl or optionally substituted phenyl.
[0336] Embodiment I-39.R a is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), a compound for use according to any one of embodiments I-30 to I-33.
[0337] Embodiment I-40.R b is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), a compound for use according to any one of embodiments I-30 to I-33.
[0338] For the use according to any one of embodiments I-30 to I-33, a compound wherein n is 0 in Embodiment I-41.
[0339] Embodiment I-42. The compound is
Chemical formula
Chemical formula
[0340] Embodiment I-43. The compound is [Chem.] and [Chem.] A compound for use according to embodiment I-30, selected from the group consisting of
[0341] Embodiment I-44. The compound is [Chem.] and [Chem.] A compound for use according to embodiment I-30, selected from the group consisting of
[0342] Embodiment I-45. The compound is [Chem.] A compound for use according to embodiment I-30, which is
[0343] Embodiment I-46. The compound is [Chem.] A compound for use according to embodiment I-30, which is
[0344] Embodiment I-47. The compound is [Chem.] A compound for use according to embodiment I-30, which is
[0345] Embodiment I-48. The compound is
Chemical formula
[0346] Embodiment I-49. The acute inflammatory condition is a systemic inflammatory condition, a compound for use according to any one of Embodiments I-30 to I-48.
[0347] Embodiment I-50. The acute inflammatory condition is an organ-specific condition, a compound for use according to any one of Embodiments I-30 to I-48.
[0348] Embodiment I-51. The acute inflammatory condition is a cytokine storm or hypercytokinemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis, a compound for use according to any one of Embodiments I-30 to I-48.
[0349] Embodiment I-52. The acute inflammatory condition is acute pancreatitis, hepatitis, respiratory condition, or enteritis, a compound for use according to any one of Embodiments I-30 to I-48.
[0350] Embodiment I-53. The pro-inflammatory cytokine is decreased or the anti-inflammatory cytokine is increased, a compound for use according to any one of Embodiments I-30 to I-52.
[0351] Embodiment I-54. The pro-inflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α or TGF-β, a compound for use according to Embodiment I-53.
[0352] Compound for use according to embodiment I-53, wherein the inflammation-promoting cytokine is MCP-1, TNF-α or IL-1β.
[0353] Embodiment I-56. Compound for use according to embodiment I-53, wherein the inflammation-promoting cytokine is IL-6.
[0354] Embodiment I-57. Compound for use according to embodiment I-53, wherein the anti-inflammatory cytokine is IL-10.
[0355] Embodiment I-58. Compound for use according to any one of embodiments I-30 to I-52, wherein the expression of the sirtuin-1 regulatory genes sod2, tfam, and dda1 genes is increased in the liver.
[0356] Embodiment I-59. Use of a compound represented by formula (I):
Chemical formula
[0357] Embodiment I-60. The compound is of formula (Ia): [Chemical formula] The use according to Embodiment I-59, which is represented by or a pharmaceutically acceptable salt or tautomer thereof.
[0358] Embodiment I-61. The compound is of formula (Ib): [Chemical formula] The use according to Embodiment I-59 or I-60, which is represented by or a pharmaceutically acceptable salt thereof, and n is 0, 1, 2 or 3.
[0359] Embodiment I-62. One of R a and R b is hydrogen and the other is CO 2 R x , -CH 2 CO 2 R x , tetrazole, or oxadiazolone; R c is halogen, -CN, -OR x , or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl; Each R e is, independently, C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; Each R y and R z is independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; n is 0, 1, 2 or 3; provided that when R d is optionally substituted phenyl, R c is not hydrogen or -CN, and when R d is 2-furyl, R c is not -CN, Use according to any one of Embodiments I-59 to I-61.
[0360] Embodiment I-63. The compound is of formula (II):
Chemical formula
[0361] Embodiment I-64. R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C6 Use according to Embodiment I-63, wherein it is alkyl.
[0362] Embodiment I-65.R c Use according to any one of Embodiments I-59 to I-64, wherein it is -CN or halogen.
[0363] Embodiment I-66.R d Method according to any one of Embodiments I-59 to I-65, wherein it is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl.
[0364] Embodiment I-67.R d Use according to any one of Embodiments I-59 to I-65, wherein it is methyl, cyclohexyl, pyridinyl, thiazolyl, thienyl or optionally substituted phenyl.
[0365] Embodiment I-68.R a is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), use according to any one of Embodiments I-59 to I-62.
[0366] Embodiment I-69.R b is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), use according to any one of Embodiments I-59 to I-62.
[0367] Use according to any one of Embodiments I-59 to I-62, wherein in Embodiment I-70, n is 0.
[0368] Embodiment I-71. The compound is
Chemical formula
Chemical formula
[0369] Embodiment I-72. The compound is
Chemical formula
Chemical formula
[0370] Embodiment I-73. The compound is
Chemical formula
Chemical formula
[0371] Embodiment I-74. The compound is
Chemical formula
[0372] Embodiment I-75. The compound is
Chemical formula
[0373] Embodiment I-76. The use according to Embodiment I-59, wherein the compound is [Chemical formula] or a pharmaceutically acceptable salt thereof.
[0374] Embodiment I-77. The use according to Embodiment I-59, wherein the compound is [Chemical formula] or a pharmaceutically acceptable salt thereof.
[0375] Embodiment I-78. The use according to any one of Embodiments I-59 to I-77, wherein the acute inflammatory condition is a systemic inflammatory condition.
[0376] Embodiment I-79. The use according to any one of Embodiments I-59 to I-77, wherein the acute inflammatory condition is an organ-specific condition.
[0377] Embodiment I-80. The use according to any one of Embodiments I-59 to I-77, wherein the acute inflammatory condition is a cytokine storm or hypercytokinemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.
[0378] Embodiment I-81. The use according to any one of Embodiments I-59 to I-77, wherein the acute inflammatory condition is acute pancreatitis, hepatitis, respiratory condition, or enteritis.
[0379] Embodiment I-82. The use according to any one of Embodiments I-59 to I-81, wherein the pro-inflammatory cytokine is decreased or the anti-inflammatory cytokine is increased.
[0380] Use according to embodiment I-82, wherein the inflammation-promoting cytokine is IL-1β, IL-6, IL-18, TNF-α or TGF-β.
[0381] Use according to embodiment I-82, wherein the inflammation-promoting cytokine is MCP-1, TNF-α or IL-1β.
[0382] Use according to embodiment I-82, wherein the inflammation-promoting cytokine is IL-6.
[0383] Use according to embodiment I-82, wherein the anti-inflammatory cytokine is IL-10.
[0384] Use according to any one of embodiments I-59 to I-81, wherein the expression of the sirtuin-1 regulatory genes sod2, tfam, and dda1 genes is increased in the liver.
[0385] Embodiment I-88. Use of a compound represented by formula (I):
Chemical formula
[0386] Embodiment I-89. The compound is of formula (Ia):
Chemical formula
[0387] Embodiment I-90. The compound is of formula (Ib):
Chemical formula
[0388] Embodiment I-91. R a and R b One of them is hydrogen and the other is CO 2 R x , -CH 2 CO 2 R x , tetrazole, or oxadiazolone; R c is halogen, -CN, -OR x , or C 1 -C 6 alkyl; R dis methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y 、C 1 -C 6 haloalkyl, -NHR z 、-OH or -CN; Each R y and R z are independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; n is 0, 1, 2 or 3; Provided that when R d is optionally substituted phenyl, R c is not hydrogen or -CN, and when R d is 2-furyl, R c is not -CN, Use according to any one of Embodiments I-88 to I-90.
[0389] Embodiment I-92. The compound is of formula (II):
Chemical formula
[0390] Embodiment I-93. R c is halogen, -CN, -OR x or C 1 -C6 is alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 is alkyl, the use according to Embodiment I-92.
[0391] Embodiment I-94. R c is -CN or halogen, the use according to any one of Embodiments I-88 to I-93.
[0392] Embodiment I-95. R d is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl, the method according to any one of Embodiments I-88 to I-94.
[0393] Embodiment I-96. R d is methyl, cyclohexyl, pyridinyl, thiazolyl, thienyl or optionally substituted phenyl, the use according to any one of Embodiments I-88 to I-94.
[0394] Embodiment I-97. R a is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the use according to any one of Embodiments I-88 to I-91.
[0395] Embodiment I-98. R b is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the use according to any one of Embodiments I-88 to I-91.
[0396] Embodiment I-99. n is 0, the use according to any one of Embodiments I-88 to I-91.
[0397] Embodiment I-100. The compound is
Chemical formula
Chemical formula
[0398] Embodiment I-101. The compound is
Chemical formula
Chemical formula
[0399] Embodiment I-102. The compound is
Chemical formula
Chemical formula
[0400] Embodiment I-103. The compound is
Chemical formula
[0401] Embodiment I-104. The compound is [Chemical formula] The use according to Embodiment I-88, which is or a pharmaceutically acceptable salt thereof.
[0402] Embodiment I-105. The compound is [Chemical formula] The use according to Embodiment I-88, which is or a pharmaceutically acceptable salt thereof.
[0403] Embodiment I-106. The compound is [Chemical formula] The use according to Embodiment I-88, which is or a pharmaceutically acceptable salt thereof.
[0404] Embodiment I-107. The use according to any one of Embodiments I-88 to I-106, wherein the acute inflammatory condition is a systemic inflammatory condition.
[0405] Embodiment I-108. The use according to any one of Embodiments I-88 to I-106, wherein the acute inflammatory condition is an organ-specific condition.
[0406] Embodiment I-109. The use according to any one of Embodiments I-88 to I-106, wherein the acute inflammatory condition is a cytokine storm or hypercytokinemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.
[0407] Embodiment I-110. The use according to any one of Embodiments I-88 to I-106, wherein the acute inflammatory condition is acute pancreatitis, hepatitis, respiratory condition, or enteritis.
[0408] Use according to any one of Embodiments I-88 to I-110, wherein a pro-inflammatory cytokine is decreased or an anti-inflammatory cytokine is increased.
[0409] Use according to Embodiment I-111, wherein the pro-inflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α or TGF-β.
[0410] Use according to Embodiment I-111, wherein the pro-inflammatory cytokine is MCP-1, TNF-α or IL-1β.
[0411] Use according to Embodiment I-111, wherein the pro-inflammatory cytokine is IL-6.
[0412] Use according to Embodiment I-111, wherein the anti-inflammatory cytokine is IL-10.
[0413] Use according to any one of Embodiments I-88 to I-110, wherein the expression of sirtuin-1 regulatory genes sod2, tfam, and dda1 genes is increased in the liver.
[0414] All percentages and ratios used herein are by weight unless otherwise specified. Other features and advantages of the invention will become apparent from the different examples. The examples provided illustrate different components and methodologies useful in practicing the disclosure. Generally speaking, the disclosure extends to any novel or any novel combination of features disclosed herein (including the appended claims and drawings). The examples do not limit the claimed disclosure. Accordingly, features, integers, characteristics, compounds or chemical moieties described in connection with a particular aspect, embodiment or example of the disclosure are to be understood as applicable to any other aspect, embodiment or example described herein, unless incompatible therewith. Based on the disclosure, those skilled in the art can identify and use other components and methodologies useful in practicing the disclosure. Further, unless otherwise specified, any feature disclosed herein may be replaced by alternative features serving the same or a similar purpose.
[0415] Here, the disclosure will be described by way of example only with reference to the following examples.
[0416] Example I. Compound Preparation General Methods and Materials All chemicals were purchased from Sigma-Aldrich, Alfa Aesar. Using the deuterated solvents shown below, 1 1H NMR spectra were recorded at 200 MHz and 400 MHz, 1313C NMR spectra were recorded at 100.6 MHz and 50.3 MHz. TLC was performed on silica plates (silica gel 60 F254) backed with aluminum. All reactions were carried out under a nitrogen atmosphere using distilled solvents. All test compounds were found to have a purity > 95% as determined by HPLC analysis. HPLC grade water was obtained from a tandem Milli - Ro / Milli - Q apparatus. Analytical HPLC measurements were performed on a Shimadzu LC - 20A Prominence equipped with a CBM - 20A communication bus module, two LC - 20AD dual piston pumps, an SPD - M20A photodiode array detector, and a Rheodyne 7725i injector with a 20 μL stainless steel loop. Scheme 1: Preparation of Intermediate 1.4
Chemical formula
[0417] Example 1: Preparation of Intermediate 1.4 To a stirred solution of Compound 1.1 (0.52 ml, 4.9 mmol), 1.2 (372 mg, 4.9 mmol) and 1.3 (0.5 mL, 0.83 mL, 4.9 mmol) in ethanol (25 mL) was added K 2 CO 3 (812 mg, 5.88 mmol). Stirring was continued at reflux overnight. After cooling, the pale yellow solid was collected, taken up in boiling water and filtered again. The aqueous phase was acidified to pH 5 with AcOH (15 drops), the precipitate was filtered and dried under vacuum. The title compound 1.4 was obtained as a pale yellow solid (500 g, 2.18 mmol). Yield 44%. Scheme 2: Preparation of Intermediate 2.2
Chemical formula
[0418] Example 2: Preparation of Intermediate 2.2 To a stirred solution of Compound 1.1 (0.96 g, 8.8 mmol), 1.2 (672 mg, 8.8 mmol) and 2.1 (1 g, 0.83 mL) in ethanol (55 mL) was added K 2CO 3 (1.57 g, 11.44 mmol) was added. Stirring was continued under reflux overnight. After cooling, the yellowish solid was collected, taken up with hot water, and filtered again. The aqueous phase was acidified to pH 1, the precipitate was filtered, and dried under vacuum. The title compound 2.2 was obtained as a yellowish solid (1 g, 4.25 mmol). Yield 49%.
Number
Chemistry
[0419] Example 3: Preparation of Intermediate 3.2 To a stirred solution of Compound 1.1 (0.96 mL, 8.8 mmol), 1.2 (672 mg, 8.8 mmol), and 3.1 (1 g, 1.29 mL) in ethanol (55 mL) was added K 2 CO 3 (1.57 g, 11.44 mmol). Stirring was continued under reflux overnight. After cooling, the yellowish solid was collected, taken up with hot water, and filtered again. The aqueous phase was acidified to pH 1, the precipitate was filtered, and dried under vacuum. The title compound 3.2 was obtained as a yellowish solid (1 g, 4.25 mmol). Yield 49%. Scheme 4: Preparation of Intermediate 4.2
Chemistry
[0420] Example 4: Preparation of Intermediate 4.2 To a stirred solution of Compound 1.1 (1.42 mL, 13.37 mmol), 1.2 (1.01 g, 13.3 mmol), and 4.1 (1.62 mL, 13.3 mL) in ethanol (50 mL) was added piperidine (2.64 mL, 26.7 mmol). Stirring was continued under reflux overnight. After cooling, the solid was collected, taken up with hot water, and filtered again. The aqueous phase was acidified to pH 1 and extracted with EtOAc (3 × 25 mL). The organic phase was washed with brine and Na 2 SO4 It was dried at [condition]. The crude product of the reaction was purified by flash chromatography (CHCl 3 / MeOH with a gradient from 0 to 2% for the product), and the title compound 4.2 (930 mg, 3.95 mmol) was obtained as a white solid. Yield: 30%. Scheme 5: Preparation of Intermediate 5.2
Chemical Structure
[0421] Example 5: Preparation of Intermediate 5.2 To a stirred solution of compound s1.1 (0.49 mL, 4.67 mmol), 1.2 (355 mg, 4.67 mmol) and 5.1 (0.44 mL, 4.67 mmol) in ethanol (25 mL), K 2 CO 3 (773 mg, 5.6 mmol) was added. Stirring was continued overnight under reflux. After cooling, the white solid was collected, dried under vacuum and used in the next step without further purification. The title compound 5.2 was obtained as a white solid (300 mg, 1.3 mmol). Yield: 29%.
Number
Chemical Structure
[0422] Example 6: Preparation of Intermediate 6.2 To a stirred solution of NaOEt (1.02 mL, 2.73 mmol) in EtOH (20 mL), compound 6.1 (500 mg, 2.73 mmol) and 1.2 (207 mg, 2.73 mmol) were added. Stirring was continued under reflux for 4 hours. The volatile substances were removed under vacuum. The crude product of the reaction was taken up in water and acidified with AcOH. The precipitate was collected, dissolved in water and washed with a mixture of CHCl 3 and MeOH. The aqueous phase was extracted with EtOAc (3 × 20 mL). The collected organic phases were washed with brine and Na 2SO 4 It was dried with. The title compound 6.2 was obtained as a white solid (250 mg, 1.49 mmol). Yield 55%. Scheme 7: Preparation of Intermediate 7.3
Chemical formula
[0423] Example 7a: Preparation of Intermediate 7.2 Piperidine (1 drop) was added to a stirred solution of Compound 1.1 (0.14 mL, 1.3 mmol) and 7.1 (150 mg, 1.3 mmol) in EtOH (5 mL). Stirring was continued overnight at room temperature. The solvent was removed under vacuum. The crude product of the reaction was purified by flash chromatography to give the title compound 7.2 (160 mg, 0.77 mmol) as a yellowish solid. Yield 58%.
[0424] Example 7b: Preparation of Intermediate 7.3 To a stirred suspension of Compound 7.2 (150 mg, 0.72 mmol) and Compound 1.2 (55 mg, 0.72 mmol) in EtOH (5 mL) was added K 2 CO 3 (99 mg, 0.72 mmol). Stirring was continued overnight at reflux. The white precipitate was collected and used in the next step without further purification. The title compound 7.3 (150 mg, 0.48 mmol) was obtained as a yellowish solid as the dipotassium salt. Yield 67%. Scheme 8: Preparation of Intermediate 8.5
Chemical formula
[0425] Example 8a: Preparation of Intermediate 8.2 NH 2 OH*HCl and NaHCO 3To a stirred solution in water (7 mL), a solution of m-tolunitrile (8.1) (2 mL, 17.0 mmol) in EtOH (13.3 mL) was gradually added. Stirring was continued at 80 °C for 4 h. Volatiles were removed under vacuum. The crude product of the reaction was taken up in water and extracted with EtOAc (3 × 25 mL). The organic phase was collected, washed with brine, and dried over Na 2 SO 4 to give the title compound 8.2 (1.5 g, 9 mmol) as a white solid. Yield 59%.
[0426] Example 8b: Preparation of Intermediate 8.3 To a solution of compound 8.2 (1 g, 6 mmol) in anhydrous acetone (5 mL) was added dropwise EtOCOCl (0.63 mL, 6.6 mmol) at 0 °C. Stirring was continued at this temperature for 1 h. Then 5% NaOH solution was added to the mixture. Stirring was continued for a further 1 h. The solvent was removed under vacuum. The crude product of the reaction was poured into water and extracted with EtOAc (3 × 50 mL). The collected organic phase was washed with brine and dried over Na 2 SO 4 to give the title compound 8.3 (600 mg, 2.7 mmol) as a white solid. Yield 45%.
[0427] Example 8c: Preparation of Intermediate 8.4 To a solution of compound 8.3 (300 mg, 1.35 mmol) in abs EtOH (5 mL) was added sodium (50 mg) portionwise. Stirring was continued at room temperature for a further 4 h. The reaction was quenched by the addition of MeOH. The solvent was removed under reduced pressure and the crude product was purified by flash chromatography. The title compound 8.4 (150 mg, 0.85 mmol) was obtained as a white solid. Yield 63%.
[0428] Example 8d: Preparation of Intermediate 8.5 To a solution of compound 8.4 (326 mg, 1.85 mmol) in CCl 4(10 mL) of suspension was added with AIBN (60.7 mg, 0.37 mmol) and NBS (493 mg, 2.77 mmol). Stirring was continued overnight under reflux. The solvent was removed under reduced pressure. The reaction product was taken up in water, extracted with EtOAc (3 × 20 mL), washed with brine, and dried over Na 2 SO 4 . The crude product was purified by flash chromatography eluting with petroleum ether (Pet.Ether) / EtOAc (30% for the product), and the title compound 8.5 (280 mg, 1.09 mmol) was obtained as a white solid. Yield 59%. Scheme 9: Preparation of Intermediate 9.2
Chem.
[0429] Example 9: Preparation of Intermediate 9.2 To a suspension of compound 9.1 (750 mg, 5 mmol) in CCl 4 (15 mL) were added AIBN (41 mg, 0.25 mmol) and NBS (933.7 mg, 5.24 mmol). Stirring was continued overnight under reflux. The solvent was removed under reduced pressure. The reaction product was taken up in water, extracted with EtOAc (3 × 20 mL), washed with brine, and dried over Na 2 SO 4 . The crude product was purified by flash chromatography eluting with CH 2 Cl 2 / MeOH (3% for the product), and the title compound 9.2 (800 mg, 3.49 mmol) was obtained as a white solid. Yield 70%. Scheme 10: Preparation of Intermediate 10
Chem.
[0430] Example 10a: Preparation of Intermediate 10.2 Compound 10.1 (1.02 mL, 8.54 mmol), NaN 3 (832 mg, 12.8 mmol) and Et 3A mixture of N*HCl (1.76 g, 12.8 mmol) was heated under reflux for 4 h. The solvent was removed under vacuum. The crude product was poured into water, acidified to pH 1 with 3N HCl, and extracted with EtOAc (3 × 20 mL). The organic phase was washed with brine, dried over Na 2 SO 4 , and concentrated under reduced pressure. The title compound 10.2 (1.22 g, 7.6 mmol) was obtained as a white solid. Yield 89%.
[0431] Example 10b: Preparation of Intermediate 10.3 CH 3 To a suspension of compound 10.2 (300 mg, 1.87 mmol) in CH 2 CN (15 mL) were added AIBN (31 mg, 0.18 mmol) and NBS (333 mg, 1.87 mmol). Stirring was continued overnight under reflux. The solvent was removed under reduced pressure. The reaction was taken up in water, extracted with EtOAc (3 × 20 mL), washed with brine, and dried over Na 4 . The crude product was purified by flash chromatography eluting with CH 2 Cl 2 / MeOH (7% for the product) to give the title compound 10.3 (150 mg, 0.62 mmol) as a pale yellow solid. Yield 34%. Scheme 11: Preparation of Intermediate 11.3
Chemical formula
[0432] Example 11: Preparation of Intermediate 11.3 CH 2 Cl 2 To a solution of compound 11.1 (2.5 g, 23 mmol) in CH 2 Cl 2 (25 mL) were added pyridine (1.63 mL, 20.3 mmol) and compound 11.2 (1.68 mL, 20.3 mmol). Stirring was continued overnight at room temperature. The solvent was removed under reduced pressure. The reaction was taken up in water, extracted with CH 2 Cl 4It was dried. The crude product was purified by flash chromatography eluting with Pet.Ether / EtOAc (25% for the product), and the title compound 11.3 (735 mg, 3.19 mmol) was obtained as a brownish solid. Yield 14%. Scheme 12: Preparation of Intermediate 12.2
Chem.
[0433] Example 12: Preparation of Intermediate 12.2 To a solution of Compound 12.1 (2 g, 10.41 mmol) in EtOH (15 mL) were added EtONa (7 mL, 18.7 mmol) and Compound 1.2 (1.18 g, 15.61 mmol). Stirring was continued at reflux overnight. The solvent was removed under reduced pressure. The reaction mixture was taken up in water, acidified to pH 3, extracted with EtOAc (3 × 20 mL), washed with brine, and dried over Na 2 SO 4 It was dried. The crude product was purified by flash chromatography eluting with CH 2 Cl 2 / MeOH (2.5% for the product), and the title compound 12.2 (500 mg, 2.44 mmol) was obtained as a white solid. Yield 24%. Scheme 13: Preparation of Intermediate 13.2
Chem.
[0434] Example 13a: Preparation of Intermediate 13.2 To a stirred solution of DIPA (7.6 mL, 54 mmol) in THF (53 mL) was added n-BuLi (21.6 mL) at 0 °C. Stirring was continued at this temperature for 10 minutes. The mixture was then cooled to -78 °C and EtOAc (2.4 mL, 27 mmol) was added dropwise. Stirring was continued at this temperature for 30 minutes. Then, a solution of compound 13.1 (3 mL, 27 mmol) in THF (20 mL) was added dropwise. The reaction was warmed to room temperature and stirred overnight. The crude product of the reaction was poured into water and extracted with EtOAc (3 × 30 mL). The recovered organic phase was washed with brine and dried over Na 2 SO 4 and concentrated under vacuum. The title compound 13.2 was obtained as a brownish oil (4.8 g, 24.3 mmol). Yield 90%.
[0435] Example 13b: Preparation of Intermediate 13.3 To a solution of intermediate 13.2 (2 g, 10 mmol) in EtOH (15 mL) were added EtONa (21% wt / wt in EtOH) (7.5 mL, 20 mmol) and compound 1.2 (1.15 g, 15.1 mmol). Stirring was continued at reflux overnight. The solvent was removed under reduced pressure. The reaction was taken up in water. The unreacted starting material was recovered at pH 10. The mixture was then acidified to pH 5, extracted with EtOAc (3 × 20 mL), washed with brine and dried over Na 2 SO 4 . The crude product was purified by flash chromatography eluting with CH 2 Cl 2 / MeOH (7% for the product) to give the title compound 13.3 (435 mg, 2.06 mmol) as a yellowish solid. Yield 21%. Scheme 14: Preparation of Compound 1
Chemical Structure
[0436] Example 14: Preparation of Compound 1 CH 3 CN (80 mL) containing intermediate 1.4 (1.6 g, 6.98 mmol) and K 2 CO 3(2.88 g, 20.9 mmol) was added to a stirred suspension of 3-(chloromethyl)benzoic acid (1.19 g, 6.98 mmol). Stirring was continued at reflux overnight. Volatiles were removed under vacuum. The crude product was taken up in water, acidified to pH 5, washed with EtOAc to remove impurities. Then the pH was adjusted to 3 / 4 and the mixture was extracted with EtOAc (3 × 50 mL). Titration with hot acetone gave compound 1 (936 mg, 2.78 mmol) as a yellowish solid. Yield 40%.
Number
Chemistry
[0437] Example 15: Preparation of Compound 4 CH 3 Intermediate 2.2 (250 mg, 1.06 mmol) and K 2 CO 3 (440 mg, 3.18 mmol) in CN (15 mL) was added to a stirred suspension of 3-(chloromethyl)benzoic acid (180 mg, 1.06 mmol). Stirring was continued at reflux overnight. Volatiles were removed under vacuum. The crude product was taken up in water, washed with EtOAc, acidified to pH 1, and extracted with EtOAc (3 × 50 mL). Titration with hot acetone gave compound 4 (45 mg, 0.12 mmol) as a yellowish solid. Yield 12%.
Number
Chemistry
[0438] Example 16: Preparation of Compound 3 CH 3Intermediate 3.2 (250 mg, 1.06 mmol) in CN (15 mL) and K 2 CO 3 (440 mg, 3.18 mmol) in a stirred suspension, 3-(chloromethyl)benzoic acid (180 mg, 1.06 mmol) was added. Stirring was continued overnight at reflux. Volatiles were removed under vacuum. The crude product was taken up in water, washed with EtOAc, acidified to pH 1, and extracted with EtOAc (3 × 50 mL). Et 2 Titration with an EtO / acetone mixture gave compound 3 (260 mg, 0.7 mmol) as a yellowish solid. Yield 70%.
Number
Chemistry
[0439] Example 17: Preparation of Compound 6 CH 3 Intermediate 4.2 (250 mg, 1.18 mmol) in CN (15 mL) and K 2 CO 3 (495 mg, 3.56 mmol) in a stirred suspension, 3-(chloromethyl)benzoic acid (202 mg, 1.18 mmol) was added. Stirring was continued overnight at reflux. Volatiles were removed under vacuum. The crude product was taken up in water, washed with EtOAc, acidified to pH 1, and extracted with EtOAc (3 × 50 mL). Et 2 Titration with EtO gave compound 6 (90 mg, 0.24 mmol) as a white solid. Yield 21%.
Number
Chemistry
[0440] Example 18: Preparation of Compound 7 To a stirred suspension of Intermediate 5.2 (220 mg, 0.95 mmol) and DIPEA (0.18 mL, 1.05 mmol) in DMSO (5 mL) was added 3-(chloromethyl)benzoic acid (178 mg, 1.05 mmol). Stirring was continued overnight at room temperature. The pale yellow solid was collected, washed with crushed ice and water, and dried under vacuum. It was triturated with hot EtOAc to give Compound 7 (180 mg, 0.49 mmol) as a pale yellow solid. Yield 53%.
Number
Chemistry
[0441] Example 19a: Preparation of Compound 14 CH 3 To a stirred suspension of Intermediate 12.2 (100 mg, 0.43 mmol) and K 2 CO 3 (178 mg, 1.29 mmol) in CN (15 mL) was added 3-(chloromethyl)benzoic acid (74 mg, 0.43 mmol). Stirring was continued overnight at reflux. The volatile substances were removed under vacuum. The crude product was taken up in water, washed with EtOAc, acidified to pH 3, and extracted with EtOAc (3 × 50 mL). Titration with a mixture of Et 2 O / acetone gave Compound 14 (30 mg, 0.088 mmol) as a white solid. Yield 21%.
Number
[0442] Example 19b: Preparation of Compound 11 To a stirred solution of Compound 14 (100 mg, 0.29 mmol) in acetic acid (5 mL) were added lead dioxide (77.2 mg, 0.32 mmol) and bromine (0.02 mL, 0.32 mmol). Stirring was continued at room temperature for 6 h. The mixture was poured into a solution of Na 2 S 2 O 5 and extracted with EtOAc (3 × 20 mL). The collected organic phases were washed with water and brine and then dried over Na 2 SO 4 . Titration with a mixture of Et 2 O / acetone afforded Compound 11 (40 mg, 0.09 mmol) as a white solid. Yield 33%.
Number
Chemistry
[0443] Example 20a: Preparation of Compound 15 CH 3 To a stirred suspension of Intermediate 13.3 (235 mg, 1.11 mmol) and K 2 CO 3 (460 mg, 3.33 mmol) in CH 2 CN (15 mL) was added 3-(chloromethyl)benzoic acid (190 mg, 1.11 mmol). Stirring was continued at reflux overnight. Volatiles were removed under vacuum. The crude product was taken up in water, washed with EtOAc, acidified to pH 3 and extracted with EtOAc (3 × 50 mL). Titration with a mixture of Et
Number
[0444] Example 20b: Preparation of Compound 12 To a stirred solution of compound 15 (134 mg, 0.39 mmol) in acetic acid (5 mL) was added lead dioxide (102 mg, 0.42 mmol) and bromine (0.022 mL, 0.42 mmol). Stirring was continued at room temperature for 6 h. The mixture was poured into a solution of Na 2 S 2 O 5 and extracted with EtOAc (3 × 20 mL). The collected organic phases were washed with water and brine and then dried over Na 2 SO 4 . The crude product of the reaction was subjected to flash chromatography purification eluting with CH 2 Cl 2 / MeOH (10% for the product). Compound 12 (45 mg, 0.11 mmol) was obtained as a white solid. Yield 27%.
Number
Chemistry
[0445] Example 21: Preparation of compound 13 To a stirred solution of compound 14 (100 mg, 0.29 mmol) in acetic acid (5 mL) was added lead dioxide (55.8 mg, 0.35 mmol) and N-chlorosuccinimide (47 mg, 0.35 mmol). Stirring was continued at room temperature for 6 h. The mixture was poured into water and extracted with EtOAc (3 × 20 mL). The collected organic phases were washed with water and brine and then dried over Na 2 SO 4 . Titration with a mixture of Et 2 O / acetone gave compound 13 (40 mg, 0.1 mmol) as a white solid. Yield 37%.
Number
Chem.
[0446] Example 22: Preparation of Compound 22 A stirred suspension of Compound 1 (160 mg, 0.44 mmol) and POCl 3 (3 mL) was heated at 70 °C for 6 h. The white suspension turned red. The excess POCl 3 was carefully destroyed with crushed ice and then water. The mixture was extracted with EtOAc (3 x 20 mL). The recovered organic phase was washed with brine and dried over Na 2 SO 4 and evaporated. Purification by flash chromatography (gradient CH 2 Cl 2 / MeOH) gave the title compound 22 (60 mg, 0.16 mmol) as a white solid. Yield 36%.
Math.
Chem.
[0447] Example 23: Preparation of Compound 10 CH 3 To a stirred suspension of Intermediate 6.2 (145 mg, 0.86 mmol) and K 2 CO 3 (599 mg, 4.33 mmol) in CH 2 Cl 2Purification by flash chromatography eluting with / MeOH + ACOH 3%) gave the title compound 10 (60 mg, 0.2 mmol) as a white solid. Yield 23%.
Number
Chemistry
[0448] Example 24: Preparation of Compound 5 CH 3 To a stirred suspension of intermediate 7.3 (414 mg, 1.27 mmol) and K 2 CO 3 (526 mg, 3.81 mmol) in CN (20 mL) was added 3-(chloromethyl)benzoic acid (217 mg, 1.27 mmol). Stirring was continued at reflux overnight. Volatiles were removed under vacuum. The crude product was taken up in water, washed with EtOAc, acidified to pH 3, and extracted with EtOAc (3 × 50 mL). After titration with a mixture of Et 2 O / acetone, the title compound 5 was obtained as a pure pale yellow solid (260 mg, 0.7 mmol). Yield 55%.
Number
Chemistry
[0449] Example 25: Preparation of Compound 19 To a stirred suspension of Intermediate 2.2 (100 mg, 0.42 mmol) and DIPEA (0.07 mL, 0.47 mmol) in DMSO (5 mL) was added Intermediate 8.5 (120 mg, 0.47 mmol). Stirring was continued overnight at room temperature. The crude product was poured into water, washed with EtOAc, then acidified to pH 3 and extracted with EtOAc (3 × 50 mL). CH 2 Cl 2 After purification by flash chromatography eluting with CH 2 Cl 2 / MeOH (10% for the product), the title compound 19 was obtained as a pure orange solid (65 mg, 0.15 mmol). Yield 38%.
Number
Chemistry
[0450] Example 26: Preparation of Compound 18 To a stirred suspension of Intermediate 2.2 (500 mg, 0. mmol) and DIPEA (0.4 mL, 2.12 mmol) in DMSO (5 mL) was added Intermediate 9.2 (487 mg, 2.12 mmol). Stirring was continued overnight at room temperature. The crude product was poured into water, washed with EtOAc, then acidified to pH 3 and extracted with EtOAc (3 × 50 mL). CH 2 Cl 2 After purification by flash chromatography eluting with CH 2 Cl 2 / MeOH (10% for the product) and titration with a mixture of Et 2 O / acetone, the title compound 18 was obtained as a pure yellowish solid (200 mg, 0.52 mmol). Yield 25%.
Number
Chemistry
[0451] Example 27: Preparation of Compound 17 To a stirred suspension of Intermediate 2.2 (160 mg, 0.66 mmol) and DIPEA (0.09 mL, 0.55 mmol) in DMSO (3 mL) was added Intermediate 10.3 (171 mg, 0.55 mmol). Stirring was continued overnight at room temperature. The crude product was poured into water, washed with EtOAc, then acidified to pH 3 and extracted with EtOAc (3 × 50 mL). CH 2 Cl 2 Purification by flash chromatography eluting with CH 2 Cl / MeOH (5% for the product) and pre-titration with a mixture of Et
Number
Chemistry
[0452] Example 28: Preparation of Compound 23 To a stirred suspension of Intermediate 2.2 (150 mg, 0.63 mmol) and K 2 CO 3 (96.6 mg, 0.70 mmol) in acetone (10 mL) was added Intermediate 11.2 (173 mg, 0.72 mmol). Stirring was continued overnight at room temperature. The volatiles were removed under vacuum. The crude product was taken up in water, acidified to pH 3 and extracted with EtOAc (3 × 50 mL). CH 2 Cl 2 Purification by flash chromatography eluting with CH
Number
Chem.
Chem.
[0453] See Hirose M, et al, "Design and synthesis of novel DFG-out RAF / vascular endothelial growth factor receptor 2 (VEGFR2) inhibitors: 3. Evaluation of 5-amino-linked thiazolo[5,4-d]pyrimidine and thiazolo[5,4-b]pyridine derivatives", Bioorg. Med. Chem. 2012, 15; 20(18): 5600-15.
Chem.
[0454] See Clift MD, Silverman RB, "Synthesis and evaluation of novel aromatic substrates and competative inhibitors of GABA aminotransferase", Bioorg. Med. Chem. Lett., 2008, 15; 18(10): 3122-5.
Chem.
[0455] A.M. El-Reedy, A.O. Ayyad and A.S. Ali, "Azolopyrimidines and pyrimidoquinazolines from 4-chloropyrimidines", J. Het. Chem. 1989, 26, 313-16.
Chem.
[0456] Iwahashi M, et al, "Design and synthesis of new prostaglandin D 2 receptor antagonists", Bioorg. Med. Chem. 2011, 19(18): 5361-71. See reference. 2 Refer to US Patent Application Publication No. 2008 / 004,302 and US Patent No. 8,716,470.
Chem.
[0457] Refer to US Patent Application Publication No. 2008 / 004,302 and US Patent No. 8,716,470.
[0458] Biological activity ACMSD and acute inflammation Cell assay Assay protocol for transfection of mouse Kupffer cells with ACMSD plasmid and cytokine analysis after LPS induction Copper cells (immortalized mouse copper cell line, (catalog number SCC119 (ImKC) Merck Millipore) were seeded in a tissue culture 24-well plate at 150,000 cells / well in RPMI medium + 10% FBS. Twenty-four hours after plating, the cells were transfected for 18 hours with Fugene HD (Promega), pCDNA3.1 mouse ACMSD, and pCDNA3.1 empty vector at a concentration of 0.75 μg / well each.
[0459] Cell stimulation with an ACMSD inhibitor (e.g., the compounds of the present disclosure, compounds of formula I, Ia, Ib, and II) was performed using concentrations of the test compound of 0.5, 5, and 50 μM, and cells to which only DMSO at a final concentration of 0.5% was added were used as a control. All wells were normalized with DMSO at a final concentration of 0.5%. The cells were treated with LPS at a final concentration of 50 ng / ml in cell medium for 18 hours, and then mouse cytokine secretion (IL-1α, IL1β, IL-2, IL-3, IL-4, IL-5, IL6, IL-9, IL-10, IL-12 (p40), IL-12 (p70), IL-13, IL-17, IFN-γ, Rantes, Eotaxin, MCP-1, MIP-1α, MIP-1β, G-CSF, GM-CSF, TNFα, and KC (keratinocyte chemoattractant)) was analyzed using the Bio-Plex Pro mouse cytokine 23-plex assay (catalog number M60009RDPD). The cells were centrifuged, and the resulting pellet was collected for either RT PCR analysis or ATP measurement (Promega Cell-Titer-Glo catalog number G7571).
[0460] Assay protocol for ACMSD silencing Copper cells seeded in a 24-well plate were transfected with either 5 pmol of ACMSD siRNA or scrambled siRNA as a negative control (siRNA ACMSD catalog number 4390771 and scrambled siRNA catalog number 4390843, both from Ambion). After 18 hours of incubation, the cells were treated with an ACMSD inhibitor (e.g., the compounds of the present disclosure, compounds of formula I, Ia, Ib and II) (5 μM) or DMSO as a vehicle, and then after an additional 1 hour, the cells were treated with LPS at a final concentration of 50 ng / ml in cell culture medium and subsequently incubated overnight. Cytokine secretion was measured using a Bio-Plex kit. All wells were normalized with DMSO at a final concentration of 0.5%.
[0461] Cytokine secretion measurement 200,000 copper cells were seeded in a 24-well plate and after adding an ACMSD inhibitor (e.g., the compounds of the present disclosure, compounds of formula I, Ia, Ib and II) (5 μM) for 1 hour, the cells were stimulated with LPS at a final concentration of 50 ng / ml (1 mg / mL stock solution in H 2 O, dispensed at 50 ng / mL in the wells) overnight. Cells treated with DMSO were used as a control at a final concentration of 0.5% in the medium. All wells were normalized with DMSO at a final concentration of 0.5%. The supernatant was collected and cytokine secretion was measured using a Bio-Plex Pro mouse cytokine 23-plex assay system (catalog number M60009RDPD) using a Bio-Plex Instrument. The cells were washed once with PBS and then lysed to extract total RNA, and RT-PCR was performed to evaluate the regulation of ACMSD on IL-10, SIRT1 and STAT3 gene expression.
[0462] Briefly, total RNA was extracted from cells using the manufacturer's protocol of the Qiagen RNeasy Plus Mini Kit (Catalog number 74134). The total RNA concentration was quantified using an Implen Instrument, and the purity was evaluated by measuring the ratio of A260 / A280. The isolated RNA had an A260 / A280 ratio in the range of (1.8 - 2.0).
[0463] Total RNA (1 μg) was reverse transcribed using the manufacturer's protocol of SuperScript IV VILO Master Mix (ThermoFisher Catalog number 11756500). Then, real-time PCR was performed on a CFX 96 Real Time System (Bio-Rad) as follows: denaturation at 95°C for 2 minutes, followed by 40 cycles of 10 seconds at 95°C, and hybridization at 60°C for 20 seconds. QPCR was performed using 2×QuantiNova SYBR Green PCR Master Mix (Qiagen). Mouse β2-microglobulin (mβ2M) was used as a reference gene.
[0464] All cytokine secretion values were normalized to the luminescence signal relative to the measurement of cellular ATP (CellTiter-Glo Catalog number G7571). Primer sequences mSTAT3_FW CACATGCCACGTTGGTGTTT mSTAT3_RW ACGATCCGGGCAATTTCCAT mIL10_FW CAGTACAGCCGGGAAGACAAT mIL10_RW TTGGCAACCCAAGTAACCCT mSIRT1_FW TATCTATGCTCGCCTTGCGG mSIRT1_RW GACACAGAGACGGCTGGAAC mACMSD_FW GCAGATGGATGGACGAATGG mACMSD_RW CGAAGCACACTTTGAGTTTGG mB2M_FW CTCGGTGACCCTGGTCTTTC mB2M_RW GGATTTCAATGTGAGGCGGG
[0465] Animal model protocol LPS-induced acute kidney and liver injury A total of 40 Sprague-Dawley rats (8-week-old male rats, 200 - 220 g) were randomly divided into three LPS model groups (sacrifice groups at 8 hours, 24 hours, and 48 hours, n = 10 per group) and a control group (n = 10 / group). The rats were obtained from Charles River Laboratories. After one week of acclimation, rats in the LPS groups were intraperitoneally injected with 10 mg / kg of LPS (dissolved in saline) based on previous reports, and rats in the control group were intraperitoneally injected with an equal volume of saline. After 8 hours, 24 hours, or 48 hours, the rats were anesthetized with chloral hydrate and then blood was collected by direct puncture of the abdominal aorta. The blood was then centrifuged at 3000 × g to prepare serum samples. Organ tissues were collected and divided into two parts. One part was fixed in 4% formaldehyde and the other part was frozen in liquid N 2 All serum and tissue samples were stored at -80°C until biochemical analysis of liver function (AST / ALT levels), kidney function (BUN and serum / plasma creatinine levels), and inflammatory biomarkers (including expression and secretion of cytokines and chemokines, TNFα, IL-6, MCP-1, MIP-1α, and IL-10).
[0466] CLP-induced sepsis model C57BL / 6 mice (12 - 15 weeks old, obtained from Charles River Laboratories) were anesthetized by intraperitoneal (i.p.) injection of a 1:1 solution of ketamine (75 mg / kg) and xylazine (15 mg / kg) (or pentobarbital (70 mg / kg)). The lower abdomen of the mice was shaved and the area was disinfected with 70% alcohol swabs. Under aseptic conditions, a 1 - 2 cm midline laparotomy was performed to expose the cecum. The cecum was tightly ligated at the level of the second cecal artery with 2.0 silk suture, punctured twice with a 22 - gauge needle, and squeezed to extrude feces, and then returned to the abdomen. Next, the abdominal wall was closed flat using running silk 4 - 0. Control animals underwent the same laparotomy and cecal exteriorization, but no ligation or puncture was performed. Immediately after the surgery, the animals were revived with 1.0 mL of 0.9% saline by subcutaneous injection and recovered on a thermal blanket under monitoring. Then, the animals were treated with 0.5 ml of LRS (SQ every 12 hours for 3 days), ampicillin - sulbactam (250 mg / kg IP every 12 hours for 3 days), and analgesic treatment (buprenorphine 0.05 mg / kg for 3 days).
[0467] The ACMSD inhibitor (e.g., the compounds of the present disclosure, compounds of formula I, Ia, Ib, and II) was administered at two different time points: (a) the early stage, i.e., the time point of CLP, and (b) 24 hours after CLP. A dose of 15 mg / kg IP injection of the ACMSD inhibitor was used. Blood samples and target organ tissues (liver and kidney) were collected at the time of sacrifice for histology and biomarker measurement.
[0468] LPS - induced sepsis model Male C57 / 6 mice (12 - 15 weeks old) (obtained from Charles River Laboratories) were housed under a 12 - hour light / dark cycle with free access to water and standard chow. The mice were divided into four groups: control, control + ACMSD inhibitor, LPS, and LPS + ACMSD inhibitor. LPS (Sigma; 20 mg / kg / d and 1 mg / ml in 0.9% saline) was injected intraperitoneally, and only the same volume of 0.9% saline was used as a control. A dose of 15 mg / kg IP injection of the ACMSD inhibitor (e.g., the compounds of the present disclosure, compounds of formula I, Ia, Ib, and II) was used and injected intraperitoneally immediately after the LPS injection. The control group and the LPS - alone group were injected with an equal volume of solvent. The mice were sacrificed 24 hours after various treatments, and the liver and kidneys were recovered for subsequent analysis.
[0469] Blood samples and target organ tissues (liver and kidney) were collected at the time of sacrifice for histology and biomarker measurement.
[0470] Acute pancreatitis model Male C57BL / 6 mice (8 weeks old) (obtained from Charles River Laboratories) were housed in a pathogen - free facility under a 12 / 12 - hour light - dark cycle, with an ambient temperature of 20 - 22 °C and a relative humidity of 50 ± 5% while being given standard commercially available diet. Experiments were performed on mice weighing 20 g - 25 g, and the age of all mice was within 3 days of each other.
[0471] Mice were fasted for 17 hours before treatment, but were allowed free access to water. Acute pancreatitis was induced by six injections of cerulein (50 μg / kg, intraperitoneal [i.p.] at 1-hour intervals) as described previously. Each experimental group consisted of five mice. The control group received an i.p. injection of saline (0.9% NaCl) solution. In the combination group of cerulein and the ACMSD inhibitor, the ACMSD inhibitor (e.g., the compounds of the present disclosure, compounds of formula I, Ia, Ib and II) (15 mg / kg body weight) was dissolved in a vehicle (corn oil) and orally administered 3 hours before the first cerulein injection. All mice were sacrificed 6 hours after the last cerulein injection. Blood samples were collected to measure serum amylase, lipase and cytokine levels. A part of the pancreas was fixed overnight in 4% paraformaldehyde in phosphate-buffered saline (PBS, pH 7.4) at 4 °C for immunohistochemical studies, embedded in paraffin, cut into 4-μm thick sections, and then stained with hematoxylin and eosin (H&E) to observe morphological changes under an optical microscope by standard procedures. After staining with H&E, the histological injury score of the pancreatic slides was graded in a blinded fashion without knowledge of the experimental protocol according to the severity and extent of edema, inflammatory cell infiltration and acinar necrosis. A part of the pancreas was also frozen in liquid nitrogen for Western blotting and RT-PCR analysis.
[0472] Acute liver injury model Male Balb / c mice (6 - 8 weeks old, 20 ± 2 g) (obtained from Charles River Laboratories) were housed in plastic cages with a controlled light-dark cycle and given a standard diet with water in an environment with controlled temperature (25 ± 1 °C) and humidity (50 ± 5%). Liver injury was induced by injection of concanavalin-A (20 mg / kg body weight) into the tail vein. The mice were randomly divided into six groups of 10 each as follows: (1) Normal saline control group, (2) ACMSD inhibitor alone group, (3) concanavalin-A induced model group, (4) low-dose ACMSD inhibitor + concanavalin-A group, (5) medium-dose ACMSD inhibitor + concanavalin-A group, and (6) high-dose ACMSD inhibitor + concanavalin-A group. During the first two weeks, mice in the ACMSD inhibitor (e.g., the compounds of the present disclosure, compounds of formula I, Ia, Ib and II) groups were orally administered 15 mg / kg body weight / day. The remaining mice were administered a 0.5% carboxymethyl cellulose solution at 0.1 mL / 10 g body weight / day. On the 14th day, 1 hour after oral administration, except for the normal saline and ACMSD inhibitor alone groups which were administered only normal saline (0.05 mL / 10 g), concanavalin-A (0.05 mL / 10 g) was injected into the tail vein of the mice, and the animals were sacrificed 8 hours later. The left liver lobe was stored at -80°C until performing IL-2, IL-6 and TNF-α assays. The right liver lobe was fixed with 4% paraformaldehyde at 4°C for hematoxylin-eosin (HE) and immunohistochemical staining.
[0473] Acute graft-versus-host disease, aGvHD, (MHC mismatched) model Nine-week-old C57BL / 6 (B6) (H-2kb) mice and B / c (H-2kd) mice were purchased from Charles River Laboratories. The mice were maintained under specific pathogen-free conditions in an animal facility at 22 ± 1°C, 55 ± 5% humidity, and a 12-hour / 12-hour light / dark cycle. The air in the facility passed through a high-efficiency particulate air (HEPA) filter system to exclude bacteria and viruses. The animals were freely given mouse feed and tap water. Splenocytes (5×10 6 ) and bone marrow cells (5×10 6It was isolated and transplanted into B / c recipient mice via intravenous (i.v.) injection. Prior to transplantation, B / c mice were irradiated with a sublethal dose of 690 cGy and allowed to stand for 2 hours. After induction of GvHD, an ACMSD inhibitor (e.g., the compounds of the present disclosure, compounds of formula I, Ia, Ib and II) (15 mg / kg body weight / day per mouse) was orally administered to the recipient mice daily starting from day 0 after bone marrow transplantation. Control GvHD mice were administered a vehicle (saline) in the same manner as the treatment group. Ten mice were used in each group.
[0474] Survival after bone marrow transplantation was monitored daily, and the degree of GvHD was evaluated weekly using a scoring system that summed changes in the following clinical parameters: weight loss, posture, activity, fur texture, and skin integrity. Mice irradiated with 690 cGy were euthanized 28 days after bone marrow transplantation prior to blinded histopathology of GvHD target tissues.
[0475] Cytokine levels were measured from blood collected from the heart by cardiac puncture.
[0476] Histopathological and immunohistochemical analyses were performed on formalin-fixed skin, liver, and large and small intestine tissue sections stained with hematoxylin and eosin. Epithelial loss, crypt damage, goblet cell depletion, and inflammatory cell infiltration were scored histologically.
[0477] siACMSD cytokine data In Kupffer cells, silencing of ACMSD regulates the secretion of both pro-inflammatory cytokines. Thus, the secretion of pro-inflammatory cytokines; tumor necrosis factor α, TNFα, interleukin, IL-1α, IL-1β and IL-6 in macrophages stimulated with LPS is decreased by short hairpin RNA, siACMSD, compared to the vehicle control (Figure 1).
[0478] Inflammation and the kynurenine pathway (ACMSD and QPRT) Under inflammatory conditions in Kupffer cells (50 ng / mL LPS), ACMSD expression increases while QPRT expression decreases. Importantly, inhibition of ACMSD by compound I-18 increases QPRT expression beyond basal conditions (Figure 2).
[0479] Similar results (downregulation and upregulation of QPRT) have been obtained in human primary bone marrow mononuclear cells (BMMC) (Figure 3).
[0480] Therefore, under inflammatory conditions, decreased QPRT expression limits de novo NAD + biosynthesis from tryptophan via the de novo pathway. In contrast, treatment with an ACMSD inhibitor upregulates QPRT expression and thus restores NAD + biosynthesis.
[0481] NAD + Restoration of biosynthesis Inhibition of ACMSD by compound I-17 and compound I-18 restores NAD + biosynthesis in Kupffer cells, primary hepatocytes, and kidney proximal tubule HK2 cells (Figure 4).
[0482] Effect of ACMSD inhibition on downstream targets (SIRT1 and SIRT3) NAD + -dependent SIRT1 is an important downstream target gene of NAD + and plays diverse functions in biological systems and is an important regulator of energy homeostasis. SIRT1 also plays an important role in DNA damage repair and maintenance of genomic integrity. SIRT1 is an important mediator between environmental stress and immune system activation and provides protection against inflammation by altering transcription factors such as histones and NFκB and AP1. Inhibition of ACMSD by compound I-18 increases the expression of both SIRT-1 in Kupffer cells and SIRT-3 in HK2 primary tubule cells, which are downstream target genes of sirtuin (Figure 5).
[0483] Both compounds I-17 and I-18 (500 nM) activate SIRT1 in primary hepatocytes measured 24 hours after treatment (Figure 6).
[0484] Inhibition of ACMSD by compound I-18 (50 μM) also reverses the decrease in SIRT expression induced by cisplatin injury in HK2 primary tubular cells (Figure 7).
[0485] Association between ACMSD inhibition, SIRT, and inflammatory response SIRT1 is a central component of the SIRT1 / STAT3 pathway, and thus, the increase in SIRT1 expression and activity induced by ACMSD inhibition by compound I-18 dose-dependently increases the expression of signal transducer and activator of transcription 3, STAT3, in Kupffer cells (Figure 8).
[0486] The Il-10 / JAK1 / STAT3 anti-inflammatory response is an essential negative regulator that controls both the degree and duration of inflammation. One of the main biological functions of IL-10 is to counteract the production of inflammatory mediators, especially in response to TLR signaling. Inhibition of ACMSD by compound I-18 dose-dependently increases the expression of IL-10 in Kupffer cells and thus promotes an anti-inflammatory response (Figure 9).
[0487] STAT3 interacts with both IL-10 and Il-6. Binding of IL-10 to the IL-10R results in the activation of JAK1, which induces STAT3 phosphorylation, and STAT3 is an important effector molecule for IL-10 action. STAT3 activation is required for the anti-inflammatory effects regulated by IL-10.
[0488] Both IL-10 and interleukin-6 (IL-6) induce the activation of STAT3 but produce different cellular responses. IL-6 stimulation promotes a pro-inflammatory response, while IL-10 signaling induces a strong anti-inflammatory response.
[0489] Inhibition and regulation of cytokine expression and secretion by ACMSD Inhibition of ACMSD by compounds I-17 and I-18 (1 μM) and dose-dependently by compound I-18 in Kupffer cells after LPS-induced inflammation decreases the secretion of the pro-inflammatory cytokine IL-6. (Kupffer cells treated with LPS 50 ng / mL, at 16 - 18 °C, incubation time 24 h, both graphs) (Figure 10).
[0490] The secretion of the pro-inflammatory cytokine IL-6 also decreases dose-dependently by inhibition of ACMSD by compounds I-17 and I-18 in co-cultures of primary hepatocytes and Kupffer cells after LPS-induced inflammation (50 ng / mL) (Figure 11).
[0491] Inhibition of ACMSD by compound I-18 (5 μM) also decreases LPS-induced IL-6 secretion in human primary bone marrow mononuclear cells (BMMC) (Figure 12).
[0492] Therefore, the simultaneous decrease in IL-6 secretion and increase in IL-10 expression induced by ACMSD inhibitors provide a synergistic anti-inflammatory effect.
[0493] Beyond the decrease in IL-6 secretion and increase in IL-10 expression, inhibition of ACMSD has a broad anti-inflammatory effect through regulation of the expression and secretion of both pro-inflammatory and anti-inflammatory cytokines, chemokines, and other mediators of the acute inflammatory response across various inflammatory cell types, as summarized below.
[0494] Therefore, inhibition of ACMSD by compounds I-17 and I-18 decreases the secretion and expression of the following pro-inflammatory cytokines, TNFα, IL-1β, and IL-6, and the expression of the chemokine MCP-1.
[0495] TNFα secretion Inhibition of ACMSD using Compounds I-17 and I-18 in co-cultures of Kupffer cells, BMMC cells, and primary hepatocytes with stellate cells reduces the secretion of the inflammatory cytokine TNFα after LPS-induced inflammation (50 ng / mL) (Figure 13).
[0496] TNFα expression In co-cultures of primary hepatocytes with stellate cells after treatment with a free fatty acid mixture (after 6-hour exposure to a mixture of palmitic acid (0.33 mM) and oleic acid (0.66 mM)), and in ex vivo kidney tissue samples from a CLP-induced sepsis model in mice intraperitoneally administered Compound I-18 at a dose of 30 mg / kg, inhibition of ACMSD by both Compounds I-17 and I-18 (5 μM) reduces the expression of TNFα (Figure 14).
[0497] IL-1β secretion Inhibition of ACMSD using Compounds I-17 and I-18 (1 μM) in co-cultures of Kupffer cells and primary hepatocytes with stellate cells reduces the secretion of the inflammatory cytokine IL-1β after LPS-induced inflammation (50 ng / mL) (Figure 15).
[0498] IL-1β expression In co-cultures of primary hepatocytes with stellate cells after treatment with a free fatty acid mixture (after 6-hour exposure to a mixture of palmitic acid (0.33 mM) and oleic acid (0.66 mM)), and in ex vivo kidney tissue samples from a CLP-induced sepsis model in mice intraperitoneally administered Compound I-18 at a dose of 30 mg / kg, inhibition of ACMSD by Compound I-17 (5 μM) reduces the expression of IL-1β (Figure 16).
[0499] MCP1 expression In ex vivo kidney tissue samples from a CLP-induced sepsis model in mice intraperitoneally administered Compound I-18 at a dose of 30 mg / kg, the expression of MCP1 is reduced by inhibition of ACMSD (Figure 17).
[0500] Anti-fibrotic / anti-apoptotic effects of ACMSD inhibition In co - cultures of primary hepatocytes and stellate cells after treatment with a free fatty acid mixture (after 6 - hour exposure to a mixture of palmitic acid (0.33 mM) and oleic acid (0.66 mM)), inhibition of ACMSD by compound I - 17 or compound I - 18 (5 μM) decreased the expression of the fibrosis - promoting cytokine, TGF - β, the fibrosis - promoting chemokine, CTGF, and the fibrosis - promoting genes, Bcl - 2 - related gene X, BAX, actin alpha 2, ACTA2, type I collagen alpha 1 chain, Col1A1, fibronectin, thrombospondin - 1, THBS - 1, and tissue inhibitor of metalloproteinase 2, TIMP2 (Figure 18).
[0501] The antifibrotic effect of ACMSD inhibition via a decrease in transforming growth factor beta, TGF - β, is mediated by the TGFβ / SMAD pathway, as shown by the dose - dependent decrease in mothers against decapentaplegic homolog 3, SMAD3, in both preventive and therapeutic treatments with compound I - 18 after TGF - β - induced fibrosis in HK2 cells. SMAD4 expression was not much regulated (Figure 19).
[0502] The antifibrotic effect of ACMSD inhibition is further demonstrated by the dose - dependent decrease in the expression of fibronectin and TIMP2 by compound I - 18 (Figure 20).
[0503] ACMSD Inhibition and Mitochondria in Inflammatory Conditions Mitochondria in Inflammatory Diseases of the Liver and Kidney
[0504] In primary mouse hepatocytes, inhibition of ACMSD by either compound I - 17 or I - 18 increased the activity of mitochondrial superoxide dismutase 2, SOD2, in a dose - dependent manner after 24 - hour treatment (Figure 21).
[0505] In HK-2 cells, inhibition of ACMSD by compound I-18 (100 μM) also increased the expression of both SOD2 and the mitochondrial dynamin-like 120 kDa protein, OPA-1, after cisplatin-induced injury (Figure 22).
[0506] Inhibition of ACMSD by compound I-17 regulates cellular ROS production and mitochondrial biogenesis (in various cell types) by increasing the expression of mitochondrial transcription factor A, TFAM, in primary hepatocytes via SIRT-1 activity and the expression of the mitochondrial fusion protein OPA-1 in rat kidney NRK52E cells via SIRT-3 activation after cisplatin injury (100 μM) (Figure 23).
[0507] In primary hepatocytes, inhibition of ACMSD by compound I-17 after 6 h exposure to a mixture of palmitic acid (0.33 mM) and oleic acid (0.66 mM) increased the mRNA levels of fatty acid oxidation genes; medium-chain acyl-CoA dehydrogenase, Mcad, carnitine palmitoyltransferase 1, Cpt1α, hydroxyacyl-CoA dehydrogenase, Hadha1, hormone-sensitive lipase, Hsl, pyruvate dehydrogenase lipoamide kinase 4, Pdk4, and succinate dehydrogenase, Sdha (Figure 24).
[0508] Inhibition of ACMSD by 100 μM of compound I-18 increased the mRNA levels of mitochondrial and oxidative stress genes; citrate synthase, CS; NADH ubiquinone oxidoreductase subunit 2, Ndufa2, cytochrome c oxidase subunit 2, Cox2, ATP synthase lipid-binding protein, Atp5g1, superoxide dismutase 1, Sod1 and superoxide dismutase 2, Sod2 (Figure 25).
[0509] Inhibition of ACMSD by compounds I-17 and I-18 increases the mRNA levels of mitochondrial genes, TFAM, Ndufa, ubiquinol-cytochrome C reductase core protein 1, Uqcrc1, CytC, Atp5g1, and CS in primary mouse hepatocytes after 24 hours of treatment (Figure 26).
[0510] The increase in the mRNA levels of mitochondrial genes, Sod1, Ndufa2, Cox2, and CytC in HK-2 cells after 24 hours of treatment with compound I-18, an ACMSD inhibitor, is SIRT1-dependent and is blocked by inhibition of Sirt1, as shown by treatment with compound I-18 in combination with the indicated concentration of the SIRT1 inhibitor EX527 (Figure 27).
[0511] Administration of compounds I-17 and I-18, ACMSD inhibitors, also induces the transcription of liver mitochondrial genes; medium-chain acyl-CoA dehydrogenase, Mcad, carnitine palmitoyltransferase 1, Cpt1a, NADH ubiquinone oxidoreductase subunit 2, Ndufa2, ATP synthase lipid-binding protein, Atp5g1, and superoxide dismutase 2, Sod2, but the expression of the same genes in the kidney was not affected (Figure 28).
[0512] Inhibition of ACMSD by compound I-17 in primary hepatocytes increases the expression of mitochondrial SOD2 (Figure 29).
[0513] ACMSD Inhibition and Kupffer Cell (Macrophage) Polarization Inhibition of ACMSD by IL-18 induces the polarization of resident liver macrophages (Kupffer cells) to the M2 macrophage phenotype, as shown by a decrease in M1 macrophage gene markers and promotion of M2 macrophage gene markers.
[0514] Therefore, mouse Kupffer cells treated with LPS and compound I-18 showed a decrease in the M1 phenotypic gene markers iNOS, IL-6, and TNFα (Figure 30), as well as a corresponding increase in the M2 phenotypic gene markers arginase-1, mannose receptor (Mrc-2), and IL-10 (Figure 31).
[0515] Inhibition of ACMSD and protection from LPS-induced systemic inflammation Inhibition of ACMSD by IL-18 increases survival, i.e., reduces the mortality of C57BL / 6 mice due to LPS-induced systemic inflammation by promoting an anti-inflammatory phenotype.
[0516] Anti-inflammatory properties of ACMSD inhibitors α-Amino-β-carboxymucon-ε-semialdehyde decarboxylase (ACMSD) is an enzyme of the kynurenine pathway (KP) mainly expressed in the liver and kidney and represents a branch point of the de novo NAD + biosynthetic pathway that dictates the conversion of tryptophan to NAD + corresponding to the biosynthetic pathway.
[0517] The inventors demonstrated that inhibition of ACMSD by the pharmacological inhibitor compound I-18 exhibits a protective effect in preclinical models of liver and kidney diseases such as NASH and AKI, respectively.
[0518] The inventors established that inhibition of ACMSD by compound I-18 exhibits an anti-inflammatory effect in vitro in liver macrophages, promoting the conversion from the pro-inflammatory M1 (induced by LPS) to the anti-inflammatory M2 phenotype (transition from M1 to M2) (a mechanism of action consistent with improved NAD + and mitochondrial homeostasis-regulated metabolic reprogramming).
[0519] Furthermore, these effects lead to an increase in survival in LPS-induced and cecal ligation and puncture (CLP)-induced systemic inflammation mouse models, expanding the therapeutic opportunities for ACMSD inhibitors in systemic inflammation-related diseases of the hepatorenal axis.
[0520] Materials and methods: To evaluate the anti-inflammatory properties and the transition from M1 to M2, treatment with compound I-18 for 24 hours in the presence of LPS was performed. Renal tubular cells were stimulated with compound I-18 and TGFβ for 16 hours to evaluate the expression of genes involved in fibrosis. Compound I-18 (50 mg / kg) was administered daily to mice treated with 15 mg / kg of LPS. Survival rate and liver gene regulation were monitored in sham, LPS, and LPS + compound I-18 groups (n = 8). CLP was performed on mice aged 12 - 15 weeks (50% ligation, penetrating puncture with a 21G needle) to evaluate CLP-induced sepsis. Compound I-18 was administered at a concentration of 50 mg / kg for 7 days starting from CLP. Survival rate and the expression of genes involved in renal inflammation were monitored.
[0521] Results: ACMSD expression was measured in liver resident macrophages (Kupffer cells). Pharmacological inhibition of ACMSD demonstrated anti-inflammatory properties that promoted the anti-inflammatory M2 phenotype in vitro. Compound I-18 decreased in vitro fibrosis in renal cells. Compound I-18 promoted the survival of mice treated with two different inflammatory stimuli (LPS and CLP).
[0522] Conclusion: Overall, these results expand the therapeutic opportunities of ACMSD inhibitors, reveal a novel physiological function of ACMSD in the regulation of the systemic inflammatory response, and provide further therapeutic applications for ACMSD inhibitors.
[0523] Effect of ACMSD inhibition on the polarization of M1 vs M2 macrophages Macrophages are an essential component of innate immunity and play a central role in inflammation and host defense. Macrophages undergo classical M1 activation, leading to the release of pro-inflammatory cytokines, ROS, and nitric oxide. Alternatively, M2 activation can promote tissue remodeling and exert immunomodulatory functions that produce ornithine and polyamines. Macrophages can return from the activated M1 state to M2 due to their plasticity, and vice versa. The polarization of Kupffer cell M1 / M2 contributes critically to the etiology of hepatic metabolic syndrome.
[0524] The M1 phenotype exhibits pro-inflammatory characteristics. The M2 phenotype exerts anti-inflammatory and immunosuppressive effects.
[0525] The shift from M1 to M2 can be seen by the inhibition of ACMSD by compound I-18 in pro-inflammatory M1 macrophages. To evaluate the role of ACMSD inhibition in M1 / M2 transition, mouse Kupffer cells were treated with LPS and compound I-18. Figure 30 shows that compound I-18 blocks pro-inflammatory M1 Kupffer macrophages.
[0526] The shift from M1 to M2 can be seen by the inhibition of ACMSD by compound I-18 due to the increase in anti-inflammatory M2 macrophages. M2 phenotype biomarkers should increase during inflammation and indicate an anti-inflammatory response. Figure 31 shows that compound I-18 promotes anti-inflammatory M2 Kupffer macrophages.
[0527] Also, two different stimuli (LPS and IL-4) were applied to evaluate the M2 phenotype. Figure 32 shows that compound I-18 can promote the M2 macrophage phenotype.
[0528] Therefore, compound I-18 is shown to dose-dependently block pro-inflammatory M1 macrophages in mouse Kupffer cells. Compound I-18 promotes the M2 macrophage phenotype in mouse Kupffer cells. These results suggest that compound I-18 may have an anti-inflammatory effect, promoting anti-inflammatory M2 while reducing the pro-inflammatory M1 phenotype.
[0529] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In this specification, the singular forms also include the plural forms unless the context clearly dictates otherwise. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, but the appropriate methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are hereby incorporated by reference in their entirety. References cited herein are not admitted to be prior art to the claimed present disclosure. In case of conflict, the present specification, including definitions, will control. Further, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0530] Equivalents One of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the present disclosure.
Claims
1. A method for treating an acute inflammatory condition of a subject, comprising administering to the subject a therapeutically effective amount of a compound represented by formula (I): 【Chemical 1】 or a pharmaceutically acceptable salt or tautomer thereof, wherein, X is O or OH; L is -(CH 2 ), m CH 2 CH 2 -, -(CH 2 ), m Y(CH 2 ), p -, -(CH 2 ), m C(O)(CH 2 ), p -, -(CH 2 ), m C(O)O(CH 2 ), p -, -(CH 2 ), m C(O)NR 2 (CH 2 ), p - or -(CH 2 ), m NR 2 C(O)(CH 2 ), p wherein; Y is O, N or S(O) q wherein; R 1 is C 6 -C 10 aryl or heteroaryl, and aryl and heteroaryl are substituted by R a and R b and optionally substituted by one or more R e ; R 2 is H or C 1 -C 6 is alkyl; R a and R b one of which is hydrogen and the other is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazolone, -(CH 2 ) r dihydrotetrazolone, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x , -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHSO 2 alkyl; R c is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x , -CO 2 R x or NO 2 and; R d is methyl, an optionally substituted 5- to 10-membered aryl, an optionally substituted 5- or 6-membered heteroaryl, or an optionally substituted 5- or 6-membered carbocycle; Each R x is, independently in each occurrence, hydrogen or C 1 -C 6 -alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y 、C 1 -C 6 haloalkyl, -NHR z 、-OH or -CN; R f is H or absent; Each R y and R z are independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; each m and p is, independently, 0, 1, or 2, and m + p < 3; q is 0, 1, or 2; r is 0 or 1; the dotted line is an optional double bond; However, when X is O, L is -SCH 2 -, and R d is phenyl which may be substituted, R c is not hydrogen or -CN, when X is O, L is -SCH 2 -, and R d is methyl, R c is C 1 -C 6 is not alkyl, when X is O, L is -SCH 2 -, and R d is 2-furyl, R c is not -CN, method.
2. The method according to claim 1, wherein the compound is represented by formula (Ia): 【Chemical Formula 2】 or a pharmaceutically acceptable salt or tautomer thereof.
3. The method according to claim 1 or 2, wherein the compound is represented by formula (Ib): 【Chemical Formula 3】 or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2, or 3.
4. R a and R b wherein one of them is hydrogen and the other is CO 2 R x , -CH 2 CO 2 R x , tetrazole, or oxadiazolone; R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, an optionally substituted 5- to 10-membered aryl, an optionally substituted 5- or 6-membered heteroaryl, or an optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 -alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y 、C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; Each R y and R z are independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; n is 0, 1, 2, or 3; However, when R d is phenyl which may be substituted, R c is not hydrogen or -CN, and when R d is 2-furyl, R c is not -CN. The method according to any one of claims 1 to 3.
5. The method according to any one of claims 1 to 3, wherein the compound is represented by formula (II): 【Chemical Formula 4】 or a pharmaceutically acceptable salt thereof.
6. R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl, the method according to claim 5.
7. R c The method according to any one of claims 1 to 6, wherein R is -CN or a halogen.
8. R d The method according to any one of claims 1 to 7, wherein R is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl.
9. R d The method according to any one of claims 1 to 7, wherein R is methyl, cyclohexyl, pyridinyl, thiazolyl, thienyl or optionally substituted phenyl.
10. R a is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the method according to any one of claims 1 to 4.
11. R b is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the method according to any one of claims 1 to 4.
12. The method according to any one of claims 1 to 4, wherein n is 0.
13. The method according to claim 1, wherein the compound is selected from the group consisting of [Chemical Formula 5] and 【Chemical Formula 6】 or a pharmaceutically acceptable salt thereof.
14. The method according to claim 1, wherein the compound is selected from the group consisting of 【Chemical Formula 7】 and 【Chemical 8】 or a pharmaceutically acceptable salt thereof.
15. The method according to claim 1, wherein the compound is selected from the group consisting of 【Chemical Formula 9】 and 【Chemical 10】 or a pharmaceutically acceptable salt thereof.
16. The method according to claim 1, wherein the compound is 【Chemical Formula 11】 or a pharmaceutically acceptable salt thereof.
17. The method according to claim 1, wherein the compound is 【Chemical Formula 12】 or a pharmaceutically acceptable salt thereof.
18. The method according to claim 1, wherein the compound is 【Chemical 13】 or a pharmaceutically acceptable salt thereof.
19. The method according to claim 1, wherein the compound is 【Chemical Formula 14】 or a pharmaceutically acceptable salt thereof.
20. The method according to any one of claims 1 to 19, wherein the acute inflammatory condition is a systemic inflammatory condition.
21. The method according to any one of claims 1 to 19, wherein the acute inflammatory condition is an organ-specific condition.
22. The method according to any one of claims 1 to 19, wherein the acute inflammatory state is a cytokine storm or hypercytokinemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.
23. The method according to any one of claims 1 to 19, wherein the acute inflammatory state is acute pancreatitis, hepatitis, respiratory condition, or enteritis.
24. The method according to any one of claims 1 to 23, wherein the method reduces a pro-inflammatory cytokine or increases an anti-inflammatory cytokine.
25. The method according to claim 24, wherein the pro-inflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α or TGF-β.
26. The method according to claim 24, wherein the pro-inflammatory cytokine is MCP-1, TNF-α or IL-1β.
27. The method according to claim 24, wherein the pro-inflammatory cytokine is IL-6.
28. The method according to claim 24, wherein the anti-inflammatory cytokine is IL-10.
29. The method according to any one of claims 1 to 23, wherein the expression of the searchin-1 regulatory genes sod2, tfam, dda1 genes is increased in the liver.
30. Formula (I): 【Chemical Formula 15】 A compound represented thereby or a pharmaceutically acceptable salt or tautomer thereof, wherein, X is O or OH; L is -(CH 2 ), m CH 2 CH 2 -, -(CH 2 ), m Y(CH 2 ), p -, -(CH 2 ), m C(O)(CH 2 ), p -, -(CH 2 ), m C(O)O(CH 2 ), p -, -(CH 2 ), m C(O)NR 2 (CH 2 ), p - or -(CH 2 ), m NR 2 C(O)(CH 2 ), p and; Y is O, N or S(O) q and; R 1 is C 6 -C 10 aryl or heteroaryl, and aryl and heteroaryl are substituted with R a and R b and optionally substituted with one or more R e ; R 2 is H or C 1 -C 6 alkyl; R a and R b One of them is hydrogen, and the other is -(CH 2 r CO 2 R x , -OCH 2 CO 2 R x , -(CH 2 r tetrazole, -(CH 2 r oxadiazolone, -(CH 2 r tetrazolone, -(CH 2 r dihydrotetrazolone, -(CH 2 r thiadiazole, -(CH 2 r isoxazol-3-ol, -(CH 2 r P(O)(OH)OR x , -(CH 2 r S(O) 2 OH, -(CH 2 r C(O)NHCN, or -(CH 2 r C(O)NHSO 2 alkyl; R c is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x , -CO 2 R x or NO 2 and; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; Each R x is, independently in each occurrence, hydrogen or C 1 -C 6 -alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y 、C 1 -C 6 haloalkyl, -NHR z 、-OH or -CN; R f is H or absent; Each R y and R z are independently hydrogen, C 1 -C 6 -alkyl, or C 1 -C 6 -haloalkyl; each m and p is independently 0, 1, or 2, and m + p < 3; q is 0, 1, or 2; r is 0 or 1; the dotted line is an optional double bond; However, when X is O, L is -SCH 2 -, and R d is phenyl which may be substituted, R c is not hydrogen or -CN, when X is O, L is -SCH 2 -, and R d is methyl, R c is C 1 -C 6 is not alkyl, when X is O, L is -SCH 2 -, and R d is 2-furyl, R c is not -CN; A compound for use in the treatment of an acute inflammatory state.
31. The compound for use according to claim 30, wherein the compound is represented by formula (Ia): 【Chemical Formula 16】 or a pharmaceutically acceptable salt or tautomer thereof.
32. The compound for use according to claim 30 or 31, wherein the compound is represented by formula (Ib): 【Chemical 17】 or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.
33. R a and R b one of which is hydrogen and the other is CO 2 R x , -CH 2 CO 2 R x tetrazole, or oxadiazolone; R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, an optionally substituted 5- to 10-membered aryl, an optionally substituted 5- or 6-membered heteroaryl, or an optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 -alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; Each R y and R z are independently hydrogen, C 1 -C 6 -alkyl, or C 1 -C 6 -haloalkyl; n is 0, 1, 2 or 3; However, when R d is phenyl which may be substituted, R c is not hydrogen or -CN, and when R d is 2-furyl, R c is not -CN. A compound for use according to any one of claims 30 to 32.
34. The compound is of formula (II): 【Chemical Formula 18】 The compound for use according to any one of claims 30 to 32, which is represented by [[ID=]] or a pharmaceutically acceptable salt thereof.
35. R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl, a compound for use according to claim 34.
36. R c A compound for use according to any one of claims 30 to 35, wherein R is -CN or halogen.
37. R d A compound for use according to any one of claims 30 to 36, wherein R is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl.
38. R d A compound for use according to any one of claims 30 to 36, wherein R is methyl, cyclohexyl, pyridinyl, thiazolyl, thienyl or optionally substituted phenyl.
39. R a is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), a compound for use according to any one of claims 30 to 33.
40. R b is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), a compound for use according to any one of claims 30 to 33.
41. The compound for use according to any one of claims 30 to 33, wherein n is 0.
42. The compound, wherein 【Chemical 19】 and 【Chemical 20】 is selected from the group consisting of [[ID=]] and a pharmaceutically acceptable salt thereof, the compound for use according to claim 30.
43. The compound, wherein 【Chemical 21】 and 【Chemical 22】 is selected from the group consisting of [[ID=]] and a pharmaceutically acceptable salt thereof, the compound for use according to claim 30.
44. The compound, wherein 【Chemical 23】 and 【Chemical 24】 is selected from the group consisting of [[ID=]] and a pharmaceutically acceptable salt thereof, the compound for use according to claim 30.
45. The compound, wherein 【Chemical 25】 or a pharmaceutically acceptable salt thereof, the compound for use according to claim 30.
46. The compound, wherein 【Chemical 26】 or a pharmaceutically acceptable salt thereof, the compound for use according to claim 30.
47. The compound, wherein 【Chemical 27】 or a pharmaceutically acceptable salt thereof, the compound for use according to claim 30.
48. The compound, wherein 【Chemical 28】 or a pharmaceutically acceptable salt thereof, the compound for use according to claim 30.
49. The compound for use according to any one of claims 30 to 48, wherein the acute inflammatory condition is a systemic inflammatory condition.
50. The compound for use according to any one of claims 30 to 48, wherein the acute inflammatory condition is an organ-specific condition.
51. The compound for use according to any one of claims 30 to 48, wherein the acute inflammatory condition is cytokine storm or hypercytokinemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.
52. The compound for use according to any one of claims 30 to 48, wherein the acute inflammatory condition is acute pancreatitis, hepatitis, respiratory condition, or enteritis.
53. The compound for use according to any one of claims 30 to 52, wherein the pro-inflammatory cytokine is decreased or the anti-inflammatory cytokine is increased.
54. A compound for use according to claim 53, wherein the pro-inflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α or TGF-β.
55. A compound for use according to claim 53, wherein the pro-inflammatory cytokine is MCP-1, TNF-α or IL-1β.
56. A compound for use according to claim 53, wherein the pro-inflammatory cytokine is IL-6.
57. A compound for use according to claim 53, wherein the anti-inflammatory cytokine is IL-10.
58. A compound for use according to any one of claims 30 to 52, wherein the expression of the searchin-1 regulatory genes sod2, tfam, dda1 genes is increased in the liver.
59. Use of a compound represented by formula (I): 【Chemical Formula 29】 or a pharmaceutically acceptable salt or tautomer thereof, wherein, X is O or OH; L is -(CH 2 ), m CH 2 CH 2 -, -(CH 2 ), m Y(CH 2 ), p -, -(CH 2 ), m C(O)(CH 2 ), p -, -(CH 2 ), m C(O)O(CH 2 ), p -, -(CH 2 ), m C(O)NR 2 (CH 2 ), p - or -(CH 2 ), m NR 2 C(O)(CH 2 ), p and; Y is O, N or S(O) q and R 1 is C 6 -C 10 aryl or heteroaryl, where aryl and heteroaryl are substituted by R a and R b and optionally substituted by one or more R e ; R 2 is H or C 1 -C 6 alkyl; R a and R b one of which is hydrogen and the other is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazolone, -(CH 2 ) r dihydrotetrazolone, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x , -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHSO 2 alkyl; R c is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x , -CO 2 R x or NO 2 and; R d is methyl, an optionally substituted 5- to 10-membered aryl, an optionally substituted 5- or 6-membered heteroaryl, or an optionally substituted 5- or 6-membered carbocycle; Each R x is, independently in each occurrence, hydrogen or C 1 -C 6 -alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y 、C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; R f is H or does not exist; Each R y and R z are independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; each m and p is independently 0, 1, or 2, and m + p < 3; q is 0, 1, or 2; r is 0 or 1; the dotted line is an optional double bond; However, when X is O, L is -SCH 2 -, and R d is phenyl which may be substituted, R c is not hydrogen or -CN, when X is O, L is -SCH 2 -, and R d is methyl, R c is C 1 -C 6 is not alkyl, when X is O, L is -SCH 2 -, and R d is 2-furyl, R c is not -CN; for treating an acute inflammatory condition.
60. The use according to claim 59, wherein the compound is represented by formula (Ia): 【Chemical 30】 or a pharmaceutically acceptable salt or tautomer thereof.
61. The use according to claim 59 or 60, wherein the compound is represented by formula (Ib): 【Chemical 31】 or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.
62. R a and R b one of which is hydrogen and the other is CO 2 R x , -CH 2 CO 2 R x is tetrazole or oxadiazolone; R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, an optionally substituted 5- to 10-membered aryl, an optionally substituted 5- or 6-membered heteroaryl, or an optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 -alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; Each R y and R z are independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; n is 0, 1, 2 or 3; However, when R d is phenyl which may be substituted, R c is not hydrogen or -CN, and when R d is 2-furyl, R c is not -CN. The use according to any one of claims 59 to 61.
63. The use according to any one of claims 59 to 61, wherein the compound is represented by formula (II): 【Chemical 32】 or a pharmaceutically acceptable salt thereof.
64. R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl, Use according to claim 63.
65. R c Use according to any one of claims 59 to 64, wherein R is -CN or halogen.
66. R d Use according to any one of claims 59 to 65, wherein R is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl.
67. R d The use according to any one of claims 59 to 65, wherein R is methyl, cyclohexyl, pyridinyl, thiazolyl, thienyl or optionally substituted phenyl.
68. R a is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the use according to any one of claims 59 to 62.
69. R b is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the use according to any one of claims 59 to 62.
70. The use according to any one of claims 59 to 62, wherein n is 0.
71. The use according to claim 59, wherein the compound is selected from the group consisting of 【Chemical Formula 33】 and 【Chemical Formula 34】 or a pharmaceutically acceptable salt thereof.
72. The use according to claim 59, wherein the compound is selected from the group consisting of 【Chemical 35】 and 【Chemical Formula 36】 or a pharmaceutically acceptable salt thereof.
73. The use according to claim 59, wherein the compound is selected from the group consisting of 【Chemical 37】 and 【Chemical Formula 38】 or a pharmaceutically acceptable salt thereof.
74. The use according to claim 59, wherein the compound is 【Chemical Formula 39】 The use according to claim 59, which is the compound or a pharmaceutically acceptable salt thereof.
75. wherein the compound is 【Chemical Formula 40】 The use according to claim 59, which is the compound or a pharmaceutically acceptable salt thereof.
76. wherein the compound is 【Chemical 41】 The use according to claim 59, which is the compound or a pharmaceutically acceptable salt thereof.
77. wherein the compound is 【Chemical 42】 The use according to claim 59, which is the compound or a pharmaceutically acceptable salt thereof.
78. The use according to any one of claims 59 to 77, wherein the acute inflammatory condition is a systemic inflammatory condition.
79. The use according to any one of claims 59 to 77, wherein the acute inflammatory condition is an organ-specific condition.
80. The use according to any one of claims 59 to 77, wherein the acute inflammatory condition is cytokine storm or hypercytokinemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.
81. The use according to any one of claims 59 to 77, wherein the acute inflammatory condition is acute pancreatitis, hepatitis, respiratory condition, or enteritis.
82. The use according to any one of claims 59 to 81, wherein the pro-inflammatory cytokine is decreased or the anti-inflammatory cytokine is increased.
83. The use according to claim 82, wherein the pro-inflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.
84. The use according to claim 82, wherein the pro-inflammatory cytokine is MCP-1, TNF-α, or IL-1β.
85. The use according to claim 82, wherein the pro-inflammatory cytokine is IL-6.
86. The use according to claim 82, wherein the anti-inflammatory cytokine is IL-10.
87. The use according to any one of claims 59 to 81, wherein the expression of the sirtuin-1 regulatory genes sod2, tfam, and dda1 genes is increased in the liver.
88. Formula (I): 【Chemical Formula 43】 The use of the compound represented thereby, or a pharmaceutically acceptable salt or tautomer thereof, wherein X is O or OH; L is -(CH 2 ), m CH 2 CH 2 -, -(CH 2 ), m Y(CH 2 ), p -, -(CH 2 ), m C(O)(CH 2 ), p -, -(CH 2 ), m C(O)O(CH 2 ), p -, -(CH 2 ), m C(O)NR 2 (CH 2 ), p - or -(CH 2 ), m NR 2 C(O)(CH 2 ), p and; Y is O, N or S(O) q and R 1 is C 6 -C 10 aryl or heteroaryl, where aryl and heteroaryl are substituted by R a and R b and optionally substituted by one or more R e ; R 2 is H or C 1 -C 6 alkyl; R a and R b one of which is hydrogen and the other is -(CH 2 ) r CO 2 R x , -OCH 2 CO 2 R x , -(CH 2 ) r tetrazole, -(CH 2 ) r oxadiazolone, -(CH 2 ) r tetrazolone, -(CH 2 ) r dihydrotetrazolone, -(CH 2 ) r thiadiazole, -(CH 2 ) r isoxazol-3-ol, -(CH 2 ) r P(O)(OH)OR x , -(CH 2 ) r S(O) 2 OH, -(CH 2 ) r C(O)NHCN, or -(CH 2 ) r C(O)NHSO 2 alkyl; R c is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halogen, -CN, -OR x , -CO 2 R x or NO 2 and; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; Each R x is, independently in each occurrence, hydrogen or C 1 -C 6 -alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; R f is H or does not exist; Each R y and R z are independently hydrogen, C 1 -C 6 -alkyl, or C 1 -C 6 -haloalkyl; each m and p is independently 0, 1, or 2, and m + p < 3; q is 0, 1, or 2; r is 0 or 1; The dotted line is an arbitrary double bond; However, when X is O, L is -SCH 2 -, and R d is phenyl which may be substituted, R c is not hydrogen or -CN, when X is O, L is -SCH 2 -, and R d is methyl, R c is C 1 -C 6 is not alkyl, when X is O, L is -SCH 2 -, and R d is 2-furyl, R c is not -CN, Use in the manufacture of a medicament for treating an acute inflammatory condition.
89. The use according to claim 88, wherein the compound is of formula (Ia): 【Chemical 44】 or a pharmaceutically acceptable salt or tautomer thereof.
90. The compound is of formula (Ib): 【Chemical 45】 or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3, the use according to claim 88 or 89.
91. R a and R b wherein one of them is hydrogen and the other is CO 2 R x , -CH 2 CO 2 R x is tetrazole or oxadiazolone; R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, an optionally substituted 5- to 10-membered aryl, an optionally substituted 5- or 6-membered heteroaryl, or an optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl; Each R e is independently C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, halogen, -OR y , C 1 -C 6 haloalkyl, -NHR z , -OH or -CN; Each R y and R z are independently hydrogen, C 1 -C 6 alkyl, or C 1 -C 6 haloalkyl; n is 0, 1, 2 or 3; However, when R d is phenyl which may be substituted, R c is not hydrogen or -CN, and when R d is 2-furyl, R c is not -CN. The use according to any one of claims 88 to 90.
92. The compound is of formula (II): 【Chemical Formula 46】 or a pharmaceutically acceptable salt thereof, the use according to any one of claims 88 to 90.
93. R c is halogen, -CN, -OR x or C 1 -C 6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocycle; R x is hydrogen or C 1 -C 6 alkyl, the use according to claim 92.
94. R c Use according to any one of claims 88 to 93, wherein R is -CN or halogen.
95. R d The use according to any one of claims 88 to 94, wherein R is methyl, cyclohexyl, pyridinyl, thiazolyl, phenyl or thienyl.
96. R d The use according to any one of claims 88 to 94, wherein R is methyl, cyclohexyl, pyridinyl, thiazolyl, thienyl or optionally substituted phenyl.
97. R a is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the use according to any one of claims 88 to 91.
98. R b is hydrogen, CH 2 CO 2 H, tetrazole or oxadiazolone (1,2,4-oxadiazol-5(4H)-one), the use according to any one of claims 88 to 91.
99. The use according to any one of claims 88 to 91, wherein n is 0.
100. The compound is 【Chemical 47】 and 【Chemical Formula 48】 or a pharmaceutically acceptable salt thereof, the use according to claim 88.
101. The compound is 【Chemical 49】 and 【Chemical 50】 or a pharmaceutically acceptable salt thereof, the use according to claim 88.
102. The compound is 【Chemical Formula 51】 and 【Chemical 52】 or a pharmaceutically acceptable salt thereof, the use according to claim 88.
103. The compound is 【Chemical Formula 53】 or a pharmaceutically acceptable salt thereof, the use according to claim 88.
104. The compound is 【Chemical 54】 or a pharmaceutically acceptable salt thereof, the use according to claim 88.
105. The compound is 【Chemical Formula 55】 or a pharmaceutically acceptable salt thereof, the use according to claim 88.
106. The compound is 【Chemical 56】 or a pharmaceutically acceptable salt thereof, the use according to claim 88.
107. The use according to any one of claims 88 to 106, wherein the acute inflammatory condition is a systemic inflammatory condition.
108. The use according to any one of claims 88 to 106, wherein the acute inflammatory condition is an organ-specific condition.
109. The use according to any one of claims 88 to 106, wherein the acute inflammatory condition is cytokine storm or hypercytokinemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.
110. The use according to any one of claims 88 to 106, wherein the acute inflammatory condition is acute pancreatitis, hepatitis, respiratory condition, or enteritis.
111. The use according to any one of claims 88 to 110, wherein the pro-inflammatory cytokine is decreased or the anti-inflammatory cytokine is increased.
112. The use according to claim 111, wherein the pro-inflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α or TGF-β.
113. The use according to claim 111, wherein the pro-inflammatory cytokine is MCP-1, TNF-α or IL-1β.
114. The use according to claim 111, wherein the pro-inflammatory cytokine is IL-6.
115. The use according to claim 111, wherein the anti-inflammatory cytokine is IL-10.
116. The use according to any one of claims 88 to 110, wherein the expression of the searchin-1 regulatory genes sod2, tfam, dda1 genes is increased in the liver.