Crosslinked multispecific antibody
The introduction of unnatural amino acids in targeting domains enables covalent binding to tumor cells, addressing the limitations of current protein therapies and enhancing the efficacy of targeted interactions with immune cells.
Patent Information
- Application Number
- JP2024569724
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-05-27
- Filing Date
- 2023-05-25
- Publication Date
- 2025-06-24
AI Technical Summary
Current protein-based therapies face limitations due to the inability of amino acid side chains to form covalent bonds, which restricts the stability and efficacy of protein interactions.
Development of a conjugate comprising a first targeting domain with unnatural amino acids (UAAs) that can covalently bind to a target on a tumor cell, and a second targeting domain that binds to an immune cell, facilitating targeted therapy.
The use of UAAs in the targeting domain allows for stable covalent binding to tumor cells, enhancing the therapeutic efficacy by promoting targeted interactions with immune cells.
Smart Images

Figure 2025519152000001_ABST
Abstract
Description
Technical Field
[0001] Cross-reference This application claims the benefit of U.S. Provisional Patent Application No. 63 / 346,798, filed May 27, 2022, the entire disclosure of which is incorporated herein by reference.
[0002] Sequence Listing This application includes a sequence listing that was electronically submitted in XML format, the entire disclosure of which is incorporated herein by reference. A copy of the XML created on May 24, 2023, is named 60801-712_601_SL.xml and is 75 kilobytes in size.
Background Art
[0003] Since the amino acid side chains of proteins generally cannot form covalent bonds with each other, except for cysteine which forms reversible and relatively weak disulfide bonds, proteins mainly utilize non-covalent interactions within or between proteins.
Summary of the Invention
[0004] In some aspects, the present specification provides a conjugate comprising a first targeting domain configured to bind to a first target on a first cell and a second targeting domain configured to bind to a second target on a second cell, wherein the first targeting domain comprises at least one first unnatural amino acid (UAA), whereby the first targeting domain is capable of covalently binding to the first target at a site from the UAA to the first target. In some embodiments, the second cell is an immune cell. In some embodiments, the first cell is a tumor cell. In some embodiments, the first targeting domain comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the first targeting domain comprises a single-domain antibody (sdAb). In some embodiments, the first UAA is included within or near a region of the first targeting domain that makes interface contact with the first target. In some embodiments, the second targeting domain comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the second targeting domain comprises a single-domain antibody (sdAb). In some embodiments, the first targeting domain and the second targeting domain are linked by chemical conjugation. In some embodiments, the first targeting domain and the second domain are linked by a linker. In some embodiments, the linker is a polypeptide linker. In some embodiments, the first target is a first cell surface molecule. In some embodiments, the second target is a second cell surface molecule. In some embodiments, at least one UAA comprises an aryl-fluorosulfate moiety. In some embodiments, at least one first UAA has the formula I
[0005]
Chemical formula
[0006]
Chemical formula
[0007]
Chemical formula
[0008]
Chemical formula
[0009]
Chemical formula
[0010]
Chemical formula
[0011]
Chemical formula
[0012]
Chemical formula
[0013]
Chemical formula
[0014]
Chemical formula
[0015]
Chemical formula
[0016] [Chemical formula] having the structure, wherein X is independently O or NR', and R', when present, is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl. In some embodiments, the first cell surface molecule is 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some embodiments, the second cell surface molecule is a cell surface molecule present on immune cells. In some embodiments, the immune cells include T cells or NK cells. In some embodiments, the second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, or Vγ9Vδ2. In some embodiments, the first targeting domain includes any one of SEQ ID NOs: 1-4, 16-18, 20, 29, 50, or 51. In some embodiments, the first targeting domain includes a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-4, 16-18, 20, 29, 50, or 51. In some embodiments, the second targeting domain includes a sequence having at least 70% sequence identity to SEQ ID NOs: 22, 25, or 52-55. In some embodiments, the conjugate includes a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 19, 21, 23, 24, 26-28, 30, 35-49, 57, or 64. In some embodiments, the first targeting domain includes SEQ ID NO: 16 or 51. In some embodiments, the first targeting domain including SEQ ID NO: 16 further includes a non-natural amino acid at position 109 compared to SEQ ID NO: 16. In some embodiments, the first targeting domain including SEQ ID NO: 51 further includes a non-natural amino acid at position 101 compared to SEQ ID NO: 51.
[0017] In some embodiments, methods are provided herein that include administering a conjugate according to embodiments of the present disclosure, the conjugate covalently binding to a first target on the surface of a first cell. In some embodiments, the first cell is a tumor cell. In some embodiments, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT. In some embodiments, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7.
[0018] In some embodiments, provided herein are methods comprising the step of administering a conjugate according to an embodiment of the present disclosure, the conjugate binding to a second target on the surface of a second cell. In some embodiments, the first cell is a tumor cell. In some embodiments, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT. In some embodiments, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7.
[0019] In some embodiments, provided herein are methods comprising administering a conjugate according to an embodiment of the present disclosure, the conjugate covalently binding to a first target on the surface of a first cell, the conjugate binding to a second target on a second cell. In some embodiments, the first cell is a tumor cell. In some embodiments, the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT. In some embodiments, the first target comprises 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some embodiments, the second cell is an immune cell, and the immune cell is a T cell or an NK cell. In some embodiments, the second cell comprises a second cell surface molecule. In some embodiments, the second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, or Vγ9Vδ2. In some embodiments, the first targeting domain comprises any one of SEQ ID NOs: 1-4, 16-18, 20, 29, 50, or 51.In some embodiments, the first targeting domain comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-4, 16-18, 20, 29, 50, or 51. In some embodiments, the second targeting domain comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 22, 25, or 52-55. In some embodiments, the conjugate comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 19, 21, 23, 24, 26-28, 30, 35-49, 57, or 64. In some embodiments, the first targeting domain comprises SEQ ID NO: 16 or 51. In some embodiments, the first targeting domain comprising SEQ ID NO: 16 further comprises a non-natural amino acid at position 109 compared to SEQ ID NO: 16. In some embodiments, the first targeting domain comprising SEQ ID NO: 51 further comprises a non-natural amino acid at position 101 compared to SEQ ID NO: 51.
[0020] In some aspects, provided herein is a method of treating a proliferative disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a conjugate according to embodiments of the present disclosure. In some embodiments, the proliferative disease or disorder is cancer.
[0021] In some aspects, provided herein is a method of manufacturing a conjugate according to embodiments of the present disclosure, comprising synthesizing in vivo a first targeting domain comprising at least one non-natural amino acid. In some embodiments, the method further comprises synthesizing in vivo a second domain. In some embodiments, the synthesizing step comprises the use of an orthogonal tRNA synthetase / suppressor tRNA pair. In some embodiments, the synthesizing step comprises an orthogonal tRNA synthetase / suppressor tRNA pair derived from pyrrolidine tRNA synthetase / tRNA Pyl and comprising.
[0022] Incorporation by reference All publications, patents, and patent applications referred to in this specification are hereby incorporated by reference to the same extent as if each individual publication, patent, or patent application had been specifically and individually indicated to be incorporated by reference.
Brief Description of the Drawings
[0023] The novel features of the present disclosure are particularly set forth in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description, which illustrates exemplary embodiments in which the principles of the present disclosure are utilized, and the accompanying drawings.
[0024]
Figure 1A
Figure 1B
Figure 2
Figure 3
Figure 4A
Figure 4B
Figure 5A
Figure 5B
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11A
Figure 11B
Figure 12A
Figure 12B
Figure 13A
Figure 13B
Figure 14A
Figure 14B
Figure 14C
Figure 14D
Figure 14E
Figure 15
Figure 16A
Figure 16B
Figure 16C
Figure 17
DETAILED DESCRIPTION OF THE INVENTION
[0025] Antibodies, antibody fragments, and antibody-related constructs can be useful tools for research and clinical applications. However, in some cases, the use of these molecules is limited by the on rate / off rate and stability towards the target. Provided herein are compositions and methods for specific covalent conjugation to a target. In some cases, the conjugate comprises a first targeting domain, a second targeting domain, and at least one unnatural amino acid (UAA), wherein the first targeting domain is configured to bind to a first target on a first cell, and the second targeting domain is configured to bind to a second target on a second cell. In some cases, the first cell is a tumor cell and the second cell is an immune cell. In some cases, the second targeting domain is configured to bind to a protein on the surface of the immune cell, and the immune cell is a T cell, NK cell, myeloid cell, or macrophage. Optionally, the T cell is an NKT cell. Optionally, the first or second targeting domain comprises at least one UAA near the interface between the target and the targeting moiety, such that when the targeting domain binds to the target, a covalent bond is formed between the target and the UAA. In some cases, the covalent interaction eliminates, reduces, or stabilizes the off rate of the conjugate that binds to the target. Optionally, the second targeting domain may also comprise a UAA. Optionally, only the first targeting domain comprises a UAA and the second domain does not. Optionally, only the first targeting domain comprises a UAA, and the first targeting domain is configured to bind to a first target on a tumor cell. Optionally, only the first targeting domain comprises a UAA, the first targeting domain is configured to bind to a first target on a tumor cell, and the second targeting domain is configured to bind to a second target on an immune cell.
[0026] Conjugate The conjugates herein include a first targeting domain and a second targeting domain, where the first targeting domain is configured to bind to a first target such as a first target on a tumor cell, and the second targeting domain is configured to bind to a second target present on a different cell. In some instances, the second target is on an immune cell such as a T cell, NK cell, myeloid cell, or macrophage. In some instances, the conjugate includes at least one unnatural amino acid (UAA) included in the first targeting domain, the second targeting domain, or each of the first targeting domain and the second targeting domain includes at least one UAA, whereby the targeting domain containing the UAA is configured to bind to its target and one of the UAAs within the targeting domain forms a covalent bond with the target. In some instances, the first targeting domain is configured to form a covalent bond with the target, whereby at least one UAA is present within the targeting domain near the interface between the target and the targeting domain, such that when the targeting domain binds to the target or is near the target, a covalent bond is formed between the target and the UAA within the targeting domain of the conjugate.
[0027] In some cases, a UAA contained in a first targeting domain forms a covalent bond with its target (e.g., a target on the surface of a tumor cell), and a second targeting domain in the conjugate binds to a second target on an immune cell such as a T cell, NK cell, myeloid cell, or macrophage (e.g., specifically binds to the second target or binds by a UAA that forms a covalent bond with the second target). In this case, the conjugate activates the immune system against the tumor cell by bringing the immune cell (e.g., a T cell, NK cell, myeloid cell, or macrophage) into proximity to the tumor cell. In one embodiment, the immune cell is a T cell, and the second targeting domain binds to a second target on the T cell. In another embodiment, the immune cell is an NK cell, and the second targeting domain binds to a second target on the NK cell. In some cases, the T cell is an NKT cell. In yet another embodiment, the immune cell is a myeloid cell, and the second targeting domain binds to a second target on the myeloid cell. In yet another embodiment, the immune cell is a macrophage, and the second targeting domain binds to a second target on the macrophage.
[0028] In some cases, the conjugate includes more than two targeting domains and has at least 1, 2, 3, 4, 5, 6, or more than 7 targeting domains. In some cases, the targeting domains are linked to each other via a linker (e.g., a chemical linker, a fusion protein, or other linker provided herein). In some cases, the first targeting domain and the second targeting domain of the conjugate herein are linked as a fusion protein.
[0029] In some cases, the targeting domain (e.g., the first targeting domain, the second targeting domain, or both) comprises an antibody or antigen-binding fragment such as a monospecific Fab2, bispecific Fab2, trispecific Fab3, monovalent IgG, scFv, bispecific diabody, trispecific tribody, scFv-Fc, sdAb, minibody, IgNAR, V-NAR, hcIgG, VHH, or peptibody. In some embodiments, the targeting moiety comprises a single-domain antibody (sdAb; also referred to as a nanobody). In some cases, the targeting domain comprises a region of one or more complementarity-determining regions (CDRs). In some embodiments, the targeting domain comprises an antibody or antigen-binding fragment that binds to a cell surface molecule. In some cases, the conjugate comprises a second targeting domain, which comprises an antibody or antigen-binding fragment such as a monospecific Fab2, bispecific Fab2, trispecific Fab3, monovalent IgG, scFv, bispecific diabody, trispecific tribody, scFv-Fc, sdAb, minibody, IgNAR, V-NAR, hcIgG, VHH, or peptibody. In some embodiments, the first targeting domain and the second targeting domain each comprise an antibody or antigen-binding fragment, and the structures of such antibodies or antigen-binding fragments may be the same or different. For example, the first targeting domain may be a single-chain antibody (e.g., Fv), and the second targeting domain may be an sdAb, or, for example, the first targeting domain may be an sdAb, and the second targeting domain may be an sdAb.
[0030] In some cases, the targeting domain (e.g., the first targeting domain and / or the second targeting domain) is an antibody mimetic such as an affibody, a darpin, or a minibinder.
[0031] The unnatural amino acid may be located at any position of the conjugate. In some cases, the first targeting domain contains the unnatural amino acid. In some cases, the first targeting domain is an antibody or antigen-binding fragment containing one or more complementarity-determining regions (CDRs), and one or more unnatural amino acids are contained within or near the CDRs of the first targeting domain. In some cases, the second targeting domain contains the unnatural amino acid. In some cases, the second targeting domain is an antibody or antigen-binding fragment containing one or more complementarity-determining regions (CDRs), and one or more unnatural amino acids are contained within or near the CDRs of the second targeting domain.
[0032] In some cases, the targeting domain includes any one of SEQ ID NOs: 1-4, 16-18, 20, 22, 29, 50, or 51. In some cases, the targeting domain includes a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1-4, 16-18, 20, 22, 25, 29, 50, or 51. In some cases, the targeting domain includes a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1-4, 16-18, 20, 22, 25, 29, or 50-55, and at least one non-natural amino acid. In some cases, the targeting domain includes constructs C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35, C36, C37, C38, C39, or C40. In an exemplary arrangement, the conjugate includes at least two targeting domains (e.g., a first targeting domain and a second targeting domain). In some cases, the conjugate includes at least two targeting domains selected from the group consisting of constructs C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35, C36, C37, C38, C39, and C40. In some cases, the conjugate includes a first targeting domain selected from the group consisting of constructs C1, C2, C3, C4, C5, C10, C11, C17, C35, C36, C37, C38, C39, and C40, and a second targeting domain. Optionally, the second targeting domain includes C6, C7, C37, C38, C39, and C40. In some cases, the conjugate includes a second targeting domain of C6, C7, C37, C38, C39, and C40, and also includes a first targeting domain that binds to a cell surface protein on a tumor cell. In some cases, the first targeting domain and the second targeting domain are the same. In some cases, the first targeting domain and the second targeting domain are different.
[0033] In some cases, the conjugate contains a tag (e.g., his6 tag) for purification or the like. In some cases, the tag includes a polyhistidine tag (e.g., his3, his4, his5, his6, his7, his8, or his9), hemagglutinin (HA) tag, SP tag (SEQ ID NO: 34), or a combination thereof. In some cases, the conjugate does not contain a his6 tag or the tag is removed prior to administration. In some cases, the conjugate contains a leader sequence for expression or secretion or the like. In some cases, the conjugate does not contain a leader sequence or the leader sequence is removed prior to administration.
[0034] In some cases, the conjugate contains a signal sequence. The signal sequence can enable expression, folding, or oxidation of the conjugate in bacterial cells. The signal sequence can transport the conjugate expressed in bacteria to another location or environment to facilitate folding or function of the conjugate. The signal sequence may be a PelB sequence. The signal sequence can enable transport of the conjugate to the periplasm of bacterial cells. The environment may be oxidative or reductive to enable disulfide formation or disulfide reduction.
[0035] Target The conjugates provided herein may be configured to bind to one or more targets. In some cases, the first and second targeting domains bind to one or more targets. In some cases, the UAA contained in the targeting domain forms a covalent bond between the targeting domain and the target. In some cases, the conjugate includes a first targeting domain containing a first UAA and a second targeting domain containing a second UAA. Such UAAs are the same in some cases or different in other cases. In some cases, the target is a cell surface molecule (i.e., is wholly or partially present on the outer surface of the cell). In some cases, the first targeting domain and the second targeting domain each bind to a different cell surface molecule.
[0036] In some cases, the first targeting domain of the conjugate is configured to bind to a first target, which is a cell surface molecule present on tumor cells. Optionally, the first target comprises a first cell surface molecule. The target in some cases is a monomer. In some cases, the first target is included in a multimeric structure consisting of homogeneous or heterogeneous units. In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, Integrin α10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target includes a cytokine. In some cases, the cytokine includes CD2, CD13, CD19, CD20, CD22, CD24, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CD123, CD138, CD142, CD147, CD155, CD166, CD171, CD205, CD228, or CD248.
[0037] In some cases, the second targeting domain of the conjugate is configured to bind to a second target, and the second target is a cell surface molecule present on an immune cell. In some cases, the immune cell is a T cell, NK cell, gamma-delta T cell, macrophage, myeloid cell, or other immune cell. In some cases, the T cell is an NKT cell. In some cases, the second target includes CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, Vγ9Vδ2, or PD-L1.
[0038] In some cases, the first targeting domain binds to a first target of a first cell, the second targeting domain binds to a second target of a second cell, the first cell is a tumor cell, and the second cell is an immune cell. In some cases, the first target on the first cell is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, Integrin α 10One or more of β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT is included.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target includes lymphocyte antigens. In some cases, the lymphocyte antigens include BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7RILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1. In some cases, the second target on the second cell includes one or more of CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, Vγ9Vδ2, or PD-L1.
[0039] Targets (e.g., a first target, a second target, or both) linked to a targeting domain (e.g., a first targeting domain, a second targeting domain, or both) may include various structures. In some cases, the target includes one or more epitopes that can be linked to the targeting domain. In some cases, the target includes multiple epitopes and can be linked to multiple targeting domains. In some cases, the target includes a monomer. In some cases, the target includes a single-chain peptide. In some cases, the target includes a multimeric molecule. In some cases, the multimeric molecule includes two or more subunits. In some cases, the subunits have the same structure. In some cases, the subunits have different structures or a combination of the same and different structures. In some cases, the multimeric molecule includes two or more molecules in a complex. In some cases, the multimeric molecule includes two proteins that form a complex with each other or interact with each other.
[0040] In some embodiments, the conjugate may bind to a first target. In some cases, the conjugate includes a first targeting domain configured to bind to a first target on a first cell. In some cases, the first targeting domain binds to the first target via ionic bonds, electrostatic interactions, hydrogen bonds, van der Waals forces, π-π stacking, or a combination thereof. In some embodiments, the first targeting component forms a covalent bond with the first target (i.e., covalently crosslinks or covalently binds). In some cases, when the first targeting component includes at least one UAA, the first targeting component forms a covalent bond with the first target.
[0041] In some embodiments, the conjugate may bind to a second target. In some cases, the conjugate includes a second targeting domain configured to bind to a second target on a second cell. In some cases, the second targeting domain binds to the second target via ionic bonding, electrostatic interaction, hydrogen bonding, van der Waals forces, π-π stacking, or a combination thereof. In some embodiments, the second targeting component forms a covalent bond with the second target (i.e., covalently crosslinks or covalently binds). In some cases, when the second targeting component includes at least one UAA, the second targeting component forms a covalent bond with the second target.
[0042] In some embodiments, the binding of the conjugate component to the target may be characterized by an affinity constant (K A ), which may be represented by a dissociation constant (K D ). In some cases, the conjugate includes a first targeting domain configured to bind to a first target on a first cell. In some cases, the binding of the first targeting domain to the first target may be characterized by K D1 . In some cases, K D1 ranges from about 1 pM to about 100 mM, 10 nM to about 1 mM, about 100 nM to about 50 μM, about 50 nM to about 100 μM, about 1 μM to about 100 μM. In some cases, K D1 ranges from about 1 nM to about 1 μM, 10 nM to about 500 nM, about 50 nM to about 250 nM, about 100 nM to about 500 nM, or about 1 nM to about 100 nM. In some cases, K D1 is at least about 1 nM, about 10 nM, about 25 nM, 50 nM, about 100 nM, about 250 nM, about 500 nM, about 1 μM, about 50 μM, about 100 μM, about 250 μM, about 500 μM, or about 1 mM. In some cases, when the first targeting domain includes at least one UAA, at least one UAA may covalently bind to the first target. In some cases, when at least one UAA covalently binds to the first target, K D1is about 0 pM, about 10 pM, about 20 pM, about 50 pM, or about 100 pM.
[0043] In some embodiments, the binding of the conjugate component to the target may be characterized by an affinity constant (K A ), which may be represented by a dissociation constant (K D ). In some cases, the conjugate includes a second targeting domain configured to bind to a second target on a first cell. In some cases, the binding of the second targeting domain configured to bind to the second target may be characterized by K D2 . In some cases, K D2 is in the range of about 1 pM to about 100 mM, 10 nM to about 1 mM, about 100 nM to about 50 μM, about 50 nM to about 100 μM, about 1 μM to about 100 μM. In some cases, K D2 is in the range of about 1 nM to about 1 μM, 10 nM to about 500 nM, about 50 nM to about 250 nM, about 100 nM to about 500 nM, or about 1 nM to about 100 nM. In some cases, K D2 is at least about 1 nM, about 10 nM, about 25 nM, 50 nM, about 100 nM, about 250 nM, about 500 nM, about 1 μM, about 50 μM, about 100 μM, about 250 μM, about 500 μM, or about 1 mM. In some cases, when the first targeting domain includes at least one UAA, at least one UAA may covalently bind to the first target. Optionally, when at least one UAA covalently binds to the first target, K D2 is about 0 pM, about 10 pM, about 20 pM, about 50 pM, or about 100 pM.
[0044] In some embodiments, the binding of the conjugate component to the target may be characterized by the binding rate (k on ) to the target. In some cases, the conjugate includes a first targeting domain configured to bind to a first target on a first cell. In some cases, the binding of the first targeting domain to the first target is the binding rate k on,1It may be characterized by. In some cases, k on,1 is determined by measuring the enzyme reaction rate. In some cases, the measurement of the enzyme reaction rate includes methods such as biolayer interferometry (BLI) and surface plasmon resonance (SPR). In some cases, k on,1 is monophasic. In some cases, k on,1 is biphasic. In some cases, k on,1 is about 1×10 1 M -1 s -1 ~ about 1×10 6 M -1 s -1 、 about 5×10 1 M -1 s -1 ~ about 1×10 5 M -1 s -1 、 about 1×10 2 M -1 s -1 ~ about 5×10 4 M -1 s -1 、 or about 5×10 2 M -1 s -1 ~ about 1×10 3 M -1 s -1 in the range of. In some cases, k on,1 is at least about 1×10 1 M -1 s -1 、 about 2×10 1 M -1 s -1 、 about 5×10 1 M -1 s -1 、 1×10 1 M -1 s -1 、 about 2×10 1 M -1 s -1 、 about 5×10 1 M -1 s -1 、 about 1×10 2 M -1 s -1 、 about 2×10 2 M -1 s -1, about 5×10 2 M -1 s -1 , about 1×10 3 about M -1 s -1 , about 2×10 3 M -1 s -1 , about 5×10 3 M -1 s -1 , about 1×10 4 M -1 s -1 , about 2×10 4 M -1 s -1 , about 5×10 4 M -1 s -1 , about 1×10 5 M -1 s -1 , about 2×10 5 M -1 s -1 , about 5×10 5 M -1 s -1 , or about 1×10 6 M -1 s -1 , about 2×10 6 M -1 s -1 , about 5×10 6 M -1 s -1 is. In some cases, k on,1 is up to about 1×10 4 M -1 s -1 , about 2×10 4 M -1 s -1 , about 5×10 4 M -1 s -1 , about 1×10 5 M -1 s -1 , about 2×10 5 M -1 s -1 , about 5×10 5 M -1 s -1 , or about 1×10 6 M -1 s -1 , about 2×10 6 M-1 s -1 and about 5×10 6 M -1 s -1 or less.
[0045] In some embodiments, the binding of the conjugate component to the target may be characterized by the binding rate (k on ) to the target. In some cases, the conjugate comprises a second targeting domain configured to bind to a second target on a second cell. In some cases, the binding of the second targeting domain to the second target may be characterized by the binding rate k on,2に . In some cases, k on,2 is determined by enzyme reaction rate measurement. In some cases, enzyme reaction rate measurements include biolayer interferometry (BLI), surface plasmon resonance (SPR), and the like. In some cases, k on,2 is monophasic. In some cases, k on,2 is biphasic. In some cases, k on,2 is about 1×10 1 M -1 s -1 to about 1×10 6 M -1 s -1 about 5×10 1 M -1 s -1 to about 1×10 5 M -1 s -1 about 1×10 2 M -1 s -1 to about 5×10 4 M -1 s -1 or about 5×10 2 M -1 s -1 to about 1×10 3 M -1 s -1 is in the range of. In some cases, k on,2 is at least about 1×10 1 M -1 s -1 about 2×10 1 M -1 s-1 and about 5×10 1 M -1 s -1 and 1×10 1 M -1 s -1 and about 2×10 1 M -1 s -1 and about 5×10 1 M -1 s -1 and about 1×10 2 M -1 s -1 and about 2×10 2 M -1 s -1 and about 5×10 2 M -1 s -1 and about 1×10 3 about M -1 s -1 and about 2×10 3 M -1 s -1 and about 5×10 3 M -1 s -1 and about 1×10 4 M -1 s -1 and about 2×10 4 M -1 s -1 and about 5×10 4 M -1 s -1 and about 1×10 5 M -1 s -1 and about 2×10 5 M -1 s -1 and about 5×10 5 M -1 s -1 or about 1×10 6 M -1 s -1 and about 2×10 6 M -1 s -1 and about 5×10 6 M -1 s -1 are. In some cases, k on,2 is up to about 1×10 4 M -1 s -1 and about 2×104 M -1 s -1 and about 5×10 4 M -1 s -1 and about 1×10 5 M -1 s -1 and about 2×10 5 M -1 s -1 and about 5×10 5 M -1 s -1 or about 1×10 6 M -1 s -1 and about 2×10 6 M -1 s -1 and about 5×10 6 M -1 s -1 respectively.
[0046] In some embodiments, the binding of the conjugate component to the target may be characterized by the dissociation rate, i.e., the "off-rate", which may be represented by k off . In some cases, the conjugate comprises a first targeting domain configured to bind to a first target on a first cell. In some cases, the binding of the first targeting domain to the first target may be characterized by the association rate k off,1 . In some cases, k off,1 is determined by enzyme reaction rate measurement. In some cases, enzyme reaction rate measurements include biolayer interferometry (BLI), surface plasmon resonance (SPR), etc. In some cases, k off,1 is monophasic. In some cases, k off,1 is biphasic. In some cases, k off,1 is about 1×10 -9 s -1 ~ about 1×10 -2 M -1 s -1 and about 1×10 -8 s -1 ~ about 1×10 -3 M -1 s -1 or about 1×10 -7 s-1 ~ about 1×10 -4 M -1 s -1 in the range of. In some cases, k off,1 is at least about 1×10 -9 s -1 about 2×10 -9 s -1 about 5×10 -9 s -1 about 1×10 -8 s -1 about 2×10 -8 s -1 about 5×10 -8 s -1 about 1×10 -7 s -1 about 2×10 -7 s -1 about 5×10 -7 s -1 about 1×10 -6 s -1 about 2×10 -6 s -1 about 5×10 -6 s -1 about 1×10 -5 s -1 about 2×10 -5 s -1 about 5×10 -5 s -1 about 1×10 -4 s -1 about 2×10 -4 s -1 about 5×10 -4 s -1 about 1×10 -3 s -1 about 2×10 -3 s -1 about 5×10 -3 s -1 about 1×10 -2 s -1 about 2×10 -2 s -1 about 5×10 -2 s -1 or about 1×10 -1 s -1 about 2×10 -1 s -1 about 5×10 -1 s -1It is. In some cases, k off,1 is about 1×10 -4 s -1 about 2×10 -4 s -1 about 5×10 -4 s -1 about 1×10 -3 s -1 about 2×10 -3 s -1 about 5×10 -3 s -1 about 1×10 -2 s -1 about 2×10 -2 s -1 about 5×10 -2 s -1 or about 1×10 -1 s -1 about 2×10 -1 s -1 about 5×10 -1 s -1 It is.
[0047] In some embodiments, the binding of the conjugate component to the target may be characterized by the dissociation rate, i.e., the "off-rate", which may be represented by k off . In some cases, the conjugate comprises a second targeting domain configured to bind to a second target on a second cell. In some cases, the binding of the second targeting domain to the second target may be characterized by an association rate k off,2 . In some cases, k off,2 is determined by enzyme reaction rate measurement. In some cases, enzyme reaction rate measurements include biolayer interferometry (BLI), surface plasmon resonance (SPR), etc. In some cases, k off,2 is monophasic. In some cases, k off,2 is biphasic. In some cases, k off,2 is about 1×10 -9 s -1 to about 1×10 -2 M -1 s -1 about 1×10 -8 s -1 to about 1×10-3 M -1 s -1 or about 1×10 -7 s -1 ~ about 1×10 -4 M -1 s -1 in the range of. In some cases, k off,2 is at least about 1×10 -9 s -1 about 2×10 -9 s -1 about 5×10 -9 s -1 about 1×10 -8 s -1 about 2×10 -8 s -1 about 5×10 -8 s -1 about 1×10 -7 s -1 about 2×10 -7 s -1 about 5×10 -7 s -1 about 1×10 -6 s -1 about 2×10 -6 s -1 about 5×10 -6 s -1 about 1×10 -5 s -1 about 2×10 -5 s -1 about 5×10 -5 s -1 about 1×10 -4 s -1 about 2×10 -4 s -1 about 5×10 -4 s -1 about 1×10 -3 s -1 about 2×10 -3 s -1 about 5×10 -3 s -1 about 1×10 -2 s -1 about 2×10 -2 s -1 about 5×10 -2 s -1 or about 1×10 -1 s -1 about 2×10-1 s -1 is about 5×10 -1 s -1 . In some cases, k off,2 is up to about 1×10 -4 s -1 is about 2×10 -4 s -1 is about 5×10 -4 s -1 is about 1×10 -3 s -1 is about 2×10 -3 s -1 is about 5×10 -3 s -1 is about 1×10 -2 s -1 is about 2×10 -2 s -1 is about 5×10 -2 s -1 or about 1×10 -1 s -1 is about 2×10 -1 s -1 is about 5×10 -1 s -1 .
[0048] Exemplary targeting domains and exemplary conjugates The conjugates herein include a targeting domain that can be assembled from molecules that link to a target. In some cases, the targeting domain includes an antigen-binding region that binds to a specific target. Such antigen-binding regions may include CDRs such as the three CDRs commonly found in the heavy or light chains of an antibody. In some cases, the targeting domain includes an antigen-binding fragment that includes a CDR, such as a VHH (also referred to as a single-domain antibody (sdAb)). In some cases, the single-domain antibody includes one or more UAAs. In some cases, the targeting domain of the conjugate is selected from single-domain antibodies in Table 1, such as any one of C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35, or C37. In some cases, the targeting domain of the conjugate is selected from single-domain antibodies in Table 1, such as any one of C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35, or C37, and one or more UAAs are present in or near the CDR of the single-domain antibody. In some cases, the first targeting domain of the conjugate is selected from single-domain antibodies in Table 1, such as any one of C1, C2, C3, C4, C5, C6, C7, C10, C11, C17, C35, or C37, and the second targeting domain binds to a second target on a second cell. In some cases, the second cell is an immune cell. In some cases, the second targeting domain includes C6, C7, C37, C38, C39, or C40. In some cases, the second targeting domain is C6 or C7. In some cases, the second targeting domain is C37, C38, C39, or C40. In some cases, the first targeting domain and the second targeting domain are not the same. In some cases, the conjugate includes a tag such as a polyhistidine tag, an HA tag, or an SP tag. In some cases, the conjugate does not include a tag. Optionally, tags such as polyhistidine tags, HA tags, or SP tags may be cleaved.
[0049] In some cases, the first targeting domain of the conjugate comprises construct C1 having a non-natural amino acid in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises construct C1 having a non-natural amino acid at any one of positions 26, 28, 29, 30, 99, 102, 103, 105, 108, 110, 111, 112, 113, 114, and 115 of SEQ ID NO: 1, 4, or 20. In some cases, the conjugate comprises construct C1 having a non-natural amino acid at any one of positions 28, 102, 112, and 113 of SEQ ID NO: 1, 4, or 20. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb. In some cases, such an sdAb comprises SEQ ID NO: 1. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 1. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 1. In some cases, such a conjugate has a second targeting domain that binds to immune cells. Optionally, the second targeting domain comprises C6, C7, C37, C38, C39, or C40, or SEQ ID NO: 22, 25, 52, 53, 54, or 55. Optionally, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22, 25, 52, 53, 54, or 55.
[0050] In some cases, the first targeting domain of the conjugate comprises construct C2 having non-natural amino acids in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises construct C2 having a non-natural amino acid at any one of positions 50, 52, 53, 54, 56, 58, or 100 of SEQ ID NO: 2, 28, 29, or 30. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 2. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 2. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 2. In some cases, such a conjugate has a second targeting domain that binds to immune cells. Optionally, the second targeting domain comprises C6, C7, C37, C38, C39, or C40, or SEQ ID NO: 22, 25, 52, 53, 54, or 55. Optionally, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22, 25, 52, 53, 54, or 55.
[0051] In some cases, the first targeting domain of the conjugate comprises construct C3 having non-natural amino acids in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises construct C3 having a non-natural amino acid at any one of positions 58, 62, 101, 103, or 107 of SEQ ID NO: 3. In some cases, the conjugate comprises a non-natural amino acid in CDR1, CDR2, or CDR3 of C3. In some cases, the conjugate comprises a non-natural amino acid at position 109. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 3. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 3. In some cases, such a conjugate has a second targeting domain that binds to immune cells. Optionally, the second targeting domain comprises C6, C7, C37, C38, C39, or C40, or SEQ ID NO: 22, 25, 52, 53, 54, or 55. Optionally, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22, 25, 52, 53, 54, or 55.
[0052] In some cases, the first targeting domain of the conjugate comprises construct C4 having non-natural amino acids in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises construct C3 having a non-natural amino acid at position 109 of SEQ ID NO: 16. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 16. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 16. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 16. In some cases, such a conjugate has a second targeting domain that binds to immune cells. Optionally, the second targeting domain comprises C6, C7, C37, C38, C39, or C40, or SEQ ID NO: 22, 25, 52, 53, 54, or 55. Optionally, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22, 25, 52, 53, 54, or 55.
[0053] In some cases, the first targeting domain of the conjugate comprises construct C5 having non-natural amino acids in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 18. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 18. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 18. In some cases, such a conjugate has a second targeting domain that binds to immune cells. Optionally, the second targeting domain comprises C6, C7, C37, C38, C39, or C40, or SEQ ID NO: 22, 25, 52, 53, 54, or 55. Optionally, the second targeting domain comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22, 25, 52, 53, 54, or 55.
[0054] In some cases, the second targeting domain of the conjugate comprises construct C6. In some cases, the second targeting domain of the conjugate comprises construct C6 having a non-natural amino acid in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 22. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22. In some cases, the conjugate comprises a second targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 22. In some cases, such a conjugate comprises a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target includes lymphocyte antigens. In some cases, the lymphocyte antigens include BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7R ILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1. Optionally, the first targeting domain includes C1, C2, C3, C4, C5, C10, C11, C17, C35, or C36, or the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1, 2, 3, 16, 18, 20, 29, 50, or 51.
[0055] In some cases, the second targeting domain of the conjugate comprises construct C7 having non-natural amino acids in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 25. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 25. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 25. In some cases, such a conjugate comprises a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, Integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target includes lymphocyte antigens. In some cases, the lymphocyte antigens include BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7RILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1. Optionally, the first targeting domain includes C1, C2, C3, C4, C5, C10, C11, C17, C35, or C36, or the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1, 2, 3, 16, 18, 20, 29, 50, or 51.
[0056] In some cases, the second targeting domain of the conjugate comprises construct C37. In some cases, the second targeting domain of the conjugate comprises construct C37 having a non-natural amino acid in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 52. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 52. In some cases, the conjugate comprises a second targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 52. In some cases, such a conjugate comprises a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, Integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target includes lymphocyte antigens. In some cases, the lymphocyte antigens include BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7RILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1. In some cases, the first targeting domain includes C1, C2, C3, C4, C5, C10, C11, C17, C35, or C36. In some cases, the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1, 2, 3, 16, 18, 20, 29, 50, or 51.
[0057] In some cases, the second targeting domain of the conjugate comprises construct C38 having non-natural amino acids in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 53. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 53. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 53. In some cases, such a conjugate comprises a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target includes a lymphocyte antigen. In some cases, the lymphocyte antigen includes BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7R ILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1. Optionally, the first targeting domain includes C1, C2, C3, C4, C5, C10, C11, C17, C35, or C36. Optionally, the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1, 2, 3, 16, 18, 20, 29, 50, or 51.
[0058] In some cases, the conjugate comprises a construct C39 having a non-natural amino acid in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 54. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 54. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 54. In some cases, such a conjugate comprises a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target includes lymphocyte antigens. In some cases, the lymphocyte antigens include BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7R ILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1. Optionally, the first targeting domain includes C1, C2, C3, C4, C5, C10, C11, C17, C35, or C36. Optionally, the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1, 2, 3, 16, 18, 20, 29, 50, or 51.
[0059] In some cases, the conjugate comprises construct C40 having non-natural amino acids in CDR1, CDR2, or CDR3. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises SEQ ID NO: 55. In some cases, the conjugate comprises a single domain antibody (sdAb) and at least one non-natural amino acid (UAA) within or near the CDR region within the sdAb, and the sdAb comprises a sequence having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 55. In some cases, the conjugate comprises a first targeting domain having at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to SEQ ID NO: 55. In some cases, such a conjugate comprises a first targeting domain that binds to a first target on the surface of a tumor cell.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, Integrin α. 10β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target includes lymphocyte antigens. In some cases, the lymphocyte antigens include BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7R ILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1.
[0060] In some cases, the first targeting domain includes C1, C2, C3, C4, C5, C10, C11, C17, C35, or C36. In some cases, the first targeting domain has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 1, 2, 3, 16, 18, 20, 29, 50, or 51.
[0061] The conjugates described herein may include two or more targeting domains. In some cases, a conjugate having a first targeting domain and a second targeting domain includes any one of SEQ ID NOs: 19, 21, 23, 24, 26, 27, 30, 35-49, 57, or 64. In some cases, the conjugate has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 19, 21, 23, 24, 26, 27, 30, 35-49, 57, or 64. In some cases, the first and second targeting domains are linked to each other via a linker. In some cases, the conjugate is a fusion protein. In some cases, the linker includes linker L1 (SEQ ID NO: 14), L2 (SEQ ID NO: 31), L3 (SEQ ID NO: 32), L4 (SEQ ID NO: 33), or L5 (SEQ ID NO: 34). In some cases, the conjugate includes any one of SEQ ID NOs: 19, 21, 23, 24, 26, 27, 28, 30, 35-49, 57, or 64. In some cases, the conjugate has at least 99%, 98%, 97%, 95%, 90%, 85%, 80%, 70%, or at least 65% sequence identity to any one of SEQ ID NOs: 19, 21, 23, 24, 26, 27, 28, 30, 35-49, 57, or 64. In some cases, the conjugate includes any one of SEQ ID NOs: 19, 21, 23, 24, 26, 27, 28, 30, 35-49, 57, or 64 and does not include a terminal his6 tag, HA tag, or SP tag.
[0062] Exemplary targeting domain-related sequences are described in Table 1 herein.
[0063]
Table 1-1
[0064]
Table 1-2
[0065]
Table 1-3
[0066]
Table 1-4
[0067]
Table 1-5
[0068]
Table 1-6
[0069]
Table 1-7
[0070] Non-natural amino acids (UAAs) may be incorporated into the conjugates described herein. In some cases, the UAA is present in the targeting domain of the conjugate. In some cases, the UAA is configured within the targeting domain to covalently bind to the target. In some cases, the conjugate comprises one, two, three, four, or more UAAs. In some cases, the conjugate comprises a first targeting domain comprising a first UAA and a second targeting domain comprising a second UAA. In some cases, the UAA is configured within the targeting domain to covalently bind to an amino acid present in the target when the targeting domain links to the target. In some cases, such UAAs comprise nucleophilic amino acids. In some cases, the UAA forms a covalent bond with lysine, histidine, or tyrosine. In some cases, the UAA is located in the target-binding domain. In some cases, one or more UAAs are located in one or more CDRs of a targeting domain, such as a targeting domain comprising an antibody or antigen-binding fragment, e.g., a single-domain antibody. In some embodiments, the UAA comprises an aryl-fluorosulfate moiety. In some cases, the UAA is genetically encoded in the conjugates described herein. In some cases, the UAA comprises a variant of tyrosine or lysine. In some embodiments, the non-natural amino acid has the structure of Formula I
[0071] [Chemical Formula] . In some embodiments, the non-natural amino acid has the structure of Formula II
[0072] [Chemical Formula] . In some embodiments, the non-natural amino acid is 2-amino-3-(4-((fluorosulfonyl)oxy)phenyl)propanoic acid
[0073] [Chemical Formula] It is. In some embodiments, the unnatural amino acid is fluorosulfonyl tyrosine (FSY)
[0074]
Chem.
[0075]
Chem.
[0076]
Chem.
[0077]
Chem.
[0078]
Chem.
[0079] In some embodiments, the unnatural amino acid (UAA) has the structure of formula (IA)
[0080]
Chem.
[0081] In some embodiments, the UAA of formula (IA) has the structure of formula (IA-a)
[0082]
Chemical Structure
[0083]
Chemical Structure
[0084] In some embodiments, the UAA of formula (IB) has the structure of formula (IB-a)
[0085]
Chemical Structure
[0086] In some embodiments, the UAA of formula (IB) has the structure of formula (IB-a)
[0087]
Chem.
[0088]
Chem.
[0089] In some embodiments, the UAA of formula (IA) is of formula (IC)
[0090]
Chem.
[0091] In some embodiments, the UAA of formula (IC) is of formula (IC-a)
[0092]
Chem.
[0093]
Chem.
[0094] In some embodiments, the UAA of formula (IA) is of formula (ID)
[0095]
Chem.
[0096] In some embodiments, the UAA of formula (ID) has the structure of formula (ID-a)
[0097]
Chemical formula
[0098]
Chemical formula
[0099] In some embodiments, the UAA of formula (IA) has the structure of formula (IE)
[0100]
Chemical formula
[0101] In some embodiments, the UAA of formula (IE) has the structure of formula (IE-a)
[0102]
Chemical formula
[0103]
Chemical formula
[0104] In some embodiments, the UAA of formula (IA) has the structure of formula (IIA)
[0105]
Chemical formula
[0106] In some embodiments, the UAA of formula (IIA) is of formula (IIA-a)
[0107]
Chemical formula
[0108]
Chemical formula
[0109] In some embodiments, the UAA of formula (IA) is of formula (IIB)
[0110]
Chemical formula
[0111] In some embodiments, the UAA of formula (IIB) is of formula (IIB-a)
[0112]
Chemical formula
[0113] [Chemical formula] has the structure of
[0114] In some embodiments, the unnatural amino acid (UAA) is
[0115] [Chemical formula] has the structure of wherein X is each independently O or NR', Y is a bond, -O-, -NR-, or -N=, A is a bond or -(CH2) n -, m is 1 or 2, n is an integer from 1 to 4, R and R', when present, are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl, ring A is a 5- to 6-membered aryl or heteroaryl, R A is each independently -OH, -OR X , halogen, NHR X , N(R X )2, or optionally substituted alkyl, p is 0, 1, 2, 3, or 4, and R X are each optionally substituted alkyl, L is -(CH2) p - or -C(O)NH-(CH2) p -, p is an integer from 1 to 6, When Y is a bond, -O-, or -NR-, m is 1; when Y is -N=, m is 2.
[0116] In some embodiments, A is a bond. In other embodiments, A is -(CH2) n- is. In some embodiments, n is 1, 2, 3, or 4. In one embodiment, n is 1. In another embodiment, n is 2. In yet another embodiment, n is 3. In still another embodiment, n is 4.
[0117] In some embodiments, ring A is a 5-membered ring. In some embodiments, ring A is a 6-membered ring. In some embodiments, ring A is aryl. In some embodiments, ring A is heteroaryl. In some embodiments, ring A is a 6-membered aryl. In some embodiments, ring A is a 6-membered heteroaryl. In one embodiment, ring A is phenyl.
[0118] In some embodiments, p is 0. In some embodiments, p is an integer from 1 to 4. In some embodiments, p is an integer from 1 to 3. In one embodiment, p is 1. In another embodiment, p is 2. In yet another embodiment, p is 3. In still another embodiment, p is 4.
[0119] In some embodiments, R A are each independently -OH, halo, or optionally substituted alkyl. In some embodiments, R A are each independently halo or optionally substituted alkyl. In some embodiments, R A are each independently -OH or optionally substituted alkyl. In some embodiments, R A are each independently optionally substituted alkyl. In some embodiments, R A are each independently substituted alkyl. In some embodiments, R A are each independently unsubstituted alkyl. In one embodiment, R A are each iodine. In another embodiment, R A are each methyl. In one particular embodiment where p is 1, R Ais iodine. In another specific embodiment where p is 2, R A are each methyl.
[0120] In some embodiments, Y is a bond, -O-, -NR-, or -N=. In some embodiments, Y is -O-, -NR-, or -N=. In some embodiments, Y is a bond, -O-, or -NR-. In some embodiments, Y is a bond, -O-, or -N=. In some embodiments, Y is a bond, -NR-, or -N=. In some embodiments, Y is -O- or -NR-. In some embodiments, Y is -O- or -N=. In some embodiments, Y is -NR- or -N=. In one embodiment, Y is a bond. In another embodiment, Y is -O-. In yet another embodiment, Y is -NR-. In yet another embodiment, Y is -N=.
[0121] In some embodiments, L is -(CH2) p -. In other embodiments, L is -C(O)NH-(CH2) p -. In some embodiments, p is an integer from 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2. In one embodiment, p is 1 to 4. In another embodiment, p is 1 or 2. In yet another embodiment, p is 1 or 4. In one embodiment, L is -CH2-. In another embodiment, L is -C(O)NH-(CH2)4-.
[0122] In some embodiments, R is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl. In some embodiments, R is hydrogen, or substituted or unsubstituted alkyl. In one embodiment, R is hydrogen. In another embodiment, R is substituted or unsubstituted C 1-6 alkyl. In yet another embodiment, R is unsubstituted C 1-6It is alkyl. In one embodiment, R is methyl. In another embodiment, R is hydrogen or methyl.
[0123] In some embodiments, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl. In some embodiments, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. In some embodiments, R' is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl. In some embodiments, R' is hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl. In an embodiment, R' is hydrogen. In another embodiment, R' is substituted or unsubstituted. In yet another embodiment, R' is substituted or unsubstituted aryl.
[0124] In some embodiments, R 1 is hydrogen. In some embodiments, R 1 is fluoro. In some embodiments, R 1 is iodo. In some embodiments, R 2 is hydrogen. In other embodiments, R 2 is methyl. In some embodiments, R 1 is hydrogen and R 2 is hydrogen. In some embodiments, R 1 is hydrogen and R 2 is methyl. In some embodiments, R 1 is fluoro and R 2 is hydrogen. In some embodiments, R 1 is iodo and R 2 is hydrogen.
[0125] In some cases, the UAA is located proximal to one or more residues on the target. In some cases, the UAA forms a covalent bond with a residue on the target. In some cases, the residue on the target is an amino acid within the polypeptide chain of the target, such as lysine, tyrosine, or histidine. In some cases, after the targeting domain binds to the target, the UAA is within 5 - 20, 5 - 10, 8 - 20, 10 - 17, 10 - 20, or 1 - 20 angstroms of a residue on the target and forms a covalent bond therewith. In some examples, the unnatural amino acids described herein are incorporated into the peptide chain of the targeting domain. In some cases, the unnatural amino acids described herein are incorporated into the peptide chain of the targeting domain via an amide bond.
[0126] Linker In some embodiments, useful functional reactive groups for conjugating or binding the targeting domain to additional targeting domains described herein include, for example, zero or higher order linkers. In some cases, the conjugate moiety includes a functional reactive group that reacts with a linker (optionally pre - attached to the targeting domain or other part of the conjugate) described herein. In some embodiments, the linker includes a reactive group that reacts with a natural amino acid of the targeting moiety described herein.
[0127] In various embodiments, the targeting domains are connected or separated by a linker. The linker may be a polypeptide linker. The linker may be expressed by recombinant techniques and may be encoded using a nucleic acid sequence along with the expression of the targeting domains. The linker may join the first targeting domain and the second targeting domain to form a fusion protein. The presence of the linker in the conjugate can enable the targeting domains to function properly without steric interference from other targeting domains. The linker may be a flexible linker. The flexibility of the linker can enable the targeting domains to adopt an independent three-dimensional structure with minimal interference from other targeting domains. In some embodiments, the linker is a polypeptide linker comprising, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, 50, or more amino acids. In some cases, the polypeptide linker comprises a maximum of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, 50, or fewer amino acids. In further cases, the polypeptide linker comprises about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids. In some cases, the polypeptide linker comprises L1. In some cases, the peptide linker comprises (GGGGS) x (SEQ ID NO: 65) or (GGGGSGGGS) x (SEQ ID NO: 56), where x is an integer from 1 to 10. In some cases, the peptide linker comprises (GGGGS) x and x is an integer from 1 to 4.
[0128] In some embodiments, the linking group is composed of an amino acid, a dipeptide, a tripeptide, or a polypeptide, and the amino acid, dipeptide, tripeptide, or polypeptide contains at least two activating groups as described herein. In some embodiments, the linking group (L) contains a moiety selected from the group consisting of amino, ether, thioether, maleimide, disulfide, amide, ester, thioester, alkene, cycloalkene, alkyne, triazole, carbamate, carbonate, cathepsin B cleavable, and hydrazone.
[0129] In some embodiments, L contains a chain of atoms that is 1 to about 60, or 1 to 30 or more atoms in length, 2 to 5 atoms, 2 to 10 atoms, 5 to 10 atoms, or 10 to 20 atoms in length. In some embodiments, all of the chain atoms are carbon atoms. In some embodiments, the chain atoms in the backbone of the linker are selected from the group consisting of C, O, N, and S. The chain atoms and the linker are selected, in some cases, according to their supposed solubility (hydrophilicity) to yield a more soluble conjugate. In some embodiments, L provides a functional group that is cleaved by an enzyme or other catalyst or hydrolysis conditions found in the target tissue or organ or cell. In some embodiments, the length of L is of sufficient length to reduce the likelihood of steric hindrance.
[0130] Optionally, multiple targeting domains or modified targeting domain molecules may be linked by a linker polypeptide, which linker polypeptide is optionally 1, 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 1 to 11, 1 to 12 amino acids in length, and longer, and optionally, the N-terminus of one targeting domain is fused to the C-terminus of the linker polypeptide and the N-terminus of the linker polypeptide is fused to the N-terminus of another targeting domain.
[0131] Therapeutic methods The conjugates described herein may be used to treat a disease and / or disorder. In some instances, the disorder includes a proliferative disorder. In some instances, the proliferative disorder includes cancer. In some instances, the cancer includes tumor cells. In some instances, the cancer includes solid tumors or liquid tumors. In some instances, the conjugate is administered to kill rapidly dividing cells, such as tumor cells, or inhibit their growth. In some instances, a method of treating a proliferative disorder or disease in a subject in need thereof includes administering to the subject a therapeutically effective amount of the conjugate described herein. In some embodiments, the proliferative disorder or disease is cancer. In some embodiments, the cancer is solid tumor cancer. In some embodiments, the solid tumor cancer is bladder cancer, bone cancer, brain cancer, breast cancer, colorectal cancer, esophageal cancer, eye cancer, head and neck cancer, kidney cancer, lung cancer, melanoma, ovarian cancer, pancreatic cancer, or prostate cancer. In some instances, the disorder includes PCa (prostate cancer), CRPCa (castration-resistant prostate cancer), solid tumor (angiogenesis), NSCLC (non-small cell lung cancer), HNSCC (head and neck squamous cell carcinoma), ESCC (esophageal cancer), GC (gastric cancer), CRC (colorectal cancer), SCLC (small cell lung cancer), MPM (mesothelioma), PDAC (pancreatic ductal adenocarcinoma), ALL (acute lymphoblastic leukemia), AML (acute myeloid leukemia), MDS (myelodysplastic syndrome), MSI-high tumors, melanoma, DLBCL (diffuse large B-cell lymphoma), endometrial cancer, cervical cancer, bladder cancer, BrCa (breast cancer), TNBC (triple-negative breast cancer), NE-PCa (neuroendocrine prostate cancer), GBM (glioblastoma), and RCC (renal cell carcinoma).
[0132] In some cases, the tumor cells targeted herein overexpress one or more targets. In some cases, the targets include surface markers or receptors. In some cases, the targets are 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, CD147, CD155, CD16, CD166, CD171, CD19, CD2, CD20, CD205, CD206, CD22, CD228, CD24, CD248, CD25, CD30, CD300f, CD33, CD34, CD352, CD36, CD37, CD38, CD40, CD44v6, CD45, CD46, CD47, CD48, CD51, CD56, CD66, CD66, CD70, CD71, CD73, CD74, CD79b, CD8, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, CLL-1, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, IL-7RILT-3, ILT-3, Integrin α 10Selected from one or more of β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, macrophage mannose receptor 1, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, survivin, TEM8, TFR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TNFSF12A, TRA-1-60, TREM2, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target is 5T4, ADAM-9, AG-7, ALK, ALPP, ALPPL2, ALPV, AMHR2, ASCT2, AXL, B1R, B7-H3, B7-H4, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CD123, CD13, CD138, CD142, CD147, CD155, CD166, CD171, CD19, CD2, CD20, CD205, CD22, CD228, CD24, CD248, CD30, CD33, CD34, CD36, CD38, CD44v6, CD45, CD46, CD47, CD48, CD56, CD66, CD70, CD71, CD73, CD74, CD79b, CD99, CDCP1, CDH17, CDH6, CEA, CEACAM6, cKIT, CLDN18.2, CLDN6, CLDN9, cMET, CSP-1, CSPG4, CXCR3, CXCR4, CXCR5, DCLK1, DLK1, DLL1, DLL3, Doppel, DPEP3, DPP4, DR5, DUX4, Dysadherin, EDB fibronectin, EGFR, EGFRviii, EMP2, endo180, Endoglin, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FolRa, GD2, GD3, GloboH, gpA33, GPC-1, GPC3, GPNMB, GPR20, GPRC5d, GRPR, GSPT1, GUCY2C (GCC), HER2, HER3, HLA-DR, ICAM-1, IGF-1R, IL-13Ra2, IL-1RAP, IL-7R, ILT-3, Integrin α. 10Including β1, ITGaVb3, ITGaVb6, ITGB4, KAAG1, KIF20A, LAMP-1, Lewis Y antigen, LGR5, LIV-1, LRP5, LRP6, LRRC15, LSR, Ly6E, Ly6G6D, MAGE, MC1R, MerTK, MICA, MICB, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, NKG2DL, NOTCH3rec, NTS1, OX001L, pCadherin, PD-L1, PD-L2, Podocalyxin, PRLR, negative regulator of prostaglandin F2 receptor, PSCA, PSMA, PT1, PTK7, RET, RON, ROR1, ROR2, SAIL, SEA, SEZ6, SIRPa, SLAMF7, SLC44A4, SLITRK6, SSEA-4, SSTR2, STEAP1, STT3, STT4, Survivin, TEM8, TfR, TIM-1, tissue factor, TM4SF1, TMEFF2, TNFSF12, TRA-1-60, Trk, TROP-2, TRP1, TSLPR, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB1, or xCT. In some cases, the first target includes 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, NECTIN4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.In some cases, the first target includes 5T4, B7-H3, B7-H4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, PSMA, ROR1, SEZ6, or SLAMF7. In some cases, the first target includes lymphocyte antigens. In some cases, the lymphocyte antigens include BAFFR, CCR2, CCR4, CCR7, CD103, CD155, CD16, CD2, CD205, CD206, CD25, CD300f, CD34, CD352, CD36, CD37, CD38, CD40, CD46, CD47, CD48, CD51, CD56, CD66, CD70, CD8, CLL-1, CXCR4, FcRH5, FLT3, GPRC5d, HLA-DR, HLA-DR, IL-13Ra2, IL-1RAP, IL-7R ILT-3, Ly6E, Ly6G6D, macrophage mannose receptor 1, MerTK, NKG2DL, PD-L1, PD-L2, SAIL, SIRPa, TFR, TIM-1, TNFSF12A, TREM2, TSLPR, VpreB, or VPREB1.
[0133] The pharmaceutical composition is administered in a manner appropriate for the disease to be treated (or prevented). Appropriate dosages as well as suitable duration and frequency of administration are determined by factors such as the patient's condition, the type and severity of the patient's disease, the specific form of the active ingredient, and the method of administration. Generally, appropriate dosages and treatment regimens provide an amount of the composition sufficient to produce a therapeutic and / or prophylactic benefit (e.g., improvement in clinical outcome) or reduction in the severity of symptoms. Optimal dosages are generally determined using experimental models and / or clinical trials. Optimal dosages depend on the patient's body size, weight, or blood volume.
[0134] In one embodiment, the injectable pharmaceutical composition described herein is used in the preparation of a medicament for the treatment of a disease or disorder in a mammal that will benefit from administration of any one of the disclosed injectable pharmaceutical compositions of the conjugate. A method for treating any of the diseases or disorders described herein in a mammal in need of such treatment comprises administering to the mammal a therapeutically effective amount of a pharmaceutical composition comprising at least one compound described herein, or a pharmaceutically acceptable salt, active metabolite, prodrug, or pharmaceutically acceptable solvate thereof.
[0135] In certain embodiments, the compositions comprising the compounds described herein are administered for prophylactic and / or therapeutic treatment. For certain therapeutic uses, the composition is administered to a patient already suffering from a disease or disorder in an amount sufficient to cure or at least partially arrest at least one of the symptoms of the disease or disorder. The amount effective for this use depends on the severity and course of the disease or disorder, previous treatment, the health condition of the patient, body weight, and response to the drug, as well as the judgment of the physician administering the treatment. The therapeutically effective amount is optionally determined by methods including, but not limited to, clinical trials of dose escalation and / or dose range finding.
[0136] For prophylactic use, the compositions comprising the compounds described herein are administered to a patient who is predisposed to or at risk of developing a particular disease, disorder, or condition. Such an amount is defined as a "prophylactically effective amount or dose". In this use, the exact amount also depends on the health condition, body weight, etc. of the patient. When used in a patient, the effective amount for this use depends on the severity and course of the disease, disorder, or condition, previous treatment, the health condition of the patient and response to the drug, as well as the judgment of the physician administering the treatment. In one aspect, a prophylactic treatment comprises administering to a mammal that has previously experienced at least one symptom of a disease being treated and is currently in remission, a pharmaceutical composition comprising a compound described herein or a pharmaceutically acceptable salt thereof, to prevent recurrence of the symptoms of the disease or disorder.
[0137] In certain embodiments where the patient's condition does not improve, at the discretion of the physician, the administration of the compound is chronic, i.e., over a long period including the patient's lifetime, in order to improve the patient's disease or the symptoms of the disease, or to otherwise suppress or limit it.
[0138] Manufacturing method The conjugates described herein may be synthesized using in vivo methods, in vitro methods, or combinations of methods. In some cases, the method is an in vivo method. In some cases, the method is an in vitro method. In some instances, the conjugate comprises a first targeting domain and a second targeting domain, wherein the first targeting domain comprising a non-natural amino acid is synthesized in vivo and the second targeting domain is conjugated in vivo, for example via a fusion protein. In some instances, the conjugate comprises a first targeting domain and a second targeting domain, wherein the first targeting domain comprising a non-natural amino acid is synthesized using chemical methods in vitro. In some cases, the method is an ex vivo method. In some cases, the conjugates described herein, including natural amino acid mutations or non-natural amino acid mutations, are produced recombinantly or chemically synthesized. In some cases, the first targeting domain, the second targeting domain, or both the first and second targeting domains described herein are produced recombinantly, for example, by a host cell line or in a cell-free system.
[0139] Generally, methods for producing target polypeptides containing non-standard amino acids are known. In some cases, aminoacyl-tRNA synthetase / tRNA pairs cognate to non-natural amino acids are orthogonal to the cellular components of the cells in which they are used. The orthogonality (i.e., compatibility) of exogenous aminoacyl-tRNA synthetase / tRNA pairs is determined by the type of host organism. For the expansion of the genetic code, four major orthogonal aminoacyl-tRNA synthetases have been developed, including Methanococcus janaschii tyrosyl-tRNA synthetase (MjTyrRS) / tRNA CUA pair, Escherichia coli tyrosyl-tRNA synthetase (EcTyrRS) / tRNA CUA pair, Escherichia coli leucyl-tRNA synthetase (EcLeuRS) / tRNA CUA pair, Methanomethylophilus alvus pyrrolidyl-tRNA synthetase PylRS / tRNA CUA pair, and pyrrolysyl-tRNA synthetase (PylRS) / tRNA CUA (tRNA pyl ) pair. The PylRS / tRNA CUA pair is orthogonal in bacteria, eukaryotic cells, and animals (e.g., Chin, Jason W. “Expanding and reprogramming the genetic code of cells and animals.” Annual review of biochemistry 83 (2014): 379-408).
[0140] In some cases, the non-natural amino acids (UAAs) provided herein are incorporated using pyrrolysyl-tRNA synthetase (tRNA pyl ). The non-natural amino acids (UAAs) are introduced onto transfer RNA molecules (tRNAs) so that they can be used in translation. However, the attachment of non-natural amino acids to tRNAs does not necessarily have to be achieved by native aminoacyl-tRNA synthetases. Thus, the produced tRNA pylEngineered tRNAs prepared and selected from mutant libraries pyl Engineered aminoacyl-tRNA synthetases, such as pyl , can be useful for attaching a desired UAA to a tRNA such that the desired UAA can be incorporated by mutagenesis.
[0141] In some embodiments, the UAAs provided herein (e.g., UAAs of Formula (I), Formula (II), Formula (III), Formula (IA), Formula (IB), Formula (IC), Formula (ID), Formula (IE), Formula (IIA), Formula (IIB), or Formula (IV), such as FSY, FSK, and FFY) can be attached to a tRNA using an engineered mutant tRNA pyl mutant capable of binding such a UAA. In some embodiments, the mutant tRNA pyl mutant contains a single amino acid mutation compared to wild-type tRNA pyl . In other embodiments, the mutant tRNA pyl mutant contains multiple amino acid mutations compared to wild-type tRNA pyl . In some embodiments, a library of tRNA pyl mutants is prepared and screened by one of ordinary skill in the art to select a tRNA pyl mutant suitable for attaching a desired UAA. In some embodiments, the tRNA pyl mutants used to introduce a UAA into the conjugates provided herein are the tRNA pyl mutants described in U.S. Patent No. 8,735,093, U.S. Patent No. 9,133,449, and International Publication No. WO2020206341, each of which is incorporated herein by reference.
[0142] In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein comprises at least five amino acid residue substitutions within the substrate binding site of the mutant pyrrolysyl-tRNA synthetase. In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein has the amino acid sequence of SEQ ID NO: 58. In some embodiments, the mutant pyrrolysyl-tRNA synthetase comprises the amino acid sequence of SEQ ID NO: 58. In some embodiments, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 58. In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein is encoded by the nucleic acid sequence of SEQ ID NO: 59. In some embodiments, the mutant pyrrolysyl-tRNA synthetase is encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 59. In some embodiments, the mutant pyrrolysyl-tRNA synthetase is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 59. In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein has the amino acid sequence of SEQ ID NO: 61. In some embodiments, the mutant pyrrolysyl-tRNA synthetase comprises the amino acid sequence of SEQ ID NO: 61. In some embodiments, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 61. In some embodiments, the mutant pyrrolysyl-tRNA synthetase provided herein has the amino acid sequence of SEQ ID NO: 61. In some embodiments, the mutant pyrrolysyl-tRNA synthetase comprises the amino acid sequence of SEQ ID NO: 61.In some embodiments, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 61.
[0143] In some cases, the sequences related to the mutant pyrrolysyl-tRNA synthetase herein are those in Table 2.
[0144]
Table 2-1
[0145]
Table 2-2
[0146] In some cases, the conjugate comprises a first targeting domain and a second targeting domain, and the conjugate is recombinantly produced by a host cell line, for example, as a fusion protein comprising the first targeting domain and the second targeting domain. In some cases, the host cell is a eukaryotic cell (e.g., a mammalian cell, an insect cell, a yeast cell, or a plant cell), an archaeal cell, or a prokaryotic cell (e.g., a gram-positive bacterium or a gram-negative bacterium). In some cases, the eukaryotic host cell is a mammalian host cell. In some cases, the mammalian host cell is a stable cell line or a cell line that has integrated the genetic material of interest into its own genome and has the ability to express the product of the genetic material after cell division over multiple generations. In other cases, the mammalian host cell is a transient cell line or a cell line that has integrated the genetic material of interest into its own genome and does not have the ability to express the product of the genetic material after cell division over multiple generations.
[0147] Exemplary mammalian host cells include 293T cell line, 293A cell line, 293FT cell line, 293F cells, 293H cells, A549 cells, MDCK cells, CHO DG44 cells, CHO-S cells, CHO-K1 cells, Expi293F cellsTM cells, Flp-InTMT-RExTM293 cell line, Flp-InTM-293 cell line, Flp-InTM-3T3 cell line, Flp-InTMBHK cell line, Flp-InTM-CHO cell line, Flp-InTM-CV-1 cell line, Flp-InTMThe Jurkat cell line, FreeStyleTM293-F cells, FreeStyleTMCHO-S cells, GripTiteTM293MSR cell line, GS-CHO cell line, HepargTM cells, T-RExTMJurkat cell line, Per.C6 cells, T-RExTM-293 cell line, T-RExTM-CHO cell line, and T-RExTMHeLa cell line.
[0148] In some embodiments, the eukaryotic host cell is an insect host cell. Exemplary insect host cells include Drosophila S2 cells, Sf9 cells, Sf21 cells, and Cellular High Five™ cells.
[0149] In some embodiments, the eukaryotic host cell is a yeast host cell. Exemplary yeast host cells include Pichia pastoris yeast strains such as GS115, KM71H, SMD1168H, and X-33, as well as Saccharomyces cerevisiae yeast strains such as INVSCl.
[0150] In some embodiments, the eukaryotic host cell is a plant host cell. Optionally, the plant cell includes cells derived from algae. Exemplary plant cell lines include strains derived from Chlamydomonas reinhardtii 137c or Synechococcus elongatus PPC 7942.
[0151] In some embodiments, the host cell is a prokaryotic host cell. Exemplary prokaryotic host cells include BL21, Mach1™, DH10B™, TOP10, DH5α, DH10Bac™, OmniMax™, MegaX™, DH12S™, INV110, TOP10F’, INVαF, TOP10 / P3, ccdB Survival, PIR1, PIR2, Stbl2™, Stbl3™, or Stbl4™.
[0152] In some cases, suitable nucleic acid molecules or vectors for producing the targeting domains described herein include any suitable vector derived from a eukaryotic or prokaryotic source. Exemplary nucleic acid molecules or vectors include vectors derived from bacterial (e.g., E. coli), insect, yeast (e.g., Pichia pastoris), algal, or mammalian sources. Bacterial vectors include, for example, pACYC177, pASK75, pBAD vector systems, pBADM vector systems, pET vector systems, pETM vector systems, pGEX vector systems, pHAT2, pMal-C2, pMal-p2, pQE vector systems, pRSET A, pRSET B, pRSET C, pTrcHis2 systems, pZA31-Luc, pZE21-MCS-1, pFLAG ATS, pFLAG CTS, pFLAG MAC, pFLAG Shift-12C, pTAC-MAT-1, pFLAG CTC, or pTAC-MAT-2.
[0153] Insect vectors include, for example, pFastBac1, pFastBac DUAL, pFastBac ET, pFastBac HTa, pFastBac HTb, pFastBac HTc, pFastBac M30a, pFastBac M30b, pFastBac M30c, pVL1392, pVL1393M 10, pVL1393M11, pVL1393M 12, FLAG vectors such as pPolh-FLAG1 or pPolh-MAT2, or MAT vectors such as pPolh-MAT1 or pPolh-MAT2.
[0154] Examples of yeast vectors include, for example, pDESTTM14a carrier, pDESTTM15a carrier, pDESTTM17a carrier, pDESTTM24 carrier a, pYES-DEST52 vector, pBAD-DEST49Target vector, pAO815 Pichia yeast vector, pFLD1 Pichia pastoris vector, pGAPZA, Pichia pastoris C vector, Pichia pastoris pPIC3.5K vector, pPIC 6A, B, and Pichia pastoris C vector, pPIC9K vector, pTEF1 / Zeo, pYES2 yeast vector, pYES2 / CT yeast vector, pYES2 / NT A, B, and C yeast parents, or pYES3 / CT yeast vector.
[0155] Examples of algal vectors include, for example, pChlamy-4 vector or MCS vector.
[0156] Examples of mammalian vectors include, for example, transient expression vectors or stable expression vectors. Exemplary mammalian transient expression vectors include p3xFLAG-CMV 8, pFLAG-Myc-CMV 19, pFLAG-Myc-CMV 23, pFLAG-CMV 2, pFLAG-CMV 6a, b, c, pFLAG-CMV 5.1, pFLAG-CMV 5a, b, c, p3xFLAG-CMV 7.1, pF-CMV 20, p3xFLAG-Myc-CMV 24, pCMV-FLAG-MAT1, pCMV-FLAG-MAT2, pBICEP-CMV 3, or pBICCMV-4. Exemplary mammalian stable expression vectors include pFLAG-CMV 3, p3xFLAG-CMV 9, p3xFLAG-CMV 13, pFLAG-Myc-CMV 21, p3xFLAG-Myc-CMV 25, pFLAG-CMV 4, p3xFLAG-CMV 10, p3xFLAG-CMV 14, pFLAG-Myc-CMV 22, p3xFLAG-Myc-CMV 26, pBICEP-CMV 1, or pBICEP-CMV 2.
[0157] In some cases, cell-free systems are used to produce the targeting domains described herein. In some cases, cell-free systems contain a mixture of cytoplasmic and / or nuclear components from cells and are suitable for nucleic acid synthesis in vitro. In some cases, cell-free systems utilize prokaryotic cell components. In other cases, cell-free systems utilize eukaryotic cell components. Nucleic acid synthesis is achieved, for example, in cell-free systems based on Drosophila cells, Xenopus eggs, archaebacterial cells, or HeLa cells. Exemplary cell-free systems include the E. coli S30 Extract system, the E. coli T7S 30 system, or XpressCF and XpressCF+.
[0158] Cell-free translation systems variously include components such as plasmids, mRNA, DNA, tRNA, synthetases, release factors, ribosomes, chaperone proteins, translation initiation and elongation factors, natural and / or unnatural amino acids, and / or other components for protein expression. Such components are optionally modified to improve yield, increase synthesis rate, increase the fidelity of the protein product, improve the activity of folding or chaperone proteins, or incorporate unnatural amino acids. In some embodiments, the targeting domains containing unnatural amino acids described herein are synthesized using a cell-free translation system described in U.S. Patent No. 8,778,631, U.S. Patent Application Publication No. 2017 / 0283469, U.S. Patent Application Publication No. 2018 / 0051065, U.S. Patent Application Publication No. 2014 / 0315245, or U.S. Patent No. 8,778,631. In some embodiments, the cell-free translation system includes a modified release factor or even one or more release factors are removed from the system. In some embodiments, the cell-free translation system includes a reduced protease concentration. In some embodiments, the cell-free translation system includes a modified tRNA having a reassigned codon encoding an unnatural amino acid. In some embodiments, the synthetase for incorporating an unnatural amino acid described herein is used in a cell-free translation system. In some embodiments, an unnatural amino acid is pre-loaded onto the tRNA using enzymatic or chemical methods before the tRNA is added to the cell-free translation system. In some embodiments, the components for the cell-free translation system are obtained from a modified organism such as a modified bacterium, yeast, or other organism.
[0159] To generate the targeted domains described herein, an orthogonal or expanded genetic code may be used, and one or more specific codons present in the nucleic acid sequence of the targeted domain are assigned to encode non-natural amino acids, whereby they can be genetically incorporated into conjugates (e.g., targeted domains) through the use of an orthogonal tRNA synthetase / tRNA pair. The orthogonal tRNA synthetase / tRNA pair is capable of charging the tRNA with a non-natural amino acid and, depending on the codon, incorporating the non-natural amino acid into the polypeptide chain. The tRNA synthetase and tRNA may be those described in Wang et al, “Genetically Encoding Fluorosulfate-L-tyrosine To React with Lysine, Histidine, and Tyrosine via SuFEx in Proteins in Vivo,” J. Am. Chem. Soc. 2018, 140 4995-4999, or Wang et al, “A Genetically Encoded Fluorosulfonyloxybenzoyl-L-lysine for Expansive Covalent Bonding of Proteins via SuFEx Chemistry,” J. Am. Chem. Soc. 2021, 143 10341-10351 (or those generated using the methods described therein).
[0160] In some cases, the codon is an amber codon, an ochre codon, an opal codon, or a quadruplet codon. In some cases, the codon corresponds to an orthogonal tRNA used to carry a non-natural amino acid. In some cases, the codon is an amber codon. In other cases, the codon is an orthogonal codon.
[0161] In some cases, the codon is a quadruplet codon and can be decoded by the orthogonal ribosome ribo-Q1. In some cases, the quadruplet codon is as described in Neumann et al, “Encoding multiple unnatural amino acid analysis of a quadruplet-decoding ribosome,” Nature, 464(7287):441-444(2010).
[0162] In some cases, the codons used in the present disclosure are recoded codons, for example, synonymous codons or rare codons that are replaced with alternative codons. In some cases, the recoded codons are as described in Napolitano et al, “Emergent rules for codon choice isolated by editing of a ray array code in Escherichia coli,” PNAS, 113(38):E5588-5597(2016). In some cases, the recoded codons are as described in Ostrov et al., “Design, synthesis, and testing translated a 57-code gene,” Science 353(6301):819.sub.822(2016).
[0163] Definitions The term "amino acid" refers to naturally occurring amino acids and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to naturally occurring amino acids. Naturally occurring amino acids include those encoded by the genetic code and those that are modified post-translationally, such as hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., a compound having a carbon bonded to a hydrogen, a carboxyl group, an amino group, and an R group, and examples thereof include homoserine, norleucine, methionine sulfoxide, and methionine methyl sulfonium. Such analogs have a modified R group (e.g., norleucine) or a modified peptide backbone, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to compounds that have a structure different from the general chemical structure of an amino acid but function in a manner similar to a naturally occurring amino acid.
[0164] Amino acids may be referred to herein by either their generally known three-letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be referred to by their generally accepted one-letter codes.
[0165] The term "amino acid side chain" refers to the functional substituent contained in an amino acid. For example, the amino acid side chain may be the side chain of a naturally occurring amino acid. Naturally occurring amino acids are those encoded by the genetic code (e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine), as well as amino acids that are later modified, such as hydroxyproline, g-carboxyglutamate, and O-phosphoserine. In some embodiments, the amino acid side chain may be a non-natural amino acid side chain. In some embodiments, the amino acid side chain is H,
[0166] [Chemical formula] and so on. In some embodiments, the non-natural amino acid side chain is
[0167] [Chemical formula] and so on. In some embodiments, the non-natural amino acid side chain is
[0168] [Chemical formula] and so on. In some embodiments, the non-natural amino acid side chain is
[0169] [Chemical formula] and so on.
[0170] The terms "non-natural amino acid side chain", "unnatural amino acid side chain", "Uaa", or "non naturally occurring amino acid" refer to functional substituents of compounds having the same basic chemical structure as the naturally occurring amino acids, i.e., compounds having hydrogen, a carboxyl group, an amino group, and a carbon bonded to an R group, such as homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium, allylalanine, 2-aminoisobutyric acid. This term may refer to amino acid analogs, synthetic amino acids, and amino acid mimetics that are not found in nature, such as arylamides, vinylsulfonamides, sulfonyl fluorides, aryl fluorosulfates, arylsulfonyl fluorides, aryl fluorosulfates, and amino acid residues containing 4-sulfotetrafluorophenyl (STP) esters. Non-natural amino acids are non-proteinogenic amino acids that are either naturally occurring or chemically synthesized. Such analogs have a modified R group (e.g., norleucine) or a modified peptide backbone but retain the same basic chemical structure as the naturally occurring amino acids. Non-limiting examples include exo-cis-3-aminobicyclo[2.2.1]hept-5-ene-2-carboxylic acid hydrochloride, cis-2-aminocycloheptanecarboxylic acid hydrochloride, cis-6-amino-3-cyclohexene-1-carboxylic acid hydrochloride, cis-2-amino-2-methylcyclohexanecarboxylic acid hydrochloride, cis-2-amino-2-methylcyclopentanecarboxylic acid hydrochloride, 2-(Boc-aminomethyl)benzoic acid, 2-(Boc-amino)octanedioic acid, Boc-4,5-Dehydro-Leu-OH (dicyclohexylammonium), Boc-4-(Fmoc-amino)-L-phenylalanine, Boc-P-homopyl-OH, Boc-(2-indanyl)-Gly-OH, 4-Boc-3-morpholineacetic acid, 4-Boc-3-morpholineacetic acid, Boc-pentafluoro-D-phenylalanine, Boc-pentafluoro-L-phenylalanine, Boc-Phe(2-Br)-OH, Boc-Phe(4-Br)-OH, Boc-D-Phe(4-Br)-OH, Boc-D-Phe(3-Cl)-OH, Boc-Phe(4-NH2)-OH, Boc-Phe(3-NH2)-OH, Boc-Phe(3,5-F2)-OH, 2-(4-Boc-piperazino)-2-(3,4-dimethoxyphenyl)acetic acid plum, 2-(4-Boc-piperazino)-2-(2-fluorophenyl)acetic acid plum, 2-(4-Boc-piperazino)-2-(3-fluorophenyl)acetic acid plum, 2-(4-Boc-piperazino)-2-(4-fluorophenyl)acetic acid plum, 2-(4-Boc-piperazino)-2-(4-methoxyphenyl)acetic acid plum, 2-(4-Boc-piperazino)-2-phenylacetic acid plum, 2-(4-Boc-piperazino)-2-(3-pyridyl)acetic acid plum, 2-(4-Boc-piperazino)-2-[4-(trifluoromethyl)phenyl]acetic acid plum, Boc-P-(2-quinolyl)-Ala-OH, N-Boc-1,2,3,6-tetrahydro-2-pyridinecarboxylic acid, Boc-P-(4-thiazolyl)-Ala-OH, Bo-b-(2-thienyl)-D-Ala-OH, Fmoc-N-(4-Boc-aminobutyl)-Gly-OH, Fmoc-N-(2-Boc-aminoethyl)-Gly-OH, Fmoc-N-(2,4-dimethoxybenzyl)-Gly-OH, Fmoc-(2-indanyl)-Gly-OH, Fmoc-pentafluoro-L-phenylalanine, Fmoc-Pen(Trt)-OH, Fmoc-Phe(2-Br)-OH, Fmoc-Phe(4-Br)-OH, FmocPhe(3,5-F2)-OH, Fmoc-P-(4-thiazolyl)-Ala-OH, Fmoc-P-(2-thienyl)-Ala-OH, 4-(hydroxymethyl)-D-phenylalanine are included. In some embodiments, the non-natural amino acid is of formula I,
[0171]
Chem.
[0172]
Chem.
[0173]
Chem.
[0174]
Chem.
[0175]
Chem.
[0176] In some embodiments, the unnatural amino acid is fluorosulfonyloxybenzoyl-L-lysine (FSK)
[0177]
Chem.
[0178] "Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to a particular nucleic acid sequence, a "conservatively modified variant" refers to a nucleic acid encoding the same or essentially the same amino acid sequence. Due to the degeneracy of the genetic code, several nucleic acid sequences will encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all code for the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be changed to any of the corresponding codons described without changing the encoded polypeptide. Such nucleic acid variants are "silent variants", which are one type of conservatively modified variants. All nucleic acid sequences herein that encode polypeptides also describe all possible silent variants of the nucleic acids. One of ordinary skill in the art will recognize that each codon in a nucleic acid (except for the AUG which is normally the only codon for methionine and TGG which is normally the only codon for tryptophan) can be modified to yield a functionally identical molecule. Thus, each silent variant of a nucleic acid encoding a polypeptide is implicit in each described sequence.
[0179] With respect to amino acid sequences, one of ordinary skill in the art will recognize that individual substitutions, deletions, or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alter, add, or delete a single amino acid or a small percentage of amino acids in the encoded sequence are "conservatively modified variants" where the change results in substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to, and do not exclude, polymorphic variants, interspecies homologs, and alleles of the present disclosure.
[0180] The following eight groups, namely, (1) alanine (A), glycine (G), (2) aspartic acid (D), glutamic acid (E), (3) asparagine (N), glutamine (Q), (4) arginine (R), lysine (K), (5) isoleucine (I), leucine (L), methionine (M), valine (V), (6) phenylalanine (F), tyrosine (Y), tryptophan (W), (7) serine (S), threonine (T), and (8) cysteine (C), methionine (M) each contain amino acids that are conservative substitutions for one another (see, e.g., Creighton, Proteins (1984)).
[0181] In some embodiments, the pyrrolysyl-tRNA synthetase (tRNA pyl ) referred to herein is an aminoacyl-tRNA synthetase that catalyzes a reaction to attach an α-amino acid pyrrolysine or a similar unnatural amino acid to cognate tRNA, thereby enabling the incorporation of pyrrolysine or a similar unnatural amino acid during protein production at an amber stop codon (i.e., UAG). Wild-type tRNA pyl from Methanosarcina species that naturally incorporates pyrrolysine is orthogonal to endogenous tRNA and aminoacyl-tRNA synthetases in E. coli and eukaryotic cells. Using this pair, and its synthetically evolved derivatives or variants, the inventors and others have aimed to efficiently incorporate unnatural amino acids, including post-translationally modified amino acids, chemical handles, and photocaged amino acids, into specific sites of desired proteins in E. coli, yeast, and mammalian cells.
[0182] In some embodiments, the tRNA pyl described herein has tRNA pyl activity (e.g., wild-type tRNA pylAt least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% less active compared to, a pyrrolysyl-tRNA synthetase, or a variant, homolog, or isoform thereof, in any recombinant or naturally occurring form is included. In some embodiments, the variant, homolog, or isoform has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50-, 100-, 150-, or 200-amino acid contiguous portion) compared to the naturally occurring pyrrolysyl-tRNA synthetase. In some embodiments, the variant tRNA pyl catalyzes the attachment of a non-natural amino acid (UAA) such as fluorosulfate L-tyrosine (FSY) (e.g., a UAA of Formula I) to a tRNA pyl such that the non-natural amino acid (UAA) is incorporated.
[0183] In some embodiments, the tRNA provided herein pyl is a tRNA derivative or variant that can be engineered by one of ordinary skill in the art. In some embodiments, the tRNA provided herein pyl is a single-stranded RNA molecule comprising about 70-90 nucleotides that are folded by intrastrand base pairing to hold a specific amino acid (e.g., a UAA of Formula I such as FSY) and form a characteristic cloverleaf structure that matches it to its corresponding codon on mRNA during protein synthesis. pyl An "imaging ligand" or "detectable agent" is a composition detectable by suitable means such as spectroscopic, photochemical, biochemical, immunochemical, chemical, magnetic resonance imaging, or other physical means. For example, useful detectable agents include
[0184] F, 18 P, 32 P, 33 P, 45 Ti, 47 Sc, 52 Fe, 59 Fe, 62 Cu,64 Cu, 67 Cu, 67 Ga, 68 Ga, 77 As, 86 Y, 90 Y, 89 Sr, 89 Zr, 94 Tc, 99m Tc, 99 Mo, 105 Pd, 105 Rh, 111 Ag, 111 In, 123 I, 124 I, 125 I, 131 I, 142 Pr, 149 Pm, 153 Sm, 154-1581 Gd, 161 Tb, 166 Dy, 166 Ho, 169 Er, 175 Lu, 177 Lu, 186 Re, 188 Re, 189 Re, 194 Ir, 198 Au, 199 Au, 211 At, 211 Pb, 212 Bi, 212 Pb, 213 Bi, 223 Ra, 225 Ac, 153 Sm, 177 Lu, 90 Y, 131 I, 149 Tb, 212 Pb / 212 Bi, 213 Bi, 227 Th, Cr, V, Mn, Fe, Co, Ni, Cu, La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, 32P, fluorophore (e.g., fluorescent dye), high electron density reagent, enzyme (e.g., those commonly used in ELISA), biotin, digoxigenin, paramagnetic molecule, paramagnetic nanoparticle, ultrasmall superparamagnetic iron oxide ("USPIO") nanoparticle, USPIO nanoparticle aggregate, superparamagnetic iron oxide ("SPIO") nanoparticle, SPIO nanoparticle aggregate, single crystal iron oxide nanoparticle, single crystal iron oxide, nanoparticle contrast agent, liposome, or other delivery medium (a "Gd-chelate") molecule containing a gadolinium chelate, gadolinium, radioisotope, radionuclide (e.g., carbon-11, nitrogen-13, oxygen-15, fluorine-18, rubidium-82), fluorodeoxyglucose (e.g., fluorine-18 labeled), any gamma ray emitting radionuclide, positron emitting radionuclide, radiolabeled glucose, radiolabeled water, radiolabeled ammonia, biocolloid, microbubble (e.g., microbubble shell containing albumin, galactose, lipid, and / or polymer, air, heavy gas(es), perfluorocarbon, nitrogen, octafluoropropane, perflexane lipid microsphere, perflutren, etc., microbubble gas core), iodine contrast agent (e.g., iohexol, ioxilanol, ioversol, iopamidol, ioxilan, iopromide, diatrizoate, metrizoate, ioxaglate), barium sulfate, titanium dioxide, gold, gold nanoparticle, gold nanoparticle aggregate, fluorophore, two-photon fluorophore, or hapten and protein, or other substances that can be made detectable by incorporating a radiolabel into a peptide or antibody that specifically reacts with, for example, a target peptide. The detectable moiety is a detectable agent that can form a bond with a monovalent detectable agent or another composition.
[0185] Examples of radioactive substances (e.g., radioisotopes) that can be used as contrast agents and / or labeling agents according to embodiments of the present disclosure include, but are not limited to, 18 F, 32 P, 33 P, 45 Ti, 47 Sc, 52 Fe,59 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 77 As, 86 Y, 90 Y, 89 Sr, 89 Zr, 94 Tc, 94 Tc, 99m Tc, “Mo, 105 Pd, 105 Rh, 111 Ag, 111 Ln, 123 I, 124 I, 125 I, 131 I, 142 Pr, 143 Pr, 149 Pm, 153 Sm, 154-1581 Gd, 161 Tb, 166 Dy, 166 HO, 169 Er, 175 Lu, 177 Lu, 186 Re, 188 Re, 189 Re, 194 Ir, 198 Au, 199 Au, 211 At, 211 Pb, 212 Bi, 212 Pb, 213 Bi, 223 Ra, 225 Ac, 153 Sm, 177 Lu, 90 Y, 131 I, 149 Tb, 212 Pb / 212 Bi, and 227Examples include Th. Paramagnetic ions that can be used as additional contrast agents according to embodiments of the present disclosure include, but are not limited to, ions of transition metals and lanthanide metals (e.g., metals having atomic numbers from 21 to 29, 42, 43, 44, or 57 to 71). Examples of these metals include ions of Cr, V, Mn, Fe, Co, Ni, Cu, La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and Lu.
[0186] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, which polymer may, in embodiments, be conjugated to moieties that are not composed of amino acids. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acids, as well as to naturally occurring and non-naturally occurring amino acid polymers. A "fusion protein" refers to a chimeric protein that encodes two or more distinct protein sequences expressed recombinantly as a single moiety.
[0187] The "position" of an amino acid or nucleotide base is represented by a number that sequentially identifies each amino acid (or nucleotide base) in the reference sequence based on its position relative to the N-terminus (or 5'-terminus). Due to deletions, insertions, cleavages, fusions, etc. that must be taken into account when determining the optimal alignment, generally, the amino acid residue numbers in the test sequence determined by simply counting from the N-terminus will not necessarily be the same as the numbers of the corresponding positions in the reference sequence. For example, if the variant has a deletion compared to the aligned reference sequence, there will be no amino acid at the site of the deletion in the variant that corresponds to the position in the reference sequence. If there is an insertion in the aligned reference sequence, the insertion will not correspond to the numbered amino acid position in the reference sequence. In the case of a cleavage or fusion, there may be a stretch of amino acids in either the reference sequence or the aligned sequence that does not correspond to any amino acid in the corresponding sequence.
[0188] The terms "numbered with reference to" or "corresponding to", when used in the context of numbering a given amino acid or polynucleotide sequence, refer to the numbering of the residues of the designated reference sequence when the given amino acid or polynucleotide sequence is compared to the reference sequence.
[0189] An amino acid residue in a protein "corresponds" to a given residue when it occupies the same essential structural position within the protein as the given residue. For example, if a selected residue occupies the same essential spatial or other structural relationship as Ala302 in the PylRS protein, the selected residue in the selected protein corresponds to Ala302 of the PylRS protein. In embodiments, when the selected protein is aligned such that it is maximally homologous to the PylRS protein, the position in the aligned selected protein that aligns with Ala302 is said to correspond to Ala302. Instead of a primary sequence alignment, for example, a three-dimensional structure alignment may be used when the structure of the selected protein is aligned such that it maximally corresponds to the PylRS protein and the overall structure being compared. In this case, an amino acid that occupies the same essential position as Ala302 in the structural model is said to correspond to the Ala302 residue.
[0190] The "percentage of sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to a reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences, obtaining the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.
[0191] The terms "percentage of identity" or "identity" refer to two or more nucleic acid or polypeptide sequences that are the same or contain the same amino acid residues or nucleotides at a specified percentage (i.e., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over the region of comparison or specified region being compared and aligned, when measured using the BLAST or BLAST 2.0 sequence comparison algorithms with the default parameters described below, or when measured by manual alignment and visual inspection (see, e.g., the NCBI website at ncbi.nlm.nih.gov / BLAST / ). In such cases, such sequences are said to be "substantially identical." This definition also refers to, or can be applied to, the complement of a test sequence. This definition includes sequences having deletions and / or additions, as well as sequences having substitutions. As described below, preferred algorithms may take into account gaps, etc. Identity exists over a region that is at least about 25 amino acids or nucleotides in length, or over a region that is 50-100 amino acids or nucleotides in length.
[0192] An "antibody" is a large, complex molecule with an intricate internal structure. Natural antibody molecules contain two identical pairs of polypeptide chains, each pair having one light chain and one heavy chain. Each light and heavy chain consists of two regions, namely, a variable ("V") region involved in binding to the target antigen and a constant ("C") region that interacts with other components of the immune system. The light and heavy chain variable regions fold together in three-dimensional space to form the variable region that binds to an antigen (e.g., a receptor on the cell surface). Within each light or heavy chain variable region are three short segments (on average 10 amino acids in length) called complementarity-determining regions ("CDRs"). The six CDRs (three from the light chain and three from the heavy chain) in the variable domain of the antibody fold together in three-dimensional space to form the actual antibody binding site that binds to the target antigen. The positions and lengths of these CDRs are precisely defined by Kabat, E. et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, 1983, 1987. The portions of the variable region not included in the CDRs are called the framework ("FR") and form the environment for the CDRs.
[0193] The term "antibody" is used in accordance with its generally known meaning in the art. Antibodies exist, for example, as intact immunoglobulins or as fragments with many known properties produced by digestion with various peptidases. Thus, for example, pepsin digests the antibody below the disulfide linkage in the hinge region to produce F(ab)'2, a dimer of Fab, which itself is a light chain that is disulfide-bonded to VH-CH1. F(ab)'2 can be reduced under mild conditions to break the disulfide linkage in the hinge region, converting the F(ab)'2 dimer to Fab' monomers. Fab' monomers are essentially Fab with a portion of the hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993)). Although various antibody fragments are defined with respect to digestion of intact antibodies, it will be apparent to those skilled in the art that such fragments can be synthesized de novo by chemical or recombinant DNA methods. Thus, the term antibody as used herein includes antibody fragments produced by modification of whole antibodies, or those synthesized de novo using recombinant DNA methods (e.g., single-chain Fv), or those identified using phage display libraries (e.g., McCafferty et al., Nature 348:552-554 (1990)).
[0194] Exemplary immunoglobulin (antibody) structural units include tetramers. Each tetramer is composed of two identical pairs of polypeptide chains, with each pair having one "light" chain (about 25 kDa) and one "heavy" chain (about 50 - 70 kDa). The N-terminus of each chain defines a variable region of about 100 - 110 or more amino acids that is mainly involved in antigen recognition. The terms variable light chain (VL) or variable heavy chain (VH) refer to these light and heavy chains, respectively. The Fc (i.e., fragment crystallizable region) is the "base" or "tail" of the immunoglobulin and is typically composed of two heavy chains that contribute to two or three constant domains, depending on the class of the antibody. The Fc region ensures that each antibody elicits an appropriate immune response against a specific antigen by binding to specific proteins. The Fc region also binds to various cell receptors, such as Fc receptors, and other immune molecules, such as complement proteins.
[0195] As used herein, "antigen-binding fragment" refers to a polypeptide that is capable of binding to an antigen and that includes one or more structural domains of an antibody or fragment thereof. Non-limiting examples of antibody variants include single-domain antibodies (nanobodies), affibodies (polypeptides that are smaller than monoclonal antibodies (e.g., about 6 kDa), bind to antigens with high affinity, and are capable of mimicking monoclonal antibodies), monospecific Fab2, bispecific Fab2, trispecific Fab3, monovalent IgG, scFv, bispecific diabodies, trispecific tribodies, scFv-Fc, minibodies, IgNAR, V-NAR, hcIgG, VhH, or peptibodies. As used herein, "peptibody" refers to a peptide moiety attached (either via a covalent linker or a non-covalent linker) to the Fc domain of an antibody. Further non-limiting examples of antibody variants known in the art include antibodies produced by cartilaginous fish or camels. General descriptions of antibodies and their variable regions from camels, as well as methods for their production, isolation, and use, can be found in references WO97 / 49805 and WO97 / 49805, which are hereby incorporated by reference in their entirety for all purposes. Similarly, antibodies and their variable regions from cartilaginous fish, as well as methods for their production, isolation, and use, can be found in WO2005 / 118629, which is hereby incorporated by reference in its entirety for all purposes.
[0196] "Single-domain antibody" or "nanobody" refers interchangeably to an antibody fragment having a single monomeric variable antibody domain. Like an entire antibody, it can selectively bind to a particular antigen. In some embodiments, the single-domain antibody is a human or humanized single-domain antibody. In some embodiments, the single-domain antibody is a camelid single-domain antibody.
[0197] As used herein, the term "antigen" refers to a molecule capable of binding to an antibody-binding domain provided herein. As used herein, an "antigen-binding domain" is the region (epitope) to which an antibody binds to an antigen. As described above, an antigen-binding domain may include one constant domain and one variable domain (VL, VH, CL, and CH1, respectively) of each of the heavy and light chains. In embodiments, the antigen-binding domain includes a light-chain variable domain and a heavy-chain variable domain. In embodiments, the antigen-binding domain includes a light-chain variable domain and does not include a heavy-chain variable domain and / or a heavy-chain constant domain. A paratope or antigen-binding site is formed at the N-terminus of the antigen-binding domain. The two variable domains of the antigen-binding domain may bind to an epitope of an antigen. Antibodies exist, for example, as intact immunoglobulins or as fragments with many known properties produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkage in the hinge region to produce F(ab)'2, a dimer of Fab, which itself is a light chain bound to VH-CH1 by a disulfide bond. F(ab)'2 can be reduced under mild conditions to break the disulfide linkage in the hinge region to convert the F(ab)'2 dimer to Fab' monomers. Fab' monomers are essentially antigen-binding portions having a portion of the hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993)). Various antibody fragments have been defined with respect to digestion of intact antibodies, but it will be apparent to those skilled in the art that such fragments can be synthesized de novo using chemical or recombinant DNA methods. Thus, as used herein, the term antibody includes antibody fragments produced by modification of whole antibodies, or those synthesized de novo using recombinant DNA methods (e.g., single-chain Fv), or those identified using phage display libraries (e.g., see McCafferty et al., Nature 348:552-554 (1990)).
Example
[0198] Example 1: Cloning and Expression of FSY-Modified sdAb The vector pBAD sequence lacking the ORF insertion (Invitrogen #43001) was PCR amplified with the following primers. Forward primer: CTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAG (SEQ ID NO: 62) Reverse primer: GTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGCCCAAAAAAACGGGTATGGAG (SEQ ID NO: 63)
[0199] The vector obtained by PCR amplification was gel extracted and purified using the Zymo PCR purification kit (Zymoclean Gel DNA Recovery kit, catalog number D4002). The dsDNA sequences of the single domain antibody (sdAb) and the bivalent construct were ligated with the PCR amplified pBAD backbone and transformed into Escherichia coli DH10b chemically competent cells (Fisher Thermo Scientific™ DH10B Competent Cells; High Efficiency; FEREC0113). The clones were miniprepped and sequenced using the pBAD forward primer. For constructs incorporating the FSY residue, the TAG codon was incorporated into the DNA sequence at the desired position for amino acid substitution within the open reading frame of the sdAb or the bivalent construct.
[0200] Expression and Purification: The pEVOL-FSYRS plasmid (reference: J. Am. Chem. Soc. 2018, 140, 15, 4995 - 4999) was synthesized by Genscript. This plasmid expresses the engineered Mm FSYRS aminoacyl tRNA synthetase and was transformed into chemically competent DH10b competent cells using standard methods to generate the parental strain FSYRS-DH10b. Each individual plasmid encoding a single domain antibody, a biparatopic construct, or a variant was transformed into chemically competent FSYRS-DH10b using standard methods. Single colonies were inoculated into 2xYT medium (Teknova# Y0166) containing 100 μg / ml ampicillin and 5 μg / ml chloramphenicol and grown by shaking overnight at approximately 220 rpm at 37°C. The overnight cultures were mixed 1:1 with sterile 50% glycerol and stored at -80°C.
[0201] Strains harboring plasmids encoding sdAb or biparatopic constructs were cultured in 2xYT medium (Teknova# Y0166) in the presence of 100 μg / ml ampicillin and 34 μg / ml chloramphenicol. Prior to induction, the cells were grown at a temperature of 37°C. At an OD600 of 0.6, the cultures were supplemented with 1 mM FSY and induced by adding 0.2% arabinose. At the time of induction, the cultures were transferred to 25°C and shaken at 220 RPM overnight for a total of 16 hours.
[0202] Expression was recovered by pelleting the cells at 2,200×g for 30 minutes at 4°C. The supernatant was removed, and the cell pellet was weighed and stored at -80°C. For lysis, the cell pellet was resuspended by adding B-PER protein extraction reagent (ThermoFisher #78243) at 4 mL per gram of pellet. The sample was placed on a medium-speed orbital shaker at room temperature for 15 minutes to lyse the resuspended pellet. The lysed cells were then clarified by centrifugation at 2200×g for 30 minutes. The soluble fraction in the supernatant was removed for further purification.
[0203] To purify the soluble fraction, the soluble material was captured from the lysate using HisPur Ni-NTA resin (ThermoFisher #88222). The resin storage buffer was removed, and the resin was equilibrated by batch washing with the wash buffer (40 mM sodium phosphate, pH 7.2, 300 mM NaCl, 20 mM imidazole). The batch washing was repeated with a total volume 50 times the resin volume. The clarified lysate was added to the washed Ni-NTA resin and allowed to bind at room temperature for 1 hour with constant rotation. After binding, the protein-bound resin was batch washed with the wash buffer at 50 times the resin volume to remove unbound contaminants. Then, the protein-bound resin was transferred to a spin column and spun briefly at 700×g to remove the remaining wash buffer. Subsequently, the target protein was eluted using the elution buffer (40 mM sodium phosphate, 7.2, 300 mM NaCl, 500 mM imidazole). The elution buffer was added at 2 times the resin volume and incubated at room temperature for 5 minutes. The sample was centrifuged briefly, and the eluted protein was collected in a new tube. The elution procedure was repeated twice using the same conditions. The elution fractions were pooled, quantified using A280 with a Nanodrop 2000, and blanked with the elution buffer. Then, the purified Ni-NTA protein was concentrated using a 0.5 mL volume 3 kDa MWCO PES spin filter (ThermoFisher #88512), and buffer exchanged into 1× PBS by repeated dilution to 8 - 10 times the sample volume and concentration.
[0204] Example 2: EGFR-targeted Biparatopic Construct An EGFR-targeted sdAb with FSY (C4-109FSY, SEQ ID NO: 17) and a bivalent construct (C9 (C4-109FSY-11-C5), SEQ ID NO: 19) having two EGFR-targeted sdAbs linked by a linker were constructed, cloned, and expressed as described in Example 1. This construct was synthesized with a pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein, and six histidines at the C-terminus were used to purify the His-Tag. The bivalent construct C9 contains a GGGGSGGGGS (SEQ ID NO: 14) linker (L1) between the first sdAb C4 and the second sdAb C5.
[0205] The kinetics of EGFR cross-linking of the FSY-modified sdAb were evaluated. The protein was incubated with EGFR at a molar ratio of 8:1 (EGFR was at a final concentration of 0.125 mg / mL, 1.25 μM). Samples were taken at time points from 0 to 180 minutes, and the rate of EGFR cross-linking was evaluated by SDS-PAGE. The ratio of the cross-linked band was calculated by quantifying the sdAb-EGFR cross-linked band, and the intensity of the EGFR band was quantified using Image J.
[0206] Samples were taken at times from zero to 360 minutes. The ligation kinetics are shown in FIGS. 1A - 1B. The bivalent construct C9 (C4-109FSY-L1-C5, SEQ ID NO: 19) was compared to a monovalent construct (C4-109FSY, SEQ ID NO: 17) containing only sdAb C4 with FSY modification. As shown in FIG. 2, the bivalent construct C9 bound to EGFR faster than the monovalent C4-109FSY sequence, as measured by a decrease in the time to half-maximal cross-linking compared to the monovalent construct.
[0207] Example 3: Manipulation of sdAb C1 to Remove Disulfide Bonds in CDR3 To express an sdAb having the sequence shown below, a PSMA-targeted sdAb C1 was constructed. This construct was synthesized with a pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein, and six histidines at the C-terminus were used to purify the His-Tag.
[0208] The C1 WT protein sequence (C1) is designated as SEQ ID NO: 1. Further constructs were made sequentially from C1, and two cysteine residues in CDR3 (SEQ ID NO: 7) were modified to alanine to remove these residues, creating C10 (C1-101A / 104A, SEQ ID NO: 20).
[0209] Subsequently, this construct was further modified to introduce FSY at residue 102, creating C10-102FSY (C1-101A / 104A / 102FSY, SEQ ID NO: 4). A diagram of the sdAb is shown in Figure 3. The cross-linking ability of these constructs was evaluated using the method of Example 2. SDS-PAGE analysis showed that all constructs cross-linked at an equivalent level under these conditions.
[0210] Example 4: PSMA-Targeted Monoparatopic Bivalent Construct FSY containing the PSMA-targeted sdAb C10-102FSY (SEQ ID NO: 4 of Example 3) was cloned and expressed as described in Example 1. The bivalent construct C11-102FSY (C10-102FSY-L1-C10, SEQ ID NO: 21) was made by ligating a further copy of C10_102FSY and C10 (SEQ ID NO: 20, without FSY) of Example 3. This construct was designed by adding a GGGGSGGGGS (SEQ ID NO: 14) linker (L1) between the two sdAb amino acid sequences. Subsequently, the bivalent construct was cloned into the pBAD vector and expressed as described in Example 1. This construct was synthesized with a pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein, and six histidines at the C-terminus were used to purify the His-Tag.
[0211] The cross-linking of the monospecific sdAb construct and the bispecific construct to PSMA was evaluated by SDS-PAGE and was carried out according to the method presented in Example 2 over time. As shown in FIGS. 4A-4B, the bispecific construct resulted in a faster ligation compared to the sdAb construct.
[0212] Example 5: Construction of Bispecific Immune Cell Engagers A bispecific T cell engager ("engager sdAb") having an sdAb that binds a target (the "target sdAb") linked by a linker to an sdAb targeting either CD3 or CD16 was constructed. In each case, the target sdAb contained the incorporated FSY. An exemplary structure is shown in FIG. 5A.
[0213] By binding C4 of Example 2 to an additional copy of C6 mobilized T cells (C6, SEQ ID NO: 22, without FSY), the bispecific constructs C12 (C4-L6-C6, SEQ ID NO: 23) or C13 (C4-109FSY-L6-C6, SEQ ID NO: 24) were generated. This construct was designed by adding a GGGGSGGGS (SEQ ID NO: 56) linker between the two sdAb amino acid sequences. Subsequently, this bispecific construct was cloned into the pBAD vector and expressed as described in Example 1. This construct was synthesized with a pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein and six histidines at the C-terminus were used to purify the His-Tag.
[0214] By binding C4-109FSY of Example 2 to an additional sdAb, C7 (SEQ ID NO: 25), which is an NK cell-binding sequence lacking FSY, bispecific constructs C14 (C4-L2-C7, SEQ ID NO: 26) or C15 (C4-109FSY-L2-C7, SEQ ID NO: 27) were prepared. This construct was designed by adding a 3x(G4S) (GGGGSGGGGSGGGGS (SEQ ID NO: 31) linker (L2) between the two sdAb amino acid sequences. Subsequently, this bispecific construct was cloned into the pBAD vector and expressed as described in Example 1. This construct was synthesized with a pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein, and six histidines at the C-terminus were used to purify the His-Tag.
[0215] By binding C17 (C2-54FSY, SEQ ID NO: 29) to an additional sdAb C6 (SEQ ID NO: 22), which is a T cell-binding sequence lacking FSY, bispecific constructs C16 (C2-L6-C6, SEQ ID NO: 28) or C18 (C2-54FSY-16-C6, SEQ ID NO: 30) were prepared. The construct was designed by adding an L6 linker (SEQ ID NO: 56) between the two sdAb amino acid sequences. Subsequently, this bispecific construct was cloned into the pBAD vector and expressed as described in Example 1. This construct was synthesized with a pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein, and six histidines at the C-terminus were used to purify the His-Tag.
[0216] The cross-linking of the bispecific FSY-modified sdAb with EGFR and PSMA was evaluated separately. The protein was incubated with EGFR or PSMA at a molar ratio of 8:1 (EGFR was at a final concentration of 0.125 mg / mL, 1.25 μM). The samples were incubated overnight at 37 °C in 1-fold PBS, pH 7.4. The proportion of cross-linked EGFR or PSMA was evaluated by SDS-PAGE (Figure 5B). 1. C12 (C4-L6-C6); 2. C12 + EGFR; 3. C13 (C4-109FSY-L6-C6); 4. C13 + EGFR; 5. C14 (C4-L2-C7); 6. C14 + EGFR; 7. C15 (C4-109FSY-L2-C7); 8. C15 + EGFR; 9. C16 (C2-L6-C6); 10. C16 + PSMA; 11. C18 (C2-54FSY-L6-C6); 12. C18 + PSMA; 13. PSMA; 14. EGFR; 15. Ladder.
[0217] Using 2x(G4S) (Linker L1: GGGGSGGGGS (SEQ ID NO: 15)), 3x(G4S) (Linker L2: GGGGSGGGGSGGGGS (SEQ ID NO: 31)), 4x(G4S) (Linker L3: GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 32)), 5x(G4S) (Linker L4: GGGGSGGGGSGGGGSGGGGSGGGGS (L4; SEQ ID NO: 33)), or SP (Linker L5: SPSTPPTPSPSTPP (SEQ ID NO: 34)) respectively, bispecific constructs C20 (C37-L2-C35), C21 (C37-L1-C35), C22 (C37-L3-C35), C23 (C37-L4-C35), and C24 (C37-L5-C35) were prepared by conjugating anti-CD16a sdAb, C37 (SEQ ID NO: 52) with anti-PSMA sdAb-FSY (SEQ ID NO: 50). Also, using the 4x(G4S) (L3) linker, a non-crosslinked bispecific construct C25 (C37-L3-C36) was prepared by conjugating anti-CD16a sdAb, C37 (SEQ ID NO: 52) with anti-PSMA sdAb-TYR (SEQ ID NO: 51). Subsequently, this bispecific construct was cloned into the pBAD vector and expressed as described in Example 1. This construct was synthesized with the pelB leader sequence (SEQ ID NO: 15) cleaved from the mature protein, and six histidines at the C-terminus were used to purify the His-Tag.
[0218] The bispecific sdAb construct containing purified FSY was incubated with PSMA (+PSMA) (Sino Biological; Catalog No. 15877-H07H) at a molar ratio of approximately 8:1 or without PSMA (-PSMA; control) in 1x PBS (pH 7.4) at 37 °C for 5 minutes. After incubation, the reaction was quenched using SDS-Laemmli loading dye (final concentration 1x with 100 mM DTT), heated at 96 °C for 5 minutes, and analyzed by Coomassie blue staining using SDS-PAGE (4-20% Mini-PROTEAN® TGX™).
[0219] As shown in Figure 6, each bispecific variant was able to rapidly crosslink with PSMA within 5 minutes, regardless of the length or composition of the linker. Figure 6 shows the SDS-PAGE analysis of various constructs provided herein. Lanes 1-12 are labeled as follows: 0. Ladder; 1. C20 (C37-L2-C35) without PSMA; 2. C20 (C37-L2-C35) with PSMA; 3. C21 (C37-L1-C35) without PSMA; 4. C21 (C37-L1-C35) with PSMA; 5. C22 (C37-L3-C35) without PSMA; 6. C22 (C37-L3-C35) with PSMA; 7. C23 (C37-L4-C35) without PSMA: 8. C23 (C37-L4-C35) with PSMA; 9. C24 (C37-L5-C35) without PSMA; 10. C24 (C37-L5-C35) with PSMA; 11. PSMA. Bands corresponding to EGFR, PSMA, and free sdAb dimer are labeled. Crosslinked species are marked with an asterisk.
[0220] Example 6: Confirmation of Binding and Kinetic Binding Characteristics of Bispecific Engager Variants to Recombinant Human CD16a and Recombinant Human PSMA Using the conjugates generated in Example 6, kinetic binding experiments to recombinant antigens were performed by biolayer interferometry on an Octet device. For some conjugates, qualitative experiments were performed using a single concentration (or the estimated concentration in a medium-purity sample) to confirm binding to the antigen and approximate affinity range. For other conjugates, a dilution series of highly purified conjugates was used to perform experiments to characterize the kinetic binding profile and affinity (k on , k off , and K D ). In the binding experiments, antigen binding to recombinant human CD16a and PSMA antigens was evaluated.
[0221] PSMA Binding To evaluate PSMA binding, PSMA-hFc (Acro Biosystms catalog number PSA-H5264) was immobilized on an anti-human capture biosensor (Sartorius catalog number 18-5060), and binding to test proteins diluted to the estimated affinity range was performed in 10 mM sodium citrate phosphate, pH 5.7, 150 mM sodium chloride containing 0.01% PS20. Initial curves were collected and presented in A of Figure 7. The binding of conjugates C21 (SEQ ID NO: 36) (B of Figure 7), C20 (SEQ ID NO: 35) (C of Figure 7), C22 (SEQ ID NO: 37) (D of Figure 7), C23 (SEQ ID NO: 38) (E of Figure 7), and C24 (SEQ ID NO: 39) (F of Figure 7) was tested at a concentration of approximately 150 nM or in a concentration range (150 nM - 500 nM). As shown in A - F of Figure 7, all four constructs with different numbers of G4S repeats in the linker (B - E of Figure 7) and the construct with an SP linker (L5) (F of Figure 7) bound to PSMA with a substantial signal above the baseline at pH 5.7.
[0222] CD16a binding Binding of CD16a was evaluated by immobilizing biotinylated CD16a (Acro P / N CDA-H82E8) onto a streptavidin biosensor (Sartorius P / N 18-5019), and binding to test proteins diluted to the estimated affinity range was performed at pH 7.4 in phosphate or HEPES buffered saline containing 0.01% PS20. (A) An initial baseline was collected before introducing any construct. (B) Binding of C21 (SEQ ID NO: 36) was tested at 180 nM, (C) C20 (SEQ ID NO: 35) was tested at 150 nM, (D) C22 (SEQ ID NO: 37) was tested at 500 nM, (E) C23 (SEQ ID NO: 38) was tested at 150 nM, 50 nM, 16.7 nM, and 5.6 nM, and (F) C24 (SEQ ID NO: 39) was tested at 150 nM, 50 nM, 16.7 nM, 5.6 nM. The kinetic binding signal (gray) and the 1:1 binding model were fit to the curve (black) of the bispecific construct binding to immobilized CD16a. As shown in A–F of FIG. 8, all five constructs bound to CD16a with an estimated affinity in the low nanomolar concentration range.
[0223] Kinetic binding of NK cell bispecific constructs to PSMA at pH 5.7 and pH 7.4 Compound C22 (SEQ ID NO: 37) having FSY and a non-covalent construct C25 (SEQ ID NO: 40) containing tyrosine (TYR) instead of FSY were generated, expressed, and purified as described in Example 6. The construct was further purified by size exclusion chromatography (SEC) and chromatography using nC-slyD-A1 resin to generate a bispecific construct with a purity greater than 90%. The construct was then evaluated in a titration series to determine the affinity of each binding domain for each antigen.
[0224] Biotinylated human PSMA with a his tag was immobilized on the streptavidin sensor as described above, and binding was evaluated at pH 5.7 or pH 7.4. Kinetic binding signals and model-fitting curves (smooth, black) were generated by measuring the binding of C25 and C22 to the immobilized PSMA in a 1:2 dilution series from 2 μM to 21.25 nM in buffer at pH 5.7 (Figures 9A and 9C respectively) or pH 7.4 (Figures 9B and 9D respectively). The control non-covalent construct C25 showed almost identical binding to PSMA between pH 5.7 and 7.4 (Figures 9A and 9B respectively), while the bispecific construct C22 containing FSY showed a clear change in the binding kinetics related to crosslinking at pH 5.7 and 7.4 (Figures 9C and 9D respectively). At pH 7.4 (Figure 9D), the association curve of the bispecific construct containing FSY showed a biphasic kinetic curve rather than a 1:1, and the apparent dissociation decreased. At pH 5.7 (Figure 9C), covalent crosslinking (or covalent bonding) decreased significantly, and by reducing these effects, it became possible to measure only the binding events and calculate the domain affinity.
[0225] Also, the purified constructs were evaluated for their binding to CD16a immobilized on a streptavidin biosensor as previously described. As a control, purified CD16a sdAb domain alone was also evaluated. Kinetic binding signals and model-fitting curves were generated from the binding of the molecules at dilutions from 200 nM to 3.125 nM. Concentrations above saturation were not included in the fitting analysis.
[0226] As shown in Figures 10A - C, the kinetic binding to CD16a was similar in the CD16a sdAb domain alone (C37; Figure 10A), C25 (Figure 10B), and C22 (Figure 10C) conjugates, suggesting that conjugation did not impair the binding of the CD16a-linked component of the conjugate.
[0227] The kinetic binding parameters determined at C25 and C22 are presented in Table 3. As a result, the binding to PSMA at pH 5.7 and the binding to CD16a at pH 7.4 show similar patterns, but there are significant differences in the binding mode to PSMA at pH 7.4. These results suggest that the difference in the binding mode of the construct to PSMA at pH 7.4 is due to the cross-linking of the anti-PSMA sdAb and its target.
[0228]
Table 3
[0229] Using an ADCC reporter assay, the effect of covalent binding to target cells on the ability of bivalent constructs to promote T cell activity in the presence of target cells expressing different levels of PSMA was investigated. PC3pip cells expressing high density of PSMA (described in US Patent No. 9,713,649B2, which is hereby incorporated by reference in its entirety) and 22Rv1 cells expressing low density of PSMA (ATCC CRL-2505) were seeded at 12,500 cells per well in a 96-well black clear-bottom plate in 100 μL of RPMI-1640, 10% FBS, incubated at 37 °C, 5% CO2 for 24 hours to allow the cells to attach to the plate.
[0230] The next day, the culture medium was removed, and the bispecific constructs of C25 and C22 generated as described above and purified to a purity exceeding 90%, or the single-specific anti-CD16a sdAb (C37), anti-PSMA sdAb (TYR) (C36), anti-PSMA (FSY) (C35), or endotoxin control sdAb were added in serial three-fold dilutions from a final concentration of 120 nM over 10 concentration points in ADCC assay buffer (RPMI1640, 4% low IgG FBS). For further comparison, treatment with the monoclonal anti-PSMA antibody, J591, and the human IgG isotype control antibody was also tested in serial three-fold dilutions from a final concentration of 30 nM over 10 concentration points in ADCC assay buffer. For continuously treated cells, some of the medium was removed, and then the test article and Jurkat CD16a V158 ADCC reporter cells from the Promega ADCC Reporter Bioassay Kit (Promega, G7010) were added in fresh medium, with the latter at an effector cell:target T cell (E:T) ratio of 6:1. The mixture of cells and the test article was then incubated at 37°C for 24 hours. For a 4-hour washout treatment, some of the medium was removed, the test article was added with fresh medium, and incubated at 37°C for 4 hours. After incubation for 4 hours, the cells were washed with ADCC assay buffer, and then the reporter cells were added at an effector cell:target cell (E:T) ratio of 6:1, and then incubated at 37°C for 20 hours. For the specificity of signal induction, wells containing only target cells (plate background), wells containing effector cells + target cells and no test article (effector cell background), and wells containing effector cells + the highest concentration of each test article (activation of NK reporter independent of target) were included.
[0231] BioGlo assay buffer and substrate were added to each well, incubated at room temperature for 5 - 30 minutes, shaken on a plate shaker for 1 minute, and then luminescence was read on a Victor X5 plate reader (Perkin Elmer). The induction fold was calculated by dividing the relative luminescence units (RLU) with the background subtracted from the treated wells by the RLU with the background subtracted from the untreated wells. (Induction fold = RLU(induced - background) / RLU(control without test substance / plate background). The data was plotted and curve fitting and EC50 were calculated using 'log(agonist) vs. response - variable slope (four - parameter).
[0232] The activation of CD16a - expressing reporter cells after incubation with high - PSMA - density target cells PC3pip that were continuously treated with increasing concentrations of the test substance for 24 hours or 4 hours and then washed out was plotted in Figures 11A and 11B, respectively, together with the corresponding EC50 data tables (Tables 4 and 5, respectively). The activation of CD16a - expressing reporter cells after incubation with low - PSMA - density target cells 22Rv1 that were continuously treated with increasing concentrations of the test substance for 24 hours or 4 hours and then washed out was plotted in Figures 12A and 12B, respectively, together with the corresponding EC50 data tables (Tables 6 and 7, respectively).
[0233]
Table 4
[0234]
Table 5
[0235] As shown in Figure 11A, continuous exposure of target cells with high PSMA density (PC3pip cells) to the bispecific construct for 24 hours resulted in a robust and dose-dependent induction of reporter cell signal, while the signal from the negative control molecule did not demonstrate dependence on antigen expression. The FSY-modified bispecific construct resulted in both greater signal induction and greater potency compared to the construct containing TYR. The differences observed between the FSY bispecific construct and the TYR bispecific construct were amplified in the 4-hour washout experiment (Figure 11B), where the FSY-modified construct resulted in a similar maximal signal and slightly reduced potency compared to continuous treatment over 24 hours, while the TYR construct lost virtually all activity.
[0236] As shown in Figure 12A, continuous exposure of target cells with low PSMA density (22Rv1 cells) to the bispecific construct for 24 hours also resulted in a dose-dependent induction of reporter cell signal. However, the maximal RLU was significantly decreased in both the construct containing FSY and the construct containing TYR. These results correlate with the decrease in antigen density and are presented in Table 6. No signal was observed for any of the negative control molecules. Similar to the observations in the PC3pip model, the differences between the FSY construct and the TYR construct were amplified in the 4-hour washout experiment (Figure 12B), where the FSY-modified construct resulted in a similar maximal signal and slightly reduced potency compared to continuous treatment over 24 hours, while the TYR construct lost virtually all activity. The results are presented in Table 7.
[0237] In summary, these results demonstrate that both arms of the bispecific construct can induce activation of reporter cells in response to target cells. Furthermore, over a range of receptor densities, the FSY-modified conjugate has an excellent ability to ligate and activate CD16a-expressing Jurkat NFAT reporter cells in a dose- and target-dependent manner.
[0238]
Table 6
[0239]
Table 7
[0240] Example 8: Induction by a Bispecific Conjugate of Primary Human NK Cell-Mediated Cytotoxicity against PSMA-Expressing Cells The effect of covalent attachment to target cells on the ability of a heterodimeric bivalent construct to induce primary human NK cell-mediated cytotoxicity against target cells expressing high levels of PSMA was tested.
[0241] Human primary NK cells were isolated from fresh PBMCs using the NK Cell Isolation Kit (Miltenyi Biotech catalog number 130-092-657) according to the manufacturer's protocol. The purity of the isolated NK cells was evaluated by flow cytometry. The overall purity of the enriched NK cells was determined to be >95%, and the majority of the isolated cells were CD56dim (i.e., the cytotoxic phenotype).
[0242] PC3pip cells expressing high density of PSMA (as described in U.S. Patent No. 9,713,649B2, which is hereby incorporated by reference in its entirety) were seeded at 10,000 cells per well in 100 μL of RPMI 1640 medium supplemented with 10% FBS in a 96-well black clear-bottom plate and incubated at 37 °C and 5% CO2 for 24 hours to allow the cells to attach to the plate.
[0243] For continuous treatment with the test article, the culture medium was removed the next day, C25 and C22 were generated, and purified to a purity of over 90% as described above. C37 monospecific anti-CD16a sdAb (as a control for target-independent NK cell activation) was also generated and purified as described above. Each of C25, C22, and C37 was added at nine concentration points of four-fold serial dilution to a final concentration in the range of 100 to 0.0015 nM in RPMI-1640 medium supplemented with 10% heat-inactivated FBS (cRPMI). Each concentration was tested in duplicate. Controls without the test article were also included. 100,000 primary NK cells in cRPMI and human IL-2 (hIL-2) were added to reach an hIL-2 final concentration of 25 ng / mL. The final volume was approximately 100 μL. Subsequently, the plates were incubated at 37 °C, 5% CO2 for 20 hours.
[0244] For the 5-hour washout of the test article, the culture medium was removed from each well and the diluted test article was added in duplicate and replaced. The plates were incubated at 37 °C, 5% CO2 for 5 hours, after which all the medium was carefully removed, washed once with 100 μL of cRPMI, and then the medium was removed. The final volume of 100 μL of cRPMI containing hIL-2 (final concentration 25 ng / mL) contained 100,000 primary NK cells (10:1 E:T). Subsequently, all the plates were incubated at 37 °C, 5% CO2 for 20 hours.
[0245] The next day, the plates were removed from the incubator and cytotoxicity was determined by the CellTiter-Glo luminescent cell viability assay (Promega). Luminescence was measured using a ClarioStar (BMG Labtech) reader. The value of cell lysis was calculated using the following formula. % Cytotoxicity = 100 [T - (T Eab - E)] / [T - T dead ] where T = target cells T Eab = treated target cells and effector cells E = effector cells T deadTarget cells lysed with 0.1% Triton X-100
[0246] Data graphs were plotted and curve fitting and EC50 values were calculated as described above. Error bars were calculated to represent standard error values.
[0247] NK cell engager C22, which includes FSY, has been demonstrated to be 106-fold more potent than non-covalent C25 in inducing specific target cell killing when present throughout the duration of the experiment (Figure 13A) and 140-fold more potent when incubated with target cells for 5 hours and washed away before adding effector cells (Figure 13B). This increase in potency may be due to the ability of the C22 construct to covalently bind to target cell-expressed PSMA, consistent with excellent binding to target cells mediated by covalent bonding. The results are summarized in Tables 8 and 9.
[0248] [Table 8]
[0249] [Table 9] Example 9: Crosslinking of PSMA with a T cell bispecific construct Generate additional bispecific conjugates, which have a PSMA-targeting sdAb linked by a 4x(G4S) linker (L3; SEQ ID NO: 32) substantially as described in Example 5, and contain C35 (SEQ ID NO: 50) and C36 (SEQ ID NO: 51), and do not contain the incorporated FSY and T cell engager sdAb C38 or C39 (SEQ ID NO: 53 or SEQ ID NO: 54) targeting CD3 epsilon (CD3ε), or do not contain C40 targeting T cell receptor α / β (TCRαβ) (SEQ ID NO: 55). The intact mass of all bispecific conjugates was confirmed by liquid chromatography - mass spectrometry (LC - MS) analysis, and by high performance liquid chromatography - size exclusion chromatography (HPLC - SEC), the preparation was determined to be 92.8 - 99.7% pure. The conjugates are summarized in Table 10 below.
[0250]
Table 10
[0251] Purified bispecific sdAb constructs were incubated at 37 °C for 0, 1, 5, or 10 minutes, or incubated without PSMA (-PSMA; control), at an approximate molar ratio of about 5:1, with PSMA (+PSMA) (Sino Biological; catalog number 15877 - H07H) in 1x PBS (pH 7.4). After incubation, the reaction was quenched with SDS - Laemmli loading dye (1x final concentration with 100 mM DTT), heated to 96 °C for 5 minutes, and analyzed by Coomassie blue staining by SDS - PAGE (4 - 20% Mini - PROTEAN® TGX™). As shown in FIGS. 14A - 14E, each bispecific variant was expressed and purified in an amount sufficient to evaluate cross - linking. All constructs containing FSY showed time - dependent cross - linking with PSMA. Bispecific variants containing TYR substitution instead of FSY did not cross - link with PSMA, so the ability to cross - link with PSMA was considered specific to FSY.
[0252] Binding to immobilized recombinant human PSMA was determined by BLI substantially as described in Example 6. All of the constructs tested had very similar binding sensorgrams (data not shown) and estimated affinities.
[0253] To evaluate the ability of C26 (having TYR) and C27 (having FSY) to crosslink with PSMA, as described above, C26 and C27 were incubated with PSMA at various concentrations. Samples of the incubated mixture were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. SDS-PAGE of the collected samples was performed and is shown in Figure 14A. Lanes A, B, and 1-12 are labeled as follows: A. Ladder; B. PSMA only; 1. C26 without PSMA, non-reduced (without DTT); 2. C26 with PSMA, reduced (with DTT); 3. C26 with PSMA at 0 minutes; 4. C26 with PSMA after 1 minute; 5. C26 with PSMA after 5 minutes; 6. C26 with PSMA after 10 minutes; 7. C27 without PSMA, non-reduced (without DTT); 7. C27 with PSMA, reduced (with DTT); 9. C27 with PSMA at 0 minutes; 10. C27 with PSMA after 1 minute; 11. C27 with PSMA after 5 minutes; 12. C27 with PSMA after 10 minutes. Different bands are marked with asterisks. * corresponds to the test substance crosslinked with PSMA, ** corresponds to PSMA, and *** corresponds to C26 or C27 which is the test substance.
[0254] To evaluate the ability of C28 (having TYR) to crosslink with PSMA, as described above, C28 was incubated with PSMA at various concentrations. Samples of the incubated mixture were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. SDS-PAGE of the collected samples was performed and shown in Figure 14B. Lanes A, B, and 1-6 are labeled as follows: A. PSMA only; B. Ladder; 1. Non-reduced C28 (without DTT) without PSMA; 2. Reduced (with DTT) C28 without PSMA; 3. C28 with PSMA at 0 minutes; 4. C28 with PSMA after 1 minute; 5. C28 with PSMA after 5 minutes; 6. C28 with PSMA after 10 minutes. Different bands are marked with asterisks. * corresponds to PSMA, and ** corresponds to the test substance C28.
[0255] To evaluate the ability of C29 (having TYR) and C30 (having FSY) to crosslink with PSMA, as described above, C29 and C30 were incubated with PSMA at various concentrations. Samples of the incubated mixture were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. SDS-PAGE of the collected samples was performed and shown in Figure 14C. Lanes A, B, C, and 1-12 are labeled as follows: A and B. Ladder; C. PSMA only; 1. Non-reduced C29 (without DTT) without PSMA; 2. Reduced (with DTT) C29 without PSMA; 3. C29 with PSMA at 0 minutes; 4. C29 with PSMA after 1 minute; 5. C29 with PSMA after 5 minutes; 6. C29 with PSMA after 10 minutes; 7. Non-reduced C30 (without DTT) without PSMA; 7. Reduced (with DTT) C30 without PSMA; 9. C30 with PSMA at 0 minutes; 10. C30 with PSMA after 1 minute; 11. C30 with PSMA after 5 minutes; 12. C30 with PSMA after 10 minutes. Different bands are marked with asterisks. * corresponds to the test substance crosslinked with PSMA, ** corresponds to PSMA, and *** corresponds to the test substance C29 or C30.
[0256] To evaluate the ability of the PSMA-T cell constructs to crosslink with PSMA, as described above, C31 (with TYR) and C32 (with FSY) were incubated with PSMA at various concentrations. Samples of the incubated mixtures were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. SDS-PAGE of the collected samples was performed and is shown in Figure 14D. Lanes A, B, C, and 1-12 are labeled as follows: A. PSMA only; B and C. ladder; 1. C31 without PSMA, non-reduced (without DTT); 2. C31 with PSMA, reduced (with DTT); 3. C31 with PSMA at 0 minutes; 4. C31 with PSMA after 1 minute; 5. C31 with PSMA after 5 minutes; 6. C31 with PSMA after 10 minutes; 7. C32 without PSMA, non-reduced (without DTT); 7. C32 with PSMA, reduced (with DTT); 9. C32 with PSMA at 0 minutes; 10. C32 with PSMA after 1 minute; 11. C32 with PSMA after 5 minutes; 12. C32 with PSMA after 10 minutes. Different bands are marked with asterisks. * corresponds to PSMA, and ** corresponds to the test article C31 or C32.
[0257] To evaluate the ability of the PSMA-T cell conjugate construct to crosslink with PSMA, as described above, C33 (having TYR) and C34 (having FSY) were incubated with PSMA at various concentrations. Samples of the incubated mixtures were taken at 0, 1, 5, and 10 minutes and quenched with SDS-Laemmli loading dye as described above. SDS-PAGE of the collected samples was performed and is shown in Figure 14E. Lanes A, B, C, and 1 - 12 are labeled as follows: A. Ladder; B. PSMA; C. Ladder; 1. C33 without PSMA, non-reduced (without DTT); 2. C33 reduced (with DTT) without PSMA; 3. C33 with PSMA at 0 minutes; 4. C33 with PSMA after 1 minute; 5. C33 with PSMA after 5 minutes; 6. C33 with PSMA after 10 minutes; 7. C34 without PSMA, non-reduced (without DTT); 7. C34 reduced (with DTT) without PSMA; 9. C34 with PSMA at 0 minutes; 10. C34 with PSMA after 1 minute; 11. C34 with PSMA after 5 minutes; 12. C34 with PSMA after 10 minutes. Different bands are marked with asterisks. * corresponds to the test substance crosslinked with PSMA, ** corresponds to PSMA, and *** corresponds to the test substance C33 or C34.
[0258] Example 10: ADCC Activity Induced by T Cell Bispecific Constructs The effect of covalent binding to target cells on the ability of the bivalent construct to promote T cell activity in the presence of target cells expressing different levels of PSMA was tested. PC3pip cells were determined substantially as described in Example 8, except that the cells and construct were incubated for 6 hours instead of 4 hours, and the construct described in Example 10 was used. An IgG1 isotype control antibody (BioXCell) was used as a negative control, and a bispecific antibody in the anti-PSMA - anti-CD3 IgG format (BPS Bioscience catalog number 101242 - 2) was used as a positive control.
[0259] As shown in Fig. 15, exposure of the T cell bispecific construct to PSMA-expressing PC3pip target cells for 6 hours resulted in a robust and dose-dependent induction of the luminescence signal. The isotype control antibody (black circles) did not induce any response. Generally, the FSY-modified T cell bispecific constructs (C27, CD3-PSMA bispecific, C30, and C34) showed higher potency compared to their TYR-containing counterparts. In some cases, compounds with FSY were characterized not only by having higher potency compared to non-covalent conjugates but also by having a higher maximal signal (Figs. 16A - C). As shown in Fig. 16A, the FSY-modified compound C27 showed a 12.7-fold higher ability (EC50 of 0.59 nM and 7.4 nM, respectively) than the TYR-containing analog C26. The covalent conjugate C27 was also 1.4-fold more potent and 1.2-fold more effective than the commercially available CD3-PSMA bispecific antibody used as a positive control. The covalent conjugate C30 showed an 11.8-fold higher potency (0.51 nM vs 5.98 nM EC50; Fig. 16B) than its non-covalent counterpart C29. C30 was similarly effective and 1.6-fold more potent (EC50 of 0.8 nM) than the commercially available CD3-PSMA bispecific antibody. The FSY-modified compound C34 was 21.9-fold more potent than its TYR-containing analog C33 (1.42 nM vs 31.09 nM EC50; Fig. 16C).
[0260] The three T cell bispecific constructs C28, C31, and C32 with TYR all effectively activated reporter cells with EC50 values of 14.76 nM, 5.33 nM, and 1.42 nM, respectively.
[0261] When tested in the presence of PSMA-negative PC-3 target cells, no substantial level of T cell activation was observed with the T cell bispecific construct, thus demonstrating the dependence of activation on PSMA expression (Figure 17). In comparison, the commercially available CD3-PSMA bispecific antibody showed activation of some T cells with about 50 to about 100 nM of the CD3-PSMA bispecific antibody, while the construct containing FSY did not appear to stimulate T cell activation.
[0262] Although embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Those skilled in the art will envision numerous variations, modifications, and substitutions without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the present disclosure described herein may be employed in practicing the present disclosure. The following claims define the scope of the present disclosure and are intended to cover methods and structures within these claims and their equivalents.
[0263] The disclosure of the present application is further illustrated by the following list of embodiments, which are for illustrative purposes only and are in no way intended to limit the present disclosure.
[0264] Embodiment 1: A conjugate comprising a first targeting domain configured to bind to a first target on a first cell and a second targeting domain configured to bind to a second target on a second cell, wherein the first targeting domain comprises at least one first unnatural amino acid (UAA), whereby the first targeting domain is capable of covalently binding to the first target at a site from the UAA to the first target.
[0265] Embodiment 2: The conjugate of Embodiment 1, wherein the second cell is an immune cell.
[0266] Embodiment 3: The conjugate of Embodiment 1 or Embodiment 2, wherein the first cell is a tumor cell.
[0267] Embodiment 4: The conjugate according to any one of Embodiments 1 to 3, wherein the first targeting domain comprises an antibody or an antigen-binding fragment thereof.
[0268] Embodiment 5: The conjugate of Embodiment 4, wherein the first targeting domain comprises a single-domain antibody (sdAb).
[0269] Embodiment 6: The conjugate according to any one of Embodiments 1 to 5, wherein the first UAA is contained within or near the region of the first targeting domain that makes interfacial contact with the first target.
[0270] Embodiment 7: The conjugate according to any one of Embodiments 1 to 6, wherein the second targeting domain comprises an antibody or an antigen-binding fragment thereof.
[0271] Embodiment 8: The conjugate of Embodiment 7, wherein the second targeting domain comprises a single-domain antibody (sdAb).
[0272] Embodiment 9: The conjugate according to any one of Embodiments 1 to 8, wherein the first targeting domain and the second targeting domain are linked as a fusion protein.
[0273] Embodiment 10: The conjugate according to any one of Embodiments 1 to 8, wherein the first targeting domain and the second targeting domain are linked by chemical conjugation.
[0274] Embodiment 11: The conjugate of Embodiment 9 or Embodiment 10, wherein the first targeting domain and the second domain are linked by a linker.
[0275] Embodiment 12: The conjugate of Embodiment 11, wherein the linker is a polypeptide linker.
[0276] Embodiment 13: The first target is the conjugate of any one of Embodiments 1 to 2, which is a first cell surface molecule.
[0277] Embodiment 14: The second target is the conjugate of any one of Embodiments 1 to 3, which is a second cell surface molecule.
[0278] Embodiment 15: At least one of the first UAAs is the conjugate of any one of Embodiments 1 to 14, which contains a fluorosulfate moiety.
[0279] Embodiment 16: At least one of the first UAAs is the conjugate of any one of Embodiments 1 to 15, which contains an aryl-fluorosulfate moiety.
[0280] Embodiment 17: At least one of the first UAAs is of Formula I
[0281]
Chemical formula
[0282] Embodiment 18: At least one of the first UAAs has the structure
[0283]
Chemical formula
[0284] Embodiment 19: At least one of the first UAAs has the structure
[0285]
Chemical formula
[0286] Embodiment 20: At least one of the first UAAs is of Formula II
[0287]
Chem.
[0288] Embodiment 21: At least one of said first UAAs has the structure
[0289]
Chem.
[0290] Embodiment 22: At least one of said first UAAs has the structure
[0291]
Chem.
[0292] Embodiment 23: At least one of said first UAAs comprises Formula III
[0293]
Chem.
[0294] Embodiment 24: At least one of said first UAAs has the structure
[0295]
Chem.
[0296] Embodiment 25: At least one of said first UAAs has the structure
[0297]
Chem.
[0298] Embodiment 26: At least one of said first UAAs has the formula (IA)
[0299]
Chemical formula
[0300] Embodiment 27: At least one of said first UAAs has the formula (IA-a)
[0301]
Chemical formula
[0302] Embodiment 28: At least one of said first UAAs has the formula (IA-b)
[0303] [Chemical formula] The conjugate of Embodiment 26 having the structure of
[0304] Embodiment 29: At least one of said first UAAs has the formula (IB)
[0305] [Chemical formula] The conjugate of Embodiment 26 having the structure of
[0306] Embodiment 30: At least one of said first UAAs has the formula (IC)
[0307] [Chemical formula] The conjugate of Embodiment 26 having the structure of
[0308] Embodiment 31: At least one of said first UAAs has the formula (ID)
[0309] [Chemical formula] having the structure of wherein X is independently O or NR' Y is a bond, -O-, -NR-, or -N= A is a bond or -(CH2) n - and m is 1 or 2 and n is an integer from 1 to 4 R and R', when present, are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl R 1 is hydrogen, fluoro, or iodo, and R 2is hydrogen or methyl, For the conjugate of Embodiment 26, when Y is a bond, -O-, or -NR-, m is 1; when Y is -N=, m is 2.
[0310] Embodiment 32: At least one of the first UAAs has the formula (IE)
[0311]
Chemical formula
[0312] Embodiment 33: At least one of the first UAAs has the formula (IIA)
[0313]
Chemical formula
[0314] Embodiment 34: At least one of said first UAAs has the formula (IIB)
[0315]
Chemical formula
[0316] Embodiment 35: At least one of said first UAAs
[0317]
Chemical formula
[0318] Embodiment 36: The first cell surface molecule is a conjugate of any one of Embodiments 13 to 35 selected from the group consisting of PSMA, EGFR, HER2, HER3, CD3, CD16, NKp46, PD-L1, EphA4, Fibronectin ED-B, CD45, EpCAM, CCR4, CD25, VEGF, VEGFR2, endo180, LIV-1, PTK7, CDH6, CSP-1, CD71, PRLR, SEZ6, DLL1, NOTCH3 rec, NaPi2b, DLK1, Muc16, LRP5, and LRP6.
[0319] Embodiment 37: The second cell surface molecule is a cell surface molecule present on an immune cell, a conjugate of any one of Embodiments 14 to 36.
[0320] Embodiment 38: The immune cell is a T cell, a conjugate of Embodiment 37.
[0321] Embodiment 39: The immune cell is an NK cell, a conjugate of Embodiment 37.
[0322] Embodiment 40: The immune cell is a gamma delta T cell, a conjugate of Embodiment 37.
[0323] Embodiment 41: The conjugate of Embodiment 37, wherein the second cell surface molecule is CD3, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, Vγ9Vδ2, or CD16.
[0324] Embodiment 42: The conjugate of any one of Embodiments 1 to 41, wherein the second domain contains a second UAA, whereby the second domain can covalently bind to the second target at the site of the second UAA.
[0325] Embodiment 43: The conjugate of any of Embodiment 42, wherein the second UAA is different from at least one UAA contained in the first targeting domain.
[0326] Embodiment 44: The conjugate of Embodiment 42, wherein the second UAA is the same as at least one UAA contained in the first targeting domain.
[0327] Embodiment 45: The conjugate of any one of Embodiments 42 to 44, wherein the second UAA contains a fluorosulfate moiety.
[0328] Embodiment 46: The conjugate of any one of Embodiments 42 to 44, wherein the second UAA contains an aryl-fluorosulfate moiety.
[0329] Embodiment 47: The conjugate of Embodiment 46, wherein the second UAA has the formula I
[0330]
Chemical formula
[0331] Embodiment 48: The conjugate of Embodiment 46, wherein the second UAA has the structure
[0332]
Chemical formula
[0333] Embodiment 49: The second UAA has a structure
[0334]
Chemical formula
[0335] Embodiment 50: The second UAA contains Formula II
[0336]
Chemical formula
[0337] Embodiment 51: The second UAA has a structure
[0338]
Chemical formula
[0339] Embodiment 52: The second UAA has a structure
[0340]
Chemical formula
[0341] Embodiment 53: The second UAA contains Formula III
[0342]
Chemical formula
[0343] Embodiment 54: The second UAA has a structure
[0344]
Chemical formula
[0345] Embodiment 55: The second UAA has the structure
[0346]
Chemical formula
[0347] Embodiment 56: The second UAA has the formula (IA)
[0348]
Chemical formula
[0349] Embodiment 57: The second UAA has the formula (IA-a)
[0350] [Chemical formula] The conjugate of Embodiment 56 having the structure of
[0351] Embodiment 58: The second UAA has the formula (IA-b)
[0352] [Chemical formula] The conjugate of Embodiment 56 having the structure of
[0353] Embodiment 59: The second UAA has the formula (IB)
[0354] [Chemical formula] The conjugate of Embodiment 56 having the structure of
[0355] Embodiment 60: The second UAA has the formula (IC)
[0356] [Chemical formula] The conjugate of Embodiment 56 having the structure of
[0357] Embodiment 61: The second UAA has the formula (ID)
[0358] [Chemical formula] having the structure of wherein X is independently O or NR' each Y is a bond, -O-, -NR-, or -N= A is a bond or -(CH2) n -, m is 1 or 2, and n is an integer from 1 to 4 R and R’, when present, are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl, R 1 is hydrogen, fluoro, or iodo, and R 2 is hydrogen or methyl, For the conjugate of embodiment 56, when Y is a bond, -O-, or -NR-, m is 1; when Y is -N=, m is 2.
[0359] Embodiment 62: The second UAA has the structure of formula (IE)
[0360]
Chemical formula
[0361] Embodiment 63: The second UAA has the structure of formula (IIA)
[0362]
Chemical formula
[0363] Embodiment 64: The second UAA has the formula (IIB)
[0364]
Chemical formula
[0365] Embodiment 65: The second UAA
[0366]
Chemical formula
[0367] Embodiment 66: The first cell surface molecule is a conjugate of any one of Embodiments 13 to 35 selected from the group consisting of PSMA, EGFR, HER2, HER3, CD3, CD16, NKp46, PD-L1, EphA4, Fibronectin ED-B, CD45, EpCAM, CCR4, CD25, VEGF, VEGFR2, endo180, LIV-1, PTK7, CDH6, CSP-1, CD71, PRLR, SEZ6, DLL1, NOTCH3 rec, NaPi2b, DLK1, Muc16, LRP5, and LRP6.
[0368] Embodiment 67: The second cell surface molecule is a conjugate of any one of Embodiments 14 to 36 that is a cell surface molecule present on an immune cell.
[0369] Embodiment 68: The immune cell contains a T cell or an NK cell, a conjugate of Embodiment 65.
[0370] Embodiment 69: The conjugate of Embodiment 65, wherein the immune cell is a gamma-delta T cell.
[0371] Embodiment 70: The conjugate of Embodiment 65, wherein the second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, or Vγ9Vδ2.
[0372] Embodiment 71: The conjugate of any one of Embodiments 1 to 65, wherein the first targeting domain comprises any one of SEQ ID NOs: 1 to 4, 16 to 18, 20, and 29.
[0373] Embodiment 72: The conjugate of any one of Embodiments 1 to 65, wherein the first targeting domain comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1 to 4, 16 to 18, 20, 29, 50, or 51.
[0374] Embodiment 73: The conjugate of any one of Embodiments 1 to 66, wherein the second targeting domain comprises SEQ ID NOs: 22, 25, or 52 to 55.
[0375] Embodiment 74: The conjugate of any one of Embodiments 1 to 66, wherein the second targeting domain comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 22, 25, or 52 to 55.
[0376] Embodiment 75: The conjugate of any one of Embodiments 1 to 65, wherein the conjugate comprises any one of SEQ ID NOs: 19, 23, 24, 26 to 28, 30, or 35 to 49.
[0377] Embodiment 76: The conjugate of any one of Embodiments 1 to 65, wherein the conjugate comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 19, 23, 24, 26 to 28, 30, or 35 to 49.
[0378] Embodiment 77: The conjugate is a conjugate according to any one of Embodiments 1 to 65, comprising a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1 to 3, 16, 18, 22, 25, or 50 to 55.
[0379] Embodiment 78: The conjugate is a conjugate according to any one of Embodiments 1 to 65, comprising a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 19, 21, 23, 24, 26 to 28, 30, or 35 to 49.
[0380] Embodiment 79: The first targeting domain is a conjugate according to any one of Embodiments 1 to 65, comprising SEQ ID NO: 1.
[0381] Embodiment 80: The UAA is present at an amino acid position selected from the group consisting of 26, 28, 29, 30, 99, 102, 103, 105, 108, 110, 111, 112, 113, 114, and 115 compared to SEQ ID NO: 1, in the conjugate of Embodiment 75.
[0382] Embodiment 81: The first targeting domain is a conjugate according to any one of Embodiments 1 to 65, comprising SEQ ID NO: 2.
[0383] Embodiment 82: The UAA is present at an amino acid position selected from the group consisting of 50, 52, 53, 54, 56, 58, and 100 compared to SEQ ID NO: 2, in the conjugate of Embodiment 77.
[0384] Embodiment 83: The first targeting domain is a conjugate according to any one of Embodiments 1 to 65, comprising SEQ ID NO: 3.
[0385] Embodiment 84: The UAA is present at an amino acid position selected from the group consisting of 58, 62, 101, 103, and 107 compared to SEQ ID NO: 3, in the engineered sdAb of Embodiment 79.
[0386] Embodiment 85: The first targeting domain is a conjugate of any one of Embodiments 1 to 65, including SEQ ID NO: 16.
[0387] Embodiment 86: The first targeting domain including SEQ ID NO: 16 is a conjugate of Embodiment 75, further including a non-natural amino acid at position 109 as compared with SEQ ID NO: 16.
[0388] Embodiment 87: The first targeting domain is a conjugate of any one of Embodiments 1 to 65, including SEQ ID NO: 18.
[0389] Embodiment 88: The second targeting domain is a conjugate of any one of Embodiments 1 to 83, including SEQ ID NO: 22.
[0390] Embodiment 89: The second targeting domain is a conjugate of any one of Embodiments 1 to 83, including SEQ ID NO: 25.
[0391] Embodiment 90: A method including the step of administering a conjugate of any one of Embodiments 1 to 85, wherein the conjugate covalently binds to the first target on the surface of the first cell.
[0392] Embodiment 91: A method including the step of administering a conjugate of any one of Embodiments 1 to 85, wherein the conjugate binds to the second target on the surface of the second cell.
[0393] Embodiment 92: A method including the step of administering a conjugate of any one of Embodiments 1 to 85, wherein the conjugate covalently binds to the first target on the surface of the first cell and the conjugate binds to the second target on the second cell.
[0394] Embodiment 93: The method of any one of Embodiments 86 to 89, wherein the second cell is a tumor cell.
[0395] Embodiment 94: The conjugate is the method of Embodiment 90 that kills tumor cells or inhibits their growth.
[0396] Embodiment 95: The first target is selected from the group consisting of PSMA, EGFR, HER2, HER3, PD-L1, EphA4, Fibronectin ED-B, CD45, EpCAM, CCR4, CD25, VEGF, VEGFR2, endo180, LIV-1, PTK7, CDH6, CSP-1, CD71, PRLR, SEZ6, DLL1, NOTCH3 rec, NaPi2b, SIRPa, DLK1, Muc16, LRP5, and LRP6, the method of Embodiment 90 or 91.
[0397] Embodiment 96: The immune cell is a T cell, the method of Embodiments 86-92.
[0398] Embodiment 97: The immune cell is a gamma-delta T cell, the method of Embodiments 86-93.
[0399] Embodiment 98: The immune cell is an NK cell or an NKT cell, the method of Embodiments 86-92.
[0400] Embodiment 99: The second cell surface molecule is CD3, CD16, CD16a, CD3ε, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, or Vγ9Vδ2, the method of Embodiments 86-95.
[0401] Embodiment 100: A method for treating a proliferative disease or proliferative disorder in a subject in need of treatment for the proliferative disease or proliferative disorder, comprising administering to the subject a therapeutically effective amount of any one of the conjugates of Embodiments 1-85.
[0402] Embodiment 101: The proliferative disease or proliferative disorder is cancer, the method of Embodiment 97.
[0403] Embodiment 102: The method of Embodiment 98, wherein the cancer is a solid tumor cancer selected from the group consisting of bladder cancer, bone cancer, brain cancer, breast cancer, colorectal cancer, esophageal cancer, eye cancer, head and neck cancer, kidney cancer, lung cancer, melanoma, ovarian cancer, pancreatic cancer, and prostate cancer.
[0404] Embodiment 103: A method for producing any one conjugate of Embodiments 1 to 85, the method comprising the step of synthesizing the first targeting domain in vivo, the first targeting domain containing at least one unnatural amino acid.
[0405] Embodiment 104: The method of Embodiment 104, further comprising the step of synthesizing a second domain in vivo.
[0406] Embodiment 105: The method of Embodiment 100 or 101, wherein the synthesizing step comprises the use of an orthogonal tRNA synthetase / suppressor tRNA pair.
[0407] Embodiment 106: The method of Embodiment 100, wherein the synthesizing step comprises an orthogonal tRNA synthetase / suppressor tRNA pair derived from pyrrolidine tRNA synthetase / tRNA Pyl to be included.
Claims
1. A conjugate comprising: a first targeting domain configured to bind to a first target on a first cell; and a second targeting domain configured to bind to a second target on a second cell, wherein the first targeting domain comprises at least one first unnatural amino acid (UAA), whereby the first targeting domain is capable of covalently binding to the first target at a site from the first UAA to the first target.
2. The conjugate according to claim 1, wherein the second cell is an immune cell.
3. The conjugate according to claim 1 or 2, wherein the first cell is a tumor cell.
4. The conjugate according to any one of claims 1 to 3, wherein the first targeting domain comprises an antibody or an antigen-binding fragment thereof.
5. The conjugate according to claim 4, wherein the first targeting domain comprises a single-domain antibody (sdAb).
6. The conjugate according to any one of claims 1 to 5, wherein the first UAA is included within or near a region of the first targeting domain that makes interfacial contact with the first target.
7. The conjugate according to any one of claims 1 to 6, wherein the second targeting domain comprises an antibody or an antigen-binding fragment thereof.
8. The conjugate according to claim 7, wherein the second targeting domain comprises a single-domain antibody (sdAb).
9. The conjugate according to any one of claims 1 to 8, wherein the first targeting domain and the second targeting domain are linked by chemical conjugation.
10. The conjugate according to claim 9, wherein the first targeting domain and the second domain are linked by a linker.
11. The conjugate according to claim 10, wherein the linker is a polypeptide linker.
12. The conjugate according to any one of claims 1 or 2, wherein the first target comprises a first cell surface molecule.
13. The conjugate according to any one of claims 1 to 3, wherein the second target is a second cell surface molecule.
14. The conjugate according to any one of claims 1 to 13, wherein at least one of the first UAAs comprises an aryl-fluorosulfate moiety.
15. At least one of said first UAAs has the formula I 【Chemical 1】 The conjugate according to claim 14, comprising
16. At least one of said first UAAs has the structure [Chemical Formula 2] The conjugate according to claim 14, having
17. At least one of said first UAAs has the formula II [Chemical 3] The conjugate according to claim 14, comprising
18. At least one of said first UAAs has the structure 【Chemical Formula 4】 The conjugate according to claim 14, having
19. At least one of said first UAAs has the formula III 【Chemical Formula 5】 The conjugate according to claim 14, comprising
20. At least one of said first UAAs has the structure [Chemical Formula 6] The conjugate according to claim 14, having
21. At least one of said first UAAs has the structure of formula (IA) 【Chemical Formula 7】 wherein In the formula, X is independently O or NR' respectively; Y is a bond, -O-, -NR-, or -N=; A is a bond or -(CH 2 ) n -, m is 1 or 2, n is an integer from 1 to 4, R and R', when present, are independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl respectively; R 1 is hydrogen, fluoro, or iodo, and R 2 is hydrogen or methyl, L is -(CH 2 ) p - or -C(O)NH-(CH 2 ) p -, p is an integer from 1 to 6, When Y is -O- or -NR-, m is 1; when Y is -N=, m is 2. The conjugate according to any one of claims 1 to 14.
22. At least one of said first UAAs has the structure of formula (IA-a) [Chemical 8] The conjugate according to claim 21, having
23. At least one of said first UAAs has the structure of formula (IB) 【Chemical Formula 9】 The conjugate according to claim 21, having
24. At least one of said first UAAs has the structure of formula (ID) 【Chemical Formula 10】 wherein In the formula, X is independently O or NR' respectively; Y is a bond, -O-, -NR-, or -N=; A is a bond or -(CH 2 ) n -, m is 1 or 2, n is an integer from 1 to 4, R and R', when present, are independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl respectively; R 1 is hydrogen, fluoro, or iodo, and R 2 is hydrogen or methyl, When Y is a bond, -O-, or -NR-, m is 1; when Y is -N=, m is 2. The conjugate according to claim 21.
25. At least one of said first UAAs has the structure of formula (IIA) 【Chemical 11】 wherein In the formula, X is independently O or NR', wherein when R' is present, it is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl, the conjugate according to claim 21.
26. At least one of said first UAAs has the structure of formula (IIB) 【Chemical 12】 and wherein X is independently O or NR', wherein when R' is present, it is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycloalkyl, the conjugate according to claim 21.
27. Said first target is 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, nectin4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT, the conjugate according to any one of claims 12-26.
28. The second cell surface molecule is a cell surface molecule present on immune cells, the conjugate according to any one of claims 13-27.
29. Said immune cells include T cells or NK cells, the conjugate according to claim 28.
30. Said second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, or Vγ9Vδ2, the conjugate according to claim 28.
31. The conjugate according to any one of claims 1 to 30, wherein the first targeting domain comprises any one of SEQ ID NOs: 1 to 4, 16 to 18, 20, 29, 50, or 51.
32. The conjugate according to any one of claims 1 to 31, wherein the first targeting domain comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1 to 4, 16 to 18, 20, 29, 50, or 51.
33. The conjugate according to any one of claims 1 to 31, wherein the second targeting domain comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 22, 25, or 52 to 55.
34. The conjugate according to any one of claims 1 to 31, wherein the conjugate comprises a sequence having at least 70% sequence identity to any one of SEQ ID NOs: 19, 21, 23, 24, 26 to 28, 30, 35 to 49, 57, or 64.
35. The conjugate according to any one of claims 1 to 34, wherein the first targeting domain comprises SEQ ID NO: 16 or 51.
36. The conjugate according to claim 35, wherein the first targeting domain comprising SEQ ID NO: 16 further comprises a non-natural amino acid at position 109 as compared to SEQ ID NO:
16.
37. The conjugate according to claim 35, wherein the first targeting domain comprising SEQ ID NO: 51 further comprises a non-natural amino acid at position 101 as compared to SEQ ID NO:
51.
38. A method comprising the step of administering the conjugate according to any one of claims 1 to 37, wherein the conjugate covalently binds to the first target on the surface of the first cell.
39. A method comprising the step of administering the conjugate according to any one of claims 1 to 37, wherein the conjugate binds to the second target on the surface of the second cell.
40. A method comprising the step of administering the conjugate according to any one of claims 1 to 37, wherein the conjugate covalently binds to the first target on the surface of the first cell and the conjugate binds to the second target on the second cell.
41. The method according to any one of claims 38 to 40, wherein the first cell is a tumor cell.
42. The method according to claim 41, wherein the first target comprises 5T4, B7-H3, B7-4, BCMA, CAIX, CD123, CD19, CD20, CD22, CD30, CD33, CD79b, CEA, DLL3, EGFR, EGFRviii, FAP, FcRH5, GPR20, GUCY2C (GCC), HER2, HER3, KAAG1, LIV-1, MICA, MSLN, Muc1, BCMA, C4.4a, CA6, CAIX, CanAg, CAXII, CCR2, CCR4, CCR7, CD103, CD123, CD13, CD138, CD142, ENPP3, EpCAM, EphA2, EphA3, EphA4, ETBR, FAP, FcRH5, FGFR2, FGFR3, FLT3, FolRa, GD2, GD3, MRC2, MSLN, MT1-MMP, MTX7, Muc1, Muc16, NaPi2b, nectin4, UCHT1, VCAM-1, VEGF, VEGFR2, VpreB, VPREB1, or xCT.
43. The method according to claim 40, wherein the second cell is an immune cell, and the immune cell is a T cell or an NK cell.
44. The method according to claim 40, wherein the second cell surface molecule is CD3, CD16, TCRαβ, NKp44, NKp46, NKp30, NKG2D, γδTCR, Vδ1, or Vγ9Vδ2.
45. A method for treating a proliferative disease or proliferative disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the conjugate according to any one of claims 1 to 37.
46. The method according to claim 45, wherein the proliferative disease or proliferative disorder is cancer.
47. A method for producing the conjugate according to any one of claims 1 to 37, the method comprising synthesizing in vivo the first targeting domain comprising at least one unnatural amino acid.
48. The method according to claim 47, further comprising synthesizing in vivo a second domain.
49. The method according to claim 47 or 48, wherein the synthesizing step comprises the use of an orthogonal tRNA synthetase / suppressor tRNA pair.
50. The synthesizing step is the method according to claim 49, comprising an orthogonal tRNA synthetase / suppressor tRNA pair derived from pyrrolidine tRNA synthetase / tRNA Pyl