Methods and compositions for genetically modifying cells

The use of orthogonal genome editing tools in cells addresses the challenges of multiplex genome editing by enhancing cell viability and efficiency, facilitating faster and more effective production of genetically modified cells for therapeutic use.

JP2025520367APending Publication Date: 2025-07-03INTELLIA THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024573146
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-16
Filing Date
2023-06-15
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Existing methods for multiplex genome editing in cells face challenges such as reduced cell viability, increased translocations, and decreased efficiency with multiple edits, particularly in clinical applications like adoptive cell therapy, due to the accumulation of toxicity and complexity in gene manipulation processes.

Method used

A method involving the simultaneous or sequential use of at least two orthogonal genome editing tools, such as base editors and RNA-guided nucleases, delivered via lipid nanoparticles, to efficiently introduce multiple edits in cells while maintaining viability and expansion, using orthogonal genome editors to minimize toxicity and improve efficiency.

Benefits of technology

The method enhances cell viability and expansion while maintaining high editing rates, reducing the time required for production and increasing yield, thereby improving the quality and safety of genetically modified cells for therapeutic applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025520367000452
    Figure 2025520367000452
  • Figure 2025520367000453
    Figure 2025520367000453
  • Figure 2025520367000454
    Figure 2025520367000454
Patent Text Reader

Abstract

Methods and compositions for genetically modifying cells are provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 353,008, filed on June 16, 2022, under 35 U.S.C. § 119(e), and the entire content thereof is incorporated herein by reference.

[0002] Sequence Listing This application includes a sequence listing that was electronically submitted in XML file format, and the entire content thereof is incorporated herein by reference. The XML file was created on June 13, 2023, named "01155 - 0060 - 00PCT_SL.xml", and has a size of 2,718,632 bytes.

[0003] Introduction and Summary The ability to introduce multiple gene edits into cells is important for gene editing and clinical therapeutic applications. For example, adoptive cell therapy approaches using genetically modified immune cells have become an attractive modality for treating various pathologies and diseases, including cancer, and for reconstituting cell lineages and immune system defenses. However, there are challenges in the clinical application of cell - based therapies, partly due to complex gene manipulation requirements. Whether multiple attributes can be introduced into a single cell depends on the ability to perform efficient editing at multiple target genes, such as knockouts and insertions at genetic loci, while maintaining cell viability and desired cell phenotypes.

[0004] CRISPR / Cas9 genome editing has been demonstrated to be extremely efficient. However, it has been reported that simultaneous editing at different genetic loci can lead to reduced cell viability, increased translocations that can compromise the quality and safety of cell products, and a decrease in gene editing efficiency with an increase in the number of edits. Existing cell manipulation techniques are limited in providing the required cell quality and yield using sequential editing processes because of the accumulation of toxicity to cells.

[0005] Therefore, there is a need for a safer and more efficient process for delivering multiple genome editing tools to cells, for example, in fewer steps or in a shorter time, and for performing multiplex gene editing.

[0006] The methods provided herein involve using at least two genome editing tools for multiplex genome editing applications, providing significant advantages over conventional methods.

[0007] In some embodiments, the methods provided herein generate cells with increased viability and expansion while maintaining a high editing rate, thereby shortening the time required for production and increasing the yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0008]

Figure 1A

Figure 1B

Figure 1C

Figure 2A

Figure 2B

Figure 2C

Figure 3A

Figure 3B

Figure 3C

Figure 4A

Figure 4B

Figure 4C

Figure 4D

Figure 4E

Figure 4F

Figure 4G

Figure 4H

Figure 5A

Figure 5B

Figure 5C

Figure 5D

Figure 5E

Figure 6A

Figure 6B

Figure 7A

Figure 7B

Figure 7C

Figure 8A

Figure 8B

Figure 9

Figure 10A

Figure 10B

Figure 11A

Figure 11B

Figure 11C

Figure 12A

Figure 12B

Figure 13A

Figure 13B

Figure 13C

Figure 14

Figure 15

Figure 16

Mode for Carrying Out the Invention

[0009]

Table 1-1

Table 1-2

Table 1-3

Table 1-4

Table 1-5

Table 1-6

Table 1-7

Table 1-8

Table 1-9

Table 1-10

Table 1-11

[0010] The present disclosure provides, for example, a method that serves as a platform for multiplex genome editing by contacting a cell with at least two genome editing tools. The method provides, for example, multiplex genome editing in a cell without causing significant side effects in the cell. The method also provides delivering multiple genome editing tools to a cell in fewer steps, enabling performing multiple edits in a shorter time.

[0011] In some embodiments, the platform relates to a manufacturing method for preparing cells in vitro for subsequent therapeutic administration to a subject. In some embodiments, the platform relates to multiplex genome editing by simultaneous or sequential administration of lipid nanoparticles (LNPs) comprising at least two genome editing tools. The platform targets any cell type, but is particularly advantageous in the preparation of cells that require multiple genome edits for sufficient therapeutic application, such as primary immune cells. The method may exhibit improved characteristics compared to conventional delivery techniques. For example, the method provides efficient delivery of nucleic acids such as at least two genome editing tools while increasing cell viability and expansion. As provided herein, the platform method applies to “cells” or “cell populations” (or “populations of cells”). When referring herein to a delivery or gene editing method for “cells,” it is understood that the method can be used for delivery or gene editing of a “population of cells.”

[0012] In some embodiments, methods for genetically modifying cells are provided herein, the methods comprising: (a) contacting the cells with a first genome editing tool, the first genome editing tool comprising a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is cognate to the first genome editor; and (b) contacting the cells with a second genome editing tool, the second genome editing tool comprising a second genome editor and at least one gRNA that targets at least one genomic locus and is cognate to the second genome editor, the first genome editor being orthogonal to the second genome editor, thereby effecting at least two genome edits in the cells.

[0013] In some embodiments, methods for genetically modifying cells are provided herein, the methods comprising: (a) contacting the cells with a first genome editing tool, the first genome editing tool comprising a first genome editor that is a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is cognate to the base editor; and (b) contacting the cells with a second genome editing tool, the second genome editing tool comprising a second genome editor that is an RNA-guided nuclease and at least one gRNA that targets at least one genomic locus and is cognate to the RNA-guided nuclease, the base editor being orthogonal to the RNA-guided nuclease, thereby effecting at least two genome edits in the cells.

[0014] In some embodiments, provided herein is a method of generating a population of cells comprising edited cells, the method comprising: (a) contacting the cells with a first genome editing tool, wherein the first genome editing tool comprises a first genome editor comprising a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the base editor; (b) contacting the cells with a second genome editing tool, wherein the second genome editing tool comprises a second genome editor comprising an RNA-guided nuclease and at least one gRNA targeting at least one genomic locus and corresponding to the RNA-guided nuclease, and the base editor is orthogonal to the RNA-guided nuclease; and (c) culturing the cells to thereby generate a population of cells comprising edited cells, wherein each cell comprises at least two genome edits.

[0015] In some embodiments, provided herein is a composition comprising: (a) a first genome editing tool comprising a first genome editor and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the first genome editor; and (b) a second genome editing tool comprising a second genome editor and at least one gRNA targeting at least one genomic locus and corresponding to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor.

[0016] In some embodiments, a composition is provided herein, the composition comprising: (a) a first genome editing tool, the first genome editor comprising a base editor, and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the base editor; and (b) a second genome editing tool, the second genome editor comprising an RNA-guided nuclease, and at least one gRNA targeting at least one genomic locus and corresponding to the RNA-guided nuclease, wherein the base editor is orthogonal to the RNA-guided nuclease.

[0017] In some embodiments, cells processed in vitro by any method or composition disclosed herein are provided herein. In some embodiments, cells processed in vivo by any method or composition disclosed herein are provided herein. In some embodiments, a population of cells comprising any cell disclosed herein is provided herein.

[0018] In some embodiments, the use of any cell, cell population, or composition disclosed herein for treating cancer is provided herein. In some embodiments, the use of any cell, cell population, or composition disclosed herein for the preparation of a medicament for treating cancer is provided herein.

[0019] In some embodiments, engineered cells are provided herein, comprising at least three base edits at at least three genomic loci and at least one foreign gene.

[0020] In some embodiments, a composition is provided herein, the composition comprising a gRNA comprising a guide sequence selected from: a.i) SEQ ID NOs: 251-264, ii) at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 251-264, iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 251-264, iv) a sequence comprising 10 consecutive nucleotides at genomic coordinates ±10 nucleotides listed in Table 5, v) at least 17, 18, 19, or 20 consecutive nucleotides of the sequence of (iv), or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); or b. a nucleic acid encoding the gRNA of (a).

[0021] In some embodiments, a method of modifying a DNA sequence within the AAVS1 gene is provided herein, the method comprising delivering to a cell: a. a gRNA comprising a guide sequence selected from: i) SEQ ID NOs: 251-264, ii) at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 251-264, iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 251-264, iv) a sequence comprising 10 consecutive nucleotides at genomic coordinates ±10 nucleotides listed in Table 5, v) at least 17, 18, 19, or 20 consecutive nucleotides of the sequence of (iv), or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); or b. a nucleic acid encoding the gRNA of (a).

[0022] In some embodiments, provided herein is a method of immunotherapy, the method comprising administering to a subject a composition comprising engineered cells, the cells comprising a genomic modification in the AAVS1 gene, the genetic modification comprising an insertion within genomic coordinates selected from chr19:55115695-55115715, chr19:55115588-55115608, chr19:55115616-55115636, chr19:55115623-55115643, chr19:55115637-55115657, chr19:55115691-55115711, chr19:55115755-55115775, chr19:55115823-55115843, chr19:55115834-55115854, chr19:55115835-55115855, chr19:55115836-55115856, chr19:55115850-55115870, chr19:55115951-55115971, and chr19:55115949-55115969; or the cells are engineered by delivering to the cells a gRNA comprising a guide sequence selected from a.i) SEQ ID NOs: 251-264, ii) at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 251-264, iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 251-264, iv) a sequence comprising 10 consecutive nucleotides at genomic coordinates ±10 nucleotides of those listed in Table 5, v) at least 17, 18, 19, or 20 consecutive nucleotides of the sequence of (iv), or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v), or b. a nucleic acid encoding the gRNA of (a).

[0023] In some embodiments, engineered cells are provided herein that contain a genetic modification in the AAVS1 gene, wherein the genetic modification comprises an insertion within genomic coordinates selected from chr19:55115695 - 55115715, chr19:55115588 - 55115608, chr19:55115616 - 55115636, chr19:55115623 - 55115643, chr19:55115637 - 55115657, chr19:55115691 - 55115711, chr19:55115755 - 55115775, chr19:55115823 - 55115843, chr19:55115834 - 55115854, chr19:55115835 - 55115855, chr19:55115836 - 55115856, chr19:55115850 - 55115870, chr19:55115951 - 55115971, and chr19:55115949 - 55115969.

[0024] The following numbered embodiments are provided herein.

[0025] Embodiment 1 is a method of genetically modifying a cell, comprising: (a) contacting the cell with a first genome editing tool, wherein the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the first genome editor; (b) contacting the cell with a second genome editing tool, wherein the second genome editing tool comprises a second genome editor and at least one gRNA that targets at least one genomic locus and corresponds to the second genome editor, and wherein the first genome editor is orthogonal to the second genome editor; thereby effecting at least two genome edits in the cell.

[0026] Embodiment 2 is the method according to Embodiment 1, wherein the first genome editor or the second genome editor is delivered to the cell as at least one polypeptide or at least one polynucleotide encoding the polypeptide.

[0027] Embodiment 3 is the method according to Embodiment 2, wherein the at least one polynucleotide is at least one mRNA.

[0028] Embodiment 4 is the method according to any one of Embodiments 1 to 3, wherein the at least one gRNA is delivered to the cell as at least one polynucleotide encoding the gRNA.

[0029] Embodiment 5 is the method according to any one of Embodiments 1 to 4, wherein the first genome editor includes a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein including a DNA polymerase and a nickase.

[0030] Embodiment 6 is the method according to any one of Embodiments 1 to 5, wherein the second genome editor includes a cleavase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein including a DNA polymerase and a nickase.

[0031] Embodiment 7 is the method according to any one of Embodiments 1 to 6, wherein one of the first genome editor and the second genome editor includes a base editor, optionally a C-to-T base editor or an A-to-G base editor, and the other of the first genome editor and the second genome editor includes a cleavase.

[0032] Embodiment 8 is the method according to Embodiment 7, further comprising contacting the cell with a nucleic acid encoding a foreign gene.

[0033] Embodiment 9 is the method according to any one of Embodiments 1 to 6, wherein one of the first genome editor and the second genome editor includes a C-to-T base editor, and the other of the first genome editor and the second genome editor includes an A-to-G base editor.

[0034] Embodiment 10 is the method according to any one of Embodiments 1 to 9, wherein one of the first genome editor and the second genome editor includes an N. meningitidis (Nme) RNA-guided nickase or nuclease, and the other of the first genome editor and the second genome editor includes an S. pyogenes (Spy) RNA-guided nickase or nuclease.

[0035] Embodiment 11 is the method according to any one of Embodiments 1 to 10, wherein the first genome editor or the second genome editor includes a Cas nuclease.

[0036] Embodiment 12 is the method according to Embodiment 11, wherein the Cas nuclease is a class 2 Cas nuclease.

[0037] Embodiment 13 is the method according to Embodiment 11, wherein the Cas nuclease is Cas9.

[0038] Embodiment 14 is the method according to Embodiment 13, wherein the Cas9 is S.pyogenes Cas9 (SpyCas9), S.aureus Cas9 (SauCas9), C.diphtheriae Cas9 (CdiCas9), Streptococcus thermophilus Cas9 (St1Cas9), A.cellulolyticus Cas9 (AceCas9), C.jejuni Cas9 (CjeCas9), R.palustris Cas9 (RpaCas9), R.rubrum Cas9 (RruCas9), A.naeslundii Cas9 (AnaCas9), Francisella novicida Cas9 (FnoCas9), or N.meningitidis (NmeCas9).

[0039] Embodiment 15 is the method according to Embodiment 13 or 14, wherein the Cas9 is Nme1Cas9, Nme2Cas9, Nme3Cas9, or SpyCas9.

[0040] Embodiment 16 is a method for genetically modifying a cell, (a) contacting the cell with a first genome editing tool, wherein the first genome editing tool comprises a first genome editor comprising a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the base editor, said contacting; (b) contacting the cell with a second genome editing tool, wherein the second genome editing tool comprises a second genome editor comprising an RNA-guided nuclease and at least one gRNA targeting at least one genomic locus and corresponding to the RNA-guided nuclease, and the base editor is orthogonal to the RNA-guided nuclease, said contacting, thereby resulting in at least two genome edits in the cell, said method.

[0041] Embodiment 17 is a method for producing a population of cells comprising edited cells, (a) contacting the cells with a first genome editing tool, wherein the first genome editing tool comprises a first genome editor comprising a base editor, and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the base editor, said contacting; (b) contacting the cells with a second genome editing tool, wherein the second genome editing tool comprises a second genome editor comprising an RNA-guided nuclease, and at least one gRNA targeting at least one genomic locus and corresponding to the RNA-guided nuclease, and the base editor is orthogonal to the RNA-guided nuclease, said contacting; (c) culturing the cells, thereby producing the population of cells comprising edited cells comprising at least two genome edits per cell.

[0042] Embodiment 18 is the method according to Embodiment 16 or 17, wherein the base editor is an optionally cytidine deaminase-containing C-to-T base editor or an optionally adenosine deaminase-containing A-to-G base editor.

[0043] Embodiment 19 is the method according to any one of Embodiments 1 to 18, wherein one of the at least two genome edits comprises a double-strand break and another one of the at least two genome edits comprises a translocation (e.g., A-to-G or C-to-T).

[0044] Embodiment 20 is the method according to any one of Embodiments 1 to 19, wherein the first genome editing tool or the second genome editing tool is delivered to the cells by electroporation.

[0045] Embodiment 21 is the method according to any one of Embodiments 1 to 20, wherein the first genome editing tool or the second genome editing tool is delivered to the cell by at least one lipid nanoparticle (LNP).

[0046] Embodiment 22 is the method according to any one of Embodiments 1 to 21, wherein the first genome editing tool or the second genome editing tool is carried on at least one vector and delivered to the cell.

[0047] Embodiment 23 is the method according to any one of Embodiments 1 to 22, wherein the first genome editing tool or the second genome editing tool is delivered as at least one nucleic acid encoding the first genome editing tool or the second genome editing tool.

[0048] Embodiment 24 is the method according to Embodiment 23, wherein the at least one nucleic acid comprises at least one mRNA.

[0049] Embodiment 25 is the method according to any one of Embodiments 1 to 24, wherein steps (a) and (b) are performed simultaneously.

[0050] Embodiment 26 is the method according to any one of Embodiments 1 to 25, wherein steps (a) and (b) are performed in any order over a time period of about 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or 24 hours.

[0051] Embodiment 27 is the method according to any one of Embodiments 1 to 26, wherein each of step (a) and step (b) is independently performed over a time period of about 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or 24 hours.

[0052] Embodiment 28 is the method according to any one of Embodiments 16 to 27, wherein the first genome editing tool includes a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are included in a single polypeptide.

[0053] Embodiment 29 is the method according to any one of Embodiments 16 to 27, wherein the first genome editing tool includes a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are included in different polypeptides.

[0054] Embodiment 30 is the method according to Embodiment 28 or 29, wherein the base editor includes a cytidine deaminase and an RNA-guided nickase.

[0055] Embodiment 31 is the method according to Embodiment 30, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are included in a single polypeptide.

[0056] Embodiment 32 is the method according to Embodiment 30, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are included in different polypeptides.

[0057] Embodiment 33 is the method according to Embodiment 30, wherein the cytidine deaminase and the RNA-guided nickase are included in a single polypeptide, and the UGI is included in a different polypeptide.

[0058] Embodiment 34 is the method according to any one of Embodiments 1 to 33, wherein the first genome editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3, 146, or 311.

[0059] Embodiment 35 is the method according to any one of Embodiments 1 to 34, wherein the first genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1, and the second genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 180 to 190.

[0060] Embodiment 36 is the method according to any one of Embodiments 1 to 35, wherein the first genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 147 or 310, and the second genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 293 or 295.

[0061] Embodiment 37 is the method according to any one of Embodiments 1 to 33, wherein the first genome editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 9, 12, 18, and 21.

[0062] Embodiment 38 is the method according to any one of Embodiments 1 to 37, wherein the first genome editor or the base editor contains cytidine deaminase, and the cytidine deaminase contains an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 22.

[0063] Embodiment 39 is the method according to Embodiment 38, wherein the cytidine deaminase contains APOBEC3A deaminase (A3A).

[0064] Embodiment 40 is the method according to Embodiment 39, wherein the A3A contains the amino acid sequence of SEQ ID NO: 22 or an amino acid sequence that is at least 87%, 90%, 95%, 98%, or 99% identical to SEQ ID NO: 22.

[0065] Embodiment 41 is the method according to Embodiment 39 or 40, wherein the A3A is human A3A.

[0066] Embodiment 42 is the method according to any one of Embodiments 39 to 41, wherein the A3A is wild-type A3A.

[0067] Embodiment 43 is the method according to any one of Embodiments 1 to 42, wherein the first genome editor or the base editor contains Cas9 nickase.

[0068] Embodiment 44 is the method according to any one of Embodiments 1 to 43, wherein the first genome editor or the base editor contains N. meningitidis (Nme) Cas9 nickase.

[0069] Embodiment 45 is the method according to any one of Embodiments 1 to 44, wherein the first genome editor or the base editor includes D16A NmeCas9 nickase, and optionally D16A Nme2Cas9, and is the method.

[0070] Embodiment 46 is the method according to any one of Embodiments 1 to 45, wherein the first genome editor or the base editor includes the amino acid sequence of SEQ ID NO: 149, and is the method.

[0071] Embodiment 47 is the method according to any one of Embodiments 1 to 46, wherein the first genome editor or the base editor includes a sequence that is at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 146, and is the method.

[0072] Embodiment 48 is the method according to any one of Embodiments 1 to 47, wherein the second genome editor or the RNA-guided nuclease includes Cas9 nuclease, and is the method.

[0073] Embodiment 49 is the method according to any one of Embodiments 1 to 48, wherein the second genome editor or the RNA-guided nuclease includes S. pyogenes (Spy) Cas9 nuclease, and is the method.

[0074] Embodiment 50 is the method according to any one of Embodiments 1 to 49, wherein the second genome editor or the RNA-guided nuclease includes an amino acid sequence that is at least 90% identical to SEQ ID NO: 156, and is the method.

[0075] Embodiment 51 is the method according to any one of Embodiments 1 to 50, wherein the second genome editor or the RNA-guided nuclease includes the amino acid sequence of SEQ ID NO: 156, and is the method.

[0076] Embodiment 52 is the method according to any one of Embodiments 1 to 43, wherein the first genome editor or the base editor includes S.pyogenes (Spy) Cas9 nickase, and the method is as described above.

[0077] Embodiment 53 is the method according to any one of Embodiments 1 to 43 and 52, wherein the first genome editor or the base editor includes D10A SpyCas9 nickase, and the method is as described above.

[0078] Embodiment 54 is the method according to any one of Embodiments 1 to 43, 52, and 53, wherein the first genome editor or the base editor includes the amino acid sequence of any one of SEQ ID NOs: 41, 43, and 45, or an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity with any one of SEQ ID NOs: 41, 43, and 45, and the method is as described above.

[0079] Embodiment 55 is the method according to any one of Embodiments 1 to 43 and 52 to 54, wherein the first genome editor or the base editor is delivered to the cell as a nucleic acid including the nucleotide sequence of any one of SEQ ID NOs: 42, 44, and 46, or a nucleotide sequence having at least 80%, 90%, 95%, 98%, or 99% identity with any one of SEQ ID NOs: 42, 44, and 46, and the method is as described above.

[0080] Embodiment 56 is the method according to any one of Embodiments 1 to 43 and 52 to 54, wherein the first genome editor or the base editor is delivered to the cell as a nucleic acid including the nucleotide sequence of any one of SEQ ID NOs: 42, 44, and 46 to 58, and the method is as described above.

[0081] Embodiment 57 is the method according to any one of Embodiments 1 to 43 and 52 to 54, wherein the first genome editor or the base editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1.

[0082] Embodiment 58 is the method according to any one of Embodiments 1 to 43 and 52 to 54, wherein the first genome editor or the base editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 4.

[0083] Embodiment 59 is the method according to any one of Embodiments 1 to 43 and 52 to 56, wherein the first genome editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 148.

[0084] Embodiment 60 is the method according to any one of Embodiments 1 to 43 and 52 to 59, wherein the second genome editor or the RNA-guided nuclease comprises N. meningitidis (Nme) Cas9 nuclease.

[0085] Embodiment 61 is the method according to any one of Embodiments 1 to 43 and 52 to 60, wherein the second genome editor or the RNA-guided nuclease comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 157 to 167, 191, 198, 205, 212, and 219.

[0086] Embodiment 62 is the method according to any one of Embodiments 1 to 43 and 52 to 61, wherein the second genome editor or the RNA-guided nuclease contains any one of the amino acid sequences of SEQ ID NOs: 157 to 167, 191, 198, 205, 212, and 219, and is the said method.

[0087] Embodiment 63 is the method according to any one of Embodiments 1 to 43 and 52 to 61, wherein the second genome editor or the RNA-guided nuclease is delivered to the cell as a nucleic acid containing a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 168 to 190, 192 to 197, 199 to 204, 206 to 211, 213 to 218, and 220 to 225, and is the said method.

[0088] Embodiment 64 is the method according to any one of Embodiments 1 to 43 and 52 to 61, wherein the second genome editor or the RNA-guided nuclease is delivered to the cell as a nucleic acid containing any one of the nucleotide sequences of SEQ ID NOs: 168 to 190, 192 to 197, 199 to 204, 206 to 211, 213 to 218, and 220 to 225, and is the said method.

[0089] Embodiment 65 is the method according to any one of Embodiments 1 to 64, wherein at least one gRNA corresponding to the first genome editor or the base editor does not correspond to the second genome editor or the RNA-guided nuclease, and is the said method.

[0090] Embodiment 66 is the method according to any one of Embodiments 1 to 65, wherein at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease does not correspond to the first genome editor or the base editor, and is the said method.

[0091] Embodiment 67 is the method according to any one of Embodiments 1 to 66, wherein the at least one gRNA comprises at least one single guide RNA (sgRNA).

[0092] Embodiment 68 is the method according to Embodiment 67, wherein the at least one sgRNA comprises a short single guide RNA (short-sgRNA) comprising a conserved portion of an sgRNA containing a hairpin region, the hairpin region lacking at least 5 to 10 nucleotides, and the short-sgRNA comprising a 5'-end modification or a 3'-end modification, or both.

[0093] Embodiment 69 is the method according to any one of Embodiments 1 to 68, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least two gRNAs targeting at least two different genomic loci.

[0094] Embodiment 70 is the method according to any one of Embodiments 1 to 69, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease comprises at least two gRNAs targeting at least two different genomic loci.

[0095] Embodiment 71 is the method according to any one of Embodiments 1 to 70, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least three gRNAs targeting at least three different genomic loci.

[0096] Embodiment 72 is the method according to any one of Embodiments 1 to 71, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease comprises at least three gRNAs targeting at least three different genomic loci.

[0097] Embodiment 73 is the method according to any one of Embodiments 1 to 72, wherein the at least one gRNA corresponding to the first genome editor or the base editor includes at least four gRNAs targeting at least four different genomic loci.

[0098] Embodiment 74 is the method according to any one of Embodiments 1 to 73, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes at least four gRNAs targeting at least four different genomic loci.

[0099] Embodiment 75 is the method according to any one of Embodiments 1 to 74, wherein the at least one gRNA corresponding to the first genome editor or the base editor includes at least five gRNAs targeting at least five different genomic loci.

[0100] Embodiment 76 is the method according to any one of Embodiments 1 to 75, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes at least five gRNAs targeting at least five different genomic loci.

[0101] Embodiment 77 is the method according to any one of Embodiments 1 to 76, wherein the at least one gRNA corresponding to the first genome editor or the base editor includes at least six gRNAs targeting at least six different genomic loci.

[0102] Embodiment 78 is the method according to any one of Embodiments 1 to 77, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes at least six gRNAs targeting at least six different genomic loci.

[0103] Embodiment 79 is the method according to any one of Embodiments 1 to 78, wherein the at least one gRNA corresponding to the first genome editor or the base editor targets one or more genomic loci selected from the TRBC locus, HLA-A locus, HLA-B locus, CIITA locus, HLA-DR locus, HLA-DQ locus, and HLA-DP locus.

[0104] Embodiment 80 is the method according to any one of Embodiments 1 to 79, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease targets one or more genomic loci selected from the TRAC locus, AAVS1 locus, and CIITA locus.

[0105] Embodiment 81 is the method according to any one of Embodiments 1 to 80, (i) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus and a gRNA targeting the CIITA locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the TRAC locus, or (ii) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus? (iii) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus? (iv) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus? (v) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus? (vi) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus, or (vii) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus, or (viii) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus, or (ix) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRAC locus, a gRNA targeting the TRBC locus, a gRNA targeting the CIITA locus, and a gRNA targeting the HLA-A locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus, or (x) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the AAVS1 locus, or (xi) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the AAVS1 locus, or (xii) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the AAVS1 locus, or (xiii) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the AAVS1 locus, and the method is as described above.

[0106] Embodiment 82 is the method according to any one of Embodiments 1 to 81, further comprising contacting the cell with a nucleic acid encoding a foreign gene for insertion into the TRAC or AAVS1 locus, said method.

[0107] Embodiment 83 is the method according to Embodiment 82, wherein in any one of sub-parts (i) to (ix), said at least one gRNA corresponding to said second genome editor or said RNA-guided nuclease comprises a further gRNA targeting the AAVS1 locus, said method.

[0108] Embodiment 84 is the method according to Embodiment 82, wherein in any one of sub-parts (x) to (xiii), said at least one gRNA corresponding to said second genome editor or said RNA-guided nuclease comprises a further gRNA targeting the TRAC locus, said method.

[0109] Embodiment 85 is the method according to Embodiment 84, wherein after contacting said cell with said gRNA targeting the TRAC locus, said cell is contacted with a further gRNA targeting the AAVS1 locus, said method.

[0110] Embodiment 86 is the method according to Embodiment 85, wherein after contacting said cell with said gRNA targeting the AAVS1 locus, said cell is contacted with a further gRNA targeting the TRAC locus, said method.

[0111] Embodiment 87 is a composition, (a) a first genome editing tool, comprising a first genome editor and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to said first genome editor, said first genome editing tool; (b) A second genome editing tool, comprising a second genome editor and at least one gRNA targeting at least one genomic locus and corresponding to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor, and the composition comprising the second genome editing tool.

[0112] Embodiment 88 is the composition according to Embodiment 87, wherein the first genome editor or the second genome editor comprises at least one polypeptide or at least one mRNA.

[0113] Embodiment 89 is the composition according to Embodiment 87 or 88, wherein the at least one gRNA comprises at least one polynucleotide encoding the gRNA.

[0114] Embodiment 90 is the composition according to any one of Embodiments 87 to 89, wherein the first genome editor comprises a nickase, a nuclease, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

[0115] Embodiment 91 is the composition according to any one of Embodiments 87 to 90, wherein the second genome editor comprises a nickase, a nuclease, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

[0116] Embodiment 92 is the composition according to any one of Embodiments 87 to 91, wherein one of the first genome editor and the second genome editor is a base editor, optionally including a C-to-T base editor or an A-to-G base editor, and the other of the first genome editor and the second genome editor is a composition including a cleavase.

[0117] Embodiment 93 is the composition according to Embodiment 92, further including a nucleic acid encoding a foreign gene.

[0118] Embodiment 94 is the composition according to any one of Embodiments 87 to 91, wherein one of the first genome editor and the second genome editor includes a C-to-T base editor, and the other of the first genome editor and the second genome editor includes an A-to-G base editor.

[0119] Embodiment 95 is the composition according to any one of Embodiments 87 to 94, wherein one of the first genome editor and the second genome editor includes an N. meningitidis (Nme) RNA-guided nickase, and the other of the first genome editor and the second genome editor includes an S. pyogenes (Spy) RNA-guided nickase.

[0120] Embodiment 96 is the composition according to any one of Embodiments 87 to 95, wherein the first genome editor or the second genome editor is a Cas nuclease.

[0121] Embodiment 97 is the composition according to Embodiment 96, wherein the Cas nuclease is a Class 2 Cas nuclease.

[0122] Embodiment 98 is the composition according to Embodiment 96, wherein the Cas nuclease is Cas9.

[0123] Embodiment 99 is the composition described in Embodiment 98, wherein the Cas9 is S.pyogenes Cas9 (SpyCas9), S.aureus Cas9 (SauCas9), C.diphtheriae Cas9 (CdiCas9), Streptococcus thermophilus Cas9 (St1Cas9), A.cellulolyticus Cas9 (AceCas9), C.jejuni Cas9 (CjeCas9), R.palustris Cas9 (RpaCas9), R.rubrum Cas9 (RruCas9), A.naeslundii Cas9 (AnaCas9), Francisella novicida Cas9 (FnoCas9), or N.meningitidis (NmeCas9), and the composition is the composition.

[0124] Embodiment 100 is the composition described in Embodiment 98 or 99, wherein the Cas9 is Nme1Cas9, Nme2Cas9, Nme3Cas9, or SpyCas9, and the composition is the composition.

[0125] Embodiment 101 is a composition, (a) a first genome editing tool, the first genome editor including a base editor, and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the base editor, the first genome editing tool; (b) a second genome editing tool, the second genome editor including an RNA-guided nuclease, and at least one gRNA targeting at least one genomic locus and corresponding to the RNA-guided nuclease, the base editor being orthogonal to the RNA-guided nuclease, the second genome editing tool, and the composition is the composition.

[0126] Embodiment 102 is the composition according to Embodiment 101, wherein the base editor is a C-to-T base editor optionally containing cytidine deaminase, or an A-to-G base editor optionally containing adenosine deaminase.

[0127] Embodiment 103 is the composition according to any one of Embodiments 87 to 102, wherein the first genome editing tool or the second genome editing tool is delivered to cells by electroporation.

[0128] Embodiment 104 is the composition according to any one of Embodiments 87 to 103, wherein the first genome editing tool or the second genome editing tool is contained in at least one lipid nanoparticle (LNP).

[0129] Embodiment 105 is the composition according to any one of Embodiments 87 to 104, wherein the first genome editing tool or the second genome editing tool comprises at least one vector.

[0130] Embodiment 106 is the composition according to any one of Embodiments 87 to 105, wherein the first genome editing tool or the second genome editing tool comprises at least one polypeptide, or at least one nucleic acid encoding the first genome editing tool or the second genome editing tool.

[0131] Embodiment 107 is the composition according to any one of Embodiments 87 to 106, wherein the first genome editing tool comprises at least one polypeptide containing the first genome editing tool, or at least one nucleic acid encoding the first genome editing tool.

[0132] Embodiment 108 is the composition according to any one of Embodiments 87 to 107, wherein the second genome editing tool comprises at least one polypeptide containing the second genome editing tool, or at least one nucleic acid encoding the second genome editing tool.

[0133] Embodiment 109 is the composition according to any one of Embodiments 106 to 108, wherein the at least one nucleic acid comprises at least one mRNA.

[0134] Embodiment 110 is the composition according to any one of Embodiments 101 to 109, wherein the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are contained in a single polypeptide.

[0135] Embodiment 111 is the composition according to any one of Embodiments 101 to 109, wherein the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are contained in different polypeptides.

[0136] Embodiment 112 is the composition according to Embodiment 110 or 111, wherein the base editor comprises cytidine deaminase and an RNA-guided nickase.

[0137] Embodiment 113 is the composition according to Embodiment 112, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in a single polypeptide.

[0138] Embodiment 114 is the composition according to Embodiment 112, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in different polypeptides.

[0139] Embodiment 115 is the composition according to Embodiment 112, wherein the cytidine deaminase and the RNA-guided nickase are contained in a single polypeptide, and the UGI is contained in a different polypeptide.

[0140] Embodiment 116 is the composition according to any one of Embodiments 87 to 115, wherein the first genome editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3, 146, or 311.

[0141] Embodiment 117 is the composition according to any one of Embodiments 87 to 116, wherein the first genome editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1, and the second genome editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 180 to 190.

[0142] Embodiment 118 is the composition according to any one of Embodiments 87 to 117, wherein the first genome editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 147 or 310, and the second genome editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 293 or 295.

[0143] Embodiment 119 is the composition according to any one of Embodiments 87 to 115, wherein the first genome editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 9, 12, 18, and 21.

[0144] Embodiment 120 is the composition according to any one of Embodiments 87 to 119, wherein the first genome editor or the base editor contains cytidine deaminase, and the cytidine deaminase contains an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 22.

[0145] Embodiment 121 is the composition according to Embodiment 120, wherein the cytidine deaminase contains APOBEC3A deaminase (A3A).

[0146] Embodiment 122 is the composition according to Embodiment 121, wherein the A3A contains the amino acid sequence of SEQ ID NO: 22, or an amino acid sequence that is at least 87%, 90%, 95%, 98%, or 99% identical to SEQ ID NO: 22.

[0147] Embodiment 123 is the composition according to Embodiment 121 or 122, wherein the A3A is human A3A.

[0148] Embodiment 124 is the composition according to any one of Embodiments 121 to 123, wherein the A3A is wild-type A3A.

[0149] Embodiment 125 is the composition according to any one of Embodiments 87 to 124, wherein the first genome editor or the base editor contains Cas9 nickase.

[0150] Embodiment 126 is the composition according to any one of Embodiments 87 to 125, wherein the first genome editor or the base editor contains N. meningitidis (Nme) Cas9 nickase.

[0151] Embodiment 127 is the composition according to any one of Embodiments 87 to 126, wherein the first genome editor or the base editor is the composition comprising D16A NmeCas9 nickase and optionally D16A Nme2Cas9.

[0152] Embodiment 128 is the composition according to any one of Embodiments 87 to 127, wherein the first genome editor or the base editor is the composition comprising the amino acid sequence of SEQ ID NO: 149.

[0153] Embodiment 129 is the composition according to any one of Embodiments 87 to 128, wherein the first genome editor or the base editor is the composition comprising a sequence that is at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 146.

[0154] Embodiment 130 is the composition according to any one of Embodiments 87 to 129, wherein the second genome editor or the RNA-guided nuclease is the composition comprising Cas9 nuclease.

[0155] Embodiment 131 is the composition according to any one of Embodiments 87 to 130, wherein the second genome editor or the RNA-guided nuclease is the composition comprising S.pyogenes (Spy) Cas9 nuclease.

[0156] Embodiment 132 is the composition according to any one of Embodiments 87 to 131, wherein the second genome editor or the RNA-guided nuclease is the composition comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 156.

[0157] Embodiment 133 is the composition according to any one of Embodiments 87 to 132, wherein the second genome editor or the RNA-guided nuclease is the composition comprising the amino acid sequence of SEQ ID NO: 156.

[0158] Embodiment 134 is the composition according to any one of Embodiments 87 to 125, wherein the first genome editor or the base editor is the composition comprising S.pyogenes (Spy) Cas9 nickase.

[0159] Embodiment 135 is the composition according to any one of Embodiments 87 to 125 and 134, wherein the first genome editor or the base editor is the composition comprising D10A SpyCas9 nickase.

[0160] Embodiment 136 is the composition according to any one of Embodiments 87 to 125, 134, and 135, wherein the first genome editor or the base editor is the composition comprising any one of the amino acid sequences of SEQ ID NOs: 41, 43, and 45, or an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity with any one of the amino acid sequences of SEQ ID NOs: 41, 43, and 45.

[0161] Embodiment 137 is the composition according to any one of Embodiments 87 to 125 and 134 to 136, wherein the first genome editor or the base editor is delivered to a cell as a nucleic acid comprising any one of the nucleotide sequences of SEQ ID NOs: 42, 44, and 46, or a nucleotide sequence having at least 80%, 90%, 95%, 98%, or 99% identity with any one of the nucleotide sequences of SEQ ID NOs: 42, 44, and 46, and the composition.

[0162] Embodiment 138 is the composition according to any one of Embodiments 87 to 125 and 134 to 137, wherein the first genome editor or the base editor is delivered to a cell as a nucleic acid comprising any one of the nucleotide sequences of SEQ ID NOs: 42, 44, and 46 to 58, and the composition.

[0163] Embodiment 139 is the composition according to any one of Embodiments 87 to 125 and 134 to 138, wherein the first genome editor or the base editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1.

[0164] Embodiment 140 is the composition according to any one of Embodiments 87 to 125 and 134 to 138, wherein the first genome editor or the base editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 4.

[0165] Embodiment 141 is the composition according to any one of Embodiments 87 to 125 and 134 to 138, wherein the first genome editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 148.

[0166] Embodiment 142 is the composition according to any one of Embodiments 87 to 125 and 134 to 141, wherein the second genome editor or the RNA-guided nuclease comprises N. meningitidis (Nme) Cas9 nuclease.

[0167] Embodiment 143 is the composition according to any one of Embodiments 87 to 125 and 134 to 142, wherein the second genome editor or the RNA-guided nuclease comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 157 to 167, 191, 198, 205, 212, and 219.

[0168] Embodiment 144 is the composition according to any one of Embodiments 87 to 124 and 134 to 143, wherein the second genome editor or the RNA-guided nuclease comprises an amino acid sequence of any one of SEQ ID NOs: 157 to 167, 191, 198, 205, 212, and 219, the composition.

[0169] Embodiment 145 is the composition according to any one of Embodiments 87 to 124 and 134 to 144, wherein the second genome editor or the RNA-guided nuclease is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 168 to 190, 192 to 197, 199 to 204, 206 to 211, 213 to 218, and 220 to 225, the composition.

[0170] Embodiment 146 is the composition according to any one of Embodiments 87 to 124 and 134 to 144, wherein the second genome editor or the RNA-guided nuclease is delivered to the cell as a nucleic acid comprising a nucleotide sequence of any one of SEQ ID NOs: 168 to 190, 192 to 197, 199 to 204, 206 to 211, 213 to 218, and 220 to 225, the composition.

[0171] Embodiment 147 is the composition according to any one of Embodiments 87 to 146, wherein the at least one gRNA corresponding to the first genome editor or the base editor does not correspond to the second genome editor or the RNA-guided nuclease, the composition.

[0172] Embodiment 148 is the composition according to any one of Embodiments 87 to 147, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease does not correspond to the first genome editor or the base editor, the composition.

[0173] Embodiment 149 is the composition according to any one of Embodiments 87 to 148, wherein the at least one gRNA comprises at least one single guide RNA (sgRNA).

[0174] Embodiment 150 is the composition according to Embodiment 149, wherein the at least one sgRNA comprises a short single guide RNA (short-sgRNA) comprising a conserved portion of the sgRNA containing a hairpin region, the hairpin region lacking at least 5 to 10 nucleotides, and the short-sgRNA comprising a 5'-end modification or a 3'-end modification, or both.

[0175] Embodiment 151 is the composition according to any one of Embodiments 87 to 150, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least two gRNAs targeting at least two different genomic loci.

[0176] Embodiment 152 is the composition according to any one of Embodiments 87 to 151, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease comprises at least two gRNAs targeting at least two different genomic loci.

[0177] Embodiment 153 is the composition according to any one of Embodiments 87 to 152, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least three gRNAs targeting at least three different genomic loci.

[0178] Embodiment 154 is the composition according to any one of Embodiments 87 to 153, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease comprises at least three gRNAs targeting at least three different genomic loci.

[0179] Embodiment 155 is the composition according to any one of Embodiments 87 to 154, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least four gRNAs targeting at least four different genomic loci.

[0180] Embodiment 156 is the composition according to any one of Embodiments 87 to 155, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease comprises at least four gRNAs targeting at least four different genomic loci.

[0181] Embodiment 157 is the composition according to any one of Embodiments 87 to 156, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least five gRNAs targeting at least five different genomic loci.

[0182] Embodiment 158 is the composition according to any one of Embodiments 87 to 157, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease comprises at least five gRNAs targeting at least five different genomic loci.

[0183] Embodiment 159 is the composition according to any one of Embodiments 87 to 158, wherein the at least one gRNA corresponding to the first genome editor or the base editor includes at least six gRNAs targeting at least six different genomic loci.

[0184] Embodiment 160 is the composition according to any one of Embodiments 87 to 159, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes at least six gRNAs targeting at least six different genomic loci.

[0185] Embodiment 161 is the composition according to any one of Embodiments 151 to 160, wherein the first genome editor and one, two, three, four, five, or six of the at least one gRNA corresponding to the first genome editor or the base editor and targeting different genomic loci are contained in the same lipid nanoparticle (LNP).

[0186] Embodiment 162 is the composition according to any one of Embodiments 87 to 161, wherein the at least one gRNA corresponding to the first genome editor or the base editor targets one or more genomic loci selected from the TRBC locus, HLA-A locus, HLA-B locus, CIITA locus, HLA-DR locus, HLA-DQ locus, and HLA-DP locus.

[0187] Embodiment 163 is the composition according to any one of Embodiments 87 to 162, wherein the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease targets one or more genomic loci selected from the TRAC locus, AAVS1 locus, and CIITA locus.

[0188] Embodiment 164 is the composition according to any one of Embodiments 87 to 163, (i) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus and a gRNA targeting the CIITA locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus, (ii) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus, (iii) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus, (iv) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and does the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease include a gRNA targeting the TRAC locus, (v) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and whether the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the TRAC locus, (vi) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and whether the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the TRAC locus, (vii) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and whether the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the TRAC locus, (viii) the at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and whether the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the TRAC locus, (ix) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRAC locus, a gRNA targeting the TRBC locus, a gRNA targeting the CIITA locus, and a gRNA targeting the HLA-A locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the TRAC locus or, (x) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the AAVS1 locus or, (xi) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the AAVS1 locus or, (xii) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the AAVS1 locus or, (xiii) The at least one gRNA corresponding to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes a gRNA targeting the AAVS1 locus, and the composition is as described above.

[0189] Embodiment 165 is the composition according to any one of Embodiments 87 to 164, further comprising a nucleic acid encoding a foreign gene for insertion into the TRAC or AAVS1 locus.

[0190] Embodiment 166 is the composition according to Embodiment 164, wherein in any one of sub-parts (i) to (ix), the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes an additional gRNA targeting the AAVS1 locus.

[0191] Embodiment 167 is the composition according to Embodiment 164, wherein in any one of sub-parts (x) to (xiii), the at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease includes an additional gRNA targeting the TRAC locus.

[0192] Embodiment 168 is the method or composition according to any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are (i) a first lipid nanoparticle (LNP) containing the second genome editor and a first gRNA, (ii) a second LNP containing the first genome editor or the base editor, (iii) a third LNP containing a uracil glycosylase inhibitor (UGI), (iv) a fourth LNP containing a second gRNA, (v) a fifth LNP containing a third gRNA, and (vi) a sixth LNP containing a fourth gRNA, and are collectively contained in the method or the composition.

[0193] Embodiment 169 is the method or composition according to any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are (i) a first lipid nanoparticle (LNP) containing the second genome editor and a first gRNA, (ii) a second LNP containing the first genome editor or the base editor, (iii) a third LNP containing a uracil glycosylase inhibitor (UGI), (iv) a fourth LNP containing a second gRNA and a third gRNA, and (v) a fifth LNP containing a fourth gRNA, and are collectively contained in the method or the composition.

[0194] Embodiment 170 is the method or composition according to any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are (i) a first lipid nanoparticle (LNP) containing the second genome editor and a first gRNA, (ii) a second LNP containing the first genome editor or the base editor and containing a uracil glycosylase inhibitor (UGI), (iii) a third LNP containing a second gRNA, (iv) a fourth LNP containing a third gRNA, and (v) a fifth LNP containing a fourth gRNA, and are collectively contained in the method or the composition.

[0195] Embodiment 171 is the method or composition according to any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are (i) a first lipid nanoparticle (LNP) comprising the second genome editor and a first gRNA, (ii) a second LNP comprising the first genome editor or the base editor and comprising a uracil glycosylase inhibitor (UGI), (iii) a third LNP comprising a second gRNA and a third gRNA, and (iv) a fourth LNP comprising a fourth gRNA, and are collectively contained in the method or the composition.

[0196] Embodiment 172 is the method or composition according to any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are (i) a first lipid nanoparticle (LNP) comprising the second genome editor and a first gRNA, (ii) a second LNP comprising the first genome editor or the base editor, (iii) a third LNP comprising a uracil glycosylase inhibitor (UGI), (iv) a fourth LNP comprising a second gRNA, a third gRNA, and a fourth gRNA, and are collectively contained in the method or the composition.

[0197] Embodiment 173 is the method or composition according to any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are (i) a first lipid nanoparticle (LNP) comprising the second genome editor and a first gRNA, (ii) a second LNP comprising a uracil glycosylase inhibitor (UGI), (iii) a third LNP comprising the first genome editor or the base editor and comprising a second gRNA, (iv) a fourth LNP comprising the first genome editor or the base editor and comprising a third gRNA, and (v) a fifth LNP comprising the first genome editor or the base editor and comprising a fourth gRNA, and are collectively contained in the method or the composition.

[0198] Embodiment 174 is the method or composition according to any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are (i) a first lipid nanoparticle (LNP) comprising the second genome editor and a first gRNA, (ii) a second LNP comprising a uracil glycosylase inhibitor (UGI), (iii) a third LNP comprising the first genome editor or the base editor and comprising a second gRNA and a third gRNA, and (iv) a fourth LNP comprising the first genome editor or the base editor and comprising a fourth gRNA, and the method or the composition is collectively contained therein.

[0199] Embodiment 175 is the method or composition according to any one of Embodiments 168 to 174, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in the first LNP to the fourth LNP, the first LNP to the fifth LNP, or the first LNP to the sixth LNP, and one or more additional LNPs comprising a fifth gRNA, and the method or the composition is collectively contained therein.

[0200] Embodiment 176 is the method or composition according to Embodiment 175, wherein the one or more additional LNPs further comprise a sixth gRNA, and the method or the composition is collectively contained therein.

[0201] Embodiment 177 is the method or composition according to Embodiment 176, wherein the one or more additional LNPs further comprise a seventh gRNA, and the method or the composition is collectively contained therein.

[0202] Embodiment 178 is the method or composition according to Embodiment 177, wherein the one or more additional LNPs further comprise an eighth gRNA, and the method or the composition is collectively contained therein.

[0203] Embodiment 179 is the method or composition according to Embodiment 178, wherein the one or more additional LNPs further comprise a ninth gRNA, the method or the composition.

[0204] Embodiment 180 is the method or composition according to Embodiment 179, wherein the one or more additional LNPs further comprise a tenth gRNA, the method or the composition.

[0205] Embodiment 181 is the method or composition according to any one of Embodiments 168 to 180, wherein the second genome editor comprises S.pyogenes (Spy) Cas9 nuclease, the first genome editor or the base editor comprises N.meningitidis (Nme) Cas9 nickase, the first gRNA targets the TRAC locus, the second gRNA targets the HLA-A locus, the third gRNA targets the CIITA locus, the fourth gRNA targets the HLA-B locus, the fifth gRNA targets the TRBC locus, and the one or more additional gRNAs each target a locus different from the TRAC locus, HLA-A locus, HLA-B locus, CIITA locus, and TRBC locus, the method or the composition.

[0206] Embodiment 182 is the method or composition according to Embodiment 181, wherein the first gRNA comprises the sequence of SEQ ID NO: 374 or 378, or a sequence that is at least 95%, 90%, or 85% identical to the sequence of SEQ ID NO: 374 or 378, the second gRNA comprises the sequence of SEQ ID NO: 366 or 370, or a sequence that is at least 95%, 90%, or 85% identical to the sequence of SEQ ID NO: 366 or 370, the third gRNA comprises the sequence of SEQ ID NO: 345 or 384, or a sequence that is at least 95%, 90%, or 85% identical to the sequence of SEQ ID NO: 345 or 384, and the fourth gRNA comprises the sequence of SEQ ID NO: 363, or a sequence that is at least 95%, 90%, or 85% identical to the sequence of SEQ ID NO: 363, the method or the composition.

[0207] Embodiment 183 is the method or composition according to any one of Embodiments 1 to 167, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different lipid nanoparticles (LNPs), each containing a different nucleic acid component, the method or the composition.

[0208] Embodiment 184 is the method or composition according to Embodiment 183, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in 4, 5, 6, or 7 different lipid nanoparticles (LNPs), each containing a different nucleic acid component, the method or the composition.

[0209] Embodiment 185 is the method or composition according to Embodiment 183, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in 4 different LNPs, each containing a different nucleic acid component, the method or the composition.

[0210] Embodiment 186 is the method or composition according to Embodiment 183, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in 5 different LNPs, each containing a different nucleic acid component, the method or the composition.

[0211] Embodiment 187 is the method or composition according to Embodiment 183, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in 6 different LNPs, each containing a different nucleic acid component, the method or the composition.

[0212] Embodiment 188 is the method or composition according to Embodiment 183, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in seven different LNPs, each containing a different nucleic acid component.

[0213] Embodiment 189 is the method or composition according to any one of Embodiments 1 to 167, wherein the at least one gRNA corresponding to the first genome editor or the base editor and the at least one gRNA corresponding to the second genome editor together include at least two gRNAs, and two of the gRNAs targeting different genomic loci are contained in the same lipid nanoparticle (LNP).

[0214] Embodiment 190 is the method or composition according to any one of Embodiments 1 to 167 and 189, wherein the at least one gRNA corresponding to the first genome editor or the base editor and the at least one gRNA corresponding to the second genome editor together include at least three gRNAs, and three of the gRNAs targeting different genomic loci are contained in the same lipid nanoparticle.

[0215] Embodiment 191 is the method or composition according to any one of Embodiments 1 to 167, 189, and 190, wherein the at least one gRNA corresponding to the first genome editor or the base editor and the at least one gRNA corresponding to the second genome editor together include at least four gRNAs, and four of the gRNAs targeting different genomic loci are contained in the same lipid nanoparticle.

[0216] Embodiment 192 is the method or composition according to any one of Embodiments 189 to 191, wherein each of the other gRNAs is contained in a different LNP, said method or said composition.

[0217] Embodiment 193 is the method or composition according to any one of Embodiments 1 to 167, wherein each of the gRNAs is contained in a different LNP, said method or said composition.

[0218] Embodiment 194 is the method or composition according to any one of Embodiments 1 to 167, wherein the at least one gRNA corresponding to the first genome editor or the base editor includes two or more gRNAs targeting different genomic loci, and the first genome editor or the base editor is contained in the same LNP as at least one of the two or more gRNAs, said method or said composition.

[0219] Embodiment 195 is the method or composition according to Embodiment 194, wherein the first genome editor or the base editor and one of the gRNAs are contained in the same LNP, said method or said composition.

[0220] Embodiment 196 is the method or composition according to Embodiment 194 or 195, wherein the first genome editor or the base editor and two of the gRNAs are contained in the same LNP, said method or said composition.

[0221] Embodiment 197 is the method or composition according to any one of Embodiments 194 to 196, wherein the first genome editor or the base editor and three of the gRNAs are contained in the same LNP, said method or said composition.

[0222] Embodiment 198 is the method or composition according to any one of Embodiments 194 to 197, wherein four of the first genome editor or the base editor and the gRNA are contained in the same LNP, and the method or composition is such.

[0223] Embodiment 199 is the method or composition according to any one of Embodiments 1 to 167, wherein the first genome editor or the base editor is contained in an LNP different from each of the at least one gRNA corresponding to the first genome editor or the base editor, and the method or composition is such.

[0224] Embodiment 200 is the method or composition according to any one of Embodiments 1 to 167, wherein the at least one gRNA corresponding to the first genome editor or the base editor includes two or more gRNAs targeting different genomic loci, and each of the two or more gRNAs is contained in a different LNP, and the method or composition is such.

[0225] Embodiment 201 is the method or composition according to Embodiment 200, wherein each of the LNPs containing one of the gRNAs corresponding to the first genome editor or the base editor further contains the first genome editor or the base editor, and the method or composition is such.

[0226] Embodiment 202 is the method or composition according to any one of Embodiments 1 to 167, wherein the second genome editor and the at least one gRNA corresponding to the second genome editor are contained in the same LNP, and the method or composition is such.

[0227] Embodiment 203 is the method or composition according to Embodiment 202, wherein the second genome editor is contained in the same LNP as one of the gRNAs, and the method or composition is such.

[0228] Embodiment 204 is the method or composition according to any one of Embodiments 1 to 167, wherein the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI is contained in an LNP different from each of the gRNAs, the method or the composition.

[0229] Embodiment 205 is the method or composition according to any one of Embodiments 1 to 204, wherein the LNP comprises a first group of different LNPs, a second group of different LNPs, and optionally a third group of different LNPs, the method or the composition.

[0230] Embodiment 206 is the method or composition according to Embodiment 205, wherein the first group of different LNPs comprises 2, 3, 4, or 5 LNPs, the second group of different LNPs comprises 2, 3, 4, or 5 LNPs, and the third group of different LNPs, if present, comprises 2, 3, 4, or 5 LNPs, the method or the composition.

[0231] Embodiment 207 is the method or composition according to Embodiment 205 or 206, wherein the first group of different LNPs comprises 3 or 4 LNPs, and the second group of different LNPs comprises 3 or 4 LNPs, the method or the composition.

[0232] Embodiment 208 is the method or composition according to any one of Embodiments 205 to 207, wherein the first group of different LNPs, the second group of different LNPs, and, if present, the third group of different LNPs are sequentially delivered to the cell, the method or the composition.

[0233] Embodiment 209 is the method or composition according to any one of Embodiments 205 to 208, wherein the second group of the different LNPs is delivered to the cells 1, 2, or 3 days after the first group of the different LNPs is delivered to the cells, and 1, 2, or 3 days after the second group of the different LNPs is delivered to the cells, if present, the third group of the different LNPs is delivered to the cells, the method or the composition.

[0234] Embodiment 210 is the method or composition according to any one of Embodiments 205 to 209, wherein the second group of the different LNPs is delivered to the cells 1 day after the first group of the different LNPs is delivered to the cells, the method or the composition.

[0235] Embodiment 211 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 210, wherein the LNP has a diameter of 1 to 250 nm, 10 to 200 nm, 20 to 150 nm, about 35 to 150 nm, 50 to 150 nm, 50 to 100 nm, 50 to 120 nm, 60 to 100 nm, 75 to 150 nm, 75 to 120 nm, or 75 to 100 nm, the method or the composition.

[0236] Embodiment 212 is the method or composition according to Embodiment 211, wherein the LNP has a diameter of less than 100 nm, the method or the composition.

[0237] Embodiment 213 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 211, wherein the LNP contains an ionizable lipid, the method or the composition.

[0238] Embodiment 214 is the method or composition according to Embodiment 213, wherein the ionizable lipid contains a biodegradable ionizable lipid, the method or the composition.

[0239] Embodiment 215 is the method or composition according to Embodiment 213 or 214, wherein the ionizable lipid has a PK value in the range of pKa of about 5.1 to about 7.4, such as about 5.5 to about 6.6, about 5.6 to about 6.4, about 5.8 to about 6.2, or about 5.8 to about 6.5, and the method or the composition.

[0240] Embodiment 216 is the method or composition according to any one of Embodiments 213 to 215, wherein the ionizable lipid comprises an amine lipid, and the method or the composition.

[0241] Embodiment 217 is the method or composition according to Embodiment 216, wherein the amine lipid is lipid A or its acetal analog, or lipid D, and the method or the composition.

[0242] Embodiment 218 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 217, wherein the LNP comprises a helper lipid, and the method or the composition.

[0243] Embodiment 219 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 218, wherein the N / P ratio of the LNP is about 6, and the method or the composition.

[0244] Embodiment 220 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 219, wherein the LNP comprises an amine lipid, a helper lipid, and a PEG lipid, and the method or the composition.

[0245] Embodiment 221 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 220, wherein the LNP comprises an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid, and the method or the composition.

[0246] Embodiment 222 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 221, wherein the LNP contains a lipid component, and the lipid component contains about 50 to 60 mol% of an amine lipid such as lipid A, about 8 to 10 mol% of a neutral lipid, and about 2.5 to 4 mol% of a stealth lipid (for example, a PEG lipid), and the remainder of the lipid component is a helper lipid, and the N / P ratio of the lipid LNP is about 3 to 7, the method or the composition.

[0247] Embodiment 223 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 222, wherein the LNP contains a lipid component, and the lipid component contains about 25 to 45 mol% of an amine lipid such as lipid A, about 10 to 30 mol% of a neutral lipid, about 25 to 65 mol% of a helper lipid, and about 1.5 to 3.5 mol% of a stealth lipid (for example, a PEG lipid), and the N / P ratio of the LNP is about 3 to 7, the method or the composition.

[0248] Embodiment 224 is the method or composition according to Embodiment 223, wherein the amount of the amine lipid is about 29 to 38 mol% of the lipid component, about 30 to 43 mol% of the lipid component, or about 25 to 34 mol% of the lipid component, optionally about 33 mol%, about 35 mol%, or about 38 mol% of the lipid component, the method or the composition.

[0249] Embodiment 225 is the method or composition according to 223 or 224, wherein the amount of the neutral lipid is about 11 to 20 mol% of the lipid component, optionally about 15 mol% of the lipid component, the method or the composition.

[0250] Embodiment 226 is the method or composition according to any one of Embodiments 223 to 225, wherein the amount of the helper lipid is about 43 to 65 mol% of the lipid component, or about 43 to 55 mol% of the lipid component, optionally about 47.5 mol% of the lipid component, or about 49 mol% of the lipid component, the method or the composition.

[0251] Embodiment 227 is the method or composition according to any one of Embodiments 223 to 226, wherein the amount of the PEG lipid is about 2.0 to 3.5 mol%, about 2.3 to 3.5 mol%, or about 2.3 to 2.7 mol% of the lipid component, optionally about 2.5 mol% of the lipid component, or about 2.7 mol% of the lipid component, of the method or the composition.

[0252] Embodiment 228 is the method or composition according to any one of Embodiments 223 to 237, a. the amount of the amine lipid is about 29 to 44 mol% of the lipid component, the amount of the neutral lipid is about 11 to 28 mol% of the lipid component, the amount of the helper lipid is about 28 to 55 mol% of the lipid component, and the amount of the PEG lipid is about 2.3 to 3.5 mol% of the lipid component, or b. the amount of the amine lipid is about 29 to 38 mol% of the lipid component, the amount of the neutral lipid is about 11 to 20 mol% of the lipid component, the amount of the helper lipid is about 43 to 55 mol% of the lipid component, and the amount of the PEG lipid is about 2.3 to 2.7 mol% of the lipid component, or c. the amount of the amine lipid is about 25 to 34 mol% of the lipid component, the amount of the neutral lipid is about 10 to 20 mol% of the lipid component, the amount of the helper lipid is about 45 to 65 mol% of the lipid component, and the amount of the PEG lipid is about 2.5 to 3.5 mol% of the lipid component, or d. the amount of the amine lipid is about 30 to 43 mol% of the lipid component, the amount of the neutral lipid is about 10 to 17 mol% of the lipid component, the amount of the helper lipid is about 43.5 to 56 mol% of the lipid component, and the amount of the PEG lipid is about 1.5 to 3 mol% of the lipid component, of the method or the composition.

[0253] Embodiment 229 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 228, wherein the LNP contains a lipid component, and the lipid component contains about 25 to 50 mol% of an amine lipid such as lipid D, about 7 to 25 mol% of a neutral lipid, about 39 to 65 mol% of a helper lipid, and about 0.5 to 1.8 mol% of a stealth lipid (e.g., PEG lipid), and the N / P ratio of the LNP is about 3 to 7, the method or the composition.

[0254] Embodiment 230 is the method or composition according to Embodiment 229, wherein the amount of the amine lipid is about 30 to 45 mol% of the lipid component, or about 30 to 40 mol% of the lipid component, optionally about 30 mol%, 40 mol%, or 50 mol% of the lipid component, the method or the composition.

[0255] Embodiment 231 is the method or composition according to Embodiment 229 or 230, wherein the amount of the neutral lipid is about 10 to 20 mol% of the lipid component, or about 10 to 15 mol% of the lipid component, optionally about 10 mol% or 15 mol% of the lipid component, the method or the composition.

[0256] Embodiment 232 is the method or composition according to any one of Embodiments 229 to 231, wherein the amount of the helper lipid is about 50 to 60 mol% of the lipid component, about 39 to 59 mol% of the lipid component, or about 43.5 to 59 mol% of the lipid component, optionally about 59 mol%, about 43.5 mol%, or about 39 mol% of the lipid component, the method or the composition.

[0257] Embodiment 233 is the method or composition according to any one of Embodiments 229 to 232, wherein the amount of the PEG lipid is about 0.9 to 1.6 mol% of the lipid component, or about 1 to 1.5 mol% of the lipid component, optionally about 1 mol% or about 1.5 mol% of the lipid component, the method or the composition.

[0258] Embodiment 234 is the method or composition according to any one of Embodiments 229 to 233, wherein a. the amount of the ionizable lipid is about 27 to 40 mol% of the lipid component, the amount of the neutral lipid is about 10 to 20 mol% of the lipid component, the amount of the helper lipid is about 50 to 60 mol% of the lipid component, and the amount of the PEG lipid is about 0.9 to 1.6 mol% of the lipid component, or b. the amount of the ionizable lipid is about 30 to 45 mol% of the lipid component, the amount of the neutral lipid is about 10 to 15 mol% of the lipid component, the amount of the helper lipid is about 39 to 59 mol% of the lipid component, and the amount of the PEG lipid is about 1 to 1.5 mol% of the lipid component, or c. the amount of the ionizable lipid is about 30 mol% of the lipid component, the amount of the neutral lipid is about 10 mol% of the lipid component, the amount of the helper lipid is about 59 mol% of the lipid component, and the amount of the PEG lipid is about 1 mol% of the lipid component, or d. the amount of the ionizable lipid is about 40 mol% of the lipid component, the amount of the neutral lipid is about 15 mol% of the lipid component, the amount of the helper lipid is about 43.5 mol% of the lipid component, and the amount of the PEG lipid is about 1.5 mol% of the lipid component, or e. the amount of the ionizable lipid is about 50 mol% of the lipid component, the amount of the neutral lipid is about 10 mol% of the lipid component, the amount of the helper lipid is about 39 mol% of the lipid component, and the amount of the PEG lipid is about 1 mol% of the lipid component, the method or the composition.

[0259] Embodiment 235 is the method or composition according to any one of Embodiments 216 to 234, wherein the amine lipid is lipid A, the method or the composition.

[0260] Embodiment 236 is the method or composition according to any one of Embodiments 216 to 234, wherein the amine lipid is lipid D, the method or the composition.

[0261] Embodiment 237 is the method or composition according to any one of Embodiments 221 to 236, wherein the neutral lipid is DSPC, the method or the composition.

[0262] Embodiment 238 is the method or composition according to any one of Embodiments 222 to 237, wherein the stealth lipid is PEG-dimyristoyl glycerol (PEG-DMG), the method or the composition.

[0263] Embodiment 239 is the method or composition according to any one of Embodiments 218 to 238, wherein the helper lipid is cholesterol, the method or the composition.

[0264] Embodiment 240 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 239, wherein the LNP is pretreated with a serum factor before contacting the cell, and optionally the serum factor is a primate serum factor, optionally a human serum factor, the method or the composition.

[0265] Embodiment 241 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 240, wherein the LNP is pretreated with human serum before contacting the cell, the method or the composition.

[0266] Embodiment 242 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 241, wherein the LNP is pretreated with ApoE before contacting the cell, and optionally the ApoE is human ApoE, the method or the composition.

[0267] Embodiment 243 is the method or composition according to any one of Embodiments 21 to 86 and 104 to 242, wherein the LNP is pretreated with recombinant ApoE3 or ApoE4 before contacting the cell, and optionally the ApoE3 or ApoE4 is human ApoE3 or ApoE4, the method or the composition.

[0268] Embodiment 244 is a cell that has been processed in vitro by the method or composition according to any one of Embodiments 1 to 243.

[0269] Embodiment 245 is a cell that has been processed in vivo by the method or composition according to any one of Embodiments 1 to 243.

[0270] Embodiment 246 is the cell according to Embodiment 244 or 245, which is a human cell.

[0271] Embodiment 247 is the cell according to any one of Embodiments 244 to 246, which is selected from mesenchymal stem cells, hematopoietic stem cells (HSCs), monocytes, endothelial progenitor cells (EPCs), neural stem cells (NSCs), limbal stem cells (LSCs), tissue-specific primary cells or cells derived therefrom (TSCs), induced pluripotent stem cells (iPSCs), ocular stem cells, pluripotent stem cells (PSCs), embryonic stem cells (ESCs), and cells for organ or tissue transplantation, and optionally cells for use in ACT therapy.

[0272] Embodiment 248 is the cell according to any one of Embodiments 244 to 247, which is an immune cell.

[0273] Embodiment 249 is the cell according to Embodiment 248, wherein the immune cell is selected from lymphocytes (e.g., T cells, B cells, natural killer cells (“NK cells”), NKT cells, or iNKT cells), monocytes, macrophages, mast cells, dendritic cells, granulocytes (e.g., neutrophils, eosinophils, and basophils), primary immune cells, CD3+ cells, CD4+ cells, CD8+ T cells, regulatory T cells (Tregs), B cells, and dendritic cells (DCs).

[0274] Embodiment 250 is the cell according to Embodiment 248, wherein the immune cell is a peripheral blood mononuclear cell (PBMC), lymphocyte, T cell, optionally a CD4+ cell, CD8+ cell, memory T cell, naive T cell, stem cell memory T cell, or B cell, optionally a memory B cell, naive B cell, and the cell selected from primary cells.

[0275] Embodiment 251 is the cell according to Embodiment 250, wherein the cell is a T cell.

[0276] Embodiment 252 is the cell according to Embodiment 251, wherein the T cell is a tumor-infiltrating lymphocyte (TIL), a T cell expressing an alpha-beta TCR, a T cell expressing a gamma-delta TCR, a regulatory T cell (Treg), a memory T cell, and an early stem cell memory T cell (Tscm, CD27+ / CD45+), and the cell selected therefrom.

[0277] Embodiment 253 is the cell according to any one of Embodiments 244 to 252, wherein the cell is isolated from human donor PBMC or leukopak before editing.

[0278] Embodiment 254 is the cell according to any one of Embodiments 244 to 253, wherein the cell is derived from a progenitor cell before editing.

[0279] Embodiment 255 is a population of cells comprising the cell according to any one of Embodiments 244 to 254.

[0280] Embodiment 256 is the population of cells according to Embodiment 255, wherein the population comprises edited T cells, and at least 30%, 40%, 50%, 55%, 60%, 65% of the cells in the population have a memory phenotype (CD27+, CD45RA+).

[0281] Embodiment 257 is the population of cells according to Embodiment 255 or 256, wherein the cells are inactivated immune cells.

[0282] Embodiment 258 is a population of cells according to any one of Embodiments 255 to 257, wherein the cells are activated immune cells.

[0283] Embodiment 259 is a population of cells according to any one of Embodiments 255 to 258, wherein the cells are T cells and the cells are responsive to restimulation after editing.

[0284] Embodiment 260 is a population of cells according to any one of Embodiments 255 to 259, wherein the cells are cultured, expanded, or proliferated ex vivo.

[0285] Embodiment 261 is a cell, population of cells, or composition according to any one of Embodiments 87 to 260 for use in the treatment of cancer.

[0286] Embodiment 262 is the use of a cell, population of cells, or composition according to any one of Embodiments 87 to 261 for the preparation of a medicament for treating cancer.

[0287] Embodiment 263 is an engineered cell comprising at least three base edits at at least three genomic loci and at least one foreign gene. Embodiment 264 is a composition, a. i) SEQ ID NOs: 251 to 264, ii) at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 251 to 264, iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 251 to 264, iv) a sequence comprising 10 consecutive nucleotides at genomic coordinates ±10 nucleotides listed in Table 5, v) at least 17, 18, 19, or 20 consecutive nucleotides of the sequence of (iv), or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v), a gRNA comprising a guide sequence selected therefrom, or b. The composition as described above, comprising a nucleic acid encoding the gRNA of (a).

[0288] Embodiment 265 is a method of modifying a DNA sequence within the AAVS1 gene, comprising: a. i) SEQ ID NOs: 251 to 264, ii) at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 251 to 264, iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 251 to 264, iv) a sequence comprising 10 consecutive nucleotides at genomic coordinates ±10 nucleotides listed in Table 5, v) at least 17, 18, 19, or 20 consecutive nucleotides of the sequence of (iv), or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v), a gRNA comprising a guide sequence selected therefrom, or b. The method as described above, comprising delivering to a cell a nucleic acid encoding the gRNA of (a).

[0289] Embodiment 266 is a method of immunotherapy, comprising administering to a subject a composition comprising engineered cells, the cell comprises a genomic modification in the AAVS1 gene, and the genetic modification comprises an insertion within genomic coordinates selected from chr19:55115695 - 55115715, chr19:55115588 - 55115608, chr19:55115616 - 55115636, chr19:55115623 - 55115643, chr19:55115637 - 55115657, chr19:55115691 - 55115711, chr19:55115755 - 55115775, chr19:55115823 - 55115843, chr19:55115834 - 55115854, chr19:55115835 - 55115855, chr19:55115836 - 55115856, chr19:55115850 - 55115870, chr19:55115951 - 55115971, and chr19:55115949 - 55115969; or the cell is a gRNA comprising a guide sequence selected from: i) SEQ ID NOs: 251 - 264, ii) at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 251 - 264, iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 251 - 264, iv) a sequence comprising 10 consecutive nucleotides at genomic coordinates ±10 nucleotides of those listed in Table 5, v) at least 17, 18, 19, or 20 consecutive nucleotides of the sequence of (iv), or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); or b. the method as described above, which is engineered by delivering to the cell a nucleic acid encoding the gRNA of (a).

[0290] Embodiment 267 is an engineered cell comprising a gene modification in the AAVS1 gene, wherein the gene modification comprises an insertion within a genomic locus selected from chr19:55115695-55115715, chr19:55115588-55115608, chr19:55115616-55115636, chr19:55115623-55115643, chr19:55115637-55115657, chr19:55115691-55115711, chr19:55115755-55115775, chr19:55115823-55115843, chr19:55115834-55115854, chr19:55115835-55115855, chr19:55115836-55115856, chr19:55115850-55115870, chr19:55115951-55115971, and chr19:55115949-55115969, said engineered cell.

[0291] Embodiment 268 is a method or composition according to any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are (a) (i) a first lipid nanoparticle (LNP) comprising a uracil glycosylase inhibitor (UGI), (ii) a second LNP comprising the first genome editor or the base editor and a second gRNA, (iii) a third LNP comprising the first genome editor or the base editor and a third gRNA, and (iv) a fourth LNP comprising the first genome editor or the base editor and a fourth gRNA, and (b) (i) a fifth LNP comprising a uracil glycosylase inhibitor (UGI); (ii) a sixth LNP comprising the second genome editor and the first gRNA; (iii) a nucleic acid encoding a foreign gene to be inserted at the editing site of the first gRNA; (iv) optionally, a seventh LNP comprising the first genome editor or the base editor and comprising a fifth gRNA; (v) optionally, an eighth LNP comprising the first genome editor or the base editor and comprising a sixth gRNA; (vi) optionally, a ninth LNP comprising the first genome editor or the base editor and comprising a seventh gRNA, which are collectively contained in the method or the composition.

[0292] I. Definitions Unless otherwise specified, the following terms and phrases used herein are intended to have the following meanings.

[0293] "Polynucleotide" and "nucleic acid" are used herein to refer to a multimeric compound comprising nucleosides or nucleoside analogs having nitrogen-containing heterocyclic bases or base analogs that are linked together along a backbone and that include conventional RNA, DNA, hybrid RNA-DNA, and polymers that are analogs thereof. The nucleic acid "backbone" can be composed of various linkages including one or more of a sugar phosphate diester linkage, a peptide-nucleic acid bond ("peptide nucleic acid" or PNA, PCT WO95 / 32305), a phosphorothioate linkage, a methylphosphonate linkage, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or a similar compound having a substitution, e.g., a 2'methoxy, 2'halide, or 2'-O-(2-methoxyethyl) (2'-O-moe) substitution. The nitrogenous bases are conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine), inosine, purine or pyrimidine derivatives (e.g., N 4-Methyldeoxyguanosine, deaza- or aza-purine, deaza- or aza-pyrimidine, pyrimidine bases having substituents at the 5- or 6-position (e.g., 5-methylcytosine), purine bases having substituents at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -Methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 -Alkyl-pyrimidine, U.S. Patent No. 5,378,825 and PCT No. WO93 / 13121). For general considerations, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 th ed., 1992). Nucleic acids can contain one or more "abasic" residues where the backbone does not contain nitrogenous bases at the position(s) of the polymer (U.S. Patent No. 5,585,481). Nucleic acids can contain only conventional RNA or DNA sugars, bases, and linkages, or can contain both conventional components and substitutions (e.g., a polymer containing a conventional base with a 2'methoxy linkage, or both a conventional base and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs), analogs containing one or more LNA nucleotide monomers having bicyclic furanose units locked into an RNA mimetic sugar structure, which improve hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). Nucleic acids include "unlocked nucleic acids", which allows for the modulation of thermodynamic stability and provides nuclease stability. RNA and DNA can differ by having different sugar moieties, with RNA having uracil or an analog thereof and DNA having thymine or an analog thereof.

[0294] As used herein, "polypeptide" refers to a multimeric compound containing amino acid residues that can adopt a three-dimensional structure. Polypeptides include, but are not limited to, enzymes, enzyme precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid-binding proteins, antibodies, and the like. Polypeptides can include, but do not necessarily include, post-translational modifications, non-natural amino acids, prosthetic groups, and the like.

[0295] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA associated with an RNA-guided DNA-binding agent such as a Cas nuclease, e.g., a Cas cleaver, a Cas nickase, or a dCas DNA binder (e.g., Cas9). In some embodiments, the guide RNA directs an RNA-guided DNA-binding agent such as Cas9 to a target sequence, the guide RNA hybridizes to the target sequence, and a drug can bind to the target sequence and, if the drug is a cleaver or a nickase, perform cleavage or nicking after binding.

[0296] As used herein, "RNA-guided DNA binding agent" means a polypeptide or complex of polypeptides having RNA and DNA binding activities, or a DNA binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the presence of a PAM and the sequence of the guide RNA. Exemplary RNA-guided DNA binding agents include Cas nucleases / Cas nickases, and their inactivated forms ("dCas DNA binding agents"). As used herein, "Cas nuclease" (also referred to as "Cas protein") includes Cas nucleases, Cas nickases and dCas DNA binding agents. Cas nucleases / Cas nickases and dCas DNA binding agents include the Csm complex or Cmr complex of the type III CRISPR system, their Cas10 subunit, Csm1 subunit or Cmr2 subunit, the Cascade complex of the type I CRISPR system, its Cas3 subunit, and class 2 Cas nucleases. As used herein, "class 2 Cas nuclease" is a single-stranded polypeptide having RNA-guided DNA binding activity. Class 2 Cas nucleases include class 2 Cas nucleases / Cas nickases (e.g., H840A variant, D10A variant or N863A variant) further having RNA-guided DNA cleavage activity or DNA nickase activity, and class 2 dCas DNA binding agents in which the cleavage activity / nickase activity is inactivated. Class 2 Cas nucleases include, for example, proteins such as Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A variant, R661A variant, Q695A variant, Q926A variant), HypaCas9 (e.g., N692A variant, M694A variant, Q695A variant, H698A variant), eSPCas9(1.0) (e.g., K810A variant, K1003A variant, R1060A variant), and eSPCas9(1.1) (e.g., K848A variant, K1003A variant, R1060A variant), and modifications thereof.The Cpf1 protein, Zetsche et al., Cell, 163:1-13 (2015), is homologous to Cas9 and contains an RuvC-like nuclease domain. The Cpf1 sequence of Zetsche is incorporated by reference in its entirety. See, for example, Tables S1 and S3 of the Zetsche reference. See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015), Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0297] As used herein, the terms "genome editor" or "editor" refer to a substance that includes a polypeptide capable of making a modification within a nucleic acid sequence (e.g., DNA or RNA). In some embodiments, the editor is a nuclease such as Cas9 nuclease. In some embodiments, the editor is capable of deaminating a base within a nucleic acid and may be referred to as a base editor. In some embodiments, the editor is capable of deaminating a base within a DNA molecule. In some embodiments, the editor is capable of deaminating cytosine (C) in DNA. In some embodiments, the editor is a fusion protein that includes an RNA-guided nickase fused to a cytidine deaminase. In some embodiments, the editor is a combination of an RNA-guided nickase and a cytidine deaminase domain. In some embodiments, the editor is a fusion protein that includes an RNA-guided nickase fused to deaminase APOBEC3A (A3A). In some embodiments, the editor includes a Cas9 nickase fused to deaminase APOBEC3A (A3A). In some embodiments, the editor is a fusion protein that includes an enzymatically inactive RNA-guided DNA-binding protein fused to a cytidine deaminase domain. In some embodiments, the editor is a nickase fused to a DNA polymerase.

[0298] As used herein, the term "genome editing tool" refers to a substance comprising a genome editor and at least one guide RNA corresponding to the nuclease or nickase component of the genome editor.

[0299] The genome editor may, for example, include a C-to-T base editor and may or may not include a uracil glycosylase inhibitor (UGI). The genome editor may, for example, include a cytidine deaminase, an RNA-guided nickase, and a UGI, and the cytidine deaminase, the RNA-guided nickase, and the UGI may be included in a single polypeptide, or the cytidine deaminase, the RNA-guided nickase, and the UGI may be included in different polypeptides, or the deaminase and the RNA-guided nickase may be included in a single polypeptide and the UGI may be included in a different polypeptide. In some embodiments, the deaminase includes a cytidine deaminase.

[0300] As used herein, the term "orthogonality" refers to any two genome editors (e.g., base editors, nucleases, nickases, or cleavases), each of which can recognize their target(s) via their corresponding guide RNA(s), but do not fit to the guide RNA(s) corresponding to other genome editors. For example, each cannot recognize the target(s) of other genome editors via the guide RNA(s) corresponding to other genome editors. For example, N. meningitidis Cas9 (NmeCas9) nickase may be able to recognize a genomic locus via a guide RNA corresponding to the NmeCas9 nickase, and S. pyogenes Cas9 (SpyCas9) cleavase may be able to recognize another genomic locus via a guide RNA corresponding to the SpyCas9 cleavase. In this example, the NmeCas9 nickase and the SpyCas9 cleavase are orthogonal to each other. Genome editors or genome editing components can be engineered to be orthogonal. In this example, the NmeCas9 nickase and the SpyCas9 cleavase are from different organisms, but two genome editors do not need to be from different organisms to be orthogonal to each other.

[0301] As used herein, "cytidine deaminase" refers to a polypeptide or polypeptide complex capable of cytidine deaminase activity that catalyzes the hydrolytic deamination of cytidine or deoxycytidine, typically resulting in uridine or deoxyuridine. Cytidine deaminases include enzymes within the cytidine deaminase superfamily, in particular enzymes of the APOBEC family (APOBEC1, APOBEC2, APOBEC4, and the APOBEC3 subfamily of enzymes), activation-induced cytidine deaminase (AID or AICDA), and CMP deaminase (see, for example, Conticello et al., Mol. Biol. Evol. 22:367-77, 2005; Conticello, Genome Biol. 9:229, 2008; Muramatsu et al., J. Biol. Chem. 274:18470-6, 1999; Carrington et al., Cells 9:1690 (2020)). In some embodiments, variants of any known cytidine deaminase or APOBEC protein are included. Variants include proteins having a sequence that differs from the wild-type protein by one or more mutations (i.e., substitutions, deletions, insertions), such as one or more point substitutions. For example, sequences shortened by deleting N-terminal, C-terminal, or internal amino acids, preferably by deleting 1 to 4 amino acids at the C-terminus of the sequence, can be used. As used herein, the term "variant" refers to allelic variants, splicing variants, and natural or artificial mutants, which are homologous to the reference sequence. Variants are "functional" in that they exhibit catalytic activity for DNA editing.

[0302] As used herein, the term "APOBEC3A" refers to a cytidine deaminase, e.g., a protein expressed by the human A3A gene. APOBEC3A can have catalytic DNA editing activity. The amino acid sequence of APOBEC3A is described (UniPROT accession ID: p31941) and is included herein as SEQ ID NO: 22. In some embodiments, the APOBEC3A protein is a human APOBEC3A protein or a wild-type protein. Variants include sequences that differ from the wild-type APOBEC3A protein by one or more mutations (i.e., substitutions, deletions, insertions), e.g., proteins having one or more point substitutions. For example, an APOBEC3A sequence shortened by deleting an N-terminal, C-terminal, or internal amino acid, preferably by deleting 1 to 4 amino acids at the C-terminus of the sequence, can be used. As used herein, the term "variant" refers to allelic variants, splicing variants, and natural or artificial mutants that are homologous to the APOBEC3A reference sequence. Variants are "functional" in that they exhibit catalytic activity for DNA editing. In some embodiments, APOBEC3A (such as human APOBEC3A) has the 57th position of the wild-type amino acids (when numbered in the wild-type sequence). In some embodiments, APOBEC3A (such as human APOBEC3A) has asparagine at the 57th position of the amino acids (when numbered in the wild-type sequence).

[0303] As used herein, "nickase" is an enzyme that creates a single-strand break (also known as a "nick") within double-stranded DNA, i.e., it cleaves one strand of the DNA double helix but not the other. As used herein, "RNA-guided nickase" means a polypeptide or complex of polypeptides having DNA nickase activity, where the DNA nickase activity is sequence-specific and dependent on the sequence of an RNA. Exemplary RNA-guided nickases include Cas nickases. Cas nickases include, but are not limited to, the Csm or Cmr complexes of the type III CRISPR system, their Cas10 subunit, Csm1 subunit or Cmr2 subunit, the Cascade complex of the type I CRISPR system, its Cas3 subunit, and the nickase forms of class 2 Cas nucleases. Class 2 Cas nickases include polypeptides in which either the HNH or RuvC catalytic domain has been inactivated, e.g., Cas9 (e.g., the H840A, D10A, or N863A variants of SpyCas9, or the D16A variant of NmeCas9). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain, or RuvC or RuvC-like domain, of N. meningitidis include Nme2Cas9D16A (HNH nickase) and Nme2Cas9H588A (RuvC nickase). Class 2 Cas nickases include, e.g., Cas9 (e.g., the H840A, D10A, or N863A variants of SpyCas9), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., the N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., the N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., the K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., the K848A, K1003A, R1060A variants) proteins, and modifications thereof.The Cpf1 protein, Zetsche et al., Cell, 163:1-13 (2015) is homologous to Cas9 and contains an RuvC-like protein domain. The Cpf1 sequence of Zetsche is incorporated herein by reference in its entirety. See, for example, Tables S1 and S3 of the Zetsche reference. "Cas9" includes S. pyogenes (Spy) Cas9, the Cas9 variants listed herein, and their equivalents. See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015), Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0304] As used herein, the term "fusion protein" refers to a hybrid polypeptide that includes polypeptides from at least two different proteins or sources. Since one polypeptide is located at the amino-terminal (N-terminal) portion or carboxy-terminal (C-terminal) protein of the fusion protein, it can form an "amino-terminal fusion protein" or a "carboxy-terminal fusion protein", respectively. Any of the proteins provided herein can be produced by any method known in the art. For example, the proteins provided herein can be produced via recombinant protein expression and purification, which is particularly suitable for fusion proteins containing peptide linkers. Methods of recombinant protein expression and purification are well known and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference.

[0305] As used herein, the term "linker" refers to a chemical group or molecule that connects two adjacent molecules or moieties. Typically, the linker is located between or sandwiched between two groups, molecules or other moieties and is linked to each by a covalent bond. In some embodiments, the linker is an amino acid, or a plurality of amino acids such as the 16 amino acid residue "XTEN" linker (e.g., a peptide or protein), or a variant thereof (see, e.g., Examples, and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 25), SGSETPGTSESA (SEQ ID NO: 26), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 27). In some embodiments, the linker comprises one or more sequences selected from SEQ ID NOs: 25-39 and 72-133.

[0306] As used herein, the term "uracil glycosylase inhibitor", "uracil-DNA glycosylase inhibitor", or "UGI" refers to a protein that can inhibit the base excision repair enzyme uracil-DNA glycosylase (UDG) (e.g., UniPROT ID: P14739, SEQ ID NO: 15, SEQ ID NO: 24).

[0307] As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that induces a molecule containing or linked to such a sequence to be transported into the nucleus of a eukaryotic cell. The nuclear localization signal can form part of the molecule being transported. In some embodiments, the NLS can be fused to the molecule by a covalent bond, a hydrogen bond, or an ionic interaction. In some embodiments, the NLS can be fused to the molecule via a linker.

[0308] As used herein, the "open reading frame" or "ORF" of a gene refers to a sequence consisting of a series of codons that specify the amino acid sequence of the protein encoded by that gene. An ORF generally begins with a start codon (e.g., ATG in DNA or AUG in RNA) and ends with a stop codon, e.g., TAA, TAG or TGA in DNA, or UAA, UAG or UGA in RNA.

[0309] "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either a crRNA (also known as CRISPR RNA) or a combination of a crRNA and a trRNA (also known as tracrRNA). The crRNA and trRNA may associate as a single RNA molecule (single guide RNA, sgRNA) or as two separate RNA molecules (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to each type. The trRNA may be a naturally occurring sequence or a trRNA sequence having modifications or differences compared to a naturally occurring sequence.

[0310] As used herein, terms such as "guide sequence" or "guide region" or "targeting sequence" or "spacer" or "spacer sequence" refer to a sequence within a gRNA that is complementary to a target sequence and functions to direct the gRNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided nickase. The guide sequence can be, for example, 20 nucleotides in length in the case of Streptococcus pyogenes (i.e., Spy Cas9, also referred to as SpCas9) and related Cas9 homologs / orthologs. Shorter or longer sequences, such as 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, can also be used as guides. The guide sequence can be, for example, 20-25 nucleotides in length in the case of Nme Cas9, e.g., 20, 21, 22, 23, 24, or 25 nucleotides in length. For example, a 24-nucleotide guide sequence can be used with Nme Cas9, e.g., Nme2 Cas9.

[0311] In some embodiments, the target sequence is, for example, within a genomic locus or on a chromosome and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence can be about 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments, the guide sequence and the target region can be 100% complementary or identical. In other embodiments, the guide sequence and the target region may include at least one mismatch. For example, the guide sequence and the target sequence may include 1, 2, 3, or 4 mismatches, in which case the full length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and the target region may include 1 to 4 mismatches, in which case the guide sequence includes at least 17, 18, 19, 20, or more nucleotides. In some embodiments, when the guide sequence includes 20 nucleotides, the guide sequence and the target region may include 1, 2, 3, or 4 mismatches. In some embodiments, for example, when the guide sequence includes 24 consecutive nucleotides, the degree of complementarity or identity between the guide sequence and its corresponding target sequence is at least 80%, 85%, 90%, or 95%. In some embodiments, the guide sequence and the target region can be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch, i.e., one nucleotide that is not identical or not complementary, depending on the reference sequence. For example, the guide sequence and the target sequence may include 1 to 2, preferably 1 or fewer mismatches, and the full length of the target sequence is 19, 20, 21, 22, 23, or 24, or more nucleotides. In some embodiments, the guide sequence and the target region may include 1 to 2 mismatches, and the guide sequence includes at least 24, or more nucleotides. In some embodiments, the guide sequence and the target region may include 1 to 2 mismatches, and the guide sequence includes 24 nucleotides.

[0312] As used herein, "target sequence" or "genomic target sequence" refers to the sequence of nucleic acid at a target genomic locus, either the plus or minus strand, that has complementarity to the guide sequence of a gRNA, i.e., is complementary to the guide sequence of the gRNA to an extent sufficient to permit specific binding of the guide to the target sequence. Interaction between the target sequence and the guide sequence induces an RNA-guided DNA binding agent to bind to its target sequence and, depending on the activity of the binding agent, potentially nick or cut within the target sequence. The specific length of the target sequence and the number of mismatches that can occur between the target sequence and the guide sequence vary, for example, depending on which Cas9 nuclease is being guided by the gRNA. Since the nucleic acid substrate of the Cas protein is double-stranded nucleic acid, the target sequence for the Cas protein includes both the plus and minus strands of genomic DNA (i.e., a given sequence and its reverse complement). Thus, when a guide sequence is said to be "complementary to a target sequence", it should be understood that the guide sequence can direct an RNA-guided DNA binding agent (e.g., dCas9 or a Cas9 with reduced activity) to bind to the reverse complement of the target sequence. Thus, in some embodiments, where the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a particular nucleotide of the target sequence (e.g., a target sequence without a PAM), except for the substitution of T for U in the guide sequence.

[0313] As used herein, when alignment of a first sequence to a second sequence shows that overall, at least X% of the positions of the second sequence match the first sequence, the first sequence is considered to "comprise a sequence having at least X% identity to the second sequence". For example, the sequence AAGA comprises a sequence having 100% identity to the sequence AAG, because the alignment gives 100% identity in that there is a match at all three positions of the second sequence. Differences between RNA and DNA (generally, the exchange of uridine for thymidine or vice versa), and the presence of nucleoside analogs such as modified uridine, do not contribute to differences in identity or complementarity between polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine, another example being cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement). Thus, for example, in the sequence 5'-AXG, where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine, all are considered 100% identical to AUG because they are all completely complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. One of ordinary skill in the art will understand which algorithm and parameter settings are appropriate for a given pair of sequences to be aligned. Generally, for sequences of amino acids with a length and expected identity generally similar and greater than 50%, or for sequences of nucleotides with a length and expected identity generally similar and greater than 75%, the Needleman-Wunsch algorithm using the default settings of the Needleman-Wunsch algorithm interface provided by EBI at the www.ebi.ac.uk web server is generally appropriate.

[0314] As used herein, "mRNA" refers to a polynucleotide that contains an open reading frame that can be translated into a polypeptide (i.e., can function as a substrate for translation by ribosomes and aminoacylated tRNA), rather than DNA. The mRNA can contain one or more modifications, such as those provided below. Generally, mRNA does not contain a significant amount of thymidine residues (e.g., 0 residues or less than 30, 20, 10, 5, 4, 3, or 2 thymidine residues, or a thymidine content of less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%). The mRNA can contain modified uridine at some or all of its uridine positions.

[0315] As used herein, "modified uridine" refers to a nucleoside other than thymidine that has the same hydrogen bond acceptors as uridine and one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which a proton has been replaced by one or more non-proton substituents (e.g., an alkoxy such as methoxy). In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which a proton has been replaced by one or more non-proton substituents (e.g., an alkyl such as methyl). In some embodiments, the modified uridine is any of a substituted uridine, pseudouridine, or substituted pseudouridine.

[0316] As used herein, "uridine position" refers to the position of a polynucleotide occupied by uridine or a modified uridine. Thus, for example, a polynucleotide in which "100% of the uridine positions are modified uridines" contains modified uridines at all positions that would be uridines in a conventional RNA of the same sequence (where all bases are standard A, U, C, or G bases). Unless otherwise indicated, U in the polynucleotide sequences of the present disclosure or in the sequence table or sequence listing appended to the present disclosure can be uridine or a modified uridine.

[0317] As used herein, the "minimal uridine codon(s)" for a given amino acid are the codon(s) having the fewest uridines (usually 0 or 1, except for the phenylalanine codons which usually have two uridines as the minimal uridine codon). Modified uridine residues are considered equivalent to uridine for the purpose of assessing uridine content.

[0318] As used herein, the "uridine dinucleotide (UU) content" of an ORF can be expressed as an absolute value as the count of UU dinucleotides in the ORF, or as a percentage as the rate of the positions occupied by uridine in the uridine dinucleotides (e.g., in AUUAU, since uridine occupies 2 out of 5 positions of the uridine dinucleotides, it has a uridine dinucleotide content of 40%). Modified uridine residues are considered equivalent to uridine for the purpose of assessing uridine dinucleotide content.

[0319] As used herein, the "minimal adenine codon(s)" for a given amino acid are the codon(s) having the fewest adenines (usually 0 or 1, except for the lysine and asparagine codons which usually have two adenines as the minimal adenine codon). Modified adenine residues are considered equivalent to adenine for the purpose of assessing adenine content.

[0320] As used herein, the “adenine nucleotide content” of an ORF can be expressed as an absolute value as the count of AA dinucleotides in the ORF, or as a percentage as the percentage of positions occupied by adenine of the adenine nucleotide (e.g., in UAAUA, since adenine of the adenine nucleotide occupies 2 out of 5 positions, it has an adenine nucleotide content of 40%). Modified adenine residues are considered equivalent to adenine for the purpose of assessing adenine nucleotide content.

[0321] As used herein, the term “genomic locus” when used with respect to a genomic locus targeted by a guide RNA includes one or more portions of the genome, and targeting thereof affects the expression of a gene associated with that locus. For example, a genomic locus can include a coding sequence of a gene, an intron sequence of a gene, a regulatory sequence, a transcriptional control sequence of a gene, a translational control sequence of a gene, a splicing site, or an intergenic non-coding sequence (e.g., intergenic space).

[0322] As used herein, the term “contact” refers to providing at least one component such that the component physically contacts a cell, including physically contacting the cell surface, the cytosol, and / or the cell nucleus. “Contacting” a cell with a polypeptide includes, for example, contacting the cell with a nucleic acid encoding the polypeptide such that the cell can express the polypeptide.

[0323] As used herein, the term "simultaneously" when used in connection with contacting a cell with at least two genome editing tools (e.g., a composition, polypeptide, nucleic acid, or combination thereof), refers to the contact of the cell with one of the at least two genome editing tools being within 48 hours of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 36 hours of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 24 hours of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 18 hours of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 12 hours of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 6 hours of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 4 hours of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 3 hours of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 2 hours of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 1 hour of the contact of the cell with the other of the at least two genome editing tools.In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 30 minutes of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 15 minutes of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 10 minutes of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is within 5 minutes of the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the contact of the cell with one of the at least two genome editing tools is simultaneous with the contact of the cell with the other of the at least two genome editing tools. In some embodiments, the two genome editing tools are premixed before contacting the cell.

[0324] As used herein, "indel" refers to an insertion or deletion mutation consisting of several nucleotides inserted, deleted, or inserted and deleted, for example, at a double-strand break (DSB) site of a target nucleic acid. As used herein, when an insertion occurs due to indel formation, this insertion is a random insertion at the DSB site and generally is not induced by or based on the template sequence.

[0325] As used herein, "knockdown" refers to a decrease in the expression of a particular gene product (e.g., protein, mRNA, or both). Protein knockdown can be measured either by detecting the protein secreted by a tissue or cell population (e.g., in serum or cell culture medium) or by detecting the total cellular amount of the protein from the tissue or cell population of interest. Methods for measuring mRNA knockdown are known and include sequencing of mRNA isolated from the tissue or cell population of interest. In some embodiments, "knockdown" can refer to some loss of expression of a particular gene product, e.g., a decrease in the amount of transcribed mRNA, or a decrease in the amount of protein expressed or secreted by a cell population (including in vivo populations such as those found in tissues).

[0326] As used herein, "knockout" refers to the loss of expression of a particular protein in a cell. Knockout can be measured by either detecting the amount of protein secreted from a tissue or cell population (e.g., in serum or cell culture medium) or by detecting the total cellular amount of the protein from the tissue or cell population. In some embodiments, the methods of the present disclosure "knock out" a target protein in one or more cells (including cell populations including in vivo populations such as those found in tissues). In some embodiments, knockout does not form a variant of the target protein created, e.g., by an indel, but rather completely eliminates the expression of the target protein in the cell, i.e., reduces the expression below the detection level of the assay used.

[0327] As used herein, terms such as "cell population comprising edited cells" or "population of cells comprising edited cells" refer to a cell population that includes edited cells, but not all cells of the population need to be edited. A cell population comprising edited cells may also include unedited cells. The percentage of edited cells within a cell population comprising edited cells can be determined by counting the number of edited cells within the population, which is determined by standard cell counting methods. For example, in some embodiments, in a cell population comprising edited cells that contain a single genome edit, at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the cells of the population have the single edit. In some embodiments, in a cell population comprising edited cells that contain at least two genome edits, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the cells of the population have at least two genome edits.

[0328] As used herein, "β2M" or "B2M" refers to the nucleic acid or protein sequence of "β-2 microglobulin", and the human gene has accession number NC_000015 (range 44711492..44718877), reference GRCh38.p13. The B2M protein associates as a heterodimer with MHC class I molecules on the surface of nucleated cells and is required for the expression of MHC class I proteins.

[0329] As used herein, "CIITA" or "CIITA" or "C2TA" refers to the nucleic acid or protein sequence of "class II major histocompatibility complex transactivator", and the human gene has accession number NC_000016.10 (range 10866208..10941562), reference GRCh38.p13. The CIITA protein in the nucleus functions as a positive regulatory gene for the transcription of MHC class II genes and is required for the expression of MHC class II proteins.

[0330] As used herein, "MHC" or "MHC molecule(s)" or "MHC protein" or "MHC complex(es)" refers to major histocompatibility complex molecule(s), including, for example, MHC class I and MHC class II molecules. In humans, MHC molecules are referred to as the "human leukocyte antigen" complex, "HLA molecule" or "HLA protein". The use of the terms "MHC" and "HLA" is not meant to be limiting, and as used herein, the term "MHC" can be used to refer to human MHC molecules, i.e., HLA molecules. Thus, the terms "MHC" and "HLA" are used interchangeably herein.

[0331] The term "HLA-A", as used herein in the context of an HLA-A protein, refers to an MHC class I protein molecule that is a heterodimer consisting of a heavy chain (encoded by the HLA-A gene) and a light chain (i.e., beta-2 microglobulin). The term "HLA-A" or "HLA-A gene", as used herein, in the context of a nucleic acid, refers to the gene that encodes the heavy chain of the HLA-A protein molecule. The HLA-A gene is also referred to as "HLA class I histocompatibility, A alpha chain", and the human gene has accession number NC_000006.12 (29942532..29945870). The HLA-A gene is known to have thousands of different types (also referred to as "alleles") across the population (an individual can receive two different alleles of the HLA-A gene). Public databases of HLA-A alleles containing sequence information can be accessed at IPD-IMGT / HLA: https: / / www.ebi.ac.uk / ipd / imgt / hla / . All alleles of HLA-A are encompassed by the terms "HLA-A" and "HLA-A gene".

[0332] "HLA-B", as used herein in the context of nucleic acids, refers to the gene encoding the heavy chain of the HLA-B protein molecule. HLA-B is also referred to as "HLA class I histocompatibility, B alpha chain", and the human gene has the accession number NC_000006.12(31353875..31357179).

[0333] "HLA-C", as used herein in the context of nucleic acids, refers to the gene encoding the heavy chain of the HLA-C protein molecule. HLA-C is also referred to as "HLA class I histocompatibility, C alpha chain", and the human gene has the accession number NC_000006.12(31268749..31272092).

[0334] "TRBC1" and "TRBC2", as used herein in connection with nucleic acids, refer to two homologous genes encoding the T cell receptor beta chain. "TRBC" or "TRBC1 / 2" are used herein to refer to TRBC1 and TRBC2. The human wild-type TRBC1 sequence is available at NCBI Gene ID:28639;Ensembl:ENSG00000211751. T cell receptor beta constant, V_segment translation product, BV05S1J2.2, TCRBC1, and TCRB are gene synonyms for TRBC1. The human wild-type TRBC2 sequence is available at NCBI Gene ID:28638;Ensembl:ENSG00000211772. T cell receptor beta constant, V_segment translation product, and TCRBC2 are gene synonyms for TRBC2.

[0335] "TRAC" is used to refer to the nucleic acid sequence or amino acid sequence of the "T cell receptor alpha chain". The human wild-type TRAC sequence is available at NCBI Gene ID:28755;Ensembl:ENSG00000277734. T cell receptor alpha constant, TCRA, IMD7, TRCA, and TRA are gene synonyms for TRAC.

[0336] "TRBC" is used to refer to the nucleic acid or amino acid sequences of "T cell receptor beta chain", e.g., TRBC1 and TRBC2. "TRBC1" and "TRBC2" refer to two homologous genes encoding the T cell receptor beta chain, which is the gene product of the TRBC1 or TRBC2 gene.

[0337] The human wild-type TRBC1 sequence is available at NCBI Gene ID:28639;Ensembl:ENSG00000211751. T cell receptor beta constant, V_segment translation product, BV05S1J2.2, TCRBC1, and TCRB are gene synonyms of TRBC1.

[0338] The human wild-type TRBC2 sequence is available at NCBI Gene ID:28638;Ensembl:ENSG00000211772. T cell receptor beta constant, V_segment translation product, and TCRBC2 are gene synonyms of TRBC2.

[0339] As used herein, the term "homozygous" refers to having two identical alleles of a particular gene.

[0340] As used herein, "treatment" refers to any administration or application of treatment for a disease or disorder in a subject, including inhibiting the disease, arresting its progression, alleviating one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease, including recurrence of symptoms.

[0341] As used herein, "deliver" and "administer" are used interchangeably and include ex vivo and in vivo applications.

[0342] As used herein, co - administration means that a plurality of substances are administered at a time when they are sufficiently close to act together. Co - administration includes administering a plurality of substances together as a single formulation and administering a plurality of substances as separate formulations at a time when they are sufficiently close to act together.

[0343] As used herein, the expression "pharmaceutically acceptable" generally means non - toxic, not biologically undesirable, and otherwise not unacceptable for pharmaceutical use, and is useful for preparing pharmaceutical compositions. Pharmaceutically acceptable substances generally refer to non - pyrogenic substances. Pharmaceutically acceptable substances may in particular refer to sterile substances for pharmaceutical substances for injection or infusion.

[0344] As used herein, "subject" refers to any member of the animal kingdom. In some embodiments, "subject" refers to a human. In some embodiments, "subject" refers to a non - human animal. In some embodiments, "subject" refers to a primate. In some embodiments, subjects include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, or worms. In certain embodiments, non - human subjects are mammals (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, or pigs). In some embodiments, the subject can be a transgenic animal, a genetically engineered animal, or a clone. In certain embodiments of the invention, the subject is an adult, adolescent, or infant. In some embodiments, the terms "individual" or "patient" are used and are intended to be interchangeable with "subject".

[0345] As used herein, "reduction or elimination" of protein expression in a cell refers to the partial or complete absence of expression of that protein as compared to an unmodified cell. In some embodiments, surface expression of a protein on a cell is "reduced or eliminated" compared to an unmodified cell, as demonstrated by a reduction in the fluorescence signal when stained with the same antibody against the protein, as measured by flow cytometry. A cell that "reduces or eliminates" surface expression of a protein by flow cytometry compared to an unmodified cell may be referred to as "negative" for expression of that protein, as demonstrated by a fluorescence signal similar to that of a cell stained with an isotype control antibody. "Reduction or elimination" of protein expression can be measured by other known techniques in the art using appropriate controls known to those of skill in the art. As used herein, "eliminated" expression is understood to mean that expression is reduced to below the level of detection of the protein by the method used.

[0346] The term "about" or "approximately" means an acceptable error for a particular numerical value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined. Or, the degree of variation that does not materially affect the characteristics of the subject being described, or within the accepted ranges in the art, e.g., within 10%, 5%, 2%, or 1% or within 2 standard deviations of a series of values. Accordingly, unless otherwise indicated, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. Each numerical parameter should at least be construed in light of the reported number of significant digits and by applying ordinary rounding techniques, not as attempts to limit the application of the doctrine of equivalents to the claims.

[0347] Here, a particular embodiment of the present invention will be described in detail. Examples thereof are shown in the accompanying drawings. Although the present invention is described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the present invention to those embodiments. On the contrary, the present invention is defined by the appended claims and is intended to cover all alternatives, modifications, and equivalents that may be included within the scope of the present invention by the embodiments included.

[0348] Before explaining the teachings of the present invention in detail, it should be understood that, since certain compositions or process steps may vary, the present disclosure is not limited thereto. As used herein and in the appended claims, it should be noted that the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a conjugate" includes a plurality of conjugates, reference to "a cell" includes a plurality of cells, and the like.

[0349] Numerical ranges include the numbers defining the range. Measured values and measurable values are understood to be approximate values taking into account significant figures and errors associated with the measurement. Also, the use of "comprise", "comprises", "comprising", "contain", "contains", "containing", "include", "includes", and "including" is not intended to be limiting. It should be understood that the foregoing general description and the mode for carrying out the invention are merely illustrative and explanatory and not restrictive of the present teachings.

[0350] Unless otherwise noted specifically in this specification, in the embodiments described in this specification, embodiments that describe various components as "including" are also contemplated to "consist of" or "consist essentially of" the described components, and embodiments described as "consisting of" various components in this specification are also contemplated to "include" or "consist essentially of" the described components. Further, in the embodiments described in this specification as "consisting essentially of" various components, it is also contemplated to "consist of" or "include" the described components (this interchangeability does not apply to the use of these terms in the claims).

[0351] The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context specifically dictates otherwise.

[0352] The section headings used in this specification are for organization purposes only and should not be construed in any way as limiting the desired subject matter. If any material incorporated by reference conflicts with any term defined in this specification or any other explicit content of this specification, this specification prevails. Although the present teachings are described in conjunction with various embodiments, this is not intended to limit the present teachings to such embodiments. On the contrary, the present teachings include various alternatives, modifications, and equivalents, as would be understood by those skilled in the art.

[0353] II. First Genome Editing Tool In some embodiments, the first genome editing tool includes a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the first genome editor. In some embodiments, the first genome editing tool includes a first genome editor that includes a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the base editor.

[0354] In some embodiments, the first genome editor is delivered to the cell as at least one polypeptide or at least one mRNA. In some embodiments, the first genome editor comprises at least one polypeptide or at least one mRNA. In some embodiments, the first genome editor comprises a nickase, a nicking nuclease, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

[0355] In some embodiments, the first genome editor comprises a Cas nuclease. In some embodiments, the Cas nuclease is Cas9. In some embodiments, Cas9 is Streptococcus pyogenes Cas9 (SpyCas9), S. aureus Cas9 (SauCas9), C. diphtheriae Cas9 (CdiCas9), Streptococcus thermophilus Cas9 (St1Cas9), A. cellulolyticus Cas9 (AceCas9), C. jejuni Cas9 (CjeCas9), R. palustris Cas9 (RpaCas9), R. rubrum Cas9 (RruCas9), A. naeslundii Cas9 (AnaCas9), Francisella novicida Cas9 (FnoCas9), or N. meningitidis (NmeCas9). In some embodiments, Cas9 is Nme1Cas9, Nme2Cas9, Nme3Cas9, or SpyCas9. In some embodiments, the Cas nuclease is a class 2 Cas nuclease. In some embodiments, the Cas nuclease is Cas12. In some embodiments, Cas12 is Lachnospiraceae bacterium Cas12a (LbCas12a) or Cas12 is Acidaminococcus sp. Cas12a (AsCas12a). In some embodiments, the Cas nuclease is Eubacterium siraeum Cas13d (EsCas13d).

[0356] In some embodiments, the first genome editor or base editor comprises a cytidine deaminase (e.g., A3A). In some embodiments, the first genome editor or base editor comprises a cytidine deaminase (including any one of the cytidine deaminases disclosed herein, e.g., A3A) and an RNA-guided nickase (including any one of the RNA-guided nickases disclosed herein). In some embodiments, the base editor is a C-to-T base editor optionally comprising a cytidine deaminase or an A-to-G base editor optionally comprising an adenosine deaminase.

[0357] In some embodiments, the first genome editing tool may be combined with any second genome editing tool disclosed herein.

[0358] A. UGI In some embodiments, the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are included in a single polypeptide. In some embodiments, the first genome editing tool comprises a UGI, and the UGI and the base editor are included in different polypeptides. In some embodiments, the base editor comprises a cytidine deaminase and an RNA-guided nickase. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are included in a single polypeptide. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are included in different polypeptides. In some embodiments, the cytidine deaminase and the RNA-guided nickase are included in a single polypeptide, and the UGI is included in a different polypeptide.

[0359] Although not bound by any theory, providing together UGI and a polypeptide comprising a deaminase may be useful in the methods described herein by inhibiting the DNA repair machinery of the cell (e.g., UDG and downstream repair effectors) that recognizes uracil of DNA as a form of DNA damage or otherwise removes or modifies uracil and / or the nucleotides surrounding it. It will be appreciated that by using UGI, the editing efficiency of enzymes that can deaminate C residues may be increased.

[0360] Suitable UGI proteins and nucleotide sequences are provided herein. Additional suitable UGI sequences are known to those of skill in the art and include, for example, those disclosed in Wang et al., Uracil-DNA glycosylase inhibitor gene of bacteriophage PBS2 encodes a binding protein specific for uracil-DNA glycosylase. J. Biol. Chem. 264:1163-1171 (1989), Lundquist et al., Site-directed mutagenesis and characterization of uracil-DNA glycosylase inhibitor protein. Role of specific carboxylic amino acids in complex formation with Escherichia coli uracil-DNA glycosylase. J. Biol. Chem. 272:21408-21419 (1997), Ravishankar et al., X-ray analysis of a complex of Escherichia coli uracil DNA glycosylase (EcUDG) with a proteinaceous inhibitor. The structure elucidation of a prokaryotic UDG. Nucleic Acids Res. 26:4880-4887 (1998), and Putnam et al., Protein mimicry of DNA from crystal structures of the uracil-DNA glycosylase inhibitor protein and its complex with Escherichia coli uracil-DNA glycosylase. J. Mol. Biol. 287:331-346 (1999), each of which is incorporated herein by reference in its entirety. It should be understood that any protein capable of inhibiting the uracil-DNA glycosylase base excision repair enzyme is within the scope of the present disclosure.Furthermore, any protein that blocks or inhibits base excision repair is also within the scope of the present disclosure. In some embodiments, the uracil glycosylase inhibitor is a protein that binds to uracil. In some embodiments, the uracil glycosylase inhibitor is a protein that binds to uracil in DNA. In some embodiments, the uracil glycosylase inhibitor is a single-stranded binding protein. In some embodiments, the uracil glycosylase inhibitor is a catalytically inactive uracil DNA-glycosylase protein. In some embodiments, the uracil glycosylase inhibitor is a catalytically inactive uracil DNA-glycosylase protein that does not remove uracil from DNA. In some embodiments, the uracil glycosylase inhibitor is a catalytically inactive UDG.

[0361] In some embodiments, the uracil glycosylase inhibitor (UGI) disclosed herein comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 15 or 24. In some embodiments, any of the foregoing levels of identity is at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the UGI comprises an amino acid sequence that has at least 90% identity to SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises an amino acid sequence that has at least 95% identity to SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises an amino acid sequence that has at least 98% identity to SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises an amino acid sequence that has at least 99% identity to SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises the amino acid sequence of SEQ ID NO: 15 or 24.

[0362] B. Cytidine Deaminase Cytidine deaminase encompasses enzymes within the cytidine deaminase superfamily, in particular enzymes of the APOBEC family (enzymes APOBEC1, APOBEC2, APOBEC4, and the APOBEC3 subfamily), activation-induced cytidine deaminase (AID or AICDA), as well as CMP deaminase (see, for example, Conticello et al., Mol. Biol. Evol. 22:367-77, 2005, Conticello, Genome Biol. 9:229, 2008, Muramatsu et al., J. Biol. Chem. 274:18470-6, 1999); and Carrington et al., Cells 9:1690 (2020)).

[0363] In some embodiments, the cytidine deaminase disclosed herein is an enzyme of the APOBEC family. In some embodiments, the cytidine deaminase disclosed herein is an enzyme of APOBEC1, APOBEC2, APOBEC4, and the APOBEC3 subfamily. In some embodiments, the cytidine deaminase disclosed herein is an enzyme of the APOBEC3 subfamily. In some embodiments, the cytidine deaminase disclosed herein is APOBEC3A deaminase (A3A).

[0364] In some embodiments, the cytidine deaminase is a cytidine deaminase comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identity to SEQ ID NO: 22.

[0365] 1. APOBEC3A deaminase In some embodiments, the APOBEC3A deaminase (A3A) disclosed herein is human A3A. In some embodiments, A3A is wild-type A3A.

[0366] In some embodiments, A3A is an A3A variant. A3A variants share homology to wild-type A3A or a fragment thereof. In some embodiments, the A3A variant has at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity to wild-type A3A. In some embodiments, the A3A variant can have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid changes compared to wild-type A3A. In some embodiments, the A3A variant comprises a fragment of A3A that has at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity to the corresponding fragment of wild-type A3A.

[0367] In some embodiments, the A3A variant is a protein having a sequence different from the wild-type A3A protein by one or more mutations such as substitutions, deletions, insertions, one or more point substitutions. In some embodiments, a truncated A3A sequence may be used by deleting N-terminal, C-terminal, or internal amino acids. In some embodiments, a truncated A3A sequence with 1 to 4 amino acids deleted at the C-terminus of the sequence is used. In some embodiments, APOBEC3A (such as human APOBEC3A) has the 57th position of the wild-type amino acids (when numbered in the wild-type sequence). In some embodiments, APOBEC3A (such as human APOBEC3A) has asparagine at the 57th position of the amino acids (when numbered in the wild-type sequence).

[0368] In some embodiments, the wild-type A3A is human A3A (UniPROT accession ID: p319411, SEQ ID NO: 22).

[0369] In some embodiments, the A3A disclosed herein comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 22. In some embodiments, the level of identity is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, A3A comprises an amino acid sequence having at least 87% identity with SEQ ID NO: 22. In some embodiments, A3A comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 22. In some embodiments, A3A comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 22. In some embodiments, A3A comprises an amino acid sequence having at least 98% identity with SEQ ID NO: 22. In some embodiments, A3A comprises an amino acid sequence having at least 99% identity with SEQ ID NO: 22. In some embodiments, A3A comprises the amino acid sequence of SEQ ID NO: 22.

[0370] C. Linker In some embodiments, the first genome editor or base editor described herein further comprises a linker that links a deaminase and an RNA-guided nickase. In some embodiments, the linker is an organic molecule, a polymer, or a chemical moiety. In some embodiments, the linker is a peptide linker. In some embodiments, the nucleic acid encoding the polypeptide comprising the deaminase and the RNA-guided nickase further comprises a sequence encoding a peptide linker. An mRNA encoding a deaminase-linker-RNA-guided nickase fusion protein is provided.

[0371] In some embodiments, the peptide linker is any amino acid region having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, or at least 50 or more amino acids.

[0372] In some embodiments, the peptide linker is a 16-residue "XTEN" linker, or a variant thereof (see, e.g., Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises a sequence that is any one of SGSETPGTSESATPES (SEQ ID NO: 25), SGSETPGTSESA (SEQ ID NO: 26), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 27). In some embodiments, the XTEN linker consists of the sequence SGSETPGTSESATPES (SEQ ID NO: 25), SGSETPGTSESA (SEQ ID NO: 26), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 27).

[0373] In some embodiments, the peptide linker is (GGGGS) n (e.g., SEQ ID NO: 73, 77, 82, 101), (G) n , (EAAAK) n (e.g., SEQ ID NO: 74, 80, 128), (GGS) n , contains the SGSETPGTSESATPES (SEQ ID NO: 25) motif (see, e.g., Guilinger J P, Thompson D B, Liu D R. Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 2014;32(6):577-82, which is incorporated herein by reference in its entirety), or (XP) n motif (SEQ ID NO: 407), or any combination thereof, wherein n is independently an integer from 1 to 30. See WO2015089406, e.g., paragraph

[0012] , which is incorporated herein by reference in its entirety.

[0374] In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NOs: 25-39 and 72-133. In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, and SEQ ID NO: 133. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 129.

[0375] D. RNA-guided nickase In some embodiments, the RNA-guided nickase disclosed herein is a Cas nickase. In some embodiments, the RNA-guided nickase is derived from a specific Cas nuclease in which the catalytic domain(s) has been inactivated. In some embodiments, the RNA-guided nickase is a class 2 Cas nickase such as Cas9 nickase or Cpf1 nickase. In some embodiments, the RNA-guided nickase is S. pyogenes Cas9 nickase. In some embodiments, the RNA-guided nickase is Neisseria meningitidis Cas9 nickase.

[0376] In some embodiments, the RNA-guided nickase is a modified class 2 Cas protein or is derived from a class 2 Cas protein. In some embodiments, the RNA-guided nickase is modified or is derived from a Cas protein, such as a class 2 Cas nuclease (which may be, for example, a type II, V, or VI Cas nuclease). Examples of class 2 Cas nucleases include, for example, Cas9, Cpf1 (Cas12a), C2c1, C2c2, and C2c3 proteins, and modifications thereof. Examples of Cas9 nucleases include those of the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, for example, the list in the following paragraph), and modified (e.g., engineered or variant) forms thereof. See, for example, US2016 / 0312198 A1, US2016 / 0312199 A1, which are incorporated herein by reference in their entireties. Other examples of Cas nucleases include the Csm complex or Cmr complex of the type III CRISPR system, or their Cas10 subunit, Csm1 subunit or Cmr2 subunit, and the Cascade complex of the type I CRISPR system, or its Cas3 subunit. In some embodiments, the Cas nuclease can be derived from a type IIA, type IIB, or type IIC system. For discussion of various CRISPR systems and Cas nucleases, see, for example, Makarova et al., Nat. Rev. Microbiol. 9:467-477 (2011); Makarova et al., Nat. Rev. Microbiol, 13:722-36 (2015), Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0377] The Cas nickases described in this specification are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp.、It may be the nickase form of a Cas nuclease derived from a species including, but not limited to, Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, or Acaryochloris marina.

[0378] In some embodiments, the Cas nickase is the nickase form of the Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nickase is the nickase form of the Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nickase is the nickase form of the Cas9 nuclease from Neisseria meningitidis. See, for example, WO / 2020081568, which describes Nme2Cas9 D16A nickase. In some embodiments, the Cas nickase is the nickase form of the Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nickase is the nickase form of the Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nickase is the nickase form of the Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nickase is the nickase form of the Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nickase is the nickase form of the Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nickase is the nickase form of the Cpf1 nuclease from Acidaminococcus or Lachnospiraceae.As described elsewhere, nickase is a form of nuclease in which one of the two catalytic domains is inactivated by mutating active site residues important for nucleolysis, such as D10, H840, or N863 of Spy Cas9, and thus, the nickase can be derived from (i.e., related to) a particular Cas nuclease. One of ordinary skill in the art will be familiar with techniques for readily identifying corresponding residues in other Cas proteins, such as sequence alignment and structural alignment, which are discussed in detail below.

[0379] In other embodiments, the Cas nickase can be related to a type I CRISPR / Cas system. In some embodiments, the Cas nickase can be a component of the Cascade complex of the type I CRISPR / Cas system. In some embodiments, the Cas nickase can be a Cas3 protein. In some embodiments, the Cas nickase can be derived from a type III CRISPR / Cas system.

[0380] In some embodiments, the Cas nickase is a nickase form of a Cas nuclease or a modified Cas nuclease in which the nucleotide strand cleavage active site is inactivated by, for example, one or more modifications (e.g., point mutations) in the catalytic domain. See, e.g., U.S. Patent No. 8,889,356 for a discussion of Cas nickases and exemplary catalytic domain modifications.

[0381] Wild-type S. pyogenes Cas9 has two catalytic domains, RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of the DNA. In some embodiments, the Cas nuclease may include amino acid substitutions in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, for example, Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may include amino acid substitutions in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the Cas9 protein of S. pyogenes). See, for example, Zetsche et al. (2015). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain, or the RuvC or RuvC-like domain of N. meningitidis, include Nme2Cas9D16A (HNH nickase) and Nme2Cas9H588A (RuvC nickase). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB-A0Q7Q2(CPF1_FRATN))).

[0382] In some embodiments, the Cas nickase (e.g., Cas9 nickase) has an inactivated RuvC or HNH domain. In some embodiments, a nickase having a reduced-activity RuvC domain is used. In some embodiments, a nickase having an inactive RuvC domain is used. In some embodiments, a nickase having a reduced-activity HNH domain is used. In some embodiments, a nickase having an inactive HNH domain is used.

[0383] In some embodiments, the Cas9 nickase has an active HNH nuclease domain and can cleave the non-target strand of DNA, i.e., the strand to which the gRNA binds. It also has an inactive RuvC nuclease domain and cannot cleave the target strand of DNA, i.e., the strand on which base editing by the deaminase is desired.

[0384] An exemplary Cas9 nickase amino acid sequence is provided as SEQ ID NO: 41. An exemplary Cas9 nickase mRNA coding sequence suitable for inclusion in a fusion protein is provided as SEQ ID NO: 42.

[0385] In some embodiments, the RNA-guided nickase is a Class 2 Cas nickase described herein. In some embodiments, the RNA-guided nickase is a Cas9 nickase described herein.

[0386] In some embodiments, the RNA-guided nickase is the S. pyogenes Cas9 nickase described herein.

[0387] In some embodiments, the RNA-guided nickase is the D10A SpyCas9 nickase described herein. In some embodiments, the RNA-guided nickase comprises an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NOs: 41, 43, or 45. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 41.

[0388] In some embodiments, the nucleic acid or the first ORF encoding the polypeptide comprises a nucleotide sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% identity with any one of the nucleotide sequences of SEQ ID NO: 42, 44, or 46. In some embodiments, the nucleic acid or the first ORF encoding the polypeptide comprises a nucleotide sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% identity with any one of the nucleotide sequences of SEQ ID NO: 42, 44, and 46-58. In some embodiments, the level of identity is at least 90%. In some embodiments, the level of identity is at least 95%. In some embodiments, the level of identity is at least 98%. In some embodiments, the level of identity is at least 99%. In some embodiments, the level of identity is at least 100%. In some embodiments, the sequence encoding the RNA-guided nickase comprises any one of the nucleotide sequences of SEQ ID NO: 42, 44, and 46.

[0389] In some embodiments, the RNA-guided nickase is the Neisseria meningitidis (Nme) Cas9 nickase described herein.

[0390] In some embodiments, the RNA-guided nickase is the D16A NmeCas9 nickase described herein. In some embodiments, the D16A NmeCas9 nickase is the D16A Nme2Cas9 nickase. In some embodiments, the D16A Nme2Cas9 nickase comprises an amino acid sequence that is at least 80%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 149. In some embodiments, the sequence encoding D16A Nme2Cas9 comprises a nucleotide sequence that is at least 80%, 90%, 95%, 98%, 99%, or 100% identical to any one of SEQ ID NO: 150-155.

[0391] A composition comprising a cytidine deaminase and an RNA-guided nickase In some embodiments, the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the first genome editor. In some embodiments, the first genome editing tool comprises a first genome editor that is a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the base editor.

[0392] In some embodiments, the first genome editing tool comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are included in a single polypeptide. In some embodiments, the first genome editing tool comprises a UGI, and the UGI and the base editor are included in different polypeptides. In some embodiments, the base editor comprises a cytidine deaminase and an RNA-guided nickase. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are included in a single polypeptide. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are included in different polypeptides. In some embodiments, the cytidine deaminase and the RNA-guided nickase are included in a single polypeptide, and the UGI is included in a different polypeptide.

[0393] 1. Exemplary compositions In some embodiments, a first genome editor (e.g., a base editor) comprising a deaminase (e.g., cytidine deaminase) and an RNA-guided nickase is provided. In some embodiments, an enzyme of the APOBEC family and an RNA-guided nickase are provided. In some embodiments, the first genome editor comprises an enzyme of the APOBEC1 subgroup and an RNA-guided nickase. In some embodiments, the first genome editor comprises an enzyme of the APOBEC2 subgroup and an RNA-guided nickase. In some embodiments, the first genome editor comprises an enzyme of the APOBEC4 subgroup and an RNA-guided nickase. In some embodiments, the first genome editor comprises an enzyme of the APOBEC3 subgroup and an RNA-guided nickase.

[0394] In some embodiments, a first genome editor or base editor comprising a deaminase (e.g., cytidine deaminase) and an RNA-guided nickase is provided. In some embodiments, an enzyme of the APOBEC family and the D10A SpyCas9 nickase are provided. In some embodiments, the first genome editor comprises an enzyme of the APOBEC1 subgroup and the D10A SpyCas9 nickase. In some embodiments, the first genome editor comprises an enzyme of the APOBEC2 subgroup and the D10A SpyCas9 nickase. In some embodiments, the first genome editor comprises an enzyme of the APOBEC4 subgroup and the D10A SpyCas9 nickase. In some embodiments, the first genome editor comprises an enzyme of the APOBEC3 subgroup and the D10A SpyCas9 nickase.

[0395] In some embodiments, a first genome editor or base editor is provided that includes a deaminase (e.g., cytidine deaminase) and an RNA-guided nickase. In some embodiments, an APOBEC family enzyme and D16A NmeCas9 nickase are provided. In some embodiments, an APOBEC family enzyme and D16A Nme2Cas9 nickase are provided. In some embodiments, the first genome editor includes an enzyme of the APOBEC1 subgroup and D16A Nme2Cas9 nickase. In some embodiments, the first genome editor includes an enzyme of the APOBEC2 subgroup and D16A Nme2Cas9 nickase. In some embodiments, the first genome editor includes an enzyme of the APOBEC4 subgroup and D16A Nme2Cas9 nickase. In some embodiments, the first genome editor includes an enzyme of the APOBEC3 subgroup and D16A Nme2Cas9 nickase.

[0396] In some embodiments, the first genome editor lacks UGI. In some embodiments, the first genome editor includes one or more UGIs.

[0397] In some embodiments, the cytidine deaminase and the RNA-guided nickase are linked via a linker. In some embodiments, the cytidine deaminase and the RNA-guided nickase are linked via a peptide linker. In some embodiments, the peptide linker includes one or more sequences selected from SEQ ID NOs: 25-39 and 72-133.

[0398] In some embodiments, the first genome editor further includes one or more additional heterologous functional domains. In some embodiments, the first genome editor further includes one or more nuclear localization sequences (NLSs) (described herein) at the C-terminus of the polypeptide or at the N-terminus of the polypeptide.

[0399] In some embodiments, a first genome editor or base editor is provided that includes a deaminase (e.g., cytidine deaminase) and an RNA-guided nickase. In some embodiments, an APOBEC family enzyme and an RNA-guided nickase are provided. In some embodiments, the first genome editor includes an enzyme of the APOBEC1 subgroup and an RNA-guided nickase. In some embodiments, the first genome editor includes an enzyme of the APOBEC2 subgroup and an RNA-guided nickase. In some embodiments, the first genome editor includes an enzyme of the APOBEC4 subgroup and an RNA-guided nickase. In some embodiments, the first genome editor includes an enzyme of the APOBEC3 subgroup and an RNA-guided nickase.

[0400] In some embodiments, a first genome editor or base editor is provided that includes a deaminase (e.g., cytidine deaminase) and an RNA-guided nickase. In some embodiments, the enzyme of the APOBEC family and D10A SpyCas9 nickase, and the enzyme of the APOBEC family and D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genome editor includes an enzyme of the APOBEC family and D10A SpyCas9 nickase, and at the C-terminus of this fusion polypeptide, includes a nuclear localization sequence (NLS). In some embodiments, the first genome editor includes an enzyme of the APOBEC family and D10A SpyCas9 nickase, and at the N-terminus of this fusion polypeptide, includes an NLS. In some embodiments, the first genome editor includes an enzyme of the APOBEC family and D10A SpyCas9 nickase, and the enzyme of the APOBEC family and D10A SpyCas9 nickase are fused via a linker. Further, the first genome editor includes an NLS optionally fused via a linker to the C-terminus of D10A SpyCas9 nickase. In some embodiments, the first genome editor includes an enzyme of the APOBEC family and D10A SpyCas9 nickase, and the enzyme of the APOBEC family and D10A SpyCas9 nickase are fused via a linker. Further, the first genome editor includes an NLS optionally fused via a linker to the C-terminus of D10A SpyCas9 nickase.

[0401] In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A NmeCas9 nickase, and the APOBEC family enzyme and the D16A NmeCas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, and the APOBEC family enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, and the fusion polypeptide comprises a nuclear localization sequence (NLS) at its C-terminus. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, and the fusion polypeptide comprises an NLS at its N-terminus. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, and the APOBEC family enzyme and the D16A Nme2Cas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of the D16A Nme2Cas9 nickase. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, and the APOBEC family enzyme and the D16A Nme2Cas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of the D16A Nme2Cas9 nickase.

[0402] In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and D10A SpyCas9 nickase, and the APOBEC1 subfamily enzyme and D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and D10A SpyCas9 nickase, and a nuclear localization sequence (NLS) is included at the C-terminus of this fusion polypeptide. In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and D10A SpyCas9 nickase, and an NLS is included at the N-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and D10A SpyCas9 nickase, and the APOBEC1 subfamily enzyme and D10A SpyCas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of D10A SpyCas9 nickase. In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and D10A SpyCas9 nickase, and the APOBEC1 subfamily enzyme and D10A SpyCas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of D10A SpyCas9 nickase.

[0403] In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and a D16A Nme2Cas9 nickase, and the APOBEC1 subfamily enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and a D16A Nme2Cas9 nickase, and the APOBEC1 subfamily enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and a D16A Nme2Cas9 nickase, and the C-terminus of this fusion polypeptide comprises a nuclear localization sequence (NLS). In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and a D16A Nme2Cas9 nickase, and the N-terminus of this fusion polypeptide comprises an NLS. In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and a D16A Nme2Cas9 nickase, and the APOBEC1 subfamily enzyme and the D16A Nme2Cas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of the D16A Nme2Cas9 nickase. In some embodiments, the first genome editor comprises an APOBEC1 subfamily enzyme and a D16A Nme2Cas9 nickase, and the APOBEC1 subfamily enzyme and the D16A Nme2Cas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of the D16A Nme2Cas9 nickase.

[0404] In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and D10A SpyCas9 nickase, and the APOBEC3 subfamily enzyme and D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and D10A SpyCas9 nickase, and the C-terminus of this fusion polypeptide comprises a nuclear localization sequence (NLS). In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and D10A SpyCas9 nickase, and the N-terminus of this fusion polypeptide comprises an NLS. In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and D10A SpyCas9 nickase, and the APOBEC3 subfamily enzyme and D10A SpyCas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of the D10A SpyCas9 nickase. In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and D10A SpyCas9 nickase, and the APOBEC3 subfamily enzyme and D10A SpyCas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of the D10A SpyCas9 nickase.

[0405] In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and a D16A Nme2Cas9 nickase, and the APOBEC3 subfamily enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and a D16A Nme2Cas9 nickase, and the APOBEC3 subfamily enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and a D16A Nme2Cas9 nickase, and the fusion polypeptide comprises a nuclear localization sequence (NLS) at its C-terminus. In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and a D16A Nme2Cas9 nickase, and the fusion polypeptide comprises an NLS at its N-terminus. In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and a D16A Nme2Cas9 nickase, and the APOBEC3 subfamily enzyme and the D16A Nme2Cas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of the D16A Nme2Cas9 nickase. In some embodiments, the first genome editor comprises an APOBEC3 subfamily enzyme and a D16A Nme2Cas9 nickase, and the APOBEC3 subfamily enzyme and the D16A Nme2Cas9 nickase are fused via a linker. Further, the first genome editor comprises an NLS optionally fused via a linker to the C-terminus of the D16A Nme2Cas9 nickase.

[0406] In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In any of the foregoing embodiments, the D10A SpyCas9 nickase may comprise an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 41, 43, and 45.

[0407] In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to SEQ ID NO: 22. In any of the foregoing embodiments, the D16A Nme2Cas9 nickase may comprise an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 149.

[0408] In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In any of the foregoing embodiments, D10A SpyCas9 comprises an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 41, 43, and 45.

[0409] In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In any of the foregoing embodiments, the D16A Nme2Cas9 nickase comprises an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 149.

[0410] The first genome editor can be composed of any means for forming a single strand. The NLS can be at the N-terminus or C-terminus, or both the N-terminus and C-terminus. The cytidine deaminase can be on the N-terminal side or C-terminal side with respect to the RNA-guided nickase. In some embodiments, the first genome editor includes, from the N-terminus to the C-terminus, a cytidine deaminase, optionally a linker, an RNA-guided nickase, and optionally an NLS. In some embodiments, the first genome editor includes, from the N-terminus to the C-terminus, an RNA-guided nickase, optionally a linker, a cytidine deaminase, and optionally an NLS. In some embodiments, the first genome editor includes, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, and a cytidine deaminase. In some embodiments, the first genome editor includes, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, a cytidine deaminase, and optionally an NLS.

[0411] In some embodiments, the first genome editor includes, from the N-terminus to the C-terminus, optionally an NLS, an enzyme of the APOBEC family, optionally a linker, an RNA-guided nickase, and optionally an NLS. In some embodiments, the first genome editor includes, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, an enzyme of the APOBEC family, and optionally an NLS. In some embodiments, the first genome editor includes, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, an enzyme of the APOBEC family, and optionally an NLS. In some embodiments, the first genome editor includes, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, an enzyme of the APOBEC family, and optionally an NLS.

[0412] In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, an enzyme of the APOBEC3 subgroup, optionally a linker, an RNA-guided nickase, and optionally an NLS. In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, an enzyme of the APOBEC3 subgroup, and optionally an NLS. In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, an enzyme of the APOBEC3 subgroup, and optionally an NLS. In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, an enzyme of the APOBEC3 subgroup, and optionally an NLS.

[0413] In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, an enzyme of the APOBEC family, optionally a linker, D10A SpyCas9 nickase or D16A Nme2Cas9 nickase, and optionally an NLS. In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, D10A SpyCas9 nickase or D16A Nme2Cas9 nickase, optionally a linker, an enzyme of the APOBEC family, and optionally an NLS. In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, D10A SpyCas9 nickase or D16A Nme2Cas9 nickase, optionally a linker, an enzyme of the APOBEC family, and optionally an NLS. In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, D10A SpyCas9 nickase or D16A Nme2Cas9 nickase, optionally a linker, an enzyme of the APOBEC family, and optionally an NLS.

[0414] In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, an enzyme of the APOBEC3 subgroup, optionally a linker, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, and optionally an NLS. In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, optionally a linker, an enzyme of the APOBEC3 subgroup, and optionally an NLS. In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, optionally a linker, an enzyme of the APOBEC3 subgroup, and optionally an NLS. In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, optionally a linker, an enzyme of the APOBEC3 subgroup, and optionally an NLS.

[0415] In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, optionally an NLS, an enzyme of the APOBEC3 subgroup, optionally a linker, and a D16A Nme2Cas9 nickase.

[0416] In some embodiments, the first genome editor comprises, from the N-terminus to the C-terminus, (i) optionally an NLS, (ii) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39, and 72-133, (iv) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, and (v) optionally an NLS.

[0417] In some embodiments, the first genome editor, from the N-terminus to the C-terminus, comprises (i) optionally an NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39, and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22, and (v) optionally an NLS.

[0418] In some embodiments, the first genome editor, from the N-terminus to the C-terminus, comprises (i) optionally an NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39, and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22, and (v) optionally an NLS.

[0419] In some embodiments, the first genome editor, from the N-terminus to the C-terminus, comprises (i) optionally an NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39, and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22, and (v) optionally an NLS.

[0420] In some embodiments, the first genome editor, from the N-terminus to the C-terminus, comprises (i) optionally an NLS, (ii) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39, and 72-133, (iv) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, and (v) optionally an NLS.

[0421] In some embodiments, the first genome editor, from the N-terminus to the C-terminus, comprises (i) optionally an NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39, and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22, and (v) optionally an NLS.

[0422] In some embodiments, the first genome editor, from the N-terminus to the C-terminus, comprises (i) optionally an NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39, and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22, and (v) optionally an NLS.

[0423] In some embodiments, the first genome editor, from the N-terminus to the C-terminus, comprises (i) optionally an NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NOs: 25-38, 39, and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22, and (v) optionally an NLS.

[0424] 2. A composition comprising an APOBEC3A deaminase and an RNA-guided nickase In some embodiments, a first genome editing tool comprising a first genome editor is provided. In some embodiments, the first genome editor comprises a base editor. In some embodiments, the first genome editor or the base editor comprises human A3A and an RNA-guided nickase. In some embodiments, the first genome editor or the base editor comprises wild-type A3A and an RNA-guided nickase. In some embodiments, the first genome editor or the base editor comprises an A3A variant and an RNA-guided nickase. In some embodiments, the first genome editor or the base editor comprises A3A and Cas9 nickase. In some embodiments, the first genome editor or the base editor comprises A3A and D10A SpyCas9 nickase. In some embodiments, the first genome editor or the base editor comprises human A3A and D10A SpyCas9 nickase. In some embodiments, the first genome editor or the base editor comprises an A3A variant and D10A SpyCas9 nickase. In some embodiments, the first genome editor or the base editor lacks UGI. In some embodiments, the first genome editor or the base editor comprises one or more UGIs. In some embodiments, the first genome editor or the base editor comprises two UGIs. In some embodiments, A3A and the RNA-guided nickase are linked via a linker. In some embodiments, the first genome editor or the base editor further comprises one or more additional heterologous functional domains. In some embodiments, the first genome editor or the base editor further comprises a nuclear localization sequence (NLS) (described herein) at the C-terminus of the polypeptide or at the N-terminus of the polypeptide.

[0425] In some embodiments, the first genome editor or base editor comprises human A3A and D10A SpyCas9 nickase, and the human A3A and D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genome editor or base editor comprises human A3A and D10A SpyCas9 nickase, and at the C-terminus of this fusion polypeptide, it comprises a nuclear localization sequence (NLS). In some embodiments, the first genome editor or base editor comprises human A3A and D10A SpyCas9 nickase, and at the N-terminus of this fusion polypeptide, it comprises an NLS. In some embodiments, the first genome editor or base editor comprises human A3A and D10A SpyCas9 nickase, and the human A3A and D10A SpyCas9 nickase are fused via a linker. Further, the first genome editor or base editor comprises an NLS optionally fused via a linker to the C-terminus of the D10A SpyCas9 nickase. In some embodiments, the first genome editor or base editor comprises human A3A and D10A SpyCas9 nickase, and the human A3A and D10A SpyCas9 nickase are fused via a linker. Further, the first genome editor or base editor comprises an NLS optionally fused via a linker to the C-terminus of the D10A SpyCas9 nickase.

[0426] In some embodiments, the first genome editor or base editor comprises human A3A and D16A NmeCas9 nickase, and the human A3A and D16A NmeCas9 nickase are fused via a linker. In some embodiments, the first genome editor or base editor comprises human A3A and D16A NmeCas9 nickase, and a nuclear localization sequence (NLS) is included at the C-terminus of this fusion polypeptide. In some embodiments, the first genome editor or base editor comprises human A3A and D16A NmeCas9 nickase, and an NLS is included at the N-terminus of this fusion polypeptide. In some embodiments, the first genome editor or base editor comprises human A3A and D16A NmeCas9 nickase, and the human A3A and D16A NmeCas9 nickase are fused via a linker. Further, the first genome editor or base editor comprises an NLS optionally fused via a linker to the C-terminus of D16A NmeCas9 nickase. In some embodiments, the first genome editor or base editor comprises human A3A and D16A NmeCas9 nickase, and the human A3A and D16A NmeCas9 nickase are fused via a linker. Further, the first genome editor or base editor comprises an NLS optionally fused via a linker to the C-terminus of D16A NmeCas9 nickase.

[0427] The first genome editor or base editor can be composed of any means for forming a single strand. The NLS can be at the N-terminus or C-terminus, or both the N-terminus and C-terminus, and A3A can be on the N-terminal side or C-terminal side with respect to the RNA-guided nickase. In some embodiments, the first genome editor or base editor comprises, from the N-terminus to the C-terminus, A3A, optionally a linker, an RNA-guided nickase, and optionally an NLS. In some first genome editors or base editors, the polypeptide comprises, from the N-terminus to the C-terminus, an RNA-guided nickase, optionally a linker, A3A, and optionally an NLS. In some first genome editors or base editors, the polypeptide comprises, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, and A3A. In some embodiments, the first genome editor or base editor comprises, from the N-terminus to the C-terminus, optionally an NLS, an RNA-guided nickase, optionally a linker, A3A, and optionally an NLS.

[0428] In any of the foregoing embodiments, the first genome editor or base editor may comprise an amino acid sequence having at least 80% identity with SEQ ID NO: 3, 6, or 146. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence having at least 90% identity with SEQ ID NO: 3, 6, or 146. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence having at least 95% identity with SEQ ID NO: 3, 6, or 146. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence having at least 98% identity with SEQ ID NO: 3, 6, or 146. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence having at least 99% identity with SEQ ID NO: 3, 6, or 146. In some embodiments, the first genome editor or base editor disclosed herein may comprise the amino acid sequence of SEQ ID NO: 3, 6, or 146.

[0429] In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity with SEQ ID NO: 2, 5, or 147. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.

[0430] In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity with SEQ ID NO: 1 or 4. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.

[0431] In any of the foregoing embodiments, the first genome editor or base editor may comprise an amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 9, 12, 18, and 21. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence having at least 90% identity with any one of SEQ ID NOs: 9, 12, 18, and 21. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence having at least 95% identity with any one of SEQ ID NOs: 9, 12, 18, and 21. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence having at least 98% identity with any one of SEQ ID NOs: 9, 12, 18, and 21. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence having at least 99% identity with any one of SEQ ID NOs: 9, 12, 18, and 21. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence of any one of SEQ ID NOs: 9, 12, 18, and 21.

[0432] In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity with any one of SEQ ID NOs: 8, 11, 17, and 20. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.

[0433] In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity with any one of SEQ ID NOs: 7, 10, 16, and 19. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.

[0434] In any of the foregoing embodiments, the first genome editor or base editor may comprise an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 136, 139, 142, or 145. In some embodiments, the first genome editor or base editor disclosed herein may comprise the amino acid sequence of SEQ ID NO: 136, 139, 142, or 145. In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 135, 138, 141, or 144. In some embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein comprises the nucleic acid sequence of SEQ ID NO: 135, 138, 141, or 144. In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 134, 137, 140, or 143. In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise the nucleic acid sequence of SEQ ID NO: 134, 137, 140, or 143.

[0435] In any of the foregoing embodiments, A3A may comprise an amino acid sequence having at least 80% identity with SEQ ID NO: 22. In some embodiments, the level of identity is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, A3A comprises the amino acid sequence of SEQ ID NO: 22.

[0436] In any of the foregoing embodiments, the RNA-guided nickase may comprise an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NO: 41, 43, or 45. In some embodiments, the level of identity is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 41. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 43. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 45.

[0437] In any of the foregoing embodiments, A3A may comprise an amino acid sequence having at least 80% identity to SEQ ID NO: 22, and the RNA-guided nickase may comprise an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity to any one of SEQ ID NO: 41, 43, or 45. In some embodiments, A3A comprises the amino acid sequence of SEQ ID NO: 22, and the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 41.

[0438] In any of the foregoing embodiments, the nucleic acid of the ORF encoding the first genome editor or base editor comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1. In any of the foregoing embodiments, the nucleic acid of the ORF encoding the first genome editor or base editor comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 147. In any of the foregoing embodiments, the nucleic acid of the ORF encoding the first genome editor or base editor comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 310.

[0439] III. Second genome editing tool In some embodiments, the second genome editing tool includes a second genome editor and at least one gRNA that targets at least one genomic locus and corresponds to the second genome editor, and the first genome editor is orthogonal to the second genome editor. In some embodiments, the second genome editing tool includes a second genome editor that includes an RNA-guided nuclease and at least one gRNA that targets at least one genomic locus and corresponds to the RNA-guided nuclease, and the base editor is orthogonal to the RNA-guided nuclease.

[0440] In some embodiments, the second genome editor is delivered to the cell as at least one polypeptide or at least one mRNA. In some embodiments, the second genome editor comprises at least one polypeptide or at least one mRNA. In some embodiments, the second genome editor comprises a nuclease, a nickase, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

[0441] In some embodiments, one of the first genome editor and the second genome editor comprises a base editor, optionally a C-to-T base editor or an A-to-G base editor, and the other of the first genome editor and the second genome editor comprises a nuclease. In some embodiments, one of the first genome editor and the second genome editor comprises a C-to-T base editor, and the other of the first genome editor and the second genome editor comprises an A-to-G base editor. In some embodiments, one of the first genome editor and the second genome editor comprises an N. meningitidis (Nme) RNA-guided nickase or nuclease, and the other of the first genome editor and the second genome editor comprises an S. pyogenes (Spy) RNA-guided nickase or nuclease.

[0442] In some embodiments, the second genome editor or RNA-guided nuclease is a Cas nuclease. In some embodiments, the Cas nuclease is Cas9. In some embodiments, Cas9 is Streptococcus pyogenes Cas9 (SpyCas9), S. aureus Cas9 (SauCas9), C. diphtheriae Cas9 (CdiCas9), Streptococcus thermophilus Cas9 (St1Cas9), A. cellulolyticus Cas9 (AceCas9), C. jejuni Cas9 (CjeCas9), R. palustris Cas9 (RpaCas9), R. rubrum Cas9 (RruCas9), A. naeslundii Cas9 (AnaCas9), Francisella novicida Cas9 (FnoCas9), or N. meningitidis (NmeCas9). In some embodiments, Cas9 is Nme1Cas9, Nme2Cas9, Nme3Cas9, or SpyCas9. In some embodiments, the Cas nuclease is a class 2 Cas nuclease. In some embodiments, the Cas nuclease is Cas12. In some embodiments, Cas12 is Lachnospiraceae bacterium Cas12a (LbCas12a) or Cas12 is Acidaminococcus sp. Cas12a (AsCas12a). In some embodiments, the Cas nuclease is Eubacterium siraeum Cas13d (EsCas13d).

[0443] In some embodiments, the second genome editor or RNA-guided nuclease is a Cas9 nuclease. In some embodiments, the second genome editor or RNA-guided nuclease is a Streptococcus pyogenes Cas9 (SpyCas9) nuclease. In some embodiments, the SpyCas9 nuclease comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 156. In some embodiments, the SpyCas9 nuclease comprises the amino acid sequence of SEQ ID NO: 156.

[0444] In some embodiments, the second genome editor or RNA-guided nuclease is a Cas9 nuclease. In some embodiments, the second genome editor or RNA-guided nuclease is a N. meningitidis Cas9 (NmeCas9) nuclease. In some embodiments, the NmeCas9 nuclease comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 157, 158-167, 191, 198, 205, 212, and 219. In some embodiments, the NmeCas9 nuclease comprises the amino acid sequence of any one of SEQ ID NOs: 157, 158-167, 191, 198, 205, 212, and 219.

[0445] In some embodiments, the second genome editing tool, the nucleic acid encoding the RNA-guided nuclease, the second nucleic acid comprising the second ORF, or the second ORF comprises a polynucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 168, 169-178, 180, 181-190, 192-197, 199-204, 206-211, 213-218, and 220-225. In some embodiments, the second genome editing tool, the nucleic acid encoding the RNA-guided nuclease, the second nucleic acid comprising the second ORF, or the second ORF comprises the polynucleotide sequence of any one of SEQ ID NOs: 168, 169-178, 180, 181-190, 192-197, 199-204, 206-211, 213-218, and 220-225.

[0446] In some embodiments, the second genome editing tool comprises an RNA-guided nuclease. In some embodiments, when the RNA-guided nuclease is used together with at least one gRNA corresponding to the nuclease, it simultaneously results in knockout of the genomic locus targeted by the at least one gRNA and knock-in of a foreign gene.

[0447] In some embodiments, the second genome editing tool comprises a fusion protein comprising a DNA polymerase and a nickase. In some embodiments, when the fusion protein comprising a DNA polymerase and a nickase is used together with at least one gRNA corresponding to the nickase, it results in targeted knock-in of a foreign nucleic acid.

[0448] In some embodiments, a second genome editing tool may be combined with any first genome editing tool disclosed herein. In some embodiments, a second nucleic acid comprising any second ORF may be combined with any first nucleic acid comprising any first ORF disclosed herein. By using Cas9 nickase and Cas9 clevase, which are orthologs of each other in the first genome editing tool and the second genome editing tool, cross-utilization can be prevented.

[0449] In some embodiments, the first genome editing tool comprises a first genome editor or base editor comprising an APOBEC family deaminase (e.g., cytidine deaminase) and D16A NmeCas9 nickase, and at least one gRNA targeting at least one genomic locus and corresponding to the nickase. In some embodiments, the first genome editor or base editor comprises one or more UGIs. In some embodiments, the second genome editing tool comprises S. pyogenes Cas9 (SpyCas9) clevase and at least one gRNA targeting at least one genomic locus and corresponding to the SpyCas9 clevase.

[0450] In some embodiments, the first genome editing tool comprises a first genome editor or base editor comprising an APOBEC family deaminase (e.g., cytidine deaminase) and D16A NmeCas9 nickase, and at least one gRNA targeting at least one genomic locus and corresponding to the nickase. In some embodiments, the first genome editor or base editor does not comprise a UGI. In some embodiments, the first genome editing tool further comprises at least one UGI in a polypeptide different from the first genome editor or base editor. In some embodiments, the second genome editing tool comprises S. pyogenes Cas9 (SpyCas9) clevase and at least one gRNA targeting at least one genomic locus and corresponding to the SpyCas9 clevase.

[0451] In some embodiments, the first genome editing tool comprises a first genome editor or base editor comprising a deaminase of the APOBEC family (e.g., cytidine deaminase) and D10A SpyCas9 nickase, and at least one gRNA targeting at least one genomic locus and corresponding to the nickase. In some embodiments, the first genome editor or base editor comprises one or more UGIs. In some embodiments, the second genome editing tool comprises an NmeCas9 cleavase and at least one gRNA targeting at least one genomic locus and corresponding to the NmeCas9 cleavase.

[0452] In some embodiments, the first genome editing tool comprises a first genome editor or base editor comprising a deaminase of the APOBEC family (e.g., cytidine deaminase) and D10A SpyCas9 nickase, and at least one gRNA targeting at least one genomic locus and corresponding to the nickase. In some embodiments, the first genome editor or base editor does not comprise a UGI. In some embodiments, the first genome editing tool further comprises at least one UGI in a polypeptide different from the first genome editor or base editor. In some embodiments, the second genome editing tool comprises an NmeCas9 cleavase and at least one gRNA targeting at least one genomic locus and corresponding to the NmeCas9 cleavase.

[0453] IV. Additional Features In the following sections, additional features of the first genome editor, base editor, second genome editor, and nucleic acids encoding them are provided. In any of the embodiments described herein, the nucleic acid can be an expression construct comprising a promoter operably linked to an ORF encoding the first genome editor, base editor, or second genome editor disclosed herein.

[0454] A. Codon Optimization In some embodiments, the nucleic acid encoding the first genome editor, base editor, or second genome editor comprises an ORF comprising a codon-optimized nucleic acid sequence. In some embodiments, the codon-optimized nucleic acid sequence comprises minimal adenine codons and / or minimal uridine codons.

[0455] In a given ORF, the uridine content or uridine dinucleotide content can be reduced, for example, by using minimal uridine codons in a sufficient fraction of the ORF. For example, the amino acid sequence of the first genome editor, base editor, or second genome editor described herein can be reverse-translated into an ORF sequence by converting the amino acids into codons, using the exemplary minimal uridine codons shown below for some or all of the ORF. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons of the ORF are the codons listed in Table 1. [Table 2]

[0456] In some embodiments, the ORF can consist of a series of codons where at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are the codons listed in Table 1.

[0457] In a given ORF, the adenine content or adenine dinucleotide content can be reduced, for example, by using a minimal adenine codon in a sufficient fraction of the ORF. For example, the amino acid sequence of the first genome editor, base editor, or second genome editor described herein can be reverse translated into an ORF sequence by converting amino acids into codons, and in doing so, using the exemplary minimal adenine codons shown below in some or all of the ORF. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons of the ORF are the codons listed in Table 2.

Table 3

[0458] In some embodiments, the ORF can consist of a series of codons where at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are the codons listed in Table 2.

[0459] To the extent practicable, any of the above-described features regarding low adenine content can be combined with any of the above-described features regarding low uridine content. This also applies to uridine and adenine dinucleotides. Similarly, the content of uridine nucleotides and adenine nucleotides in the ORF can be as described above. Similarly, the content of uridine dinucleotides and adenine nucleotides in the ORF can be as described above.

[0460] In a given ORF, for example, by using minimal uridine and adenine codons in a sufficient fraction of the ORF, the uridine and adenine nucleotide or dinucleotide content can be reduced. For example, the amino acid sequences of the polypeptides, second genome editors, or RNA-guided nucleases described herein can be reverse-translated into an ORF sequence by converting the amino acids into codons, using the exemplary minimal uridine and adenine codons shown below for some or all of the ORF. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons of the ORF are the codons listed in Table 3.

Table 4

[0461] In some embodiments, the ORF can consist of a series of codons where at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are the codons listed in Table 3. As can be seen from Table 3, each of the three serine codons listed contains either one A or one U. In some embodiments, minimizing uridine by using the AGC codon for serine is preferred. In some embodiments, minimizing adenine by using the UCC or UCG codon for serine is preferred.

[0462] In some embodiments, the ORF may have codons that increase translation in mammals such as humans. In further embodiments, the ORF is an mRNA and includes codons that increase translation in an organ of a mammal, such as the liver of a human. In further embodiments, the ORF may have codons that increase translation in a cell type of a mammal, such as a human hepatocyte. The increase in translation in a mammal, cell type, mammalian organ, human, human organ, etc. can be determined by comparison to the level of translation of the wild-type sequence of the ORF, or to an ORF having a codon distribution that matches the codon distribution of the organism from which the ORF is derived or the codon distribution of an organism that includes an ORF that is most similar at the codon distribution or amino acid level. Alternatively, in some embodiments, the increase in translation of the Cas9 sequence in a mammal, cell type, mammalian organ, human, human organ, etc. is determined by comparison to the translation of an ORF having the sequence of SEQ ID NO: 2 or 5 and all other conditions such as any applicable point mutations, heterologous domains, etc. being the same. In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons within the ORF are codons corresponding to tRNAs that are highly expressed in a mammal such as a human (e.g., the most highly expressed tRNA for each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons within the ORF are codons corresponding to tRNAs that are highly expressed in an organ of a mammal, such as the liver of a human (e.g., the most highly expressed tRNA for each amino acid).

[0463] Alternatively, codons corresponding to tRNAs that are highly expressed throughout an organism (e.g., a human) may be used.

[0464] Any of the aforementioned approaches to codon selection may be combined with the minimal uridine or adenine codons shown above, which may be, for example, starting from the codons in Table 1, Table 2, or Table 3, and then, if two or more options are available, using the codons corresponding to the tRNAs that are more highly expressed in the organism as a whole (e.g., human) or in either the organ or cell type of interest (e.g., human liver or human hepatocytes).

[0465] In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons of the ORF are codons from the codon sets shown in Table 4 (e.g., the low U1, low A, or low A / U codon sets). For the low U1, low G, low A, and low A / U sets of codons, while using the codons that minimize the indicated nucleotides, codons corresponding to the tRNAs that are highly expressed are also used when two or more options are available. In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons of the ORF are codons from the low U1 codon set shown in Table 4. In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons of the ORF are codons from the low A codon set shown in Table 4. In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons of the ORF are codons from the low A / U codon set shown in Table 4. [Table 5]

[0466] B. Heterologous functional domain, nuclear localization signal (NLS) In some embodiments, the first genome editor, base editor, or second genome editor disclosed herein further comprises one or more additional heterologous functional domains (e.g., is or comprises a ternary or higher-order fusion polypeptide).

[0467] In some embodiments, a heterologous functional domain may facilitate the transport of a first genome editor, base editor, or second genome editor into the cell nucleus. For example, the heterologous functional domain can be a nuclear localization signal (NLS). In some embodiments, the first genome editor, base editor, or second genome editor can be fused with 1 to 10 NLSs (multiple possible). In some embodiments, the first genome editor, base editor, or second genome editor can be fused with 1 to 5 NLSs (multiple possible). In some embodiments, the first genome editor, base editor, or second genome editor can be fused with one NLS. When one NLS is used, the NLS can be fused at the N-terminus or C-terminus of the sequence of the first genome editor, base editor, or second genome editor. In some embodiments, the first genome editor, base editor, or second genome editor can be fused with at least one NLS at the C-terminus. The NLS may be inserted into the sequence of a polypeptide, second genome editor, or RNA-guided nuclease. In other embodiments, the first genome editor, base editor, or second genome editor can be fused with two or more NLSs. In some embodiments, the first genome editor, base editor, or second genome editor can be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the first genome editor, base editor, or second genome editor can be fused with two NLSs. In certain situations, the two NLSs can be the same (e.g., two SV40 NLSs) or different. In some embodiments, the first genome editor, base editor, or second genome editor is fused with two SV40 NLS sequences at the carboxy terminus. In some embodiments, the first genome editor, base editor, or second genome editor can be fused with two NLSs, one at the N-terminus and the other at the C-terminus. In some embodiments, the first genome editor, base editor, or second genome editor can be fused with three NLSs.In some embodiments, the first genome editor, base editor, or second genome editor may not be fused to an NLS. In some embodiments, the NLS may be a single-segment sequence, such as the SV40 NLS, PKKKRKV (SEQ ID NO: 40), or PKKRRV (SEQ ID NO: 70). In some embodiments, the NLS may be a two-segment sequence, such as KRPAATKKAGQAKKKK (SEQ ID NO: 71), which is the NLS of nucleoplasmin. In certain embodiments, a single PKKKRKV (SEQ ID NO: 40) NLS may be fused to the C-terminus of the first genome editor, base editor, or second genome editor. One or more linkers may optionally be included at the fusion site (e.g., between the first genome editor, base editor, or second genome editor and the NLS). In some embodiments, one or more NLS(s) according to any of the foregoing embodiments may be present in the first genome editor, base editor, or second genome editor in combination with one or more additional heterologous functional domains, such as any of the heterologous functional domains described below.

[0468] In some embodiments, a cytidine deaminase (e.g., A3A) is located N-terminal to an RNA-guided nickase in a first genome editor or base editor. In some embodiments, the RNA-guided nickase comprises a nuclear localization signal (NLS). In some embodiments, the NLS is fused to the C-terminus of the RNA-guided nickase. In some embodiments, the NLS is fused to the C-terminus of the RNA-guided nickase via a linker. In some embodiments, the NLS is fused to the N-terminus of the RNA-guided nickase. In some embodiments, the NLS is fused to the N-terminus of the RNA-guided nickase via a linker (e.g., SEQ ID NO: 39). In some embodiments, the NLS comprises a sequence having at least 80%, 85%, 90%, or 95% identity to any one of SEQ ID NOs: 40 and 59-71. In some embodiments, the NLS comprises a sequence of any one of SEQ ID NOs: 40 and 59-71. In some embodiments, the NLS is encoded by a sequence having at least 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 40 and 59-71.

[0469] In some embodiments, the heterologous functional domain may be able to modify the intracellular half-life of A3A or an RNA-guided nickase in a first genome editor or base editor. In some embodiments, the half-life of A3A or an RNA-guided nickase in a polypeptide may be increased. In some embodiments, the half-life of A3A or an RNA-guided nickase in a first genome editor or base editor may be reduced. In some embodiments, the heterologous functional domain may be able to increase the stability of A3A or an RNA-guided nickase in a first genome editor or base editor. In some embodiments, the heterologous functional domain may be able to reduce the stability of A3A or an RNA-guided nickase in a first genome editor or base editor. In some embodiments, the heterologous functional domain may function as a signal peptide for proteolysis. In some embodiments, proteolysis may be mediated by a protease such as, for example, a proteasome, a lysosomal protease, or a calpain protease. In some embodiments, the heterologous functional domain may comprise a PEST sequence. In some embodiments, the polypeptide may be modified by the addition of ubiquitin or a polyubiquitin chain. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neuronally expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-associated (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin-fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).

[0470] In some embodiments, the heterologous functional domain can be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain can be a fluorescent protein. Any known fluorescent protein, for example, GFP, YFP, EBFP, ECFP, DsRed, or any other suitable fluorescent protein may be used as the marker domain. In other embodiments, the marker domain can be a purification tag or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6×His (SEQ ID NO: 401), 8×His (SEQ ID NO: 402), biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. In some embodiments, the marker domain can be a reporter gene. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or a fluorescent protein.

[0471] In additional embodiments, the heterologous functional domain can target the first genome editor, base editor, or second genome editor to a particular organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain can target the first genome editor, base editor, or second genome editor to mitochondria.

[0472] C.UTR, Kozak sequence In some embodiments, the nucleic acids (e.g., mRNA) disclosed herein comprise a 5′UTR, 3′UTR, or both a 5′UTR and a 3′UTR derived from hydroxysteroid 17-beta dehydrogenase 4 (HSD17B4 or HSD), or a globin such as human alpha globin (HBA), human beta globin (HBB), Xenopus beta globin (XBG), bovine growth hormone, cytomegalovirus (CMV), murine Hba-al, heat shock protein 90 (Hsp90), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta-actin, alpha-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).

[0473] In some embodiments, the nucleic acids described herein do not comprise a 5′UTR, e.g., there are no additional nucleotides between the 5′ cap and the start codon. In some embodiments, the nucleic acid comprises a Kozak sequence (described below) between the 5′ cap and the start codon but does not have an additional 5′UTR. In some embodiments, the nucleic acid does not comprise a 3′UTR, e.g., there are no additional nucleotides between the stop codon and the polyA tail.

[0474] In some embodiments, the nucleic acids herein comprise a Kozak sequence. The Kozak sequence can affect translation initiation and the overall yield of the polypeptide translated from the mRNA. The Kozak sequence includes a methionine codon that can function as a start codon. The minimal Kozak sequence is NNNRUGN, where at least one of the following is true: the first N is A or G, and the second N is G. In the context of a nucleotide sequence, R means a purine (A or G). In some embodiments, the Kozak sequence is RNNRUGN, NNNRUGG, RNNRUGG, RNNAUGN, NNNAUGG, RNNAUGG, or GCCACCAUG.

[0475] D. PolyA Tail In some embodiments, the nucleic acids disclosed herein further comprise a polyadenylation (polyA) tail. The polyA tail can comprise at least 8 consecutive adenine nucleotides, but can also comprise one or more non-adenine nucleotides. As used herein, "non-adenine nucleotide" refers to any natural or non-natural nucleotide that does not contain adenine. Guanine nucleotides, thymine nucleotides, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the polyA tail on the nucleic acids described herein can comprise consecutive adenine nucleotides located on the 3' side of the nucleotides encoding the polypeptide of interest. In some cases, the polyA tail on the nucleic acid comprises non-consecutive adenine nucleotides located on the 3' side of the nucleotides encoding the polypeptide, with non-adenine nucleotides intervening between the adenine nucleotides at regularly or irregularly spaced intervals.

[0476] In some embodiments, the polyA tail is encoded in a plasmid used for in vitro transcription of mRNA and becomes part of the transcript. The number of consecutive adenine nucleotides in the polyA sequence encoded in the plasmid, i.e., the polyA sequence, may not be exact. For example, 100 polyA sequences (SEQ ID NO: 403) of the plasmid may not result in exactly 100 polyA sequences (SEQ ID NO: 403) in the transcribed mRNA. In some embodiments, the polyA tail is not encoded in the plasmid and is added by PCR tailing or enzymatic tailing, for example, using E. coli poly(A) polymerase.

[0477] In some embodiments, one or more non-adenine nucleotides are arranged to interrupt consecutive adenine nucleotides such that a poly(A)-binding protein can bind to a stretch of consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotide(s) are located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides (SEQ ID NO: 404). In some embodiments, one or more non-adenine nucleotides are located after 8 to 50 consecutive adenine nucleotides (SEQ ID NO: 405). In some embodiments, one or more non-adenine nucleotides are located after 8 to 100 consecutive adenine nucleotides (SEQ ID NO: 406).

[0478] In some embodiments, the poly-A tail comprises or contains one non-adenine nucleotide or one stretch of 2 to 10 consecutive non-adenine nucleotides.

[0479] In some embodiments, the non-adenine nucleotide is guanine, cytosine, or thymine. Optionally, when two or more non-adenine nucleotides are present, the non-adenine nucleotides may be selected from a) guanine and thymine nucleotides, b) guanine and cytosine nucleotides, c) thymine and cytosine nucleotides, or d) guanine, thymine, and cytosine nucleotides.

[0480] E. Modified nucleotides In some embodiments, the nucleic acids disclosed herein contain modified uridine at some or all uridine positions. In some embodiments, the modified uridine is uridine modified at the 5-position, for example, with a halogen or a C1-C3 alkoxy. In some embodiments, the modified uridine is pseudouridine modified at the 1-position, for example, with a C1-C3 alkyl. The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or combinations thereof.

[0481] In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the uridine positions of the nucleic acids disclosed herein are modified uridines. In some embodiments, 10% to 25%, 15 to 25%, 25 to 35%, 35 to 45%, 45 to 55%, 55 to 65%, 65 to 75%, 75 to 85%, 85 to 95%, or 90 to 100% of the uridine positions of the mRNA disclosed herein are modified uridines, such as 5-methoxyuridine, 5-iodouridine, N1-methylpseudouridine, pseudouridine, or combinations thereof.

[0482] In some embodiments, at least 10% of the uridines are replaced with modified uridines. In some embodiments, 15% to 45% of the uridines are replaced with modified uridines. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the uridines are replaced with modified uridines.

[0483] F. 5' Cap In some embodiments, the nucleic acids disclosed herein include a 5' cap such as Cap0, Cap1, or Cap2. The 5' cap is generally a 7-methylguanosine ribonucleotide linked via a 5'-triphosphate to the 5' position of the first nucleotide of the 5'-3' strand of the nucleic acid, i.e., the first cap-proximal nucleotide (which may be further modified as discussed below with respect to ARCA). In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both contain a 2'-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the nucleic acid contain 2'-methoxy and 2'-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the nucleic acid both contain 2'-methoxy. See, for example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30, Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous nucleic acids of higher eukaryotes, including mammalian nucleic acids such as human nucleic acids, contain Cap1 or Cap2. Cap0, as well as other cap structures different from Cap1 and Cap2, may be immunogenic in mammals such as humans because they are recognized as "non-self" by components of the innate immune system such as IFIT-1 and IFIT-5, which can lead to an increase in cytokine concentrations such as type I interferon. Also, components of the innate immune system such as IFIT-1 and IFIT-5 may compete with eIF4E for binding to nucleic acids having caps other than Cap1 or Cap2, potentially inhibiting translation of the nucleic acids.

[0484] The cap can be included by co-transcription. For example, ARCA (anti-reverse cap analog, Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanosine 3'-methoxy-5'-triphosphate linked to the 5'-position of guanine ribonucleotide and can be incorporated into the transcription product in vitro at the start. By ARCA, a Cap0 cap or Cap0-like cap in which the 2'-position of the first cap-proximal nucleotide is hydroxyl is generated. See, for example, Stepinski et al., (2001) “Synthesis and properties of mRNAs containing the novel ‘anti-reverse’ cap analogs 7-methyl(3’-O-methyl)GpppG and 7-methyl(3’deoxy)GpppG,” RNA 7:1486-1495. The structure of ARCA is shown below. [Chemical formula]

[0485] The Cap1 structure can be provided co-transcriptionally using CleanCap™ AG (m7G(5’)ppp(5’)(2’OMeA)pG, TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5’)ppp(5’)(2’OMeG)pG, TriLink Biotechnologies catalog number N-7133). The 3’-O-methylated forms of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies as catalog numbers N-7413 and N-7433, respectively. The structure of CleanCap™ AG is shown below. The structure of CleanCap™ may be referred to herein using the last three digits of the catalog numbers listed above (e.g., TriLink Biotechnologies catalog number N-7113 is “CleanCap™ 113”). [Chemical formula]

[0486] Alternatively, the cap can also be added to the RNA after transcription. For example, Vaccinia capping enzyme is commercially available (New England Biolabs catalog number M2080S) and has RNA triphosphatase and guanylyltransferase activities provided by its D1 subunit, as well as guanine methyltransferase provided by its D12 subunit. Therefore, in the presence of S-adenosylmethionine and GTP, 7-methylguanine can be added to the RNA to give Cap0. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027, Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479. For further considerations regarding caps and capping approaches, see, for example, WO2017 / 053297, and Ishikawa et al., Nucl. Acids. Symp. Ser. (2009) No. 53, 129-130.

[0487] V. Cells In some embodiments, the cells contacted with the first genome editing tool or the second genome editing tool are human cells.

[0488] In some embodiments, a cell is contacted with (a) a first genome editing tool comprising a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the first genome editor, and (b) a second genome editing tool comprising a second genome editor and at least one gRNA that targets at least one genomic locus and corresponds to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor, thereby resulting in at least two genome edits in the cell.

[0489] In some embodiments, a cell is contacted with (a) a first genome editing tool comprising a first genome editor that includes a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the base editor, and (b) a second genome editing tool comprising a second genome editor that includes an RNA-guided nuclease and at least one gRNA that targets at least one genomic locus and corresponds to the RNA-guided nuclease, wherein the base editor is orthogonal to the RNA-guided nuclease, thereby resulting in at least two genome edits in the cell.

[0490] In some embodiments, a cell is contacted with (a) a first genome editing tool comprising a first genome editor that is a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the base editor, and (b) a second genome editing tool comprising a second genome editor that is an RNA-guided nuclease and at least one gRNA that targets at least one genomic locus and corresponds to the RNA-guided nuclease, wherein the base editor is orthogonal to the RNA-guided nuclease, and in some embodiments, the cell is (c) cultured, thereby producing a population of cells comprising edited cells comprising at least two genome edits per cell.

[0491] In some embodiments, the cells are treated in vitro by any of the methods or compositions disclosed herein. In some embodiments, the cells are treated in vivo by any of the methods or compositions disclosed herein.

[0492] In some embodiments, any cell of the embodiments provided herein is engineered with a first genome editing tool and a second genome editing tool. In some embodiments, the first genome editing tool comprises a C-to-T base editor, or an A-to-G base editor. In some embodiments, the first genome editing tool comprises a first genome editor comprising a cytidine deaminase and an RNA-guided nickase, or a nucleic acid encoding a polypeptide thereof. In some embodiments, the cytidine deaminase is APOBEC3A deaminase (A3A). In some embodiments, the first genome editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3, SEQ ID NO: 146, or SEQ ID NO: 311. In some embodiments, the nucleic acid encoding the first genome editor comprises a sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 147, or SEQ ID NO: 310. In some embodiments, the first genome editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 9, 12, 18, and 21.

[0493] In some embodiments, the first genome editing tool or the second genome editing tool is delivered to cells by electroporation. In some embodiments, the first genome editing tool or the second genome editing tool is delivered to cells by at least one lipid nanoparticle (LNP). In some embodiments, the first genome editing tool or the second genome editing tool is contained in at least one LNP. In some embodiments, the first genome editing tool or the second genome editing tool is carried on at least one vector and delivered to cells. In some embodiments, the first genome editing tool or the second genome editing tool comprises at least one vector. In some embodiments, the first genome editing tool or the second genome editing tool is delivered as at least one nucleic acid encoding the first genome editing tool or the second genome editing tool. In some embodiments, the first genome editing tool or the second genome editing tool comprises at least one nucleic acid encoding the first genome editing tool or the second genome editing tool. In some embodiments, the first genome editing tool comprises at least one polypeptide comprising the first genome editing tool, or at least one nucleic acid encoding the first genome editing tool. In some embodiments, the second genome editing tool comprises at least one polypeptide comprising the second genome editing tool, or at least one nucleic acid encoding the second genome editing tool. In some embodiments, the at least one nucleic acid comprises at least one mRNA. In some embodiments, the first genome editor or the second genome editor is delivered to cells as at least one polypeptide or at least one mRNA. In some embodiments, the first genome editor or the second genome editor comprises at least one polypeptide or at least one mRNA. In some embodiments, the at least one gRNA is delivered to cells as at least one polynucleotide encoding the gRNA. In some embodiments, the cells are contacted with a nucleic acid encoding a foreign gene for insertion into a genomic locus.In some embodiments, the cells are contacted with a nucleic acid encoding a foreign gene for insertion into the TRAC or AAVS1 locus.

[0494] In some embodiments, in any of the methods disclosed herein, steps (a) and (b) of contacting the cells are performed simultaneously. In some embodiments, steps (a) and (b) of contacting the cells are performed in any order over a time period of about 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 30 hours, 36 hours, or 48 hours. In some embodiments, each of steps (a) and (b) is performed independently over a time period of about 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 30 hours, 36 hours, or 48 hours.

[0495] In some embodiments, the cells are immune cells. As used herein, "immune cells" refers to cells of the immune system, including, for example, lymphocytes (e.g., T cells, B cells, natural killer cells ("NK cells", and NKT cells, or iNKT cells)), monocytes, macrophages, mast cells, dendritic cells, or granulocytes (e.g., neutrophils, eosinophils, and basophils). In some embodiments, the cells are primary immune cells. In some embodiments, the immune system cells may be selected from CD3 + T cells, CD4 + T cells and CD8 + T cells, regulatory T cells (Tregs), B cells, NK cells, and dendritic cells (DC). In some embodiments, the immune cells are allogeneic.

[0496] In some embodiments, the cell is a lymphocyte. In some embodiments, the cell is an adaptive immune cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is a B cell. In some embodiments, the cell is a NK cell.

[0497] As used herein, a T cell can be defined as a cell that expresses a T cell receptor ( "TCR" or "αβ TCR" or "γδ TCR"), but in some embodiments, the TCR of the T cell may be genetically modified to reduce its expression (e.g., by gene modification to the TRAC or TRBC gene), and thus, the expression of the protein CD3 may be used as a marker for identifying T cells by standard flow cytometry methods. CD3 is a multi-subunit signaling complex that associates with the TCR. Thus, T cells can be referred to as CD3+. In some embodiments, a T cell is a cell that expresses the CD3+ marker and either the CD4+ or CD8+ marker.

[0498] In some embodiments, the T cell expresses the glycoprotein CD8 and thus may be CD8+ by standard flow cytometry methods and may be referred to as a "cytotoxic" T cell. In some embodiments, the T cell expresses the glycoprotein CD4 and thus is CD4+ by standard flow cytometry methods, which can be referred to as a "helper" T cell. CD4+ T cells can differentiate into subsets and can be called Th1 cells, Th2 cells, Th9 cells, Th17 cells, Th22 cells, regulatory T ( "Treg") cells, or follicular helper T ( "Tfh") cells. Each CD4+ subset releases specific cytokines that can have either pro-inflammatory or anti-inflammatory functions, survival or protective functions. T cells can be isolated from a subject by methods of CD4+ or CD8+ selection.

[0499] In some embodiments, the T cell is a memory T cell. In the body, memory T cells have encountered antigens. Memory T cells can be located within secondary lymphoid organs (central memory T cells) or within recently infected tissues (effector memory T cells). Memory T cells can be CD8+ T cells. Memory T cells can be CD4+ T cells.

[0500] As used herein, a "central memory T cell" can be defined as an antigen-experienced T cell, for example, capable of expressing CD62L and CD45RO. Central memory T cells may be detected as CD62L+ and CD45RO+ by central memory T cells, also express CCR7, and thus may be detected as CCR7+ by standard flow cytometry methods.

[0501] As used herein, an "initial stem cell memory T cell" (or "Tscm") can be defined as a T cell that expresses CD27 and CD45RA, and thus, by standard flow cytometry methods, is CD27+ and CD45RA+. Since Tscm does not express CD45RO, an isoform of CD45, when stained for this isoform, Tscm will further be CD45RO- by standard flow cytometry methods. Thus, CD45RO-CD27+ cells are also initial stem cell memory T cells. Tscm cells further express CD62L and CCR7 and thus can be detected as CD62L+ and CCR7+ by standard flow cytometry methods. Initial stem cell memory T cells have been shown to correlate with increased persistence and therapeutic efficacy of cell therapy products.

[0502] In some embodiments, the cell is a B cell. As used herein, "B cell" can be defined as a cell that expresses CD19 or CD20, or B cell maturation antigen ("BCMA"), and thus, a B cell is CD19+, or CD20+, or BCMA+ by standard flow cytometry methods. The B cell is further CD3 negative and CD56 negative by standard flow cytometry methods. The B cell can be a plasma cell. The B cell can be a memory B cell. The B cell can be a naive B cell. The B cell can be IgM+ or have a class-switched B cell receptor (e.g., IgG+ or IgA+).

[0503] In some embodiments, the cell is a mononuclear cell such as derived from bone marrow or peripheral blood. In some embodiments, the cell is a peripheral blood mononuclear cell ("PBMC"). In some embodiments, the cell is a PBMC, e.g., a lymphocyte or a monocyte. In some embodiments, the cell is a peripheral blood lymphocyte ("PBL").

[0504] In some embodiments, the cell is induced from a progenitor cell prior to editing. In some embodiments, the cell is an induced pluripotent stem cell (iPSC).

[0505] Cells used in ACT therapy include, for example, mesenchymal stem cells (e.g., isolated from bone marrow (BM), peripheral blood (PB), placenta, umbilical cord (UC), or adipose tissue), hematopoietic stem cells (HSC) (e.g., isolated from BM), monocytes (e.g., isolated from BM or PB), endothelial progenitor cells (EPC) (isolated from BM, PB, and UC), neural stem cells (NSC), limbal stem cells (LSC), or tissue-specific primary cells or cells derived therefrom (TSC). Cells used in ACT therapy further include induced pluripotent stem cells (iPSC) that can be induced to differentiate into other cell types such as, for example, pancreatic islet cells, neurons, and blood cells (see, e.g., Mahla, International J. Cell Biol. 2016 (Article ID 6940283): 1-24 (2016)), ocular stem cells, pluripotent stem cells (PSC), embryonic stem cells (ESC), cells for organ or tissue transplantation, such as pancreatic islet cells, cardiomyocytes, thyroid cells, thymocytes, neurons, skin cells, retinal cells, chondrocytes, muscle cells, and keratinocytes.

[0506] In some embodiments, the cells are human cells such as cells from a subject. In some embodiments, the cells are isolated from a human subject. In some embodiments, the cells are isolated from a patient. In some embodiments, the cells are isolated from a donor. In some embodiments, the cells are separated from PBMC or leukopak of a human donor. In some embodiments, the cells are from a subject with a disease state, disorder, or disease. In some embodiments, the cells are from a human donor having Epstein-Barr virus (「EBV」).

[0507] In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the cells contain a genetic modification in the HLA-A gene, are homozygous for HLA-B, and are homozygous for HLA-C. In some embodiments, the cells are homozygous for HLA-A and homozygous for HLA-C. In some embodiments, the cells contain a genetic modification in the HLA-B gene, are homozygous for HLA-A, and are homozygous for HLA-C. In some embodiments, the cells are homozygous for HLA-C. In some embodiments, the cells contain a genetic modification in the HLA-A gene, contain a genetic modification in the HLA-B gene, and are homozygous for HLA-C.

[0508] In some embodiments, the methods disclosed herein are performed ex vivo. As used herein, "ex vivo" refers to an in vitro method in which cells can be transferred to a subject, for example, ACT therapy. In some embodiments, the ex vivo method is an in vitro method that includes ACT therapy cells or cell populations.

[0509] In some embodiments, the cells are maintained in culture. In some embodiments, the cells are transplanted into a patient. In some embodiments, the cells are removed from a subject, genetically modified ex vivo, and then administered back to the same patient. In some embodiments, the cells are removed from a subject, genetically modified ex vivo, and then administered to a subject other than the subject from whom the cells were removed.

[0510] In some embodiments, the cells are derived from a cell line. In some embodiments, the cell line is derived from a human subject. In some embodiments, the cell line is a lymphoblastoid cell line ("LCL"). The cells can be cryopreserved and thawed. The cells may not have been cryopreserved previously.

[0511] In some embodiments, the cells are from a cell bank. In some embodiments, the cells are genetically modified and then transferred to a cell bank. In some embodiments, the cells are removed from a subject, genetically modified ex vivo, and transferred to a cell bank. In some embodiments, a population of genetically modified cells is transferred to a cell bank. In some embodiments, a population of genetically modified immune cells is transferred to a cell bank. In some embodiments, a population of genetically modified immune cells comprising first and second subpopulations, wherein the first and second subpopulations have at least one common genetic modification and at least one different genetic modification, is transferred to a cell bank.

[0512] In some embodiments, the population of cells comprises any cells edited using any method or composition disclosed herein.

[0513] In some embodiments, the population of cells comprises edited T cells, and at least 30%, 40%, 50%, 55%, 60%, 65% of the cells in the population have a memory phenotype (CD27+, CD45RA+).

[0514] In some embodiments, the population of cells comprises inactivated immune cells. In some embodiments, the population of cells comprises activated immune cells.

[0515] In some embodiments, the population of cells comprises T cells and is responsive to restimulation after editing. In some embodiments, the population of cells is cultured, expanded, differentiated, or proliferated ex vivo.

[0516] VI. Guide RNA and Donor Nucleic Acid In some embodiments, the first genome editing tool includes a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the first genome editor. In some embodiments, the first genome editing tool includes a first genome editor that is a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the base editor.

[0517] In some embodiments, the second genome editing tool includes a second genome editor and at least one gRNA that targets at least one genomic locus and corresponds to the second genome editor, and the first genome editor is orthogonal to the second genome editor. In some embodiments, the second genome editing tool includes a second genome editor that is an RNA-guided nuclease and at least one gRNA that targets at least one genomic locus and corresponds to the RNA-guided nuclease, and the base editor is orthogonal to the RNA-guided nuclease.

[0518] In some embodiments, at least one gRNA corresponding to the first genome editor or the base editor does not correspond to the second genome editor or the RNA-guided nuclease. In some embodiments, at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease does not correspond to the first genome editor or the base editor.

[0519] In some embodiments, at least one gRNA corresponding to a first genome editor or a base editor comprises at least two gRNAs targeting at least two different genomic loci. In some embodiments, at least one gRNA corresponding to a second genome editor or an RNA-guided nuclease comprises at least two gRNAs targeting at least two different genomic loci. In some embodiments, at least one gRNA corresponding to a first genome editor or a base editor comprises at least three gRNAs targeting at least three different genomic loci. In some embodiments, at least one gRNA corresponding to a second genome editor or an RNA-guided nuclease comprises at least three gRNAs targeting at least three different genomic loci. In some embodiments, at least one gRNA corresponding to a first genome editor or a base editor comprises at least four gRNAs targeting at least four different genomic loci. In some embodiments, at least one gRNA corresponding to a second genome editor or an RNA-guided nuclease comprises at least four gRNAs targeting at least four different genomic loci. In some embodiments, at least one gRNA corresponding to a first genome editor or a base editor comprises at least five gRNAs targeting at least five different genomic loci. In some embodiments, at least one gRNA corresponding to a second genome editor or an RNA-guided nuclease comprises at least five gRNAs targeting at least five different genomic loci. In some embodiments, at least one gRNA corresponding to a first genome editor or a base editor comprises at least six gRNAs targeting at least six different genomic loci. In some embodiments, a first genome editor and one, two, three, four, five, or six of at least one gRNA corresponding to the first genome editor or a base editor and targeting different genomic loci are contained in the same lipid nanoparticle (LNP).In some embodiments, the base editor, or at least one gRNA corresponding to a second genome editor or an RNA-guided nuclease, comprises at least six gRNAs targeting at least six different genomic loci.

[0520] A. Target Sequences and Genes In some embodiments, the methods and compositions of the disclosure utilize a CRISPR / Cas system to cleave a target sequence at at least one genomic locus targeted by a guide RNA. For example, the target sequence can be recognized and cleaved by a Cas nuclease. In some embodiments, the target sequence of a Cas nuclease is located near the corresponding PAM sequence of the nuclease. In some embodiments, a class 2 Cas nuclease can be guided to the target sequence of a gene by a gRNA, which hybridizes to the target sequence and causes the class 2 Cas protein to cleave the target sequence. In some embodiments, the guide RNA hybridizes to the target sequence and causes the class 2 Cas nuclease to cleave the target sequence adjacent to or including its corresponding PAM. In some embodiments, the target sequence can be complementary to the targeting sequence of the guide RNA. In some embodiments, the degree of complementarity between the targeting sequence of the guide RNA and the portion of the corresponding target sequence that hybridizes to the guide RNA can be about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the percent identity between the targeting sequence of the guide RNA and the portion of the corresponding target sequence that hybridizes to the guide RNA can be about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the target homology region is adjacent to the corresponding PAM sequence. In some embodiments, the target sequence can include a sequence that is 100% complementary to the targeting sequence of the guide RNA. In other embodiments, the target sequence can include at least one mismatch, deletion, or insertion compared to the targeting sequence of the guide RNA.

[0521] The length of the target array may depend on the nuclease system used. For example, the targeting sequence of the guide RNA of the CRISPR / Cas system may include nucleotide lengths of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more than 50, the target sequence is of the corresponding length and is optionally adjacent to the PAM sequence. In some embodiments, the target sequence may include a length of 15 to 24 nucleotides. In some embodiments, the target sequence may include a length of 17 to 21 nucleotides. In some embodiments, the target sequence may include a length of 20 nucleotides. In some embodiments, the target sequence may include a length of 24 nucleotides. When nickases are used, the target sequence may include a pair of target sequences recognized by a pair of nickases that cleave opposite strands of the DNA molecule. In some embodiments, the target sequence may include a pair of target sequences recognized by a pair of nickases that cleave the same strand of the DNA molecule. In some embodiments, the target sequence may include a portion of the target sequence recognized by one or more Cas nucleases.

[0522] The target nucleic acid molecule can be any DNA or RNA molecule that is endogenous or foreign to the cell. In some embodiments, the target nucleic acid molecule can be episomal DNA, plasmid, genomic DNA, viral genome, or chromosomal DNA. In some embodiments, the target sequence of a gene can be a genomic sequence from or within a cell including a human cell.

[0523] In further embodiments, the target sequence can be a viral sequence. In further embodiments, the target sequence can be a pathogen sequence. In still other embodiments, the target sequence can be a synthetic sequence. In further embodiments, the target sequence can be a chromosomal sequence. In certain embodiments, the target sequence can include the junction of a translocation, for example a translocation associated with cancer. In some embodiments, the target sequence can be on a eukaryotic chromosome, for example, a human chromosome.

[0524] In some embodiments, the target sequence may be located at a genomic locus. For example, the target sequence may be located in the coding sequence of a gene, the intron sequence of a gene, a regulatory sequence, a transcriptional control sequence of a gene, a translational control sequence of a gene, a splicing site, or an intergenic non-coding sequence (e.g., intergenic space). In some embodiments, the gene may be a protein-coding gene. In other embodiments, the gene may be a non-coding RNA gene. In some embodiments, the target sequence may include all or part of a disease-related gene. In some embodiments, the target sequence may be located at a non-gene functional site of the genome, such as a site that controls the mode of chromatin structure formation, such as a scaffold site or a locus control region.

[0525] In some embodiments regarding Cas nucleases such as class 2 Cas nucleases, the target sequence may be adjacent to a protospacer adjacent motif (「PAM」). In some embodiments, the PAM may be adjacent to the 3’ end of the target sequence or within 1, 2, 3, or 4 nucleotides thereof. The length and sequence of the PAM may depend on the Cas protein being used. For example, the PAM may be selected from the consensus PAM sequence of a particular Spy Cas9 protein or Spy Cas9 ortholog or a particular PAM sequence, including those disclosed in FIG. 1 of Ran et al., Nature, 520:186-191 (2015) and FIG. S5 of Zetsche 2015, the relevant disclosures of each of which are incorporated herein by reference. In some embodiments, the PAM may be 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Non-limiting exemplary PAM sequences include NGG, NGGNG, NG, NAAAAN, NNNAAAW, NNNNACA, GNNNCNNA, TTN, and NNNNGATT (where N is defined as any nucleotide and W is defined as either A or T). In some embodiments, the PAM sequence may be NGG. In some embodiments, the PAM sequence may be NGGNG. In some embodiments, the PAM sequence may be TTN. In some embodiments, the PAM sequence may be NNNAAAW.

[0526] In some embodiments, the PAM can be selected from the consensus PAM sequence of a specific Nme Cas9 protein or Nme Cas9 ortholog or a specific PAM sequence (Edraki et al., 2019). In some embodiments, the Nme Cas9 PAM can include 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Non-limiting exemplary PAM sequences include NCC, N4GAYW, N4GYTT, N4GTCT, NNNNCC(a), NNNNCAAA (where N is defined as any nucleotide, W is defined as either A or T, and (a) is preferably but not necessarily A following the second C). In some embodiments, the PAM sequence can be NCC.

[0527] In some embodiments, at least one gRNA corresponding to a first genome editor or base editor, or at least one gRNA corresponding to a second genome editor or RNA-guided nuclease, includes at least one single guide RNA (sgRNA). In some embodiments, at least one gRNA corresponding to a first genome editor or base editor, or at least one gRNA corresponding to a second genome editor or RNA-guided nuclease, is a short single guide RNA (short-sgRNA) that includes a conserved portion of the sgRNA that contains a hairpin region, the hairpin region lacking at least 5-10 nucleotides, and the short-sgRNA includes a 5' end modification or a 3' end modification, or both.

[0528] In some embodiments, at least one gRNA corresponding to a first genome editor or base editor targets one or more genes selected from the TRBC locus, HLA-A locus, HLA-B locus, CIITA locus, HLA-DR locus, HLA-DQ locus, and HLA-DP locus. In some embodiments, at least one gRNA corresponding to a second genome editor or RNA-guided nuclease targets one or more genomic loci selected from the TRAC locus, AAVS1 locus, and CIITA locus.

[0529] In some embodiments, (i) at least one gRNA corresponding to a first genome editor or base editor includes a gRNA targeting the HLA-A locus and a gRNA targeting the CIITA locus, and at least one gRNA corresponding to a second genome editor or RNA-guided nuclease includes a gRNA targeting the TRAC locus; (ii) at least one gRNA corresponding to a first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and at least one gRNA corresponding to a second genome editor or RNA-guided nuclease includes a gRNA targeting the TRAC locus; (iii) at least one gRNA corresponding to a first genome editor or base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and at least one gRNA corresponding to a second genome editor or RNA-guided nuclease includes a gRNA targeting the TRAC locus; (iv) at least one gRNA corresponding to a first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and at least one gRNA corresponding to a second genome editor or RNA-guided nuclease includes a gRNA targeting the TRAC locus; (v) at least one gRNA corresponding to a first genome editor or base editor includes a gRNA targeting the HLA-A locus and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and at least one gRNA corresponding to a second genome editor or RNA-guided nuclease includes a gRNA targeting the TRAC locus;(vi) At least one gRNA corresponding to the first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and at least one gRNA corresponding to the second genome editor or RNA-guided nuclease includes a gRNA targeting the TRAC locus; (vii) At least one gRNA corresponding to the first genome editor or base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and at least one gRNA corresponding to the second genome editor or RNA-guided nuclease includes a gRNA targeting the TRAC locus; (viii) At least one gRNA corresponding to the first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and at least one gRNA corresponding to the second genome editor or RNA-guided nuclease includes a gRNA targeting the TRAC locus; (ix) At least one gRNA corresponding to the first genome editor or base editor includes a gRNA targeting the TRAC locus, a gRNA targeting the TRBC locus, a gRNA targeting the CIITA locus, and a gRNA targeting the HLA-A locus, and at least one gRNA corresponding to the second genome editor or RNA-guided nuclease includes a gRNA targeting the TRAC locus;(x) At least one gRNA corresponding to the first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and at least one gRNA corresponding to the second genome editor or RNA-guided nuclease includes a gRNA targeting the AAVS1 locus; (xi) At least one gRNA corresponding to the first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and at least one gRNA corresponding to the second genome editor or RNA-guided nuclease includes a gRNA targeting the AAVS1 locus; (xii) At least one gRNA corresponding to the first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and at least one gRNA corresponding to the second genome editor or RNA-guided nuclease includes a gRNA targeting the AAVS1 locus; (xiii) At least one gRNA corresponding to the first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and at least one gRNA corresponding to the second genome editor or RNA-guided nuclease includes a gRNA targeting the AAVS1 locus.;

[0530] In some embodiments, in any one of the above sub-parts (i)-(ix), at least one gRNA corresponding to a second genome editor or an RNA-guided nuclease comprises an additional gRNA targeting the AAVS1 locus. In some embodiments, in any one of the above sub-parts (x)-(xiii), at least one gRNA corresponding to a second genome editor or an RNA-guided nuclease comprises an additional gRNA targeting the TRAC locus. In some embodiments, after contacting the cell with a gRNA targeting the TRAC locus, the cell is contacted with an additional gRNA targeting the AAVS1 locus. In some embodiments, after contacting the cell with a gRNA targeting the AAVS1 locus, the cell is contacted with an additional gRNA targeting the TRAC locus.

[0531] B. Modified gRNA In the case of sgRNA, the above guide sequence may further comprise additional nucleotides for forming the sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence. In the 5' to 3' orientation, GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 226).

[0532] In the case of sgRNA, the above guide sequence may further comprise additional nucleotides for forming the sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence. In the 5' to 3' orientation, GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 227).

[0533] In the case of sgRNA, the guide sequence may be incorporated into the following modified motif mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 228), where "N" can be any natural or non-natural nucleotide, preferably an RNA nucleotide, the sugar moiety of the nucleotide can be ribose, deoxyribose, or a similar compound with substitutions, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage to the adjacent nucleotide residue, and N together is the nucleotide sequence of the guide sequence. For the modified sequences, unless otherwise indicated, A, C, G, N, and U are unmodified RNA nucleotides, i.e., 2'-OH sugar moieties with phosphodiester linkages to the adjacent nucleotide residues, or 5'-terminal PO4.

[0534] In the case of sgRNA, the guide sequence may further comprise a SpyCas9 sgRNA sequence. An example of a SpyCas9 sgRNA sequence is shown in Table YY (SEQ ID NO: 226: GUUUUAGAGC UAGAAAUAGC AAGUUAAAAU AAGGCUAGUC CGUUAUCAAC UUGAAAAAGU GGCACCGAGU CGGUGC, "Exemplary SpyCas9 sgRNA-1"), which is included at the 3' end of the guide sequence and is provided together with domains as shown in the following Table YY. LS is the lower stem. B is the bulge. US is the upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. H1 and H2 together are referred to as the hairpin region. A model of the structure is provided in FIG. 10A of WO2019237069, which is incorporated herein by reference.

[0535] The nucleotide sequence of Exemplary SpyCas9 sgRNA-1 can function as a template sequence for specific chemical modifications, sequence substitutions, and cleavage.

[0536] In certain embodiments, the gRNA is, for example, an sgRNA or a dgRNA and optionally includes chemical modifications. In some embodiments, the modified sgRNA includes a guide sequence and a SpyCas9 sgRNA sequence, such as the exemplary SpyCas9 sgRNA-1. A gRNA such as an sgRNA can include modifications of the exemplary SpyCas9 sgRNA-1 at the 5' end of the guide sequence or the 3' end of the SpyCas9 sgRNA sequence, for example, at one or more terminal nucleotides, such as nucleotides 1, 2, 3, or 4 at the 3' or 5' end. In certain embodiments, the modified nucleotide is selected from a 2'-O-methyl (2'-OMe) modified nucleotide, a 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotide, a 2'-fluoro (2'-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, or an inverted deoxyribose modified nucleotide, or combinations thereof. In certain embodiments, the modified nucleotide includes a 2'-OMe modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage. In certain embodiments, the modified nucleotide includes a 2'-OMe modified nucleotide and a PS linkage.

[0537] In certain embodiments, using SEQ ID NO: 226 (“Exemplary SpyCas9 sgRNA-1”) as an example, the Exemplary SpyCas9 sgRNA-1 further comprises one or more of the following. (A) A shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein (1) at least one of the nucleotide pairs of H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9 is substituted with Watson-Crick paired nucleotides in hairpin 1, and the hairpin 1 region optionally (a) lacks any one or two of H1-5 to H1-8, (b) lacks 1, 2, or 3 of the nucleotide pairs of H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or (c) lacks 1 to 8 nucleotides of the hairpin 1 region; or (2) the shortened hairpin 1 region lacks 4 to 8 nucleotides, preferably 4 to 6 nucleotides, and (a) one or more of the positions of H1-1, H1-2, or H1-3 are deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226), or (b) one or more of the positions of H1-6 to H1-10 are substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226); or (3) the shortened hairpin 1 region lacks 5 to 10 nucleotides, preferably 5 to 6 nucleotides, and one or more of the positions of N18, H1-12, or n are substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226), a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region; or (B) a shortened upper stem region that lacks 1 to 6 nucleotides, and 6, 7, 8, 9, 10, or 11 nucleotides of this shortened upper stem region contain 4 or fewer substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226), a shortened upper stem region;Alternatively, a substitution in any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14 with respect to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226), wherein the substituted nucleotide is not a pyrimidine followed by adenine and not an adenine preceded by a pyrimidine; or (D) an exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226) having an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in this upper stem region, (1) the modified nucleotide is optionally selected from a 2'-O-methyl (2'-OMe) modified nucleotide, a 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotide, a 2'-fluoro (2'-F) modified nucleotide, a phosphorothioate (PS) bond between nucleotides, an inverted abasic modified nucleotide, or a combination thereof, or (2) the modified nucleotide optionally comprises a 2'-OMe modified nucleotide, an exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226).;

[0538] In some embodiments, the sgRNA comprises a modification motif disclosed herein, such as any one of the modification motifs of SEQ ID NOs: 228-242 and 246-250, 312-314, or any other modification motif shown in the sequence listing, wherein "N" may be any natural or non-natural nucleotide, preferably an RNA nucleotide, the sugar moiety of the nucleotide may be ribose, deoxyribose, or a similar compound having a substitution, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate bond to an adjacent nucleotide residue, and N' is collectively the nucleotide sequence of the guide sequence.

[0539] In certain embodiments, using SEQ ID NO: 400 (Exemplary NmeCas9 sgRNA-1 shown in Table 20) as an example, the exemplary NmeCas9 sgRNA-1 is a guide RNA (gRNA) comprising a guide region and a conserved region, where the conserved region is (a) a shortened repeat / anti-repeat region lacking 2 to 24 nucleotides, (i) one or more of nucleotides 37 to 48 and 53 to 64 are deleted relative to SEQ ID NO: 400, and optionally one or more of nucleotides 37 to 64 are substituted, and (ii) nucleotide 36 is linked to nucleotide 65 by at least two nucleotides, a shortened repeat / anti-repeat region; or (b) a shortened hairpin 1 region lacking 2 to 10, optionally 2 to 8 nucleotides, (i) one or more of nucleotides 82 to 86 and 91 to 95 are deleted relative to SEQ ID NO: 400, and optionally one or more of positions 82 to 96 are substituted, and (ii) nucleotide 81 is linked to nucleotide 96 by at least four nucleotides, a shortened hairpin 1 region; or (c) a shortened hairpin 2 region lacking 2 to 18, optionally 2 to 16 nucleotides, (i) one or more of nucleotides 113 to 121 and 126 to 134 are deleted relative to SEQ ID NO: 400, and optionally one or more of nucleotides 113 to 134 are substituted, and (ii) nucleotide 112 is linked to nucleotide 135 by at least four nucleotides, a shortened hairpin 2 region; and includes one or more of the above, where one or both of nucleotides 144 to 145 are optionally deleted relative to SEQ ID NO: 400, and optionally at least 10 nucleotides are modified nucleotides, and comprises a guide RNA (gRNA).

[0540] Exemplary unmodified conserved partial nucleotide sequences include GUUGUAGCUCCCUUUCUCAUUUCGGAAACGAAAUGAGAACCGUUGCUACAAUAAGGCCGUCUGAAAAGAUGUGCCGCAACGCUCUGCCCCUUAAAGCUUCUGCUUUAAGGGGCAUCGUUUA (SEQ ID NO: 243), GUUGUAGCUCCCUGAAACCGUUGCUACAAUAAGGCCGUCGAAAGAUGUGCCGCAACGCUCUGCCUUCUGGCAUCGUU (SEQ ID NO: 244), and GUUGUAGCUCCCUGGAAACCCGUUGCUACAAUAAGGCCGUCGAAAGAUGUGCCGCAACGCUCUGCCUUCUGGCAUCGUUUAUU (SEQ ID NO: 245).

[0541] In the case of sgRNA, the guide sequence can be incorporated into one of the following exemplary modified conserved partial motifs. GUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGCmAmAmCmGCUCUmGmCCmUmUmCmUGmGCmAmUC*mG*mU*mU (SEQ ID NO: 246), and GUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*mU (SEQ ID NO: 247).

[0542] In certain embodiments, the guide sequence is 20-25 nucleotides in length ((N)20-25), and each nucleotide can be independently modified. In certain embodiments, each of nucleotides 1-3 at the 5' end of the guide is independently modified. In certain embodiments, each of nucleotides 1-3 at the 5' end of the guide is independently modified with a 2'-OMe modification. In certain embodiments, each of nucleotides 1-3 at the 5' end of the guide is independently modified with a phosphorothioate bond to an adjacent nucleotide residue. In certain embodiments, each of nucleotides 1-3 at the 5' end of the guide is independently modified with a 2'-OMe modification and a phosphorothioate bond to an adjacent nucleotide residue.

[0543] In the case of sgRNA, the modified guide sequence can be incorporated into one of the following exemplary modified conserved partial motifs. mN*mNNNNNNNNmNNNmNNNNNNNNNNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGCmAmAmCmGCUCUmGmCCmUmUmCmUGmGCmAmUC*mG*mU*mU (SEQ ID NO: 248), (N) 20-25 GUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AA GmGmCCmGmUmCmGm AmAmAmGmAmUGUGC mCGCmAmAmCmGCUCUmGm CCmUmUmCmUGmGCmAmUC*mG*mU*mU (SEQ ID NO: 249), mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*mU (SEQ ID NO: 250), or mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAUAAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*mU (SEQ ID NO: 312), mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGmCmUmCmUmGmCCmUmUmCmUGGCAUCG*mU*mU (SEQ ID NO: 313), mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAUAAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGmCmUmCmUmGmCCmUmUmCmUGGCAUCG*mU*mU (SEQ ID NO: 314), any one of them.

[0544] In certain embodiments, sgRNAs such as exemplary SpyCas9 sgRNA-1, or sgRNAs comprising exemplary SpyCas9 sgRNA-1, further comprise a 3' tail, e.g., a 3' tail of 1, 2, 3, 4, or more nucleotides. In certain embodiments, the tail comprises one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotide comprises 2'-OMe modified nucleotides. In certain embodiments, the modified nucleotide comprises PS linkages between nucleotides. In certain embodiments, the modified nucleotide comprises 2'-OMe modified nucleotides and PS linkages between nucleotides.

[0545] In certain embodiments, the hairpin region comprises one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotide comprises 2'-OMe modified nucleotides.

[0546] In certain embodiments, the upper stem region comprises one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from a 2'-O-methyl (2'-OMe) modified nucleotide, a 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotide, a 2'-fluoro (2'-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof. In certain embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide.

[0547] In certain embodiments, exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is a pyrimidine and the YA dinucleotide comprises a modified nucleotide. In certain embodiments, the modified nucleotide is selected from a 2'-O-methyl (2'-OMe) modified nucleotide, a 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotide, a 2'-fluoro (2'-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof. In certain embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide.

[0548] In certain embodiments, exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is a pyrimidine and the YA dinucleotide comprises a sequence-substituted nucleotide, and the pyrimidine is substituted in place of a purine. In certain embodiments, when the pyrimidine forms a Watson-Crick base pair within a single guide, the Watson-Crick base of the sequence-substituted pyrimidine nucleotide is substituted and the Watson-Crick base pair is maintained.

[0549] In some embodiments, the gRNA is chemically modified. A gRNA containing one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or "chemically modified" gRNA to account for the presence of one or more non-natural or naturally occurring components or configurations used in place of, or in addition to, the canonical A, G, C, and U residues. In some embodiments, the modified gRNA is synthesized with non-canonical nucleosides or nucleotides, herein referred to as "modifications". Modified nucleosides and nucleotides can include (i) alterations of one or both of the unbonded phosphate oxygens or one or both of the bonded phosphate oxygens in the phosphodiester backbone linkage, e.g., replacement (exemplary backbone modifications), (ii) alterations of components of the ribose sugar, e.g., replacement of the 2'-hydroxyl of the rib...

Claims

**Claim 1** A method for genetically modifying a cell, comprising: (a) contacting the cell with a first genome editing tool, wherein the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and corresponds to the first genome editor; (b) contacting the cell with a second genome editing tool, wherein the second genome editing tool comprises a second genome editor and at least one gRNA that targets at least one genomic locus and corresponds to the second genome editor, and the first genome editor is orthogonal to the second genome editor; thereby resulting in at least two genome edits in the cell. **Claim 2** The method of claim 1, wherein the first genome editor or the second genome editor is delivered to the cell as at least one polypeptide or at least one polynucleotide encoding the polypeptide. **Claim 3** The method of claim 2, wherein the at least one polynucleotide is at least one mRNA. **Claim 4** The method according to any one of claims 1 to 3, wherein the at least one gRNA is delivered to the cell as at least one polynucleotide encoding the gRNA. **Claim 5** The method according to any one of claims 1 to 4, wherein the first genome editor comprises a nickase, a nuclease, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nickase. **Claim 6** The method according to any one of claims 1 to 5, wherein the second genome editor comprises a nickase, a nuclease, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nickase. **Claim 7** A method according to any one of claims 1 to 6, wherein one of the first genome editor and the second genome editor is a base editor, optionally including a C-to-T base editor or an A-to-G base editor, and the other of the first genome editor and the second genome editor includes a nickase.

8. The method according to claim 7, further comprising contacting the cell with a nucleic acid encoding a foreign gene.

9. A method according to any one of claims 1 to 8, wherein one of the first genome editor and the second genome editor includes an N. meningitidis (Nme) RNA-guided nickase or a nickase, and the other of the first genome editor and the second genome editor includes an S. pyogenes (Spy) RNA-guided nickase or a nickase.

10. The method according to any one of claims 1 to 9, wherein the first genome editor or the second genome editor includes Nme1Cas9, Nme2Cas9, Nme3Cas9, or SpyCas9.

11. A method for genetically modifying a cell, comprising: (a) contacting the cell with a first genome editing tool, wherein the first genome editing tool includes a first genome editor including a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the base editor; (b) contacting the cell with a second genome editing tool, wherein the second genome editing tool includes a second genome editor including an RNA-guided nickase and at least one gRNA targeting at least one genomic locus and corresponding to the RNA-guided nickase, and the base editor is orthogonal to the RNA-guided nickase; thereby effecting at least two genome edits in the cell.

12. A method for producing a population of cells comprising edited cells, comprising: (a) contacting the cell with a first genome editing tool, wherein the first genome editing tool comprises a first genome editor comprising a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the base editor, said contacting; (b) contacting the cell with a second genome editing tool, wherein the second genome editing tool comprises a second genome editor comprising an RNA-guided nuclease and at least one gRNA targeting at least one genomic locus and corresponding to the RNA-guided nuclease, and the base editor is orthogonal to the RNA-guided nuclease, said contacting; (c) culturing the cell to thereby produce a population of the cell comprising an edited cell comprising at least two genome edits per cell. The method as described above.

13. The method according to claim 11 or 12, wherein the base editor is a C to T base editor optionally comprising cytidine deaminase, or an A to G base editor optionally comprising adenosine deaminase.

14. The method according to any one of claims 1 to 13, wherein one of the at least two genome edits comprises a double-strand break and another one of the at least two genome edits comprises a translocation or a base edit (e.g., A to G or C to T).

15. The method according to any one of claims 1 to 14, wherein the first genome editing tool or the second genome editing tool is delivered to the cell by at least one lipid nanoparticle (LNP).

16. The method according to claims 1 to 15, wherein steps (a) and (b) are performed simultaneously.

17. The method according to any one of claims 1 to 16, wherein the first genome editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3, 146, or 311.

18. The method according to any one of claims 1 to 17, wherein the first genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1, and the second genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 180 to 190.

19. The method according to any one of claims 1 to 18, wherein the first genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 147 or 310, and the second genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 293 or 295.

20. The method according to any one of claims 1 to 16, wherein the first genome editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 9, 12, 18, and 21.

21. The method according to any one of claims 1 to 20, wherein the first genome editor or the base editor comprises cytidine deaminase, and the cytidine deaminase comprises an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO:

22.

22. The method according to claim 21, wherein the cytidine deaminase comprises APOBEC3A deaminase (A3A).

23. The method according to any one of claims 1 to 22, wherein the first genome editor or the base editor comprises Cas9 nickase.

24. The method according to any one of claims 1 to 23, wherein the first genome editor or the base editor comprises N. meningitidis (Nme) Cas9 nickase.

25. The method according to any one of claims 1 to 24, wherein the first genome editor or the base editor comprises D16A NmeCas9 nickase, optionally D16A Nme2Cas9. **Claim 26** The method according to any one of claims 1 to 25, wherein the second genome editor or the RNA-induced nuclease comprises a Cas9 nuclease. **Claim 27** The method according to any one of claims 1 to 26, wherein the second genome editor or the RNA-induced nuclease comprises S. pyogenes (Spy) Cas9 nuclease. **Claim 28** The method according to any one of claims 1 to 23, wherein the first genome editor or the base editor comprises S. pyogenes (Spy) Cas9 nickase. **Claim 29** The method according to any one of claims 1 to 23 and 28, wherein the first genome editor or the base editor comprises D10A SpyCas9 nickase. **Claim 30** The method according to any one of claims 1 to 23 and 29, wherein the second genome editor or the RNA-induced nuclease comprises N. meningitidis (Nme) Cas9 nuclease. **Claim 31** The method according to any one of claims 1 to 30, wherein at least one gRNA corresponding to the first genome editor or the base editor does not correspond to the second genome editor or the RNA-induced nuclease. **Claim 32** The method according to any one of claims 1 to 31, wherein at least one gRNA corresponding to the second genome editor or the RNA-induced nuclease does not correspond to the first genome editor or the base editor. **Claim 33** The method according to any one of claims 1 to 32, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least two gRNAs targeting at least two different genomic loci. **Claim 34** The method according to any one of claims 1 to 33, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least three gRNAs targeting at least three different genomic loci. **Claim 35** The method according to any one of claims 1 to 34, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least four gRNAs targeting at least four different genomic loci. **Claim 36** The method according to any one of claims 1 to 35, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least five gRNAs targeting at least five different genomic loci.

37. A composition comprising: (a) a first genome editing tool comprising a first genome editor and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the first genome editor; (b) a second genome editing tool comprising a second genome editor and at least one gRNA targeting at least one genomic locus and corresponding to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor.

38. The composition according to claim 37, wherein the first genome editor or the second genome editor comprises at least one polypeptide or at least one mRNA.

39. The composition according to claim 37 or 38, wherein the at least one gRNA comprises at least one polynucleotide encoding the gRNA.

40. The composition according to any one of claims 37 to 39, wherein the first genome editor comprises a nickase, a nicking nuclease, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

41. The composition according to any one of claims 37 to 40, wherein the second genome editor comprises a nickase, a nicking nuclease, a catalytically inactive nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

42. The composition according to any one of claims 37 to 41, wherein one of the first genome editor and the second genome editor comprises a base editor, optionally a C-to-T base editor or an A-to-G base editor, and the other of the first genome editor and the second genome editor comprises a nickase.

43. The composition according to claim 42, further comprising a nucleic acid encoding a foreign gene.

44. The composition according to any one of claims 37 to 41, wherein one of the first genome editor and the second genome editor comprises a C-to-T base editor, and the other of the first genome editor and the second genome editor comprises an A-to-G base editor.

45. The composition according to any one of claims 37 to 44, wherein one of the first genome editor and the second genome editor comprises an N. meningitidis (Nme) RNA-guided nickase, and the other of the first genome editor and the second genome editor comprises an S. pyogenes (Spy) RNA-guided nickase.

46. The composition according to any one of claims 37 to 45, wherein the first genome editor or the second genome editor is Nme1Cas9, Nme2Cas9, Nme3Cas9, or SpyCas9.

47. A composition comprising: (a) a first genome editing tool, the first genome editor comprising a base editor, and at least one guide RNA (gRNA) targeting at least one genomic locus and corresponding to the base editor, the first genome editing tool; (b) a second genome editing tool, the second genome editor comprising an RNA-guided nuclease, and at least one gRNA targeting at least one genomic locus and corresponding to the RNA-guided nuclease, the base editor being orthogonal to the RNA-guided nuclease, the second genome editing tool, the composition.

48. The composition according to claim 47, wherein the base editor is a C-to-T base editor optionally comprising a cytidine deaminase, or an A-to-G base editor optionally comprising an adenosine deaminase.

49. The composition according to any one of claims 37 to 48, wherein the first genome editing tool or the second genome editing tool is contained in at least one lipid nanoparticle (LNP).

50. The composition according to any one of claims 37 to 49, wherein the first genome editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3, 146, or 311.

51. The composition according to any one of claims 37 to 50, wherein the first genome editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1, and the second genome editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 180 to 190.

52. The composition according to any one of claims 37 to 51, wherein the first genome editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 147 or 310, and the second genome editor is delivered to a cell as a nucleic acid comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 293 or 295.

53. The composition according to any one of claims 37 to 49, wherein the first genome editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to any one of SEQ ID NOs: 9, 12, 18, and 21.

54. The composition according to any one of claims 37 to 53, wherein the first genome editor or the base editor comprises cytidine deaminase, and the cytidine deaminase comprises an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO:

22.

55. The composition according to claim 54, wherein the cytidine deaminase comprises APOBEC3A deaminase (A3A).

56. The composition according to any one of claims 37 to 55, wherein the first genome editor or the base editor comprises Cas9 nickase.

57. The composition according to any one of claims 37 to 56, wherein the first genome editor or the base editor comprises N. meningitidis (Nme) Cas9 nickase.

58. The composition according to any one of claims 37 to 57, wherein the first genome editor or the base editor comprises D16A NmeCas9 nickase, optionally D16A Nme2Cas9.

59. The composition according to any one of claims 37 to 58, wherein the second genome editor or the RNA-guided nuclease comprises Cas9 nuclease.

60. The composition according to any one of claims 37 to 59, wherein the second genome editor or the RNA-guided nuclease comprises S. pyogenes (Spy) Cas9 nuclease.

61. The composition according to any one of claims 37 to 56, wherein the first genome editor or the base editor comprises S. pyogenes (Spy) Cas9 nickase.

62. The composition according to any one of claims 37 to 56 and 61, wherein the first genome editor or the base editor comprises D10A SpyCas9 nickase.

63. The composition according to any one of claims 37 to 56, 61, and 62, wherein the second genome editor or the RNA-guided nuclease comprises N. meningitidis (Nme) Cas9 nuclease.

64. The composition according to any one of claims 37 to 63, wherein at least one gRNA corresponding to the first genome editor or the base editor does not correspond to the second genome editor or the RNA-guided nuclease.

65. The composition according to any one of claims 37 to 64, wherein at least one gRNA corresponding to the second genome editor or the RNA-guided nuclease does not correspond to the first genome editor or the base editor.

66. The composition according to any one of claims 37 to 65, wherein the at least one gRNA comprises at least one single guide RNA (sgRNA).

67. The composition according to any one of claims 37 to 66, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least two gRNAs targeting at least two different genomic loci.

68. The composition according to any one of claims 37 to 67, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least three gRNAs targeting at least three different genomic loci.

69. The composition according to any one of claims 37 to 68, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least four gRNAs targeting at least four different genomic loci.

70. The composition according to any one of claims 37 to 69, wherein the at least one gRNA corresponding to the first genome editor or the base editor comprises at least five gRNAs targeting at least five different genomic loci.

71. The composition according to any one of claims 68 to 70, wherein the first genome editor and 1, 2, 3, 4, 5, or 6 of the at least one gRNA corresponding to the first genome editor or the base editor and targeting different genomic loci are contained in the same lipid nanoparticle (LNP).

72. The method or composition according to any one of claims 15 to 36 and 49 to 71, wherein the LNP contains an ionizable lipid.

73. The method or composition according to claim 72, wherein the ionizable lipid contains a biodegradable ionizable lipid.

74. The method or composition according to any one of claims 15 to 36 and 49 to 73, wherein the LNP contains a lipid component, the lipid component contains about 50 to 60 mol% of an amine lipid such as lipid A, about 8 to 10 mol% of a neutral lipid, and about 2.5 to 4 mol% of a stealth lipid (for example, a PEG lipid), the remainder of the lipid component is a helper lipid, and the N / P ratio of the lipid LNP is about 3 to 7.

75. The method or composition according to any one of claims 15 to 36 and 49 to 74, wherein the LNP contains a lipid component, and the lipid component contains about 25 to 45 mol% of amine lipids such as lipid A, about 10 to 30 mol% of neutral lipids, about 25 to 65 mol% of helper lipids, and about 1.5 to 3.5 mol% of stealth lipids (for example, PEG lipids), and the N / P ratio of the LNP is about 3 to 7.

76. A cell that has been treated in vitro by the method or composition according to any one of claims 1 to 75.

77. The cell according to claim 76, wherein the cell is a human cell.

78. The cell according to claim 76 or 77, wherein the cell is selected from mesenchymal stem cells, hematopoietic stem cells (HSCs), monocytes, endothelial progenitor cells (EPCs), neural stem cells (NSCs), limbal stem cells (LSCs), tissue-specific primary cells or cells derived therefrom (TSCs), induced pluripotent stem cells (iPSCs), ocular stem cells, pluripotent stem cells (PSCs), embryonic stem cells (ESCs), and cells for organ or tissue transplantation, and optionally cells for use in ACT therapy.

79. The cell according to any one of claims 76 to 78, wherein the cell is an immune cell.

80. A population of cells comprising the cell according to any one of claims 76 to 79.

81. The population of cells according to claim 80, wherein the cells are cultured ex vivo, expanded, or proliferated.

82. The cell, cell population, or composition according to any one of claims 37 to 81 for use in the treatment of cancer.

83. Use of the cell, cell population, or composition according to any one of claims 37 to 82 for the preparation of a medicament for treating cancer.

84. An engineered cell comprising at least three base edits at at least three genomic loci and at least one foreign gene.