RNA inhibitors that inhibit APOC3 gene expression and their applications
RNA inhibitors with modified nucleotides and liver-targeting carriers enhance APOC3 gene inhibition efficiency and duration, addressing limitations in existing technologies and providing effective treatments for APOC3-related diseases.
Patent Information
- Application Number
- JP2025506057
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-05
- Filing Date
- 2023-08-04
- Publication Date
- 2025-08-07
AI Technical Summary
Existing RNA inhibitors for APOC3 gene expression have limitations in inhibition efficiency and durability, and there is a need for safer and more effective delivery systems to target liver cells for treating cardiovascular and cerebrovascular diseases.
Development of RNA inhibitors with specific base pairing between sense and antisense strands, modified nucleotides, and a carrier structure targeting the hepatic asialoglycoprotein receptor (ASGPR) for liver-specific delivery, enhancing inhibition efficiency and duration.
The RNA inhibitors effectively inhibit APOC3 protein expression, providing long-lasting effects and safer delivery to liver cells, offering potential treatments for hypertriglyceridemia, familial chylomicronemia syndrome, and other APOC3-related diseases.
Smart Images

Figure 2025525928000001_ABST
Abstract
Description
[Technical Field]
[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims priority to Chinese patent applications filed with the State Intellectual Property Office of China on August 5, 2022, March 17, 2023, and June 5, 2023, bearing application numbers 202210936491.5, 202310260531.3, and 202310655563.3, respectively, and titled "RNA inhibitors inhibiting APOC3 gene expression and applications thereof," "APOC3 inhibitors and applications thereof," and "RNA inhibitors inhibiting APOC3 gene expression and applications thereof," respectively, the entire contents of which are incorporated herein by reference.
[0002] The present invention relates to the field of biomedicine, and in particular to an RNA inhibitor that inhibits APOC3 gene expression and its application. [Background technology]
[0003] (RNA inhibitors) RNA inhibitors (RNA interference) were discovered in 1998 by Andrew Z. Fire and colleagues during antisense RNA inhibition experiments in Caenorhabditis elegans, and they named this process RNA interference. This discovery was listed as one of the top 10 scientific advances of 2001 by Science magazine and ranked first in the top 10 scientific advances in 2002. Since then, siRNAs, which use RNA interference as their mechanism of action, have attracted widespread attention as potential gene therapy agents. In 2006, Andrew Z. Fire and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of RNA interference mechanisms. RNA interference can be induced by double-stranded RNA (dsRNA) in many organisms, including animals, plants, and fungi. In the RNA inhibitor process, an endonuclease called "Dicer" cleaves or "dices" long dsRNA into small fragments 21–25 nucleotides long. These small fragments are called small interfering RNAs (siRNAs), whose antisense strand (guide strand) is loaded onto the Argonaute protein (AGO2). AGO2 loading occurs in the RISC-loading complex, a ternary complex consisting of the Argonaute protein, Dicer, and a dsRNA-binding protein (TRBP). During loading, AGO2 cleaves and ejects the sense strand (passenger strand). AGO2 then binds to mRNAs containing perfectly complementary sequences with the antisense strand and catalyzes the cleavage of these mRNAs, resulting in mRNA fragmentation, loss of their role as translation templates, and prevention of the synthesis of associated proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex loaded with the antisense strand is recycled for further cleavage.
[0004] Statistics show that over 80% of disease-related proteins in the human body cannot be targeted or treated with conventional small molecule drugs or biopolymer preparations. Gene therapy, which aims to treat diseases through functions such as gene expression and silencing, is considered by the industry as the third-generation therapeutic agent following chemical small molecule drugs and biopolymer drugs. This therapy can treat diseases at the gene level and is not limited by undruggable proteins. As the most mainstream type of RNA inhibitor technology in gene therapy, RNA inhibitor technology treats diseases at the mRNA level, which is more effective than chemical small molecule drugs or biopolymer drugs at the protein level. Using RNA inhibitor technology, it is possible to design sense and antisense strand sequences of siRNA with high specificity and inhibitory effect according to specific gene sequences. These single-stranded sequences are synthesized by solid-phase synthesis, and then the sense and antisense strands are paired with siRNA according to base-pairing principles in a specific annealing buffer. Finally, they are delivered to the corresponding target in the body via a carrier system, where they degrade the target mRNA, disrupting its function as a translation template and preventing the synthesis of the associated protein.
[0005] (siRNA delivery system) siRNA is unstable in blood and tissues and is easily degraded by nucleases. To improve siRNA stability, the sense and / or antisense strands of siRNA can be modified, but these chemical modifications only provide limited protection from nuclease degradation and may ultimately affect siRNA activity. Therefore, a corresponding delivery system is also required to safely and efficiently cross the cell membrane. Due to its large molecular weight, high negative charge, and high water solubility, siRNA itself cannot smoothly cross the cell membrane and enter cells.
[0006] The basic structure of liposomes consists of a hydrophilic core and a phospholipid bilayer. This phospholipid bilayer, similar to biological membranes, provides high biocompatibility, making liposomes the most popular and widely used siRNA carrier. Liposome-mediated siRNA delivery primarily involves encapsulating siRNA within the liposome, protecting it from nuclease degradation, improving its efficiency in crossing the cell membrane barrier, and facilitating cellular uptake. While there have been advances in liposomes, such as anionic liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and cationic liposomes, liposomes themselves are prone to inflammatory reactions, necessitating the use of various antihistamines and hormonal agents, such as cetirizine and dexamethasone, prior to administration to reduce potential acute inflammatory responses. Therefore, liposomes are not suitable for all therapeutic areas in clinical applications. Especially in the field of chronic disease treatment, potential toxicity accumulation during long-term use poses a potential safety risk, and therefore a safer and more effective carrier system is needed for siRNA delivery.
[0007] The hepatic asialoglycoprotein receptor (ASGPR) is a highly efficient intracellular receptor specifically expressed in hepatocytes. Under physiological conditions in vivo, various glycoproteins undergo enzymatic or acid hydrolysis of sialic acid, resulting in the exposed secondary terminus of galactose residues. Therefore, ASGPR specifically binds to galactosyl groups, hence the term galactose-specific receptor. Both monosaccharide and polysaccharide molecules, such as galactose, galactosamine, and N-acetylgalactosamine, have high affinity for ASGPR. The primary physiological function of ASGPR is to mediate the clearance of substances such as asialoglycoproteins and lipoproteins from the blood, which is closely related to the development and progression of liver diseases such as viral hepatitis, cirrhosis, and hepatocellular carcinoma. This characteristic expression of ASGPR plays an important role in the diagnosis and treatment of hepatic diseases (Ashwell G, Harford J, Carbohydrate-specific Receptors of the Liver, Ann Rev Biochem 1982 51:531-554). Hepatogenic disease therapeutic agents containing galactose or galactosamine and their derivatives in their structure have specific affinity for ASGPR, so they actively target the liver and do not require other carrier systems for delivery.
[0008] (APOC3 and cardiovascular and cerebrovascular diseases) APOC3 (apolipoprotein C-III) is the gene encoding apolipoprotein C3, an 8.8-kD glycoprotein composed of 79 amino acid residues and approximately 3.1 kb in length. APOC3 inhibits the activity of lipoprotein lipase and hepatic lipase, interfering with the ApoE-mediated binding of triglyceride-rich lipoproteins to hepatic lipase, affecting the balance of lipid metabolism and predisposing to hypertriglyceridemia. Numerous association studies have shown that the SstI restriction site polymorphism in the APOC3 gene is associated with hypertriglyceridemia and may therefore be associated with other cardiovascular diseases caused by hypertriglyceridemia.
[0009] APOC3 plays a key role in the metabolism of triglyceride-rich lipoproteins. In normal fasting plasma, it is primarily bound to high-density lipoprotein cholesterol (HDL-c) (approximately 70%), whereas in patients with hypertriglyceridemia, plasma APOC3 levels are significantly increased and it is primarily (approximately 86%) bound to very-low-density lipoprotein (VLDL).
[0010] Domestic and international studies have shown that elevated plasma APOC3 levels can cause hypertriglyceridemia, and that plasma APOC3 levels are positively correlated with plasma triglycerides and triglyceride levels in very low-density lipoproteins. Numerous studies have now shown that APOC3 gene function is correlated with cardiovascular and cerebrovascular diseases, such as coronary arteriosclerosis, type 2 diabetes, and cerebral infarction.
[0011] Familial hyperchylomicronemia (FCS), also known as lipoprotein lipase deficiency and primary hyperlipoproteinemia type 1, is a rare autosomal recessive genetic disorder that requires long-term dietary fat restriction. Prior to November 2012, no specific medications were available to treat FCS. Clinical features of FCS include elevated triglycerides and recurrent pancreatitis. In November 2012, the European Commission (EC) approved Glybera, the first gene therapy drug in the Western world. However, Glybera is extremely expensive, with an estimated cost per patient of 1.25 million euros (approximately $1.6 million). There is an urgent need for specific drugs to treat FCS. APOC3 is a key regulator of lipid metabolism. Loss-of-function mutations in APOC3 inhibit hepatocytes from removing triglyceride-rich lipoprotein particles, resulting in elevated triglyceride and VLDL levels and reduced HDL-c levels. Silencing APOC3 expression can lower harmful lipoprotein indices (i.e., TG and VLDL levels) and increase levels of "good" cholesterol HDL-c. APOC3 small molecule interfering inhibitors are being developed for the treatment of hypertriglyceridemia (HTG), severe hypertriglyceridemia (sHTG), and familial chylomicronemia syndrome (FCS), offering new hope for the treatment of chylomicronemia.
[0012] Conventional technology has already been able to inhibit APOC3 gene expression using RNA interference technology, but the inhibition efficiency and durability still need to be improved, and the market needs RNA inhibitors with higher inhibition efficiency and longer-lasting effects. Summary of the Invention [Problem to be solved by the invention]
[0013] To achieve the above object, the present invention provides an RNA inhibitor or a pharmaceutically acceptable salt thereof that inhibits APOC3 gene expression, which specifically interferes with APOC3 gene mRNA, disrupts its function as a translation template, and inhibits APOC3 protein expression, thereby preventing and / or treating APOC3 gene-mediated diseases. The RNA inhibitor of the present invention has excellent inhibitory effect on APOC3 protein expression, a long duration of action, and is highly valuable for medical applications. [Means for solving the problem]
[0014] In one aspect, the present invention provides an RNA inhibitor or a pharmaceutically acceptable salt thereof that inhibits APOC3 gene expression, wherein the RNA inhibitor is formed by base pairing between a sense strand and an antisense strand, each strand independently having a length of 15 to 30 nucleotides, wherein the length of each strand is independently preferably 19 to 23 nucleotides, and there is at least 80% base complementarity between the sense strand and the antisense strand.
[0015] In some embodiments, the antisense strand is preferably selected from a) the following sequences, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), and c) a sequence that differs from the sequences in a) and b) by 3 nucleotides or less: 5'uugguggcgugcuucauguaatt3' (SEQ ID NO: 212), 5'uaacccugcaugaagcugagatt3' (SEQ ID NO: 216), 5'uuaacggugcuccaguagucutt3' (SEQ ID NO: 224), 5'cagagaacuuguccuuaacggtt3' (SEQ ID NO: 225), 5'uauugaggucucaggcagccatt3' (SEQ ID NO: 241), 5'ugaaguuggucugaccucaggtt3' (SEQ ID NO: 255), 5'gcacugagaauacugucccuuuu3' (SEQ ID NO: 256), 5'gcacugagaauacugucccuu3' (SEQ ID NO: 459), 5' acacugagaauacugucccua3' (SEQ ID NO: 461), 5'ugaauacugucccuuuuaagc3' (SEQ ID NO: 465), 5'cugagaauacugucccuuuua3' (SEQ ID NO: 471), 5'acugagaauacugucccuuua3' (SEQ ID NO: 472), 5'uaauacugucccuuuuaagcaa3' (SEQ ID NO: 438), 5'ugaggucucaggcagccacgg3' (SEQ ID NO: 600), 5'uggauaggcagguggacuugg3' (SEQ ID NO: 620), 5'caggauggauaggcaggugga3' (SEQ ID NO: 624), 5'gagcacugagaauacuguccc3' (SEQ ID NO: 668), 5'acacugagaauacugucgcuc3' (SEQ ID NO: 687), 5'acacugagaauacugucgcuu3' (SEQ ID NO: 700), 5'ucacugagaauacugucccuu3' (SEQ ID NO: 519); Among them, g = guanylic acid, a = adenylic acid, u = uridylic acid, c = cytidylic acid, and t = thymidylic acid.
[0016] It should be noted that "at least 15 consecutive nucleotides, each independently representing the sequence, refers to 15, 16, 17, 18, 19, 20, 21, etc. consecutive nucleotides." "Independently differing by 3 or fewer nucleotides" means that 1, 2, or 3 nucleotides are different. The sense strands and antisense strands exemplified below are not limited to the combinations required to form the RNA inhibitors exemplified in the present invention. As long as they can be complementarily paired to form a double strand, sense strand, or antisense strand, any combination may be used, and the examples are not intended to limit the scope of the invention.
[0017] In some embodiments, more preferably, the sense strand and the antisense strand are selected from a) the following sequences, b) sequences having at least 15 consecutive nucleotides identical to the sequence in a), and c) sequences that differ from the sequences in a) and b) by 3 nucleotides or less, and the combination of the sequences of the sense strand and the antisense strand is as follows: JPEG2025525928000002.jpg122170
[0018] In the RNA inhibitors described in this invention, one or more nucleotides in the sense and / or antisense strand may be modified to form modified nucleotides.
[0019] Preferably, in the RNA inhibitors described in the present invention, the sense strand and / or the antisense strand comprises at least one 2'-modified nucleotide, and the 2'-modified nucleotide comprises a 2'-O-methyl nucleotide, a 2'-deoxy-2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2'-methoxyethyl nucleotide, a 2'-amino nucleotide or a 2'-alkyl nucleotide.
[0020] More preferably, in the RNA inhibitors described in the present invention, the sense strand and / or the antisense strand comprises at least one 2'-O-methyl nucleotide or 2'-deoxy-2'-fluoro nucleotide.
[0021] Preferably, in the RNA inhibitors described in the present invention, the phosphate ester bonds between three adjacent nucleotides at at least one of the ends of the sense strand and / or the antisense strand may be thioated.
[0022] In the above technical solution, preferably, the sense strand and the antisense strand are selected from a) the following sequences, b) sequences having at least 15 consecutive nucleotides identical to the sequence in a), and c) sequences having 3 or fewer nucleotides different from the sequences in a) and b): JPEG2025525928000003.jpg143170where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenylic acid, U = 2'-O-methyluridylic acid, C = 2'-O-methylcytidylic acid, fG = 2'-fluoroguanylic acid, fA = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid, Gs = 2'-O-methyl-3'-cytidylic acid fguanylic acid, As = 2'-O-methyl-3'-thioadenylic acid, U = 2'-O-methyl-3'-thiouridylic acid, Cs = 2'-O-methyl-3'-thiocytidylic acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = thymidylic acid.
[0023] In the technical solution, preferably, the RNA inhibitor or its pharmaceutically acceptable salt further comprises a carrier structure, and the RNA inhibitor is as shown in formula Ia, Ib, or Ic: JPEG2025525928000004.jpg192170where, the carrier structure comprises a 5'MVIP and a 3'MVIP, 5'MVIP is composed of a transition point R1, a connecting chain D, a linker B, a branched chain L, and a liver-targeting specific ligand X, and is connected to the 5' end of the sense strand or the 5' end of the antisense strand via the transition point R1, and its structure is represented by general formula I: MVIP is composed of a transition point R2, a connecting chain D, a linker B, a branched chain L, and a liver-targeting specific ligand X, which is connected to the 3' end of the sense strand or the 3' end of the antisense strand via the transition point R2, and its structure is represented by general formula II: JPEG2025525928000006.jpg17170where, n and m are each independently any integer from 0 to 4, and are each independently preferably an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3, or 4, and more preferably 4.
[0024] In one embodiment, the transition point R1 is a heterocyclic or carbocyclic structure containing N, S, or O, such as: JPEG2025525928000007.jpg63170 or R1 is -NH(CH2) x CH2O-, where x is any integer from 3 to 12, and preferably any integer from 4 to 6.
[0025] In one embodiment, the transition point R2 is a heterocyclic or carbocyclic structure containing N, S, or O, such as: JPEG2025525928000008.jpg66170 Or, the transition point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, where x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4; The liver-targeting specific ligand X is the same or different within each of the 5'MVIP and the 3'MVIP, or between the 5'MVIP and the 3'MVIP, and is selected from monosaccharides and derivatives thereof, preferably N-acetylgalactosamine and derivatives thereof, and more preferably selected from the following structures: JPEG2025525928000009.jpg78170 In one embodiment, W is -OH, -NHCOOH, and -NHCO(CH2). qCH3, where q is an integer from 0 to 4.
[0026] In one example, the branched chains L are the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP and are selected from one or more of the following structures: JPEG2025525928000010.jpg124170Here, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, Z is H, an alkyl group or an amide group, and the alkyl is, for example, a C1 to C5 alkyl group.
[0027] In one embodiment, the linker B is the same or different within each of the 5'MVIP and the 3'MVIP, or between the 5'MVIP and the 3'MVIP, and is selected from the following structures: JPEG2025525928000011.jpg126170 where A1 and A2 each independently represent C, O, S, —NH—, a carbonyl group, an amide group, a phosphoryl group, or a thiophosphoryl group, and r is an integer of 0 to 4.
[0028] In one embodiment, the linking chain D is the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP, and is selected from the following structures: JPEG2025525928000012.jpg56170JPEG2025525928000013.jpg154170JPEG2025525928000014.jpg208170Here, each p is independently any integer from 1 to 20, s is any integer from 2 to 13, and Z1 and Z2 are the same or different substituents.
[0029] It should be noted that none of the above structures are exhaustive, and targeting of any receptor or any structure, whether the delivery mode is disclosed or not, is within the scope of protection of the present invention, as long as the carrier is connected to the sequence of the present invention.
[0030] The disclosed delivery methods include a coupling carrier delivery method and a lipid encapsulation delivery method, such as cholesterol binding, antibody binding, folate binding, and GalNac binding, and a lipid encapsulation delivery method such as lipid nanoparticles (LNPs), polymer nanoparticles, and extracellular vesicles.
[0031] More preferably, in the RNA inhibitor or a pharmaceutically acceptable salt thereof described in the present invention, the carrier structure at the 5'-end of the sense strand is 5'MVIP17, the carrier structure at the 3'-end of the sense strand is 3'MVIP17, and the combination of 5'MVIP in the sense strand and 3'MVIP in the antisense strand is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, 5'MVIP17 / 3'MVIP01 or 5'MVIP09 / 3'MVIP09, or the combination of 5'MVIP in the sense strand and 3'MVIP in the sense strand is 5'MVIP01 / 3'MVIP09, 5'MVIP09 / 3'MVIP01 or 5'MVIP01 / 3'MVIP01.
[0032] More preferably, in the RNA inhibitor or a pharmaceutically acceptable salt thereof described in the present invention, said RNA inhibitor is selected from the group consisting of Ky-12-DS23001, Ky-12-DS25001, Ky-12-DS25401, Ky-12-DS29701, Ky-12-DS29801, Ky-12-DS31701, Ky-12-DS31702, Ky-12-DS31703, Ky-12-DS31704, Ky-12-DS31705, Ky-12-DS31706, Ky-12-DS31707, Ky-12-DS31708, Ky-12-DS31709, Ky-12-DS3171 1, Ky-12-DS31712, Ky-12-DS31713, Ky-12-DS33001, Ky-12-DS33006, Kylo-12-DS1071, Kylo-12-DS1081, Kylo-12-DS1131, Kylo-12-DS1141, Kylo-12-DS1241, Kylo-12-DS1311, Kylo-12-DS1321, Kylo-12-DS5911, Kylo-12-DS2911, Kylo-12-DS2611, Kylo-12-DS2311, Kylo-12-DS3111, and Kylo-12-DS5411.
[0033] Meanwhile, the present invention also provides the use of the RNA inhibitor or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for treating and / or preventing a disease associated with elevated APOC3 levels, including inflammatory diseases, cardiovascular and cerebrovascular diseases, and hepatic diseases including metabolic diseases, and the cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary artery sclerosis, aortic stenosis, hypertriglyceridemia (HTG), severe hypertriglyceridemia (sHTG), and familial chylomicronemia syndrome (FCS).
[0034] The present invention also provides a pharmaceutical composition comprising the above-mentioned RNA inhibitor that inhibits APOC3 gene expression or a pharmaceutically acceptable salt thereof, and any pharmaceutically acceptable adjuvant, wherein the pharmaceutically acceptable adjuvant may be a pharmaceutically acceptable excipient, carrier, and / or diluent, and the pharmaceutical composition is administered orally, intravenously, or subcutaneously or intramuscularly, preferably subcutaneously.
[0035] The present invention also provides a method for treating and / or preventing a disease, condition, or syndrome associated with elevated APOC3 levels, comprising administering to a subject in need of such treatment and / or prevention a therapeutically effective amount of an RNA inhibitor that inhibits APOC3 gene expression, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a pharmaceutically acceptable salt of the RNA inhibitor and an optional pharmaceutically acceptable adjuvant. The administration route (administration method) to the subject can be oral administration, intravenous injection, subcutaneous or intramuscular injection, rectal or intraperitoneal administration, or aerosol inhalation. Those skilled in the art will readily appreciate other aspects and advantages of the present application from the following detailed description. Only exemplary embodiments of the present application are shown and described in the following detailed description. As will be apparent to those skilled in the art, the teachings of the present application will enable those skilled in the art to make modifications to the specific embodiments disclosed without departing from the spirit and scope of the present invention. Accordingly, the drawings and description herein are illustrative only and not restrictive. [Brief explanation of the drawings]
[0036] Specific features of the invention of the present application are set forth in the appended claims. The features and advantages of the invention of the present application can be better understood with reference to the exemplary embodiments and drawings described in detail below, a brief description of which follows. [Figure 1] FIG. 1 is a schematic diagram of the average hAPOC3 levels in the serum of hAPOC3 Tg mice after intervention with an RNA inhibitor in Example 9 of the present application. [Figure 2] FIG. 1 is a schematic diagram of the inhibitory effect on APOC3 mRNA levels after intervention with an RNA inhibitor in Example 10 of the present application. [Figure 3] FIG. 1 is a schematic diagram of the inhibitory effect on APOC3 mRNA levels in HepG2 cells after intervention with an RNA inhibitor in Example 11 of the present application. [Figure 4] FIG. 1 is a schematic diagram of the inhibitory effect on APOC3 mRNA levels in PHH cells after intervention with an RNA inhibitor in Example 12 of the present application. [Figure 5] FIG. 1 is a schematic diagram of the average hAPOC3 levels in the serum of hAPOC3 Tg mice after intervention with an RNA inhibitor in Example 13 of the present application. [Figure 6] FIG. 1 is a schematic diagram of the average serum TG levels of hAPOC3 Tg mice after intervention with an RNA inhibitor in Example 13 of the present application. [Figure 7] FIG. 1 is a schematic diagram of the hAPOC3 inhibitory effect in the serum of hAPOC3 Tg mice after intervention with an RNA inhibitor in Example 14 of the present application. [Figure 8] FIG. 10 is a schematic diagram showing the effect of reducing TC in the serum of hAPOC3 Tg mice after intervention with an RNA inhibitor in Example 14 of the present application. [Figure 9] FIG. 10 is a schematic diagram showing the effect of lowering TG in the serum of hAPOC3 Tg mice after intervention with an RNA inhibitor in Example 14 of the present application. [Figure 10] FIG. 10 is a schematic diagram showing the effect of lowering LDL-c in the serum of hAPOC3 Tg mice after intervention with an RNA inhibitor in Example 14 of the present application. [Figure 11] FIG. 1 is a schematic diagram of the APOC3 inhibitory effect in serum of fat-rich cynomolgus monkeys after intervention with an RNA inhibitor in Example 15 of the present application. [Figure 12] FIG. 1 is a schematic diagram showing the effect of lowering TG in serum of fat-obese cynomolgus monkeys after intervention with an RNA inhibitor in Example 15 of the present application. [Figure 13] FIG. 1 is a schematic diagram of changes in HDL-c levels in serum of fat-obese cynomolgus monkeys after intervention with RNA inhibitors in Example 15 of the present application. [Figure 14]FIG. 1 is a schematic diagram showing the effect of lowering LDL-c in serum of fat-obese cynomolgus monkeys after intervention with an RNA inhibitor in Example 15 of the present application. [Figure 15] FIG. 1 is a schematic diagram of the TC-reducing effect in serum of fat-obese cynomolgus monkeys after intervention with an RNA inhibitor in Example 15 of the present application. DETAILED DESCRIPTION OF THE INVENTION
[0037] The embodiments of the present invention are described below with reference to specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed herein.
[0038] (Definition of terms) In this application, examples of APOC3 mRNA sequences can be easily obtained using public databases such as GenBank, UniProt, and OMIM. The term "APOC3" includes human APOC3, cynomolgus monkey APOC3, macaque APOC3, mouse APOC3, rat (Rattus norvegicus) APOC3, and rabbit (Rattus europaea) APOC3, and so on, all of which are within the scope of the present invention as long as the organism actually exists and has the APOC3 gene. The mRNA sequence of human APOC3 can be found, for example, in GenBank NM_000040.3. The amino acid sequence of cynomolgus monkey APOC3 and its complete coding sequence can be found, for example, in GenBank accession number GI:544489959 (XM_05579730.1), the amino acid sequence of macaque monkey APOC3 and its complete coding sequence can be found, for example, in GenBank accession number GI:297269260 (XM_001090312.2), the amino acid sequence of mouse APOC3 and its complete coding sequence can be found, for example, in GenBank accession number GI:577019555 (NM_023114.4), the amino acid sequence of rat (Rattus norvegicus) APOC3 and its complete coding sequence can be found, for example, in GenBank accession number GI:402534545 (NM_012501.2), and the amino acid sequence of rabbit (Rattus norvegicus) APOC3 can be found, for example, in GenBank accession number GI:655601498 (XM_002708371.2).
[0039] In this application, the terms "iRNA," "RNA inhibitor," "iRNA formulation," and "RNA interfering agent" can be used interchangeably and generally refer to agents containing RNA as defined herein, which can mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNA induces sequence-specific degradation of mRNA through a process called RNA interference (RNA inhibitor). iRNA regulates (e.g., inhibits) the expression of the APOC3 gene in cells (e.g., cells of a subject, such as a mammal).
[0040] In certain embodiments, the RNA inhibitor may be a single-stranded siRNA (ssRNA inhibitor) that is introduced into a cell or organism to inhibit target mRNA. The single-stranded RNA inhibitor binds to the RISC endonuclease Argonaute2, which cleaves the target mRNA. Single-stranded siRNAs are generally 15-30 nucleotides long and chemically modified.
[0041] In certain embodiments, the term "iRNA" used in this application refers to double-stranded RNA, and is referred to herein as a "double-stranded RNA inhibitor," a "double-stranded RNA (dsRNA) molecule," a "dsRNA formulation," or a "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure, comprising two antiparallel and substantially complementary nucleic acid strands, and is known to have a "sense" and an "antisense" orientation relative to the target RNA (i.e., the APOC3 gene). In some embodiments of this application, double-stranded RNA (dsRNA) causes the degradation of target RNA (e.g., mRNA) through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNA inhibitor).
[0042] The double-stranded structure can be any length that allows the desired target RNA to be specifically degraded through the RISC pathway, and can have a length ranging from about 19 to 36 base pairs, e.g., about 19 to 30 base pairs, e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs. Intermediate ranges and lengths within the above ranges and lengths are also encompassed by this application. In some embodiments, the iRNA formulation of this application is a dsRNA containing 15 to 23 nucleotides on each strand, which interacts with a target RNA sequence (e.g., an APOC3 gene) to induce cleavage of the target RNA. In some embodiments, the iRNA of this application is a dsRNA of 24 to 30 nucleotides that interacts with a target RNA sequence (e.g., an APOC3 target mRNA sequence) to induce cleavage of the target RNA.
[0043] Generally, most of the nucleotides in each strand of a dsRNA molecule are ribonucleotides; however, as described in detail herein, each or both strands may contain one or more non-ribonucleotides, such as deoxyribonucleotides or modified nucleotides. Furthermore, as used herein, "iRNA" can contain chemically modified ribonucleotides. iRNA can contain substantial modifications in multiple nucleotides. The term "modified nucleotide" as used herein refers to a nucleotide having an independently modified sugar moiety, modified internucleotide linkage, or modified nucleobase, or any combination thereof. Thus, the term "modified nucleotide" includes, for example, the substitution, addition, or removal of functional groups or atoms in the internucleotide linkage, sugar moiety, or nucleobase. Modifications applied to the formulations of the present application include all types of modifications disclosed in the present invention or known in the art.
[0044] In this application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides or their analogs) of any length. Polynucleotides can have any three-dimensional structure and perform any function. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g., probes, primers, ESTs, or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, carriers, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNA inhibitor reagents, and primers. Polynucleotides may be modified or substituted in one or more bases, sugars, and / or phosphates with any of a variety of modifications or substitutions described herein or known in the art. Polynucleotides may also include modified nucleotides, such as methylated nucleotides or nucleotide analogs. If present, the nucleotide structure may be modified before or after assembly of the polymer. The nucleotide sequence can be blocked by non-nucleotide components. A polynucleotide can be modified after polymerization, for example, by conjugation with a labeling component. The term can refer to double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of a polynucleotide in this application includes a double-stranded form and two complementary single-stranded forms that are known or predicted to constitute a double-stranded form.
[0045] As used herein, the term "target nucleic acid" or "target sequence" generally refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the APOC3 gene, including the mRNA as the RNA processing product of the primary transcription product. The target portion of the sequence must be long enough to function as a substrate for directing iRNA cleavage at or near that portion of the nucleotide sequence of the mRNA molecule formed during transcription of the APOC3 gene. In one embodiment, the target sequence is within the protein-coding region of APOC3. The length of the target sequence may be approximately 19 to 36 nucleotides, with a preferred length being approximately 19 to 30 nucleotides, for example. Intermediate ranges and lengths within the above ranges and lengths are also encompassed by this application.
[0046] In this application, the term "nucleotide sequence" generally refers to a series or specific sequence of modified or unmodified nucleic acid bases, nucleotides and / or nucleosides, described as a series of letters by the standard nucleotide nomenclature and the list of symbols for modified nucleotides set forth in this application.
[0047] In this application, the term "oligonucleotide" generally refers to a polymer composed of multiple nucleotide residues (deoxyribonucleotides or ribonucleotides, or related structural variants or synthetic analogs) linked by phosphodiester bonds (or related structural variants or synthetic analogs). Thus, while the term "oligonucleotide" generally refers to a nucleotide polymer in which the nucleotide residues and linkages between them are naturally occurring, it should be understood that the scope of the term also includes various analogs, including, but not limited to, peptide nucleic acids (PNAs), aminophosphates, phosphorothioates, methylphosphonates, 2-O-methylribonucleic acids, and the like. The exact size of the molecule may vary depending on the particular application. Oligonucleotides are generally short in length, typically having about 10-30 nucleotide residues, although the terms "polynucleotide" or "nucleic acid" are commonly used for larger oligonucleotides, and the terms may refer to molecules of any length.
[0048] In some embodiments, an oligonucleotide comprises one or more unmodified ribonucleotides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleotides. The term "modified oligonucleotide" generally refers to an oligonucleotide comprising at least one modified nucleoside and / or at least one modified internucleoside linkage.
[0049] In this application, the term "modified nucleoside" generally refers to a nucleoside that contains at least one chemical modification compared to a naturally occurring RNA or DNA nucleoside. Modified nucleosides include a modified sugar moiety and / or a modified nucleobase.
[0050] In this application, the term "nucleobase" generally refers to a heterocyclic pyrimidine or purine compound, which includes adenine, guanine, cytosine, thymine, and uracil as components of all nucleic acids. Nucleotides may include modified nucleotides or nucleotide mimics, abasic sites (Ab or X), or portions replaced by substitutes. As used in this application, "nucleobase sequence" generally refers to the order of consecutive nucleobases independent of any sugar, linkage, or nucleobase modifications. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally refers to the naturally occurring heterocyclic nucleobases of RNA or DNA, i.e., the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine, and uracil. A "modified nucleobase" generally refers to any nucleobase that is not a naturally occurring nucleobase.
[0051] The letters "g," "c," "a," "t," and "u" generally refer to nucleotides containing guanine, cytosine, adenine, thymine, and uracil, respectively, as bases. However, it should be understood that the term "ribonucleotide" or "nucleotide" can also refer to modified nucleotides, as shown in Tables 1 and 2. Those skilled in the art will recognize that guanine, cytosine, adenine, thymidine, and uracil can be substituted with other moieties without significantly altering the base-pairing properties of the oligonucleotide containing such a substituted moiety. For example, but not limited to, i (inosinic acid), also known as hypoxanthine, can form base pairs with a, c, and u, and in some cases, i can also pair with g, a phenomenon known as wobble. Therefore, in the nucleotide sequences of dsRNAs characterized in the present application, nucleotides containing a, c, or u may be replaced with, for example, nucleotides containing i. In another example, a and c anywhere within an oligonucleotide can be replaced with g and u, respectively, to form a gu wobble base pair with the target mRNA. Sequences containing such substituted moieties find application in compositions and methods within the context of this application.
[0052] In this application, the term "sugar moiety" generally refers to the naturally occurring sugar moiety of a nucleoside or a modified sugar moiety. The term "naturally occurring sugar moiety" generally refers to a ribofuranosyl group found in naturally occurring RNA or a deoxyribofuranosyl group found in naturally occurring DNA. A "modified sugar moiety" refers to a substituted sugar moiety or sugar substitute.
[0053] In this application, the term "internucleoside linkage" generally refers to a covalent bond between adjacent nucleosides in an oligonucleotide. A "naturally occurring internucleoside linkage" refers to a 3' to 5' phosphodiester linkage. A "modified internucleoside linkage" refers to any internucleoside linkage other than a naturally occurring internucleoside linkage.
[0054] As used herein, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide molecule having a nucleobase sequence complementary to a corresponding segment of a target nucleic acid (e.g., a target genomic sequence, pre-mRNA, or mRNA molecule). In some embodiments, an antisense oligonucleotide has a length of 12 to 30 nucleobases. In some embodiments, an antisense oligonucleotide is an unmodified or modified nucleic acid having a nucleotide sequence complementary to that of a target nucleic acid (e.g., an APOC3 polynucleotide).
[0055] In this application, the term "antisense strand" generally refers to the strand that comprises a region that is substantially complementary to the target sequence of an RNA inhibitor (e.g., dsRNA). As used in the present invention, the term "complementary region" generally refers to the region on the antisense strand that is substantially complementary to the sequence defined in this application (e.g., target sequence). If the complementary region is not completely complementary to the target sequence, mismatches may occur within the molecule or at the terminal region. Generally, mismatches are most tolerated within the terminal region, for example, within 5, 4, 3, or 2 nucleotides at the 5'-end and / or 3'-end.
[0056] In this application, the term "sense strand" (S) generally refers to the strand of an RNA inhibitor that contains a region substantially complementary to the region of the antisense strand, as defined herein. The "sense" strand may also be referred to as the "significant" strand, the "passenger" strand, or the "anti-guide" strand. Using corresponding sequences, the antisense strand targets the desired mRNA, while the sense strand targets a different target. Thus, when the antisense strand is incorporated into RISC, the correct target is targeted. Integration of the sense strand may cause off-target effects. Such off-target effects can be limited by modifications on the sense strand or the use of a 5'-end cap.
[0057] In this application, the term "complementary" used to describe a first nucleotide sequence (e.g., the sense strand of an RNA inhibitor or APOC3 mRNA) with respect to a second nucleotide sequence (e.g., the antisense strand of an RNA inhibitor) refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize (form base-pair hydrogen bonds) with an oligonucleotide or polynucleotide containing the second nucleotide sequence under certain conditions to form a double-stranded or double-helical structure. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimics, so long as the above requirements for hybridization ability are met. "Complementary" does not necessarily require nucleobase complementarity at each nucleoside. Conversely, some mismatches are tolerated.
[0058] In this application, the term "fully complementary" generally means that all (100%) of the bases in a contiguous sequence of a first polynucleotide hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence can include all or part of the first or second nucleotide sequence. As used in this application, "partially complementary" generally means that, in a hybridized nucleic acid base sequence pair, at least about 70% of the bases in a contiguous sequence of a first polynucleotide hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. As used in this application, "substantially complementary" generally means that, in a hybridized nucleic acid base sequence pair, at least about 80% of the bases in a contiguous sequence of a first polynucleotide hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. As used in this application, the terms "complementary," "fully complementary," and "substantially complementary" can be used to refer to base matching between the sense strand and antisense strand of an RNA inhibitor, or between the antisense strand of an RNA inhibitor and the sequence of APOC3 mRNA. Sequence identity or complementarity is independent of modification. For example, for purposes of determining identity or complementarity, A and Af are complementary to U (or T) and are the same as a.
[0059] In this application, the term "homology" or "homology" generally refers to the number of nucleotides in a subject nucleic acid sequence that match the same nucleotides in a reference nucleic acid sequence, typically determined by a sequence analysis program (e.g., Karlin and Altschul, 1990, PNAS 87:2264-2268; Karlin and Altschul, 1993, PNAS 90:5873-5877) or visual inspection. As used herein, the term "complete homology" or "complete homology" typically refers to complete (100%) homology or "identity" between a reference sequence and a subject nucleic acid sequence. As used herein, the terms "substantially homologous" or "substantially homologous" generally mean that a subject sequence and a reference sequence share at least 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) homologous nucleotides with nucleotides at identical nucleotide positions in the subject sequence and the reference sequence.
[0060] In this application, the term "ligand" generally refers to any compound or molecule that can be covalently or otherwise chemically bound to a biologically active substance (e.g., an oligonucleotide). In some embodiments, a ligand can interact directly or indirectly with another compound, such as a receptor, which may be present on the cell surface or may be an intracellular and / or intercellular receptor, and the interaction between the ligand and receptor may lead to a biochemical reaction or may simply be a physical interaction or binding.
[0061] In this application, terms such as "induction," "inhibition," "enhancement," "elevation," "increase," "decrease," and "reduction" typically refer to a quantitative difference between two states. For example, "an amount that effectively inhibits APOC3 activity or expression" means that the level of APOC3 activity or expression in a treated sample is lower than the level of APOC3 activity or expression in an untreated sample. This term applies, for example, to expression levels and activity levels. The terms "decrease" and "reduction" are used interchangeably and can refer to any change, usually smaller than the original value. "Decrease" and "reduction" are relative terms that require a comparison between before and after measurement. "Decrease" and "reduction" include complete depletion.
[0062] In some embodiments, the term "reduction" can refer to an overall decrease in the expression level / amount of a gene, gene product, e.g., protein or biomarker, in a first sample by about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100% compared to the expression level / amount of the corresponding gene, gene product, e.g., protein or biomarker in a second sample, as detected by standard methods known in the art (as described herein). In some embodiments, the term "reduction" refers to a decrease in the expression level / amount of a gene or biomarker in a first sample, wherein the decrease is at least about 0.9-fold, 0.8-fold, 0.7-fold, 0.6-fold, 0.5-fold, 0.4-fold, 0.3-fold, 0.2-fold, 0.1-fold, 0.05-fold, or 0.01-fold the expression level / amount of the corresponding gene or biomarker in a second sample. In some embodiments, the first sample is a sample obtained from a subject and the second sample is a reference sample.
[0063] In this application, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5'-capping), and translation.
[0064] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations generally include salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations also generally include compatible solid or liquid fillers, diluents, or encapsulating materials suitable for human administration. When used in medicine, salts should be pharmaceutically acceptable, although non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts and are not excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, and succinic acid. Pharmaceutically acceptable salts can also be prepared as alkali metal or alkaline earth metal salts, such as sodium, potassium, or calcium salts.
[0065] In this application, the term "lipid nanoparticle" or "LNP" generally refers to nanoparticles encapsulating pharmacologically active molecules (e.g., nucleic acid molecules such as iRNA or plasmids into which iRNA is transcribed). The iRNA may be ligand-free or may contain a ligand such as a GalNAc derivative. LNPs are described, for example, in Chinese Patent No. CN103189057B, the entire contents of which are incorporated herein by reference.
[0066] In this application, the term "prevention and / or treatment" refers not only to disease prevention and / or treatment, but also generally to preventing the onset of a disease, slowing or reversing the progression of a disease, preventing or delaying the onset of one or more symptoms associated with a disease, reducing and / or alleviating one or more symptoms associated with a disease, reducing the severity and / or duration of a disease and / or any symptoms associated therewith, or preventing a further increase in the severity of a disease and / or any symptoms associated therewith, preventing, reducing, or reversing any physiological damage resulting from a disease, and any pharmacological effect that is generally beneficial to the patient receiving treatment. While the RNA inhibitor or drug composition of the present application forms a viable therapeutic agent, it is not necessary to achieve complete treatment or eradication of every symptom or sign of a disease. As recognized in the relevant art, a drug used as a therapeutic agent may reduce the severity of a given disease state, but need not eliminate all signs of a disease to be considered a useful therapeutic agent. Similarly, a prophylactically administered therapy constitutes a viable prophylactic agent, but need not completely and effectively prevent the onset of symptoms. It may be sufficient to simply reduce the impact of the disease on the subject (e.g., by reducing the number or severity of symptoms, improving the effectiveness of other treatments, or producing another beneficial effect) or to reduce the likelihood of the occurrence or worsening of the disease.
[0067] In this application, the terms "disease" or "condition" can be used interchangeably and generally refer to any deviation from the normal state of a subject, for example, any altered state of the body or some organs, which may interfere with or disrupt the performance of functions and / or cause symptoms such as discomfort, impairment, pain, or even death in the sick person or in those in contact with the sick person. A disease or condition may also be referred to as distemper, ailment, sickness, ailment, illness, sickness, or ill-health.
[0068] In this application, the term "administration" generally refers to introducing the drug formulation of the present application into the body of a subject via any introduction or delivery route. Any method known to those skilled in the art for contacting cells, organs, or tissues with the drug can be employed. The administration includes, but is not limited to, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous, transdermal, or oral administration. The daily dosage can be divided into one, two, or more appropriate doses and administered once, twice, or more times over a specific period.
[0069] In this application, the term "contacting" generally refers to contact of two or more different types of substances in any order, in any manner, and for any period of time. Contacting can occur in vivo, ex vivo, or in vitro. In some embodiments, the term can refer to direct contact of an RNA inhibitor or composition of the present application with a cell or tissue. In other embodiments, the term refers to indirect contact of an RNA inhibitor or composition of the present application with a cell or tissue. For example, the methods of the present application include contacting a subject with an RNA inhibitor or composition of the present application, followed by contacting the RNA inhibitor or composition with a cell or tissue via diffusion or any other active or passive transport process known in the art, through which a compound circulates in vivo.
[0070] In this application, the term "effective amount" or "effective dose" generally refers to an amount sufficient to achieve, or at least partially achieve, a desired effect. A "therapeutically effective amount" or "therapeutically effective dose" of a drug or therapeutic agent generally refers to any amount of drug used alone or in combination with other therapeutic agents that promotes disease eradication (as evidenced by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease-free periods, or prevention of damage or disability due to the disease). A "prophylactically effective amount" or "prophylactically effective dose" of a drug generally refers to the amount of drug that, when administered alone or in combination with other therapeutic agents, inhibits the onset or recurrence of disease when administered to a subject at risk of disease onset or disease recurrence. Various methods known to those skilled in the art can be used to assess the ability of a therapeutic or prophylactic agent to promote disease eradication or inhibit the onset or recurrence of disease. For example, predicting efficacy in humans in human subjects and animal model systems during clinical trials or measuring the activity of a formulation in an in vitro assay. In some embodiments, "effective amount" refers to the amount of an RNA inhibitor that produces the expected pharmacological, therapeutic, or prophylactic result.
[0071] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) in need of disease diagnosis, prognosis, amelioration, prevention, and / or treatment, such as humans, non-human primates (monkeys, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs, cats), farm animals (poultry such as chickens and ducks, horses, cows, goats, sheep, pigs), and laboratory animals (mice, rats, rabbits, guinea pigs). Human subjects include fetal, neonatal, infant, adolescent, and adult subjects. Subjects include animal disease models.
[0072] In this application, the terms "comprise," "include," "have," "can," "contain," and variations thereof are generally intended as open-ended transitional phrases, terms, or words that do not exclude additional operations or structures. The term "consisting of" generally implies the absence of other components (or equivalently, features, integers, steps, etc.).
[0073] In this application, the term "about" generally means approximately, in the vicinity of, roughly, or to the extent of. When the term "about" is used to refer to a range of values, the cut-off value or particular value is used to indicate that the stated value may differ from the recited value by as much as 10%. Thus, the term "about" can be used to cover a variation from the particular value of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less.
[0074] It should also be understood that the term "at least" preceding a number or series of numbers includes the number adjacent to the term "at least" and all subsequent numbers or integers that are logically included, i.e., "greater than or equal to." For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 15 nucleotides" means 15, 16, 17, 18, 19, 20, 21, or more nucleotides; "at least 16 nucleotides" means 16, 17, 18, 19, 20, 21, or more nucleotides; "at least 17 nucleotides" means 17, 18, 19, 20, 21, or more nucleotides; and by analogy, when "at least" appears before a series or range of numbers, it should be understood that "at least" can modify each number in the series or range.
[0075] As used herein, "not many" should be understood to mean a value or integer adjacent to the numerical value in question, logically lower, i.e., "less than" such as zero in context. For example, having "3 or fewer nucleotides" means having 3, 2, or 1 nucleotide. When "less than" appears before a series of numbers or a range, it should be understood that "less than" can modify each number in the series or range. The range used in the present invention includes both the upper and lower limits.
[0076] (Details of the invention) On the other hand, the present invention provides an RNA inhibitor that inhibits APOC3 gene expression or a pharmaceutically acceptable salt thereof.
[0077] In some embodiments, the RNA inhibitor comprises a single-stranded oligonucleotide or double-stranded ribonucleic acid (dsRNA) molecule used to inhibit expression of the APOC3 gene in cells, such as cells of a subject (e.g., a mammal, such as a human, susceptible to an APOC3-related disorder, such as hyperlipidemia). The dsRNA includes an antisense strand having a complementary region complementary to at least a portion of the mRNA formed during expression of the APOC3 gene. The complementary region is about 15 to 30 nucleotides long (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, or 15 nucleotides long).
[0078] dsRNA contains two RNA strands that are complementary and can hybridize to form a double-stranded structure (complementary region) under the conditions in which the dsRNA is used. One strand of the dsRNA (antisense strand) is substantially complementary to the target sequence and typically contains a perfectly complementary region. The target sequence can be derived from a sequence that forms the mRNA during expression of the APOC3 gene. The other strand (sense strand) contains a region complementary to the antisense strand, and when combined under appropriate conditions, both strands can hybridize to form a double-stranded structure. Typically, the length of the double-stranded structure is 15 to 30 base pairs. Similarly, the length of the complementary region to the target sequence is 15 to 30 nucleotides.
[0079] In some embodiments, the length of the dsRNA is about 19 to about 23 nucleotides, or about 24 to about 30 nucleotides. Generally, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is known in the art that dsRNAs longer than about 21 to 23 nucleotides can be used as Dicer substrates. Those skilled in the art will also understand that the RNA region targeted for cleavage is generally a portion of a larger RNA molecule (usually an mRNA molecule). A "portion" of the target is a contiguous nucleotide sequence of the mRNA target that is long enough to serve as a substrate for RNA inhibitor-directed cleavage (i.e., cleavage by the RISC pathway).
[0080] Those skilled in the art will also understand that a double-stranded region of about 19 to about 30 base pairs, such as about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, or 19-20 base pairs, is the primary functional portion of a dsRNA. Thus, in one embodiment, an RNA molecule or complex of RNA molecules having a double-stranded region of more than 30 base pairs is dsRNA, in order to achieve the degree of functional double-stranded structure (e.g., 15-30 base pairs) required for targeting.
[0081] In one embodiment of the present invention, the RNA inhibitor or a pharmaceutically acceptable salt thereof of the present application comprises an antisense strand, wherein the antisense strand comprises at least 15 consecutive nucleotides substantially complementary to nucleotides selected from the corresponding positions of APOC3 mRNA NM_000040.3 (SEQ ID NO: 1), or a sequence differing therefrom by no more than 3 nucleotides.
[0082] In certain embodiments, the double-stranded structure formed by the antisense and sense strands (complementary region) comprises at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides.
[0083] In certain embodiments, the sense strand of the RNA inhibitor has substantial homology to a target sequence in Table 1. JPEG2025525928000015.jpg255170JPEG2025525928000016.jpg52170
[0084] In certain embodiments, the sense strand of the RNA inhibitor has substantial homology to a target sequence in Table 1 and is selected from a) a sequence in Table 2, b) a sequence having at least 15 consecutive nucleotides identical to a sequence in a), and c) a sequence that differs from a sequence in a) and b) by no more than 3 nucleotides. JPEG2025525928000017.jpg177170JPEG2025525928000018.jpg255146JPEG2025525928000019.jpg255146JPEG2025525928000020.jpg255146 JPEG2025525928000021.jpg255147JPEG2025525928000022.jpg255147JPEG2025525928000023.jpg255147JPEG2025525928000024.jpg216170
[0085] In certain embodiments, the antisense strand of the RNA inhibitor is selected from a) the following sequences: b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), or c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides. JPEG2025525928000025.jpg255152JPEG2025525928000026.jpg255151JPEG2025525928000027.jpg255150JPEG2025525928000028.jpg255150 JPEG2025525928000029.jpg255150JPEG2025525928000030.jpg255150JPEG2025525928000031.jpg255150JPEG2025525928000032.jpg156170
[0086] In certain embodiments, the RNA inhibitor is selected from a) a combination of a sense strand in Table 2 and an antisense strand in Table 3, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), and c) a sequence that differs from the sequence in a) and b) by no more than 3 nucleotides.
[0087] In certain embodiments, the RNA inhibitor is selected from a) a sequence in Table 5, b) a sequence having at least 15 consecutive nucleotides identical to a sequence in a), or c) a sequence that differs from a sequence in a) and b) by no more than 3 nucleotides. JPEG2025525928000033.jpg255170JPEG2025525928000034.jpg255168JPEG2025525928000035.jpg255168JPEG2025525928 000036.jpg255168JPEG2025525928000037.jpg255168JPEG2025525928000038.jpg255168JPEG2025525928000039.jpg90170
[0088] In some embodiments, the above-mentioned RNA inhibitors can be added to cell lines for sequence screening by cell transfection methods or liposome-nucleic acid nanoparticle methods well known to those skilled in the art. The full texts of patents US9233971B2, US9080186B2, CN102985548B and CN103189057B relating to methods for producing lipid compounds and liposome-nucleic acid nanoparticles are incorporated herein.
[0089] In some embodiments, the amphoteric lipids in the above lipid compounds are preferably macrocyclic lipid-based compounds D1C1, T1C1, T1C6, T4C4, B2C1, B2C6, B2C7, and M10C1.
[0090] As is well known to those skilled in the art, dsRNAs having a double-stranded structure of approximately 19-23 base pairs, e.g., 21 base pairs, have been considered particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, others have found that shorter or longer RNA double-stranded structures are also effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). Furthermore, those skilled in the art can design new sequences by subtracting or adding a few nucleotides from one or both ends of one of the sequences in Tables 1-3 and 5, and can reasonably be expected to be similarly effective compared to the sequences of the present invention. Therefore, any sequence having at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides identical to the sequences shown in Tables 1-3 and 5 should fall within the scope of the present invention. At least 15 consecutive nucleic acids means a sequence having 15, 16, 17, 18, 19, 20, 21, 22, 23 or more consecutive nucleotides, and all sequences whose inhibitory effect in terms of their ability to inhibit APOC3 gene expression differs from that of the sequences of the present invention by about 5, 10, 15, 20, 25, or 30% or less are within the scope of protection of the present application.
[0091] The dsRNA described herein can further comprise an overhang of one or more single-stranded nucleotides, for example, 1, 2, 3, or 4 nucleotides. The overhang of nucleotides can comprise nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides, or a combination thereof. The overhang can be in the sense strand, the antisense strand, or any combination thereof. Furthermore, the overhanging nucleotides can be present at the 5'-end, 3'-end, or both ends of the antisense or sense strand of the dsRNA. The overhang can be formed by one strand being longer than the other, or by the interleaving of two strands of the same length. The overhang can form a mismatch with the target mRNA, be complementary to the target gene sequence, or have a different sequence.
[0092] dsRNA may only contain a single overhang, which can enhance the interference activity without affecting the overall stability of RNA inhibitor.For example, the single-stranded overhang may be located at the 3' end of the sense strand, or at the 3' end of the antisense strand.RNA inhibitor may have a blunt end located at the 5' end of the antisense strand (or at the 3' end of the sense strand), or vice versa.Generally, the antisense strand of RNA inhibitor has a nucleotide overhang at the 3' end, and the 5' end is blunt.
[0093] In some embodiments, the overhang is present on the sense strand, the antisense strand, or the 3' end of the duplex. In some embodiments, the 3' overhang is present in the antisense strand. In some embodiments, the 3' overhang is present in the sense strand.
[0094] In a specific embodiment, the dsRNA is blunt-ended and has a length of 21 nucleotides.
[0095] In a specific embodiment, the dsRNA has a length of 21 nucleotides, and both the sense and antisense strands have a 2-nucleotide overhang at the 3' end.
[0096] In a specific embodiment, the sense strand of the dsRNA has a length of 19 nucleotides, the antisense strand has a length of 21 nucleotides, and the antisense strand has a 2-nucleotide overhang at the 3' end.
[0097] In a specific embodiment, the sense strand of the dsRNA has a length of 21 nucleotides, the antisense strand has a length of 23 nucleotides, and the antisense strand has a 2-nucleotide overhang at the 3' end.
[0098] In order to improve the in vivo stability of the RNA inhibitors described in the present application, without affecting or even enhancing their activity, the sense and antisense strands of the RNA inhibitors can be modified, where the nucleotides may have modified groups, and all or part of the strands may be modified. In some embodiments, one or more nucleotides on the sense and / or antisense strands are modified to form modified nucleotides.
[0099] In some embodiments, the RNA of the RNA inhibitors (e.g., dsRNA) of the present application is unmodified and does not include chemical modifications or bonds known in the art and described in the present invention. In another embodiment, the RNA of the RNA inhibitors (e.g., dsRNA) of the present application is chemically modified to enhance stability or other beneficial characteristics. In another embodiment of the present application, all or substantially all nucleotides of the RNA inhibitors of the present application are modified. That is, there are 5, 4, 3, 2, or 1 or less unmodified nucleotides in the strand of the RNA inhibitor.
[0100] The nucleic acids described herein can be synthesized and / or modified using methods known in the art, such as those described in "Current Protocols in Nucleic Acid Chemistry," Beaucage, SLet et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA, which are incorporated herein by reference. Modifications include terminal modifications such as 5'-end modifications (phosphorylation, coupling, reverse linkage) or 3'-end modifications (coupling, DNA nucleotides, reverse linkage, etc.); base modifications such as the use of stabilizing bases, the use of destabilizing bases, or base substitution with bases paired with an expanded repertoire of partner bases, base removal (abasic nucleotides), or base linkage; sugar modifications (e.g., at the 2' or 4' position) or sugar substitution; or backbone modifications, including modification or substitution of phosphodiester linkages. In the RNA inhibitors provided herein, both the sense and antisense strands of the RNA inhibitor need not be uniformly modified; one or more modifications may be incorporated into a single nucleotide.
[0101] In some embodiments, the modified nucleotides include deoxyribonucleotides, nucleotide mimetics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides, nucleotides containing unnatural bases, bridged nucleotides, peptide nucleic acids (PNAs), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' internucleoside linked) nucleotides, 2'-fluorine-arabinonucleotides, 5'-methyl / 2'-fluoro nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, nucleotides containing vinyl phosphonates, and nucleotides containing cyclopropyl phosphonates.
[0102] In some embodiments, 2'-modified nucleotides include 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides, and 2'-alkyl nucleotides.
[0103] In certain embodiments, some or all of the 2' positions of the odd-numbered nucleotide sugar groups starting from the 5' end of the sense strand are fluorine.
[0104] In certain embodiments, the 2' position of the sugar group of at least three or four nucleotides of the sense strand is fluorine.
[0105] In certain embodiments, some or all of the 2' positions of the even-numbered nucleotide sugar groups, starting from the 5' end of the antisense strand, are fluorine.
[0106] In certain embodiments, the 2' position of the sugar group of at least two or four nucleotides of the antisense strand is fluorine.
[0107] In certain embodiments, at least one of the 2' positions of the nucleotide sugar groups at positions 2, 4, 6, 8, 14, and 16 from the 5' end of the antisense strand is fluorine. For example, the 2' positions of the nucleotide sugar groups at positions 2, 4, 6, 8, 14, and 16 from the 5' end of the antisense strand are all fluorine.
[0108] In certain embodiments, at least one of the 2' positions of the remaining nucleotide sugar groups is methoxy, except for the nucleotides at positions 2, 4, 6, 8, 14, and 16 from the 5' end of the antisense strand.
[0109] In certain embodiments, at least one of the 2' positions of the nucleotide sugar groups at positions 9, 10, and 11 from the 5' end of the sense strand is fluorine. For example, the 2' positions of the nucleotide sugar groups at positions 9, 10, and 11 from the 5' end of the sense strand are all fluorine.
[0110] In certain embodiments, except for the nucleotides at positions 9, 10, and 11 from the 5' end of the sense strand, at least one of the 2' positions of the remaining nucleotide sugar groups is methoxy.
[0111] In certain embodiments, except for the nucleotides at positions 7, 9, 10, and 11 from the 5' end of the sense strand, at least one of the 2' positions of the remaining nucleotide sugar groups is methoxy.
[0112] For example, the -OH at the 2' position of some or all of the nucleotide sugar groups in the sense strand and / or antisense strand may be substituted, wherein the substituent is fluorine or methoxy. Preferably, the 2' position of the nucleotide sugar groups at positions 9, 10, and 11 from the 5' end of the sense strand is fluorine, the 2' position of the nucleotides at positions 2, 4, 6, 8, 14, 16, 18, and 20 from the 5' end of the antisense strand is fluorine, and the 2' position of the remaining nucleotide sugar groups is all methoxy; or preferably, the 2' position of the nucleotides at positions 5, 7, 8, and 9 from the 5' end of the sense strand is fluorine, the 2' position of the nucleotide sugar groups at positions 7, 12, and 14 from the 5' end of the antisense strand is fluorine, and the 2' position of the remaining nucleotide sugar groups is all methoxy.
[0113] In some embodiments, there are at least two consecutive phosphorothioate linkages between nucleotides in the sense strand and / or antisense strand.
[0114] In some embodiments, there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at least at one end of the sense strand and / or the antisense strand.
[0115] For example, there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' and 3' ends of the sense and antisense strands.
[0116] For example, the 2' positions of the nucleotide sugar groups at positions 9, 10, and 11 from the 5' end of the sense strand are fluorine, the 2' positions of the nucleotide sugar groups at positions 2, 4, 6, 8, 14, 16, 18, and 20 from the 5' end of the antisense strand are fluorine, and the 2' positions of the remaining nucleotide sugar groups are all methoxy, and there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' and 3' ends of the sense and antisense strands.
[0117] In some embodiments, the 2' positions of some nucleotides in the sense strand are fluorine or methoxy, and phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand may be thioated. The 2' positions of the 5th, 7th, 8th, and 9th nucleotides or the 3rd, 5th, 7th, 9th, 11th, 13th, and 15th nucleotides from the 5' end of the sense strand are fluorine, and the 2' positions of the remaining nucleotides are methoxy, and phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand may be thioated.
[0118] In some embodiments, the 2' positions of some nucleotides in the sense strand are fluorine or methoxy, and phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand may be thioated. The 2' positions of the 9th, 10th, and 11th nucleotides or the 3rd, 5th, 7th, 9th, 11th, 13th, 15th, and / or 17th nucleotides from the 5' end of the sense strand are fluorine, and the 2' positions of the remaining nucleotides are methoxy, and phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand may be thioated.
[0119] In some specific embodiments, the 3' ends of the sense strand and the antisense strand may each be tagged with two tts, and the sense strand and the antisense strand of the RNA inhibitor are selected from a) a sequence in Table 6, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), and c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides. JPEG2025525928000040.jpg165170JPEG2025525928000041.jpg187170
[0120] In some embodiments, the 2' position of some nucleotides in the sense strand is fluorine, and phosphate ester bonds between at least three adjacent nucleotides at the end of the antisense strand may be thioated.
[0121] In some embodiments, the sense strand in the RNA inhibitor is preferably selected from the sense strand sequences in Tables 6-1 and 6-2 below. JPEG2025525928000042.jpg255159JPEG2025525928000043.jpg255159JPEG2025525928000044.jpg86170JPEG20255259280 00045.jpg167170JPEG2025525928000046.jpg255145JPEG2025525928000047.jpg255145JPEG2025525928000048.jpg30170
[0122] where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenylic acid, U = 2'-O-methyluridylic acid, C = 2'-O-methylcytidylic acid; fG = 2'-fluoroguanylic acid, fA = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'- thioadenylic acid, Us = 2'-O-methyl-3'-thiouridylic acid, Cs = 2'-O-methyl-3'-thiocytidylic acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = thymidylic acid, Ts = 3'-thiothymidylic acid.
[0123] In certain embodiments, the sense strand of the RNA inhibitor described in the present application is selected from a) a sequence in Table 6-1 and Table 6-2, b) a sequence having at least 15 consecutive nucleotides identical to a sequence in a), or c) a sequence that differs from a sequence in a) and b) by no more than 3 nucleotides.
[0124] In some embodiments, the 2' position of some nucleotides in the antisense strand is fluorine, and the phosphate ester bonds between at least three adjacent nucleotides at the end of the antisense strand are thioated, and the antisense strand in the RNA inhibitor is preferably selected from a) a sequence in Table 7-1 and Table 7-2, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), or c) a sequence that differs from the sequence in a) and b) by 3 or less nucleotides. JPEG2025525928000049.jpg74170JPEG2025525928000050.jpg255142JPEG2025525928000051.jpg255148 JPEG2025525928000052.jpg255145JPEG2025525928000053.jpg255141JPEG2025525928000054.jpg83170
[0125] where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenylic acid, U = 2'-O-methyluridylic acid, C = 2'-O-methylcytidylic acid, fG = 2'-fluoroguanylic acid, fA = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O- fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = thymidylic acid.
[0126] In certain embodiments, the antisense strand of the RNA inhibitor described in the present application is selected from a) the sequences in Table 7-1 and Table 7-2, b) sequences having at least 15 consecutive nucleotides identical to the sequences in a), and c) sequences that differ from the sequences in a) and b) by no more than 3 nucleotides. In certain embodiments, the sense and antisense strands in the RNA inhibitor are selected from Table 8 below. JPEG2025525928000055.jpg209170
[0127] In some embodiments, the distribution, targeting, or stability of RNA inhibitors is altered by introducing ligands of target tissue receptors into the carrier. For example, a specific ligand can provide enhanced affinity for a selected target (e.g., molecule, cell or cell type, compartment (e.g., cell or organ compartment, body tissue, organ, or region)) compared to species in which the ligand is not present.
[0128] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL) or globulins), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid), or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids.
[0129] The ligand can include a targeting group, such as a cell that binds to a given cell type, such as a kidney cell, or a tissue targeting agent, such as a lectin, glycoprotein, lipid, or protein (e.g., an antibody). The targeting group can be thyroid-stimulating hormone, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetylglucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acid, multivalent galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, cholic acid, folic acid, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimic. In some embodiments, the ligand is a multivalent galactose, such as N-acetylgalactosamine.
[0130] The sense strand and antisense strand contained in the RNA inhibitor of the present invention can be prepared simply and normally by known solid phase synthesis technology.In addition or alternatively, any other synthesis method known in the art can be used, such as liquid phase synthesis or fermentation.It is also known that similar technology can be used to prepare other oligonucleotides (for example, phosphorothioate and alkylated derivatives).
[0131] In some embodiments, in addition to the standard and non-standard nucleoside phosphoramidite monomers that are commercially available and commonly used in oligonucleotide synthesis, the oligonucleotides or linked nucleotides of the present application can be synthesized by an automated synthesizer using the phosphoramidite method derived from carrier-nucleoside phosphoramidite monomers.
[0132] In some embodiments, the ligand binding aspects according to the invention are attached to the 5' and / or 3' end of the antisense strand and / or the 5' and / or 3' end of the sense strand via a carrier structure.
[0133] For example, the carrier structure may be attached to the 5'-end and / or 3'-end of the sense strand, or the carrier structure may be attached to the 5'-end of the antisense strand and the 3'-end of the sense strand, or the carrier structure may be attached to the 3'-end of the antisense strand and the carrier structure may be attached to the 5'-end of the sense strand.
[0134] In some embodiments, the carrier structure comprises a 5'MVIP and a 3'MVIP, wherein the 5'MVIP is attached to the 5' end of the sense strand and / or antisense strand, and the 3'MVIP is attached to the 3' end of the antisense strand and / or sense strand, and the configuration of the 5'MVIP is shown in Formula I, and the configuration of the 3'MVIP is shown in Formula II. JPEG2025525928000056.jpg33170 where, X is a liver-targeting specific ligand; L is a branched chain; B is a linker, D is a linking chain, R1 and R2 are transition points, The 5'MVIP is linked to the 5' end of the sense strand or the 5' end of the antisense strand via transition point R1, and the 3'MVIP is linked to the 3' end of the sense strand or the 3' end of the antisense strand via transition point R2; n and m are each independently any integer from 0 to 4, and n+m=2 to 6, preferably n+m=2, 3, or 4, and more preferably 4.
[0135] In certain embodiments, R1 or R2 is connected to the sense or antisense strand via a phosphate or modified phosphate, and R1 or R2 is preferably connected to the sense or antisense strand via a phosphate or phosphorothioate.
[0136] In certain embodiments, m or n may be 0, i.e., there is no 3'MVIP or 5'MVIP.
[0137] In certain embodiments, when n=0 (i.e., there is no 5'MVIP), the structure of the 3'MVIP can be: JPEG2025525928000057.jpg75170JPEG2025525928000058.jpg97170In certain embodiments, when n=1, the structure of the 3'MVIP may be: In certain embodiments, when n=2, the structure of the 3′MVIP may be: JPEG2025525928000060.jpg139170 In certain embodiments, when n=3, the structure of the 3′MVIP may be: JPEG2025525928000061.jpg123170 In certain embodiments, when n=4, the structure of the 3′ MVIP may be: JPEG2025525928000062.jpg114170
[0138] In some embodiments, n means the sum of n's located simultaneously in the 5'MVIP at the 5' ends of the sense and antisense strands of the RNA inhibitor, and m means the sum of m's located in the 3'MVIP at the 3' ends of the sense and antisense strands of the RNA inhibitor.
[0139] In some embodiments, R1 and R2 comprise -NH-, -S- and / or -O- in their structures, and R1 and R2 are linked to the linking strand D and the 5' end and 3' end of the sense strand and / or antisense strand, respectively, via -NH-, -S- or -O- in their structures, and R1 and R2 are the same or different.
[0140] In some embodiments, R1 and R2 are any straight chain or branched chain or cyclic structure of the type of amide, carboxyl, or alkyl group, including saturated or unsaturated aliphatic carbocyclyl, or 5- or 6-membered heterocyclyl or aromatic hydrocarbyl containing sulfur, oxygen, or nitrogen atoms.
[0141] In some embodiments, R1 and / or R2 are -E1(CH2) x CH2E2-, where x is any integer from 3 to 12, and the groups E1 and E2 may each be -NH-, -S-, or -O-.
[0142] In some embodiments, R1 and / or R2 are -E1(CH2) x1 CH(OH)(CH2) x2 E2-, where x1 and x2 each independently represent any integer from 3 to 10, and E1 and E2 may each be -NH-, -S-, or -O-.
[0143] In some embodiments, R1 is a heterocyclic or carbocyclic structure containing N, S, or O, as shown below: JPEG2025525928000063.jpg65170
[0144] In certain embodiments, the transition point R1 is -NH(CH2) x CHO-, where x is any integer from 3 to 12, preferably any integer from 4 to 6, and can be introduced in the form of the following two types of phosphoramidite monomers.
[0145] i. One -O- or -S- in the R1 structure is used to synthesize a phosphoramidite monomer of R1, which is then linked to the 5'-end of the sense or antisense strand of an RNA inhibitor by solid-phase synthesis. In the structure, -NH-, -S-, or -O- is linked to the linker D in the 5'MVIP to introduce a liver-targeting specific ligand X into the 5'-end of the sense or antisense strand of an RNA inhibitor. Exemplary structures of the monomers introduced into the 5'-end of the sense or antisense strand of an RNA inhibitor are as follows: JPEG2025525928000064.jpg28170 In a particular embodiment, the following structure is preferred: JPEG2025525928000065.jpg28170
[0146] ii. One -NH-, -S-, or -O- in the R1 structure is preferentially linked to the linker chain D, and the other -NH-, -S-, or -O- is used to form an ester with a phosphoramidite in the synthesis of a 5'MVIP phosphoramidite monomer. Exemplary structures of the 5'MVIP phosphoramidite monomer for the sense or antisense strand are as follows: JPEG2025525928000066.jpg36170 In certain embodiments, the 5'MVIP phosphoramidite monomer of the sense or antisense strand preferably has the following structure: JPEG2025525928000067.jpg29170
[0147] When n in the general formula is 1 to 4, the linker B moiety in the above monomer is branched 1 to 4 times to obtain the corresponding monomer compound. With the help of the above monomer compound, the liver-targeting specific ligand X is introduced to the 5'-end of the sense strand or antisense strand by solid-phase synthesis.
[0148] In certain embodiments, the transition point R1 is -NH(CH2) x CH2O-, where x may be any integer from 3 to 12, and is preferably any integer from 4 to 6.
[0149] In certain embodiments, the 5'MVIP phosphoramidite monomer structure is selected from the following structures: JPEG2025525928000068.jpg176170JPEG2025525928000069.jpg242170JPEG2025525928000070.jpg48170In certain embodiments, the transition point R2 is a heterocyclic or carbocyclic structure containing N, S, or O, as shown below: JPEG2025525928000071.jpg67170
[0150] In certain embodiments, the transition point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, where x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4.
[0151] The transition point R2 described in this application forms an ester or amide with succinic anhydride and -NH-, -S-, or -O- in the R2 structure, which simultaneously binds to -NH- in an empty solid support to form a 3'MVIP solid support, and then the 3'MVIP is introduced to the 3' end of the sense strand or antisense strand by phosphoramidite solid-phase synthesis.
[0152] In certain embodiments, the heterocycle in the structure of the transition point R2 is a pyrrole ring or a piperidine ring, and is connected to the connecting chain D of the 3'MVIP via the nitrogen heteroatom in the ring. An exemplary structure of the loaded 3'MVIP Solid Support is as follows: JPEG2025525928000072.jpg47170When m in the general formula is 1 to 4, the linker B moiety in the above monomer is branched 1 to 4 times to obtain the corresponding solid support.
[0153] In certain embodiments, the transition point R2 is -B4(CH2) x1 CH(OH)(CH2) x2An exemplary structure of the introduced 3'MVIP solid support is: CH2B5-, where x1 is any integer from 1 to 4, x2 is any integer from 0 to 4, and B4 and B5 are -NH-, -S-, or -O-, respectively. JPEG2025525928000073.jpg23170When m in the general formula is 1 to 4, the linker B moiety in the above monomer is branched 1 to 4 times to obtain the corresponding solid support.
[0154] In certain embodiments, R2 is -NHCH2CH(OH)CH2O-, and an exemplary structure of the loaded 3'MVIP solid spport is as follows: JPEG2025525928000074.jpg23170When m in the general formula is 1 to 4, the linker B moiety in the above monomer is branched 1 to 4 times to obtain the corresponding solid support.
[0155] In certain embodiments, the 3'MVIP solid support structure is as follows: JPEG2025525928000075.jpg116170JPEG2025525928000076.jpg253170JPEG2025525928000077.jpg255158
[0156] In some embodiments, the liver-targeting specific ligand X is selected from structures used to enhance hepatocyte uptake of RNA inhibitors, and these structures may include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptidomimetic structures. In the RNA inhibitors provided by the present application, the liver-targeting specific ligands X introduced at the end of the sense or antisense strand of the RNA inhibitor may be the same or different. For example, in terms of properties, some may improve liver targeting, some may have structures that regulate the pharmacokinetics of the RNA inhibitor in vivo, and some may have solubility activity in vivo. In some embodiments, the liver-targeting specific ligand X is selected from one or more monosaccharides and derivatives thereof having the following structures:
[0157] In some embodiments, the monosaccharide is one or more selected from the group consisting of mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, and ribose, and the monosaccharide derivative is selected from the group consisting of mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives.
[0158] In certain embodiments, the liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and derivatives thereof, and has the following general structure: JPEG2025525928000078.jpg26170
[0159] where W1 is hydrogen or a hydroxyl protecting group, which may be the same or different. W is -OH, -NHCOOH, or -NHCO(CH2) q CH3, where q is an integer of 0 to 4, and W2 is -NH-, O, S, or C.
[0160] In a particular embodiment, said liver-targeting specific ligand X is N-acetylgalactosamine and its derivatives.
[0161] In certain embodiments, the liver-targeting specific ligand X is selected from the following structures: JPEG2025525928000079.jpg85170Where W is -OH, -NHCOOH, or -NHCO(CH2) q CH3, where q is an integer from 0 to 4.
[0162] In certain embodiments, said liver-targeting specific ligands X may be the same or different within the same 5'MVIP or 3'MVIP structure.
[0163] In certain embodiments, X between the 5'MVIP and the 3'MVIP may be the same or different.
[0164] In certain embodiments, the branched chain L is -NH-, -C(=O)-, -O-, -S-, an amide group, a phosphoryl group, a thiophosphoryl group, a C4 to C6 10 C4-C containing aliphatic carbocyclyl groups, phenyl groups, or combinations of these groups 18 It is a carbon chain.
[0165] In certain embodiments, the branched chain L also carries a hydroxyethyl group or a carboxylic acid-based side chain.
[0166] In certain embodiments, the branched chain L is a C7-C amide group or a six-membered aliphatic carbocyclyl group. 18 It is a carbon chain.
[0167] In certain embodiments, the branched chain L is selected from one or more of the following structures: JPEG2025525928000080.jpg74170Here, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group such as a C1 to C5 alkyl, or an amide group.
[0168] In a specific embodiment, the structure of the linker B is related to the number of X that can be introduced, and the linker B contains -NH-, C, O, S, an amide group, a phosphoryl group, or a thiophosphoryl group, and is linear when n or m is 1, and has 2, 3, or 4 branches when n or m is 2, 3, or 4, respectively. In certain embodiments, the linker B is selected from the following structures: JPEG2025525928000081.jpg158170 where A1 and A2 each independently represent C, O, S, —NH—, a carbonyl group, an amide group, a phosphoryl group, or a thiophosphoryl group, and r is an integer of 0 to 4.
[0169] In certain embodiments, the linker B is selected from the following structures: JPEG2025525928000082.jpg203170JPEG2025525928000083.jpg227170Here, r is an integer between 0 and 4.
[0170] In certain embodiments, the linker B is selected from the following structures: JPEG2025525928000084.jpg223170JPEG2025525928000085.jpg229170JPEG2025525928000086.jpg67170In certain embodiments, the linker B is selected from the following structures: JPEG2025525928000087.jpg106170
[0171] In certain embodiments, the linking chain D is —NH—, C═O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aromatic hydrocarbon group, a C4 to C6 10 C3-C containing aliphatic carbocyclyl groups, five- or six-membered heterocyclyl containing 1-3 nitrogen atoms, or a combination of these groups 18 It is a carbon chain.
[0172] In certain embodiments, the linking chain D also has a side chain of hydroxymethyl, methyl tert-butyl, methylphenyl, or a C5-C6 aliphatic cyclic group.
[0173] In certain embodiments, the linking chain D is a C3-C aryl group containing two C=O, six-membered aliphatic carbocyclyl groups, or phenyl groups. 10 It is a carbon chain.
[0174] In certain embodiments, the linking chain D is a C3-C 10 It is a carbon chain.
[0175] In certain embodiments, the linking chain D is selected from the following structures: JPEG2025525928000088.jpg236170JPEG2025525928000089.jpg176170In this case, each p is independently an integer of 1 to 20, s is an integer of 2 to 13, and Z1 and Z2 are the same or different substituents, for example, C3 to C 10 It is an alkyl group.
[0176] In certain embodiments, the linking chain D is selected from the following structures: JPEG2025525928000090.jpg37170JPEG2025525928000091.jpg245170JPEG2025525928000092.jpg219170JPEG2025525928000093.jpg20170J PEG2025525928000094.jpg237170JPEG2025525928000095.jpg232170JPEG2025525928000096.jpg235170JPEG2025525928000097.jpg214170J PEG2025525928000098.jpg233170JPEG2025525928000099.jpg178170JPEG2025525928000100.jpg215170JPEG2025525928000101.jpg209170 JPEG2025525928000102.jpg232170JPEG2025525928000103.jpg223170JPEG2025525928000104.jpg228170JPEG2025525928000105.jpg109170
[0177] In certain embodiments, said X, L, B, and D are the same or different within or between each 5'MVIP and 3'MVIP.
[0178] JPEG2025525928000106.jpg16170JPEG2025525928000107.jpg99170JPEG2025525928000108.jpg240170JPEG2025525928000109.jpg243170JPEG2025525928000110.jpg242170In certain embodiments, the 5'MVIP may be absent, in which case m may be any integer from 2 to 4.
[0179] JPEG2025525928000111.jpg17170JPEG2025525928000112.jpg201170JPEG20255259280 00113.jpg252170JPEG2025525928000114.jpg231170JPEG2025525928000115.jpg148170
[0180] JPEG2025525928000116.jpg16170JPEG2025525928000117.jpg80170JPEG2025525928000118.jpg133170
[0181] In certain embodiments, the 3'MVIP may be absent, in which case n may be any integer from 2 to 4.
[0182] JPEG2025525928000119.jpg14170JPEG2025525928000120.jpg69170JPEG2025525928000121.jpg254170JPEG2025525928000122.jpg126170
[0183] In certain embodiments, the 5'MVIP is selected from any one or more of 5'MVIP01 to 5'MVIP22 in Table 11.
[0184] In certain embodiments, the 3'MVIP is selected from any one or more of 3'MVIP01 to 3'MVIP27 in Table 12.
[0185] In certain embodiments, a 5'MVIP from Table 11 may be combined with any of the 3'MVIPs from Table 12, where n+m=2, 3, 4, 5, or 6.
[0186] In some embodiments, the sense strand of the RNA inhibitor can be selected from the sequences in Table 13 below. JPEG2025525928000123.jpg65170JPEG2025525928000124.jpg49170
[0187] In certain embodiments, the sense strand of the RNA inhibitor described in the present application is a sequence that differs from each of the sequences in Table 13 by 1, 2, or 3 nucleotides, or has at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides identical to a sequence in Table 13.
[0188] In certain embodiments, the antisense strand of the RNA inhibitor can be selected from the sequences in Table 14 below. JPEG2025525928000125.jpg100170
[0189] In certain embodiments, the antisense strand of the RNA inhibitor described in the present application is a sequence that differs from each of the sequences in Table 14 by 1, 2, or 3 nucleotides, or has at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides identical to a sequence in Table 14.
[0190] In some in vivo test embodiments, the RNA inhibitors described in the present application are selected from the sequences in Table 15. JPEG2025525928000126.jpg108170
[0191] In certain embodiments, the sense and antisense strands of the RNA inhibitors described in the present application are sequences that differ from each of the sequences in Table 15 by 1, 2, or 3 nucleotides, or have at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides identical to the sequences in Table 15.
[0192] Note that the combinations in Tables 13, 14, and 15 are not exhaustive, and the sequences of the present invention can be attached to MVIPs of any structure, with no limitations on the attachment site or number of attachments. "No limitations on the attachment site" means that the attachment may be to the 5' end, the 3' end, or no end. "No limitations on the number of attachments" means that there may be one or more attachments, with no limitations on the number.
[0193] In a specific embodiment, the 5' and / or 3' ends of the antisense strand UsfAsAfCCfCUfGCAUGAfAGfCUGAsGsA (sequence number 382) of the RNA inhibitor are connected to 5'MVIPs and / or 3'MVIPs of different structures, and the antisense strand and its carrier structure are selected from Table 16 below. JPEG2025525928000127.jpg255151JPEG2025525928000128.jpg174170
[0194] In certain embodiments, the antisense strand of the RNA inhibitor described in the present application is a sequence that differs from each of the sequences in Table 16 by 1, 2, or 3 nucleotides, or has at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides identical to a sequence in Table 16.
[0195] In certain embodiments, the antisense strand linked to a 5'MVIP and / or a 3'MVIP of Table 16 is obtained by linking a sequence of Table 7-1 and Table 7-2 to the 5'MVIP and / or the 3'MVIP.
[0196] In a specific embodiment, the 5' and / or 3' ends of the sense strand UsCsUCAGCUfUfCfAUGCAGGGUsUsA (sequence number 412) of the RNA inhibitor are connected to 5'MVIPs and / or 3'MVIPs of different structures, and the sense strands and their carrier structures are selected from Table 17 below. JPEG2025525928000129.jpg255160JPEG2025525928000130.jpg129170
[0197] In certain embodiments, the sense strand of the RNA inhibitor described in the present application is a sequence that differs from each of the sequences in Table 17 by 1, 2, or 3 nucleotides, or has at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides identical to a sequence in Table 17.
[0198] In a specific embodiment, the 5' and / or 3' ends of the antisense strand of the RNA inhibitor, AsfCsAfCUfGAfGAAUACfUGfUCfGCsfUsC (sequence number 970), are connected to 5'MVIPs and / or 3'MVIPs of different structures, and the antisense strand and its carrier structure are selected from Table 18 below. JPEG2025525928000131.jpg255165JPEG2025525928000132.jpg209170
[0199] In certain embodiments, the antisense strand of an RNA inhibitor described in the present application is a sequence that differs from each sequence in Table 18 by 1, 2, or 3 nucleotides and has at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides identical to a sequence in Table 18.
[0200] Note that the combinations in Table 18 are not exhaustive, and the sequences of the present invention can be connected to MVIPs of any structure, with no limitations on the connection site or number of connections. "No limitations on the connection site" means that the connection may be to the 5' end, the 3' end, or no end. "No limitations on the number of connections" means that there may be one or more connections, with no limitations on the number.
[0201] In a specific embodiment, the 5' and / or 3' ends of the sense strand GsAsGCGACAfGfUfAUUCUCAGUsGsU (sequence number 1033) of the RNA inhibitor are connected to 5'MVIP and / or 3'MVIP of different structures, and the sense strand and its carrier structure are selected from Table 19 below. JPEG2025525928000133.jpg140170JPEG2025525928000134.jpg255162JPEG2025525928000135.jpg64170
[0202] In some embodiments, the sense strand of the RNA inhibitor described in the present application is a sequence that differs from each of the sequences in Table 19 by 1, 2, or 3 nucleotides, or has at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides identical to a sequence in Table 19.
[0203] Note that the combinations in Table 19 are not exhaustive, and the sequences of the present invention can be connected to MVIPs of any structure, with no limitations on the connection site or number of connections. "No limitations on the connection site" means that the connection may be to the 5' end, the 3' end, or no end. "No limitations on the number of connections" means that there may be one or more connections, with no limitations on the number.
[0204] In a specific embodiment, the antisense strand of the RNA inhibitor can be obtained by combining the antisense strand sequence exemplified above with any 5'MVIP and / or 3'MVIP.
[0205] In a particular embodiment, the sense strand of the RNA inhibitor can be obtained by optional 5'MVIP and / or 3'MVIP binding of the sense strand sequences exemplified above.
[0206] In certain embodiments, the sequences within the scope of protection of this application can be connected at any position to any structure of any number of 5'MVIPs or 3'MVIPs to form an RNA inhibitor, and all of these RNA inhibitors are within the scope of protection of the present invention and are all covered by the present invention.
[0207] Chinese Patent CN113171371B has investigated in detail the influence of different X, L, B, D, R1, and R2 in 5'MVIP and / or 3'MVIP structures on the activity of RNA inhibitors. This patent document is incorporated herein by reference in its entirety. When any of X, L, B, D, R1, and R2 is different, the other parts of the corresponding 5'MVIP and / or 3'MVIP are the same as 5'MVIP09 / 3'MVIP09.
[0208] In the RNA inhibitors provided by the present invention, when X is galactose, galactosamine, N-acetylgalactosamine, or a derivative thereof, N-acetylgalactosamine and a derivative thereof are preferred as liver-targeting specific ligands. JPEG2025525928000136.jpg95170
[0209] The length of the L chain significantly affects the efficacy of the RNA inhibitor, and the L chain should not be too short or too long. The activity of the resulting RNA inhibitors is not significantly affected by the presence of -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, or aliphatic carbocyclyl groups such as cyclohexane, or by a combination of these groups, or by the presence of different L structures within the same 5'MVIP or 3'MVIP structure or between 5'MVIP and 3'MVIP, and the length of the L chain is in the range of C7 to C18. JPEG2025525928000137.jpg66170JPEG2025525928000138.jpg236170
[0210] Except for the structural changes in linker B, when X, L, D, and R1 / R2 are the same for the 5'MVIP09 / 3'MVIP09 combination, A1 and A2 in the general formula of linker B each independently represent C, O, S, -NH-, a carbonyl group, an amide group, a phosphoryl group, or a thiophosphoryl group, and r is an integer from 0 to 4. Whether they are the same or different between 5'MVIP and 3'MVIP, the activity of the resulting RNA inhibitor does not change significantly. JPEG2025525928000139.jpg192170JPEG2025525928000140.jpg255161JPEG2025525928000141.jpg255159JPEG2025525928 000142.jpg255158JPEG2025525928000143.jpg255158JPEG2025525928000144.jpg255160JPEG2025525928000145.jpg61170
[0211] When the MVIP structure and RNA inhibitor are the same, different linker chains D affect the activity of the RNA inhibitor, among which D1, D2, and D4 have effects similar to or even superior to D3. JPEG2025525928000146.jpg175170JPEG2025525928000147.jpg30170
[0212] Different transition points R1 affect the activity of RNA inhibitors, among which the activity of RNA inhibitors as the transition point R1-1 is the best. JPEG2025525928000148.jpg44170
[0213] Different transition points R2 affect the activity of the RNA inhibitors, but the RNA inhibitors are optimal when R2-1 is used as the transition point. JPEG2025525928000149.jpg116170JPEG2025525928000150.jpg96170
[0214] In certain embodiments, n+m in the RNA inhibitors described herein is 2, 3, 4, 5, and 6, respectively. The positions of 5'MVIP and / or 3'MVIP binding include the 5'-end and / or 3'-end of the antisense strand, the 5'-end and / or 3'-end of the sense strand, the 5'-end of the antisense strand and the 3'-end of the sense strand, and the 5'-end of the sense strand and the 3'-end of the antisense strand. Annealing occurs through base pairing between the antisense and sense strands, where n+m=2, 3, 4, 5, and 6, as shown in Table 20. JPEG2025525928000151.jpg107170JPEG2025525928000152.jpg212170
[0215] In some embodiments, n and m are each independently any integer from 0 to 4, preferably an integer from 1 to 3, and n+m=2 to 6, preferably n+m=2, 3, or 4, more preferably 4.
[0216] In certain embodiments, the linked sense and antisense strands of said 5'MVIP and / or 3'MVIP are selected from Table 21 below. JPEG2025525928000153.jpg255167JPEG2025525928000154.jpg255162JPEG2025525928000155.jpg255161 JPEG2025525928000156.jpg255163JPEG2025525928000157.jpg255165JPEG2025525928000158.jpg255161 JPEG2025525928000159.jpg255162JPEG2025525928000160.jpg255162JPEG2025525928000161.jpg255162 JPEG2025525928000162.jpg255161JPEG2025525928000163.jpg255162JPEG2025525928000164.jpg108170
[0217] In some embodiments, the RNA inhibitor is selected from Table 22-1 and Table 22-2, wherein the sense strand and / or antisense strand is a sequence that differs from each of the sequences in Table 22-1 and Table 22-2 by 1, 2, or 3 nucleotides, or has at least 15 consecutive nucleotides identical to a sequence in Table 22-1, Table 22-2. JPEG2025525928000165.jpg110170JPEG2025525928000166.jpg244170JPEG2025525928 000167.jpg72170JPEG2025525928000168.jpg174170JPEG2025525928000169.jpg164170
[0218] In some embodiments, the RNA inhibitors or pharmaceutically acceptable salts thereof described in the present application are preferably prepared or synthesized in the form of sodium salts and triethylamine salts or other pharmaceutically acceptable salts.
[0219] In some embodiments, the RNA inhibitor or a pharmaceutically acceptable salt thereof is more preferably a sodium salt or a triethylamine salt.
[0220] The present application also provides a pharmaceutical composition comprising the above RNA inhibitor or a pharmaceutically acceptable salt thereof.
[0221] In one embodiment, the present invention also provides a pharmaceutical composition comprising the above-described RNA inhibitor or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable pharmaceutical adjuvant. The pharmaceutical composition comprising the RNA inhibitor can be used to prevent and / or treat diseases associated with elevated APOC3 levels, such as hepatic diseases, inflammatory diseases, cardiovascular and cerebrovascular diseases, and metabolic diseases. Cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary artery sclerosis, aortic stenosis, hypertriglyceridemia (HTG), severe hypertriglyceridemia (sHTG), or familial chylomicronemia syndrome (FCS). Such pharmaceutical compositions are prepared according to the delivery mode. An exemplary embodiment is a composition for systemic administration via parenteral delivery, such as subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical composition of the present application can be administered at a dose sufficient to inhibit APOC3 gene expression.
[0222] A pharmaceutically acceptable "adjuvant" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle used to deliver one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected taking into account the intended mode of administration to provide the required volume, viscosity, etc. when combined with the nucleic acid and other components in a given drug composition. RNA inhibitors can be delivered in a manner that targets specific tissues (e.g., liver cells).
[0223] In certain embodiments, the drug composition further comprises a delivery vehicle (eg, a nanoparticle, a dendrimer, a polymer, a liposome, or a cationic delivery system).
[0224] In certain embodiments, the delivery vehicle comprises a liposome.
[0225] In certain embodiments, the delivery vehicle comprises a nanolipid capable of forming a liposome-nucleic acid nanoparticle with a nucleic acid molecule.
[0226] In certain embodiments, the delivery vehicle comprises the amphoteric lipid compound M10C1.
[0227] The pharmaceutical compositions of the present application include, but are not limited to, solutions, emulsions, and formulations containing liposomes. These compositions can be prepared from multiple components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Formulations include those targeted to the liver. The pharmaceutical formulations of the present application, conveniently available in unit dosage form, can be prepared based on conventional techniques known in the pharmaceutical industry. Such techniques include combining the active ingredient with a pharmaceutical adjuvant or excipient.
[0228] (Application) Meanwhile, the present application further provides a method for reducing the expression of APOC3 mRNA or protein in a cell or tissue, the method comprising contacting the cell or tissue with an effective amount of an RNA inhibitor or a pharmaceutically acceptable salt thereof and / or the above-mentioned pharmaceutical composition for inhibiting APOC3 gene expression.
[0229] Cells suitable for treatment using the method of the present application may be cells that express the APOC3 gene, such as liver cells, brain cells, gallbladder cells, heart cells, or kidney cells, but are preferably liver cells. Cells applied to the method of the present application may also be mammalian cells. When contacted with cells that express the APOC3 gene, the RNA inhibitor inhibits the expression of the APOC3 gene (e.g., human, primate, non-primate, or rat APOC3 gene) by at least about 50%. For example, this can be measured by PCR or branched DNA (bDNA)-based methods, or protein-based methods such as immunofluorescence, Western blotting, or flow cytometry.
[0230] In some embodiments, the tissue is liver tissue.
[0231] As used herein, "inhibition" can be used interchangeably with the terms "reduction," "decreasement," "silencing," "downregulation," "suppression," and other similar terms, and includes any level of inhibition. APOC3 gene expression can be evaluated according to the level or change in level of any variable related to APOC3 gene expression, such as APOC3 mRNA level or APOC3 protein level. This level can be analyzed in a single cell or a group of cells (e.g., including samples from a subject). Inhibition can be evaluated by a decrease in the absolute or relative level of one or more variables related to APOC3 expression compared to a control level. The control level can be any type of control level used in the art, such as a baseline level before administration, or a level measured from a similar subject, cell, or sample that is untreated or treated with a control (e.g., a buffer control or an inactive agent control only).
[0232] Inhibition of APOC3 gene expression can be achieved by transcribing and processing the APOC3 gene (e.g., by contacting one or more cells with an RNA inhibitor of the present application, or by administering an RNA inhibitor of the present application to a subject in which the cells are present) so that the amount of mRNA expressed by a first cell or group of cells in which APOC3 gene expression is inhibited is substantially equal to that of a first cell or group of cells (such cells may be present, for example, in a sample from a subject), but is reduced compared to a second cell or group of cells that has not been so treated (control cells that have not been treated with an RNA inhibitor or an RNA inhibitor targeting a gene of interest). In a preferred embodiment, inhibition is assessed in a cell line that highly expresses APOC3 using an appropriate concentration of siRNA according to the method provided in Example 2, and the mRNA level of the mediated cells is expressed as a percentage of the mRNA level of the non-mediated control cells.
[0233] In another embodiment, inhibition of APOC3 gene expression can be evaluated by parameters related to the expression function of the APOC3 gene, such as a decrease in APOC3 protein level in the blood or serum of a subject. APOC3 gene silencing can be measured in any APOC3-expressing cell (endogenous or exogenous from an expression construct) and by any analytical method known in the art.
[0234] Inhibition of APOC3 protein expression can be expressed by reducing the level of APOC3 protein expressed by a cell or a group of cells or a subject sample (for example, the protein level in a blood sample from a subject). As described above, to assess mRNA inhibition, the inhibition of the protein expression level of the treated cell or group of cells can be expressed as a percentage of the protein level of a control cell or group of cells, or as a change in the protein level of a subject sample (for example, blood or its derived serum).
[0235] Control cells, cell groups, or subject samples that can be used to evaluate the inhibition of the APOC3 gene include cells, cell groups, or subject samples that have not been contacted with the RNA inhibitors of the present application. For example, control cells, cell groups, or subject samples can be derived from a single subject (e.g., a human or animal subject) before treatment with the RNA inhibitor, or from an appropriately matched group control.
[0236] The APOC3 mRNA level expressed by cell or cell group can be measured by any method known in the art for evaluating mRNA expression.For example, qRT-PCR is used to evaluate the reduction of gene expression.The reduction of protein production can be evaluated by any method known in the art, such as ELISA.In some embodiments, puncture liver biopsy sample is used as tissue material for monitoring the reduced APOC3 gene or protein expression.In another embodiment, blood sample is used as subject sample for monitoring the reduced APOC3 protein expression.
[0237] Meanwhile, the present application provides a use of the above-mentioned RNA inhibitor that inhibits APOC3 gene expression or a pharmaceutically acceptable salt thereof, or the above-mentioned pharmaceutical composition, in the manufacture of a drug, which is used to prevent and / or treat a disease or symptom, or to reduce the risk of a disease or symptom.
[0238] In some embodiments, the disease or condition comprises an APOC3-associated disease or condition.
[0239] In certain embodiments, the disease or condition is selected from atherosclerosis, vascular disease, myocardial infarction, angina, stroke, kidney disease, renal failure, obesity, glucose intolerance, type 2 diabetes (non-insulin dependent diabetes mellitus), and metabolic syndrome.
[0240] Furthermore, the present application provides a method for preventing and / or treating a disease or symptom, the method comprising administering to a subject in need thereof an effective amount of the RNA inhibitor that inhibits the expression of the APOC3 gene or a pharmaceutically acceptable salt thereof, and / or the above-mentioned pharmaceutical composition.
[0241] The in vivo method of the present application can include administering to a subject a composition comprising an RNA inhibitor, wherein the RNA inhibitor comprises a nucleotide sequence complementary to at least a portion of the RNA transcript of the APOC3 gene of the mammal receiving the RNA inhibitor. The composition can be administered by any method known in the art, including, but not limited to, parenteral routes, including oral, intraperitoneal, or intracranial (e.g., intraventricular, intracerebral, and intraspinal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual). In some embodiments, the pharmaceutical composition is administered by intravenous infusion or injection. In some embodiments, the composition is administered by subcutaneous injection. In some embodiments, the composition is administered by intramuscular injection.
[0242] The RNA inhibitors of the present application can also be administered as "free RNA inhibitors." Free RNA inhibitors can also be administered without a drug composition. Naked RNA inhibitors can be contained in an appropriate buffer. The buffer can include acetate, citrate, prolamin, carbonate, phosphate, or any combination thereof. In one embodiment, the buffer is phosphate-buffered saline (PBS). The pH and osmolality of the buffer containing the RNA inhibitor can be adjusted to be suitable for administration to a subject.
[0243] Alternatively, the RNA inhibitors of the present application may be administered as pharmaceutical compositions, such as liposomal formulations.
[0244] The pharmaceutical composition of the present application may be administered at a dose sufficient to inhibit APOC3 gene expression. In some embodiments, a suitable dose of the RNA inhibitor of the present application is within the range of about 0.001 to about 1000.0 mg / kg of subject body weight per day, in some embodiments, about 1 to 50 mg / kg of subject body weight per day, and in some embodiments, a suitable dose of the RNA inhibitor of the present application is within the range of about 0.1 mg / kg to about 10.0 mg / kg, for example, within the range of about 0.3 mg / kg to about 3.0 mg / kg.
[0245] In one embodiment, the method comprises administering a pharmaceutical composition described herein to reduce target APOC3 gene expression for about 1, 2, 3, 4, 5, 6, 1-6, 1-3, or 3-6 months per dose. In some embodiments, the composition is administered once every 3-6 months.
[0246] In some embodiments, after an initial treatment regimen, administration can be performed less frequently. Repeated dose therapy can include administering therapeutic doses of the RNA inhibitor at regular intervals (e.g., from once a month to once a year). In some embodiments, the RNA inhibitor is administered about once a month to about once every three months, or about once every three months to about once every six months.
[0247] After the initial treatment regimen, treatment can be administered less frequently, and the duration of treatment can be determined depending on the severity of the disease.
[0248] In another embodiment, the single dose of the drug composition can be long-acting, such that the doses are administered at intervals of no more than 1, 2, 3, or 4 months. In some embodiments of the present application, the single dose of the drug composition of the present application is administered approximately once a month. In another embodiment of the present application, the single dose of the drug composition of the present application is administered quarterly (i.e., approximately every 3 months). In another embodiment of the present application, the single dose of the drug composition of the present application is administered twice a year (i.e., approximately once every 6 months).
[0249] Those skilled in the art will understand that factors including, but not limited to, mutations present in the subject, previous treatments, the subject's overall health or age, and the presence of other diseases, can affect the dosage and duration of administration required to effectively treat a subject. Moreover, treating a subject with a prophylactically and / or therapeutically effective amount of a composition, as appropriate, can include a single treatment or a series of treatments.
[0250] In some embodiments, the method further comprises measuring the level of APOC3 in a sample from the subject.
[0251] For example, it further includes measuring the level of APOC3 in a blood, serum or urine sample from said subject.
[0252] In some embodiments, the method further comprises administering to the subject an additional therapeutic agent for treating hypertension.
[0253] For example, the additional therapeutic agent can be selected from statins such as atorvastatin, rosuvastatin, and the like, cholesterol absorption inhibitors such as ezetimibe, and PCSK9 inhibitors.
[0254] On the other hand, the present application further provides a cell comprising the above-mentioned RNA inhibitor that inhibits APOC3 gene expression or a pharmaceutically acceptable salt thereof.
[0255] In yet another aspect, the present application further provides a kit comprising the above-mentioned RNA inhibitor that inhibits APOC3 gene expression or a pharmaceutically acceptable salt thereof, or the above-mentioned pharmaceutical composition.
[0256] Without intending to be bound by any theory, the following examples are used only to illustrate the RNA inhibitors, production methods and uses of the present application, and are not intended to limit the scope of the invention of the present application.
[0257] (Example) explanation: DMSO stands for dimethyl sulfoxide, The name DMF is N,N-dimethylformamide, The name HOBt is 1-hydroxybenzotriazole, The name of HBTU is O-benzotriazole-tetramethylurea hexafluorophosphate. The name of DIPEA (DIEA) is N,N-diisopropylethylamine, DCM is the name for dichloromethane. The name DMAP is 4-dimethylaminopyridine, The name DMT-CL is 4,4'-dimethoxytriphenylchloromethane, The name MEOH is methanol, The name of TBTU is O-benzotriazole-N,N,N',N'-tetramethylurea tetrafluoroborate. JPEG2025525928000170.jpg11170
[0258] Example 1: Synthesis of RNA inhibitors The sense and antisense strands of the uncoupled carrier constructs were synthesized using a solid-phase synthesizer using standard solid-phase phosphoramidite techniques. RNA inhibitors were prepared by complementary annealing of the sense strand with the corresponding antisense strand.
[0259] The basic steps of the solid phase phosphoramidite method are as follows: 1) Deprotection: Removal of the Solid Support hydroxyl protecting group (DMTr) from the starting monomer; 2) Coupling: adding the first phosphoramidite monomer and allowing the coupling reaction to occur in the 3' to 5' direction; 3) oxidation: oxidation of the resulting nucleoside phosphite to a more stable nucleoside phosphate ester (i.e., oxidation of trivalent phosphorus to pentavalent phosphorus); 4) Blocking: This step involves adding a cap to the 5'-OH of the nucleotide sequence that failed in the previous step to prevent further reaction. Finally, the above steps are repeated until the phosphoramidite monomer is introduced, and then the ester bond between the solid support and the starting monomer is cleaved using aqueous methylamine and ammonia water. The protecting groups of each base and phosphate in the resulting nucleotide sequence are removed, and the resulting nucleotide sequence is separated and purified by HPLC, then filter-sterilized and lyophilized to obtain the corresponding sense or antisense strand.
[0260] Description of the synthesis process of RNA inhibitors: The lyophilized powders of the sense and antisense strands were reconstituted separately and mixed in equal molar amounts. An appropriate amount of water for injection and an appropriate amount of TRIS buffer were then added. The solution was gently shaken for approximately 1-2 minutes to ensure uniform mixing. The water bath was heated to 92-95°C. The reaction mixture was placed in the water bath and heated for 3-5 minutes, after which the mixture was gently shaken to ensure uniform heating. The mixture was then allowed to cool to room temperature. A colorless or slightly yellowish, transparent liquid was obtained, and a sample was taken to measure the concentration.
[0261] Example 2-1 In vitro inhibition test 1 of APOC3 gene expression by RNA inhibitors The RNA inhibitors (DS52 to DS102) in this example were prepared by the method described in Example 1. An aqueous solution of the RNA inhibitor was mixed with an organic solution of DOTMA to form a water-insoluble precipitate. This precipitate was separated, dried, dissolved in chloroform, and then mixed with a chloroform solution of other lipids, including M10C1 and PEG600-cholesterol. This mixture was evaporated by vacuum centrifugation and dried overnight to obtain the RNA inhibitor encapsulated in nanolipids. The weight ratios of DOTMA, M10C1, and PEG600-cholesterol to the RNA inhibitor were 1 to 1.6, 1.5 to 2.5, and 2.5 to 3.5, respectively.
[0262] Sample solutions of nanolipid-encapsulated RNA inhibitors at the appropriate concentrations were prepared using DMEM containing 10% fetal bovine serum. 5HepG2 cells were seeded at 37°C / 5% CO2 in 10% fetal bovine serum-DMEM medium at 10% CO2 for 24 hours, then 10 nM of sample intervention was added. After 72 hours of incubation, the cell samples were collected. 1 ml of Ezol lysis solution was added to the collected cell samples and mixed well using a vortex shaker. 0.2 ml of chloromethane was added, shaken vigorously for 10 seconds, and then left at room temperature for 1 minute. The cells were centrifuged at 12,000 x g for 15 minutes at 4°C. The supernatant aqueous phase was transferred to a new, RNAse-free centrifuge tube and an equal volume of 100% ethanol was added. The entire sample was aspirated and loaded onto a mini-spin centrifuge column with a 2 ml collection tube. The sample was centrifuged at 8,000 x g for 15 seconds at room temperature, and the flow-through was discarded. The remaining sample was transferred to the centrifuge column and the previous step was repeated. Add 700 μL of WB to the column, gently close the cover, and centrifuge at 8,000 × g for 15 seconds at room temperature. Discard the flow-through and repeat the previous step, washing the column twice with 500 μL of WB. qRT-PCR was used to measure APOC3 mRNA levels. The relative expression levels of APOC3 mRNA in the intervention samples were determined compared to the supernatants of HepG2 cells without intervention.
[0263] Numerical analysis ΔΔCt method (Ct difference comparison method): The housekeeping gene GAPDH is expressed in all cells, and its product is necessary for maintaining cell viability. Furthermore, its intracellular expression level and genome copy number are constant and are less affected by the environment. Therefore, GAPDH is referred to as an internal reference gene. After qRT-PCR, the C value of the internal reference is simultaneously recorded and is called Ct(GAPDH), while the C value of the sample is called Ct(sample).
[0264] ΔCt(sample) = Ct(sample) - Ct(GAPDH) ΔCt(control) = Ct(control) - Ct(GAPDH) ΔΔCt = ΔCt(sample) - ΔCt(control) Relative expression level of gene = 2^-△△Ct The test results obtained are shown in Table 23 below. JPEG2025525928000171.jpg151170JPEG2025525928000172.jpg255157JPEG2025525928000173.jpg255160JPEG2025525928000174.jpg195170
[0265] The test results showed that the RNA inhibitors in Table 6 exhibited different inhibitory effects on the expression level of APOC3 mRNA in HepG2 cells at different concentrations, among which DS52-58, DS60, DS62-64, DS66-75, DS77-87, DS90-98 and DS100-102 exhibited significant inhibitory effects on the expression level of APOC3 mRNA in HepG2 cells.
[0266] Example 2-2 In vitro inhibition test 2 of APOC3 gene expression by RNA inhibitors The RNA inhibitor sequences in this example were selected from Table 5 and prepared according to the method described in Example 1. HepG2 cells containing the RNA inhibitor were seeded into 96-well cell plates. Simultaneously with plating, siRNA compounds were transfected into the cells using a transfection reagent. The siRNA test concentrations were 1 nM and 0.1 nM. The cells were cultured overnight in a 5% CO2 incubator at 37°C, and triplicate (three biological replicates) parallel assays were performed. A control group was also set up.
[0267] Detection of target gene mRNA expression levels by qPCR: 48 hours after transfection, RNA was extracted and target cDNA was detected by qPCR. GAPDH cDNA was also detected as an internal control for parallel detection. 8 μL of the prepared qPCR reaction mixture and 2 μL of sample cDNA were added to a 384-well plate. The qPCR reaction procedure was as follows: heat at 95°C for 10 minutes, then enter cycling mode, heat at 95°C for 15 seconds, followed by heating at 60°C for 1 minute, for a total of 40 cycles. The relative expression levels of APOC3 mRNA in the sample intervention group were determined compared to the supernatant of HepG2 cells without intervention, and the average relative expression levels of APOC3 were obtained from triplicates. The test results obtained at 1 nM and 0.1 nM are shown in Tables 24 and 25 below. JPEG2025525928000175.jpg255160JPEG2025525928000176.jpg255156JPEG2025525928 000177.jpg255160JPEG2025525928000178.jpg255160JPEG2025525928000179.jpg25515 6JPEG2025525928000180.jpg255157JPEG2025525928000181.jpg43170JPEG20255259280 00182.jpg225170JPEG2025525928000183.jpg255159JPEG2025525928000184.jpg200170
[0268] The RNA inhibitors Ky-12-DS230, Ky-12-DS250, Ky-12-DS254, Ky-12-DS297, Ky-12-DS298, Ky-12-DS317, and Ky-12-DS330 are preferably used for EC 50 The values were examined and the experimental results are shown in Table 26. JPEG2025525928000185.jpg59170
[0269] Example 3: In vitro inhibition test 2 of APOC3 gene expression by RNA inhibitors The sequences in this example were selected from Table 8. The 2'-position of the sugar group in the sense and antisense strand sequences was methoxylated or fluoro-modified, and the sequences after modification of the sense and antisense strands are shown in Tables 6-1 and 7-1, respectively. The corresponding sequences in Tables 6-1 and 7-1 were selected and annealed to synthesize RNA inhibitors.
[0270] The RNA inhibitors prepared according to the method described in Example 1 were collected. The RNA inhibitors were transfected into HepG2 cells, and the intervention effect of the RNA inhibitors on the cells was investigated at a concentration of 1.0 nM. APOC3 mRNA levels were measured by qRT-PCR. The relative expression levels of APOC3 mRNA in the sample intervention group were determined compared with the supernatant of HepG2 cells without intervention. The test results obtained are shown in Table 27. JPEG2025525928000186.jpg121170JPEG2025525928000187.jpg255161JPEG2025525928000188.jpg126170
[0271] For further activity studies, DS104-105, DS107-109, DS111, DS113-114, DS118, DS122, DS124, DS127, DS131, and DS132 are preferred as RNA inhibitors.
[0272] Example 4: In vitro inhibition test 3 of APOC3 gene expression by RNA inhibitors The sequences in this example were selected from Table 8. The 2' position of the sugar group in the sense and antisense strand sequences was methoxylated or fluoro-modified, and the sequences after modification of the sense and antisense strands are shown in Tables 6-1 and 7-1, respectively. The corresponding sequences from Tables 6-1 and 7-1 were selected and annealed to synthesize RNA inhibitors. The APOC3 intervention effect of RNA inhibitors on cells was investigated at a low concentration of 0.1 nM. RNA inhibitors prepared according to the method described in Example 1 were collected. HepG2 cells were transfected with the RNA inhibitors, and APOC3 mRNA levels were measured by qRT-PCR. The relative expression levels of APOC3 mRNA in the sample intervention group were determined compared to the supernatant of HepG2 cells without intervention. The test results obtained are shown in Table 28. JPEG2025525928000189.jpg54170JPEG2025525928000190.jpg180170Result:More preferably, select DS107, DS108, DS113, DS114, DS124, DS131, and DS132 for the next EC 50 Proceed to detection.
[0273] Example 5: In vitro inhibition test of APOC3 gene expression by RNA inhibitors In this embodiment, ECs of DS107, DS108, DS113, DS114, DS124, DS131, and DS132 50 Detect the value.
[0274] The RNA inhibitor was transfected into HepG2 cells, and the intervention effect of the RNA inhibitor on the APOC3 gene in cells was investigated at concentrations of 10nM, 5nM, 2nM, 1nM, 0.5nM, 0.1nM, 0.05nM, and 0.01nM. APOC3 mRNA levels were measured by qRT-PCR, and EC 50 The test results are shown in Table 29. JPEG2025525928000191.jpg54170
[0275] Preferably, DS107, DS108, DS113, DS114, DS124, DS131, and DS132 are selected and then proceeded to the next step to be linked with 5'MVIP / 3'MVIP.
[0276] Example 6 Synthesis of 5'MVIP and 3'MVIP Compounds When the 3'-end of the sense strand or antisense strand of the RNA inhibitor of the present application is bound to a 3'-MVIP of a carrier structure, the solid support of the 3'-MVIP serves as the initiating monomer for solid-phase synthesis. When the 5'-end of the sense strand or antisense strand of the RNA inhibitor of the present application is bound to a 5'-MVIP of a carrier structure, the 5'-MVIP phosphoramidite monomer serves as the final monomer for solid-phase synthesis.
[0277] When the 3' end of the sense strand or antisense strand of the RNA inhibitor of the present application is bound to a 3'MVIP, the solid support of the 3'MVIP serves as the starting monomer for solid-phase synthesis, and the general formula of the solid support of the 3'MVIP is as follows: JPEG2025525928000192.jpg35170
[0278] When m is 1 to 4, the linker B moieties in the general formula are each branched 1 to 4 times to obtain a solid support for the corresponding 3'MVIP.
[0279] For example, when m is 1, the resulting solid support functions as a disclosed monomer for solid-phase synthesis of the sense strands of RNA inhibitors Kylo-12-DS134 to Kylo-12-DS136, Kylo-12-DS142, Kylo-12-DS145, Kylo-12-DS146, Kylo-12-DS157, and Kylo-12-DS158, and the antisense strands of Kylo-12-DS131 to Kylo-12-DS133, Kylo-12-DS139, Kylo-12-DS140, Kylo-12-DS149, Kylo-12-DS150, and other RNA inhibitors described in this invention.
[0280] When m is 2, the resulting solid support functions as a monomer for the solid-phase synthesis of the sense strand of the RNA inhibitors Kylo-12-DS141, Kylo-12-DS143, Kylo-12-DS144, Kylo-12-DS154 to Kylo-12-DS156, Kylo-12-DS166, Kylo-12-DS169, and Kylo-12-DS170, and the antisense strand of Kylo-12-DS1081, Kylo-12-DS137, Kylo-12-DS138, Kylo-12-DS151 to Kylo-12-DS153, Kylo-12-DS163, Kylo-12-DS164, and other RNA inhibitors described in this invention.
[0281] When m is 3, the resulting solid support serves as a disclosed monomer for the solid-phase synthesis of the sense strand of the RNA inhibitors Kylo-12-DS159, Kylo-12-DS160, Kylo-12-DS165, Kylo-12-DS167, Kylo-12-DS168, Kylo-12-DS174, and Kylo-12-DS175, and the antisense strand of Kylo-12-DS147, Kylo-12-DS148, Kylo-12-DS161, Kylo-12-DS162, Kylo-12-DS171, Kylo-12-DS172, and other RNA inhibitors described in this invention.
[0282] When the 5'-end of the sense strand or antisense strand of the RNA inhibitor of the present application has 5'MVIP, the 5'MVIP phosphoramidite monomer serves as the final phosphoramidite monomer for solid-phase synthesis of the sense strand or antisense strand. The general formula of the 5'MVIP phosphoramidite monomer is as follows: JPEG2025525928000193.jpg28170
[0283] When n is 1 to 4, the linker B moieties in the general formula are each branched 1 to 4 times to give the corresponding 5'MVIP phosphoramidite monomers.
[0284] For example, when n is 1, the resulting 5'MVIP phosphoramidite monomer serves as the final monomer for solid-phase synthesis of the sense strand of the RNA inhibitors Kylo-12-DS131 to Kylo-12-DS134, Kylo-12-DS137, Kylo-12-DS138, Kylo-12-DS141, Kylo-12-DS147, Kylo-12-DS148, and other RNA inhibitors described in this invention, and the antisense strand of Kylo-12-DS135, Kylo-12-DS136, Kylo-12-DS143, Kylo-12-DS144, Kylo-12-DS159, Kylo-12-DS160, and other RNA inhibitors described in this invention.
[0285] When n is 2, the resulting 5'MVIP phosphoramidite monomer serves as the final monomer for solid-phase synthesis of the sense strand of Kylo-12-DS1081, Kylo-12-DS139, Kylo-12-DS140, Kylo-12-DS142, Kylo-12-DS151 to Kylo-12-DS154, Kylo-12-DS161, Kylo-12-DS162, Kylo-12-DS165, and other RNA inhibitors described in the present invention, and the antisense strand of Kylo-12-DS145, Kylo-12-DS146, Kylo-12-DS155, Kylo-12-DS156, Kylo-12-DS167, Kylo-12-DS168, and other RNA inhibitors described in the present invention.
[0286] When n is 3, the resulting 5'MVIP phosphoramidite monomer bearing three liver-targeting-specific ligands X serves as the final monomer for solid-phase synthesis of the sense strands of Kylo-12-DS149, Kylo-12-DS150, Kylo-12-DS163, Kylo-12-DS164, Kylo-12-DS166, Kylo-12-DS171 to Kylo-12-DS173, and other RNA inhibitors described herein, and the antisense strands of Kylo-12-DS157, Kylo-12-DS158, Kylo-12-DS169, Kylo-12-DS170, Kylo-12-DS174, Kylo-12-DS175, and other RNA inhibitors described herein.
[0287] The above are merely exemplary examples of some RNA inhibitors, and all RNA inhibitors described in the present invention but not described herein also fall under this rule. That is, when a 3'MVIP carrier structure is attached to the 3'-end of the sense strand or antisense strand of an RNA inhibitor of the present application, the solid support of the 3'MVIP functions as the starting monomer for solid-phase synthesis. When a 5'MVIP carrier structure is attached to the 5'-end of the sense strand or antisense strand of an RNA inhibitor of the present application, the 5'MVIP phosphoramidite monomer functions as the final monomer for solid-phase synthesis.
[0288] Before the sense and antisense strands of these RNA inhibitors described above can be synthesized by solid-phase phosphoramidite synthesis, the corresponding 3'MVIP solid support and 5'MVIP phosphoramidite monomers must be chemically synthesized.
[0289] This example provides only an exemplary chemical synthesis process for the 3'MVIP solid support and 5'MVIP phosphoramidite monomer of some of the RNA inhibitors described in this invention. Those skilled in the art can easily synthesize other 3'MVIP solid supports and 5'MVIP phosphoramidite monomers not described here. The synthesis process is described as follows:
[0290] 4.1 Synthesis of 3'MVIP solid support 4.1.1 Synthesis of 3'MVIP09 Solid Support JPEG2025525928000194.jpg44170
[0291] Description of the synthesis process: 4.1.1.1 Synthesis of ERC-01-c1 JPEG2025525928000195.jpg33170
[0292] 2-Amino-1,3-propanediol (5.0 g, 54.9 mmol) was weighed, DMSO (50 mL), and sodium hydroxide solution (1 g / mL) (5 mL) were added, and the mixture was cooled to 0 °C. t-Butyl acrylate (20 mL, 137.8 mol) was added dropwise over 2 hours. After reacting at room temperature for 48 hours, petroleum ether (100 mL) was added, washed twice with saturated brine, and the organic layer was dried. The mixture was passed through a chromatography column (eluent: ethyl acetate: petroleum ether = 25% to 75%). 0.05% triethylamine was added to the column, yielding 6.2 g of a colorless oil.
[0293] 4.1.1.2 Synthesis of ERC-01-c2 JPEG2025525928000196.jpg32170
[0294] ERC-01-c1 (6.2 g, 17.9 mmol) was weighed, 50 mL of dichloromethane and 23 mL of 25% sodium carbonate solution were added, and benzyl chloroformate (8.2 mL, 57.4 mmol) was added dropwise at room temperature for 2 hours. After standing overnight at room temperature, the mixture was washed three times with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated. The mixture was then passed through a chromatography column (ethyl acetate:petroleum ether = 5% to 30%) to obtain 4.0 g of oil.
[0295] 4.1.1.3 Synthesis of ERC-01-c3 JPEG2025525928000197.jpg25170
[0296] ERC-01-c2 (4.0 g, 8.3 mmol) was weighed, and 12 mL of formic acid was added thereto. The mixture was allowed to react at room temperature overnight, and the solvent was evaporated to dryness under reduced pressure to obtain 2.8 g of a product.
[0297] 4.1.1.4 Synthesis of ERCd-01-c1 JPEG2025525928000198.jpg77170
[0298] Compound ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), followed by HOBt (2.24 g) and HBTU (3.36 g), followed by the slow addition of DIEA (4.16 mL). The reaction mixture was stirred at room temperature for 3 hours. Water was then added, and the aqueous layer was extracted with dichloromethane (2 × 10 mL). The combined organic layers were washed with saturated sodium bicarbonate (80 mL), water (2 × 60 mL), and saturated brine (60 mL), successively. The mixture was dried over anhydrous sodium sulfate and evaporated to dryness under reduced pressure. The product was then purified by silica gel column chromatography (eluent: 3–15% MeOH in DCM). 3.24 g of a pale yellow solid was obtained.
[0299] 4.1.1.5 Synthesis of ERCd-01-c2 JPEG2025525928000199.jpg77170
[0300] ERCd-01-c1 (3.24 g, 2.6 mmol) was dissolved in methanol (60 mL), and 10% palladium-carbon (0.3 g) and acetic acid (2.0 mL) were added. Hydrogen was then introduced under atmospheric pressure and the reaction was allowed to proceed overnight. The reaction mixture was filtered through diatomaceous earth, and the filtrate was evaporated to dryness under reduced pressure to give 2.9 g of an oil, ERCd-01-c2.
[0301] 4.1.1.6 Synthesis of 3'MVIP09-c1 JPEG2025525928000200.jpg92170
[0302] SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added to a vial in this order, followed by 10 mL of DCM and stirring until dissolved. TBTU (0.963 g) and DIPEA (0.517 g) were then added in this order and allowed to react overnight. Water was then added, followed by extraction with DCM. The organic phase was washed with saturated brine, dried, filtered, concentrated, and finally purified using a silica gel column to obtain 1.3 g of the product.
[0303] 4.1.1.7 Synthesis of 3'MVIP09-c2 JPEG2025525928000201.jpg69170
[0304] 3'MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added to a vial and stirred at room temperature until dissolved. Then, DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were added in that order and stirred at room temperature. The resulting DCM was analyzed by TLC. After the reaction, water was added, followed by extraction with DCM and washing the organic phase again with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and finally purified on a silica gel column to yield 1.55 g of product.
[0305] 4.1.1.8 Synthesis of 3'MVIP09 Solid Support JPEG2025525928000202.jpg79170
[0306] 3'MVIP09-c2 (0.86 g, 0.5 μmol) and 10 mL of DMF were added to a vial in order. After dissolution, HBTU (0.19 g), DIPEA (0.194 g), and macroporous aminomethyl resin (2.0 g) were added in order. The mixture was shaken for 24 hours, filtered, and the resin was washed with 10% methanol / DCM. Then, end-capping was performed using 25% acetic acid / pyridine to adjust the degree of substitution to 150 μmol / g.
[0307] 4.1.2 Synthesis of 3'MVIP17 Solid Support JPEG2025525928000203.jpg75170
[0308] 4.1.2.1 Synthesis of SANC-01-c1 For the JPEG2025525928000204.jpg53170 synthesis procedure, please refer to 4.1.1.1 ERC-01-c1 Synthesis.
[0309] 4.1.2.2 Synthesis of SANC-01-c2 For the JPEG2025525928000205.jpg47170 synthesis procedure, please refer to 4.1.1.2 ERC-01-c2 Synthesis.
[0310] 4.1.2.3 Synthesis of SANC-01-c3 For the JPEG2025525928000206.jpg43170 synthesis procedure, please refer to 4.1.1.3 ERC-01-c3 Synthesis.
[0311] 4.1.2.4 Synthesis of SANCd-01-c1 For the JPEG2025525928000207.jpg50170 synthesis procedure, see 4.1.1.4 ERCd-01-c1 Synthesis.
[0312] 4.1.2.5 Synthesis of SANCd-01-c2 JPEG2025525928000208.jpg54170For the synthesis procedure, see 4.1.1.5 ERCd-01-c2 Synthesis.
[0313] 4.1.2.6 Synthesis of 3'MVIP17-c1 JPEG2025525928000209.jpg145170The synthesis procedure was as described in 4.1.1.6 Synthesis of 3'MVIP09-c1, and 3'MVIP17-c1 was obtained by synthesis.
[0314] 4.1.2.7 Synthesis of 3'MVIP17-c2 JPEG2025525928000210.jpg110170For synthesis procedures, please refer to 4.1.1.7 Synthesis of 3'MVIP09-c2.
[0315] 4.1.2.8 Synthesis of 3'MVIP17 Solid Support JPEG2025525928000211.jpg116170For synthesis procedures, please refer to 4.1.1.8 Synthesis of Solid Support of 3'MVIP09.
[0316] 4.1.3 Synthesis of 3'MVIP01 Solid Support: JPEG2025525928000212.jpg34170 Compositing procedure description: 4.1.3.1 Synthesis of 3'MVIP01-c1 JPEG2025525928000213.jpg60170For the synthesis procedure, please refer to 4.1.1.6 Synthesis of 3'MVIP09-c1.
[0317] 4.1.3.2 Synthesis of 3'MVIP01-c2 JPEG2025525928000214.jpg73170For the synthesis procedure, please refer to 5.1.1.7 Synthesis of 3'MVIP09-c2.
[0318] 4.1.3.3 Synthesis of 3'MVIP01 Solid Support JPEG2025525928000215.jpg68170For synthesis procedures, please refer to 4.1.1.8 Synthesis of Solid Support of 3'MVIP09.
[0319] 4.2. Synthesis of 5'MVIP phosphoramidite monomer 4.2.1 Synthesis of 5'MVIP09 phosphoramidite monomer JPEG2025525928000216.jpg42170
[0320] 4.2.1.1 Synthesis of 5'MVIP09-ERCd-PFP-c1 JPEG2025525928000217.jpg31170
[0321] ERCd-01-c2 (2.18 g, 2.0 mmol) was weighed and dissolved in DMF (50 mL). Monobenzyl glutarate (0.53 g, 2.4 mmol), DIPEA (0.78 g), and TBTU (0.84 g) were added and stirred overnight at room temperature. The mixture was quenched with water (50 mL), extracted with DCM (30 mL), washed with 10% citric acid (50 mL), saturated sodium bicarbonate (50 mL), and pyridine (100 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to give 5'MVIP09-ERCd-PFP-c1 (2.15 g).
[0322] 4.2.1.2 Synthesis of 5'MVIP09-ERCd-PFP-c2 JPEG2025525928000218.jpg28170
[0323] 5'MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% palladium-carbon (0.21 g) were weighed, and methanol (50 mL) was added. The mixture was then hydrogenated overnight at room temperature with stirring. After the reaction was complete, the palladium-carbon was filtered through diatomaceous earth and rotary evaporated to give crude 5'MVIP09-ERCd-PFP-c2 (1.9 g).
[0324] 4.2.1.3 Synthesis of 5'MVIP09-ERCd-PFP JPEG2025525928000219.jpg31170
[0325] The crude 5'MVIP09-ERCd-PFP-c2 product (1.9 g, 1.58 mmol) was weighed and dissolved in DCM (60 mL), DIPEA (1.33 g) was added, and after cooling, pentafluorophenol trifluoroacetate (2.21 g, 7.9 mmol) was added. After stirring at room temperature for 2 h, the mixture was rotary evaporated, redissolved in DCM (60 mL), washed with saturated sodium bicarbonate (30 mL*3), 10% citric acid (30 mL*1), saturated brine (50 mL*1), dried over anhydrous sodium sulfate, filtered, and rotary evaporated to give the crude 5'MVIP09-ERCd-PFP product (2.35 g), which was dried under vacuum and used in the next reaction without further purification.
[0326] 4.2.1.4 Synthesis of 5'MVIP09 phosphoramidite monomer-c1 JPEG2025525928000220.jpg26170
[0327] The crude 5'MVIP09-ERCd-PFP product (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL), DIPEA (0.82 g, 6.32 mmol) and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added, and the mixture was stirred overnight at room temperature. 10% citric acid (30 mL) was added, and the mixture was extracted with DCM (30 mL), washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain the 5'MVIP09 monomer-c1 (1.73 g) product.
[0328] 4.2.1.5 5'MVIP09 Phosphoramidite Monomer JPEG2025525928000221.jpg88170
[0329] 5'MVIP09 phosphoramidite monomer-c1 (1.3 g, 1.0 mmol) was weighed and dissolved in acetonitrile (30 mL), diisopropylamine triazole (0.22 g) was added, and bis-(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.2 mmol) was added dropwise in an ice bath. The reaction was allowed to proceed at room temperature for 4 hours. The reaction was then verified by HPLC concentration control, concentrated, and purified on a column to obtain the 5'MVIP09 monomer (1.2 g) product.
[0330] 4.2.2 Synthesis of 5'MVIP01 phosphoramidite monomer JPEG2025525928000222.jpg33170
[0331] Weigh out YICd-01-c2 (1.12 g, 2.0 mmol), the phosphoramidite monomer of 5'MVIP01, and follow the remaining procedures in 4.2.1.1 to 4.2.1.5.
[0332] Example 7: Synthesis of RNA inhibitors in which various siRNAs are linked to 5'MVIP09 / 3'MVIP09 Description of synthesis of the antisense strand and its carrier structure: The reagent bottle was purged with argon gas for at least 2 minutes. The phosphoramidite monomer and acetonitrile were added to the reagent bottle in that order, the bottle cap was tightened, and the mixture was shaken until the solids were completely dissolved by visual inspection. 3A molecular sieves were then added and the mixture was left for at least 8 hours for later use. The reagent bottle was purged with argon gas for at least 2 minutes. Xanthan hydride and dry pyridine were added to the reagent bottle in that order, the bottle cap was tightened, and the mixture was shaken until the solids were completely dissolved by visual inspection. The mixture was then temporarily stored for later use. The following operations were performed under ambient conditions at room temperature (20-30°C): 3'MVIP carrier was weighed and added to the reagent bottle, followed by acetonitrile, and the mixture was shaken until uniformly mixed. The carrier was transferred to a synthesis column, and the remaining carrier remaining in the reagent bottle was eluted with acetonitrile and transferred to the synthesis column. After elution was complete, acetonitrile was added to fill the synthesis column, and the amount of acetonitrile used was recorded. The synthesis column was then set up and secured according to the instrument operation.
[0333] Connect the monomer solution, CAP A, CAP B, oxidant, thio reagent, activator, decapping agent, and acetonitrile prepared above to the corresponding pipelines of the AKTA PILOT100, ensuring that the pipelines are inserted at the bottom of the reagent bottle.
[0334] Once the synthesis method is set up and the instrument is ready to run, click "Run" to begin the synthesis. The area of each detritylation peak was recorded through online observation. Additional operations were performed depending on the amount of deprotection reagent actually used during the synthesis process.
[0335] After the synthesis was completed, the synthesis column was purged with argon gas for at least 2 hours and then unloaded according to the operating procedure. The solid support in the synthesis column was transferred to a vial, and after adding methylamine aqueous solution and ammonia water, the vial was placed on a shaker at 35 °C for 2-3 hours. The solution was filtered into a round-bottom flask, and the remaining solid phase was washed with 50% aqueous ethanol. This was then filtered again and combined with the previous filtrate. The round-bottom flask was then connected to a rotary evaporator, and the water temperature was set to 50 °C. The mixture was evaporated until no distillate remained. Ethanol was then added to the round-bottom flask, mixed well, and evaporated again until no distillate remained. This process was repeated until a white powder was left at the bottom of the flask. The resulting white powder was prepared into a solution and purified using a reverse chromatography column. Samples were then taken to check OD260 and purity. The purified antisense strand solution was divided into vials and lyophilized for future use. The product was then sealed and stored in a refrigerator at -20 °C.
[0336] The synthesis procedure for the sense strand and its carrier structure was the same as that for the antisense strand and its carrier structure, except that the carrier loaded on the column was a universal carrier. DIPEA was added to the resulting intermediate to prepare a solution, followed by the addition of the 5'MVIP phosphoramidite monomer. After mixing thoroughly, the vial was placed in a shaker at 35°C and allowed to react for 2-3 hours.
[0337] Description of the synthesis annealing process of RNA inhibitors: The sense strand and its carrier structure were separated, and the antisense strand and its carrier structure were mixed in a 1:1 equimolar ratio in a vial. After placing the mixture in a 95°C water bath for 5 minutes, the water bath was turned off and the mixture was allowed to cool to below 40°C. The double-stranded solution was added with 3M sodium acetate solution and mixed thoroughly. An appropriate amount of absolute ethanol was then added and mixed evenly. The reaction mixture was then placed in a -20°C refrigerator for 45 minutes. A refrigerated high-speed centrifuge was pre-cooled to 4°C. Once the temperature reached that temperature, the double-stranded solution was added and the centrifuge was started. After centrifugation, the double-stranded solution was removed, the supernatant was discarded, and ultrapure water was added to completely dissolve the solids. Samples were then taken to determine OD260 and purity. The RNA inhibitors listed in Table 14 were obtained. The purified finished solution was divided into vials and lyophilized. The product was then sealed and stored in a -20°C refrigerator for future use.
[0338] Example 8-1: Study on the activity evaluation of RNA inhibitors containing 5'MVIP09 / 3'MVIP09 structure using PHH Primary human hepatocytes (PHH) were used to evaluate the in vitro activity of the RNA inhibitors in Table 15. Frozen PHH were thawed and cultured at a cell density (cells per mL) of 6 x 10 5 The RNA inhibitor was removed from the dilution plate and added to a 96-well cell culture plate (10 μL / well). 90 μL / well of cells were added to the 96-well plate for a final volume of 100 μL / well. The RNA inhibitor was diluted 10-fold starting from 200 nM, resulting in three concentration points. Three replicate wells were used. After addition, the cells were incubated in a 5% CO2, 37°C incubator for 48 hours. After intracellular RNA extraction, the RNA was reverse transcribed into cDNA. qPCR was used to detect the cDNA of the target gene. GAPDH was used as an internal reference gene, and qPCR was performed in a 384-well plate. The qPCR reaction procedure consisted of 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. The relative expression level of APOC3 mRNA was detected. The test results are shown in Table 31. JPEG2025525928000223.jpg68170
[0339] In this example, it was verified that the combination of 5'MVIP09 / 3'MVIP09 carriers can achieve self-delivery of siRNA.
[0340] Example 8-2: Evaluation of the activity of RNA inhibitors having 5'MVIP / 3'MVIP using PHH In this example, primary human hepatocytes were used to evaluate the in vitro activity of the modified RNA inhibitors in Table 22-1. Frozen PHHs were thawed and the cell density (cells per mL) was adjusted to 6 x 10 5 The RNA inhibitor was adjusted to 100 μL / well. The prepared RNA inhibitor was removed from the dilution plate and added to a 96-well cell culture plate (10 μL / well). 90 μL / well of cells were added to the 96-well plate for a final volume of 100 μL / well. The RNA inhibitor was added at two concentrations, 200 nM and 20 nM, and three wells were set up. After addition, the cells were incubated in a 5% CO2, 37°C incubator for 48 hours. After intracellular RNA extraction, the RNA was reverse transcribed into cDNA. qPCR was used to detect the cDNA of the target gene. GAPDH was used as an internal reference gene, and qPCR was performed in a 384-well plate. The qPCR reaction procedure consisted of 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. The relative expression level of APOC3 mRNA was detected. The test results are shown in Table 32. JPEG2025525928000224.jpg146170
[0341] The test results showed that the carrier structure at the 5' end of the modified sense strand was 5'MVIP17, and the carrier structure at the 3' end of the modified sense strand was 3'MVIP17. The RNA inhibitors formed by the coupling carriers 5'MVIP / 3'MVIP of the modified sense strand and antisense strand, 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, 5'MVIP17 / 3'MVIP01 or 5'MVIP09 / 3'MVIP09, or the combinations of 5'MVIP of the sense strand and 3'MVIP of the sense strand, 5'MVIP01 / 3'MVIP09, 5'MVIP09 / 3'MVIP01 or 5'MVIP01 / 3'MVIP01, were freely taken up by PHH cells and showed significant inhibitory effects on APOC3 mRNA in PHH cells.
[0342] Example 9: Study on the effect of 5'MVIP and 3'MVIP with different structures bound to the same siRNA on the activity of RNA inhibitors The antisense and sense strands were separately selected and paired and annealed according to the method described in Example 7 to synthesize RNA inhibitors (see Table 22-2). The effects of different X, L, B, D, R1, or R2 in the 5'MVIP and / or 3'MVIP structures on the activity of the RNA inhibitors were investigated. APOC3 Tg mice of appropriate ages were selected for experimental evaluation. Each mouse was administered 3 mg / kg subcutaneously on Day 0. Blood was collected on Day 14 after administration, and serum was separated. APOC3 levels in the serum were measured using ELISA. The test results are shown in Table 33 and Figure 1. JPEG2025525928000225.jpg131170
[0343] NOTE: For normalization, the TG levels of animals at each time point were divided by the TG levels of those animals on Day 0 to obtain ratio A1, and the average TG levels of control animals at each time point were divided by the average TG levels of the control group on Day 0 to obtain ratio A2. Dividing A1 by A2 yields the normalized average TG levels in the blood. Experimental results showed that the overall activity of the RNA inhibitors in the 5'MVIP / 3'MVIP combination (n + m = 4) was slightly higher than that of the combination (n + m = 3).
[0344] Example 10: Investigation of the effect of differences in 5'- or 3'-terminal nucleotides on the activity of RNA inhibitors The RNA inhibitors were transfected into HepG2 cells, and APOC3 mRNA levels were measured by qRT-PCR. The relative percentage of APOC3 mRNA in the sample intervention group was determined compared to the supernatant of HepG2 cells without intervention. The test results are shown in Table 34 and Figure 2. JPEG2025525928000226.jpg255170JPEG2025525928000227.jpg59170
[0345] The results of the study showed that the activity of RNA inhibitors was not significantly affected even if the 5' or 3' ends of the sense and antisense strands of the RNA inhibitors differed by one, two, or three nucleotides.
[0346] Example 11: Examination of the effect of different modifications at the 2' position of the nucleotide sugar group on the activity of RNA inhibitors We investigated the effects of fluoro-modification of the 2' position of nucleotide sugar groups at different positions starting from the 5' end of the sense strand and fluoro-modification of the 2' position of nucleotide sugar groups at different positions starting from the 5' end of the antisense strand on the activity of RNA inhibitors.
[0347] The RNA inhibitors were transfected into HepG2 cells, and APOC3 mRNA levels were measured by qRT-PCR. The mean APOC3 mRNA expression levels of the intervention samples were compared with those of the untreated HepG2 cell supernatant, and the inhibition rates were calculated. The results are shown in Table 35 and Figure 3. JPEG2025525928000228.jpg115170JPEG2025525928000229.jpg238170JPEG2025525928000230.jpg49170
[0348] Experimental results showed that the modification method had sequence specificity, and the effects of fluoro-modifying the 2' position of the nucleotide sugar groups 5, 7, 8, and 9 from the 5' end of the sense strand and the 2' position of the nucleotide sugar groups 7, 14, and 16 from the 5' end of the antisense strand were more ideal in DS231, DS261, DS281, and DS311.
[0349] DS541 and DS551 have the same sequence, but maintain good RNA inhibitor activity by modifying the 2' position of the nucleotide sugar groups at positions 5, 7, 8, and 9 from the 5' end of the sense strand, and the 2' position of the nucleotide sugar groups at positions 7, 14, and 16 from the 5' end of the antisense strand, or by modifying the 2' position of the nucleotide sugar groups at positions 3, 5, 7, 8, 9, 11, 13, and 15 from the 5' end of the sense strand, and the 2' position of the nucleotide sugar groups at positions 2, 4, 6, 8, 14, and 16 from the 5' end of the antisense strand.
[0350] DS571 has relatively ideal effects, with fluoro-modifications at the 2'-position of the nucleotide sugar groups at positions 3, 5, 7, 8, 9, 11, 13, and 15 from the 5'-end of the sense strand, and fluoro-modifications at the 2'-position of the nucleotide sugar groups at positions 2, 4, 6, 8, 14, and 16 from the 5'-end of the antisense strand.
[0351] DS591 has relatively ideal effects, with fluoro modifications at the 2'-position of the nucleotide sugar groups at positions 9, 10, and 11 from the 5'-end of the sense strand, and fluoro modifications at the 2'-position of the nucleotide sugar groups at positions 2, 4, 6, 8, 14, and 16 from the 5'-end of the antisense strand.
[0352] Example 12 Screening and evaluation of the delivery effect of 5'MVIP09 / 3'MVIP09 combination on RNA inhibitors by PHH Primary human hepatocytes were used to evaluate the in vitro activity of the RNA inhibitors in Table 36. Frozen PHHs were thawed and the cell density (cells per mL) was adjusted to 6 x 10 5 The RNA inhibitor was removed from the dilution plate and added to a 96-well cell culture plate (10 μL / well). 90 μL / well of cells were added to the 96-well plate for a final volume of 100 μL / well. The RNA inhibitor was diluted 10-fold starting from 500 nM, resulting in three concentration points. After addition, the cells were incubated in a 5% CO2, 37°C incubator for 48 hours. After intracellular RNA extraction, the RNA was reverse transcribed into cDNA. qPCR was used to detect the cDNA of the target gene. GAPDH was used as an internal reference gene, and qPCR was performed in a 384-well plate. The qPCR reaction procedure consisted of 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. The relative expression level of APOC3 mRNA was detected, and the inhibition rate was calculated. The results are shown in Table 36 and Figure 4. JPEG2025525928000231.jpg121170
[0353] The test results showed that the RNA inhibitor formed by coupling the modified sense and antisense strands to the carrier 5'MVIP09 / 3'MVIP09 was freely taken up by PHH cells and had an inhibitory effect on APOC3 mRNA in PHH cells, showing obvious inhibitory effects.
[0354] Example 13: Evaluation of RNA inhibitor activity using a transgenic mouse model The in vivo activity of the RNA inhibitors listed in Table 36 was investigated. APOC3 Tg mice of appropriate ages were obtained for experimental evaluation. Each mouse was subcutaneously administered 3 mg / kg on day 0. Blood samples were collected on days 8, 15, 22, 29, 35, and 42 after administration, and TG and APOC3 levels were measured. The normalized mean serum APOC3 levels after RNA inhibitor intervention are shown in Table 37 and Figure 5. JPEG2025525928000232.jpg37170
[0355] NOTE: For normalization, the APOC3 level of an animal at each time point was divided by the level of that animal on day d0 to obtain ratio A1, and the mean level of control animals at each time point was divided by the mean level of the control group on day d0 to obtain ratio A2. Dividing A1 by A2 gives the normalized mean APOC3 level in serum.
[0356] The normalized mean serum TG level results after RNA inhibitor intervention are shown in Table 38 and FIG. JPEG2025525928000233.jpg39170
[0357] NOTE: For normalization, the TG level of an animal at each time point was divided by the level of that animal on day d0 to obtain the ratio A1, and the mean level of the control group animals at each time point was divided by the mean level of the control group on day d0 to obtain the ratio A2. Dividing A1 by A2 gives the normalized mean TG level in serum.
[0358] Example 14 Evaluation of RNA inhibitor activity using a transgenic mouse model The in vivo activity of the RNA inhibitors listed in Table 22-1 was investigated. Age-appropriate hAPOC3 Tg mice were used for experimental evaluation. Fifty-five male hAPOC3 Tg mice, 6-8 weeks old, were divided into treatment groups (Ky-12-DS23001, Ky-12-DS25001, Ky-12-DS25401, Ky-12-DS29701, Ky-12-DS29801, Ky-12-DS31705, Ky-12-DS33001, and Ky-12-DS31701) and a saline group. After 2-3 days of adaptive feeding, blood was collected after fasting and serum was separated for the detection of hAPOC3 protein, TG, TC, and LDL-c levels. Five mice per group were randomly assigned according to their TG index. The administration day was defined as Day 0. Ky-12-DS31701 was tested in three dose groups, with 1 mg / kg, 3 mg / kg, and 6 mg / kg administered subcutaneously on Day 0, and 3 mg / kg administered subcutaneously to the other groups. Blood samples were collected on Days 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, and 77 after administration to measure hAPOC3, TC, TG, and LDL-c levels. The measurement results were normalized (see Example 13 for calculation method). The normalized interference effects of hAPOC3, TC, TG, and LDL-c are shown in Figures 7, 8, 9, and 10.
[0359] The experimental results showed that the RNA inhibitors investigated in this study all had varying degrees of effect on serum hAPOC3 expression and TC, TG, and LDL-c levels in hAPOC3 Tg mice, with the effects on hAPOC3 expression and TG levels being significant and durable. At a dose of 3 mg / kg, Ky-12-DS25401 reduced TG levels by up to 89.89% by Day 35, and the TG level reduction rate with each RNA inhibitor was maintained at 50% by Day 77. In this experiment, the dose-effect relationship of the RNA inhibitor Ky-12-DS31701 on hAPOC3 expression and TC, TG, and LDL-c levels was investigated. The experimental results showed that the effect of this RNA inhibitor on TG levels showed a significant dose-effect relationship: by Day 14, TG levels were reduced by 84.21%, 88.98%, and 95.06%, respectively, at 1 mg / kg, 3 mg / kg, and 6 mg / kg.
[0360] Example 15: Evaluation of RNA inhibitor activity in a cynomolgus monkey model Fifteen male cynomolgus monkeys (three per group) were divided into treatment groups (Ky-12-DS31701, Ky-12-DS31712, Ky-12-DS31711, and Ky-12-DS33001) and saline groups. After two weeks of adaptive feeding, they were randomly assigned to groups based on their TG levels and administered 4 mg / kg subcutaneously on the day of group assignment. Blood was collected from the saphenous or cephalic vein on Day 0 and at Days 7, 14, 21, 28, 35, 42, 49, 56, and 63 after administration. APOC3, TC, TG, HDL-c, and LDL-c levels were measured, and the normalized results were used to evaluate the interference effects of normalized APOC3, TG, HDL-c, LDL-c, and TC. These results are shown in Figures 11, 12, 13, 14, and 15. On Day 28 and Day 63, additional liver biopsies were performed on the cynomolgus monkeys in the Ky-12-DS31701-treated groups, liver tissue was extracted, and APOC3 mRNA levels in the cynomolgus monkey livers were measured by RT-qPCR, and the detection results were normalized.
[0361] Test results showed that the RNA inhibitors Ky-12-DS31701, Ky-12-DS31712, Ky-12-DS31711, and Ky-12-DS33001 all showed significant inhibitory effects on APOC3 expression in cynomolgus monkey serum. Ky-12-DS31701 and Ky-12-DS33001 reduced triglyceride levels by 84.01% and 81.15%, respectively, while reducing total cholesterol and LDL-c levels to varying degrees and significantly increasing HDL-c levels. The above compounds exhibited significant and sustained inhibitory effects on APOC3 expression and triglyceride levels. Among them, Ky-12-DS31701 was able to reduce triglyceride levels by 75.48% even at day 63. On day 28 and day 63, liver biopsies were performed on the cynomolgus monkeys in the Ky-12-DS31701 treatment groups, liver tissues were extracted, and APOC3 mRNA levels in the cynomolgus monkey livers were measured by RT-qPCR. The detection results were normalized, and the normalization calculation method is described in Example 13. The test results showed that the inhibition rates of Ky-12-DS31701 on cynomolgus monkey APOC3 mRNA levels were 91.65% and 87.23%, respectively, with the highest individual inhibition rate reaching 95%.
[0362] The basic principles, main features and advantages of the present invention have been shown and described above. Those skilled in the art should understand that the above embodiments do not limit the present invention in any way, and any technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.
Claims
1. An RNA inhibitor or a pharmaceutically acceptable salt thereof that inhibits APOC3 gene expression, wherein the RNA inhibitor is formed by base pairing of a sense strand and an antisense strand, each strand independently being 15 to 30 nucleotides in length, wherein the length of each strand is independently preferably 19 to 23 nucleotides, and there is at least 80% base complementarity between the sense strand and the antisense strand.
1. An RNA inhibitor or a pharmaceutically acceptable salt thereof,
2. The antisense strand is selected from a) the following sequences, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), and c) a sequence that differs from the sequences in a) and b) by 3 nucleotides or less: 5'uugguggcgugcuucauguaatt3' (SEQ ID NO: 212), 5'uaacccugcaugaagcugagatt3' (SEQ ID NO: 216), 5'uuaacggugcuccaguagucutt3' (SEQ ID NO: 217), ' (SEQ ID NO: 224), 5'cagagaacuuguccuuaacggtt3' (SEQ ID NO: 225), 5'uauugaggucucaggcagccatt3' (SEQ ID NO: 241), 5'ugaaguuggucugaccucaggtt3' (SEQ ID NO: 255), 5'gcacugagaauacugucccuuuu3' (SEQ ID NO: 256), 5'gcacugagaauacugucccuuu3' (SEQ ID NO: 459), 5'acacugaga auacugucccua 3' (SEQ ID NO: 461), 5'ugaauacugucccuuuuaagc 3' (SEQ ID NO: 465), 5'cugagaauacugucccuuuua 3' (SEQ ID NO: 471), 5'acugagaauacugucccuuua 3' (SEQ ID NO: 472), 5'uaauacugucccuuuuaagcaa 3' (SEQ ID NO: 438), 5'ugaggucucaggcagccacgg 3' (SEQ ID NO: 600), 5'ugg auaggcaggugggacuugg 3' (SEQ ID NO: 620), 5'caggauggauaggcagguggga 3' (SEQ ID NO: 624), 5'gagcacugagaauacuguccc 3' (SEQ ID NO: 668), 5'acacugagaauacugucgcuc 3' (SEQ ID NO: 687), 5'acacugagaauacugucgcuu 3' (SEQ ID NO: 700), 5'ucacugagaauacugucccuu 3' (SEQ ID NO: 519); where g = guanylic acid, a = adenylic acid, u = uridylic acid, c = cytidylic acid, and t = thymidylic acid. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1 .
3. The sense strand and the antisense strand are selected from a) the following sequences, b) sequences having at least 15 consecutive nucleotides identical to the sequence in a), and c) sequences having 3 or fewer nucleotides different from the sequences in a) and b), and the combinations of the sequences of the sense strand and the antisense strand are as follows: where g = guanylic acid, a = adenylic acid, u = uridylic acid, c = cytidylic acid, and t = thymidylic acid. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1 .
4. the sense strand and / or the antisense strand comprises at least one 2'-modified nucleotide, the 2'-modified nucleotide comprising a 2'-O-methyl nucleotide, a 2'-deoxy-2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2'-methoxyethyl nucleotide, a 2'-amino nucleotide, or a 2'-alkyl nucleotide; The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1 .
5. the sense strand and / or the antisense strand comprises at least one 2'-O-methyl nucleotide or 2'-deoxy-2'-fluoro nucleotide; The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 4.
6. phosphate ester bonds between three adjacent nucleotides at at least one of the ends of the sense strand and / or the antisense strand can be thioated; The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 5 .
7. the sense strand and the antisense strand are selected from the group consisting of: a) the following sequences; b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a); and c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides; where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenylic acid, U = 2'-O-methyluridylic acid, C = 2'-O-methylcytidylic acid, fG = 2'-fluoroguanylic acid, fA = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O- fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenylic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidylic acid, T=thymidylic acid. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 5 .
8. The RNA inhibitor further comprises a carrier structure, the structure of which is shown in Formula Ia, Ib, or Ic: where: the carrier structure comprises a 5'MVIP and a 3'MVIP; The 5'MVIP has a transition point R 1 , a connecting chain D, a linker B, a branched chain L, and a liver-targeting specific ligand X, and a transition point R 1 and the structure thereof is represented by general formula I, The 3'MVIP has a transition point R 2 , a connecting chain D, a linker B, a branched chain L, and a liver-targeting specific ligand X, and a transition point R 2 and the structure thereof is represented by general formula II: where: n and m each independently represent any integer from 0 to 4, preferably an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3, or 4, more preferably 4; The transition point R 1 is a heterocyclic or carbocyclic structure containing N, S or O, as shown below: Or, the R 1 is -NH(CH 2 ) x CH 2 O—, where x is any integer from 3 to 12, preferably any integer from 4 to 6; The transition point R 2 is a heterocyclic or carbocyclic structure containing N, S or O, as shown below: Or, the transition point R 2 is -NH(CH 2 ) x1 CH(OH)(CH 2 ) x2 CH 2 O—, where x1 is any integer from 1 to 4 and x2 is any integer from 0 to 4; The liver-targeting specific ligand X is the same or different within each of 5'MVIP and 3'MVIP, or between 5'MVIP and 3'MVIP, and is selected from monosaccharides and derivatives thereof, preferably N-acetylgalactosamine and derivatives thereof, and more preferably selected from the following structures: where W is —OH, —NHCOOH, and —NHCO(CH 2 ) q CH 3 where q is an integer from 0 to 4; The branched chains L are the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP and are selected from one or more of the following structures: Here, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, Z is H, an alkyl group or an amide group, and the alkyl group is, for example, C 1 ~C 5 is an alkyl group, The linker B is the same or different within each of the 5'MVIP and the 3'MVIP, or between the 5'MVIP and the 3'MVIP, and is selected from the following structures: Here, A 1 and A 2 are each independently C, O, S, —NH—, a carbonyl group, an amide group, a phosphoryl group, or a thiophosphoryl group, and r is an integer of 0 to 4, The linking chain D is the same or different within each of the 5'MVIP and the 3'MVIP, or between the 5'MVIP and the 3'MVIP, and is selected from the following structures: where each p is independently an integer from 1 to 20, s is an integer from 2 to 13, and Z 1 and Z 2 are the same or different substituents, The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 7.
9. The 5'MVIP is 5'MVIP01, 5'MVIP09 or 5'MVIP17 shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09 or 3'MVIP17 shown below.
9. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 8.
10. the carrier structure at the 5' end of the sense strand is 5'MVIP17, the carrier structure at the 3' end of the sense strand is 3'MVIP17, the combination of 5'MVIP of the sense strand and 3'MVIP of the antisense strand is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, 5'MVIP17 / 3'MVIP01 or 5'MVIP09 / 3'MVIP09, or the combination of 5'MVIP of the sense strand and 3'MVIP of the sense strand is 5'MVIP01 / 3'MVIP09, 5'MVIP09 / 3'MVIP01 or 5'MVIP01 / 3'MVIP01; The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 9.
11. The RNA inhibitors include Ky-12-DS23001, Ky-12-DS25001, Ky-12-DS25401, Ky-12-DS29701, Ky-12-DS29801, Ky-12-DS31701, Ky-12-DS31702, Ky-12-DS31703, Ky-12-DS31704, Ky-12-DS31705, Ky-12-DS31706, Ky-12-DS31707, Ky-12-DS31708, Ky-12-DS31709, Ky-12-DS31711, Ky-12-DS31712, Ky-12-DS31713, Ky-12-DS31714, Ky-12-DS31715, Ky-12-DS31716, Ky-12-DS31717, Ky-12-DS31718, Ky-12-DS31719, Ky-12-DS31720, Ky-12-DS31721, Ky-12-DS31722, Ky-12-DS31723, Ky-12-DS31724, Ky-12-DS31725, Ky-12-DS31726, Ky-12-DS31727, Ky-12-DS31728, Ky-12-DS31729, Ky-12-DS31730, Ky-12-DS31731, Ky-12-DS31732, Ky-12-DS31733, Ky-12-DS31734, Ky-12-DS31735, Ky-12-DS31736, Ky-12-DS31737, Ky-12-DS31738, Ky- DS31713, Ky-12-DS33001, Ky-12-DS33006, Kylo-12-DS1071, Kylo-12-DS1081, Kylo-12-DS1131, Kylo-12-DS1141, Kylo-12-DS1241, Kylo-12-DS1311, Kylo-12-DS1321, Kylo-12-DS5911, Kylo-12-DS2911, Kylo-12-DS2611, Kylo-12-DS2311, Kylo-12-DS3111, and Kylo-12-DS5411; The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 9.
12. 12. The use of the RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 11 in the manufacture of a drug for treating and / or preventing a disease associated with an elevated level of APOC3, wherein the disease associated with an elevated level of APOC3 includes inflammatory diseases, cardiovascular and cerebrovascular diseases, and hepatic diseases including metabolic diseases, and the cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary artery sclerosis, aortic stenosis, hypertriglyceridemia (HTG), severe hypertriglyceridemia (sHTG), or familial chylomicronemia syndrome (FCS).
10. Use of an RNA inhibitor or a pharmaceutically acceptable salt thereof in the manufacture of a drug, comprising:
13. A pharmaceutical composition comprising the APOC3 inhibitor according to any one of claims 1 to 11 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable adjuvant, wherein the pharmaceutical composition is an oral agent, an intravenous injection agent, or a subcutaneous or intramuscular injection agent, and preferably a subcutaneous injection agent. A pharmaceutical composition comprising: