Novel receptors with synthetic transmembrane domains for enhanced control of ligand-dependent transcriptional activation

Abstract

The present disclosure relates generally to the engineering of chimeric polypeptides that signal to reduce cancer cell proliferation, particularly a new class of receptors engineered to (i) bind target cell surface-displayed ligands and (ii) have synthetic transmembrane domains. The disclosure also provides compositions and methods useful for producing such receptors, nucleic acids encoding them, host cells genetically modified with these nucleic acids, and methods for modulating cellular activity and / or treating various diseases, such as cancer.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 398,186, filed August 15, 2022, the disclosure of which is incorporated by reference in its entirety, including all drawings.

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under Grant No. OD025751 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Incorporation of sequence listings

[0001] This application contains a Sequence Listing, which is hereby incorporated by reference in its entirety. The attached Sequence Listing file, named "2023-08-14 Sequence_Listing_ST26 048536-730001WO.xml", was created on August 14, 2023, and is 126,933 bytes.

[0004] Field The present disclosure relates generally to a new class of receptors with synthetic transmembrane domains that bind to target cell surface-displayed ligands and to manipulating receptor signaling to attenuate cancer cell growth. The disclosure also provides compositions and methods involving the receptors, nucleic acids encoding them, host cells genetically modified with these nucleic acids, and methods for modulating cellular activity and / or treating various diseases. [Background technology]

[0005] background A key problem that limits the development of gene therapy in humans is the regulation of therapeutic gene expression so that the gene expression or the vehicle used to achieve expression does not cause enhanced immunogenicity, resulting in host rejection.One method of achieving gene expression is to activate gene expression using chimeric polypeptides, such as Notch receptors, Notch-based receptors, or hinge-Notch receptors, as disclosed in U.S. Patent No. 11,202,801, the entire contents of which are incorporated herein by reference.

[0006] Notch and Notch-based receptors are type I transmembrane proteins that mediate cell-cell contact signaling and play a central role in development and other aspects of cell-to-cell communication, such as communication between two contacting cells, where one contacting cell is the "receiver" cell and the other is the "sender" cell. Notch and Notch-based receptors expressed in recipient cells recognize their ligands (e.g., proteins of the delta / serrate / lag, or "DSL" family) expressed on the sender cell. Engagement of Notch and DSL-ligands on these contacting cells results in two-step proteolysis of the Notch receptor, ultimately causing the release of the intracellular portion of the receptor from the membrane into the cytoplasm. This released domain alters the behavior of the recipient cell by functioning as a transcriptional regulator. Notch receptors are involved in and required for a variety of cellular functions during development and are important for the function of a vast number of cell types across species.

[0007] Notch possesses a metalloprotease cleavage site (designated "S2") that is normally protected from cleavage by the Notch negative regulatory region (NRR), which contains three LIN-12-Notch repeat (LNR) modules and a heterodimerization domain (HD) of the Notch extracellular subunit (NEC). At the C-terminus of the HD domain is the transmembrane domain (B), which contains the S3 cleavage site, a substrate for regulated intramembrane proteolysis by the γ-secretase complex (γSec). S3 proteolysis results in the release of the Notch intracellular domain. This event occurs only after the rate-limiting S2 cleavage, making S3 accessible to γSec.

[0008] An example of an existing first-generation synthetic derivative of Notch receptors, often referred to as "SynNotch receptors," exploits this direct signaling behavior by replacing the extracellular ligand-binding domain, which contains multiple EGF-like repeats in wild-type Notch, with an antibody derivative and the cytoplasmic domain with a selected transcriptional activator, but still relies on the functionality of the Notch NRR (L. Morsut et al., Cell (2016) 164:780-91). Generally, SynNotch signaling correlates with ligand binding, but tuning receptor sensitivity and response is difficult. Furthermore, the NRR spans approximately 160 amino acids, and this domain alone is the size of some mature proteins, such as insulin or epidermal growth factor (EGF). This makes expression of chimeric polypeptides less efficient, and due to size constraints related to vector capacity, the resulting chimeric polypeptides may exceed the capacity of some cloning and transfection vectors.

[0009] Next-generation SynNotch, which does not require an NRR receptor, can bind to user-defined cell surface-displayed ligands and undergo proteolytic cleavage of the receptor to release transcriptional regulators, thereby inducing custom transcriptional programs in cells. The receptor only requires a cleavable transmembrane domain, an extracellular juxtamembrane domain that can be tuned to regulate receptor cleavage, and a positively charged juxtamembrane sequence.

[0010] Receptors, whether native or synthetic, have various characteristics, such as "noise" (i.e., the baseline level of expression induced in the absence of the intended ligand) and signal or sensitivity (the amount of expression induced by binding of the intended ligand). Generally, signaling through Notch and "SynNotch" correlates with ligand binding, but tailoring receptor sensitivity and response is difficult, and additional tools are needed to provide synthetic receptors with a broader range of more easily tunable characteristics.

[0011] Another major obstacle to the effectiveness of many immunotherapy-based approaches to solid tumors, including cell therapy, is drug delivery or immune cell activation in solid tumors. Cells of the monocyte / macrophage lineage constitute a major component of immune cells infiltrating solid tumors. These cell types are actively recruited and retained in solid tumors, making them potentially important cell types for gene therapy delivery.

[0012] In light of these issues, there remains a need in the art for alternative receptors that can confer enhanced control of ligand-dependent transcriptional activation and that can complement existing therapeutic standards for immunotherapy of cancer and other immune diseases. Summary of the Invention [Means for solving the problem]

[0013] overview The present disclosure provides, inter alia, methods and compositions comprising chimeric polypeptides having a synthetic transmembrane domain (STMD) that is functional in primary human T cells. Surprisingly, modifying the chimeric polypeptide to include the STMD still provided functional, tunable receptors that exhibit a range of signaling characteristics mediated by the STMD. These receptors provide a range of sensitivity based on the location of specific amino acid residues in the STMD, as described below.

[0014] Provided herein, inter alia, are chimeric polypeptides having (a) an extracellular ligand-binding domain (ECD) having binding affinity for a selected ligand, (b) an STMD including one or more ligand-inducible proteolytic cleavage sites; and (c) an intracellular domain (ICD) having a transcriptional regulator (TR), wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site and release of the transcriptional regulator. In some embodiments, the chimeric polypeptide further comprises a hinge domain located between the extracellular ligand-binding domain and the STMD. In some embodiments, the hinge domain is derived from CD8α or CD28. In some embodiments, the hinge domain is a truncated CD8α hinge domain or a similar hinge.

[0015] In some embodiments, the chimeric polypeptide comprises, in order from the N-terminus to the C-terminus of the first polypeptide, an ECD, an STMD, and an ICD. In some embodiments, the chimeric polypeptide comprises, in order from the N-terminus to the C-terminus of the first polypeptide, an ECD, a hinge domain, an STMD, and an ICD.

[0016] In some embodiments, the STMD comprises one or more valine residues. In some embodiments, the STMD comprises a series of at least five valine residues (i.e., five consecutive valine residues). In some embodiments, the STMD comprises 5 to 30 valine residues. In some embodiments, the STMD comprises 10 to 25 valine residues. In some embodiments, the STMD further comprises two consecutive glycine residues. In some embodiments, the two consecutive glycine residues are located at any one of positions 5 to 30 of the polyvaline TMD, with position 30 being closer to the C-terminus of the chimeric polypeptide than position 5. In some embodiments, the STMD consists of valine residues.

[0017] In some embodiments of the chimeric polypeptides of the present disclosure, the ligand comprises a protein or carbohydrate, hi some embodiments, the ligand is selected from a cell surface receptor, an adhesion protein, an integrin, a mucin, a lectin, a tumor-associated antigen, and a tumor-specific antigen. In some embodiments, the ligand is CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXC R1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placenta-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), and signal regulatory protein alpha (SIRPα).

[0018] In some embodiments of the chimeric polypeptides of the present disclosure, the extracellular binding domain (ECD) comprises a ligand-binding portion of a receptor. In some embodiments, the ECD comprises an antigen-binding portion capable of binding to, e.g., having binding affinity for, a ligand on the surface of a cell.

[0019] In some embodiments of the chimeric polypeptides of the present disclosure, the antigen-binding portion is selected from the group consisting of an antibody, nanobody, diabody, triabody or minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. In some embodiments, the antigen binding portion is selected from the group consisting of CD19, B7H3 (CD276), BCMA, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-beta, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, BCMA (CD269), ALPI, citrullinated vimentin, cMet, and Axl. In some embodiments, the tumor-associated antigen is CD19, CEA, HER2, MUC1, CD20, or EGFR. In some embodiments, the tumor-associated antigen is CD19. In some embodiments, the cell is a pathogen.

[0020] In some embodiments, the ligand-inducible proteolytic cleavage site is two consecutive glycine residues.

[0021] In some embodiments of the chimeric polypeptide, the transcriptional regulator comprises a transcriptional activator, a transcriptional repressor, a site-specific nuclease, an inhibitory immunoreceptor, or an activating immunoreceptor. In some embodiments, the transcriptional regulator is selected from the group consisting of Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16.

[0022] In some embodiments, the chimeric polypeptides of the present disclosure comprise a ligand-induced proteolytic cleavage site, a tumor-specific cleavage site, a disease-specific cleavage site, an autoproteolytic peptide sequence, a nuclear localization signal, a juxtamembrane domain, a signaling domain, or any combination thereof.

[0023] In some embodiments of the chimeric polypeptides of the present disclosure, the signaling domain is derived from DAP12, CD3 zeta, TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (ICOS), Fc epsilon RI, DAP10, DAP12, or CD66d.

[0024] In some embodiments, the juxtamembrane domain of a chimeric polypeptide of the present disclosure is a Notch 2 juxtamembrane domain or an analogous polybasic domain.

[0025] In some embodiments of the chimeric polypeptides of the present disclosure, the ligand-induced proteolytic cleavage site is cleavable by gamma secretase.

[0026] In some embodiments, the chimeric polypeptide of the present disclosure comprises an autoproteolytic peptide sequence derived from porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), or any combination thereof.

[0027] 32. The chimeric polypeptide of any one of claims 1 to 31, wherein the STMD comprises an amino acid sequence encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 2 to SEQ ID NO: 22, SEQ ID NO: 27 or SEQ ID NO: 30.

[0028] In some embodiments of the chimeric polypeptides of the present disclosure, the STMD comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, and SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55.

[0029] In some embodiments, the chimeric polypeptide is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO:2 or SEQ ID NO:3.

[0030] In another aspect, the present disclosure provides an STMD for a chimeric polypeptide. In some embodiments, the STMD comprises at least five valine residues. In some embodiments, the STMD comprises at least 10 valine residues. In some embodiments, the STMD comprises at least 20 valine residues. In some embodiments, the STMD comprises between 15 and 25 valine residues. In some embodiments, the STMD comprises a ligand-inducible proteolytic cleavage site, and binding of a selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site and release of the transcriptional regulator.

[0031] In a further aspect, provided herein is a recombinant nucleic acid molecule comprising a nucleotide sequence encoding a chimeric polypeptide of the present disclosure.

[0032] In some embodiments, the recombinant nucleic acid molecule comprises a sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity to any one of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:27, or SEQ ID NO:30.

[0033] In another aspect, the present disclosure provides a vector comprising the recombinant nucleic acid molecule of the present disclosure. In some embodiments, the vector is an expression vector. In some embodiments, the expression vector is a viral vector. In some embodiments, the viral vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

[0034] In another aspect, provided herein is a recombinant cell comprising the chimeric polypeptide of the present disclosure, the recombinant nucleic acid of the present disclosure, the vector according to the present disclosure, or the STMD according to the present disclosure. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is an immune cell, a neuron, an epithelial cell, an endothelial cell, or a stem cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, a CD4+ T cell, a CD8+ T cell, or another T cell.

[0035] In some embodiments, the recombinant cell further comprises a nucleic acid sequence encoding a protein operably linked to a promoter, wherein expression of the protein is modulated by the transcriptional regulator of the chimeric polypeptide. In some embodiments, the protein is heterologous. In some embodiments, the protein is a cytokine, cytotoxin, chemokine, immunomodulator, pro-apoptotic factor, anti-apoptotic factor, hormone, differentiation factor, or de-differentiation factor.

[0036] In a further aspect, the present disclosure provides a pharmaceutical composition comprising a recombinant cell of the present disclosure.

[0037] In another aspect, further provided herein is a method for modulating the activity of a cell, comprising providing a recombinant cell of the present disclosure and contacting the recombinant cell with a selected ligand, wherein binding of the selected ligand to the extracellular binding domain induces cleavage of the ligand-inducible proteolytic cleavage site, releasing a transcriptional regulator, and the released transcriptional regulator modulates the activity of the recombinant cell. In some embodiments, the contacting step is performed in vivo, ex vivo, or in vitro.

[0038] In some embodiments, the cellular activity is selected from the group consisting of expression of a selected gene of the cell, proliferation of the cell, apoptosis of the cell, non-apoptotic death of the cell, differentiation of the cell, dedifferentiation of the cell, migration of the cell, secretion of a molecule from the cell, cell adhesion, and cytolytic activity of the cell. In some embodiments, the released transcriptional regulator modulates expression of a gene product of the cell. In some embodiments, the released transcriptional regulator modulates expression of a heterologous gene product. In some embodiments, the gene product of the cell is selected from the group consisting of a chemokine, a chemokine receptor, a chimeric antigen receptor, a cytokine, a cytokine receptor, a differentiation factor, a growth factor, a growth factor receptor, a hormone, a metabolic enzyme, a pathogen-derived protein, a proliferation inducer, a receptor, an RNA-guided nuclease, a site-specific nuclease, a T cell receptor, a toxin, a toxin-derived protein, a transcriptional activator, a transcriptional repressor, a translational regulator, a translational activator, a translational repressor, an activating immunoreceptor, an antibody, an apoptosis inhibitor, an apoptosis inducer, an engineered T cell receptor, an immune activator, an immune inhibitor, and an inhibitory immunoreceptor.

[0039] In some embodiments, the released transcriptional regulator modulates differentiation of a cell, and the cell is an immune cell, stem cell, progenitor cell, or precursor cell. In some embodiments, the administered recombinant cell modulates the activity of a target cell in an individual. In some embodiments, the target cell is a cancer cell. In some embodiments, the cancer cell is a solid tumor or a hematological malignancy cell. In some embodiments, the hematological malignancy cell is a multiple myeloma cell.

[0040] In a further aspect, the present disclosure provides a method for treating a health condition in an individual in need thereof, comprising administering to the individual a first therapeutic agent comprising an effective number of recombinant cells of the present disclosure, wherein the recombinant cells treat the disease in the individual. In some embodiments, the method further comprises administering to the individual a second therapeutic agent. In some embodiments, the second therapeutic agent is selected from the group consisting of a chemotherapeutic agent, a radiation therapeutic agent, an immunotherapeutic agent, a hormonal therapeutic agent, and a toxin therapeutic agent. In some embodiments, the first therapeutic and the second therapeutic agents are administered together in the same composition or in separate compositions. In some embodiments, the first therapeutic and the second therapeutic agents are administered simultaneously. In some embodiments, the first therapeutic and the second therapeutic agents are administered sequentially. In some embodiments, the first therapeutic agent is administered before the second therapeutic agent.

[0041] In another aspect, the present disclosure provides a method for inducing T cell signaling and gene regulation in a T cell, the method comprising: (a) providing a vector having a chimeric polypeptide of the present disclosure; and (b) transducing a T cell with the vector, wherein binding of a selected ligand to the extracellular ligand-binding domain of the chimeric polypeptide induces intracellular signaling and release of a transcriptional regulator.

[0042] In yet another aspect, provided herein is a system for modulating cellular activity, killing targeted cancer cells, or treating a disease in an individual in need thereof, the system comprising one or more of the following: a chimeric polypeptide, a recombinant nucleic acid molecule, a recombinant cell, a pharmaceutical composition, and a STMD of the present disclosure.

[0043] In a further aspect, the present disclosure provides a method for making a recombinant cell of the present disclosure, the method comprising providing a cell capable of protein expression and contacting the provided cell with a recombinant nucleic acid of the present disclosure.

[0044] In another aspect, the present disclosure provides use of one or more of the following: chimeric polypeptides, recombinant nucleic acid molecules, recombinant cells, and STMDs of the present disclosure, for the treatment of a disease. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid tumor or a hematological cancer. In some embodiments, the hematological cancer is multiple myeloma.

[0045] Also provided herein, in certain aspects, is the use of any of the inventions disclosed herein for the manufacture of a medicament for the treatment of a disease.

[0046] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the illustrative embodiments and features described herein, further aspects, embodiments, objects and features of the present disclosure will become more fully apparent from the drawings and detailed description, and the claims. [Brief explanation of the drawings]

[0047] [Figure 1] Figures 1A-1C show a schematic comparison between a first-generation SynNotch having a Notch-based regulatory region, a second-generation hinge-Notch having a hinge-based regulatory region, and a third-generation chimeric polypeptide of the present disclosure having an STMD.

[0048] [Figure 2]Figures 2A-2B schematically illustrate non-limiting examples of chimeric polypeptides according to some embodiments of the present disclosure. Figure 1A shows the schematic structure of an exemplary chimeric polypeptide disclosed herein (referred to as the GGO embodiment) having an anti-CD19 scFv extracellular domain (ECD) with a transmembrane domain composed of a series of valine residues (polyvaline STMD), a Notch2 juxtamembrane domain (JMD), and an intracellular domain containing a transcriptional regulator (TR) capable of regulating transcription of a BFP reporter gene. Figure 2B schematically summarizes the results of experiments on receptor activation in primary human CD3 T cells using a BFP reporter gene. These results demonstrate that a chimeric polypeptide having an STMD and engineered to bind to the B lymphocyte antigen CD19 can activate expression of a blue fluorescent protein BFP reporter gene when expressed in primary human CD3 T cells.

[0049] [Figure 3] Figure 3 shows the structure-based engineering and activation profiles of two embodiments of a chimeric polypeptide of the present disclosure having a polyvaline STMD (Figure 3A) and a modified polyvaline STMD engineered to contain two destabilizing GG residues that could potentially act as proteolytic cleavage sites for or mediate cleavage by gamma-secretase (Figure 3B). Reporter activation profiles for both embodiments show increased activation for receptors engineered with GG residues in the STMD.

[0050] [Figure 4] FIG. 4 shows a schematic illustration of an engineering strategy for testing the influence of the position of destabilizing GG residues within the polyvaline STMD.

[0051] [Figure 5]Figure 5 summarizes the results of experiments performed to demonstrate the effect of placing GG residues along the STMD toward the N-terminus of the chimeric polypeptide. These experiments demonstrate that receptor activation can be tunable in primary human CD3 T cells with K562 CD19 cells, even with placement of G residues toward the N-terminus and away from the C-terminus.

[0052] [Figure 6] Figure 6 summarizes the results of activation experiments performed to demonstrate the effect of GG residue placement along the C-terminus of the polyvaline STMD. These experiments demonstrate that receptor activation is tunable and increased when the G residue is moved toward the C-terminus in primary human CD3 T cells, including K562 CD19 cells. DETAILED DESCRIPTION OF THE INVENTION

[0053] Detailed Description of the Disclosure The present disclosure generally relates to a new class of chimeric polypeptides (e.g., receptors) engineered to modulate transcriptional regulation in a ligand-dependent manner while possessing a completely synthetic transmembrane domain (STMD). The new receptors disclosed herein (STMD receptors) do not require the Notch regulatory region or any naturally occurring heterologous transmembrane domains previously thought to be necessary for induced cleavage of type I transmembrane receptors. In some embodiments, the receptors disclosed herein include STMDs (polyvaline STMDs) that have a series of identical residues, such as a series of valines. In some embodiments, the receptors have a GG dipeptide that can act as a proteolytic cleavage site for gamma-secretase or other proteases. Binding of a ligand displayed on the target cell surface triggers proteolytic cleavage of the receptor, presumably along the GG residues, and releases a transcriptional regulator that modulates a custom transcriptional program in the cell. The present disclosure also provides compositions and methods useful for producing such receptors, nucleic acids encoding same, host cells genetically modified with these nucleic acids, and methods for modulating cellular activity and / or treating various diseases, such as cancer.

[0054] Receptors of the present disclosure can be rationally designed with tunable features for enhanced regulation of proteolytic processing and possibly other intramembrane protein-protein interactions.

[0055] As described in the Examples, the new STMD receptors disclosed herein have been tested and validated in primary human T cells. Those skilled in the art will readily understand after reading this disclosure that the STMD receptors disclosed herein can be engineered into various immune cell types for enhanced tumor differentiation and elimination, or engineered into cells for the control of autoimmunity and tissue regeneration. Thus, engineered cells, such as immune cells engineered to express one or more of the STMD receptors disclosed herein, are also within the scope of this disclosure.

[0056] The STMD receptors disclosed herein may have better activity than existing synNotch receptors and may be a more modular platform for engineering. While existing synNotch receptors can be engineered using ligand-binding domains such as scFvs and nanobodies, it has been difficult to use the native extracellular domains derived from the receptor / ligand on synNotch receptors. In contrast, some of the STMD receptors disclosed herein may be amenable to other types of ligand-binding domains, expanding the landscape of targetable diseases and tissues.

[0057] In the following detailed description, reference is made to the accompanying drawings, which form a part of this specification. In the drawings, like symbols generally identify like elements unless context dictates otherwise. The illustrative options set forth in the detailed description, drawings, and claims are not meant to be limiting. Other options may be used, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects, as generally described herein and illustrated in the figures, can be arranged, substituted, combined, and designed in a wide variety of different configurations, all of which are expressly contemplated and form a part of this application. definition

[0058] Unless otherwise defined, all terms of technology, notation, and other scientific or technical terms used herein are intended to have the meaning commonly understood by one of ordinary skill in the art to which this application pertains. In some instances, terms having commonly understood meanings are defined herein for clarity and / or ready reference, and the inclusion of such definitions herein should not necessarily be construed as indicating a substantial difference beyond that commonly understood in the art. Many of the techniques and procedures described and referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art.

[0059] The singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all of the following alternatives: "A," "B," "A or B," and "A and B."

[0060] The terms "administration" and "administering," as used herein, refer to the delivery of a bioactive composition or formulation by a route of administration, including, but not limited to, oral, intravenous, intraarterial, intramuscular, intraperitoneal, subcutaneous, intramuscular, and topical administration, or a combination thereof. This term includes, but is not limited to, administration by a medical professional and self-administration.

[0061] The terms "cancer" and "tumor" are used interchangeably herein. These terms refer to the presence of cells that possess characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. Cancer cells are often in the form of tumors, but such cells may exist alone in an animal subject or may be non-tumorigenic cancer cells, such as leukemia cells. These terms include solid tumors, soft tissue tumors, or metastatic lesions. As used herein, the term "cancer" includes pre-malignant as well as malignant cancers. In some embodiments, the cancer is a solid tumor, soft tissue tumor, or metastatic lesion.

[0062] The terms "cell," "cell culture," "cell line," "recombinant host cell," "recipient cell," and "host cell," as used herein, include the primary subject cell and any progeny thereof, regardless of the number of transfers.

[0063] The term "operably linked," as used herein, refers to a physical or functional connection between two or more elements, e.g., polypeptide or polynucleotide sequences, that allows them to operate in their intended manner. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (e.g., a promoter) is a functional association that allows expression of the polynucleotide of interest. In this sense, the term "operably linked" refers to the positioning of a regulatory region and a transcribed coding sequence such that the regulatory region is effective to regulate the transcription or translation of the coding sequence of interest. Thus, a promoter is in operably linked to a nucleic acid sequence if it is capable of mediating the transcription of that nucleic acid sequence. It should be understood that operably linked elements can be contiguous or non-contiguous. With respect to a polypeptide, "operably linked" refers to a physical connection (e.g., directly or indirectly linked) between amino acid sequences (e.g., different segments, modules, or domains) to provide the described activity of the polypeptide. In the present disclosure, various segments, regions, or domains of the disclosed chimeric polypeptides and STMD receptors can be operably linked to maintain proper folding, processing, targeting, expression, binding, and other functional properties of the polypeptides and receptors in cells. Unless otherwise specified, the various segments, regions, or domains of the disclosed chimeric polypeptides and STMD receptors are operably linked to each other. The operably linked segments, regions, or domains of the disclosed chimeric polypeptides and STMD receptors of the present disclosure can be contiguous or non-contiguous (e.g., can be linked to each other via a linker).

[0064] The term "percent identity," as used herein with respect to two or more nucleic acids or proteins, refers to two or more sequences or subsequences that are identical or have a specified percentage of the same nucleotides or amino acids (e.g., about 60% sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection. See, for example, the NCBI website at ncbi.nlm.nih.gov / BLAST. Such sequences are then said to be "substantially identical." This definition can also refer to or apply to the complement of a test sequence. This definition also includes sequences that have deletions and / or additions, as well as sequences that have substitutions. Sequence identity typically exists over a region that is at least about 20 amino acids or nucleotides in length, or over a region that is 10-100 amino acids or nucleotides in length, or over the entire length of a given sequence.

[0065] Where appropriate, sequence identity can be calculated using published techniques and widely available computer programs, such as the GCS program package (Devereux et al., Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, FASTA (Atschul et al., J. Molecular Biol. 215:403, 1990). Sequence identity can be measured using sequence analysis software, such as the Sequence Analysis Software Package, Genetics Computer Group, University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705), with its default parameters.

[0066] As used herein, unless otherwise specified, a "therapeutically effective amount" of a drug is an amount sufficient to provide a therapeutic benefit in the treatment or management of cancer, or to delay or minimize one or more symptoms associated with cancer. A therapeutically effective amount of a compound means an amount of a therapeutic agent, alone or in combination with other therapeutic agents, that provides a therapeutic benefit in the treatment or management of cancer. The term "therapeutically effective amount" can encompass an amount that improves overall treatment, reduces or avoids the symptoms or causes of cancer, or enhances the therapeutic effectiveness of another therapeutic agent. An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom(s) of a disease, which may also be referred to as a "therapeutically effective amount." A "reduction" of a symptom means a decrease in the severity or frequency of the symptom(s), or the elimination of the symptom(s). The exact amount of a composition that comprises a "therapeutically effective amount" will depend on the purpose of the treatment and can be determined by one of ordinary skill in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).

[0067] As used herein, "subject" or "individual" includes animals, e.g., humans (e.g., human subjects) and non-human animals. In some embodiments, a "subject" or "individual" is a patient under the care of a physician. Thus, a subject may be a human patient or individual who has, is at risk of, or is suspected of having a disease of interest (e.g., cancer) and / or one or more symptoms of the disease. A subject may also be an individual who has been diagnosed as being at risk for a condition of interest at the time of diagnosis or at a later time. The term "non-human animal" includes all vertebrates, e.g., mammals, e.g., rodents, e.g., mice, and non-mammals, e.g., non-human primates, e.g., sheep, dogs, cows, chickens, amphibians, reptiles, etc.

[0068] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value between the upper and lower limit of that range, to the tenth of the unit of the lower limit, and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in those smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of these limits, ranges excluding either or both of those included limits are also included within the disclosure.

[0069] Certain ranges are described herein using numerical values ​​preceded by the term "about." The term "about" is used herein to provide literal support for the exact number it precedes, as well as a number that is close to or approximately the number preceded by the term. In determining whether a number is close to or approximately a specifically recited number, the close or approximate unrecited number may be a number that, in the context in which it is presented, provides a substantial equivalent to the specifically recited number.

[0070] As will be understood by those skilled in the art, for any and all purposes, e.g., with respect to providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations thereof. Any recited range can be readily recognized as fully describing and enabling the same range to be divided into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily divided into a lower third, middle third, and upper third, etc. As will also be understood by those skilled in the art, all language, e.g., "up to," "at least," "greater than," "less than," etc., includes the recited numbers and refers to a range that can be subsequently divided into subranges as discussed above. Finally, as will be understood by those skilled in the art, a range includes each individual number. Thus, for example, a group having 1 to 3 items refers to a group having 1, 2, or 3 items. Similarly, a group having 1 to 5 items refers to a group having 1, 2, 3, 4, or 5 items, etc.

[0071] Aspects and embodiments of the present disclosure described herein are understood to include "comprising," "consisting of," and "consisting essentially of" aspects and embodiments. As used herein, "comprising" is synonymous with "including," "containing," or "characterized by" and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, "consisting of" excludes any element, step, or ingredient not specified in the claimed composition or method. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. In particular, any recitation herein of the term "comprising," in a description of a component of a composition or in a description of a step of a method, is understood to encompass compositions and methods that consist essentially of and consist of the recited components or steps.

[0072] Headings, e.g., (a), (b), (i), etc., are provided solely to facilitate the reading of the specification and claims. The use of headings in the specification and claims does not require that the steps or elements be performed in alphabetical or numerical order or in the order in which they are presented.

[0073] It is understood that certain features of the present disclosure that are described for clarity in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, various features of the present disclosure that are described for brevity in the context of a single embodiment may also be provided separately or in any suitable subcombination. All combinations of the embodiments of the present disclosure are specifically embraced by the present disclosure and are disclosed herein as if each and every combination were individually and expressly disclosed. Furthermore, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein as if each and every such subcombination were individually and expressly disclosed herein. Compositions of the present disclosure Chimeric Polypeptides

[0074] As described in more detail below, the present disclosure provides a new class of chimeric polypeptides engineered to modulate transcriptional regulation in a ligand-dependent manner, with various advantages over existing receptors, including the ability to associate additional signaling chains via charged residues.

[0075] Thus, the present disclosure provides a chimeric polypeptide comprising: (a) an extracellular ligand-binding domain (ECD) having binding affinity for a selected ligand; (b) a synthetic transmembrane domain (STMD) having one or more ligand-inducible proteolytic cleavage sites; and (c) an intracellular domain (ICD) comprising a transcription regulator (TR), wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site and release of the transcription regulator. Extracellular domain

[0076] In some embodiments, the chimeric polypeptides and extracellular domains of the STMD receptors disclosed herein have binding affinity to one or more target ligands. In principle, there is no particular limitation on suitable ligands that can be targeted. In some embodiments, the target ligand is a cell surface ligand. Non-limiting examples of suitable ligands include cell surface receptors, adhesion proteins, integrins, mucins, and lectins. In some embodiments, the ligand is a protein. In some embodiments, the ligand is a carbohydrate.

[0077] In some embodiments, the extracellular domain of the disclosed chimeric polypeptides and STMD receptors can bind to, e.g., have binding affinity for, a tumor-associated antigen (TAA) or tumor-specific antigen (TSA). The term "tumor-associated antigen" or "TAA" generally refers to a molecule, e.g., a protein, that is present on tumor cells and normal cells, or that is present on many normal cells but at much lower concentrations than on tumor cells. In contrast, the term "tumor-specific antigen" or "TSA" generally refers to a molecule, e.g., a protein, that is present on tumor cells but not on normal cells.

[0078] In some embodiments, the extracellular domain comprises a ligand-binding portion of a receptor. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody or functional antigen-binding fragment thereof. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, nanobody, diabody, triabody, or minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv.

[0079] An antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, such as binding affinity. Generally, the binding affinity of an antigen-binding portion, e.g., an antibody, to a target antigen (e.g., a CD19 antigen) can be calculated by the Scatchard method described by Frankel et al., Mol. Immunol, 16: 101-106, 1979. In some embodiments, binding affinity may be measured by the antigen / antibody dissociation rate. In some embodiments, binding affinity may be measured by competitive radioimmunoassay. In some embodiments, binding affinity may be measured by ELISA. In some embodiments, antibody affinity may be measured by flow cytometry. An antibody that "selectively binds" to an antigen (e.g., CD19) is an antigen-binding portion that binds to the antigen with high affinity and does not significantly bind to other unrelated antigens.

[0080] In general, there are no particular limitations regarding suitable antigens that can be targeted by the chimeric polypeptides and STMD receptors disclosed herein. Non-limiting examples of suitable target antigens include CD19, B7H3 (CD276), BCMA, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, ephrin B2, FAP, and FLT. These include 3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-beta, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, BCMA (CD269), ALPI, citrullinated vimentin, cMet, and Axl.

[0081] Additional antigens that may be suitable for the chimeric polypeptides and STMD receptors disclosed herein include, but are not limited to, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7-H3), IL-13-receptor alpha 1, IL-13-receptor alpha 2, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA). Other suitable target antigens include, but are not limited to, tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), gross cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan-A (melanoma antigen recognized by T lymphocytes; MART-1), myo-D1, muscle-specific actin (MSA), neurofilament, neuron-specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, and thyroid transcription factor-1.

[0082] Additional antigens suitable for the chimeric polypeptides and STMD receptors disclosed herein include, but are not limited to, pyruvate kinase isozyme type M2 (tumor M2-PK), CD19, CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CD1a, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, kappa light chain, lambda light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and its isovariants, TEM-8, sperm protein 17 (Sp17), and mesothelin. Further non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternate reading frame protein), Trp-p8, STEAP1 (prostate six-transmembrane epithelial antigen 1), aberrant ras protein, aberrant p53 protein, integrin β3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), and Ral-B. In some embodiments, the antigen is glypican 2 (GPC2), CD19, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7-H3), or IL-13-receptor alpha.

[0083] In some embodiments, the chimeric polypeptides and STMD receptors disclosed herein comprise an extracellular domain comprising an antigen-binding portion that binds to CD19, CEA, HER2, MUC1, CD20, or EGFR. In some embodiments, the chimeric polypeptides and STMD receptors disclosed herein comprise an extracellular domain comprising an antigen-binding portion that binds to CD19. In some embodiments, the antigen-binding portion comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to one or more of SEQ ID NO: 26 in the Sequence Listing. In some embodiments, the antigen-binding portion comprises an amino acid sequence having 100% sequence identity to one or more of SEQ ID NOs: 12-22 in the Sequence Listing.

[0084] In some embodiments of the chimeric polypeptides of the present disclosure, the ligand is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD 181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placenta-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), and signal regulatory protein alpha (SIRPα).

[0085] In some embodiments, the ligand comprises a protein or a carbohydrate.

[0086] In some embodiments, the ligand is selected from a cell surface receptor, an adhesion protein, an integrin, a mucin, a lectin, a tumor-associated antigen, and a tumor-specific antigen. Synthetic Transmembrane Domains (STMDs)

[0087] The present disclosure provides STMDs and chimeric polypeptides comprising the STMDs. Generally, suitable transmembrane domains for the chimeric polypeptides and STMD receptors disclosed herein can be synthetic (STMDs). In some embodiments, the STMDs comprise one or more alanine, leucine, or valine residues, or a combination thereof. In some embodiments, the STMDs comprise only valine residues. In some embodiments, the STMDs comprise one or more valine residues. In some embodiments, the STMDs comprise a series of at least five valine residues. In some embodiments, the STMDs comprise between 1 and 35 valine residues, between 5 and 30 valine residues, between 10 and 25 valine residues, between 15 and 20 valine residues, or between 15 and 25 valine residues.

[0088] In some embodiments, the STMD comprises at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 valine residues.

[0089] In some embodiments, the STMD consists of a valine residue (example GG0, encoded by SEQ ID NO: 2 in the Sequence Listing).

[0090] In some embodiments, the STMD may further comprise a glycine residue. In some embodiments, the STMD may further comprise two or more glycine residues. In some embodiments, the STMD comprises two consecutive glycine residues (i.e., diglycine or GG). In some embodiments, GG is located at any one of positions 1-20, 1-25, or 1-30 of the polyvaline TMD, with position 30 being closer to the C-terminus of the chimeric polypeptide than position 1. In some embodiments, GG is at position 1 (GG1), 2 (GG2), 3 (GG3), 4 (GG1), 5 (GG5), 6 (GG6), 7 (GG7), 8 (GG8), 9 (GG9), 10 (GG10), 11 (GG11), 12 (GG12), 13 (GG13), 14 (GG14), 15 (GG15), 16 (GG16), 17 (GG17), 18 (GG18), 19 (GG19), or 20 (GG20).

[0091] An STMD may comprise an amino acid sequence encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:27, or SEQ ID NO:30, or a functional variant of any of them.

[0092] An STMD may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, or a functional variant of any of them.

[0093] In some embodiments, the STMD of the present disclosure is GG0, encoded by SEQ ID NO: 2. In some embodiments, the STMD is any one of the GG1-GG20 receptors (SEQ ID NO: 34-SEQ ID NO: 55). GG1-GG20 (GGX) are the same as GG0 except for having GG substitutions at numbered positions X and X+1 within the polyvaline TMD.

[0094] The STMD may comprise an amino acid sequence identical to SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, or a functional variant thereof.

[0095] The STMD of the present disclosure can comprise a ligand-inducible proteolytic cleavage site. In some embodiments, binding of a selected ligand to the extracellular ligand-binding domain of a chimeric polypeptide of the present disclosure induces cleavage at the ligand-inducible proteolytic cleavage site on the STMD and release of the transcriptional regulator. Linker

[0096] The various domains of the chimeric polypeptide and STMD receptor of the present disclosure can be directly fused to each other or can be operably linked to each other via a linker. In some embodiments, at least two of the polypeptide segments are directly linked to each other via at least one covalent bond. In some embodiments, at least two of the polypeptide segments are directly linked to each other via at least one peptide bond. In some embodiments, at least two of the polypeptide segments are operably linked to each other via a linker. There are no particular limitations on the linkers that can be used in the chimeric polypeptides described herein. In some embodiments, the linker is a synthetic compound linker, such as a chemical crosslinker. Non-limiting examples of suitable commercially available cross-linkers include N-hydroxysuccinimide (NHS), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl)suberate (BS3), dithiobis(succinimidyl propionate) (DSP), dithiobis(sulfosuccinimidyl propionate) (DTSSP), ethylene glycol bis(succinimidyl succinate) (EGS), ethylene glycol bis(sulfosuccinimidyl succinate) (sulfo-EGS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo-DST), bis[2-(succinimidooxycarbonyloxy)ethyl]sulfone (BSOCOES), and bis[2-(sulfosuccinimidooxycarbonyloxy)ethyl]sulfone (sulfo-BSOCOES).

[0097] The linker may also be a linker peptide sequence. Thus, in some embodiments, at least two of the polypeptide segments are operably linked to each other via a linker peptide sequence. In principle, there are no particular limitations on the length and / or amino acid composition of the linker peptide sequence. In some embodiments, any random single-chain peptide containing about 1 to 100 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as a peptide linker. In some embodiments, the linker peptide sequence contains about 5 to 50, about 10 to 60, about 20 to 70, about 30 to 80, about 40 to 90, about 50 to 100, about 60 to 80, about 70 to 100, about 30 to 60, about 20 to 80, or about 30 to 90 amino acid residues. In some embodiments, the linker peptide sequence comprises about 1-10, about 5-15, about 10-20, about 15-25, about 20-40, about 30-50, about 40-60, or about 50-70 amino acid residues. In some embodiments, the linker peptide sequence comprises about 40-70, about 50-80, about 60-80, about 70-90, or about 80-100 amino acid residues. In some embodiments, the linker peptide sequence comprises about 1-10, about 5-15, about 10-20, or about 15-25 amino acid residues. Juxtamembrane domain

[0098] In some embodiments, the chimeric polypeptides and STMD receptors of the present disclosure comprise a juxtamembrane domain (JMD). In these examples, the term "juxtamembrane domain" generally refers to a flexible polypeptide connector region located between the STMD domain and the intracellular domain (ICD) in the chimeric polypeptides and STMD receptors disclosed herein. In some embodiments, the JMD is operably linked downstream of the STMD domain and upstream of the ICD domain. In principle, there are no particular limitations regarding the length and / or amino acid composition of the JMD. In some embodiments, any random single-chain peptide containing about 1 to about 300 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as a JMD. In some embodiments, the JMD comprises about 5-50, about 10-60, about 20-70, about 30-80, about 40-90, about 50-100, about 60-120, about 70-150, about 100-200, about 150-250, about 200-300, about 30-60, about 20-80, or about 30-90 amino acid residues. In some embodiments, the JMD comprises about 1-10, about 50-100, about 100-150, about 150-200, about 200-300, about 20-80, about 40-120, or about 200-250 amino acid residues. In some embodiments, the JMD comprises about 40-70, about 50-80, about 60-80, about 70-90, or about 80-100 amino acid residues. In some embodiments, the JMD comprises about 1-10, about 5-15, about 10-20, or about 15-25 amino acid residues. In some embodiments, the JMD comprises about 220, 225, 230, 235, or 240 amino acid residues. In some embodiments, the JMD comprises 229 amino acid residues. In some embodiments, the length and amino acid composition of the JMD can be optimized to vary the orientation and / or proximity of the STMD and ICD domains relative to each other to achieve the desired activity of the chimeric polypeptide and STMD receptor.In some embodiments, the orientation and / or proximity of the JMD and ICD domains relative to each other can be varied and / or optimized as a "tuning" tool or effect to enhance or reduce the effectiveness of the chimeric polypeptide and STMD receptor.

[0099] In some embodiments, the JMD is the Notch 2 JMD. In some embodiments, the JMD comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 28 in the Sequence Listing. In some embodiments, the transmembrane domain comprises an amino acid sequence having 100% sequence identity to SEQ ID NO: 28 in the Sequence Listing. In some embodiments, the JMD is a polybasic domain similar to the Notch 2 JMD. In some embodiments, the polybasic domain comprises an amino acid sequence in which the majority of residues (i.e., at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) are lysine and / or arginine and / or histidine and / or any combination thereof. Hinge domain

[0100] In some embodiments, the chimeric polypeptides or STMD receptors of the present disclosure may include a hinge domain. In these examples, the term "hinge domain" generally refers to a flexible polypeptide connector region located between the targeting moiety and the transmembrane domain. These sequences are generally derived from IgG subclasses (e.g., IgG1 and IgG4), IgD, and CD8 domains, of which IgG1 has been most widely used. In some embodiments, the hinge domain provides structural flexibility to adjacent polypeptide regions. The hinge domain may be composed of a natural or synthetic polypeptide. It will be understood by those skilled in the art that the hinge domain may improve the function of the chimeric polypeptide or STMD receptor by promoting optimal positioning of the antigen-binding moiety in relation to the portion of the antigen recognized thereby. It will be understood that in some embodiments, the hinge domain may not be required for optimal chimeric polypeptide or STMD receptor activity. In some embodiments, a beneficial hinge domain comprising a short sequence of amino acids enhances chimeric polypeptide or STMD receptor activity by facilitating antigen binding, for example, by relieving any steric constraints that may otherwise alter antibody binding kinetics. The sequence encoding the hinge domain may be located between the antigen recognition portion and the transmembrane domain, hi some embodiments, the hinge domain is operably linked downstream of the antigen binding portion and upstream of the transmembrane domain.

[0101] In some embodiments, the hinge domain is a CD8α hinge domain. In some embodiments, the hinge domain is a truncated CD8α hinge domain. In some embodiments, the CD8α hinge domain comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 56 in the Sequence Listing. In some embodiments, the transmembrane domain comprises an amino acid sequence having 100% sequence identity to SEQ ID NO: 56 in the Sequence Listing. In some embodiments, the truncated CD8α hinge domain is encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 55, or any value therebetween, or is a functional variant thereof. Intracellular domain

[0102] In some embodiments, the chimeric polypeptide or STMD receptor of the present disclosure comprises an intracellular domain (ICD). The intracellular domain may have intracellular biological activity. The ICD may comprise a transcriptional regulator. The transcriptional regulator of the present disclosure is a polypeptide element that acts to activate or inhibit the transcription of a promoter-driven DNA sequence. Transcriptional regulators suitable for the compositions and methods of the present disclosure may be naturally occurring transcriptional regulators or may be engineered, designed, or modified to provide desired and / or improved properties, such as transcriptional modulation. As discussed above, the engineered receptors of the present disclosure are advantageous in that they can provide the ability to induce custom transcriptional programs in engineered cells. In some embodiments, the transcriptional regulator of the present disclosure is a custom transcriptional regulator that drives the transcription of a specific sequence that appears only once in the engineered cell.

[0103] In some embodiments, the transcriptional regulator directly regulates cell differentiation. In some embodiments, the transcriptional regulator indirectly modulates (e.g., regulates) cell differentiation by modulating the expression of a second transcription factor. It will be understood by those skilled in the art that the transcriptional regulator can be a transcriptional activator or a transcriptional repressor. In some embodiments, the transcriptional regulator is a transcriptional repressor. In some embodiments, the transcriptional regulator is a transcriptional activator. In some embodiments, the transcriptional regulator may further comprise a nuclear localization signal. In some embodiments, the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the transcriptional regulator is Gal4-VP64.

[0104] The chimeric polypeptides and STMD receptors of the present disclosure may be chimeric polypeptides of any length, generally between about 100 amino acids (aa) and about 1000 aa, including chimeric polypeptides of, for example, about 100 aa to about 200 aa, about 150 aa to about 250 aa, about 200 aa to about 300 aa, about 250 aa to about 350 aa, about 300 aa to about 400 aa, about 350 aa to about 450 aa, or about 400 aa to about 500 aa. In some embodiments, the disclosed chimeric polypeptides generally have a length of between about 400 aa and about 450 aa, about 450 aa and about 500 aa, about 500 aa and about 550 aa, about 550 aa and about 600 aa, about 600 aa and about 650 aa, about 650 aa and about 700 aa, about 700 aa and about 750 aa, about 750 aa and about 800 aa, about 800 aa and about 850 aa, about 850 aa and about 900 aa, about 900 aa and about 950 aa, or about 950 aa and about 1000 aa. In some examples, the disclosed chimeric polypeptides have a length of between about 300 aa and about 400 aa. In some examples, the disclosed chimeric polypeptides have a length of between about 300 aa and about 350 aa. In some examples, the chimeric polypeptides of the present disclosure have a length of about 300 aa to about 325 aa. In some examples, the chimeric polypeptides of the present disclosure have a length of about 350 aa to about 400 aa. In some examples, the chimeric polypeptides of the present disclosure have a length of 750 aa to 850 aa. In some embodiments, the chimeric polypeptides of the present disclosure have a length of about 525 aa, about 538 aa, about 539 aa, about 542 aa, about 550 aa, about 556 aa, or about 697 aa. nucleic acid

[0105] In one aspect, some embodiments disclosed herein relate to nucleic acid molecules, including expression cassettes, that contain nucleotide sequences encoding the chimeric polypeptides and STMD receptors of the present disclosure, and expression vectors containing these nucleic acid molecules operably linked to heterologous nucleic acid sequences.

[0106] The present disclosure includes compositions and methods for introducing chimeric polypeptide-based components into cells. Nucleic acid can be introduced into cells by several methods, including those described in many standard laboratory manuals, such as Davis et al., Basic methods in molecular biology, (1986); Sambrook et al., Molecular cloning: A laboratory manual 2nd Ed., Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY (1989); and Kim and Eberwine, Mammalian cell transfection: the present and the future (2010), such as calcium phosphate transfection, DEAE-dextran-mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, nucleoporation, hydrodynamic shock and infection.

[0107] The present disclosure includes methods in which different chimeric polypeptide or receptor components are introduced into cells by different means, as well as compositions for carrying out such methods. For example, lentiviral vectors can be used to introduce chimeric polypeptide-based component-encoding nucleic acids by transfection.

[0108] In most instances, the chimeric polypeptide or receptor component is introduced into a cell in a manner that results in the production of the chimeric polypeptide by the cell. Thus, if the cell expresses the chimeric polypeptide protein, the cell has been transfected with a chimeric polypeptide-encoding nucleic acid operably linked to a promoter, which is then integrated, for example, into a chromosome.

[0109] Transfection agents suitable for use with the present disclosure include transfection agents that facilitate the introduction of RNA, DNA, and proteins into cells. Exemplary transfection reagents include TurboFect Transfection Reagent (Thermo Fisher Scientific), Pro-Ject Reagent (Thermo Fisher Scientific), TRANSPASS™ P Protein Transfection Reagent (New England Biolabs), CHARIOT™ Protein Delivery Reagent (Active Motif), PROTEOJUICE™ Protein Transfection Reagent (EMD Millipore), 293fectin, LcIPOFECTAMINE™ 2000, LIPOFECTAMINE™ 3000 (Thermo Fisher Scientific), LIPOFECTAMINE™ (Thermo Fisher Scientific), LIPOFECTIN™ (Thermo Fisher Scientific), DMRIE-C, CELLFECTIN™ (Thermo Fisher Scientific), OLIGOFECTAMINE™ (Thermo Fisher Scientific). Scientific), LIPOFECTACE(TM), FUGENE(TM)(Roche, Basel, Switzerland), FUGENE(TM) HD(Roche), TRANSFECTAM(TM)(Transfectam, Promega, Madison, Wis.), TFX-10(TM)(Promega), T FX-20(TM)(Promega), TFX-50(TM)(Promega), TRANSFECTIN(TM)(BioRad, Hercules, Calif.), SILENTFECT(TM)(Bio-Rad), Effectene(TM)(Qiagen, Valencia, Calif.), DC-chol(Avanti Polar Lipids), GENEPORTER(TM) (Gene Therapy Systems, San Diego, Calif.).), DHARMAFECT 1™ (Dharmacon, Lafayette, Colo.), DHARMAFECT 2™ (Dharmacon), DHARMAFECT 3™ (Dharmacon), DHARMAFECT 4™ (Dharmacon), ESCORT™ III (Sigma, St. Louis, Mo.), and ESCORT™ IV (Sigma Chemical Co.).

[0110] The present disclosure further includes methods in which one molecule is introduced into a cell, followed by another molecule. Thus, more than one chimeric polypeptide or receptor component can be introduced into a cell at the same time or at different times. For example, the present disclosure includes a method in which a chimeric polypeptide or STMD receptor-encoding nucleic acid is introduced into a cell while the cell is contacted with a transfection reagent (e.g., TurboFect Transfection Reagent) designed to facilitate the introduction of nucleic acids into the cell, after which the cell is washed, and then another chimeric polypeptide component is introduced while the cell is contacted with, for example, LIPOFECTAMINE™ 2000.

[0111] Additionally and / or alternatively, the introduction of nucleic acids into cells can be achieved using viral transduction methods. Transduction does not require physical contact between the DNA-donating and DNA-receiving cells and is DNase-resistant. Adeno-associated virus (AAV) is a non-enveloped virus that can be engineered to deliver nucleic acids to target cells via viral transduction. Therefore, the ability to generate AAV particles that lack any viral genes and contain nucleic acid sequences of interest for various therapeutic applications has largely proven to be one of the safest strategies for gene therapy. Several AAV serotypes have been described, and all known serotypes are capable of infecting cells from multiple diverse tissue types. AAV is capable of transducing a wide range of species and tissues in vivo without evidence of toxicity and generates relatively mild innate and adaptive immune responses.

[0112] Lentiviral systems are also suitable for nucleic acid delivery and gene therapy via viral transduction.Lentiviral vectors offer several attractive properties as gene delivery vehicles, including: (i) sustained gene delivery through stable vector integration into host genome; (ii) ability to infect both dividing and non-dividing cells; (iii) broad tissue tropism, including important gene therapy and cell therapy target cell types; (iv) no viral protein expression after vector transduction; (v) ability to deliver complex genetic elements, such as polycistronic or intron-containing sequences; (vi) potentially safer integration site profile; and (vii) a relatively easy system for vector manipulation and production.

[0113] By way of example, the present disclosure includes a method in which a chimeric polypeptide-encoding nucleic acid is introduced into cells using an expression cassette or expression vector, e.g., a viral vector. Viral vectors can be produced according to methods described in the art, for example, in Watson and Wolfe et al. Transduction of target cells can be carried out for approximately 2 hours using the vector at the desired cell number and multiplicity of infection (MOI) in appropriate medium. Cells can be prepared so that they are growing exponentially and are 70-80% confluent or less before transduction. Cells can be added to wells of a 96-well plate in fresh medium and then incubated at 37°C in a humidified incubator. Lentiviral vectors can be added to the appropriate wells, gently mixed, and incubated at 37°C in a humidified incubator. Due to concerns about the toxicity of lentiviral vectors, cells can be incubated for 2-4 hours before replacing the medium containing the lentiviral vector (Nasri et al.).

[0114] Disclosed herein are nucleic acid molecules encoding the chimeric polypeptide system components of the present disclosure, expression cassettes and expression vectors containing these nucleic acid molecules operably linked to regulatory sequences that allow for expression of the chimeric polypeptide system components in host cells or ex-vivo cell-free expression systems.

[0115] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably herein and refer to both RNA and DNA molecules, including nucleic acid molecules including cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules containing nucleic acid analogs. Nucleic acid molecules can be double-stranded or single-stranded (e.g., sense or antisense strands). Nucleic acid molecules can contain unconventional or modified nucleotides. The terms "polynucleotide sequence" and "nucleic acid sequence," as used herein, interchangeably refer to the sequence of a polynucleotide molecule. The nomenclature for nucleotide bases set forth in 37 CFR §1.822 is used herein.

[0116] Nucleic acid molecules of the present disclosure can be of any length, generally between about 5 Kb and about 50 Kb, e.g., between about 5 Kb and about 40 Kb, between about 5 Kb and about 30 Kb, between about 5 Kb and about 20 Kb, or between about 10 Kb and about 50 Kb, about 15 Kb to about 30 Kb, about 20 Kb to about 50 Kb, about 20 Kb to about 40 Kb, about 5 Kb to about 25 Kb, or about 30 Kb to about 50 Kb.

[0117] In some embodiments, the nucleic acid molecule encodes a polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to the first or second polypeptide chain of a chimeric polypeptide disclosed herein. In some embodiments, the nucleic acid molecule encodes a single-chain polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of the amino acid sequences identified in the Sequence Listing. In some embodiments, the nucleic acid molecule encodes a polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of the chimeric polypeptide amino acid sequences identified in the Sequence Listing. In some embodiments, a nucleic acid molecule of the present disclosure encodes a single-chain polypeptide having an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 59 through 79.

[0118] Some embodiments disclosed herein relate to vectors or expression cassettes containing recombinant nucleic acid molecules encoding the chimeric polypeptides disclosed herein. Expression cassettes generally contain a coding sequence and sufficient regulatory information to direct the appropriate transcription and / or translation of the coding sequence in recipient cells in vivo and / or ex vivo. The expression cassette can be inserted into a vector for targeting to a desired host cell and / or subject. The expression cassette can be inserted into a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, or phage as a linear or circular, single-stranded or double-stranded, DNA or RNA polynucleotide molecule from any source, capable of genome integration or autonomous replication, containing one or more nucleic acid sequences linked in a functional manner, i.e., operably linked nucleic acid molecules.

[0119] Also provided herein are vectors, plasmids, or viruses containing one or more of the nucleic acid molecules encoding any chimeric polypeptide disclosed herein.The nucleic acid molecules can be contained in a vector that can direct their expression in cells transformed / transduced with the vector, for example.Vectors suitable for use in eukaryotic and prokaryotic cells are known in the art, commercially available, or easily prepared by those skilled in the art.Additional vectors can also be found, for example, in Ausubel, FM, et al., Current Protocols in Molecular Biology, New York, NY: Wiley (including supplements up to 2014), and Sambrook, J., & Russell, DW (2012).Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russell, DW (2001).

[0120] In some embodiments, the chimeric polypeptide components are expressed from a vector, e.g., an expression vector. The vector is useful for autonomous replication in a host cell or can be integrated into the genome of the host cell, thereby replicating along with the host genome (e.g., a non-episomal mammalian vector). Expression vectors are capable of directing the expression of coding sequences to which they are operably linked. Generally, expression vectors are often in the form of plasmids. However, other forms of expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses), are also included. Exemplary recombinant expression vectors may include one or more regulatory sequences operably linked to the nucleic acid sequence to be expressed, selected based on the host cell to be used for expression.

[0121] DNA vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (2001, supra) and other standard molecular biology laboratory manuals.

[0122] The nucleic acid sequence encoding chimeric polypeptide can be optimized for expression in a target host cell.For example, the GC content of the sequence can be adjusted to be the same level as the average for a given cell host, calculated by referring to the known genes expressed in the host cell.Methods for codon optimization are known in the art.The codon usage in the coding sequence of the chimeric polypeptide disclosed herein can be optimized to enhance expression in a host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75% or up to 100% of the codons in the coding sequence are optimized for expression in a specific host cell.

[0123] Suitable vectors for use include T7-based vectors for use in bacteria, pMSXND expression vectors for use in mammalian cells, and baculovirus-derived vectors for use in insect cells.

[0124] Viral vectors that can be used in the present disclosure include, for example, retroviral vectors, adenoviral vectors and adeno-associated viral vectors, lentiviral vectors, herpesvirus, simian virus 40 (SV40), and bovine papillomavirus vectors (see, e.g., Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, NY).

[0125] Viral vectors can include the modified pHR'SIN:CSW vector (SEQ ID NO: 1) used for lentiviral transduction and receptor expression. The chimeric polypeptides of the present disclosure can be inserted into the BamHI (GGATCC) site downstream of the PGK promoter sequence by in-fusion cloning (Clontech).

[0126] The exact components of the expression system are not critical. For example, the chimeric polypeptides disclosed herein can be produced in prokaryotic hosts, such as bacteria, E. coli, or eukaryotic hosts, such as insect cells (e.g., Sf21 cells) or mammalian cells (e.g., COS cells, NIH 3T3 cells, or HeLa cells). These cells are available from many sources, including the American Type Culture Collection (Manassas, Va.). When selecting an expression system, it is only important that the components are compatible with each other. Those skilled in the art can make such decisions. Furthermore, if guidance is needed in selecting an expression system, those skilled in the art can consult Ausubel et al. (Current Protocols in Molecular Biology, John Wiley and Sons, New York, NY, 1993) and Pouwels et al. (Cloning Vectors: A Laboratory Manual, 1985 Suppl. 1987).

[0127] The expressed antibodies can be purified from the expression system using conventional biochemical procedures and can be used, for example, as therapeutic agents, as described herein.

[0128] In some embodiments, the resulting chimeric polypeptide or STMD receptor is glycosylated or non-glycosylated, depending on the host organism used to produce the chimeric polypeptide. If a bacterium is selected as the host, the produced chimeric polypeptide will be non-glycosylated. On the other hand, eukaryotic cells will glycosylate the chimeric polypeptide, but perhaps not in the same manner as the native polypeptide. Recombinant antibodies produced by the transformed host can be purified according to any suitable method known in the art. The produced recombinant antibodies can be isolated from inclusion bodies produced in bacteria such as E. coli, or from conditioned medium from either mammalian or yeast cultures producing the chimeric polypeptides of the present disclosure using cation exchange, gel filtration, and / or reverse-phase liquid chromatography.

[0129] Additionally or alternatively, another exemplary method for constructing a DNA sequence encoding a chimeric polypeptide of the present disclosure is by chemical synthesis. This includes directly synthesizing a peptide by chemical means an amino acid sequence encoding a chimeric polypeptide exhibiting the described properties. This method can incorporate both natural and unnatural amino acids at positions that affect the binding affinity of the chimeric polypeptide to a target protein. Alternatively, a gene encoding a desired chimeric polypeptide can be synthesized by chemical means using an oligonucleotide synthesizer. Such oligonucleotides are designed based on the amino acid sequence of the desired chimeric polypeptide, preferably selecting codons that are preferred in the host cell in which the chimeric polypeptide of the present disclosure will be produced. In this regard, it is well recognized in the art that the genetic code is degenerate, such that an amino acid can be coded for by more than one codon. For example, Phe (F) is coded for by two codons, TIC or TTT, Tyr (Y) is coded for by TAC or TAT, and his (H) is coded for by CAC or CAT. Trp (W) is coded for by a single codon, TGG. Therefore, it is understood by those skilled in the art that for a given DNA sequence that encodes a particular chimeric polypeptide, there are many degenerate DNA sequences that encode the chimeric polypeptide.For example, in addition to the DNA sequence for the chimeric polypeptide provided herein, it is understood that there are many degenerate DNA sequences that encode the chimeric polypeptide disclosed herein.These degenerate DNA sequences are considered to be within the scope of the present disclosure.Therefore, in the context of the present disclosure, "degenerate variants thereof" refers to all DNA sequences that code a particular chimeric polypeptide, thereby enabling the expression of the particular chimeric polypeptide.

[0130] Whether prepared by site-directed mutagenesis, chemical synthesis, or other methods, the DNA sequence encoding the subject chimeric polypeptide may also contain a DNA sequence encoding a signal sequence. If present, such a signal sequence should be a sequence recognized by the cell selected for expression of the chimeric polypeptide. This may be prokaryotic, eukaryotic, or a combination of the two. Generally, the inclusion of a signal sequence depends on whether it is desired to secrete the chimeric polypeptide disclosed herein from the recombinant cell in which it is produced. If the selected cell is prokaryotic, it is generally preferred that the DNA sequence does not encode a signal sequence. If the selected cell is eukaryotic, it is generally preferred that a signal sequence be included.

[0131] The provided nucleic acid molecules may contain naturally occurring sequences, or due to the degeneracy of the genetic code, sequences that are different from those that occur in nature may encode the same polypeptide, for example, an antibody. These nucleic acid molecules may be composed of RNA or DNA (e.g., genomic DNA, cDNA, or synthetic DNA, such as those produced by phosphoramidite-based synthesis), or a combination or modification of nucleotides within these types of nucleic acids. Furthermore, nucleic acid molecules may be double-stranded or single-stranded (e.g., either the sense or antisense strand).

[0132] Nucleic acid molecules are not limited to sequences that code for polypeptides (e.g., antibodies); they can also include some or all of the non-coding sequences upstream or downstream of the coding sequence (e.g., the coding sequence of a chimeric polypeptide).Those skilled in the art of molecular biology are familiar with conventional procedures for isolating nucleic acid molecules.They can be produced, for example, by treating genomic DNA with restriction endonucleases or by carrying out polymerase chain reaction (PCR).If the nucleic acid molecule is ribonucleic acid (RNA), the molecule can be produced, for example, by in vitro transcription.

[0133] Exemplary isolated nucleic acid molecules of the present disclosure can include fragments not found in nature. Thus, the present disclosure encompasses recombinant molecules, e.g., those in which a nucleic acid sequence (e.g., a sequence encoding a chimeric polypeptide disclosed herein) has been incorporated into a vector (e.g., a plasmid or viral vector) or into the genome of a heterologous cell (or the genome of a homologous cell at a location other than its natural chromosomal location).

[0134] Provided herein are methods for incorporating one or more nucleic acids encoding one or more chimeric polypeptides of the present disclosure into the genome of a heterologous cell. Such methods preferably involve homology-directed recombination (HDR), which requires the introduction of a double-strand break (DSB) at a target genomic location using a specifically designed endonuclease or nickase. A "donor" nucleic acid comprising one or more chimeric polypeptides is then introduced into the genome of the cell by HDR.

[0135] As used herein, "donor" nucleic acid is used interchangeably and refers to a nucleic acid that corresponds to a fragment of a cell's endogenous targeted gene (in some embodiments, the entire targeted gene), but includes one or more chimeric polypeptides and other sequences necessary for expression of the chimeric polypeptides (e.g., but not limited to, promoters and / or enhancers). The donor nucleic acid must be of sufficient size and similarity to allow homologous recombination with the targeted gene. The donor nucleic acid can be provided, for example, as a single-stranded oligodeoxynucleotide (ssODN), as a PCR product (amplicon), or within a vector. Preferably, the donor nucleic acid contains modifications with respect to the endogenous gene that: i) prevent it from being cleaved by the gRNA when integrated into the cell's genome, and / or facilitate detection of the introduction of the donor nucleic acid by homologous recombination.

[0136] The CRISPR / CAS system is an efficient system for inducing targeted genetic alterations. Target recognition by the Cas9 protein requires a "seed" sequence within the guide RNA (gRNA) and a conserved dinucleotide-containing protospacer adjacent motif (PAM) sequence upstream of the gRNA binding region. This allows the CRISPR / CAS system to be engineered to cleave virtually any DNA sequence by redesigning the gRNA in cell lines (e.g., 293T cells), primary cells, and T cells. The CRISPR / CAS system can simultaneously target multiple genomic loci by co-expressing a single CAS9 protein with two or more gRNAs, making this system suitable for HDR when a donor sequence is provided.

[0137] The present disclosure provides a method for generating cells that express one or more chimeric polypeptides by introducing a Cas expression vector and a gene-specific guide nucleic acid sequence into the cell. In another embodiment, the Cas expression vector induces the expression of Cas9 endonuclease. Other endonucleases can also be used, including, but not limited to, T7, Cas3, Cas8a, Cas8b, Cas10d, Csel, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, Cpf1 (or Cas12a), other nucleases known in the art, and any combination thereof.

[0138] In one embodiment, inducing the Cas expression vector comprises exposing the cell to an agent that activates an inducible promoter in the Cas expression vector. In such an embodiment, the Cas expression vector comprises an inducible promoter, for example, a promoter that is inducible by exposure to an antibiotic (e.g., by tetracycline or a derivative of tetracycline, such as doxycycline). However, it should be understood that other inducible promoters can be used. The inducing agent can be a selective condition (e.g., exposure to an agent, e.g., an antibiotic) that results in induction of the inducible promoter, which results in expression of the Cas expression vector.

[0139] The guide nucleic acid sequence is specific to a gene and targets the gene for Cas endonuclease-induced double-strand break.The sequence of the guide nucleic acid sequence can be within the locus of the gene.In one embodiment, the length of the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides.The guide nucleic acid sequence can be specific to any genomic locus in a cell.

[0140] The guide nucleic acid sequence can be an RNA sequence, a DNA sequence, a combination thereof (RNA-DNA combination sequence), or a sequence having synthetic nucleotides. The guide nucleic acid sequence can be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence comprises a single guide RNA.

[0141] The present specification provides methods for incorporating one or more nucleic acids encoding one or more chimeric polypeptides of the present disclosure into the genome of a heterologous cell by HDR, using various types of endonucleases or nickases. Non-limiting examples of endonucleases and nickases include meganucleases, zinc finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs) (Gaj T, Gersbach CA, & Barbas CF, 3rd (2013) ZFNs, TALENs, and CRISPR / Cas-based methods for genome engineering. Trends Biotechnol 31(7):397-405; Arnould S, et al. (2011) The l-CreI meganuclease and its engineered derivatives: applications from cell modification to gene therapy. Protein engineering, design & selection: PEDS 24(1-2):27-31). These endonucleases and nickases can be used to introduce nucleic acids encoding one or more chimeric polypeptides into a targeted genomic sequence by HDR in accordance with the present invention, when a donor sequence comprising an expression cassette for said one or more chimeric polypeptides is provided. host cell

[0142] One aspect of the present disclosure is a cell containing a chimeric polypeptide and / or a nucleic acid encoding any of the chimeric polypeptides disclosed herein. An embodiment is a recombinant cell comprising the chimeric polypeptide and the STMD receptor disclosed herein, and its progeny. In some embodiments, the recombinant cell comprises a recombinant nucleic acid disclosed herein.

[0143] Cell cultures containing at least one recombinant cell disclosed herein are also within the scope of this disclosure. It should be understood that not all progeny will be exactly identical to the parent cell (due to deliberate or inadvertent mutations or differences in environment); however, so long as the progeny retain the same functionality as the originally transformed cell, such altered progeny are included within these terms.

[0144] The nucleic acids of the present disclosure can be introduced into host cells, such as human T lymphocytes, to produce recombinant cells containing the nucleic acid molecules. Accordingly, some embodiments of the present disclosure relate to methods for making recombinant cells, comprising: (a) providing a cell capable of protein expression; and (b) contacting the provided cell with a recombinant nucleic acid of the present disclosure.

[0145] Introduction of the nucleic acid molecules of the present disclosure into cells can be achieved by methods known to those of skill in the art, such as viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0146] Therefore, in some embodiments, nucleic acid molecules can be delivered by viral or non-viral delivery vehicles known in the art.For example, nucleic acid molecules can be stably integrated into the host genome, or can replicate as episomes, or can exist in recombinant host cells as mini-circle expression vectors for transient expression.Thus, in some embodiments, nucleic acid molecules are maintained and replicated in recombinant host cells as episomal units.In some embodiments, nucleic acid molecules are stably integrated into the genome of recombinant cells.Stable integration can be achieved using classical random genome recombination techniques, or more precise techniques, such as guide RNA-directed CRISPR / Cas9 genome editing, or DNA-guided endonuclease genome editing using NgAgo (Natronobacterium gregoryi Argonaute), or TALEN genome editing (transcription activator-like effector nuclease).In some embodiments, nucleic acid molecules exist in recombinant host cells as mini-circle expression vectors for transient expression.

[0147] Nucleic acid molecules can be encapsulated in viral capsids or lipid nanoparticles, or can be delivered by viral or non-viral delivery means and methods known in the art, such as electroporation.For example, the introduction of nucleic acid into cells can be achieved by viral transduction.In a non-limiting example, adeno-associated virus (AAV) is engineered to deliver nucleic acid to target cells via viral transduction.Several AAV serotypes have been described, and all known serotypes can infect cells from multiple diverse tissue types.AAV can transduce a wide range of species and tissues in vivo without evidence of toxicity, and produces relatively mild innate and adaptive immune responses.

[0148] Lentivirus-derived vector systems are also useful for nucleic acid delivery and gene therapy via viral transduction.Lentivirus vectors offer several attractive properties as gene delivery vehicles, including: (i) sustained gene delivery through stable vector integration into host genome; (ii) ability to infect both dividing and non-dividing cells; (iii) broad tissue tropism, including important gene therapy and cell therapy target cell types; (iv) no viral protein expression after vector transduction; (v) ability to deliver complex genetic elements, such as polycistronic or intron-containing sequences; (vi) potentially safer integration site profile; and (vii) relatively easy system for vector manipulation and production.

[0149] In some embodiments, host cells can be genetically engineered (e.g., transduced or transformed or transfected) with a vector construct of the present application, which can be, for example, a viral vector or a vector for homologous recombination comprising a nucleic acid sequence homologous to a portion of the host cell's genome, or an expression vector for expression of a polypeptide of interest. Host cells can be either untransformed cells or cells that have already been transfected with at least one nucleic acid molecule.

[0150] In some embodiments, the recombinant cell is a prokaryotic or eukaryotic cell. In some embodiments, the cell is in vivo. In some embodiments, the cell is ex vivo. In some embodiments, the cell is in vitro. In some embodiments, the recombinant cell is a eukaryotic cell. In some embodiments, the recombinant cell is an animal cell. In some embodiments, the animal cell is a mammalian cell. In some embodiments, the animal cell is a human cell. In some embodiments, the cell is a non-human primate cell. In some embodiments, the mammalian cell is an immune cell, a neuron, an epithelial cell, an endothelial cell, or a stem cell. In some embodiments, the recombinant cell is an immune system cell, for example, a lymphocyte (e.g., a T cell or an NK cell) or a dendritic cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer (NK) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell (Tx), a cytotoxic T cell (Tcm), or other T cell. In some embodiments, the immune system cell is a T lymphocyte.

[0151] In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells. In some embodiments of the cells, the cells are lymphocytes. In some embodiments, the cells are precursor T cells or T regulatory (Treg) cells. In some embodiments, the cells are CD34+, CD8+, or CD4+ cells. In some embodiments, the cells are CD8+ T cytotoxic lymphocyte cells selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, and bulk CD8+ T cells. In some embodiments of the cells, the cells are CD4+ T helper lymphocyte cells selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, and bulk CD4+ T cells. In some embodiments, the cells can be obtained by leukapheresis performed on a sample obtained from a subject. In some embodiments, the subject is a human patient.

[0152] In some embodiments, the recombinant cell further comprises a first and a second nucleic acid molecule disclosed herein, wherein the first nucleic acid molecule and the second nucleic acid molecule do not have the same sequence. In some embodiments, the recombinant cell further comprises a first and a second chimeric polypeptide or STMD receptor disclosed herein, wherein the first chimeric polypeptide or STMD receptor and the second chimeric polypeptide or STMD receptor do not have the same sequence. In some embodiments, the first chimeric polypeptide or STMD receptor modulates the expression and / or activity of the second chimeric polypeptide or STMD receptor.

[0153] In some embodiments, the recombinant cell further comprises an expression cassette operably linked to a promoter and encoding a protein of interest, and the expression of the protein of interest is modulated by the chimeric receptor transcriptional regulator. In some embodiments, the protein of interest is heterologous to the recombinant cell. A heterologous protein is a protein not normally found in the cell, e.g., not normally produced by the cell. In principle, there are no particular limitations regarding suitable proteins whose expression can be modulated by the chimeric receptor transcriptional regulator. Exemplary types of proteins suitable for use with the compositions and methods disclosed herein include cytokines, cytotoxins, chemokines, immunomodulators, pro-apoptotic factors, anti-apoptotic factors, hormones, differentiation factors, de-differentiation factors, immune cell receptors, or reporters. In some embodiments, the immune cell receptor is a T cell receptor (TCR).

[0154] In some embodiments, the immune cell receptor is a chimeric antigen receptor (CAR). In some embodiments, an expression cassette encoding a protein of interest is incorporated into the same nucleic acid molecule encoding the chimeric receptor of the present disclosure. In some embodiments, an expression cassette encoding a protein of interest is incorporated into a second expression vector separate from the nucleic acid molecule encoding the chimeric receptor of the present disclosure. In another aspect, provided herein is a cell culture comprising at least one recombinant cell disclosed herein and a culture medium. Generally, the culture medium can be any culture medium suitable for culturing the cells described herein. Techniques for transforming a wide variety of the above-mentioned host cells and species are known in the art and described in the technical and scientific literature. Therefore, a cell culture comprising at least one recombinant cell disclosed herein is also within the scope of the present application. Suitable methods and systems for generating and maintaining cell cultures are known in the art. Pharmaceutical Composition

[0155] In some embodiments, the chimeric polypeptides, STMD receptors, nucleic acids, and recombinant cells of the present disclosure can be incorporated into compositions, including pharmaceutical compositions. Such compositions typically include the chimeric polypeptides, STMD receptors, nucleic acids, and / or recombinant cells, and a pharmaceutically acceptable excipient, e.g., a carrier.

[0156] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and fluid to permit easy syringability. The composition must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants such as sodium dodecyl sulfate. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it is common to include isotonic agents in the composition, such as sugars, polyalcohols such as mannitol, sorbitol, sodium chloride, etc. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, such as aluminum monostearate and gelatin.

[0157] Sterile injectable solution can be prepared by incorporating the required amount of active compound in suitable solvent with one or combination of the above-listed components, and then optionally sterilize by filtration.Generally, dispersion is prepared by incorporating active compound into sterile vehicle that contains basic dispersion medium and other necessary components from above-listed components.For the preparation of sterile powder for sterile injectable solution, the preferred method of preparation is vacuum drying and freeze-drying, which obtains the powder of active ingredient plus any additional desired components from the solution that has been previously sterilized and filtered.

[0158] Oral compositions, if used, generally contain an inert diluent or edible carrier.For oral therapeutic administration, the active compound (e.g., the chimeric polypeptide, STMD receptor, nucleic acid and / or recombinant cell of the present disclosure) can be incorporated with an excipient and used in the form of a tablet, a troche, or a capsule, for example, a gelatin capsule.Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.Pharmaceutically compatible binding agents and / or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like may contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel™ or corn starch; a lubricant such as magnesium stearate or Sterotes™; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate or orange flavoring.

[0159] For administration by inhalation, a subject chimeric polypeptide and STMD receptor of the present disclosure are delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer, including those methods described in U.S. Patent No. 6,468,798.

[0160] Systemic administration of the subject chimeric polypeptide and STMD receptor of the present disclosure can also be via transmucosal or transdermal means. For transmucosal or transdermal administration, a penetrant appropriate for the barrier to be permeated is used in the formulation. Such penetrants are generally known in the art, and include, for example, detergents, bile salts, and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be achieved through the use of nasal sprays or suppositories. For transdermal administration, the active compound is formulated into ointments, salves, gels, or creams, as is generally known in the art.

[0161] In some embodiments, the chimeric polypeptides and STMD receptors of the present disclosure can also be prepared in the form of suppositories (e.g., with conventional suppository bases, such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0162] In some embodiments, the chimeric polypeptides and STMD receptors of the present disclosure may also be administered by transfection or infection using methods known in the art, including, but not limited to, those described in McCaffrey et al. (Nature 418:6893, 2002), Xia et al. (Nature Biotechnol. 20: 1006-1010, 2002), or Putnam (Am. J. Health Syst. Pharm. 53: 151-160, 1996, as corrected in Am. J. Health Syst. Pharm. 53:325, 1996).

[0163] In some embodiments, the subject chimeric polypeptides and STMD receptors of the present disclosure are prepared with carriers that protect the recombinant polypeptide against rapid elimination from the body, such as controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid, can be used. Such formulations can be prepared using standard techniques. These materials can also be commercially obtained from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells using monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811. As described in more detail below, the chimeric polypeptides and STMD receptors of the present disclosure can also be modified to achieve a prolonged duration of action, for example, by pegylation, acylation, Fc fusion, linkage to molecules such as albumin, etc. In some embodiments, recombinant polypeptides can be further modified to extend their half-life in vivo and / or ex vivo. Non-limiting examples of known strategies and methodologies suitable for modifying the recombinant polypeptides of the present disclosure include: (1) chemical modification of the recombinant polypeptides described herein with highly soluble polymers, such as polyethylene glycol (PEG), which prevent the recombinant polypeptides from contacting proteases; and (2) covalently linking or conjugating the recombinant polypeptides described herein with stable proteins, such as albumin. Thus, in some embodiments, the chimeric polypeptides and STMD receptors of the present disclosure can be fused to stable proteins, such as albumin. For example, human albumin is known to be one of the most effective proteins for enhancing the stability of polypeptides fused thereto, and many such fusion proteins have been reported.

[0164] In some embodiments, the pharmaceutical compositions of the present disclosure comprise one or more pegylation reagents. As used herein, the term "pegylation" refers to modifying a protein by covalently attaching polyethylene glycol (PEG) to the protein, and "pegylated" refers to a protein to which PEG has been attached. A range of PEG, or PEG derivative sizes, ranging optionally from about 10,000 daltons to about 40,000 daltons, can be attached to the recombinant polypeptides of the present disclosure using a variety of chemistries. In some embodiments, the average molecular weight of the PEG or PEG derivative is about 1 kD to about 200 kD, e.g., about 10 kD to about 150 kD, about 50 kD to about 100 kD, about 5 kD to about 100 kD, about 20 kD to about 80 kD, about 30 kD to about 70 kD, about 40 kD to about 60 kD, about 50 kD to about 100 kD, about 100 kD to about 200 kD, or about 1,150 kD to about 200 kD. In some embodiments, the average molecular weight of the PEG or PEG derivative is about 5 kD, about 10 kD, about 20 kD, about 30 kD, about 40 kD, about 50 kD, about 60 kD, about 70 kD, or about 80 kD. In some embodiments, the average molecular weight of the PEG or PEG derivative is about 40 kD. In some embodiments, the PEGylation reagent is selected from methoxypolyethylene glycol succinimidyl propionate (mPEG-SPA), mPEG-succinimidyl butyrate (mPEG-SBA), mPEG-succinimidyl succinate (mPEG-SS), mPEG-succinimidyl carbonate (mPEG-SC), mPEG-succinimidyl glutarate (mPEG-SG), mPEG-N-hydroxyl-succinimide (mPEG-NHS), mPEG-tresylate, and mPEG-aldehyde. In some embodiments, the PEGylation reagent is polyethylene glycol; for example, the PEGylation reagent is polyethylene glycol having an average molecular weight of 20,000 daltons covalently attached to the N-terminal methionine residue of a recombinant polypeptide of the present disclosure.In some embodiments, the pegylation reagent is polyethylene glycol having an average molecular weight of about 5 kD, about 10 kD, about 20 kD, about 30 kD, about 40 kD, about 50 kD, about 60 kD, about 70 kD, or about 80 kD covalently attached to the N-terminal methionine residue of the chimeric polypeptides and STMD receptors of the present disclosure. In some embodiments, the pegylation reagent is polyethylene glycol having an average molecular weight of about 40 kD covalently attached to the N-terminal methionine residue of the chimeric polypeptides and STMD receptors of the present disclosure.

[0165] Therefore, in some embodiments, the chimeric polypeptides and STMD receptors of the present disclosure are chemically modified with one or more polyethylene glycol moieties, for example, PEGylated; or chemically modified by similar modifications, for example, PASylated. In some embodiments, PEG or PAS molecules are conjugated to one or more amino acid side chains of the disclosed recombinant polypeptides. In some embodiments, PEGylated or PASylated polypeptides contain PEG or PAS moieties on only one amino acid. In other embodiments, PEGylated or PASylated polypeptides contain PEG or PAS moieties on two or more amino acids, for example, two or more, five or more, ten or more, fifteen or more, or twenty or more different amino acid residues. In some embodiments, the PEG or PAS chain is 2000 Da, greater than 2000 Da, 5000 Da, greater than 5,000 Da, 10,000 Da, greater than 10,000 Da, greater than 10,000 Da, 20,000 Da, greater than 20,000 Da, or 30,000 Da. The PAS-ylated polypeptide can be coupled directly (e.g., without a linking group) to the PEG or PAS via an amino group, sulfhydryl group, hydroxyl group, or carboxyl group. In some embodiments, the recombinant polypeptide of the present disclosure is covalently bound to polyethylene glycol having an average molecular weight of 20,000 daltons. In some embodiments, the recombinant polypeptides of the present disclosure are covalently linked to polyethylene glycol having an average molecular weight ranging from about 1 kD to about 200 kD, e.g., from about 10 kD to about 150 kD, from about 50 kD to about 100 kD, from about 5 kD to about 100 kD, from about 20 kD to about 80 kD, from about 30 kD to about 70 kD, from about 40 kD to about 60 kD, from about 50 kD to about 100 kD, from about 100 kD to about 200 kD, or from about 1,150 kD to about 200 kD.In some embodiments, the recombinant polypeptides of the present disclosure are covalently linked to polyethylene glycol having an average molecular weight of about 5 kD, about 10 kD, about 20 kD, about 30 kD, about 40 kD, about 50 kD, about 60 kD, about 70 kD, or about 80 kD. In some embodiments, the recombinant polypeptides of the present disclosure are covalently linked to polyethylene glycol having an average molecular weight of about 40 kD. Methods of the present disclosure Methods for treating a health condition in an individual in need thereof - Patent application

[0166] Provided herein is a method for treating a health condition in an individual in need thereof.The administration of any one of the therapeutic compositions described herein, such as chimeric polypeptides, STMD receptors, nucleic acids, recombinant cells, and pharmaceutical compositions, can be used to treat patients in the treatment of related diseases, such as cancer and chronic infections.In some embodiments, the chimeric polypeptides, STMD receptors, nucleic acids, recombinant cells, and pharmaceutical compositions described herein can be incorporated into a therapeutic agent for use in a method for treating an individual who has, is suspected of having, or may be at high risk of developing one or more autoimmune disorders or health conditions associated with checkpoint inhibition.Exemplary autoimmune disorders and health conditions can include, without limitation, cancer and chronic infections.

[0167] In some embodiments, these methods include administering to an individual an effective number of recombinant cells disclosed herein, wherein the recombinant cells inhibit the activity of a target cell in the individual. Generally, the target cell of the disclosed methods can be any cell type in the individual, such as acute myeloma leukemia cells, anaplastic lymphoma cells, astrocytoma cells, B-cell cancer cells, breast cancer cells, colon cancer cells, ependymoma cells, esophageal cancer cells, glioblastoma cells, glioma cells, leiomyosarcoma cells, liposarcoma cells, liver cancer cells, lung cancer cells, mantle cell lymphoma cells, melanoma cells, multiple myeloma cells, neuroblastoma cells, non-small cell lung cancer cells, oligodendroglioma cells, ovarian cancer cells, pancreatic cancer cells, peripheral T-cell lymphoma cells, renal cancer cells, sarcoma cells, gastric cancer cells, carcinoma cells, mesothelioma cells, or sarcoma cells. In some embodiments, the target cell is a pathogenic cell.

[0168] In some embodiments, the methods of the present disclosure include administering an effective amount of recombinant cells of the present disclosure to an individual in need of such treatment. This administering step can be accomplished using any method of implantation delivery known in the art. For example, the recombinant cells of the present disclosure can be injected directly into the individual's bloodstream or administered to the individual by other means.

[0169] In some embodiments, the methods disclosed herein include administering, which term is used interchangeably with the terms "introducing," "implanting," and "transplanting" recombinant cells into an individual by a method or route that results in at least partial localization of the introduced cells at the desired site such that the desired effect(s) occur. The recombinant cells or their differentiated progeny can be administered by any suitable route that results in delivery to the desired location in an individual, where at least a portion of the administered cells or cellular components continue to survive. The period of cell survival after administration to an individual can be as short as a few hours, e.g., 24 hours, to several days, to as long as several years, or even for the lifespan of the individual, i.e., long-term engraftment.

[0170] When provided prophylactically, the recombinant cells described herein can be administered to an individual prior to any symptoms of the disease or condition being treated. Thus, in some embodiments, prophylactic administration of the recombinant cell population prevents the onset of symptoms of the disease or condition.

[0171] When provided therapeutically, in some embodiments, the recombinant cells are provided at (or after) the onset of symptoms or signs of a disease or condition, e.g., at the onset of the disease or condition.

[0172] For use in the various embodiments described herein, an effective amount of the recombinant cells disclosed herein is at least 10 2 cells, at least 5 x 10 2 cells, at least 10 3 cells, at least 5 x 10 3 cells, at least 10 4 cells, at least 5 x 10 4 cells, at least 10 5 cells, at least 2 x 10 5 cells, at least 3 x 10 5 cells, at least 4 x 10 5 cells, at least 5 x 10 5 cells, at least 6 x 10 5 cells, at least 7 x 10 5 cells, at least 8 x 10 5 cells, at least 9 x 10 5 cells, at least 1 x 10 6 cells, at least 2 x 10 6 cells, at least 3 x 10 6 cells, at least 4 x 10 6 cells, at least 5 x 10 6 cells, at least 6 x 10 6 cells, at least 7 x 10 6 cells, at least 8 x 10 6 cells, at least 9 x 10 6The recombinant cells may be derived from one or more donors or may be obtained from an autologous source. In some embodiments, the recombinant cells are expanded in culture prior to administration to an individual in need thereof.

[0173] In some embodiments, delivery of a recombinant cell composition (e.g., a composition comprising a plurality of recombinant cells according to any of the cells described herein) into an individual by a method or route results in at least partial localization of the cell composition at a desired site. The recombinant cell-containing composition can be administered by any suitable route that results in effective treatment in the individual, e.g., administration results in delivery to a desired location in the individual, where at least a portion of the delivered composition, e.g., at least 1 x 10 4 The cells are delivered to the desired site over a period of time. Modes of administration include injection, infusion, and instillation. "Injection" includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal / intrathecal, intraventricular / intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous. Delivery by injection or infusion is a preferred mode of administration for cell delivery.

[0174] In some embodiments, the recombinant cells are administered systemically, e.g., via infusion or injection, e.g., a population of recombinant cells is administered other than directly into a target site, tissue, or organ, such that they enter the circulatory system of an individual and are therefore subject to metabolic and other similar biological processes.

[0175] The effectiveness of treatment, including any of the compositions provided herein for the treatment of a disease or condition, can be determined by a skilled clinician. However, those skilled in the art will understand that a treatment is considered effective if any one or all of the signs or symptoms or markers of the disease are improved or ameliorated. Efficacy can also be measured by the individual's failure to worsen (e.g., the progression of the disease is halted or at least slowed), as assessed by a reduction in the need for hospitalization or medical intervention. Methods for measuring these indicators are known to those skilled in the art and / or described herein. Treatment includes any treatment of disease in an individual or animal (some non-limiting examples include humans or mammals), including: (1) inhibiting the disease, e.g., stopping or slowing the progression of symptoms; or (2) alleviating the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the onset of symptoms.

[0176] As discussed above, a therapeutically effective amount includes an amount of a therapeutic composition that is sufficient to promote a specific beneficial effect when administered to an individual, for example, an individual who has, is suspected of having, or is at risk of having a disease. In some embodiments, an effective amount includes an amount that is sufficient to prevent or delay the onset of disease symptoms, alter the course of disease symptoms (for example, but not limited to, slowing the progression of disease symptoms), or reverse disease symptoms. It is understood that for any given case, the appropriate effective amount can be determined by one skilled in the art using routine experimentation.

[0177] In some embodiments of the disclosed methods, the individual is a mammal. In some embodiments, the mammal is a human. In some embodiments, the individual has or is suspected of having a disease associated with the inhibition of cell signaling mediated by a cell surface ligand or antigen. Diseases suitable for treatment by the compositions and methods of the present disclosure include, but are not limited to, cancer, autoimmune diseases, inflammatory diseases, and infectious diseases. In some embodiments, the disease is cancer or a chronic infectious disease. Additional therapeutic agents

[0178] As discussed above, the recombinant cells and pharmaceutical compositions described herein can be administered in combination with one or more additional therapeutic agents, such as chemotherapeutic agents or anti-cancer agents or anti-cancer treatments. Administration "in combination with" one or more additional therapeutic agents includes simultaneous (concurrent) administration and sequential administration in any order. In some embodiments, the one or more additional therapeutic agents, chemotherapeutic agents, anti-cancer agents or anti-cancer treatments are selected from the group consisting of chemotherapy agents, radiation therapy agents, immunotherapy agents, hormonal therapy agents, toxin therapy agents and surgery. "Chemotherapeutic agents" and "anti-cancer agents" are used interchangeably herein. Various classes of anti-cancer agents may be used. Non-limiting examples include: alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxins, antibodies (e.g., monoclonal or polyclonal), tyrosine kinase inhibitors (e.g., imatinib mesylate (Gleevec® or Glivec®)), hormonal treatments, soluble receptors, and other antineoplastic agents.

[0179] In some embodiments, the first therapeutic agent and the additional therapeutic agent (e.g., the second therapeutic agent) are administered simultaneously. In some embodiments, the first therapeutic agent and the additional therapeutic agent are administered separately or sequentially. The treatments may be administered in the same composition or in different compositions. Methods for modulating cellular activity

[0180] In one aspect, some embodiments of the present disclosure relate to a method for modulating the activity of a target cell in an individual, the method comprising providing a recombinant cell of the present disclosure and contacting the recombinant cell with a selected ligand, wherein binding of the selected ligand to the extracellular binding domain of a chimeric polypeptide or STMD receptor of the present disclosure induces cleavage of the ligand-inducible proteolytic cleavage site, releasing a transcriptional regulator, whereby the released transcriptional regulator modulates the activity of the recombinant cell. In some embodiments, the released transcriptional regulator modulates differentiation of a cell, wherein the cell is an immune cell, a stem cell, a progenitor cell, or a precursor cell.

[0181] In some embodiments, the released transcriptional regulator modulates expression of a gene product of the cell. In some embodiments, the released transcriptional regulator modulates expression of an endogenous gene product. In some embodiments, the released transcriptional regulator modulates expression of a heterologous gene product. In some embodiments, the gene product of the cell is a chemokine, a chemokine receptor, a chimeric antigen receptor, a cytokine, a cytokine receptor, a differentiation factor, a growth factor, a growth factor receptor, a hormone, a metabolic enzyme, a pathogen-derived protein, a growth inducer, a receptor, an RNA-guided nuclease, a site-specific nuclease, a T cell receptor, a toxin, a toxin-derived protein, a transcriptional activator, a transcriptional repressor, a translational regulator, a translational activator, a translational repressor, an activating immunoreceptor, an antibody, an apoptosis inhibitor, an apoptosis inducer, an engineered T cell receptor, an immunoactivator, an immunoinhibitor, and an inhibitory immunoreceptor.

[0182] Some embodiments of the present disclosure relate to methods for inhibiting the activity of target cells in an individual, the methods comprising administering to the individual a first therapeutic agent comprising one or more of the nucleic acids, recombinant cells, and pharmaceutical compositions disclosed herein, wherein the first therapeutic agent inhibits the target cells. For example, a target cell may be inhibited if its proliferation is reduced, if its pathological or pathogenic behavior is reduced, if it is destroyed or killed, etc. Inhibition includes at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% reduction in measured pathological or pathogenic behavior. In some embodiments, these methods comprise administering to the individual an effective number of recombinant cells disclosed herein, wherein the recombinant cells inhibit the activity of the target cells in the individual. In general, the target cells of the disclosed methods can be any cell type in an individual, such as acute myeloma leukemia cells, anaplastic lymphoma cells, astrocytoma cells, B-cell cancer cells, breast cancer cells, colon cancer cells, ependymoma cells, esophageal cancer cells, glioblastoma cells, glioma cells, leiomyosarcoma cells, liposarcoma cells, liver cancer cells, lung cancer cells, mantle cell lymphoma cells, melanoma cells, multiple melanoma cells, neuroblastoma cells, non-small cell lung cancer cells, oligodendroglioma cells, ovarian cancer cells, pancreatic cancer cells, peripheral T-cell lymphoma cells, renal cancer cells, sarcoma cells, gastric cancer cells, carcinoma cells, mesothelioma cells, hematological malignancy cells, solid tumor cells, or sarcoma cells. In some embodiments, the target cells are pathogenic cells.

[0183] A target cell may be inhibited if its proliferation is reduced, if its pathological or pathogenic behavior is reduced, if it is destroyed or killed, etc. Inhibition includes at least about a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% reduction in measured pathological or pathogenic behavior. In some embodiments, the contacting of the cell is performed in vivo, ex vivo, or in vitro.

[0184] For example, the activity of a cell can be the expression of a selected gene of a cell, proliferation of a cell, apoptosis of a cell, non-apoptotic death of a cell, differentiation of a cell, dedifferentiation of a cell, migration of a cell, secretion of a molecule from a cell, cell adhesion of a cell, and cytolytic activity of a cell. Methods for inducing T cell signaling and gene regulation in T cells

[0185] The present disclosure also provides a method for inducing T cell signaling and gene regulation in a T cell, the method comprising providing a vector comprising a chimeric polypeptide of the present disclosure and transducing a T cell with the vector, wherein binding of a selected ligand to the extracellular ligand-binding domain of the chimeric polypeptide induces intracellular signaling and release of a transcriptional regulator. Methods for Producing Recombinant Cells of the Present Disclosure

[0186] The present disclosure also provides a method for producing a recombinant cell of the present disclosure. In some embodiments, the method for producing a recombinant cell includes providing a cell capable of protein expression; and contacting the provided cell with a recombinant nucleic acid molecule of the present disclosure. The contacting step can include transducing the cell with the recombinant nucleic acid molecule by any method known to those skilled in the art. Some of the methods are described above.

[0187] The present disclosure also provides uses of the compositions of the present disclosure for the treatment of diseases. In some embodiments, the use is a chimeric polypeptide of the present disclosure. In some embodiments, the use is a recombinant nucleic acid molecule of the present disclosure. In some embodiments, the use is a recombinant cell of the present disclosure. In some embodiments, the use is a STMD of the present disclosure.

[0188] The present disclosure also provides the use of any of the compositions, methods, kits, and systems herein in or for the manufacture of a medicament for the treatment of a disease. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid tumor or a hematological malignancy. In some embodiments, the hematological malignancy is multiple myeloma. Systems and Kits

[0189] The disclosed systems or kits include one or more of any of the chimeric polypeptides, STMD receptors, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions disclosed herein, as well as syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) used to administer any of the chimeric polypeptides, STMD receptors, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions to an individual. The kits also include written instructions for using any of the chimeric polypeptides, STMD receptors, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions disclosed herein, as well as the syringes and / or catheters for use in administering them.

[0190] Thus, provided herein is a system for modulating cellular activity, killing target cancer cells, or treating disease in an individual in need thereof, comprising one or more of the following: a) a chimeric polypeptide described in any one of claims 1 to 34; b) a recombinant nucleic acid molecule described in any one of claims 40 to 41; c) a recombinant cell described in any one of claims 46 to 52; and / or d) a pharmaceutical composition of the present disclosure.

[0191] Any of the above systems and kits may further comprise one or more additional reagents, which may be selected from the following: a dilution buffer; a reconstitution solution, a wash buffer, a control reagent, a control expression vector, a negative control polypeptide, a positive control polypeptide, a reagent for in vitro production of a chimeric receptor polypeptide.

[0192] In some embodiments, the components of the system or kit may be in separate containers. In some other embodiments, the components of the system or kit may be combined in a single container.

[0193] In some embodiments, the system or kit may further include instructions for using the components of the kit to practice these methods. The instructions for practicing the methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic. The instructions may be present in the kit as a package insert, on the label of the container of the kit or its components (i.e., in connection with the packaging or sub-packaging), etc. The instructions may be present as an electronic storage data file present on a suitable computer-readable storage medium, such as a CD-ROM, diskette, flash drive, etc. In some cases, the actual instructions are not present in the kit, but a means for obtaining the instructions from a remote source (e.g., via the Internet) may be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions may be recorded on a suitable substrate.

[0194] All publications and patent applications mentioned in this disclosure are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0195] No admission is made that any reference cited herein constitutes prior art. The discussion of a reference states that its author asserts it, and that the inventors reserve the right to challenge the accuracy and pertinence of the cited documents. Although several information sources, including scientific journal articles, patent documents, and textbooks, are mentioned herein, it is expressly understood that this mention does not constitute an admission that any of these documents constitutes part of the general knowledge in the field.

[0196] The discussion of general methods provided herein is intended for illustrative purposes only. Other alternative methods and options will be apparent to those skilled in the art in view of this disclosure, and are within the spirit and scope of this application. [Example]

[0197] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry and immunology, which are well known to those skilled in the art. Such techniques are described in Sambrook, J., & Russell, DW (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russell, DW (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (collectively referred to herein as "Sambrook"); Ausubel, FM (1987). Current Protocols in Molecular Biology. New York, NY: Wiley (with addenda through 2014); Bollag, DM et al. (1996). Protein Methods. New York, NY: Wiley-Liss; Huang, L. et al. (2005). Nonviral Vectors for Gene Therapy. San Diego: Academic Press; Kaplitt, MG et al. (1995). Viral Vectors: Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press;Lefkovits, I. (1997). The Immunology Methods Manual: The Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press;Doyle, A. et al. (1998). Cell and Tissue Culture: Laboratory Procedures in Biotechnology.New York, NY: Wiley; Mullis, KB, Ferre, F. & Gibbs, R. (1994). PCR: The Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, EA (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY: Cold Spring Harbor Laboratory Press; Beaucage, SL et al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including supplements up to 2014); and Makrides, SC (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences BV, the disclosures of which are incorporated herein by reference.

[0198] Additional embodiments are disclosed in further detail in the following examples, which are provided by way of illustration and are in no way intended to limit the scope of the disclosure or the claims. Example 1 Design and Construction of Chimeric Polypeptide and Response Element Constructs

[0199] This example describes the design and construction of a receptor with an STMD.

[0200] The chimeric polypeptides described herein were constructed by fusing CD19 scFv (Porter et al. 2011) to the corresponding receptor scaffold and Gal4 DBD VP64. All receptors contained an N-terminal CD8α signal peptide (MALPVTALLLPLALLLHAARP) (SEQ ID NO: 31) for membrane targeting and a myc-tag (EQKLISEEDL) (SEQ ID NO: 32) for appropriate determination of surface expression using a fluorescent dye-conjugated antibody (α-myc A647®, Cell Signaling Technology, Cat. No. 2233).

[0201] The transcriptional regulator GAL4-VP64 used in these experiments contained a DNA domain from the yeast GAL4 transcription factor fused to the activation domain VP64, consisting of tetrameric repeats of the minimal activation domain (amino acids 437-447) of the herpes simplex protein VP16. The receptor was cloned into a modified pHR'SIN:CSW vector (SEQ ID NO: 1) containing the PGK promoter for all primary T cell experiments.

[0202] The pHR'SIN:CSW vector was also modified to generate response element plasmids. Five copies of the Gal4 DNA-binding domain target sequence (GGAGCACTGTCCTCCGAACG) (SEQ ID NO: 33) were cloned 5' to the minimal pybTATA promoter. To easily identify transduced T cells, the PGK promoter, which constitutively drives mCitrine expression, was also included in the response element plasmid. For all inducible BFP vectors, BFP was cloned 3' to the Gal4 response element via the BamHI site in the multiple cloning site. For all inducible CAR vectors, CAR was c-terminally tagged with GFP and cloned 3' to the Gal4 response element via the BamHI site in the multiple cloning site. All constructs were cloned via infusion cloning (Clontech #ST0345).

[0203] BamHI homology sites were added to the following receptor sequences (provided as nucleotide sequences) and inserted into the lentiviral transduction vectors. A description of the individual components follows the sequential sequence. The following chimeric polypeptides, listed in Table 1, were constructed: [Table 1-1] [Table 1-2] [Table 1-3] Example 2 Isolation and culture of primary human T cells

[0204] This example describes the isolation and culture of primary human T cells that were subsequently used in various cell transduction experiments described in Example 3 below.

[0205] Primary CD4+ and CD8+ T cells were isolated from anonymous donor blood after negative selection apheresis (STEMCELL Technologies Nos. 15062 and 15063). Blood was obtained from the Blood Centers of the Pacific (San Francisco, CA) upon approval by the University Institutional Review Board. T cells were cryopreserved in RPMI-1640 (UCSF Cell Culture Core) with 20% human AB serum (Valley Biomedical Inc., No. HP1022) and 10% DMSO. After thawing, T cells were cultured in human T cell medium consisting of X-VIVO 15 (Lonza No. 04-418Q), 5% human AB serum, and 10 mM neutralized N-acetyl-L-cysteine ​​(Sigma-Aldrich No. A9165), supplemented with 30 units / mL of IL-2 (NCI BRB Preclinical Repository) for all experiments. Example 3 Lentiviral transduction of human T cells

[0206] This example describes the general protocol used for lentiviral transduction of human T cells with pantropic VSV-G pseudotyped lentivirus.

[0207] Pantropic VSV-G pseudotyped lentivirus was produced by transfection of Lenti-X 293T cells (Clontech #11131D) with the pHR'SIN:CSW transgene expression vector and viral packaging plasmids pCMVdR8.91 and pMD2.G using Mirus TransIT-Lenti (Mirus #MIR 6606). Primary T cells were thawed the same day and, after 24 hours in culture, stimulated with Human T-Activator CD3 / CD28 Dynabeads (Life Technologies #11131D) at a cell:bead ratio of 1:3. At 48 hours, viral supernatant was collected, and primary T cells were exposed to virus for 24 hours. Five days after T cell stimulation, the Dynabeads were removed, and T cells were sorted using a Beckton Dickinson (BD) FACs ARIA II and expanded for use in the assay. Example 4 Cancer cell lines

[0208] This example describes the generation of myeloid leukemia cells that express CD19 at levels equivalent to Daudi tumors.

[0209] The cancer cell line used was K562 myeloid leukemia cells (ATCC No. CCL-243). K562 was lentivirally transduced to stably express human CD19 at levels equivalent to Daudi tumors. CD19 levels were determined by staining cells with α-CD19 APC (Biolegend No. 302212). All cell lines were screened for transgene expression. Example 5 In vitro stimulation of primary T cells

[0210] This example describes the stimulation of primary T cells in vitro.

[0211] For all in vitro T cell stimulations, 1 x 10 5 T cells were co-cultured with target cells at a 1:1 ratio in U-bottom 96-well tissue culture plates. Cultures were analyzed for reporter activation and / or target cell killing using a BD Fortessa X-50 at 24 hours or as indicated. All flow cytometry analyses were performed with FlowJo software (TreeStar). Example 6 Testing of synthetic polyvaline TMD-based receptors

[0212] Primary human CD3+ T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with a lentiviral construct expressing a multichain receptor construct and another lentiviral construct containing a transcriptional reporter construct. Receptor expression was measured using an AlexaFluor 647-tagged anti-myc antibody (Cell Signaling) directed against the myc tag on the binder (CD19scFv)-containing chain. Reporter expression was measured via a constitutive mCitrine gene found on the reporter plasmid. Double-positive cells were sorted 5 days after initial T cell stimulation and further expanded for activation studies. To measure receptor activity, 1E5 double-positive T cells expressing the anti-CD19 receptor were co-cultured with either no addition (red), 1E5 K562 cells (blue), or 1E5 CD19+ K562 cells (yellow) for 48 hours. Subsequently, transcriptional activation of the inducible BFP reporter gene was measured using a Fortessa X-50 (BD) (Fig. 2B). Example 7 Testing synthetic polyvaline TMD-based receptors with destabilizing residues

[0213] Primary human CD3+ T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with a lentiviral construct expressing a multichain receptor construct and another lentiviral construct containing a transcriptional reporter construct. Receptor expression was measured using an AlexaFluor 647-tagged anti-myc antibody (Cell Signaling) directed against the myc tag on the binder (CD19scFv)-containing chain. Reporter expression was measured via a constitutive mCitrine gene found on the reporter plasmid. Double-positive cells were sorted 5 days after initial T cell stimulation and further expanded for activation studies. To measure receptor activity, 1E5 double-positive T cells expressing the anti-CD19 receptor were cocultured with either no addition (red), 1E5 K562 cells (blue), or 1E5 CD19+ K562 cells (yellow) for 48 hours. Subsequently, transcriptional activation of an inducible BFP reporter gene was measured using a Fortessa X-50 (BD) and showed that the presence of a destabilizing residue at positions 18-19 of the polyvaline TMD (GG18, Figure 3B) increased transcriptional activation compared to the absence of the destabilizing residue (Figure 3A). Example 8 Examination of destabilizing residues within the first N-terminal residues of synthetic polyvaline TMD-based receptors

[0214] Primary human CD3+ T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with a lentiviral construct expressing a multichain receptor construct and another lentiviral construct containing a transcriptional reporter construct. Receptor expression was measured using an AlexaFluor 647-tagged anti-myc antibody (Cell Signaling) directed against the myc tag on the binder (CD19scFv)-containing chain. Reporter expression was measured via the constitutive mCitrine gene found on the reporter plasmid. Double-positive cells were sorted 5 days after initial T cell stimulation and further expanded for activation studies. To measure receptor activity, 1E5 double-positive T cells expressing the anti-CD19 receptor were cocultured with 1E5 CD19+ K562 cells (yellow) for 48 hours. Subsequently, transcriptional activation of the inducible BFP reporter gene was measured using a Fortessa X-50 (BD). Here, the destabilizing residues at positions 1-2 (GG1) through 12-13 (GG12) showed approximately equivalent or higher activity compared to the original polyvaline TMD (PV TMD) (Figure 5). Example 9 Examination of destabilizing residues within the last C-terminal residues of synthetic polyvaline TMD-based receptors

[0215] Primary human CD3+ T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with a lentiviral construct expressing a multichain receptor construct and another lentiviral construct containing a transcriptional reporter construct. Receptor expression was measured using an AlexaFluor 647-tagged anti-myc antibody (Cell Signaling) directed against the myc tag on the binder (CD19scFv)-containing chain. Reporter expression was measured via a constitutive mCitrine gene found on the reporter plasmid. Double-positive cells were sorted 5 days after initial T cell stimulation and further expanded for activation studies. To measure receptor activity, 1E5 double-positive T cells expressing the anti-CD19 receptor were cocultured with 1E5 CD19+ K562 cells (yellow) for 48 hours. Subsequently, transcriptional activation of the inducible BFP reporter gene was measured using a Fortessa X-50 (BD). Here, destabilizing residues at positions 13–14 (GG13) through 20–21 (GG20) showed a monotonic increase in receptor activation, with the more C-terminal the GG mutation, the higher the activity (Figure 6).

[0216] While particular options of the present disclosure have been disclosed, it should be understood that various modifications and combinations are possible and are contemplated within the true spirit and scope of the appended claims. Accordingly, no limitations to the precise abstract and disclosure of the specification as presented are intended. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6]

Table 2-7

Table 2-8

Table 2-9

Table 2-10

Table 2-11

Table 2-12

change

change

Claims

1. (a) an extracellular ligand-binding domain (ECD) having binding affinity for a selected ligand; (b) a synthetic transmembrane domain (STMD) containing one or more ligand-inducible proteolytic cleavage sites; and (c) an intracellular domain (ICD) containing a transcription regulator (TR); wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site and release of the transcriptional regulator.

2. The chimeric polypeptide of claim 1, further comprising a hinge domain incorporated between the extracellular ligand-binding domain and the STMD.

3. The chimeric polypeptide of claim 1, comprising, in order from the N-terminus to the C-terminus of the first polypeptide, the ECD, the STMD, and the ICD.

4. The chimeric polypeptide of claim 2, comprising, in order from the N-terminus to the C-terminus of the first polypeptide, the ECD, the hinge domain, the STMD, and the ICD.

5. The chimeric polypeptide of claim 1 , wherein the STMD comprises one or more valine residues.

6. The chimeric polypeptide of claim 1 , wherein the STMD comprises a series of at least five valine residues.

7. The chimeric polypeptide of any one of claims 1 to 6, wherein the STMD comprises between 5 and 30 valine residues.

8. The chimeric polypeptide of claim 1 , wherein the STMD further comprises two consecutive glycine residues.

9. The chimeric polypeptide of claim 8, wherein the two consecutive glycine residues are located at any one of positions 5 to 30 of STMD, and position 30 is closer to the C-terminus of the chimeric polypeptide than position 5.

10. The chimeric polypeptide of claim 1 , wherein the STMD consists of a valine residue.

11. The chimeric polypeptide of claim 1 , wherein the ligand comprises a protein or a carbohydrate.

12. The chimeric polypeptide of claim 1 , wherein the ligand is selected from a cell surface receptor, an adhesion protein, an integrin, a mucin, a lectin, a tumor-associated antigen, and a tumor-specific antigen.

13. The ligand is CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD5 2, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD 95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), C 13. The chimeric polypeptide of any one of claims 1 to 12, wherein the chimeric polypeptide is selected from the group consisting of D183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placenta-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), and signal regulatory protein alpha (SIRPα).

14. The chimeric polypeptide of claim 11 , wherein the extracellular binding domain comprises a ligand-binding portion of a receptor.

15. 15. The chimeric polypeptide of any one of claims 1 to 14, wherein the ECD comprises an antigen-binding portion capable of binding to a ligand on the surface of a cell.

16. 16. The chimeric polypeptide of claim 15, wherein the antigen-binding portion is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody or a minibody, an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv) and a single-domain antibody (sdAb), or a functional fragment thereof.

17. The chimeric polypeptide of claim 16 , wherein the antigen-binding portion comprises an scFv.

18. The antigen-binding portion is CD19, B7H3 (CD276), BCMA, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD4 6, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, EphrinB2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 18. The chimeric polypeptide of any one of claims 1 to 17, which is capable of binding to a tumor-associated antigen selected from the group consisting of: IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-beta, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, BCMA (CD269), ALPI, citrullinated vimentin, cMet, and Axl.

19. The chimeric polypeptide of claim 10, wherein the tumor-associated antigen is CD19, CEA, HER2, MUC1, CD20 or EGFR.

20. The chimeric polypeptide of claim 11, wherein the tumor-associated antigen is CD19.

21. The chimeric polypeptide of claim 15 , wherein the cell is a pathogen.

22. 14. The chimeric polypeptide of claim 8, wherein the ligand-inducible proteolytic cleavage site is the two consecutive glycine residues.

23. The chimeric polypeptide of any one of claims 1 to 22, wherein the transcriptional regulatory factor comprises a transcriptional activator, a transcriptional repressor, a site-specific nuclease, an inhibitory immunoreceptor, or an activating immunoreceptor.

24. 24. The chimeric polypeptide of any one of claims 1 to 23, wherein the transcriptional regulatory factor is selected from the group consisting of Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16.

25. 24. The chimeric polypeptide of any one of claims 1 to 23, further comprising a combination of a ligand-induced proteolytic cleavage site, a tumor-specific cleavage site, a disease-specific cleavage site, an autoproteolytic peptide sequence, a nuclear localization signal, a juxtamembrane domain, a signaling domain, or any combination thereof.

26. 26. The chimeric polypeptide of claim 25, wherein the signaling domain is derived from DAP12, CD3 zeta, TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (ICOS), Fc epsilon RI, DAP10, DAP12, or CD66d.

27. 26. The chimeric polypeptide of claim 25, wherein the juxtamembrane domain is a Notch 2 juxtamembrane domain or an analogous polybasic domain.

28. 26. The chimeric polypeptide of claim 25, wherein the proteolytic cleavage site is cleavable by gamma secretase.

29. 26. The chimeric polypeptide of claim 25, wherein the autoproteolytic peptide sequence is derived from Porcine Teschovirus-1 2A (P2A), Foot-and-Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna Virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Flacheria Falcata Virus 2A (BmIFV2A), or a combination thereof.

30. 26. The chimeric polypeptide of any one of claims 2 to 25, wherein the hinge domain is derived from CD8α or CD28.

31. The chimeric polypeptide of claim 30, wherein the hinge domain is a truncated CD8α hinge domain.

32. 32. The chimeric polypeptide of any one of claims 1 to 31, wherein the STMD comprises an amino acid sequence encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs: 2 to 22, SEQ ID NO: 27 or SEQ ID NO:

30.

33. 33. The chimeric polypeptide of any one of claims 1 to 32, wherein the STMD comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, and SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:

55.

34. 18. A chimeric polypeptide described in any one of claims 1 to 17, encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 2 or SEQ ID NO:

3.

35. 35. An STMD for the chimeric polypeptide of any one of claims 1 to 34, comprising at least five valine residues.

36. 36. The STMD of claim 35, comprising at least 10 valine residues.

37. 36. The STMD of claim 35, comprising at least 20 valine residues.

38. 36. The STMD of claim 35, comprising between 15 and 25 valine residues.

39. The STMD of any one of claims 35 to 38, wherein the STMD comprises a ligand-inducible proteolytic cleavage site, and binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site and release of the transcriptional regulator.

40. 35. A recombinant nucleic acid molecule comprising a nucleotide sequence encoding the chimeric polypeptide of any one of claims 1 to 34.

41. 41. The recombinant nucleic acid molecule of claim 40, comprising a sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity to any one of SEQ ID NO:2, SEQ ID NO:22, SEQ ID NO:27 and SEQ ID NO:

30.

42. 42. A vector comprising the recombinant nucleic acid molecule of claim 40 or 41.

43. 43. The vector of claim 42, which is an expression vector.

44. 44. The vector of claim 43, wherein the expression vector is a viral vector.

45. 45. The vector of claim 44, wherein the viral vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

46. A chimeric polypeptide according to any one of claims 1 to 34; or A recombinant nucleic acid according to any one of claims 40 to 41; or A vector according to any one of claims 42 to 45; or 40. The STMD of any one of claims 35 to 39. A recombinant cell comprising:

47. 47. The recombinant cell of claim 46, which is a mammalian cell.

48. 55. The recombinant cell of claim 54, wherein the mammalian cell is an immune cell, a neuron, an epithelial cell, or an endothelial cell or a stem cell.

49. 49. The recombinant cell of claim 48, wherein the immune cell is a B cell, a monocyte, a natural killer cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, a CD4+ T cell, a CD8+ T cell, or another T cell.

50. A recombinant cell described in any one of claims 46 to 49, comprising a chimeric polypeptide described in any one of claims 1 to 34, further comprising a nucleic acid sequence encoding a protein operably linked to a promoter, wherein expression of the protein is modulated by the transcriptional regulatory factor of the chimeric polypeptide.

51. 51. The recombinant cell of claim 50, wherein the protein is heterologous.

52. 52. The recombinant cell of claim 50 or 51, wherein the protein is a cytokine, cytotoxin, chemokine, immunomodulator, pro-apoptotic factor, anti-apoptotic factor, hormone, differentiation factor or de-differentiation factor.

53. 53. A pharmaceutical composition comprising a recombinant cell according to any one of claims 46 to 52.

54. 1. A method for modulating the activity of a cell, comprising: Providing a recombinant cell according to any one of claims 46 to 52 comprising the chimeric polypeptide of any one of claims 1 to 34; and contacting the recombinant cell with the selected ligand wherein binding of the selected ligand to the extracellular binding domain induces cleavage of a ligand-inducible proteolytic cleavage site, releasing the transcriptional regulator, and the released transcriptional regulator modulates an activity of the recombinant cell.

55. 55. The method of claim 54, wherein said contacting step is carried out in vivo, ex vivo, or in vitro.

56. 56. The method of any one of claims 54 or 55, wherein the activity of the cell is selected from the group consisting of expression of a selected gene of the cell, proliferation of the cell, apoptosis of the cell, non-apoptotic death of the cell, differentiation of the cell, dedifferentiation of the cell, migration of the cell, secretion of a molecule from the cell, cell adhesion of the cell, and cytolytic activity of the cell.

57. 57. The method of any one of claims 54 to 56, wherein the released transcriptional regulator modulates expression of a gene product in the cell.

58. 58. The method of claim 57, wherein the released transcriptional regulator modulates expression of a heterologous gene product.

59. 59. The method of claim 57 or 58, wherein said gene product of said cell is selected from the group consisting of a chemokine, a chemokine receptor, a chimeric antigen receptor, a cytokine, a cytokine receptor, a differentiation factor, a growth factor, a growth factor receptor, a hormone, a metabolic enzyme, a pathogen-derived protein, a proliferation inducer, a receptor, an RNA-guided nuclease, a site-specific nuclease, a T cell receptor, a toxin, a toxin-derived protein, a transcriptional activator, a transcriptional repressor, a translational regulator, a translational activator, a translational repressor, an activating immunoreceptor, an antibody, an apoptosis inhibitor, an apoptosis inducer, an engineered T cell receptor, an immune activator, an immune inhibitor, and an inhibitory immunoreceptor.

60. 60. The method of any one of claims 54 to 59, wherein the released transcriptional regulator modulates differentiation of the cell, and the cell is an immune cell, a stem cell, a progenitor cell, or a precursor cell.

61. 60. The method of any one of claims 54 to 59, wherein the administered recombinant cells modulate the activity of a target cell in the individual.

62. 62. The method of claim 61, wherein the target cell is a cancer cell.

63. 63. The method of claim 62, wherein the cancer cells are solid tumor or hematological malignancy cells.

64. 64. The method of claim 63, wherein the hematological malignancy cells are multiple myeloma cells.

65. 53. A method for treating a health condition in an individual in need thereof, comprising administering to the individual a first therapeutic agent comprising an effective number of recombinant cells of any one of claims 46 to 52, wherein the recombinant cells treat the disease in the individual.

66. 66. The method of claim 65, wherein the disease is cancer.

67. 67. The method of claim 66, wherein the cancer is a solid tumor.

68. 67. The method of claim 66, wherein the cancer is a hematological malignancy.

69. 69. The method of claim 68, wherein the hematological malignancy is multiple myeloma.

70. 70. The method of claim 69, further comprising administering a second therapeutic agent to the individual.

71. 71. The method of claim 70, wherein the second therapeutic agent is selected from the group consisting of a chemotherapeutic agent, a radiation therapy agent, an immunotherapy agent, a hormone therapy agent, and a toxin therapy agent.

72. 72. The method of any one of claims 65-71, wherein the first and second therapeutic agents are administered together, either in the same composition or in separate compositions.

73. 73. The method of claim 72, wherein the first and second therapeutic agents are administered simultaneously.

74. 74. The method of any one of claims 70-73, wherein the first and second therapeutic agents are administered sequentially.

75. 73. The method of claim 72, wherein the first therapeutic agent is administered before the second therapeutic agent.

76. 1. A method for inducing T cell signaling and gene regulation in a T cell, comprising: (a) providing a vector comprising the chimeric polypeptide of any one of claims 1 to 41; and (b) transducing T cells with said vector wherein binding of a selected ligand to the extracellular ligand-binding domain of the chimeric polypeptide induces intracellular signaling and release of the transcriptional regulator.

77. 1. A system for modulating cellular activity, killing targeted cancer cells, or treating disease in an individual in need thereof, comprising:

35. The chimeric polypeptide of any one of claims 1 to 34; 42. A recombinant nucleic acid molecule according to any one of claims 40 to 41; 53. A recombinant cell according to any one of claims 46 to 52; and 54. The pharmaceutical composition of claim 53 A system comprising one or more of:

78. 53. A method for producing a recombinant cell according to any one of claims 46 to 52, comprising: Providing a cell capable of protein expression; and contacting the provided cell with a recombinant nucleic acid molecule of any one of claims 40 to 41. A method comprising:

79. For the treatment of diseases:

35. The chimeric polypeptide of any one of claims 1 to 34; A recombinant nucleic acid molecule according to any one of claims 40 to 41; and 53. The recombinant cell of any one of claims 46 to 52. Use of one or more of the following:

80. 80. The use of claim 79, wherein the disease is cancer.

81. 54. Use of the invention according to any one of claims 1 to 53 for the manufacture of a medicament for the treatment of a disease.

Images