Novel uses for anti-cancer viruses

Abstract

The present invention relates to a novel use of an anticancer virus, specifically to a composition for intravenous injection for repeated administration, which contains as active ingredients an anticancer virus in which the expression of the thymidine kinase (TK) gene has been inhibited and genes encoding the complement regulatory protein CD55 and granulocyte-macrophage colony-stimulating factor (GM-CSF) have been inserted. Specifically, the present invention relates to a composition for intravenous injection for repeated administration, which contains as active ingredients an anticancer virus in which the expression of the thymidine kinase (TK) gene has been inhibited and in which a gene encoding CD55 fused with the transmembrane domain of a viral membrane protein and a gene encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) have been inserted so that the complement regulatory protein CD55 is expressed on the membrane of intracellular mature virions (IMVs). When the composition of the present invention is administered into the body, CD55, which is fused with the viral membrane protein H3 and expressed on the viral IMV membrane, avoids the neutralizing reaction of antibodies against the virus, allowing repeated intravenous administration of the anti-cancer virus, thereby preventing a decrease in the anti-cancer effect of neutralizing antibodies and maximizing the anti-cancer effect.

Description

[Technical Field]

[0001] The present invention relates to a novel use of an anticancer virus, specifically to a composition for intravenous injection for repeated administration, which contains as active ingredients an anticancer virus in which the expression of the thymidine kinase (TK) gene has been inhibited and genes encoding the complement regulatory protein CD55 and granulocyte-macrophage colony-stimulating factor (GM-CSF) have been inserted. Specifically, the present invention relates to a composition for intravenous injection for repeated administration, which contains as active ingredients an anticancer virus in which the expression of the thymidine kinase (TK) gene has been inhibited and in which a gene encoding CD55 fused with the transmembrane domain of a viral membrane protein and a gene encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) have been inserted so that the complement regulatory protein CD55 is expressed on the membrane of intracellular mature virions (IMVs). [Background technology]

[0002] Cancer is a leading cause of death worldwide and places an enormous burden on individuals and society. Therefore, the importance of developing innovative anti-cancer therapeutic agents is increasing day by day, and various approaches based on advances in molecular biology are being attempted.

[0003] Oncolytic viruses, an anti-cancer treatment that has recently been gaining attention, are replicable and infectious viruses. They are used to treat cancer by inserting specific genes into wild-type or attenuated viruses that target genetically abnormal sites in tumor cells. After viral replication, these genetically engineered anti-cancer viruses selectively spread through tissues, lysing the cells and targeting cancer cells and the blood vessels surrounding them. A representative anti-cancer virus is Amgen's Illygic (talimogene laherparepvec), which was approved by the US Food and Drug Administration (FDA) in October 2015 as a melanoma treatment.

[0004] On the other hand, intravenous injection of drugs is one of the most preferred forms of drug administration due to its ease of administration and its convenient and rapid systemic delivery of drugs that cannot be administered orally. Furthermore, intravenous injection allows drugs to reach tumors through blood vessels, ensuring uniform distribution of the drug within the tumor and ensuring that the drug's efficacy is evenly distributed throughout the tumor. However, anticancer virus preparations have the limitation that they are rapidly eliminated by the body's immune system, including the complement system and neutralizing antibodies, upon intravenous injection, only a small amount of the anticancer virus reaches the tumor, resulting in reduced efficacy. Therefore, anticancer virus preparations are generally injected directly into the target tumor rather than intravenously to increase the probability of the virus reaching the tumor.

[0005] Although intratumoral injection is generally effective for superficial cancers that are easily accessible, such as melanoma, breast cancer, and head and neck cancer, it has the disadvantage of being difficult to administer an effective dose to all tumor tissues when multiple tumors exist in a single organ, when deep solid cancers occur in areas that are difficult to access, or when cancer has metastasized to multiple organs.In addition, intratumoral injection is a very invasive procedure, so it is not as easy to use as an intravenous injection for repeated treatment.

[0006] Despite the advantages of intravenous injection, it is difficult to administer anticancer viruses via intravenous injection because foreign substances (i.e., viruses) administered into the bloodstream are gradually eliminated by the body's defense mechanisms, reducing the activity of the anticancer viruses. That is, when viruses travel through the body via blood vessels, they activate the complement system present in the blood, which either directly neutralizes the virus or promotes phagocytosis by macrophages, eliminating the virus.

[0007] Furthermore, when anti-cancer viruses are administered into the body for therapeutic purposes, neutralizing antibodies against the virus are formed through an acquired immune response, and the more frequently the administration is repeated, the stronger and more numerous the antibodies formed become. Because the formed neutralizing antibodies bind to the surface antigens of the virus and prevent viral infection, repeated administration gradually reduces the anti-cancer effect of the virus, ultimately resulting in its loss. Therefore, research and development is needed to avoid the antibody-mediated neutralization reaction so that anti-cancer viruses can be administered intravenously and repeatedly. Summary of the Invention

[0008] The present invention relates to a novel use of an anticancer virus, specifically, to a composition for intravenous injection for repeated administration, which contains, as an active ingredient, an anticancer virus in which the expression of the thymidine kinase (TK) gene has been inhibited and genes encoding the complement regulatory protein CD55 and granulocyte-macrophage colony-stimulating factor (GM-CSF) have been inserted. Specifically, the present invention relates to a composition for intravenous injection for repeated administration, which contains, as an active ingredient, an anticancer virus in which the expression of the thymidine kinase (TK) gene has been inhibited and in which a gene encoding CD55 fused with the transmembrane domain of a viral membrane protein and a gene encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) have been inserted so that the complement regulatory protein CD55 is expressed on the membrane of intracellular mature virions (IMVs).

[0009] The technical problems to be achieved based on the technical ideas of the invention disclosed in this specification are not limited to the problems to be solved above, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

[0010] This will be explained in more detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each of the other descriptions and embodiments. In other words, all combinations of various elements disclosed in this application belong to the category of this application. Furthermore, the category of this application is not limited by the specific descriptions described below.

[0011] In one aspect to achieve the above object, the present invention provides a composition for intravenous injection for repeated (or multiple) administration, which comprises, as an active ingredient, an anticancer virus in which the expression of the thymidine kinase (TK) gene has been suppressed and into which genes encoding the complement regulatory protein CD55 and granulocyte-macrophage colony-stimulating factor (GM-CSF) have been inserted.

[0012] More specifically, the present invention provides an intravenous composition for repeated administration, which contains an anti-cancer virus as an active ingredient; in which the expression of the thymidine kinase (TK) gene has been suppressed; and in which a gene encoding the complement regulatory protein CD55 fused with the transmembrane domain region of a viral membrane protein and a gene encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) have been inserted so that the complement regulatory protein CD55 is expressed on the membrane of intracellular mature virions (IMVs).

[0013] In the present invention, in order to protect the anticancer virus from complement attack during intravenous injection, a complement regulatory protein, e.g., CD55, which has the highest complement regulatory activity, is expressed on the IMV membrane to avoid complement attack. In particular, the present inventors have conducted research efforts to develop an anticancer virus that can be administered intravenously repeatedly, and have discovered and demonstrated that the proposed anticancer virus avoids neutralization by viral antibodies, thereby completing the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0014] The term "oncolytic vaccinia virus" as used herein may also be referred to as "oncolytic virus," which includes recombinant viruses engineered through the deletion of all or part of endogenous genes or the introduction of foreign genes. Such oncolytic viruses may be vaccinia virus, adenovirus, herpes simplex virus, retrovirus, reovirus, Newcastle disease virus, coxsackievirus, enterovirus, herpes virus, etc.

[0015] In the present invention, by way of example, the vaccinia virus may be, but is not limited to, Western Reserve (WR), NYVAC (New York Vaccinia Virus), Wyeth, LC16m8, Lister, Copenhagen, Tian Tan, USSR, TashKent, Evans, IHD-J (International Health Division-J) or IHD-W (International Health Division-White) strain.

[0016] The term "thymidine kinase (TK)" as used herein refers to an enzyme involved in the biosynthesis of nucleotides. Thymidine kinase encoded by the TK gene plays a role in binding the phosphate at the gamma (γ) position of ATP to thymidine to produce nucleotides that constitute viral DNA. The TK may have a sequence such as, but is not limited to, GenBank: AAR17937.1 or AY313847.1. Specifically, the TK or its gene may have the amino acid sequence of GenBank: AAR17937.1 or the nucleotide sequence of GenBank: AY313847.1, but is not limited to these. Furthermore, the TK or its gene may have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more homology with the amino acid sequence of GenBank: AAR17937.1 or the nucleotide sequence of GenBank: AY313847.1.

[0017] As used herein, the term "granulocyte-macrophage colony-stimulating factor (GM-CSF)" refers to a protein that plays a central role in the generation, differentiation, and activation of various immune cells, including cells that give rise to granulocytes, macrophages, and platelets. It is a cytokine that belongs to the hematopoietic (blood-forming) drug family and is also known as sargramostim. GM-CSF is produced by many different cell types (e.g., activated T cells, B cells, macrophages, mast cells, endothelial cells, and fibroblasts) in response to cytokines or immune and inflammatory stimuli. In addition to granulocyte-macrophage progenitors, GM-CSF is also a growth factor for erythroid, megakaryocyte, and eosinophil progenitors. With respect to mature hematopoietic cells, GM-CSF is a survival factor for granulocytes, monocytes / macrophages, and eosinophils, and activates their effector functions. GM-CSF has also been reported to have functional roles in nonhematopoietic cells. It can induce human endothelial cells to migrate and proliferate.

[0018] The GM-CSF may be, but is not limited to, the sequence of GenBank: M10663.1 or GenBank: X02333.1. Specifically, the GM-CSF gene may consist of, or be a part of, the nucleotide sequence of GenBank: M10663.1 or GenBank: X02333.1, and the GM-CSF gene may have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more homology to the nucleotide sequence of GenBank: M10663.1 or GenBank: X02333.1. Furthermore, the GM-CSF may consist of, or be a part of, the amino acid sequence of SEQ ID NO: 3 or 8, or may consist of, or be a part of the nucleotide sequence of SEQ ID NO: 4 or 9.

[0019] The term "complement regulatory protein" as used herein refers to a protein that effectively regulates the complement activation pathway in vivo. Complement regulatory proteins are broadly classified into serotype (water-soluble) regulatory proteins and membrane-bound regulatory proteins. Serotype regulatory proteins include C4b-binding protein, factor H, SGP120, and properdin (P), while membrane-bound regulatory proteins include CRI (CD35), CR2 (CD21), CR3 (CD11b / CD18), CR4 (CD11c / CD18), DAF (CD55), membrane cofactor proteins (MCP, CD46), and CD59. Among these, only P acts to enhance complement activation, while the others act to attenuate it. The complement regulatory protein contained in the recombinant vaccinia virus of the present invention may be CD35, CD21, CD18, CD55, CD46, or CD59, specifically, but not limited to, CD55. Specifically, the CD55 gene may consist of or be a part of the nucleotide sequence of Genbank: NM_000574.3, and may have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more homology to the nucleotide sequence of NCBI Reference Sequence: NM_000574.3. More specifically, the CD55 may consist of the amino acid sequence of SEQ ID NO: 1 or the nucleotide sequence of SEQ ID NO: 2.

[0020] As used herein, the term "transmembrane domain" is also called a transmembrane region or a transmembrane region, and refers to a region that penetrates and crosses the lipid bilayer of a membrane protein.

[0021] Specifically, the vaccinia virus membrane protein may be D8L, A16L, F9L, G9R, H3L, L1R, A9L, A13L, A21L, A28L, E10R, G3L, H2R, I2L, J5L, L5R or O3L, and may include all or part of the membrane protein sequence, examples of which are shown in Table 1 below.

[0022] [Table 1] JPEG2025531806000003.jpg141160

[0023] In this case, the transmembrane domains of the complement regulatory protein and the anticancer virus protein can be designed to contain all or part of the gene through genetic engineering. Specifically, among the anticancer viruses, the transmembrane domain of the vaccinia virus membrane protein may be composed of, but is not limited to, the amino acid sequence of SEQ ID NO: 10 or the nucleotide sequence of SEQ ID NO: 11.

[0024] In the present invention, gene expression suppression or gene inactivation refers to the deletion of a part or all of a gene, or the insertion of a foreign gene into a gene, resulting in the gene not being expressed or only a part of the gene being expressed, and the activity of the protein encoded by the gene not being exhibited. The gene deletion and foreign gene insertion methods can be performed using methods well known in the art. For example, foreign gene insertion methods can be performed using the methods disclosed in "Molecular Cloning, A Laboratory Manual, Second Edition (2003)" by J. Sambrook, E.F. Fritsch, and T. Maniatis, Cold Spring Harbor Laboratory Press; "Virology Methods Manual (1996)" edited by Brian W.J. Mahy and Hiliar O. Kangro, Academic Press; and "Expression of Genes by Vaccinia Virus Vectors. Current Protocols in Molecular Biology, Chapter 16 (1998)" published by John Wiley and Sons. Specifically, the expression of the thymidine kinase gene may be suppressed when a foreign gene is inserted into a part or the whole of the thymidine kinase J2R region. TMForeign genes were inserted using a PCR Cloning Kit (Solgent, Korea, Cat. No. SOT01-K020). The GM-CSF and complement regulatory protein contained in the anticancer virus of the present invention can be expressed under the control of, but not limited to, the late-early VACV p7.5 promoter, the vaccinia synthetic early-late promoter (pSEL), the vaccinia synthetic late promoter (pSL), the vaccinia variant H5 (mH5) promoter, the vaccinia short synthetic early-late pS promoter, the pLate promoter, the pC11R promoter, the pF11L promoter, the psFJ1-10 synthetic early promoter, the pHyb synthetic early promoter, any native vaccinia early promoter, or the late-early optimized (LEO) promoter. For example, the GM-CSF can be expressed under the control of the pSEL promoter, and the complement regulatory protein or CD55 can be expressed under the control of the pLate promoter. More specifically, the GM-CSF can be expressed under the control of the pSEL promoter of SEQ ID NO: 5 or the p7.5 promoter of SEQ ID NO: 7, and the above complement regulatory proteins can be expressed under the control of the pLate promoter of SEQ ID NO: 6.

[0025] The anti-cancer virus of the present invention may further contain a gene capable of enhancing the efficacy of cancer treatment. Such genes may include, but are not limited to, anti-cancer therapeutic genes, various immunoregulatory factors, enzymes that degrade extracellular matrix such as intratumoral fibrous tissue, etc., such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-17, IL-18, IL-21, IL-23, IL-24, interferon-α, interferon-β, interferon-γ, CCL3, CCL5, CXCR4, CXCL9, CXCL10, CXCL11, and interleukin superagonists (IL-2 superagonists, IL-15). The therapeutic agent may further include, but is not limited to, a TGF-β superagonist, a TGF-β blockade, a TLR-2 agonist, a TLR-3 agonist, a TLR-7 agonist, a STAT-3 inhibitor, PTENα, p53, p63, p73, adenosine deaminase-2, a cancer-specific antigen, a cancer-associated antigen, hyaluronidase, collagenase, protease, and the like.

[0026] The composition of the present invention may be administered in combination with a substance that promotes immune activity to enhance the therapeutic effect on cancer. Examples of such substances include immune checkpoint inhibitors such as anti-PD-1 (Programmed Cell Death protein-1) antibody, anti-PD-L1 antibody, anti-CTLA-4 (Cytotoxic T Lymphocyte Antigen-4) antibody, anti-LAG-3 (Lymphocyte Activation Gene-3) antibody, anti-TIM-3 (T-cell Membrane protein-3) antibody, anti-TIGIT (T cell Immunoreceptor with Ig and ITIM domains) antibody, anti-VISTA (V-domain Immunoglobulin-containing Suppressor of T-cell Activation) antibody, IDO (Indoleamine 2,3-dioxygenase) inhibitor, BLTA (B and T Lymphocyte Attenuator) inhibitor, B7-H3 inhibitor, B7-H4 inhibitor, B7-H3 inhibitor, galectin 9 (GAL9) inhibitor, KIR (Killer-cell Immunoglobulin-like It may be used in combination with, but is not limited to, a CCR4 inhibitor, CAR-T cells (Chimeric Antigen Receptor T cells), CAR-NK cells (Chimeric Antigen Receptor Natural Killer cells), or a combination of two or more thereof.

[0027] Unlike other anticancer viruses that are primarily administered intratumorally, the anticancer virus of the present invention can be administered intravenously, allowing for easy administration via a single route when used in combination with an immune checkpoint inhibitor that is an intravenous formulation. Furthermore, the anticancer virus of the present invention does not develop drug resistance, which reduces efficacy due to neutralization reactions even with repeated administration, and therefore a certain synergistic effect of the drug combination can be maintained even when repeatedly administered in combination with other anticancer drugs.

[0028] The composition of the present invention for the combined administration may be, but is not limited to, a composition for parenteral administration. Specifically, the parenteral administration may include intratumoral, intravenous, intraarterial, hepatic arterial, intracerebral, intraperitoneal, intramuscular, intrasternal, subcutaneous, or intranasal administration, for example, intratumoral, intravenous, intraarterial, or intraperitoneal administration, and more specifically, intravenous administration.

[0029] The anticancer virus of the present invention preferably further lacks a partial or complete deletion of the K2L region encoding serine protease inhibitor-3 (SPI-3), thereby suppressing serine protease inhibitor expression. The K2 protein plays a role in suppressing cell-cell fusion caused by vaccinia virus infection, and deletion of the K2L gene can lead to the formation of cell fusion complexes (syncytia), which can cause the rapid disappearance of infected cells, especially infected cancer cells.

[0030] In the present invention, the composition may preferably avoid a neutralizing reaction caused by an antibody against the virus.

[0031] In the present invention, the composition may be preferably intended for administration to a subject who has a neutralizing antibody against the anti-cancer virus of the present invention. Such a subject may have previously been administered with the anti-cancer virus of the present invention, or may have a neutralizing antibody due to infection with or vaccination against smallpox virus or monkeypox virus, which are in the same series as the vaccinia virus of the present invention.

[0032] The term "neutralizing antibody" as used herein refers to an antibody that protects cells by neutralizing the biological effects of infectious particles such as viruses when they infiltrate the body. Neutralizing antibodies generally perform an immune function to protect cells by binding to and inhibiting the activity of pathogens that are toxic to the body. However, they also have the same effect on anti-cancer viruses administered for anti-cancer therapy, thereby reducing the anti-cancer effect of the anti-cancer viruses. Therefore, when anti-cancer viruses are repeatedly injected, the formation of neutralizing antibodies against the viruses limits the number of injections.

[0033] The term "neutralization" as used herein refers to the immunological sensing ability of specific antibodies that prevent viruses and other pathogens from invading target cells. The neutralization of antibodies converts viruses from an infectious state to a non-infectious state, and prevents infection by binding neutralizing antibodies, which act to wrap around the antigen protein portion of the virus so that it does not bind to host receptors.

[0034] In the present invention, the avoidance of neutralization may be due to the fact that CD55 is fused to the transmembrane domain of the vaccinia virus membrane protein H3 and expressed on the IMV membrane. Specifically, by expressing CD55 on the IMV membrane using H3, a major antigen of vaccinia virus, exposure of the major viral antigen may be limited, thereby avoiding neutralization by antibodies against the virus.

[0035] By avoiding the neutralization reaction by CD55, the anticancer virus can be repeatedly administered and exhibits significantly superior anticancer effects compared to control viruses that do not express CD55. Furthermore, the anticancer virus lacking K2L and expressing CD55 exhibits significantly superior anticancer effects compared to control viruses.

[0036] Specifically, in the case of the recombinant vaccinia virus expressing CD55 of the present invention, even if antibodies are formed by repeated intravenous administration of the virus, it is possible to avoid the neutralizing reaction caused by the viral antibody and exhibit anti-cancer effects. It was experimentally confirmed that even when a neutralizing antibody against vaccinia virus is injected in advance, or when vaccinia virus is injected to induce antibody formation against the virus and then the recombinant vaccinia virus is repeatedly administered intravenously, it is possible to exhibit anti-cancer effects without being affected by the neutralizing antibody.

[0037] In one embodiment, the composition for intravenous injection for repeated administration of the present invention can be provided as a pharmaceutical composition.

[0038] The specific dosage of the pharmaceutical composition of the present invention can be selected by a person skilled in the art based on factors such as the formulation method, the patient's condition and weight, the patient's sex, age, the degree of disease, the drug form, the route and duration of administration, the excretion rate, and reaction sensitivity, and the dosage and frequency do not limit the scope of the present invention in any way. Specifically, the pharmaceutical composition of the present invention is 5 to about 10 13 These may include, but are not limited to, pfu (plaque forming units) of an anti-cancer virus.

[0039] The pharmaceutical composition of the present invention contains 1×10 5 pfu (plaque forming unit) to 1×10 13 pfu can be administered to patients at a dose of 1 x 10 5 pfu (plaque forming unit) to 1×10 13 A single dose or multiple (i.e., 1 × 10) doses of pfu 8 p.f.u., 5 × 10 8 p.f.u., 1 × 10 9 pfu) to the patient.

[0040] Specifically, 1 × 10 per single dose 5 p.f.u., 1 × 10 6 p.f.u., 1 × 10 7 p.f.u., 1 × 108 p.f.u., 1 × 10 9 p.f.u., 1 × 10 10 p.f.u., 1 × 10 11 p.f.u., 1 × 10 13 pfu or 1 x 10 5 pfu to 1 × 10 6 pfu or less, 1 x 10 6 pfu to 1 × 10 7 pfu or less, 1 x 10 7 pfu to 1 × 10 8 pfu or less, 1 x 10 8 pfu to 1 × 10 9 pfu or less, 1 x 10 9 pfu to 1 × 10 10 pfu or less, 1 x 10 10 pfu to 1 × 10 11 pfu or less, 1 x 10 11 pfu to 1 × 10 12 pfu or less or 1 x 10 12 pfu to 1 × 10 13 It can be administered in the pfu range.

[0041] The pharmaceutical compositions of the present invention may be administered in a single dose or in repeated (or multiple) doses (2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses).

[0042] When the pharmaceutical composition of the present invention is administered two or more times, it can be administered 2 to 28 days after the first administration day or the immediately preceding administration day, specifically, but not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 days after the first administration day or the immediately preceding administration day.

[0043] When the pharmaceutical composition of the present invention is administered repeatedly, the administration intervals may be, but are not limited to, daily, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 1 week, every 2 weeks, or every month, or may be at regular intervals of one or more days, or a combination of multiple intervals.

[0044] The pharmaceutical composition of the present invention can be prepared in the form of a pharmaceutical composition for treating or preventing cancer, further comprising a suitable carrier, excipient, or diluent typically used in the preparation of pharmaceutical compositions, although the carrier may include a non-naturally occurring carrier. Specifically, the pharmaceutical composition can be formulated into oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, topical preparations, suppositories, and sterile injectable solutions by conventional methods. Examples of carriers, excipients, and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulated, they are prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid formulations for oral administration include tablets, pills, powders, granules, capsules, and the like. These solid formulations are prepared by mixing at least one or more excipients, such as starch, calcium carbonate, sucrose or lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Oral liquid formulations include suspensions, oral solutions, emulsions, syrups, and the like. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as wetting agents, sweeteners, flavoring agents, and preservatives, are also used. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, and suppositories. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used.As a base for a suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin, etc. can be used.

[0045] Specific formulations of pharmaceutical compositions are known in the art, and reference can be made to, for example, Remington's Pharmaceutical Sciences (19th ed., 1995), which is incorporated herein by reference.

[0046] The pharmaceutical composition of the present invention can be administered to mammals such as rats, dogs, cats, cows, horses, pigs, and humans via various routes, with humans being preferred. For example, the intravenous composition of the present invention for repeated administration has resistance to the human complement system, avoids antibody neutralization reactions against viruses during intravenous injection, and can be administered repeatedly. It can also maintain stable anticancer activity, so it can demonstrate sufficient therapeutic effects even when administered intravenously.

[0047] In particular, the anti-cancer virus of the present invention can be applied as a composition for repeated administration, for example, two or more times, three or more times, and can be administered intravenously repeatedly by avoiding neutralization by antibodies against the virus formed by immune responses. It can also be effective against deep-seated cancers or metastatic cancers that occur in areas that are difficult to access.

[0048] The term "cancer (or tumor)" as used herein does not distinguish between primary and metastatic cancers, but includes all cancers. The cancer may include solid cancers or blood cancers. The solid cancer may be, but is not limited to, any of the following: lung cancer, colon cancer, prostate cancer, thyroid cancer, breast cancer, brain cancer, head and neck cancer, esophageal cancer, skin cancer, thymus cancer, stomach cancer, colon cancer, liver cancer, ovarian cancer, uterine cancer, bladder cancer, rectal cancer, gallbladder cancer, biliary tract cancer, pancreatic cancer, kidney cancer, osteosarcoma, sarcoma, chondrosarcoma, and combinations thereof. The blood cancer may be, but is not limited to, any of the following: lymphoma, leukemia, multiple myeloma, and combinations thereof.

[0049] The term "metastatic cancer" as used herein refers to cancer that develops when cancer cells leave the primary organ, migrate to other organs, and grow there. The metastatic cancer may include, but is not limited to, cancer tissue growing from the primary cancer and directly invading surrounding organs, as well as distant metastasis to other distant organs via blood or lymphatic vessels.

[0050] The present invention also relates to a method for treating cancer, comprising the step of intravenously administering the anticancer virus of the present invention to a patient who has previously been administered the anticancer virus of the present invention. Such an anticancer virus can be administered to a patient in the form of the above-mentioned intravenous composition.

[0051] The present invention also relates to the use of the anticancer virus of the present invention for intravenous administration to a patient who has previously been administered the anticancer virus of the present invention, which can be administered to the patient in the form of the above-mentioned intravenous composition.

[0052] In the present invention, the "patient previously administered with the anti-cancer virus of the present invention" refers to a subject who has previously been administered with the anti-cancer virus of the present invention, including a patient who has been administered with the anti-cancer virus once, twice, three times, four times, five times, six times, seven times or more, and who has a neutralizing antibody against the anti-cancer virus of the present invention.

[0053] The present invention also relates to a composition for administering the anticancer virus of the present invention to cancer patients who have been infected with vaccinia virus or a related poxvirus (e.g., smallpox virus or monkeypox virus) or who have been vaccinated to prevent infection with the virus, based on its excellent ability to evade neutralizing antibodies.

[0054] Specifically, if a patient has been infected with a virus or vaccinated, they will acquire neutralizing antibodies against the virus through active immunization. When the human body is re-exposed to the virus, the formed neutralizing antibodies bind to the viral antigens and prevent reinfection. If a cancer patient has been infected with a virus, vaccinated, or previously administered an anti-cancer virus for therapeutic purposes, neutralizing antibodies against the anti-cancer virus will be formed, and the anti-cancer effect will be continuously reduced with repeated administration, eventually losing its effectiveness. Because the anti-cancer vaccinia virus of the present invention avoids the neutralizing reaction caused by viral antibodies, it can be repeatedly intravenously injected without a decrease in anti-cancer effect in cancer patients who have been infected with poxviruses such as smallpox or monkeypox, vaccinated to prevent infection by these viruses, or previously administered an anti-cancer virus.

[0055] The composition includes the components of the intravenous composition for repeated administration described hereinabove.

[0056] Furthermore, the present invention relates to a method or use for cancer treatment, which comprises administering the anticancer virus of the present invention to a subject who has been infected with or vaccinated against such a vaccinia virus or a poxvirus of the same series (e.g., smallpox virus or monkeypox virus).

[0057] In one aspect to achieve the above object, the present invention provides a method for preventing or treating cancer, comprising administering to an individual an intravenous composition for repeated administration, in which expression of the thymidine kinase (TK) gene is inhibited; a gene encoding the complement regulatory protein CD55 fused with the transmembrane domain region of a viral membrane protein and a gene encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) have been inserted such that CD55 is expressed on the membrane of intracellular mature virions (IMVs); and an anticancer virus is used as an active ingredient.

[0058] The term "composition" of the present invention is as defined above.

[0059] The individual may be a mammal, including, but not limited to, humans, cattle, sheep, goats, horses, pigs, dogs, cats, rabbits, rats, mice, fish, and birds. The individual may also be, but is not limited to, a subject that has been infected with or vaccinated against vaccinia virus or a poxvirus of the same series (e.g., small pox virus or monkeypox virus).

[0060] In the present invention, the cancer treatment method includes a treatment method using a conventionally known anticancer agent and anticancer therapy in combination.

[0061] To achieve the above object, another aspect of the present invention provides use of a composition containing the above anticancer virus for the prevention or treatment of cancer.

[0062] Effect of the invention When the composition of the present invention is administered into the body, the expression of CD55 circumvents the neutralizing reaction of antibodies against the virus, allowing repeated intravenous administration of the anti-cancer virus, thereby preventing a decrease in the anti-cancer effect of neutralizing antibodies and maximizing the anti-cancer effect. [Brief explanation of the drawings]

[0063] [Figure 1] FIG. 1 is a diagram of recombinant vaccinia virus SJ-607, which lacks the J2R gene and contains human GM-CSF and human CD55 fused to a transmembrane domain. [Figure 2] FIG. 2 is a diagram of recombinant vaccinia virus mSJ-612, which is deleted for the K2L and J2R genes and expresses mouse GM-CSF. [Figure 3] FIG. 3 is a schematic representation of recombinant vaccinia virus mSJ-650, which is deleted for the K2L and J2R genes and expresses mouse GM-CSF and human CD55 fused to a transmembrane domain. [Figure 4] FIG. 4 shows the results of examining the neutralizing antibody titer over time when the recombinant vaccinia virus SJ-607 of the present invention was intravenously administered to BALB / c mice. [Figure 5] FIG. 5 shows the results of examining the neutralizing antibody titer over time when the control recombinant vaccinia virus JX-594 was intravenously administered to BALB / c mice. [Figure 6] FIG. 6 shows the results of examining the neutralizing antibody titer over time when the recombinant vaccinia virus SJ-607 of the present invention was intravenously administered to C57BL / 6 mice. [Figure 7] FIG. 7 shows the results of examining the neutralizing antibody titer over time when the control recombinant vaccinia virus JX-594 was intravenously administered to C57BL / 6 mice. [Figure 8] FIG. 8 shows the results of confirming the amount of antibody produced against vaccinia virus JX-594 when JX-594 and SJ-607 were repeatedly administered intravenously to BALB / c mice. [Figure 9] FIG. 9 shows the results of confirming the amount of antibody produced against vaccinia virus SJ-607 when JX-594 and SJ-607 were repeatedly administered intravenously to BALB / c mice. [Figure 10] Figure 10 shows the results of measuring the neutralizing antibody titers against JX-594 or SJ-607 of antibodies against vaccinia virus present in the blood when JX-594 and SJ-607 were repeatedly administered intravenously to BALB / c mice. [Figure 11] Figure 11 shows the results of measuring the neutralizing antibody titers against JX-594 or SJ-607 of antibodies against vaccinia virus present in the blood when JX-594 and SJ-607 were repeatedly administered intravenously to C57BL / 6 mice. [Figure 12] Figure 12 shows the results of measuring the tumor growth inhibitory effect when mSJ-650, which expresses CD55 on the IMV membrane, or mSJ-612, which does not express CD55, was repeatedly administered intravenously at low or high doses to a mouse breast cancer model. [Figure 13] FIG. 13 shows the results of measuring changes in body weight when mSJ-650 or mSJ-612 was repeatedly administered intravenously at low or high doses to a mouse breast cancer model. [Figure 14] Figure 14 shows the results of repeated intravenous administration of mSJ-650 or mSJ-612 to a mouse breast cancer model, and measurement of the neutralizing antibody titers against mSJ-650 or mSJ-612 of antibodies against the virus formed in the blood three weeks after the initial virus administration. [Figure 15] Figure 15 shows the results of repeated intravenous administration of mSJ-650 to BALB / c mice to obtain serum containing neutralizing antibodies against anti-cancer vaccinia virus, and measurement of neutralizing antibody titers against mSJ-650 or mSJ-612 in the mouse blood 4 weeks after the initial virus administration. [Figure 16] Figure 16 shows the results of measuring the tumor growth inhibitory effect in a mouse breast cancer model when serum containing neutralizing antibodies was administered into the tail vein of mice every day before virus administration and mSJ-650 or mSJ-612 was repeatedly administered intravenously. [Figure 17] Figure 17 shows the results of measuring weight changes in a mouse breast cancer model in which serum containing neutralizing antibodies was administered into the tail vein of mice every day before virus administration, and mSJ-650 or mSJ-612 was administered intravenously repeatedly. [Figure 18] Figure 18 shows the results of measuring the tumor growth inhibitory effect when mSJ-650 or mSJ-612 was repeatedly administered intravenously to a mouse breast cancer model in which the virus was administered in advance to induce the formation of neutralizing antibodies against vaccinia virus in the individual. [Figure 19] Figure 19 shows the results of measuring body weight changes in a mouse breast cancer model in which the virus was administered in advance to induce the formation of neutralizing antibodies against vaccinia virus in the individual, and mSJ-650 or mSJ-612 was administered intravenously repeatedly. [Figure 20] Figure 20 shows the results of a mouse breast cancer model in which the virus was administered in advance to induce the formation of neutralizing antibodies against vaccinia virus in the individual, and mSJ-650 or mSJ-612 was administered intravenously repeatedly, and the tumor size or weight was measured 21 days after tumor implantation. [Example]

[0064] The present invention will be described in more detail with reference to the following examples, which are merely illustrative of the present invention and are not intended to limit the scope of the present invention.

[0065] The present inventors have constructed a vector in which the expression of the thymidine kinase (TK) gene is suppressed and a gene encoding the complement regulatory protein CD55 fused with the transmembrane domain region of a viral membrane protein so that CD55 is expressed on the membrane of intracellular mature virions (IMVs) and a gene encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) are inserted. They then produced a recombinant vaccinia virus in which expression of the above genes was induced by homologous recombination between the vector and vaccinia virus, and confirmed that this virus can be administered repeatedly without causing a neutralizing reaction when administered in vivo.

[0066] Production Example 1: Production of recombinant vaccinia virus SJ-607 lacking the J2R gene and expressing human GM-CSF and human CD55 As shown in Figure 1, the J2R region encoding thymidine kinase (TK) was completely deleted from the vaccinia virus strain Wire, and genes encoding human CD55 (hCD55) and human GM-CSF (hGM-CSF) were inserted into this region to produce a recombinant vaccinia virus. To express hCD55 in the intracellular mature virus (IMV) membrane of the virus, the hCD55 gene, minus the GPI anchor region, was fused to the transmembrane domain and intravirion region (C-terminal region) of the vaccinia virus membrane protein H3, and the pLate promoter was used for expression. The specific process is as follows:

[0067] 1.1. Construction of plasmid vectors expressing hGM-CSF and hCD55 genes To delete the J2R region of vaccinia virus, T-blunt TM The J1R and J3R genes, which are the left and right flanking regions of the J2R region, were inserted into a vector (Solgent) using NEBuilder. (R)Cloning was performed using the HiFi DNA Assembly Cloning Kit (NEW ENGLAND BioLabs, Catalog No. M5520A). J1R and J3R DNAs were amplified by PCR using the corresponding regions of JX-594 (Pexastimogene Devacirepvec, Pexa-Vec) as a template. J1R is identical to the region from amino acids 1 to 154 of J1R (Protein ID = AAR17936.1) of the vaccinia virus Acamins 2000 strain, except that amino acid 118 is substituted from alanine to serine. J3R (Protein ID = AAR17938.1) is the region from amino acids 1 to 145. This vector was cloned with hGM-CSF (GenBank: M10663.1) driven by the vaccinia virus synthetic early-late promoter, the complement regulatory protein hCD55 gene (GenBank: NM_000574.3) driven by the vaccinia virus late promoter, and the transmembrane domain and intravirion region of vaccinia virus H3L to complete the shuttle vector. The amino acid and gene sequences of hCD55 and hGM-CSF used are shown in SEQ ID NOs: 1 to 4 in Table 2, respectively.

[0068] [Table 2]

[0069] The transmembrane and intraviral domains of hGM-CSF and H3L were amplified by PCR from JX-594, and hCD55 was amplified by PCR from the pCMV3 plasmid (Sinobio, Catalog No. HG10101-UT). hGM-CSF (GenBank: M10663.1) was expressed from amino acids 1 to 145 using a synthetic early-late promoter (aaaaattgaaattttattttttttttttggaatataaata, SEQ ID NO: 5, pSEL, amplified by PCR from Pexavec). hCD55 (GenBank: NM_000574.3) was expressed from amino acids 1 to 352, with the GPI anchor region deleted, using a synthetic late promoter (ttttttttttttttttttttggcatataaata, SEQ ID NO: 6, pLate, synthesized by Macrogen). The 3' end of the hCD55 gene was fused to the transmembrane domain and intravirion region of vaccinia virus H3L, allowing CD55 to be expressed on the intracellular membrane of the virus. The information and nucleotide sequence of the transmembrane domain region of H3L used are shown in Tables 3 and 4.

[0070] [Table 3]

[0071] [Table 4]

[0072] 1.2. Production of SJ-607 recombinant vaccinia virus by homologous recombination The SJ-607 recombinant vaccinia virus was produced by homologous recombination of the wild-type vaccinia virus strain Wire with a pre-constructed plasmid vector encoding the hGM-CSF and hCD55 genes.

[0073] The wild-type Wire strain was prepared by inserting the J2R region gene of the Western Reserve (WR) vaccinia virus strain (ATCC, Catalog No. VR-1354) into the inactivated J2R region (TK region) of JX-594 (Pexastimogene Devacirepvec, Pexa-Vec). The J2R region gene of the Western Reserve strain (Protein ID = YP_232976.1) corresponds to amino acids 1 to 178. The J2R region gene of the Western Reserve strain was amplified by PCR, and the wild-type Wire strain was constructed by homologous recombination of this PCR product with JX-594.

[0074] To generate SJ-607, 143B osteosarcoma cells (Creative Bioarray) were infected with the wild-type WYAS strain and transfected with a plasmid vector expressing hGM-CSF and hCD55. To select for recombinant SJ-607 virus plaques lacking the TK domain, 143B osteosarcoma cells were infected with vaccinia virus and transfected with the plasmid vector. The cell lysates were treated with 5-Bromo-2'-deoxyuridine (BrdU), a TK deletion selection reagent, and then cultured. The selected recombinant virus plaques were then passaged twice more in 143B cells to obtain the purified single clone SJ-607. The nucleotide sequence of the recombination site of SJ-607 was confirmed by sequencing.

[0075] Finally, the structure of SJ-607 produced in the above production example is as shown in FIG.

[0076] Production Example 2: Production of recombinant vaccinia virus mSJ-612 lacking the K2L and J2R genes and expressing mouse GM-CSF As shown in Figure 2, mouse GM-CSF (mGM-CSF) was inserted into the J2R region encoding thymidine kinase of the vaccinia virus Wyers strain to inactivate TK expression and construct a recombinant vaccinia virus lacking the K2L region encoding serine proteases inhibitor-3 (SPI-3). The promoter for mGM-CSF expression was the vaccinia virus promoter p7.5 (ccgtgcaataaattagaatatattttctacttttacgagaaattaattattgtatttattattattatgggtgaaaaacttactataaaaagcgggtgggtttgga, SEQ ID NO: 7). The specific process is as follows.

[0077] 2.1. Construction of a plasmid vector for deleting the K2L gene To delete the vaccinia virus K2L region, T-blunt TM The K1L and K3L to K4L genes, which are the left and right flanking regions of the K2L region, were cloned into the vector. K1L, K3L, and K4L DNA were amplified by PCR using the corresponding regions of JX-594 (Pexastimogene Devacirepvec, Pexa-Vec) as a template. The K1L gene is identical to the region located at amino acids 1 to 94 of K1L (Protein ID=AAR17875.1) of the vaccinia virus Acambis 2000 strain. K3L (Protein ID=AAR17877.1) is identical to the region located at amino acids 1 to 88, and K4L (Protein ID=AAR17878.1) is identical to the region located at amino acids 382 to 424.

[0078] 2.2. Production of mSJ-612 recombinant vaccinia virus by homologous recombination The mSJ-612 recombinant vaccinia virus was produced by homologous recombination of a previously constructed plasmid vector that deleted the K2L region into a Wire strain vaccinia virus (provided by Generex) in which TK expression had been inactivated by inserting mGM-CSF (GenBank: X02333.1) into the J2R region. The amino acid sequence and gene sequence of the mouse GM-CSF used are shown in SEQ ID NOs: 8 and 9, respectively, in Table 5.

[0079] [Table 5]

[0080] To generate mSJ-612, U-2 OS osteosarcoma cells (ATCC) were infected with a virus in which mGM-CSF was inserted into the J2R region to inactivate TK expression, and then transfected with a plasmid vector that deleted the K2L region. The recombinant virus mSJ-v612, lacking the K2L region, was then generated using conventional methods. The nucleotide sequence of the recombination site was confirmed by sequencing.

[0081] Production Example 3: Production of recombinant vaccinia virus mSJ-650 lacking the K2L gene and J2R gene and expressing mouse GM-CSF and human CD55 First, the K2L region encoding the serine protease inhibitor enzyme (SPI-3) of the vaccinia virus of the Wys strain was deleted, and then mGM-CSF and hCD55 were inserted into the J2R region encoding thymidine kinase (TK) to produce the recombinant vaccinia virus mSJ-v650 (Figure 3). To express hCD55 in the viral IMV membrane, the hCD55 gene, minus the GPI anchor region, was fused to the transmembrane domain and intravirion region of the vaccinia virus membrane protein H3. The pLate promoter was used for expression. The specific process is as follows.

[0082] 3.1. Plasmid vector for deleting the K2L gene The plasmid vector used in the production of the recombinant vaccinia virus in Production Example 2 was used.

[0083] 3.2. Construction of a plasmid vector lacking the J2R gene and encoding the expression of mouse GM-CSF and human CD55 genes

[0084] The J2R gene was deleted in the same manner as in the plasmid vector used to produce the recombinant vaccinia virus in Preparation Example 1, except that mGM-CSF (GenBank: X02333.1) expressed by the vaccinia virus p7.5 promoter was used, and a plasmid vector encoding the mGM-CSF and hCD55 genes was prepared.

[0085] 3.3. Production of mSJ-650 recombinant vaccinia virus by homologous recombination The mSJ-650 recombinant vaccinia virus was prepared by homologous recombination of the wild-type vaccinia virus strain with a previously prepared plasmid vector that deleted the K2L region, followed by homologous recombination of a plasmid vector that deleted the J2R gene and encoded the mGM-CSF and hCD55 genes.

[0086] First, a recombinant vaccinia virus lacking the K2L region was prepared by using the wild-type vaccinia virus strain prepared in Preparation Example 1 and the plasmid vector lacking the K2L region prepared in Preparation Example 2 in the same manner as in Preparation Example 2. Next, the recombinant vaccinia virus lacking the K2L region and the plasmid vector encoding the mGM-CSF and hCD55 genes were used in the same manner as in Preparation Example 1 to generate recombinant vaccinia virus mSJ-650 lacking the K2L and J2R genes and expressing mGM-CSF and hCD55. The nucleotide sequence of the mSJ-650 recombination site was confirmed by sequencing.

[0087] Example 1: Confirmation of neutralizing antibody formation after SJ-607 administration in mice The recombinant vaccinia virus SJ-607 prepared in Preparation Example 1 was administered intravenously to the tail of BALB / c mice or C57BL / 6 mice (5×10 6pfu, either once or three times at weekly intervals). JX-594 (Pexa-vec), a control virus with inactivated TK and expressing hGM-CSF and Lac-Z, was used. Blood samples were collected from the retroorbital vein of mice immediately before virus administration, and then at weekly intervals for 5 weeks (7, 14, 21, 28, and 35 days before and after virus administration, respectively). The collected blood samples were left at room temperature for 60 minutes and then centrifuged at 4°C to separate the serum. The separated serum was then heated at 56°C for 30 minutes to inactivate serum complement, and neutralizing antibody formation against JX-594 or SJ-607 was assayed. The heat-treated serum was diluted 10-fold to 316,228-fold in cell culture medium and then incubated with JX-594 or SJ-607 for 2 hours to allow the anti-cancer vaccinia virus neutralizing antibodies in the serum to neutralize the virus. JX-594 or SJ-607 diluted in serum was then infected with U-2 OS human osteosarcoma cells seeded in a 96-well plate and cultured at 37°C for 3 days before observing cell death. The viability of U-2 OS cells 3 days after virus infection was assessed by measuring absorbance at 450 nm after treatment with Cell Counting Kit-8 (Dojindo). Neutralizing antibody titers (Titer) were calculated. 50 ) was determined as the maximum dilution at which 50% or more of U-2 OS cells survived.

[0088] As a result, when BALB / c mice were intravenously administered the SJ-607 anticancer vaccinia virus, no significant neutralizing response to SJ-607 was observed during any observation period after administration, either in a single dose or three doses at one-week intervals (Figure 4).

[0089] Meanwhile, when JX-594 anti-cancer vaccinia virus was administered intravenously, neutralizing antibodies began to form two weeks after administration, with a single administration reaching a peak at week four, and three weeks after three weekly administrations, maintaining the peak until the final observation point of week five after administration. Furthermore, the neutralizing efficacy was more than 10-fold higher with three weekly administrations compared to a single administration (Figure 5).

[0090] Similarly, in the case of C57BL / 6 mice, when the SJ-607 anticancer vaccinia virus was administered intravenously, no significant neutralizing response to SJ-607 was observed up to 35 days after administration, either in a single dose or three doses administered at weekly intervals (Figure 6).

[0091] On the other hand, when the JX-594 anti-cancer vaccinia virus was administered intravenously, in the case of a single administration, neutralizing efficacy was observed only at the final observation point, week 5 of administration. In the case of three administrations at weekly intervals, the neutralizing response to JX-594 began to appear from week 2 of administration, with the maximum value measured at week 4 (Figure 7).

[0092] Example 2: Confirmation of antibody formation against SJ-607 vaccinia virus To confirm the presence or absence of antibody formation against the SJ-607 vaccinia virus, naive BALB / c mice were injected with either the JX-594 anti-cancer vaccinia virus or the SJ-607 anti-cancer vaccinia virus via the tail vein at a dose of 5 × 10 6Three doses of 1000pfu were administered at weekly intervals. Blood samples were collected from the orbital vein of each mouse at weeks 3, 4, and 5 after the initial virus administration. The samples were then incubated at room temperature for 60 minutes and centrifuged at 4°C to separate the serum. The isolated serum was then heat-treated at 56°C for 30 minutes to inactivate serum complement. Antibody levels of vaccinia virus in the serum were quantified using an enzyme-linked immunosorbent assay (ELISA). Clear flat-bottom immuno 96-well plates were coated with vaccinia virus JX-594 or SJ-607 and incubated overnight at 4°C to coat the virus. The following day, the plates were blocked with 5% BSA and 0.05% Tween 20 for 2 hours, followed by incubation with heat-treated serum diluted 10- to 100,000-fold in PBS at room temperature for 1 hour. To detect antibodies against vaccinia virus in serum, the samples were incubated with an anti-mouse secondary antibody conjugated with HRP (Invitrogen, Catalog No. G21040) at room temperature for 30 minutes, and then the HRP activity was analyzed by treating with TMB substrate and measuring the absorbance at 450 nm.

[0093] As a result, antibodies against the JX-594 vaccinia virus were produced to the same extent in both mice repeatedly administered with the JX-594 vaccinia virus and mice repeatedly administered with the SJ-607 vaccinia virus (Figure 8). Antibodies against the SJ-607 vaccinia virus were also produced to the same extent in both mice repeatedly administered with the JX-594 vaccinia virus and mice repeatedly administered with the SJ-607 vaccinia virus (Figure 9). Therefore, we were able to confirm that intravenous administration of anticancer vaccinia viruses induces similar levels of antibody formation against vaccinia viruses, regardless of hCD55 expression on the IMV membrane.

[0094] Example 3: Confirmation of the ability of SJ-607 to evade the neutralization response of vaccinia virus antibodies To confirm the ability of SJ-607 vaccinia virus to evade the neutralization response of vaccinia virus antibodies, naive BALB / c or C57BL / 6 mice were injected with 5 × 10 anti-cancer vaccinia viruses JX-594 or SJ-607 via the tail vein.6 The mice were administered a single dose of pfu or three doses at weekly intervals. Three and four weeks after the initial virus administration, blood samples were collected from the retroorbital vein of the mice, incubated at room temperature for 60 minutes, and then centrifuged at 4°C to separate the serum. The isolated serum was heat-treated at 56°C for 30 minutes to inactivate serum complement. Neutralizing antibody titration assays were used to assess the neutralization of vaccinia virus antibodies present in the blood of mice given repeated intravenous injections of JX-594 against JX-594 and SJ-607, as well as the neutralization of vaccinia virus antibodies present in the blood of mice given repeated intravenous injections of SJ-607. Heat-treated serum was diluted 10-fold to 316,228-fold in cell culture medium and then incubated with JX-594 or SJ-607 for 2 hours to allow neutralizing antibodies present in the serum against the anti-cancer vaccinia virus to neutralize the virus. JX-594 or SJ-607 diluted in serum was used to infect U-2 OS human osteosarcoma cells seeded in 96-well plates and cultured at 37°C for 3 days before observing cell death. The viability of U-2 OS cells 3 days after virus infection was assessed by measuring absorbance at 450 nm after treatment with Cell Counting Kit-8 (Dojindo). Neutralizing antibody titers were determined at the highest dilution at which 50% or more of the U-2 OS cells survived.

[0144] The results showed that antibodies against vaccinia virus present in the blood of BALB / c mice injected with JX-594 vaccinia virus effectively neutralized JX-594, but did not show a neutralizing response to SJ-607 to a similar extent as in mice injected with SJ-607. On the other hand, antibodies against vaccinia virus present in the blood of mice injected with SJ-607 neutralized JX-594 vaccinia virus to a similar extent as in mice injected with JX-594 (Figure 10). These results were also observed in C57BL / 6 mice (Figure 11). Therefore, although antibodies against vaccinia virus were formed in mice injected with SJ-607 vaccinia virus, the SJ-607 vaccinia virus, unlike JX-594, was found to be able to evade neutralization by antibodies against vaccinia virus.

[0095] Example 4: Confirmation of antitumor effect upon repeated intravenous administration in a breast cancer model 4.1. Confirmation of tumor growth inhibitory effect The mouse triple-negative breast cancer cell line EMT-62 × 10 cells were transfected into the mammary fat pads of immunocompetent inbred BALB / c mice. 5 A syngeneic stereotactic breast cancer model was established by orthotopic transplantation of the tumors. 3 When the tumor growth rate reached 100%, mSJ-650 (Production Example 3), which expresses CD55 on the viral IMV membrane, or the control virus mSJ-612 (Production Example 2), which does not express CD55, was administered intravenously twice a week at 3-4 day intervals through the tail vein of the mice to compare the tumor growth inhibitory effects of the viruses. mSJ-650 and mSJ-612 were administered at low concentrations (1 x 10 6 pfu) or high concentration (3 × 10 6 pfu) was administered intravenously.

[0096] Twenty-one days after the first virus administration, blood samples were collected from the orbital vein of each mouse and incubated at room temperature for 30 minutes. Serum was then separated by centrifugation at room temperature for 5 minutes. The isolated serum was heat-treated at 56°C for 30 minutes to inactivate serum complement, and neutralizing antibodies against mSJ-612 or mSJ-650 were then measured. The heat-treated serum was diluted 10-fold to 316,228-fold in cell culture medium and then incubated with mSJ-612 or mSJ-650 for 2 hours to allow the anti-vaccinia virus neutralizing antibodies in the serum to neutralize the virus. The diluted serum was then used to infect U-2 OS human osteosarcoma cells seeded in 96-well plates. After incubation at 37°C for 3 days, cell death was observed. Three days after virus infection, the viability of U-2 OS cells was assessed by measuring absorbance at 450 nm after treatment with Cell Counting Kit-8 (Dojindo). The neutralizing antibody titer was determined at the highest dilution at which 50% or more of U-2 OS cells survived.

[0097] As a result, both mSJ-612 and mSJ-650 showed significant tumor growth inhibitory effects compared to the negative control group (PBS), and specifically, repeated intravenous administration of mSJ-650 suppressed tumor growth more significantly than repeated intravenous administration of mSJ-612 (Figure 12). However, no significant differences were observed in mouse weight changes among all experimental groups (Figure 13).

[0098] 4.2. Confirmation of neutralization reaction avoidance ability 3×10 anticancer viruses were injected into the mouse breast cancer EMT-6 tumor model. 6 The virus was administered intravenously twice a week at 3-4 day intervals (pfu), and the amount of neutralizing antibody produced against the mSJ-612 or mSJ-650 virus in the mouse blood was measured 21 days after the initial virus administration.

[0099] As a result, as shown in Figure 14, a large amount of antibodies neutralizing mSJ-612 were formed in the blood of mice repeatedly administered with mSJ-612, which does not express CD55 (average titer 50The neutralizing activity of the same sample against mSJ-650 was approximately 389.2 times lower than that of mSJ-612 (mean titer 50 On the other hand, although some antibodies neutralizing mSJ-650 were formed in the blood of mice repeatedly administered with CD55-expressing mSJ-650 (mean titer 50 ≒25.7), which was approximately 50.9 times lower than the neutralizing activity of the same sample against mSJ-612 (mean titer 50 ≒1,308.9).

[0100] These results again demonstrate that antibodies to vaccinia virus are generated sufficiently after injection of CD55-expressing vaccinia virus, but that CD55-expressing virus can evade the neutralizing effect of these antibodies.

[0101] Example 5: Confirmation of resistance to mSJ-650 anti-cancer virus neutralizing antibody upon repeated intravenous administration in a breast cancer model 5.1. Direct injection of neutralizing antibodies model To obtain serum containing neutralizing antibodies against the anti-cancer vaccinia virus, 20 immunocompetent inbred BALB / c mice were infected with 5 x 10 of the anti-cancer vaccinia virus mSJ-650. 6 pfu was administered to mice via the tail vein two to three times at weekly intervals. Whole blood was collected from the mice 28 days after the first virus administration. The collected blood samples were left to stand at room temperature for 30 minutes and then centrifuged at room temperature for 5 minutes to separate the serum. The separated serum was mixed and dispensed, and then frozen at -80°C until use. The amount of neutralizing antibodies present in the serum was measured in the same manner as in Example 4.

[0102] As a result, it was confirmed that vaccinia virus antibodies present in the blood of mice were able to neutralize mSJ-612 to a degree approximately 300 times higher than that of mSJ-650 (FIG. 15).

[0103] On the other hand, in the mouse breast cancer model established in Example 4.1, the tumor size was approximately 50 to 70 mm 3When the virus reached 100 μg / ml, 3 × 10 cells were added to the cells. The cells were then treated with either mSJ-650, which expresses CD55 on the viral IMV membrane, or the control virus mSJ-612, which does not express CD55. 6 The anti-cancer virus mSJ-650 was administered intravenously twice a week at 3-4 day intervals via the tail vein of mice at pfu. To verify the ability of the anti-cancer virus mSJ-650 to evade neutralization, serum containing neutralizing antibodies was diluted in PBS and administered to the tail vein of mice one day before each administration of the therapeutic anti-cancer virus, and the tumor growth inhibitory effects were compared.

[0104] As a result, as shown in Figure 16, administration of mSJ-650 showed a significant tumor growth inhibitory effect compared to the negative control group (PBS) from day 9 after tumor inoculation, regardless of whether or not serum containing antibodies against vaccinia virus was injected. On the other hand, administration of mSJ-612 showed tumor growth inhibitory effect without injection of serum containing antibodies against the virus, but the level was lower than that of administration of mSJ-650, and no tumor growth inhibitory effect was observed when serum containing antibodies was injected. Furthermore, no significant differences were observed in the weight changes of mice in all experimental groups (Figure 17).

[0105] 5.2. Neutralizing antibody induction model by repeated virus injection Two weeks before tumor cell transplantation into immunocompetent BALB / c mice, mSJ-650 virus was injected at 3 × 10 6 pfu of the virus was administered intravenously twice at a weekly interval through the tail vein of mice to induce antibody formation against the virus. Two weeks after the first virus administration, 2 × 10 EMT-6 triple-negative breast cancer cell lines were injected into the mammary fat pads of the mice. 5 A syngeneic stereotactic breast cancer model was established by orthotopic transplantation of the tumors. 3 When the virus reached 100 μg / ml, 3 × 10 cells were added to the cells. The virus mSJ-650, which expresses CD55 on the viral IMV membrane, or the control virus mSJ-612, which does not express CD55, was added to the cells. 6The mSJ-650 anti-cancer virus and mSJ-612 virus were administered intravenously twice a week at 3-4 day intervals via the tail vein of mice in a dose of pfu. The tumor growth inhibitory effects of the mSJ-650 anti-cancer virus and mSJ-612 virus were compared and evaluated between a group that had been administered the virus before tumor implantation to induce intra-individual neutralizing antibody formation against vaccinia virus and a group that had not been administered the virus, and the ability of the mSJ-650 anti-cancer virus to evade neutralization responses was examined.

[0106] As a result, as shown in Figure 18, administration of mSJ-650 showed a significant tumor growth inhibitory effect, regardless of whether or not the virus was administered beforehand. On the other hand, administration of mSJ-612 showed a tumor growth inhibitory effect without prior administration of the virus, but at a lower level than administration of mSJ-650, and no tumor growth inhibitory effect was observed when the virus was administered beforehand. Meanwhile, no significant differences were observed in the weight changes of mice in any of the experimental groups (Figure 19).

[0107] Furthermore, 21 days after the implantation of EMT-6 mouse breast cancer cells, mice were sacrificed and tumors were extracted and weighed. Compared to the negative control group (PBS) without virus injection, no significant difference in tumor size was observed in the group pre-injected with vaccinia virus and administered with mSJ-612, while significant tumor size reduction was observed in the remaining groups. Compared to the group administered with mSJ-612 without vaccinia virus pre-injection, the group pre-injected with vaccinia virus and administered with mSJ-650 also showed significant tumor size reduction. In other words, the mSJ-650 group exhibited tumor growth inhibition regardless of pre-injection with virus, demonstrating that, unlike the mSJ-612 group, the anti-cancer effect of the virus was not reduced by neutralizing antibodies (Figure 20).

[0108] From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are illustrative in all respects and are not limiting. The scope of the present invention should be interpreted as including all modifications and variations derived from the meaning and scope of the claims below, and equivalent concepts thereof, rather than the above detailed description.

Claims

1. The expression of the thymidine kinase (TK) gene is suppressed; The gene encoding the complement regulatory protein CD55 fused with the transmembrane domain region of the viral membrane protein and the gene encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) were inserted so that CD55 would be expressed on the membrane of the intracellular mature virion (IMV); A composition for intravenous injection for repeated administration, comprising an anti-cancer virus as an active ingredient.

2. The intravenous composition for repeated administration according to claim 1, wherein the CD55 is composed of the sequence of SEQ ID NO:

1.

3. The intravenous composition for repeated administration according to claim 1, wherein the anticancer viral membrane protein is D8L, A16L, F9L, G9R, H3L, L1R, A9L, A13L, A21L, A28L, E10R, G3L, H2R, I2L, J5L, L5R or O3L.

4. The intravenous composition for repeated administration according to claim 1, wherein the anti-cancer virus is a vaccinia virus, adenovirus, herpes simplex virus, retrovirus, reovirus, Newcastle disease virus, coxsackievirus, enterovirus or herpesvirus.

5. 5. The intravenous composition for repeated administration according to claim 4, wherein the vaccinia virus is Western Reserve (WR), NYVAC (New York Vaccinia Virus), Wyeth, LC16m8, Lister, Copenhagen, Tian Tan, USSR, TashKent, Evans, IHD-J (International Health Division-J) or IHD-W (International Health Division-White) strain.

6. The intravenous composition for repeated administration according to claim 1, wherein the composition avoids a neutralization reaction caused by antibodies against the virus.

7. The intravenous composition for repeated administration according to claim 6, wherein the neutralization response avoidance is due to expression of CD55.

8. The intravenous composition for repeated administration according to claim 1, wherein the anti-cancer virus has suppressed expression of a serine proteases inhibitor-3 (SPI-3) gene.

9. A method for preventing or treating cancer, comprising administering to an individual a composition according to any one of claims 1 to 8.

10. 10. Use of a composition according to any one of claims 1 to 8 for the prevention or treatment of cancer.

11. 10. Use of a composition according to any one of claims 1 to 8 for the manufacture of a medicament for the prevention or treatment of cancer.

Images