Vanoxerine, used to treat brain, breast, pancreatic, and lung cancer

Abstract

The present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject Compound 1(I). JPEG2025533522000028.jpg57165, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising Compound 1, or a pharmaceutically acceptable salt thereof. Also provided are pharmaceutical compositions for treating cancer. In one aspect, the present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of Compound 1, or a pharmaceutically acceptable salt thereof, wherein the cancer is selected from brain cancer, breast cancer, pancreatic cancer, lung cancer, or any combination thereof.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This PCT application claims the benefit of Indian Patent Application No. 202211055079, filed September 26, 2022, and U.S. Provisional Application No. 63 / 382,653, filed November 7, 2022. The entire contents of the foregoing applications are hereby incorporated by reference in their entirety.

[0002] The present invention relates to compounds and methods of treatment for cancer in subjects in need thereof. [Background technology]

[0003] Cancer remains one of the most deadly threats to human health. Certain cancers are metastatic and grow rapidly and uncontrolled, making timely detection and treatment extremely difficult. In the United States, cancer affects approximately 1.9 million new patients each year and is the second leading cause of death after heart disease. Although numerous anticancer drugs have been approved for therapeutic use, few are effective against a wide range of cancers. This is due to the significant variability that can exist between individual cancers. Furthermore, most anticancer drugs are believed to treat cancer through multiple mechanisms of action, further reducing the number of drugs that are broadly effective against a wide range of cancers. Most current efforts focus on cancer treatment, with little emphasis on quality of life for patients undergoing cancer treatment, end-of-life care management, or palliative care for patients with terminal glioblastoma multiforme.

[0004] Gliomas are a type of primary tumor that develops in the brain or spine. The most common type of glioma is astrocytoma. Astrocytomas are graded on a scale of I to IV based on whether the cells are normal or abnormal: Grade I - pilocytic astrocytoma; Grade II - diffuse astrocytoma; Grade III - anaplastic astrocytoma; Grade IV - glioblastoma, also known as glioblastoma multiforme (GBM). Low-grade astrocytomas are usually localized and grow over time. High-grade astrocytomas grow rapidly and require different treatment methods.

[0005] GBM accounts for approximately 48% of all primary malignant brain tumors and is typically fatal within 12-15 months of diagnosis. The 5-year survival rate for GBM is 3-7%.

[0006] Currently, there is no known way to prevent GBM. Furthermore, treating GBM can be extremely challenging due to a variety of factors, including the brain's limited ability to repair itself, the difficulty of drugs crossing the blood-brain barrier, potential brain damage from conventional treatments (e.g., aggressive chemotherapy, radiation therapy, and / or surgery), and the difficulty of surgically removing all cancer cells due to tumor infiltration throughout the brain. Due to the aforementioned challenges in treating GBM, most care for GBM patients involves palliative care, care aimed at slowing the spread of the disease, and other measures aimed at temporarily improving the survival and lifestyle of GBM patients.

[0007] Thus, there remains a need for compounds and methods for treating cancer in general, and GBM in particular. Toward this end, the compounds, pharmaceutically acceptable salts thereof, pharmaceutical compositions, and methods described herein are directed. Summary of the Invention [Means for solving the problem]

[0008] The present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject Compound 1 [ka] or a pharmaceutically acceptable salt thereof.

[0009] In one aspect, the present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of Compound 1. [ka] or a pharmaceutically acceptable salt thereof, wherein the cancer is selected from brain cancer, breast cancer, pancreatic cancer, lung cancer, or any combination thereof.

[0010] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is the hydrochloride salt of Compound 1. Also, in some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is the dihydrochloride salt of Compound 1.

[0011] In some embodiments, the cancer is a brain tumor.

[0012] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, ZNF75A, or any combination thereof in cancer cells. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in cancer cells.

[0013] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient, or diluent. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily (e.g., once daily, at least twice daily, twice daily, or three times daily).

[0014] In some embodiments, the method further comprises administering an additional therapeutic agent to the subject. In some embodiments, the additional therapeutic agent is an anticancer agent. In some embodiments, the anticancer agent is selected from temozolomide, ixabepilone, cladribine, enzalutamide, omacetaxine mepesuxinate, epothilone, erbulin, latrunculin, a pharmaceutically acceptable salt of any of these anticancer agents, or any combination thereof. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are orally administered simultaneously. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are orally administered sequentially. In some embodiments, the method further comprises administering radiation therapy to the subject.

[0015] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 1,000 mg. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 25 mg to about 750 mg. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 300 mg.

[0016] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered chronically. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment.

[0017] In some embodiments, the subject experiences reduced weight loss after initiation of treatment compared to a subject not administered Compound 1 or a pharmaceutically acceptable salt thereof. In some embodiments, the subject experiences mitochondrial vacuolation in cancer cells after initiation of treatment. Also, in some embodiments, the subject is a human.

[0018] Another aspect of the present invention is a method of treating glioma in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of Compound 1. [ka] or a pharmaceutically acceptable salt thereof.

[0019] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is the hydrochloride salt of Compound 1. Also, in some embodiments, the hydrochloride salt is the dihydrochloride salt of Compound 1.

[0020] In some embodiments, the glioma is selected from the group consisting of astrocytoma, ependymoma, oligodendroglioma, brainstem glioma, optic nerve glioma, and mixed glioma. In some embodiments, the glioma is an astrocytoma. In some embodiments, the astrocytoma is glioblastoma multiforme (GBM).

[0021] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, ZNF75A, or any combination thereof in glioma cells. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in glioma cells.

[0022] In some embodiments, Compound 1 or a pharmaceutically acceptable salt thereof is administered as a pharmaceutical composition additionally comprising a pharmaceutically acceptable carrier, excipient, or diluent. In some embodiments, Compound 1 or a pharmaceutically acceptable salt thereof is administered at least once daily (e.g., once daily, at least twice daily, twice daily, or three times daily).

[0023] In some embodiments, the method further comprises administering an additional therapeutic agent to the subject. In some embodiments, the additional therapeutic agent is an anti-cancer agent. In some embodiments, the anti-cancer agent is selected from temozolomide, ixabepilone, cladribine, enzalutamide, omacetaxine mepesuxinate, epothilone, erbulin, latrunculin, a pharmaceutically acceptable salt of any of these anti-cancer agents, or any combination thereof. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered simultaneously. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered sequentially. In some embodiments, the method further comprises administering radiation therapy to the subject.

[0024] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 1,000 mg. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 25 mg to about 750 mg. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 300 mg.

[0025] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered chronically. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment.

[0026] In some embodiments, the subject experiences reduced weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. In some embodiments, the subject experiences mitochondrial vacuolation in glioma cells after initiation of treatment. Also, in some embodiments, the subject is human.

[0027] Another aspect of the present invention is a method of inducing mitochondrial vacuolization in glioblastoma multiforme (GBM) cells in a subject, comprising administering to the subject a therapeutically effective amount of Compound 1. [ka] or a pharmaceutically acceptable salt thereof.

[0028] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is the hydrochloride salt of Compound 1. Also, in some embodiments, the hydrochloride salt is the dihydrochloride salt of Compound 1.

[0029] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, ZNF75A, or any combination thereof in GBM cells. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in GBM cells.

[0030] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition additionally comprising a pharmaceutically acceptable carrier, excipient, or diluent. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily.

[0031] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 1,000 mg. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 25 mg to about 750 mg. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 300 mg.

[0032] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered chronically. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment. Also, in some embodiments, the subject is a human.

[0033] Another aspect of the present invention is a method of depolarizing mitochondria in glioblastoma multiforme (GBM) cells in a subject, comprising administering to the subject a therapeutically effective amount of Compound 1. [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is the hydrochloride salt of Compound 1. Also, in some embodiments, the hydrochloride salt is the dihydrochloride salt of Compound 1.

[0034] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, ZNF75A, or any combination thereof in GBM cells. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in GBM cells.

[0035] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition additionally comprising a pharmaceutically acceptable carrier, excipient, or diluent. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily.

[0036] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 1,000 mg. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 25 mg to about 750 mg. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 300 mg.

[0037] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered chronically. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment. In some embodiments, the subject experiences mitochondrial vacuolization in GBM cells after the start of treatment. In some embodiments, the subject is human.

[0038] Another aspect of the present invention is a pharmaceutical composition for treating glioma in a subject, the pharmaceutical composition comprising Compound 1. [ka] or a pharmaceutically acceptable salt thereof.

[0039] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is the hydrochloride salt of Compound 1. Also, in some embodiments, the hydrochloride salt is the dihydrochloride salt of Compound 1.

[0040] In some embodiments, the pharmaceutical composition is a nasal spray having a viscosity of about 100 cP to about 2,500 cP. Also, in some embodiments, the pharmaceutical composition comprises a tablet, capsule, or oral suspension. [Brief explanation of the drawings]

[0041] The following figures are provided by way of illustration and are not intended to limit the scope of the claimed invention.

[0042] [Figure 1A] 1 is a plot of cell viability of patient-derived cell lines treated with various classes of compounds according to Example 1. [Figure 1B] 1 is a graph of cell viability of patient-derived GBM cells (GBM) and fibroblasts (HF) treated with Compound 1 (CMPD1) according to Example 3. [Figure 1C] 1 is a graph of cell viability of patient-derived GBM cells and fibroblasts over multiple passages after 4 days of treatment with Compound 1 according to Example 3. [Figure 1D] 1 is a graph of cell viability of patient-derived fibroblasts over multiple passages 4 days after treatment with Compound 1 according to Example 3. [Figure 2] 1 is a graph of cell viability of patient-derived GBM cells (isolated from five additional patients) after treatment with Compound 1 according to Example 3. [Figure 3A] 1 is a bar graph of cell viability of patient-derived GBM cells treated with DMSO or Compound 1 (0.1 μM or 5 μM) according to Example 4 at days 4, 8, 14, and 21. [Figure 3B] 1 is a bar graph of cell viability of patient-derived fibroblasts (control) treated with DMSO or Compound 1 (0.1 μM) according to Example 4 at days 4 and 21. [Figure 4A] 1 is a graph of cell viability of patient-derived GBM cells treated with Compound 1 according to Example 5, following knockdown with scrambled (control) siRNA or DAT-specific siRNA. [Figure 4B] 1 is a bar graph of relative DAT expression in patient-derived GBM cells after knockdown with scrambled (control) or DAT-specific siRNA according to Example 5. [Figure 4C] 1 is a graph of cytotoxicity / apoptosis of patient-derived GBM cells containing the apoptotic marker caspase 3 after treatment with DMSO (control), Compound 1 (CMPD1), or staurosporine (positive control for apoptosis) according to Example 5. [Figure 4D] 4C is an image for quantification of apoptotic cells expressed as a percentage of total cells analyzed from FIG. 4C according to Example 5. [Figure 5A] 1 is a plot of the membrane potential of GMB cells treated with DMSO (negative control), CCCP (positive control), and Compound 1 (CMPD1) according to Example 6. [Figure 5B] 1 is a bar graph of JC1 staining of mitochondrial depolarization in GMB cells treated with DMSO (negative control), CCCP (positive control), or Compound 1 (CMPD1) according to Example 6 at 24 hours, 48 ​​hours, and 72 hours. [Figure 6A] TEM images of mitochondria from GBM cells treated with Compound 1 (CMPD1) (2.5 μM, 5 μM, or 10 μM) or DMSO according to Example 7. [Figure 6B] 1 is a bar graph of mitochondrial vacuolization in GMB cells treated with DMSO or Compound 1 (2.5 μM, 5 μM, or 10 μM) at 3, 6, 12, 24, and 48 hours according to Example 7. [Figure 7A] FIG. 1 is a step diagram of a CRISPR-Cas9 genome-wide screening study to identify potential targets of Compound 1 in GBM cells according to Example 8. [Figure 7B]1 is a plot of a CRISPR-Cas9 genome-wide screening study to identify potential targets of Compound 1 in GBM cells according to Example 8. [Figure 7C] 7B is a graph of cell viability following treatment with Compound 1 against the specific targets identified in FIG. 7B in patient-derived glioma cells, followed by determination of the IC50 following treatment with serial dilutions of Compound 1 according to Example 8. [Figure 8A] Photograph of an electrophoresis gel showing the expression of specific targets identified in Figure 7B after treatment with DMSO (control), Compound 1 (CMPD1), biotin (control), and biotin-labeled Compound 1 (CMPD1-biotin) according to Example 8. [Figure 8B] 1 is a photograph of an electrophoresis gel showing the results of a pull-down assay using biotin-labeled Compound 1 according to Example 8. [Figure 9] 1 is a photograph showing GBM tumor size in mice treated with Compound 1 and untreated mice according to Example 9. [Figure 10] 1 is a graph comparing the average body weight of mice treated with Compound 1 and untreated mice according to Example 9. [Figure 11] 1 is a graph comparing the survival rates of mice treated with Compound 1 and untreated mice according to Example 9. [Figure 12A] 1 is a graph of cell viability of patient-derived GBM cells treated with temozolomide (TMZ) and a combination of TMZ and Compound 1 according to Example 10. [Figure 12B] 1 is a bar graph of cell viability of patient-derived GBM cells treated with Compound 1 (GK09) and / or compounds approved by the FDA for use as tumor therapeutics according to Example 10. [Figure 12C] 1 is a bar graph of cell viability of patient-derived GBM cells treated with compound 1 (GK09) and / or compounds approved by the FDA for use as tumor therapeutics and including measured IC50 values ​​according to Example 10. DETAILED DESCRIPTION OF THE INVENTION

[0043] The present invention provides compounds and methods for treating cancer in a subject in need thereof.

[0044] As used herein, the following definitions shall apply unless otherwise stated.

[0045] I. Definition

[0046] As used herein, the term "modulate" refers to the inhibition or enhancement of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, and / or ZNF75A function. A "modulator" (e.g., a compound or a pharmaceutically acceptable salt thereof that regulates the function of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, and / or ZNF75A) can be, for example, an agonist, partial agonist, antagonist, or partial antagonist of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, and / or ZNF75A.

[0047] As used herein, the term "about," when referring to a numerical value or range of values, allows for a degree of variation in the value or range or values, for example, within 10%, or within 5% of the stated limit of the stated value or range.

[0048] As used herein, the term "pharmaceutically acceptable" means approved or approvable by a regulatory agency of the Federal or State government, or a corresponding agency in a country other than the United States, or listed in the United States Pharmacopoeia or other generally recognized pharmacopoeias for use in animals, especially humans.

[0049] As used herein, "pharmaceutically acceptable salts" refers to salts of the compounds of the present invention that are pharmaceutically acceptable and possess the desired pharmacological activity of the parent compound. In particular, such salts are non-toxic and can be inorganic or organic acid addition salts and base addition salts. Specifically, such salts include: (1) salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, or with acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphor acid, and the like. or (2) salts formed when an acidic proton present in the parent compound is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion, or an aluminum ion, or coordinates with an organic base, such as ethanolamine, diethanolamine, triethanolamine, N-methylglucamine, etc. Salts further include, by way of example only, salts of non-toxic organic or inorganic acids, such as sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, etc., and, if the compound contains a basic functional group, salts of hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, etc. The term "pharmaceutically acceptable cation" refers to an acceptable cationic counterion of an acidic functional group. Such cations are exemplified by sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium cations, and the like. See, e.g., Berge, et al., J. Pharm. Sci. (1977) 66(1):1-79.

[0050] As used herein, the term "prodrug" is intended to encompass therapeutically inactive compounds that are converted into the therapeutically active agents of the present invention under physiological conditions. One method for producing a prodrug is to design a selective site that is hydrolyzed or cleaved under physiological conditions at the target biological site of action to reveal the desired molecule that produces the therapeutic effect. In certain embodiments, the prodrug is converted by the enzyme activity of the target.

[0051] In another embodiment, the present invention provides prodrugs of the compounds described herein (eg, Compound 1).

[0052] As used herein, the term "subject" to which administration is contemplated includes, but is not limited to, humans (e.g., male or female of any age, e.g., a pediatric subject (e.g., infant, child, adolescent) or an adult subject (e.g., young adult, middle-aged adult, or elderly adult)), and / or non-human animals, e.g., mammals such as primates (e.g., cynomolgus monkeys, rhesus monkeys), cows, pigs, horses, sheep, goats, rodents, cats, and / or dogs. In certain embodiments, the subject is a mammal. In other embodiments, the subject is a human.

[0053] As used herein, and unless otherwise specified, the terms "treat," "treating," and "treatment" contemplate actions that occur while a subject is afflicted with a particular disease, disorder, or condition and that reduce the severity of the disease, disorder, or condition (or any symptoms thereof) or prevent or slow the progression of the disease, disorder, or condition ("therapeutic treatment"), and also contemplate prophylactic treatment that occurs before a subject begins to suffer from a particular disease, disorder, or condition.

[0054] In general, an "effective amount" of a compound refers to an amount sufficient to elicit a desired biological response, for example, to treat cancer (e.g., glioblastoma multiforme (GBM)). As will be appreciated by those skilled in the art, the effective amount of a compound of the present invention may vary depending on factors such as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated, the mode of administration, and the age, weight, and health of the subject.

[0055] As used herein, and unless otherwise specified, a "therapeutically effective amount" of a compound is an amount sufficient to provide a therapeutic benefit in the treatment of a disease, disorder, or condition, or an amount sufficient to delay or minimize one or more symptoms associated with a disease, disorder, or condition. A therapeutically effective amount of a compound means an amount of a therapeutic agent that, alone or in combination with other therapies, provides a therapeutic effect in the treatment of a disease, disorder, or condition. The term "therapeutically effective amount" can encompass an amount that improves overall treatment, reduces or avoids the symptoms or causes of a disease or condition, or enhances the therapeutic effect of another therapeutic agent.

[0056] In an alternative embodiment, the present invention contemplates administering a compound of the present invention, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable composition thereof, as a prophylactic agent before a subject begins to suffer from a particular disease, disorder, or condition. As used herein, and unless otherwise specified, a "prophylactically effective amount" of a compound is an amount sufficient to prevent or prevent the recurrence of a disease, disorder, or condition, or one or more symptoms associated with the disease, disorder, or condition. A prophylactically effective amount of a compound refers to an amount of a therapeutic agent, alone or in combination with other agents, that is effective in preventing a disease, disorder, or condition. The term "prophylactically effective amount" can encompass an amount that improves overall prophylaxis or enhances the prophylactic effect of another prophylactic agent.

[0057] As used herein, the terms "treatment initiation" and "initiation of treatment" are used interchangeably to refer to the date on which treatment (e.g., administration of Compound 1 or a pharmaceutically acceptable salt thereof) begins. For example, the treatment initiation date is the date on which chemotherapy is first administered. Also, in the case of a dosing regimen consisting of administration of two or more therapeutic agents, the treatment initiation date is the date on which Compound 1 or a pharmaceutically acceptable salt thereof is first administered.

[0058] As used herein, a "halogen" or "halo" group refers to fluorine, chlorine, bromine, or iodine.

[0059] Unless otherwise stated, structures depicted herein are intended to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure, including, for example, the R and S configurations of each asymmetric center, (Z) and (E) double bond isomers, and (Z) and (E) conformational isomers. Accordingly, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the compounds of the invention are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compounds of the invention are within the scope of the invention. Furthermore, unless otherwise stated, structures depicted herein are intended to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the structures of the present invention except for the replacement of a hydrogen by deuterium or tritium, or the replacement of a carbon by a C- or C-enriched carbon are within the scope of the invention. Such compounds are useful, for example, as analytical tools or probes in biological assays, or as therapeutic agents.

[0060] The compounds disclosed herein may be "isomerically pure" compounds. As used herein, the term "isomerically pure" refers to an isomer of a compound that is substantially free of other isomers (e.g., substantially free of other stereoisomers (e.g., enantiomers, diastereomers, geometric (or conformational) isomers, etc.), structural isomers, isotopomers, etc.). For example, an "isomerically pure" compound having at least one asymmetric center of a particular configuration (i.e., R or S configuration) is substantially free of other isomers of the compound having a different configuration at the at least one asymmetric center. An "isomerically pure" compound contains greater than 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.5%, 99%, 99.2%, 99.5%, 99.6%, 99.7%, 99.8%, or greater than 99.9% by weight of a single isomer of the compound, based on the total weight of all isomers of the compound present.

[0061] Chemical structures and nomenclature are taken from ChemDraw, version 11.0.1, Cambridge, MA.

[0062] II. Compounds of the Invention

[0063] The present invention provides compounds useful in the treatment of cancer.

[0064] A. Compounds of the Invention

[0065] One aspect of the present invention is compound 1 [ka] or a pharmaceutically acceptable salt thereof.

[0066] In some embodiments, the present invention provides a pharmaceutically acceptable salt of Compound 1. For example, the pharmaceutically acceptable salt is the hydrochloride or dihydrochloride salt of Compound 1. In other examples, the pharmaceutically acceptable salt is the dihydrochloride salt of Compound 1.

[0067] B. Pharmaceutical Compositions / Formulations

[0068] The compositions described herein may be formulated into pharmaceutical compositions further comprising a pharmaceutically acceptable carrier, diluent, adjuvant, or vehicle. In one aspect, the present invention provides a pharmaceutical composition comprising the compound of the present invention described above and a pharmaceutically acceptable carrier, diluent, adjuvant, or vehicle. In one aspect, the present invention provides a pharmaceutical composition comprising an effective amount of a compound of the present invention, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, diluent, adjuvant, or vehicle. In one aspect, the present invention provides a pharmaceutical composition comprising the compound of the present invention described above, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, excipient, or diluent. Pharmaceutically acceptable carriers include, for example, pharmaceutical diluents, excipients, or carriers that are appropriately selected for the intended administration form and consistent with conventional pharmaceutical practice.

[0069] In accordance with another aspect, the present invention provides a composition comprising a compound of the present invention, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, excipient, or diluent. The pharmaceutical composition of the present invention comprises a therapeutically effective amount of Compound 1, or a pharmaceutically acceptable salt thereof.

[0070] It will be understood that some of the compounds of the present invention may exist for therapy in free form or, where appropriate, as a pharmaceutically acceptable derivative thereof (e.g., salt). In accordance with the present invention, a pharmaceutically acceptable derivative includes, but is not limited to, a pharmaceutically acceptable prodrug, salt, ester, salt of such ester, or other adduct or derivative that, upon administration to a patient in need thereof, is capable of directly or indirectly providing a compound as otherwise described herein, or a metabolite or residue thereof.

[0071] As used herein, the term "pharmaceutically acceptable salt" refers to salts that are suitable, within the scope of sound medical judgment, for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like.

[0072] Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, which is incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts include salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid of amino groups, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or salts formed using other methods used in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, and 2-hydroxy-ethanesulfonate. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N(C1-4 alkyl) salts. The present invention also contemplates the quaternization of any basic nitrogen-containing group of the compounds disclosed herein. Such quaternization may result in water- or oil-soluble or dispersible products. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.Additionally, pharmaceutically acceptable salts include non-toxic ammonium cations, quaternary ammonium cations, and amine cations, formed where appropriate, using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfonates, and arylsulfonates.

[0073] Pharmaceutically acceptable carriers may contain inert ingredients that do not excessively inhibit the biological activity of compound.Pharmaceutically acceptable carriers must be biocompatible, for example, non-toxic, non-inflammatory, non-immunogenic, or have no other undesirable reactions or side effects when administered to subjects.Standard pharmaceutical formulation techniques can be adopted.

[0074] As used herein, pharmaceutically acceptable carriers, adjuvants, or vehicles include any solvents, diluents, or other liquid vehicles, dispersion or suspension aids, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, solid binders, lubricants, and the like, depending on the particular dosage form desired. Remington's Pharmaceutical Sciences, Sixteenth Edition, E.W. Martin (Mack Publishing Co., Easton, Pa., 1980) discloses various carriers used in formulating pharmaceutically acceptable compositions and known techniques for their preparation. Except insofar as any conventional carrier medium is incompatible with the compounds described herein, such as by producing any undesired biological effects or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutically acceptable composition, the use of such conventional carrier media is contemplated as being within the scope of the present invention. As used herein, the phrase "side effects" encompasses undesired and adverse side effects of a therapy (e.g., a prophylactic or therapeutic agent). While side effects are always unwanted, undesired effects are not necessarily adverse. Side effects of therapies (e.g., prophylactic or therapeutic agents) can be harmful, uncomfortable, or dangerous, and include, but are not limited to, fever, chills, lethargy, gastrointestinal toxicity (including gastric and intestinal ulcers and erosions), nausea, vomiting, neurotoxicity, nephrotoxicity, kidney toxicity (including conditions such as renal papillary necrosis and chronic interstitial nephritis), hepatotoxicity (including elevated serum liver enzyme levels), bone marrow toxicity (including leukopenia, bone marrow suppression, thrombocytopenia, and anemia), dry mouth, metallic taste, prolonged pregnancy, weakness, somnolence, pain (including muscle pain, bone pain, and headache), hair loss, asthenia, dizziness, extrapyramidal symptoms, akathisia, cardiovascular disorders, and sexual dysfunction.

[0075] Some examples of materials that may serve as pharmaceutically acceptable carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as twin 80, phosphate, glycine, sorbate, or potassium sorbate, saturated vegetable fatty acids, water, salt, or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, and zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, methylcellulose, hydroxypropylmethylcellulose, wool fat, sugars such as lactose, glucose, and sucrose, starches such as corn starch and potato starch, sodium carboxymethylcellulose. Examples of suitable additives include, but are not limited to, cellulose and its derivatives such as ethyl cellulose and cellulose acetate, a partial glyceride mixture of tragacanth powder, malt, gelatin, talc, excipients such as cocoa butter and suppository wax, oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil, glycols such as propylene glycol or polyethylene glycol, esters such as ethyl oleate and ethyl laurate, agar, buffers such as magnesium hydroxide and aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and phosphate buffer, as well as other non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as colorants, release agents, coating agents, sweeteners, flavorings, and perfumes. Preservatives and antioxidants may also be present in the composition at the discretion of the formulator.

[0076] The compositions of the present invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or via an implanted reservoir. As used herein, the term "parenteral" includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intraocular, intrahepatic, intralesional, and intracranial injection or infusion techniques. Preferably, the compositions are administered intraperitoneally or intravenously. Sterile injectable forms of the compositions of the present invention may be aqueous or oily suspensions. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent (e.g., as a solution in 1,3-butanediol). Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. Additionally, sterile, fixed oils are conventionally used as a solvent or suspending medium.

[0077] For this purpose, any sterile fixed oil may be employed, including synthetic mono- or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives, are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils, such as olive oil or castor oil, especially their polyoxyethylated versions. These oil solutions or suspensions may also contain long-chain alcohol diluents or dispersants, such as carboxymethylcellulose or similar dispersants, which are commonly used in the formulation of pharmaceutically acceptable dosage forms, including emulsions or suspensions. Other commonly used surfactants, such as Tween®, Span®, and other emulsifiers or bioavailability enhancers, commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms, may also be used for formulation purposes.

[0078] The pharmaceutically acceptable composition of the present invention can be orally administered in any orally acceptable dosage form, including but not limited to capsules, tablets, aqueous suspensions, or solutions.For tablets for oral use, commonly used carriers include lactose and cornstarch.Lubricants such as magnesium stearate are also typically added.For oral administration in capsule form, useful diluents include lactose and dried cornstarch.When aqueous suspension is required for oral use, active ingredient is combined with emulsifier and suspending agent.If desired, certain sweeteners, flavorings, or coloring agents can also be added.

[0079] Alternatively, the pharmaceutically acceptable compositions of the present invention can be administered in the form of suppositories for rectal or vaginal administration. These can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature, thereby melting in the rectum or vaginal cavity to release the drug. Such materials include cocoa butter, polyethylene glycol, or suppository waxes that are solid at room temperature but liquid at body temperature, thereby melting in the rectum or vaginal cavity to release the active ingredient.

[0080] The pharmaceutically acceptable compositions of this invention may also be administered topically, particularly when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, or the lower intestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs.

[0081] Topical application for the lower intestinal tract can be effected in a rectal suppository formulation (see above) or in a suitable enema formulation. Topically-transdermal patches may also be used.

[0082] For topical application, pharmaceutically acceptable compositions can be formulated into a suitable ointment, containing the active ingredient suspended or dissolved in one or more carriers.Carriers for topical administration of the compounds of the present invention include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsifying wax, and water.Alternatively, pharmaceutically acceptable compositions can be formulated into a suitable lotion or cream, containing the active ingredient suspended or dissolved in one or more pharmaceutically acceptable carriers.Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl ester wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol, and water.

[0083] For ophthalmic use, pharmaceutically acceptable compositions can be formulated, for example, as a micronized suspension in isotonic, pH-adjusted sterile saline or other aqueous solution, or preferably as an isotonic, pH-adjusted sterile saline or other solution, with or without a preservative such as benzylalkonium chloride. Alternatively, for ophthalmic use, pharmaceutically acceptable compositions can be formulated into an ointment such as petrolatum. The pharmaceutically acceptable compositions of the present invention can also be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well known in the art of pharmaceutical formulation and can be prepared as a solution in saline using benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, fluorocarbons, and / or other conventional solubilizers or dispersants.

[0084] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compound, liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers, and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid ester sorbitan, and mixtures thereof. In addition to inert diluents, oral compositions may also contain adjuvants such as wetting agents, emulsifiers and suspending agents, sweeteners, flavorings, and perfumes.

[0085] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, can be formulated according to known techniques using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations can also be sterile injectable solutions, suspensions, or emulsions in non-toxic parenterally acceptable diluents or solvents, such as solutions in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution, USP, and isotonic sodium chloride solution. In addition, sterile fixed oils are commonly used as solvents or suspending media. For this purpose, any sterile fixed oil can be used, including synthetic monoglycerides or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables.

[0086] Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium before use.

[0087] To prolong the effect of a compound of the present invention, it is often desirable to slow its absorption from subcutaneous or intramuscular injection. This can be accomplished by using a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the compound therefore depends on its dissolution rate, which in turn may depend on crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form can be achieved by dissolving or suspending the compound in an oil vehicle. Injectable depot formulations are prepared by forming microencapsule matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of compound to polymer and the nature of the particular polymer used, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.

[0088] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate, and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia; c) humectants such as glycerol; d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; e) solution retardants such as paraffin; f) absorption accelerators such as quaternary ammonium compounds; g) humectants such as, for example, cetyl alcohol and glycerol monostearate; h) absorbents such as kaolin and bentonite clay; and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents.

[0089] Solid compositions of a similar type may also be used as fillers in soft and hard-filled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycols. Solid dosage forms such as tablets, dragees, capsules, pills, and granules may be prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulation art. Solid dosage forms may optionally contain opacifying agents. These solid dosage forms may also be of a composition that releases the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that may be used include polymeric substances and waxes. Solid compositions of a similar type may also be used as fillers in soft and hard-filled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycols.

[0090] The active compound may also be in microencapsulated form with one or more of the excipients described above. Solid dosage forms such as tablets, dragees, capsules, pills, and granules may be prepared with coatings and shells, such as enteric coatings, release-controlling coatings, and other coatings well known in the pharmaceutical formulation art. In such solid dosage forms, the active ingredient may be mixed with at least one inert diluent, such as sucrose, lactose, or starch. As is common, such dosage forms may contain additional substances in addition to inert diluents, such as tableting lubricants and other tableting aids, such as magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets, and pills, the dosage forms may contain buffering agents. They may optionally contain opacifying agents and may be of a composition that releases the active ingredient(s) only, or preferentially in a certain part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that may be used include polymeric substances and waxes.

[0091] Dosage forms for topical or transdermal administration of the compounds of the present invention include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active ingredient is mixed under sterile conditions with a pharmaceutically acceptable carrier and any necessary preservatives or buffers, as needed. Ophthalmic formulations, ear drops, and eye drops are also contemplated within the scope of the present invention. Furthermore, the present invention contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of the compound to the body. Such dosage forms can be made by dissolving or dispensing the compound in an appropriate medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate-controlling membrane or by dispersing the compound in a polymer matrix or gel.

[0092] The compounds herein are preferably formulated in dosage unit form for ease of administration and uniformity of dosage.As used herein, the phrase "dose unit form" refers to a physically discrete pharmaceutical unit suitable for the patient to be treated.However, it will be understood that the total daily use amount of the compounds and compositions of the present invention will be determined by the attending physician within the scope of sound medical judgment.The specific effective dose level for any particular patient or organism will depend on various factors, including the disorder being treated, the severity of the disorder, the activity of the specific compound used, the specific composition used, the patient's age, weight, general condition, sex, and diet, the time, route of administration, and excretion rate of the specific compound used, the duration of treatment, drugs used in combination with or simultaneously with the specific compound used, and similar factors well known in the medical field.

[0093] The compounds and / or compositions of the present invention can be delivered in a controlled release system. In one embodiment, a pump can be used to facilitate the controlled release of the compounds and / or compositions of the present invention (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, the compositions of the present invention may include polymeric materials that provide sustained, intermediate, pulsed, or alternate release (see MEDICAL APPLICATIONS OF CONTROLLED RELEASE, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); CONTROLLED DRUG BIOAVAILABILITY, DRUG PRODUCT DESIGN AND PERFORMANCE, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg. 71:105 (1989); Remington's Pharmaceutical Sciences, 18th Ed., (Mack Publishing Company, Easton, Pa., 1990). Other controlled-release systems discussed in the review by Langer (Science 249:1527-1533 (1990)) may be used.

[0094] The amount of the compounds of the present invention that can be combined with the carrier materials to produce a composition in a single dosage form will vary depending upon the host treated, the particular mode of administration, and other factors. Preferably, the compositions should be formulated to provide a dosage of 0.01 to 100 mg / kg body weight / day of the inhibitor to patients receiving these compositions.

[0095] Depending on the particular condition, or disease, to be treated or prevented, additional therapeutic agents, which are normally administered to treat or prevent that condition, may also be present in the compositions of this invention. As used herein, additional therapeutic agents that are normally administered to treat or prevent a particular disease, or condition, are known as "appropriate for the disease, or condition, being treated."

[0096] In one aspect, the present invention provides a pharmaceutical composition for treating glioma in a subject, the pharmaceutical composition comprising Compound 1. [ka] or a pharmaceutically acceptable salt thereof.

[0097] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is a hydrochloride salt. In some embodiments, the hydrochloride salt is a dihydrochloride salt.

[0098] In some embodiments, the pharmaceutical composition is a nasal spray having a viscosity of about 100 cP to about 2,500 cP. In some embodiments, the nasal spray has a viscosity of at least about 100 cP, at least about 250 cP, at least about 500 cP, at least about 750 cP, at least about 1000 cP, at least about 1250 cP, at least about 1500 cP, at least about 1750 cP, at least about 2000 cP, at least about 2250 cP, or at least about 2500 cP, and / or a viscosity of about 100 cP or less, about 250 cP or less, about 500 cP or less, about 750 cP or less, about 1000 cP or less, about 1250 cP or less, about 1500 cP or less, about 1750 cP or less, about 2000 cP or less, about 2250 cP or less, or about 2500 cP or less.

[0099] In some embodiments, the nasal spray has a viscosity of about 100 cP to about 2,500 cP. In some embodiments, the nasal spray has a viscosity of at least about 100 cP. In some embodiments, the nasal spray has a viscosity of at least about 2,500 cP.In some embodiments, the nasal spray has a viscosity of about 100 cP to about 250 cP, about 100 cP to about 500 cP, about 100 cP to about 750 cP, about 100 cP to about 1,000 cP, about 100 cP to about 1,250 cP, about 100 cP to about 1,500 cP, about 100 cP to about 1,750 cP, about 100 cP to about 2,000 cP, about 100 cP to about 2,250 cP, about 100 cP to about 2,500 cP, about 250 cP to about 500 cP, about 250 cP to about 750 cP, about 250 cP to about 1,000 cP, about 250 cP to about 1,250 cP, Approx. 250cP ~ Approx. 1,500cP, Approx. 250cP ~ Approx. 1,750cP, Approx. 250cP ~ Approx. 2,000cP, Approx. 250cP ~ Approx. 2, 250cP, approx. 250cP ~ approx. 2,500cP, approx. 500cP ~ approx. 750cP, approx. 500cP ~ approx. 1,000cP, approx. 500cP ~ Approx. 1,250cP, Approx. 500cP~Approx. 1,500cP, Approx. 500cP~Approx. 1,750cP, Approx. 500cP~Approx. 2,000cP, Approx. 5 00cP ~ approx. 2,250cP, approx. 500cP ~ approx. 2,500cP, approx. 750cP ~ approx. 1,000cP, approx. 750cP ~ approx. 1,250 cP, approx. 750cP ~ approx. 1,500cP, approx. 750cP ~ approx. 1,750cP, approx. 750cP ~ approx. 2,000cP, approx. 750cP ~ Approx. 2,250cP, Approx. 750cP~Approx. 2,500cP, Approx. 1,000cP~Approx. 1,250cP, Approx. 1,000cP~Approx. 1,500c P, about 1,000cP to about 1,750cP, about 1,000cP to about 2,000cP, about 1,000cP to about 2,250cP, about 1, 000cP ~ approx. 2,500cP, approx. 1,250cP ~ approx. 1,500cP, approx. 1,250cP ~ approx. 1,750cP, approx. 1,250cP to about 2,000 cP, about 1,250 cP to about 2,250 cP, about 1,250 cP to about 2,500 cP, about 1,500 cP to about 1,750 cP, about 1,500 cP to about 2,000 cP, about 1,500 cP to about 2,250 cP, about 1,500 cP to about 2,500 cP, about 1,750 cP to 2,000 cP, about 1,750 cP to about 2,250 cP, about 1,750 cP to about 2,500 cP, about 2,000 cP to about 2,250 cP, about 2,000 cP to about 2,500 cP, or about 2,250 cP to about 2,500 cP.In some embodiments, the nasal spray has a viscosity of about 100 cP, about 250 cP, about 500 cP, about 750 cP, about 1,000 cP, about 1,250 cP, about 1,500 cP, about 1,750 cP, about 2,000 cP, about 2,250 cP, or about 2,500 cP.

[0100] In some embodiments, the pharmaceutical composition comprises a tablet, capsule, or oral suspension, for example, a tablet containing about 10 mg to about 1000 mg of Compound 1 or a pharmaceutically acceptable salt thereof.

[0101] III. Cancer Treatment Methods

[0102] A.Cancer treatment methods

[0103] The present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of Compound 1. [ka] or a pharmaceutically acceptable salt thereof, wherein the cancer is selected from brain cancer, breast cancer, pancreatic cancer, lung cancer, or any combination thereof.

[0104] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is the hydrochloride salt of Compound 1. For example, the hydrochloride salt is the dihydrochloride salt of Compound 1.

[0105] In some embodiments, the cancer is a brain tumor. Examples of brain tumors include, but are not limited to, acoustic neuroma, astrocytoma (e.g., pilocytic astrocytoma, fibrillary astrocytoma, protoplasmic astrocytoma, mastocytic astrocytoma, anaplastic astrocytoma, and glioblastoma multiforme (GBM)), brain lymphoma, brain metastasis, pituitary tumor (e.g., prolactinoma, HGH (human growth hormone) tumor, ACTH (adrenocorticotropic hormone) tumor), craniopharyngioma, medulloblastoma, meningioma, and oligodendroglioma. In some examples, the brain tumor is glioblastoma multiforme (GBM).

[0106] In some embodiments, the cancer is breast cancer. Examples of breast cancer include, but are not limited to, adenocarcinoma, ductal carcinoma, colloid carcinoma, invasive lobular carcinoma, tubular carcinoma, adenoid cystic carcinoma, and papillary carcinoma.

[0107] In some embodiments, the cancer is pancreatic cancer. Examples of pancreatic cancer include, but are not limited to, exocrine (non-endocrine) pancreatic cancer and neuroendocrine pancreatic cancer.

[0108] In some embodiments, the cancer is lung cancer. Examples of lung cancer include, but are not limited to, bronchial carcinoma, small cell lung cancer, and non-small cell lung cancer (e.g., squamous cell carcinoma, lung adenocarcinoma, and large cell bronchial carcinoma).

[0109] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, ZNF75A, or any combination thereof in cancer cells. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in cancer cells. For example, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A in cancer cells. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of UTP23 in cancer cells. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of ARHGAP33 in cancer cells. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of ITSN1 in cancer cells.

[0110] Compound 1, or a pharmaceutically acceptable salt thereof, that modulates the function of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, and / or ZNF75A may be, for example, an agonist, partial agonist, antagonist, or partial antagonist of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, and / or ZNF75A. Without wishing to be bound by theory, it is believed that Compound 1, or a pharmaceutically acceptable salt thereof, regulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, ZNF75A, or any combination thereof in cancer cells, thereby exhibiting cytotoxicity against cancer cells. Compound 1 (also known as vanoxerine or GBR-12909) is a known dopamine reuptake inhibitor (DPI) that binds to the target site of the dopamine transporter (DAT). Izenwasser, S. et al., Comparison of the effects of cocaine and other inhibitors of dopamine uptake in rat striatum, nucleus accumbens, olfactory tubercle, and medial prefrontal cortex, 520 Brain Research 303 (1990). Therefore, compound 1 is believed to exhibit unexpected cytotoxicity against cancer cells (e.g., GBM cells) via a novel mechanism of action.

[0111] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient, or diluent. The pharmaceutically acceptable carrier, excipient, or diluent can be any of the carriers, excipients, or diluents described herein.

[0112] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered once or twice daily. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered once daily. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered once daily. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered two or three times daily.

[0113] In some embodiments, the method further comprises administering an additional therapeutic agent to the subject. For example, the additional therapeutic agent can be an anti-cancer agent. Examples of anti-cancer agents include abiraterone acetate, afatinib, aldesleukin, alemtuzumab, alitretinoin, altretamine, amifostine, aminoglutethimide anagrelide, anastrozole, arsenic trioxide, asparaginase, azacitidine, azathioprine, bendamustine, bevacizumab, bexarotene, bicalutamide, bleomycin, bortezomib, busulfan, capecitabine, carboplatin, carmustine, cemiplimab, cetuximab, chlorambucil, cisplatin, cladrifin, and the like. ib, crizotinib, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, dasatinib, daunorubicin, denileukin diftitox, decitabine, docetaxel, dexamethasone, dostarlimab, doxifluridine, doxorubicin, enzalutamide, epirubicin, epoetin alfa, epothilone, erlotinib, erbulin, estramustine, echinostat, etoposide, everolimus, exemestane, filgrastim, floxuridine, fludarabine, fluorouracil, fluoxetine Xymesterone, flutamide, folate-linked alkaloids, gefitinib, gemcitabine, gemtuzumab ozogamicin, GM-CT-01, goserelin, hexamethylmelamine, hydroxyurea, ibritumomab, idarubicin, ifosfamide, imatinib, interferon α, interferon β, irinotecan, ixabepilone, lapatinib, latrunculin, leucovorin, leuprolide, lenalidomide, letrozole, lomustine, mechlorethamine, megestrol, melphalan, mercaptopurine, methadone Trexate, mitomycin, mitoxantrone, nelarabine, nilotinib, nilutamide, nivolumab, octreotide, ofatumumab, omacetaxine mepesuxinate, oprelvekin, oxaliplatin, paclitaxel, panitumumab, pembrolizumab, pemetrexed, pentostatin, polysaccharide galectin inhibitors, procarbazine, proscillaridin A, raloxifene, retinoic acid, rituximab, romiplostim, sargramostim, sorafenib, streptozocin, sunitinib, tamoxifen,These include, but are not limited to, temsirolimus, temozolomide, teniposide, thalidomide, thioguanine, thiotepa, thioguanine, topotecan, toremifene, tositumomab, trametinib, trastuzumab, tretinoin, valrubicin, VEGF inhibitors and traps, vinblastine, vincristine, vindesine, vinorelbine, vintafolide (EC145), and vorinostat.

[0114] In some embodiments, the anticancer agent is selected from temozolomide, ixabepilone, cladribine, enzalutamide, omacetaxine mepesuccinate, epothilone, erbulin, latrunculin, a pharmaceutically acceptable salt of any of these anticancer agents, or any combination thereof. For example, the anticancer agent is temozolomide or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is ixabepilone or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is cladribine or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is enzalutamide or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is omacetaxine mepesuccinate or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is epothilone or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is erbulin or a pharmaceutically acceptable salt thereof. Also, in some embodiments, the anticancer agent is latrunculin or a pharmaceutically acceptable salt thereof.

[0115] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered simultaneously. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered sequentially. For example, the additional therapeutic agent can be administered before or after Compound 1, or a pharmaceutically acceptable salt thereof.

[0116] In some embodiments, the method further comprises administering radiation therapy to the subject. In other words, radiation therapy may be administered during the course of treatment in which a compound of the invention (or a pharmaceutically acceptable salt thereof) is administered to a patient in need thereof.

[0117] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 2,000 mg. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 1,000 mg. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 900 mg, 1 mg to about 800 mg, 1 mg to about 700 mg, 1 mg to about 600 mg, 1 mg to about 500 mg, 1 mg to about 400 mg, 1 mg to about 300 mg, 1 mg to about 200 mg, 1 mg to about 100 mg, 1 mg to about 75 mg, or 1 mg to about 50 mg. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 100 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 150 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 200 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 400 mg.

[0118] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered chronically (i.e., "chronic administration"). Chronic administration refers to administration of Compound 1, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, for an extended period of time (e.g., 3 months, 6 months, 1 year, 2 years, 3 years, 5 years, etc.) or indefinitely (e.g., for the life of the subject). In some examples, chronic administration maintains a constant blood level of Compound 1, or a pharmaceutically acceptable salt thereof, (e.g., within the therapeutic window for an extended period of time).

[0119] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about two days from the start of treatment. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about 5, 10, 15, 20, 25, 30, 60, 90, 120, 180 days, or one year from the start of treatment. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, or eleven months from the start of treatment. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment. Also, in some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about 2, 3, 4, 5, 6, 7, 8, 9, or 10 years from the start of treatment.

[0120] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally or intranasally. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered intranasally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a nasal spray.

[0121] In some embodiments, the subject experiences reduced weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. For example, the subject experiences at least about 1% (e.g., at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, or at least about 9%) reduced weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. In other examples, the subject experiences at least about 10% (e.g., at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, or at least about 19%) reduced weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. In some embodiments, the subject experiences at least about 20% (e.g., at least about 21%, at least about 22%, at least about 23%, at least about 24%, at least about 25%, at least about 26%, at least about 27%, at least about 28%, or at least about 29%) reduction in weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. Also, in some embodiments, the subject experiences at least about 30% to about 99% (e.g., about 30% to about 85%, about 30% to about 80%, about 30% to about 75%, etc.) reduction in weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof.

[0122] In some embodiments, the subject experiences an increase in life expectancy after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. For example, the subject experiences an increase in life expectancy of at least about 1% (e.g., at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, or at least about 9%) after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. In other examples, the subject experiences an increase in life expectancy of at least about 10% (e.g., at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, or at least about 19%) after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. In some embodiments, the subject experiences an increase in lifespan of at least about 20% (e.g., at least about 21%, at least about 22%, at least about 23%, at least about 24%, at least about 25%, at least about 26%, at least about 27%, at least about 28%, or at least about 29%) after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. Also, in some embodiments, the subject experiences an increase in lifespan of at least about 30% to about 99% (e.g., about 30% to about 85%, about 30% to about 80%, about 30% to about 75%, etc.) after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof.

[0123] In some embodiments, the subject experiences mitochondrial vacuolization in the cancer cells after initiation of treatment, hi other embodiments, the subject experiences mitochondrial depolarization in the cancer cells after initiation of treatment.

[0124] Without wishing to be bound by theory, it is believed that treatment with Compound 1, or a pharmaceutically acceptable salt thereof, induces mitochondrial vacuolation in cancer cells (e.g., glioblastoma multiforme (GBM) cells), which leads to mitochondrial depolarization in the cancer cells and ultimately to cell death.

[0125] In some embodiments, the subject is an animal, e.g., the subject is a mammal, hi other embodiments, the subject is a human.

[0126] B. Treatment methods for glioma

[0127] Another aspect of the present invention is a method of treating glioma in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of Compound 1, [ka] or a pharmaceutically acceptable salt thereof.

[0128] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is a hydrochloride salt. For example, the hydrochloride salt is a dihydrochloride salt.

[0129] In some embodiments, the glioma is selected from the group consisting of astrocytoma, ependymoma, oligodendroglioma, brainstem glioma, optic nerve glioma, and mixed glioma. For example, the glioma is an astrocytoma. Non-limiting examples of astrocytomas include pilocytic astrocytoma, subependymal giant cell astrocytoma, fibrillary astrocytoma, pleomorphic xanthoastrocytoma, mixed oligoastrocytoma, anaplastic astrocytoma, and glioblastoma multiforme (GBM). In some embodiments, the astrocytoma is GBM.

[0130] In some embodiments, the glioma is an ependymoma, including, but not limited to, subependymoma, myxopapillary ependymoma, and anaplastic ependymoma.

[0131] In some embodiments, the glioma is an oligodendroglioma, including, by way of non-limiting example, grade II oligodendroglioma and grade III oligodendroglioma (i.e., anaplastic oligodendroglioma).

[0132] In some embodiments, the glioma is a brainstem glioma, including, but not limited to, midbrain tectal glioma, diffuse intrinsic pontine glioma (DIPG), and cervical spinal cord glioma.

[0133] In some embodiments, the glioma is an optic glioma. In some embodiments, the glioma is a mixed glioma (e.g., oligodendroglioma and oligoastrocytoma).

[0134] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, ZNF75A, or any combination thereof in glioma cells. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in glioma cells (e.g., GBM cells). For example, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A in glioma cells. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of UTP23 in glioma cells. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of ARHGAP33 in glioma cells. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of ITSN1 in glioma cells.

[0135] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient, or diluent. The pharmaceutically acceptable carrier, excipient, or diluent can be any of the carriers, excipients, or diluents described herein.

[0136] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once a day. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered once or twice a day. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered once a day.

[0137] In some embodiments, the method further comprises administering an additional therapeutic agent to the subject. For example, the additional therapeutic agent can be an anti-cancer agent. Examples of anti-cancer agents include abiraterone acetate, afatinib, aldesleukin, alemtuzumab, alitretinoin, altretamine, amifostine, aminoglutethimide anagrelide, anastrozole, arsenic trioxide, asparaginase, azacitidine, azathioprine, bendamustine, bevacizumab, bexarotene, bicalutamide, bleomycin, bortezomib, busulfan, capecitabine, carboplatin, carmustine, cemiplimab, cetuximab, chlorambucil, cisplatin, cladrifin, and the like. ib, crizotinib, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, dasatinib, daunorubicin, denileukin diftitox, decitabine, docetaxel, dexamethasone, dostarlimab, doxifluridine, doxorubicin, enzalutamide, epirubicin, epoetin alfa, epothilone, erlotinib, erbulin, estramustine, echinostat, etoposide, everolimus, exemestane, filgrastim, floxuridine, fludarabine, fluorouracil, fluoxetine Xymesterone, flutamide, folate-linked alkaloids, gefitinib, gemcitabine, gemtuzumab ozogamicin, GM-CT-01, goserelin, hexamethylmelamine, hydroxyurea, ibritumomab, idarubicin, ifosfamide, imatinib, interferon α, interferon β, irinotecan, ixabepilone, lapatinib, latrunculin, leucovorin, leuprolide, lenalidomide, letrozole, lomustine, mechlorethamine, megestrol, melphalan, mercaptopurine, methadone Trexate, mitomycin, mitoxantrone, nelarabine, nilotinib, nilutamide, nivolumab, octreotide, ofatumumab, omacetaxine mepesuxinate, oprelvekin, oxaliplatin, paclitaxel, panitumumab, pembrolizumab, pemetrexed, pentostatin, polysaccharide galectin inhibitors, procarbazine, proscillaridin A, raloxifene, retinoic acid, rituximab, romiplostim, sargramostim, sorafenib, streptozocin, sunitinib, tamoxifen,These include, but are not limited to, temsirolimus, temozolomide, teniposide, thalidomide, thioguanine, thiotepa, thioguanine, topotecan, toremifene, tositumomab, trametinib, trastuzumab, tretinoin, valrubicin, VEGF inhibitors and traps, vinblastine, vincristine, vindesine, vinorelbine, vintafolide (EC145), and vorinostat.

[0138] In some embodiments, the anticancer agent is selected from temozolomide, ixabepilone, cladribine, enzalutamide, omacetaxine mepesuccinate, epothilone, erbulin, latrunculin, a pharmaceutically acceptable salt of any of these anticancer agents, or any combination thereof. For example, the anticancer agent is temozolomide or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is ixabepilone or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is cladribine or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is enzalutamide or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is omacetaxine mepesuccinate or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is epothilone or a pharmaceutically acceptable salt thereof. In some embodiments, the anticancer agent is erbulin or a pharmaceutically acceptable salt thereof. Also, in some embodiments, the anticancer agent is latrunculin or a pharmaceutically acceptable salt thereof.

[0139] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered simultaneously. In other embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered sequentially. For example, the additional therapeutic agent can be administered before or after Compound 1, or a pharmaceutically acceptable salt thereof.

[0140] In some embodiments, the method further comprises administering radiation therapy to the subject. In other words, radiation therapy may be administered during the course of treatment in which a compound of the invention (or a pharmaceutically acceptable salt thereof) is administered to a patient in need thereof.

[0141] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 2,000 mg. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 1,000 mg. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 900 mg, 1 mg to about 800 mg, 1 mg to about 700 mg, 1 mg to about 600 mg, 1 mg to about 500 mg, 1 mg to about 400 mg, 1 mg to about 300 mg, 1 mg to about 200 mg, 1 mg to about 100 mg, 1 mg to about 75 mg, or 1 mg to about 50 mg. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 100 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 150 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 200 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 400 mg.

[0142] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered chronically.

[0143] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about two days from the start of treatment. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about five, ten, fifteen, twenty, twenty-five, thirty, or sixty days from the start of treatment. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one, two, three, four, five, six, seven, eight, nine, ten, or eleven months from the start of treatment. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment. Also, in some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about two, three, four, five, six, seven, eight, nine, or ten years from the start of treatment.

[0144] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally or intranasally. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered intranasally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a nasal spray.

[0145] In some embodiments, the subject experiences reduced weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. For example, the subject experiences at least about 1% (e.g., at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, or at least about 9%) reduced weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. In other examples, the subject experiences at least about 10% (e.g., at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, or at least about 19%) reduced weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. In some embodiments, the subject experiences at least about 20% (e.g., at least about 21%, at least about 22%, at least about 23%, at least about 24%, at least about 25%, at least about 26%, at least about 27%, at least about 28%, or at least about 29%) reduction in weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. Also, in some embodiments, the subject experiences at least about 30% to about 99% (e.g., about 30% to about 85%, about 30% to about 80%, about 30% to about 75%, etc.) reduction in weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof.

[0146] In some embodiments, the subject experiences an increase in life expectancy after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. For example, the subject experiences an increase in life expectancy of at least about 1% (e.g., at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, or at least about 9%) after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. In other examples, the subject experiences an increase in life expectancy of at least about 10% (e.g., at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, or at least about 19%) after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. In some embodiments, the subject experiences an increase in lifespan of at least about 20% (e.g., at least about 21%, at least about 22%, at least about 23%, at least about 24%, at least about 25%, at least about 26%, at least about 27%, at least about 28%, or at least about 29%) after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof. Also, in some embodiments, the subject experiences an increase in lifespan of at least about 30% to about 99% (e.g., about 30% to about 85%, about 30% to about 80%, about 30% to about 75%, etc.) after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof.

[0147] In some embodiments, the subject experiences mitochondrial vacuolation in the glioma cells (e.g., GBM cells) after initiation of treatment. In other embodiments, the subject experiences mitochondrial depolarization in the glioma cells (e.g., GBM cells) after initiation of treatment.

[0148] In some embodiments, the subject is an animal, for example, the subject is a human.

[0149] C. Methods for Inducing Vacuolization

[0150] Another aspect of the present invention is a method of inducing mitochondrial vacuolization in glioblastoma multiforme (GBM) cells in a subject, comprising administering to the subject a therapeutically effective amount of Compound 1. [ka] or a pharmaceutically acceptable salt thereof.

[0151] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is a hydrochloride salt. For example, the hydrochloride salt is a dihydrochloride salt.

[0152] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, ZNF75A, or any combination thereof in GBM cells. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in GBM cells. For example, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A in GBM cells. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of UTP23 in GBM cells. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of ARHGAP33 in GBM cells. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of ITSN1 in GBM cells.

[0153] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient, or diluent. The pharmaceutically acceptable carrier, excipient, or diluent can be any of the carriers, excipients, or diluents described herein.

[0154] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered once or twice daily. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered once daily.

[0155] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 2,000 mg. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 1,000 mg. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 900 mg, 1 mg to about 800 mg, 1 mg to about 700 mg, 1 mg to about 600 mg, 1 mg to about 500 mg, 1 mg to about 400 mg, 1 mg to about 300 mg, 1 mg to about 200 mg, 1 mg to about 100 mg, 1 mg to about 75 mg, or 1 mg to about 50 mg. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 100 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 150 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 200 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 400 mg.

[0156] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered chronically.

[0157] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about two days from the start of treatment. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about five, ten, fifteen, twenty, twenty-five, thirty, or sixty days from the start of treatment. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one, two, three, four, five, six, seven, eight, nine, ten, or eleven months from the start of treatment. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment. Also, in some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about two, three, four, five, six, seven, eight, nine, or ten years from the start of treatment.

[0158] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally or intranasally. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered intranasally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a nasal spray.

[0159] In some embodiments, the subject experiences depolarization of mitochondria in GBM cells after initiation of treatment.

[0160] In some embodiments, the subject is an animal, for example, the subject is a human.

[0161] D. Mitochondrial depolarization method

[0162] Another aspect of the present invention is a method of depolarizing mitochondria in glioblastoma multiforme (GBM) cells in a subject, comprising administering to the subject a therapeutically effective amount of Compound 1. [ka] or a pharmaceutically acceptable salt thereof.

[0163] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is a hydrochloride salt. For example, the hydrochloride salt is a dihydrochloride salt.

[0164] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, CARD1, ETV2L, HMGN5, LYSMD4, PLA2G7, TAF11, TDRD5, UTP23, UGP2, WT1P, ZNF75A, or any combination thereof in GBM cells. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in GBM cells. For example, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A in GBM cells. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of UTP23 in GBM cells. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of ARHGAP33 in GBM cells. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of ITSN1 in GBM cells.

[0165] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient, or diluent. The pharmaceutically acceptable carrier, excipient, or diluent can be any of the carriers, excipients, or diluents described herein.

[0166] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered once or twice daily. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered once daily.

[0167] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 2,000 mg. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 1,000 mg. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1 mg to about 900 mg, 1 mg to about 800 mg, 1 mg to about 700 mg, 1 mg to about 600 mg, 1 mg to about 500 mg, 1 mg to about 400 mg, 1 mg to about 300 mg, 1 mg to about 200 mg, 1 mg to about 100 mg, 1 mg to about 75 mg, or 1 mg to about 50 mg. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 100 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 500 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg to about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg to about 150 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 50 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 75 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 100 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 200 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 300 mg. In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dose of about 400 mg.

[0168] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered chronically.

[0169] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about two days from the start of treatment. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about five, ten, fifteen, twenty, twenty-five, thirty, or sixty days from the start of treatment. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one, two, three, four, five, six, seven, eight, nine, ten, or eleven months from the start of treatment. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment. Also, in some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at least once daily for at least about two, three, four, five, six, seven, eight, nine, or ten years from the start of treatment.

[0170] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally or intranasally. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered orally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension. In some examples, Compound 1, or a pharmaceutically acceptable salt thereof, is administered intranasally. For example, Compound 1, or a pharmaceutically acceptable salt thereof, is administered as a nasal spray.

[0171] In some embodiments, the subject experiences mitochondrial vacuolization in GBM cells after initiation of treatment.

[0172] In some embodiments, the subject is an animal, for example, the subject is a human. [Example]

[0173] IV. Working Examples

[0174] In order that the invention described herein may be more fully understood, the following examples are set forth. The synthetic and biological examples described in this application are offered to illustrate the compounds, pharmaceutical compositions, and methods provided herein, and are not to be construed in any way as limiting the scope thereof.

[0175] A. Materials and Methods

[0176] Cell Culture: Patient-derived glioblastoma (GBM) cell lines isolated after surgery, commercially available glioma cell lines (87MG and U-118MG), breast cancer cell lines (MDA-MB-231 and MCF-7), pancreatic cancer cell lines (MIA PaCa-2 and PANC-1), lung cancer cell line (H1299), bladder cancer cell line (T24), acute myeloid leukemia cell lines (NOMO-1, THP-1), colon cancer cell line (HT-29), neuroblastoma cell line (BE(2)-C), and human foreskin fibroblasts (CRL-2429) were cultured as adherent cultures in Dulbecco's modified Eagle's medium (DMEM) (GE Healthcare Life Sciences), 10% fetal bovine serum (FBS) (GE Healthcare Life Sciences), and 1X penicillin-streptomycin (Penstrep) (GE Healthcare Life Sciences). Cell cultures were passaged at 90% confluence.

[0177] Cell viability assay: Cell viability assays were performed by measuring total adenosine triphosphate (ATP) levels in live cells (CellTiter-Glo® Assay (Promega) according to the manufacturer's protocol). Luminescence was measured using a Victor3 FA (PerkinElmer) microtiter plate reader and plotted graphically using GraphPad Prism (v6.02) software.

[0178] Primary Screening: Primary screening was performed using cells seeded in triplicate in 96-well plates (3,000 cells per well) and allowed to adhere for at least 3 hours. The medium was changed to DMEM (FBS + 10% Penstrep-free) and cells were allowed to acclimate for 45 minutes before compound addition. Compounds were added to a final concentration of 10 μM and cells were incubated at 37°C for 4 days. ATP levels were measured after incubation.

[0179] IC50 Measurement: To measure compound dose-response inhibition of cell viability, a 96-well polypropylene (PP) microtiter compound plate (Nunc) was prepared. 11 serial dose-response dilutions of compound from 500 μM to 500 nM in 100% DMSO were added at 20 μL / well to columns 1–9 of each row. Negative controls (100% DMSO) and positive controls (10 mM staurosporine in DMSO) were placed in columns 10 and 11, respectively. The plate was diluted with 180 μL of growth medium per well, and 5 μL of the resulting compound solution was transferred in quadruplicate to the assay plate. Assay plates were prepared by seeding 3,000 cells / well in a 384-well clear-bottom microtiter plate and allowing them to adhere for at least 3 hours. The medium was then changed to DMEM (FBS + 10% Penstrep-free), and the cells were allowed to acclimate for 45 minutes before adding 5 μL of compound from the compound plate. Plates were incubated for 1, 2, 3, or 4 days, and ATP levels were measured after incubation.

[0180] Long-term exposure assay: Measurements for the long-term assay were performed on days 4, 8, 14, and 21. 3,000 cells / well were seeded into 384-well plates (day 4 assay), 96-well plates (day 8 assay), 24-well plates (day 14 assay), 6-well plates (day 21 assay), or 10 cm plates (day 30 assay) and allowed to attach as described above. Following this, the medium was replaced with DMEM (without FBS + 1X Penstrep) containing either DMSO as a control treatment or compound (final concentrations of 0.1 μM or 5 μM). Every 4 days, the medium was replaced with fresh DMEM (without FBS + 1X Penstrep) containing DMSO (control) or compound. Cell viability assays were performed at the end of days 4, 8, 14, and 21.

[0181] Transfection with siRNA: Cells were seeded in triplicate at 3,000 cells / well and treated with 40 or 50 nmol of siRNA against SLC6A3 (siGENOME Human SLC6A3 (6531 siRNA-SMARTpool, 5 nmol (Dharmacon)) or 40 nmol Scramble (siGENOME Non-Targeting siRNA Pool #1, 20 nmol (Dharmacon)) as an internal control in DMEM (-FBS, -Penstrep). Total siRNA / HiPerfect® Transfection Reagent 29 (QIAGEN) was prepared in 16% of the total volume, and siRNA was prepared in OPTIMEM (8% of the total volume). After incubation at room temperature (RT) for 5 min, the cells were mixed with HiPerfect / OPTIMEM solution (8% of the total volume, HiPerfect 0.3%) and incubated at RT for 20 min. After 20 h, the medium was replaced with DMEM (10% The cells were then incubated for 48 hours with compounds (at the concentrations used in the IC50 studies) and cell viability assays were performed. To determine knockdown efficiency, total RNA from cells treated with scrambled RNA or siRNA was isolated using the TRIzol method (according to the manufacturer's instructions), and cDNA was prepared using SuperScript III First-Strand Synthesis SuperMix.qPCR was performed using cDNA with SYBR Select Master Mix (Applied Biosystems) and primers generated with Primer3 software for SLC6A3 (500 nM) (primer pair SLC6A3:1 forward; TCACCAACGGTGGCATCTAC, reverse; TCATCTGCTGGATGTCGTCG, 5' to 3', generating a 144-bp amplicon (Integrated DNA technologies) and SLC6A3:2 forward; TCACCAACGGTGGCATCTAC, reverse; CACTCCGATGGCTTCGATGA, 5' to 3', generating a 95-bp amplicon (Schrodter et al., 2016) (Integrated DNA technologies)); and beta-actin control (500 nM) (Hs_ACTB_2_SG QuantiTect Primer Assay (Qiagen)). PCR conditions were 50°C for 2 minutes (UDG activation), 95°C for 2 minutes (AmpliTaq DNA polymerase activation), and 40 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 60 seconds, using Corbette Research's RotorGene 6000 Series Software 1.7. Housekeeping genes were run at concentrations of 1:2.5, 1:5, and 1:25, and SLC6A3 was run at 1:5 and 1:25 (from 1000 ng / μL cDNA). Samples were pooled and run at 4°C on a Lonza Flash gel cassette (10 μL, 0.5 mg / μL, 1.2% 12+1 Single Tier DNA (Lonza)). Results were analyzed by relative expression using the ΔΔCt method.

[0182] Example 1: Preliminary cytotoxicity studies.

[0183] The cytotoxic effects of a variety of compounds were observed in the patient-derived cell lines described above in Materials and Methods. These compounds were classified based on their previously established activity as antipsychotics, stimulants, anticonvulsants and mood stabilizers, antidepressants and benzodiazepines, sedatives, and hypnotics.

[0184] Referring to Figure 1A, after treatment with benzodiazepines, sedatives, and hypnotics, overall low toxicity was detected compared to other classes of compounds. The most effective compounds were found to be anticonvulsants, mood stabilizers, antidepressants, antipsychotics, and stimulants that target the dopaminergic system.

[0185] All compounds targeting the dopaminergic pathway were further classified based on the target receptor and analyzed in brain, breast, colon, lung, and pancreatic cancer cell lines. The results are shown in Tables 1-3. Cancer cells were isolated from GBM, breast, colon, pancreatic, and lung cancer tumors. The compounds tested included dopamine agonists (DAg), dopamine (DA), dopamine reuptake inhibitors (DRI), dopamine uptake inhibitors (DUI), and dopamine antagonists (DAn). DMSO was used as a control and assigned a value of 1. The activity of each compound was compared to DMSO and classified. The compounds tested are shown in Tables 1-3. Compounds with the highest cytotoxicity against a particular cancer cell line are classified as "A," while compounds with the lowest cytotoxicity against a particular cancer cell line are classified as "D." Compounds showing moderate cytotoxicity are classified as "B" or "C." In Tables 1-3, "A" indicates a score less than 0.60 (i.e., A<0.60), "B" indicates a score between 0.60 and 1.00 (i.e., 0.60≦B<1.00), "C" indicates a score between 1.00 and 1.30 (i.e., 1.00≦C<1.30), and "D" indicates a score greater than or equal to 1.30 (i.e., D≧1.30).

[0186] [Table 1-1] [Table 1-2] [Table 1-3]

[0187] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]

[0188] [Table 3]

[0189] The results demonstrate that various compounds known as dopamine antagonists, dopamine agonists, and dopamine release / uptake / reuptake inhibitors exhibit significant cytotoxicity against specific cancer cell lines compared to the cytotoxicity of DMSO. Among these compounds, compound 1 (i.e., GBR-12909 in Table 3) exhibited the most potent level of cytotoxic activity (i.e., Level A) against all cell lines tested.

[0190] Example 2: Additional cytotoxicity studies.

[0191] Based on the results of Example 1, Compound 1 was selected for further evaluation. The half-maximal inhibitory concentrations (IC50) of Compound 1 were obtained after 4 days of treatment based on the cell viability assay and are summarized in Table 4 below.

[0192] [Table 4]

[0193] As shown in Tables 3 and 4, compound 1 exhibited uniformly potent cytotoxic activity in all cancer cell lines studied. In this initial study, the selectivity of compound 1 for inhibiting cancer cells compared to normal cells was not evaluated.

[0194] Example 3: Compound 1 in GBM cells.

[0195] Figure 1B shows a serial dilution experiment of Compound 1 performed on patient-derived GBM cells and fibroblasts isolated from the same patient after 4 days of incubation. The serial dilution experiment showed an IC50 of 4.9 μM for glioma cells from Patient 1 and 13.8 μM for fibroblasts from Patient 1. Figures 1C and 1D show serial dilution experiments performed multiple times at various cell passages to determine the variability of IC50 values. Referring to Figure 1C, the IC50 of Compound 1 for GBM cells was found to range from about 300 nM to about 6.4 μM. Referring to Figure 1D, the IC50 of Compound 1 for fibroblasts was found to range from about 16 μM to about 41 μM.

[0196] The serial dilutions in Figure 2 show the effect of Compound 1 on GBM cells isolated from five additional patients. A mean IC50 of 4.72 μM was observed in GBM cells. This indicates that Compound 1 acted as a potent cytotoxin against glioma cells, demonstrating its potential usefulness as a therapeutic agent.

[0197] Example 4: Long-term exposure study of Compound 1 in GBM cells.

[0198] Patient-derived GBM cells were treated with Compound 1 at concentrations of 5 μM or 0.1 μM and incubated for 21 days. Fibroblasts were used as a control (Figure 3B). As shown in Figure 3A, Compound 1 at 0.1 μM eliminated GBM cells without exhibiting cytotoxicity to fibroblasts (i.e., the control). These results indicate that Compound 1 may be administered at therapeutically effective doses to treat GBM without affecting non-GBM cells.

[0199] Example 5: Dopamine transporter knockdown and cell death analysis in GBM cells.

[0200] Compound 1 is known to bind to the dopamine transporter (DAT) and inhibit dopamine release. To assess whether the cytotoxicity of Compound 1 in GBM cells is due to inhibition of dopamine reuptake, we knocked down DAT in GBM cells using siRNA. Coded samples were used as controls. As shown in Figure 4A, Compound 1 showed similar IC50 values ​​in both DAT-knockdown and control (scrambled) cells 96 h after treatment, but the relative expression of DAT was dramatically reduced in cells treated with siRNA against DAT. If the cytotoxic activity of Compound 1 were due to modulation of DAT, Compound 1 would not exhibit cytotoxicity against DAT-knockdown cells. Therefore, these results suggest that the cytotoxic activity of Compound 1 is likely due to targets other than DAT.

[0201] As shown in Figure 4B, cytotoxicity and apoptosis assay analysis (performed using the ApoTox-Glo (Promega) kit according to the manufacturer's instructions) indicated that compound 1-treated cells generated significant cytotoxicity but did not initiate apoptosis in glioma cells. As shown in Figures 4C and 4D, immunostaining with a caspase 3 antibody (apoptosis marker) indicated that compound 1 did not generate apoptosis-positive cells (similar to the control) compared with staurosporine, a positive control for apoptosis, in patient 1 glioma cells. Quantification of Annexin V-positive cells following immunostaining indicated that compound 1-treated cells did not generate more apoptosis-positive cells in fibroblast control and patient 1 glioma cells. These results suggest that compound 1 does not act through the DAT receptor and dopaminergic pathways and does not cause cell death via apoptosis.

[0202] Examples 6 and 7: Mitochondrial vacuolation and depolarization in GBM cells treated with Compound 1.

[0203] GBM cells were treated with Compound 1, carbonyl cyanide m-chlorophenylhydrazine (CCCP; positive control), or DMSO (negative control), and the mitochondrial membrane potential (indicating the functional status of GBM cells) was measured and analyzed. Referring to Figures 5A and 5B, treatment with Compound 1 resulted in mitochondrial depolarization, similar to CCCP (i.e., the positive control).

[0204] Separately, GBM cells were treated with Compound 1 (2.5 μM, 5 μM, or 10 μM) or DMSO (control) and incubated for 48 hours. Referring to Figures 6A and 6B, GBM cells were analyzed by transmission electron microscopy (TEM) after 3, 6, 12, 24, and 48 hours of incubation. Treatment with Compound 1 induced mitochondrial vacuolization in GBM cells.

[0205] Example 8: Identification of potential targets of Compound 1 in GBM cells.

[0206] Referring to step I of Figures 7A and 7B, we conducted a genome-wide CRISPR-Cas9 study (B. Schmierer, Mol. Systems Biol., 13, 945 (2017)) to identify targets that may explain the effects of compound 1 on cancer cells. The top 5% of targets, shown in Figure 7B, were identified, some of which were confirmed by siRNA-based knockdown using either control (mock-siRNA or scrambled control siRNA (SCR)) or gene-specific siRNA (for BMPR1A, UTP23, ARHGAP33, and ITSN1), as shown in Figure 7C, followed by treatment with or without compound 1. Referring to Figure 7C, knockdown of the targets BMPR1A, ARHGAP33, and ITSN1 resulted in higher IC50 values ​​upon treatment with compound 1, indicating some resistance to the cytotoxic effects of compound 1. This indicates that these targets are required for the maximal cytotoxic activity of compound 1. Referring to step II of FIG. 7A and FIGS. 8A and 8B, after the CRISPR screening analysis was completed, the expression of the identified hits was confirmed in GB cells, as shown in FIG. 8A. The binding between compound 1 and the identified hits was established by a pull-down assay using biotin-labeled compound 1 (FIG. 8B). The results indicate that the cytotoxic effect of compound 1 observed in GBM cells may be related to the modulation of BMPR1A, UTP23, ARHGAP33, and / or ITSN1.

[0207] Example 9: Effect of Compound 1 in a mouse model.

[0208] GBM cancer cell lines were xenografted into 8-week-old male nude mice, and tumors were allowed to grow for 4 weeks. GBM cells were stereotaxically implanted into the brain and allowed to grow for 4 weeks. After 4 weeks, oral treatment with Compound 1 was initiated (day 1). Mice were allowed to survive until reaching the ethical endpoint of the study. Animal weight and activity were continuously monitored. As shown in Figure 9, mice treated with Compound 1 exhibited reduced tumor size compared to mice not treated with Compound 1. As shown in Figure 10, mice treated with Compound 1 experienced reduced weight loss compared to mice not treated with Compound 1. As shown in Figure 11, mice treated with Compound 1 exhibited extended survival compared to mice not treated with Compound 1. Mice treated with Compound 1 also exhibited increased physical activity compared to mice not treated with Compound 1. These results indicate that Compound 1 may be useful for both the treatment of GBM and palliative care for subjects suffering from GBM.

[0209] Example 10: Combination therapy studies.

[0210] GBM cells were treated with Compound 1 and various other U.S. Food and Drug Administration (FDA)-approved anti-tumor drugs, including temozolomide (TMZ), ixabepilone, cladribine, enzalutamide, omacetaxine mepesuccinate, epothilone, erbulin, and latrunculin. Treatment with Compound 1 in the additional presence of ixabepilone, cladribine, or enzalutamide resulted in a statistically significant decrease in cell viability. Referring to Figures 12A-C, the results demonstrate that Compound 1 can be effectively combined with other FDA-approved anti-tumor drugs for the treatment of GBM.

[0211] These examples demonstrate the potential of Compound 1, a selective dopamine uptake inhibitor, as a broad-spectrum cytotoxic agent. Compound 1, as documented in Examples 1 and 2, is more potent and broadly cytotoxic than numerous dopamine antagonists, dopamine agonists, and dopamine release / uptake / reuptake inhibitors. Examples 3 and 4 demonstrate that Compound 1 inhibits the proliferation of GBM cells, and does so to a greater extent than human fibroblasts (Figures 1B-3B). Example 5 demonstrates that Compound 1 does not exert its anti-glioma effect via the dopamine transporter. Instead, Compound 1 appears to act via mitochondrial vacuolization and depolarization in GBM cells (Example 7). Using a genomic CRISPR-Cas9 screen, it was shown that inhibition may be related to the regulation of BMPR1A, UTP23, ARHGAP33, and / or ITSN1 (Example 8). Compound 1 was also shown to inhibit the proliferation of GBM cells xenografted into mice. In addition to tumor size reduction as a result of Compound 1 administration, treated mice also showed increased physical activity compared to mice not treated with Compound 1 and experienced less weight loss than xenografted mice not treated with Compound 1 (Example 9). In studies involving the use of other FDA-approved oncology drugs, the additional presence of ixabepilone, cladribine, or enzalutamide resulted in a statistically significant increase in cell viability (Example 10). Compound 1 has previously been tested in clinical trials as a dopamine uptake inhibitor, and its safety when administered to humans has been established.

[0212] These data support the potential utility of compound 1 for the treatment of glioma and suggest that compound 1 functions through a unique mechanism of action involving mitochondrial inhibition in glioblastoma cells. Therefore, although other compounds are being tested for the treatment of glioma, as exemplified by recent studies on CDK inhibitors (Bronner et al. Bioorg. Med Chem., 29, 2294 (2019); Yin et al. Eur. J. Med Chem., 144, 1 (2018)), these compounds appear to act as kinase inhibitors rather than through mitochondrial inhibition.

[0213] As demonstrated in Example 10, the activity of Compound 1 can be potentiated by at least three FDA-approved anticancer drugs. This finding suggests that Compound 1 may be suitable for the treatment of cancers other than glioblastoma, either as a single agent or in a treatment regimen, as does its broad cytotoxic activity against a variety of cancer cell types (Examples 1 and 2). Other embodiments

[0214] While the present invention has been described in conjunction with its detailed description, it is to be understood that the foregoing description is illustrative and not limiting of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. 1. A method of treating cancer in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of Compound 1. 【Chemistry 13】 or a pharmaceutically acceptable salt thereof, wherein the cancer is selected from brain cancer, breast cancer, pancreatic cancer, lung cancer, or any combination thereof.

2. 2. The method of claim 1, wherein the compound 1, or the pharmaceutically acceptable salt thereof, is the hydrochloride salt of the compound 1.

3. 2. The method of claim 1, wherein the compound 1, or the pharmaceutically acceptable salt thereof, is the dihydrochloride salt of the compound 1.

4. The method according to any one of claims 1 to 3, wherein the cancer is a brain tumor.

5. The method of any one of claims 1 to 4, wherein compound 1, or the pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in cancer cells.

6. 6. The method of any one of claims 1 to 5, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient, or diluent.

7. The method of any one of claims 1 to 6, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered at least once daily.

8. The method of any one of claims 1 to 7, further comprising administering to the subject an additional therapeutic agent.

9. 9. The method of claim 8, wherein the additional therapeutic agent is an anti-cancer agent.

10. 10. The method of claim 9, wherein the anticancer agent is selected from temozolomide, ixabepilone, cladribine, enzalutamide, omacetaxine mepesuxinate, epothilone, erbulin, latrunculin, a pharmaceutically acceptable salt of any of these anticancer agents, or any combination thereof.

11. The method of any one of claims 8 to 10, wherein the compound 1, or the pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered simultaneously.

12. The method of any one of claims 8 to 10, wherein the compound 1, or the pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered sequentially.

13. The method of any one of claims 1 to 12, further comprising administering radiation therapy to the subject.

14. 14. The method of any one of claims 1 to 13, wherein Compound 1, or the pharmacologically acceptable salt thereof, is administered at a dosage of about 1 mg to about 1,000 mg.

15. The method of any one of claims 1 to 14, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered chronically.

16. 16. The method of any one of claims 1 to 15, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally.

17. The method of any one of claims 1 to 16, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered orally.

18. 18. The method of any one of claims 1 to 17, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension.

19. 19. The method of any one of claims 1 to 18, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment.

20. 20. The method of any one of claims 1 to 19, wherein the subject experiences reduced weight loss after initiation of treatment compared to a subject not administered Compound 1 or a pharmaceutically acceptable salt thereof.

21. The method according to any one of claims 1 to 20, wherein the subject experiences mitochondrial vacuolation in cancer cells after initiation of treatment.

22. The method of any one of claims 1 to 21, wherein the subject is a human.

23. 1. A method of treating glioma in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of Compound 1. 【Chemistry 14】 or a pharmaceutically acceptable salt thereof.

24. 24. The method of claim 23, wherein the compound 1, or the pharmaceutically acceptable salt thereof, is the hydrochloride salt of the compound 1.

25. 24. The method of claim 23, wherein the compound 1, or the pharmaceutically acceptable salt thereof, is the dihydrochloride salt of the compound 1.

26. 26. The method of any one of claims 23 to 25, wherein the glioma is selected from the group consisting of astrocytoma, ependymoma, oligodendroglioma, brainstem glioma, optic nerve glioma, and mixed glioma.

27. 27. The method of any one of claims 23 to 26, wherein the glioma is an astrocytoma, and the astrocytoma is glioblastoma multiforme (GBM).

28. The method of any one of claims 23 to 27, wherein compound 1, or the pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in glioma cells.

29. 29. The method of any one of claims 23 to 28, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition additionally comprising a pharmaceutically acceptable carrier, excipient, or diluent.

30. 30. The method of any one of claims 23 to 29, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered at least once daily.

31. 31. The method of any one of claims 23 to 30, further comprising administering to the subject an additional therapeutic agent.

32. 32. The method of claim 31 , wherein the additional therapeutic agent is an anti-cancer agent.

33. 33. The method of claim 32, wherein the anticancer agent is selected from temozolomide, ixabepilone, cladribine, enzalutamide, omacetaxine mepesuxinate, epothilone, erbulin, latrunculin, a pharmaceutically acceptable salt of any of these anticancer agents, or any combination thereof.

34. 34. The method of any one of claims 31 to 33, wherein the Compound 1, or the pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered simultaneously.

35. 34. The method of any one of claims 31 to 33, wherein the compound 1, or the pharmaceutically acceptable salt thereof, and the additional therapeutic agent are administered sequentially.

36. The method of any one of claims 23 to 35, further comprising administering radiation therapy to the subject.

37. 37. The method of any one of claims 23 to 36, wherein Compound 1, or the pharmacologically acceptable salt thereof, is administered at a dosage of about 1 mg to about 1,000 mg.

38. 38. The method of any one of claims 23 to 37, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered chronically.

39. 39. The method of any one of claims 23 to 38, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally.

40. 40. The method of any one of claims 23 to 39, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered orally.

41. 41. The method of any one of claims 23 to 40, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension.

42. 42. The method of any one of claims 23-41, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment.

43. 43. The method of any one of claims 23-42, wherein the subject experiences reduced weight loss after initiation of treatment compared to a subject not administered Compound 1, or a pharmaceutically acceptable salt thereof.

44. 44. The method of any one of claims 23 to 43, wherein the subject experiences mitochondrial vacuolization in glioma cells after initiation of treatment.

45. The method of any one of claims 23 to 44, wherein the subject is a human.

46. 1. A method for inducing mitochondrial vacuolation in glioblastoma multiforme (GBM) cells in a subject, comprising administering to the subject a therapeutically effective amount of Compound 1. 【Chemistry 15】 or a pharmaceutically acceptable salt thereof.

47. 47. The method of claim 46, wherein the compound 1, or the pharmaceutically acceptable salt thereof, is the hydrochloride salt of the compound 1.

48. 47. The method of claim 46, wherein the compound 1, or the pharmaceutically acceptable salt thereof, is the dihydrochloride salt of compound 1.

49. The method of any one of claims 46 to 48, wherein compound 1, or a pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in GBM cells.

50. 50. The method of any one of claims 46 to 49, wherein the compound, or the pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition additionally comprising a pharmaceutically acceptable carrier, excipient, or diluent.

51. 51. The method of any one of claims 46 to 50, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered at least once daily.

52. 52. The method of any one of claims 46 to 51, wherein Compound 1, or the pharmacologically acceptable salt thereof, is administered at a dosage of about 1 mg to about 1,000 mg.

53. 53. The method of any one of claims 46 to 52, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered chronically.

54. 54. The method of any one of claims 46 to 53, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally.

55. 55. The method of any one of claims 46 to 54, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered orally.

56. 56. The method of any one of claims 46 to 55, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension.

57. 57. The method of any one of claims 46-56, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment.

58. 58. The method of any one of claims 46 to 57, wherein the subject is a human.

59. 1. A method of depolarizing mitochondria in glioblastoma multiforme (GBM) cells in a subject, comprising administering to the subject a therapeutically effective amount of Compound 1. 【Chemistry 16】 or a pharmaceutically acceptable salt thereof.

60. 60. The method of claim 59, wherein the compound 1, or the pharmaceutically acceptable salt thereof, is the hydrochloride salt of the compound 1.

61. 60. The method of claim 59, wherein the compound 1, or the pharmaceutically acceptable salt thereof, is the dihydrochloride salt of compound 1.

62. The method of any one of claims 59 to 61, wherein compound 1, or the pharmaceutically acceptable salt thereof, modulates the activity of BMPR1A, UTP23, ARHGAP33, ITSN1, or any combination thereof in the GBM cells.

63. 63. The method of any one of claims 59-62, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered as a pharmaceutical composition additionally comprising a pharmaceutically acceptable carrier, excipient, or diluent.

64. 64. The method of any one of claims 59 to 63, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered at least once daily.

65. 65. The method of any one of claims 59 to 64, wherein Compound 1, or the pharmacologically acceptable salt thereof, is administered at a dosage of about 1 mg to about 1,000 mg.

66. 66. The method of any one of claims 59 to 65, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered chronically.

67. 67. The method of any one of claims 59 to 66, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered orally, subcutaneously, intramuscularly, intravenously, intracranially, intrathecally, or intranasally.

68. 68. The method of any one of claims 59 to 67, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered orally.

69. 69. The method of any one of claims 59 to 68, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered as a tablet, capsule, or oral suspension.

70. 70. The method of any one of claims 59-69, wherein Compound 1, or the pharmaceutically acceptable salt thereof, is administered at least once daily for at least about one year from the start of treatment.

71. 71. The method of any one of claims 59 to 70, wherein the subject experiences mitochondrial vacuolization in GBM cells after initiation of treatment.

72. 72. The method of any one of claims 59 to 71, wherein the subject is a human.

73. A pharmaceutical composition for treating glioma in a subject, the pharmaceutical composition comprising Compound 1. 【Chemistry 17】 or a pharmaceutically acceptable salt thereof.

74. 74. The pharmaceutical composition of claim 73, wherein the composition comprises the hydrochloride salt of Compound 1.

75. 74. The pharmaceutical composition of claim 73, wherein the composition comprises the dihydrochloride salt of Compound 1.

76. The pharmaceutical composition according to any one of claims 73 to 75, wherein the pharmaceutical composition is a nasal spray having a viscosity of about 100 cP to about 2,500 cP.

77. 76. The pharmaceutical composition of any one of claims 73 to 75, wherein the pharmaceutical composition comprises a tablet, capsule, or oral suspension.

Images