Increasing leaf biomass and nitrogen use efficiency by regulating NTP2

Abstract

Disclosed are mutant, non-native, or transgenic plants or plant parts that have reduced or suppressed expression or activity of NtNTP2-T, or reduced or suppressed expression or activity of NtNTP2-T and NtNTP2-S.

Description

[Technical Field]

[0001] The present invention generally relates to mutant, non-native, or transgenic plant leaves or plant leaf portions having modulated expression or activity of NTP2. In particular, the present invention relates to mutant, non-native, or transgenic plants or plant parts (such as leaves) having reduced or suppressed expression or activity of NTP2, resulting in increased biomass and nitrogen use efficiency (NUE) responses without reducing nitrate levels in the plant or plant part. [Background technology]

[0002] Modern industrial agriculture aims to continuously improve crop yield relative to cost. Nitrogen fertilizers enable farmers to achieve these improved yields. Depending on the crop, fertilizer use contributes to a large portion of production costs and is associated with the risk of adverse environmental impacts, as 50–70% of applied nitrogen is lost from the plant-soil system, causing pollution. Improving nitrogen use efficiency (NUE) is important for reducing the costs of crop production as well as environmental damage.

[0003] Reducing tobacco nitrate levels in tobacco plants reduces the accumulation of tobacco-specific nitrosamines (TSNAs) in cured leaves and cigarette smoke (Lu et al. (2016) Plant Biotechnology Journal, 14:1500-1510, and WO2016046288). TSNAs are a class of compounds primarily produced during the curing of tobacco leaves, although additional formation can occur during subsequent processing and storage of the leaves, and possibly via thermal synthesis during combustion. Two TSNAs found in cured leaves, N-nitrosonornicotine (NNN) and 4-(methylnitrosamino)-l-(3-pyridyl)-l-butanone (NNK), are classified as Group I carcinogens (highest rating) by the International Agency for Research on Cancer. Due to evidence implicating these compounds in various tobacco-related cancers, the World Health Organization and other experts in the field have recommended mandatory practices to ensure that future tobacco products contain reduced levels of these toxicants. TSNAs have been shown to be potent carcinogens in numerous animal studies (Hecht (1998) Chem Res Toxicol, Jun;11(6):559-603; Ma et al. (2018) Carcinogenesis, Feb 9;39(2):232-241; Kovi et al. (2018) Toxicol Pathol., Feb;46(2):184-192; Carlson et al. (2018) Chem Res Toxicol., May 21;31(5):358-370).

[0004] Although reducing nitrate levels can have a positive impact on reducing TSNA levels in tobacco, growing tobacco under these conditions can have a negative impact on plant biomass and quality, making it not a viable option, particularly for commercial tobacco production. There is a general need in the art to develop plants, such as tobacco plants, that have increased yields with less fertilization and therefore improved NUE. Summary of the Invention

[0005] Disclosed herein are two genes from Nicotiana tabacum (NtNTP2-S and NtNTP2-T), which, by homology search to Arabidopsis thaliana AtNTP2 At2g26690, belong to the nitrate transporter family 1 NRT1.4 (PTR2 family of peptide transporters). Using a variety of different methods, reducing or suppressing (e.g., switching off) the expression or activity of endogenous NtNTP2-T or both NtNTP2-S and NtNTP2-T in Nicotiana tabacum was found to confer advantageous phenotypes that improved agronomic traits compared to control plants grown under the same conditions. Specifically, (i) nitrate levels were not reduced, (ii) biomass (e.g., leaf biomass) increased under both standard and nitrogen-starved conditions, and (iii) the NUE response, expressed as biomass per unit of nitrogen fertilization applied, increased. As used herein, "unit" in the context of applied units of nitrogen fertilization means "kg per hectare," as discussed herein. These results make NtNTP2-T, or both NtNTP2-S and NtNTP2-T, excellent targets for developing plants that exhibit increased yields at lower fertilization rates compared to control plants grown under the same conditions. Surprisingly, NtNTP2-T alone, but not NtNTP2-S alone, can confer this advantageous phenotype.

[0006] It is also shown herein that reducing or suppressing NtNTP2 function, for example, using mutation or RNAi, surprisingly results in altered (e.g., increased) root development by producing more and finer roots compared to wild-type plants grown under the same conditions. Without being bound by any particular theory, this may increase the plant's ability to take up nutrients from the soil.

[0007] The advantageous phenotype of the present invention is also surprising in light of the results reported in Chiu et al. (2004) Plant Cell Physiol., 45(9), 1139-1148 (which discloses results on homozygous Arabidopsis AtNTP2 insertion mutants). Arabidopsis homozygous AtNTP2 insertion mutants developed (i) 50-64% lower nitrate levels, (ii) increased plant leaf width due to cell proliferation, and (iii) no mention of improved NUE. Therefore, it is surprising and unexpected that, despite the 77% identity between NtNTP2 and AtNTP2, NtNTP2 is an excellent target for developing plants with increased yield and a higher NUE response (ratio of biomass per unit of nitrogen applied) compared to wild-type plants grown under the same conditions. Meanwhile, this has not been demonstrated for AtNTP2 in the mentioned publication.

[0008] This advantageous phenotype is even more surprising in light of results reported in U.S. Patent Application Publication No. 2014 / 0201863, in which loss of function of Arabidopsis NRT1.7 under nitrogen starvation conditions via transgenic approaches resulted in growth retardation and a 30% reduction in rosette diameter.

[0009] In one aspect, a mutant, non-naturally occurring, or transgenic plant or plant part is disclosed that has reduced or suppressed expression or activity of NtNTP2-T, or reduced or suppressed expression or activity of NtNTP2-T and NtNTP2-S, wherein said NtNTP2-T and NtNTP2-S are (i) an NtNTP2-S polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO:3, or (ii) a sequence having at least 70% sequence identity to SEQ ID NO:11. or (iii) a polypeptide encoded by the polynucleotide described in (i) or (ii), or (iv) an NtNTP2-S polypeptide having at least 77% sequence identity to SEQ ID NO: 7, or (v) an NtNTP2-T polypeptide having at least 77% sequence identity to SEQ ID NO: 12, wherein expression or activity of NtNTP2-T, or expression or activity of NtNTP2-T and NtNTP2-S, is reduced or suppressed compared to a control plant.

[0010] Preferably, the plant or plant part (i) has no reduced nitrate levels compared to control plants grown under the same fertilization conditions, (ii) has increased biomass compared to control plants grown under the same fertilization conditions, and (iii) has an increased NUE response, expressed as biomass per unit of nitrogen applied, compared to control plants grown under the same conditions. The plant or plant part may also have increased root development compared to control plants grown under the same fertilization conditions.

[0011] In one embodiment, the plant or plant part (e.g., a leaf) (i) does not have reduced nitrate levels compared to a control plant grown under the same conditions, (ii) has at least a 5% increase in biomass compared to a control plant grown under the same conditions, and (iii) has at least a 5% increase in NUE response compared to a control plant grown under the same conditions. The plant or plant part may also have increased root development compared to a control plant grown under the same fertilization conditions.

[0012] In another embodiment, the plant or plant part (e.g., a leaf) (i) has no reduced nitrate levels compared to a control plant grown under the same fertilization conditions, (ii) has at least a 5% increase in biomass compared to a control plant grown under the same fertilization conditions, and (iii) has at least a 5% increase in NUE response compared to a control plant grown under the same fertilization conditions. The plant or plant part may also have increased root development compared to a control plant grown under the same fertilization conditions.

[0013] Mutant, non-naturally occurring, or transgenic plants or plant parts can be modified in various ways to reduce or suppress the expression or activity of NtNTP2-T, or to reduce or suppress the expression or activity of NtNTP2-T and NtNTP2-S. Preferably, the mutant, non-naturally occurring, or transgenic plant or plant part in which the expression or activity of NtNTP2-T, or the expression or activity of NtNTP2-T and NtNTP2-S, is reduced or suppressed is characterized by the presence of (i) one or more sequence-specific polynucleotides capable of interfering with the transcription of NtNTP2-T, or NtNTP2-T and NtNTP2-S, (ii) one or more sequence-specific polypeptides capable of interfering with the stability of NtNTP2-T, or NtNTP2-T and NtNTP2-S, (iii) one or more sequence-specific polypeptides capable of interfering with the enzymatic activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, with respect to a substrate or regulatory protein, or (iv) one or more sequence-specific polypeptides capable of interfering with the stability of NtNTP2-T, or NtNTP2-T and NtNTP2-S, with respect to a substrate or regulatory protein, or (v) one or more sequence-specific polypeptides capable of interfering with the enzymatic activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, with respect to a substrate or regulatory protein, or (vi) one or more sequence-specific polypeptides capable of interfering with the enzymatic activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, with respect to a substrate or regulatory protein, or (vii ... (iv) a gene-edited NtNTP2-T, or NtNTP2-T and NtNTP2-S, or (v) at least one genetic alteration in the NtNTP2-T polynucleotide sequence, or at least one genetic alteration in the NtNTP2-T polynucleotide and NtNTP2-S polynucleotide sequences, or at least one genetic alteration in the NtNTP2-T polypeptide sequence, or at least one genetic alteration in the NtNTP2-T polypeptide sequence and NtNTP2-S polypeptide sequence, preferably at least one genetic alteration that causes the encoded polypeptide to terminate or stop translation earlier than in a control plant.

[0014] Suitably, NtNTP2-T, or NtNTP2-T and NtNTP2-S, are gene edited using a bacterial CRISPR / Cas system.

[0015] Preferably, the at least one genetic alteration is at least one mutation.

[0016] Preferably, the mutant, non-naturally occurring, or transgenic plant or plant part comprises at least one nonsense mutation in an NtNTP2-T polynucleotide or NtNTP2-T polypeptide, or at least one nonsense mutation in an NtNTP2-T polynucleotide or NtNTP2-T polypeptide and at least one nonsense mutation in an NtNTP2-S polynucleotide or NtNTP2-S polypeptide.

[0017] Preferably, the mutant, non-naturally occurring or transgenic plant or plant part comprises a single nucleotide polymorphism in NtNTP2-S at nucleotide position 632, or 633, or 632 and 633 of SEQ ID NO:3, preferably the single nucleotide polymorphism is a "g" to "a" mutation at nucleotide position 632, or 633 of SEQ ID NO:3, or a "g" to "a" mutation at nucleotide positions 632 and 633 of SEQ ID NO:3.

[0018] Preferably, the mutant NtNTP2-S polynucleotide sequence comprises, consists of, or consists essentially of SEQ ID NO:4, or SEQ ID NO:5, or SEQ ID NO:6.

[0019] Preferably, the mutant, non-naturally occurring or transgenic plant or plant part comprises a single nucleotide polymorphism in NtNTP2-T at nucleotide position 636 of SEQ ID NO:11, preferably the single nucleotide polymorphism is a "g" to "a" mutation at nucleotide position 635 or 636 of SEQ ID NO:11, or a "g" to "a" mutation at nucleotide positions 635 and 636 of SEQ ID NO:11.

[0020] Preferably, the mutant NtNTP2-T polynucleotide sequence comprises, consists of, or consists essentially of SEQ ID NO:13, or SEQ ID NO:14, or SEQ ID NO:15.

[0021] Preferably, the mutant NtNTP2-T polypeptide, or the mutant NtNTP2-T polypeptide and the mutant NtNTP2-S polypeptide, respectively, has at least one nonsense mutation at positions W212 and W211, respectively.

[0022] Preferably, the mutant NtNTP2-T polypeptide, or the mutant NtNTP2-T polypeptide and the mutant NtNTP2-S polypeptide, comprises, consists of, or consists essentially of SEQ ID NO: 16, or either SEQ ID NO: 8 and SEQ ID NO: 16, respectively; and optionally, the mutant NtNTP2-T polypeptide, or the mutant NtNTP2-T polypeptide and the mutant NtNTP2-S polypeptide, is truncated.

[0023] Preferably, the plant part is selected from (i) a green leaf or part thereof, or (ii) a dried leaf or part thereof (preferably, the dried leaf or part thereof is air-dried, preferably sun-dried or flame-dried and hot air-dried through an air flue), or (iii) a dried leaf or part thereof (preferably, the dried leaf is air-dried, more preferably sun-dried or flame-dried and hot air-dried through an air flue).

[0024] In a further aspect, a method of preparing a plant or plant part is disclosed, the method comprising: (a) producing an NtNTP2-S polynucleotide sequence comprising, consisting of, or consisting essentially of (i) an NtNTP2-S polynucleotide sequence having at least 70% sequence identity to SEQ ID NO:3, or (ii) an NtNTP2-T polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO:11, or (iii) a polypeptide encoded by the polynucleotide set forth in (i) or (ii), or (iv) an NtNTP2-S polypeptide having at least 77% sequence identity to SEQ ID NO:7; or (v) providing a plant comprising an NtNTP2-T polypeptide having at least 77% sequence identity with SEQ ID NO: 12; (b) reducing the expression or activity of NtNTP2-T or a combination of NtNTP2-T and NtNTP2-S in the plant; and (c) obtaining a plant or part of a plant, wherein (i) nitrate levels are not reduced compared to control plants grown under the same fertilization conditions; and (ii) biomass is increased compared to control plants grown under the same fertilization conditions; and (iii) NUE response is increased compared to control plants grown under the same fertilization conditions. The plant or part of a plant may also have increased root development compared to control plants grown under the same fertilization conditions. In a further aspect, a mutant, non-natural, or transgenic plant or part thereof obtained or obtainable by the method of the present invention is disclosed.

[0025] In a further aspect, disclosed is a mutant, non-natural or transgenic plant or part thereof, wherein the nitrate level is not significantly different compared to a control plant grown under the same fertilization conditions, the biomass yield is higher compared to a control plant grown under the same fertilization conditions, and the NUE of the plant is higher compared to a control plant grown under the same fertilization conditions.The mutant, non-natural or transgenic plant or part thereof can also have increased root development compared to a control plant grown under the same fertilization conditions.

[0026] Preferably, the mutant, non-naturally occurring, or transgenic plant or plant part has reduced or suppressed expression or activity of NtNTP2-T, or has reduced or suppressed expression or activity of NtNTP2-T and NtNTP2-S, wherein said NtNTP2-T and NtNTP2-S comprise, consist of, or consist essentially of (i) an NtNTP2-S polynucleotide sequence having at least 70% sequence identity to SEQ ID NO:3, or (ii) a sequence having at least 70% sequence identity to SEQ ID NO:11, if or (iii) a polypeptide encoded by the polynucleotide described in (i) or (ii), or (iv) an NtNTP2-S polypeptide having at least 77% sequence identity to SEQ ID NO: 7, or (v) an NtNTP2-T polypeptide having at least 77% sequence identity to SEQ ID NO: 12, wherein expression or activity of NtNTP2-T, or expression or activity of NtNTP2-T and NtNTP2-S, is reduced or suppressed compared to a control plant.

[0027] In a further aspect, a tobacco product or smoking article is disclosed that comprises a mutant, non-naturally occurring, or transgenic plant or plant part according to the present invention.

[0028] In a further aspect, a method for improving the agronomic properties of a plant is provided, the method comprising reducing or suppressing the expression or activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, wherein said NtNTP2-T and NtNTP2-S are selected from the group consisting of (i) an NtNTP2-S polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO: 3, or (ii) an NtNTP2-S polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO: 11. or (iii) a polypeptide encoded by the polynucleotide described in (i) or (ii), or (iv) an NtNTP2-S polypeptide having at least 77% sequence identity to SEQ ID NO: 7, or (v) an NtNTP2-T polypeptide having at least 77% sequence identity to SEQ ID NO: 12, wherein expression or activity of NtNTP2-T, or expression or activity of NtNTP2-T and NtNTP2-S, is reduced or suppressed compared to a control plant.

[0029] Preferably, the agronomic traits are: (i) no reduction in nitrate levels; (ii) an increase in biomass (e.g., leaf biomass) under both standard and nitrogen-starved conditions; and (iii) an increase in NUE response, expressed as biomass per unit of nitrogen fertilization applied. [Brief explanation of the drawings]

[0030] [Figure 1] Figure 1 shows photographs of the morphology of the AA37 ntp2-S W211stop and ntp2-T W212stop double mutant lines in the field at harvest. Representative photographs of two truncated plants in the field at harvest. Double wild type shows an example of an outsegregant wild-type plant, and double mutant shows an example of an ntp2-S W211stop / ntp2-T W212stop double mutant plant. [Figure 2]Figure 2 shows graphs of nitrate levels in desiccated leaf material from AA37 ntp2 double stop mutants. Average nitrate levels measured in the dried blade (A) and mid-vein (B) of mid-position leaves from plants grown in the Burley method are shown. sstt indicates the ntp2 double mutant homozygous genotype, and SSTT indicates the ntp2 double mutant out-segregant wild-type genotype. Error bars indicate standard error. n = 8 plots of 10 plants each for the out-segregant wild-type, and n = 7 plots of 10 plants each for the double mutant. [Figure 3] Figure 3 is a graph showing the morphology of AA37 ntp2-S W211stop and ntp2-T W212stop double mutant lines in the field. Representative photographs show plants grown in the field 3 months after transplanting. Wild type shows an example plot of 10 plants of the out-segregant wild type, double mutant shows an example plot of 10 plants for the ntp2-S W211stop / ntp2-T W212stop double mutant, and AA37 shows control AA37 non-mutated plots. The top panel (Burley formula) shows a field portion fertilized with 254 units of nitrogen, and the bottom panel (Virginia formula) shows a field portion fertilized with 55 units of nitrogen. [Figure 4] Figure 4 shows the total leaf dry biomass harvest results for the AA37 ntp2 double stop mutant line grown under different nitrogen regimes. The total leaf dry biomass (expressed in grams per plant) is shown from plants grown under standard conditions (Burley) or nitrogen starvation (Virginia) during the first year of testing. sstt indicates the ntp2 double mutant homozygous genotype, and SSTT indicates the ntp2 double mutant out-segregant wild-type genotype. Error bars indicate 95% confidence intervals. n = 19 plots with 8 plants each (two edge plants were discarded to minimize position effects). [Figure 5]Figure 5 is a graph showing the segregation of mutant phenotypes. The dry processed biomass (expressed in grams per plant) of the total leaf harvest from plants grown under standard conditions during the second year of the study is shown. SSTT indicates outsegregant wild-type plants, sstt indicates the ntp2 double mutant homozygous genotype, and ssTT and SStt indicate homozygous single mutants of the -S and -T forms, respectively. Error bars indicate standard error. n = 8–10 plots of 8 plants each (two edge plants were discarded to minimize the effect of position). [Figure 6] Figure 6 shows the NUE index (expressed as kilograms of dried leaf biomass per kilogram of N input per hectare, assuming 12,000 plants per hectare) of the AA37 ntp2 double-stop mutant line grown under different nitrogen regimes. The NUE index (expressed as kilograms of dried leaf biomass per kilogram of N input per hectare, assuming 12,000 plants per hectare) is shown for total leaf harvest from plants grown under standard conditions (Burley) or under nitrogen fertilization with hot air drying through a flue (Virginia) during the 2019 growing season. sstt indicates the ntp2 double mutant homozygous genotype, and SSTT indicates the ntp2 double mutant out-segregant wild-type genotype. Error bars indicate 95% confidence intervals. n = 19 plots with eight plants each (two edge plants were discarded to minimize position effects). [Figure 7] Figure 7 is a graph showing the expression levels of the Ntntp2 gene in tobacco leaves from different cultivars before and immediately after harvest. Microarray expression profiles of Ntntp2 are shown for Swiss-Burrley (Burrley) and Swiss-Air-Cured (Virginia) varieties during vegetative growth (green maturity), harvest (harvest), and early curing (7-hour and 15-hour curing). Expression levels are shown as log2-scale fold changes normalized to the respective total transcript levels. [Figure 8]Figure 8 shows two graphs illustrating how NtNTP2 mutations affect root development. Figure 8(A) shows the number of lateral roots in seedlings grown on agar plates for 13 days. Figure 8(B) shows the maximum submerged root length in 6-week-old young plants grown in hydroponic conditions. SSTT, sstt, ssTT, and SStt represent the outsegregant wild type, the homozygous double -S / -T mutant, and the -S and -T single mutants, respectively. The letters at the top of the columns in Figure 8(B) indicate statistical groups in a one-way ANOVA test. Error bars indicate 95% confidence intervals. P values ​​are indicated. [Figure 9] Figure 9 shows two graphs of the average number of roots per plant for Ntntp2-S W211stop / Ntntp2-T W212stop BC2S2 TN90 (A) and K326 (B) mutant plants and their wild-type outsegregant controls. SSTT indicates wild-type plants, and SSTT indicates the double mutant Ntntp2-S W211stop / Ntntp2-T W212stop genetic background. TN90 and K326 BC2S2 plants were grown in a hydroponic solution with 50% N fertilization compared to standard agricultural practices in greenhouse conditions. Four to six weeks after transplanting, primary roots beginning to grow from the central pillar were counted for a minimum of 18 plants per genotype for TN90 and a minimum of 25 plants for K326. Statistical validity of the data was tested using a Student's t-test, and p values ​​are reported. Error bars indicate 95% confidence intervals. [Figure 10] Figure 10 is a graph showing the average root diameter of TN90 BC2S2 plants. SSTT indicates wild-type plants, and sstt indicates the double mutant Ntntp2-S W211stop / Ntntp2-T W212stop genetic background. TN90 BC2S2 plants were grown in a hydroponic solution with 50% N fertilization compared to standard agricultural practices in greenhouse conditions. Between 4 and 6 weeks after transplanting, the diameter of the primary roots that begin to grow from the central stele was measured for a minimum of 655 roots per genotype. The statistical validity of the data was tested using Student's t-test, and p values ​​are reported in the figures. Error bars indicate 95% confidence intervals. [Figure 11]Figure 11 is a graph showing the total root diameter distribution in BC2S2 TN90 plants grown with 50% N fertilization. TN90 BC2S2 plants are grown in a hydroponic solution with 50% N fertilization compared to standard agricultural practices in greenhouse conditions. Between 4 and 6 weeks after transplanting, primary roots beginning to grow from the central stele are counted and their diameter measured with a thickness gauge instrument. The distribution of root diameter measured for 15 plants per genotype plotted against the number of roots measured is reported. SSTT indicates wild-type plants, and sstt indicates the genetic background of the double mutant Ntntp2-S W211stop / Ntntp2-T W212stop. [Figure 12] FIG. 12 is a diagram showing a synthetic RNAi loop with a 35S CaMV terminator, having the DNA sequence shown in SEQ ID NO:45. [Figure 13] FIG. 13 shows the RNAi loop of FIG. 12 cloned via HindIII-AvrII into a binary vector carrying an MMV promoter and translator enhancer. [Figure 14] Figure 14 is a graph showing the average number of roots per plant in TN90 transgenic plants grown with 50% N fertilization. TN90 transgenic plants are grown in a hydroponic solution with 50% N fertilization compared to standard agricultural practices in greenhouse conditions. Primary roots beginning to grow from the central stele are counted for a minimum of 24 plants per genotype between 4 and 6 weeks after transplantation. CT-T2 indicates control plants transformed with an empty binary vector, and RNAi-T2 indicates plants transformed with an RNAi vector. The statistical validity of the data was tested with a Student's t-test, and p values ​​are reported along with the percentage increase in the RNAi lines compared to the control. Error bars indicate 95% confidence intervals. [Figure 15]Figure 15 is a graph showing the total root diameter distribution in TN90 transgenic plants grown with 50% N fertilization. TN90 transgenic plants are grown in a hydroponic solution with 50% N fertilization compared to standard agricultural practices in greenhouse conditions. Between 4 and 6 weeks after transplanting, primary roots that begin to grow from the central pillar are counted and their diameter measured. The distribution of root diameters measured for seven plants per construct plotted against the number of roots measured is reported. CT-T2 indicates control plants transformed with an empty binary vector, and RNAi-T2 indicates plants transformed with an RNAi vector. DETAILED DESCRIPTION OF THE INVENTION

[0031] Some advantages It is possible to obtain plants with increased yields with less fertilization and therefore improved NUE, intended as biomass per unit of nitrogen fertilization applied.

[0032] The phenotype can be achieved through non-transgenic methods to develop non-genetically modified (non-GM) plants. This is highly desirable due to the difficulty in cultivating and commercializing GM plants in various countries, including Europe. Mutant plants characterized by one or more single nucleotide polymorphisms are not considered GM plants. For example, in the EU, there are no specific regulations for plants derived from mutation breeding. Therefore, in certain embodiments, it is preferred that the plant contains only one or more single nucleotide polymorphisms (i.e., one or more mutations) to result in a non-genetically modified plant.

[0033] Plants can be grown at lower nitrogen rates than normally required, but without significant biomass loss. Thus, less nitrogen fertilizer can be used, which can achieve reduced plant nitrate levels, and therefore reduced TSNAs, without reducing yield. This is highly advantageous in commercial plant production, for example, commercial tobacco plant production.

[0034] A further advantage is that the present invention can be applied to green or cured leaves. When applied to tobacco, this means that green or cured tobacco can be obtained in higher yields. This can be used in a variety of tobacco applications, including (i) smoking products, (ii) biofuel production, (iii) the production of genetically modified products, and (iv) the extraction of bioactive compounds. The present invention can also be applied to cured leaves.

[0035] Detailed Description The section headings used in this disclosure are for organizational purposes and are not intended to be limiting.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. In case of conflict, the present document, including definitions, governs. Preferred methods and materials are described below, but methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. The materials, methods, and examples disclosed herein are merely illustrative and are not intended to be limiting.

[0037] As used herein, the terms "comprise," "include," "having," "having," "can," "containing," and variations thereof are intended to be open-ended transitional phrases, terms, or words that do not exclude the possibility of additional acts or configurations.

[0038] The singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise.

[0039] The term "and / or" means either (a) or (b), or both (a) and (b).

[0040] The present disclosure also contemplates other embodiments, whether explicitly stated or not, that "comprise," "consist," and "consist essentially of" the embodiments or elements presented herein.

[0041] For purposes of reciting numerical ranges herein, each intermediate number therebetween of the same degree of precision is expressly contemplated. For example, for the range 6 to 9, the numbers 7 and 8 are contemplated in addition to the numbers 6 and 9, and for the range 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly contemplated.

[0042] As used throughout the specification and claims, the following terms have the following meanings:

[0043] "Coding sequence" or "encoding polynucleotide" refers to a nucleotide (RNA or DNA molecule) comprising a polynucleotide that encodes a polypeptide. The coding sequence may further comprise initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the polynucleotide is administered. The coding sequence may be codon optimized.

[0044] "Complement" or "complementary" can refer to Watson-Crick (e.g., AT / U and CG) or Hoogsteen base pairing between nucleotides or nucleotide analogs. "Complementarity" refers to the property shared between two polynucleotides, e.g., when aligned antiparallel to each other, that the nucleotide bases at each position are complementary.

[0045] A "construct" refers to a double-stranded recombinant polynucleotide fragment comprising one or more polynucleotides. A construct comprises a "template strand" base-paired with a complementary "sense or coding strand." A given construct can be inserted into a vector in either of two possible orientations: the same (or sense) orientation or the opposite (or antisense) orientation relative to the orientation of a promoter placed within the vector (e.g., an expression vector).

[0046] The term "control" in the context of a control plant or control plant cell refers to a plant or plant cell in which the expression, function, or activity of one or more Ntntp2 genes or NtNTP2 polypeptides has not been altered (e.g., increased, reduced, or suppressed), thereby providing a comparison with a plant in which the expression, function, or activity of the same one or more Ntntp2 genes or NtNTP2 polypeptides has been altered. As used herein, a "control plant" is a plant that is substantially equivalent to a test plant or modified plant in all parameters except for the test parameter. For example, when referring to a plant into which a polynucleotide has been introduced or modified, the control plant is an equivalent plant into which such polynucleotide has not been introduced or modified. A control plant can be an equivalent plant into which a control polynucleotide has been introduced. In such cases, the control polynucleotide is one that is predicted to have little or no phenotypic effect on the plant. A control plant can contain an empty vector. A control plant can correspond to a wild-type (WT) plant. A control plant can be a null segregant, in which the T1 segregant no longer carries the transgene. For comparison purposes, the control plants and the plants to which the control plants are compared are grown under the same conditions.

[0047] "Donor DNA" or "donor template" refers to a double-stranded DNA fragment or molecule that contains at least a portion of a gene of interest. The donor DNA can encode a fully functional polypeptide or a partially functional polypeptide.

[0048] An "endogenous gene or polypeptide" refers to a gene or polypeptide that originates in the genome of an organism and has not undergone alteration, such as deletion, gain, or replacement of genetic material. An endogenous gene is subject to normal gene transmission and gene expression. An endogenous polypeptide is subject to normal expression.

[0049] "Enhancer sequences" refer to sequences that can increase gene expression. These sequences can be located upstream, within introns, or downstream of the transcribed region. The transcribed region consists of exons and intervening introns from the promoter to the transcription termination region. Enhancement of gene expression can be through various mechanisms, including increasing transcription efficiency, stabilizing mature mRNA, and enhancing translation.

[0050] "Expression" refers to the production of a functional product. For example, expression of a polynucleotide fragment can refer to transcription of the polynucleotide fragment (e.g., transcription resulting in mRNA or functional RNA) and / or translation of mRNA into a precursor or mature polypeptide. "Overexpression" refers to the production of a gene product in a transgenic organism that exceeds production levels in a null segregant (or non-transgenic) organism of the same experiment.

[0051] "Functional" and "fully functional" describe a polypeptide that has a biological function or activity. A "functional gene" refers to a gene that is transcribed into mRNA that is translated into a functional or active polypeptide.

[0052] A "genetic construct" refers to a DNA or RNA molecule comprising a polynucleotide that encodes a polypeptide. The coding sequence can include initiation and termination signals operably linked to regulatory elements, including a promoter and polyadenylation signal, capable of directing expression.

[0053] "Genome editing" refers to a change in an endogenous gene encoding an endogenous polypeptide, resulting in the expression of a truncated endogenous polypeptide or an endogenous polypeptide with an amino acid substitution. Genome editing can include replacing a targeted region of an endogenous gene or replacing the entire endogenous gene with a copy of the gene with a truncated or amino acid substitution by a repair mechanism such as HDR. Genome editing can also include the generation of an amino acid substitution in an endogenous gene by generating a double-strand break in the endogenous gene, which is then repaired using NHEJ. NHEJ can add or delete at least one base pair during repair, which can result in an amino acid substitution. Genome editing can also include deleting a gene segment by the simultaneous action of two nucleases on the same DNA strand to create a break between two nuclease target sites and repair the DNA break by NHEJ.

[0054] "Heterologous" in reference to a sequence means a sequence that originates from a foreign species or, if from the same species, has been significantly altered in composition and / or genomic locus from its naturally occurring form by deliberate human intervention.

[0055] " Homologous recombination repair " or " HDR " refers to the cell's mechanism for repairing double-stranded DNA damage when a piece of homologous DNA is present in the nucleus, mainly during the G2 and S phases of the cell cycle.HDR uses donor DNA or donor template to guide repair and can be used to create specific sequence changes to genomes, including the targeted addition of entire genes.When donor template is provided with site-specific nucleases, then the cell's mechanism repairs the break by homologous recombination, which is increased by orders of magnitude in the presence of DNA breaks.If no homologous DNA piece is present, NHEJ can be performed instead.

[0056] The terms "homology" or "similarity" refer to the degree of sequence similarity between two polypeptide molecules or two polynucleotide molecules compared by sequence alignment. The degree of homology between two discontinuous polynucleotides being compared is a function of the number of identical or matching nucleotides at comparable positions.

[0057] "Identical" or "identity" in the context of two or more polynucleotides or polypeptides means that the sequences have a specified percentage of residues that are the same over a specified region. The percentage is calculated by optimally aligning the two sequences, comparing the two sequences over a specified region, determining the number of positions where identical residues exist in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the specified region, and multiplying the result by 100 to obtain the percentage of sequence identity. If the two sequences are of different lengths, or if the alignment results in one or more staggered ends, and a specified region of comparison contains only a single sequence, the residues of the single sequence are included in the denominator of the calculation, but not in the numerator. The percentage of identity can be determined over the entire length of the sequence. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be determined manually or by using a computer sequence algorithm such as ClustalW, ClustalX, BLAST, FASTA, or Smith-Waterman. The general multiple alignment program ClustalW (Nucleic Acids Research (1994) 22, 4673-4680, Nucleic Acids Research (1997), 24, 4876-4882) is a suitable method for creating multiple alignments of polypeptides or polynucleotides. Suitable parameters for ClustalW may be as follows: for polynucleotide alignments: gap opening penalty = 15.0, gap extension penalty = 6.66, and matrix = Identity; for polypeptide alignments: gap opening penalty = 10.0, gap extension penalty = 0.2, and matrix = Gonnet; for DNA and protein alignments: ENDGAP = -1, and GAPDIST = 4. Those skilled in the art will be aware that these and other parameters may need to be varied for optimal sequence alignment.A percentage identity calculation is then suitably calculated from such an alignment as (N / T), where N is the number of positions where the sequences share identical residues and T is the total number of positions compared, including gaps but not overhangs.

[0058] The term "increase" or "increased" refers to an increase of about 5% to about 99% in amount or function or activity, such as, but not limited to, polypeptide function or activity, transcriptional function or activity, and / or polypeptide expression, or an increase of at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100%, at least about 150%, or at least about 200% or more. The term "increased" or the phrase "increased amount" can refer to an amount or function or activity in a modified plant or a product made from a modified plant that is greater than that which would be found in an unmodified plant or a product derived from the same variety of plant processed in the same manner. Thus, in some contexts, wild-type plants of the same variety processed in the same manner are used as controls to determine whether an increase in yield is obtained.

[0059] As used herein, the term "reduced" or "reduced" refers to a reduction of about 5% to about 99% in the amount or function, such as polypeptide function, transcription function, or gene expression, or a reduction of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or at least about 100%, or at least about 150%, or at least about 200% or more. The term "reduced" or the phrase "reduced amount" can refer to an amount or function in a modified plant or a product produced from a modified plant that is less than that found in an unmodified plant or a product derived from the same plant processed in the same manner. Thus, in some contexts, a wild-type plant of the same species or variety processed in the same manner is used as a control to determine whether a reduction in amount is obtained.

[0060] The term "inhibit" or "inhibited" refers to a reduction of about 98% to about 100%, or at least about 98%, at least about 99%, but particularly about 100%, of the amount or function or activity, including, but not limited to, a polypeptide function or activity, a transcriptional function or activity, and / or polypeptide expression.

[0061] The term "introduced" means providing a polynucleotide (e.g., a construct) or polypeptide to a cell. "Introduced" includes reference to the uptake of a polynucleotide into a eukaryotic cell, where the polynucleotide may be integrated into the genome of the cell, and includes reference to the transient supply of a polynucleotide or polypeptide to a cell. Introduced includes reference to stable or transient transformation methods, as well as sexual crossing. Thus, "introduced" in the context of inserting a polynucleotide (e.g., a recombinant / expression construct) into a cell means "transfection" or "transformation" or "transduction," and includes reference to the uptake of a polynucleotide into a eukaryotic cell, where the polynucleotide may be integrated into the genome of the cell (e.g., a chromosome, a plasmid, a plastid, or a mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).

[0062] The terms "isolated" or "purified" refer to a material that is substantially or essentially free from components that normally accompany it when found in its native state. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high-performance liquid chromatography. A polypeptide that is the predominant species present in a preparation is substantially purified. In particular, an isolated polynucleotide is separated from open reading frames that flank the desired gene and encode polypeptides other than the desired polypeptide. As used herein, the term "purified" means that the polynucleotide or polypeptide gives rise to essentially one band in an electrophoretic gel. Specifically, this means that the polynucleotide or polypeptide is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure. Isolated polynucleotides can be purified from naturally occurring host cells. Conventional polynucleotide purification methods known to those of skill in the art can be used to obtain isolated polynucleotides. The term also encompasses recombinant and chemically synthesized polynucleotides.

[0063] The term "level" means an amount and is used interchangeably with "content."

[0064] "Modulate" or "modulation" refers to causing or promoting a qualitative or quantitative change, alteration, or modification in a process, pathway, function, or activity of interest. Without being limited thereto, such a change, alteration, or modification can be an increase or decrease in the relative process, pathway, function, or activity of interest. For example, Ntntp2 gene expression or NtNTP2 polypeptide expression, or NtNTP2 polypeptide function or activity can be modulated. Typically, the relative change, alteration, or modification will be determined by comparing with a control.

[0065] As used herein, the term "non-homologous end joining (NHEJ) pathway" refers to a pathway that repairs double-strand breaks in DNA by directly joining the broken ends without the need for a homologous template. Non-template-dependent religation of DNA ends by NHEJ is a stochastic, error-prone repair process that introduces random microinsertions and microdeletions (indels) at the DNA breakpoint. This method can be used to intentionally disrupt, delete, or alter the reading frame of a target gene sequence. NHEJ typically uses short homologous DNA sequences, called microhomologies, to guide repair. These microhomologies are often present in single-strand overhangs on the ends of the double-strand break. When the overhangs are perfectly compatible, NHEJ typically repairs the break accurately; however, imprecise repairs resulting in nucleotide loss can occur, but incompatible overhangs are even more common.

[0066] The term "non-natural" describes entities such as polynucleotides, genetic mutations, polypeptides, plants, plant cells, and plant materials that are not naturally occurring or do not exist in nature. Such non-natural or artificial entities can be created, synthesized, initiated, modified, intervened, or manipulated by methods described herein or known in the art. Such non-natural or artificial entities can be created, synthesized, initiated, modified, intervened, or manipulated by humans. Thus, for example, non-natural plants, non-natural plant cells, or non-natural plant materials can be created using traditional plant breeding techniques such as backcrossing, or by genetic engineering techniques such as antisense RNA, interfering RNA, and meganucleases. As a further example, a non-naturally occurring plant, plant cell, or plant material can be created by introgressing or transferring one or more genetic mutations (e.g., one or more polymorphisms) from a first plant or plant cell to a second plant or plant cell (which itself may be natural) so that the resulting plant, plant cell, or plant material, or its progeny, contains a genetic configuration (e.g., a genome, chromosome, or segment thereof) that is not naturally occurring or does not exist in nature. The resulting plant, plant cell, or plant material is therefore artificial or non-natural. Thus, an artificial or non-naturally occurring plant or plant cell can be created by modifying a genetic sequence in a first naturally occurring plant or plant cell, even if the resulting genetic sequence is naturally occurring in a second plant or plant cell that contains a different genetic background from the first plant or plant cell. In certain embodiments, the mutation is not a naturally occurring mutation that occurs naturally in a polynucleotide or polypeptide. Differences in genetic background can be detected by phenotypic differences or by molecular biology techniques known in the art, such as polynucleotide sequencing, the presence or absence of genetic markers (e.g., microsatellite RNA markers).

[0067] "Oligonucleotide" or "polynucleotide" refers to at least two nucleotides covalently linked together. A depiction of a single strand also defines the sequence of the complementary strand. Thus, a polynucleotide also encompasses the complementary strand of a depicted single strand. Many variants of polynucleotides can be used for the same purpose as a given polynucleotide. Polynucleotides also encompass substantially identical polynucleotides and their complements. A single strand provides a probe that can hybridize to a given sequence under stringent hybridization conditions. Thus, a polynucleotide also encompasses probes that hybridize under stringent hybridization conditions. A polynucleotide can be single-stranded or double-stranded, or can contain portions of both double-stranded and single-stranded sequence. Polynucleotides can be DNA, both genomic and cDNA, RNA, or hybrids, and can contain combinations of deoxyribonucleotides and ribonucleotides, as well as combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Polynucleotides can be obtained by chemical synthesis or recombinant methods. The specificity of single-stranded DNA for hybridizing complementary fragments is determined by the "stringency" of the reaction conditions (Sambrook et al., Molecular Cloning and Laboratory Manual, Second Ed., Cold Spring Harbor (1989)). Hybridization stringency increases as the tendency to form DNA duplexes decreases. In polynucleotide hybridization reactions, stringency can be selected to favor specific hybridization (high stringency), which can be used, for example, to identify full-length clones from a library. Low-specificity hybridization (low stringency) can be used to identify related but not exactly the same (homologous but not identical) DNA molecules or segments.DNA duplexes are stabilized by (1) the number of complementary base pairs, (2) the type of base pair, (3) the salt concentration (ionic strength) of the reaction mixture, (4) the reaction temperature, and (5) the presence of certain organic solvents, such as formamide, which reduce the stability of DNA duplexes. Generally, the longer the probe, the higher the temperature required for proper annealing. A common approach is to vary the temperature; the higher the relative temperature, the more stringent the reaction conditions. Hybridization under "stringent conditions" describes a hybridization protocol in which polynucleotides that are at least 60% homologous to each other remain hybridized. Generally, stringent conditions are selected to be approximately 5°C lower than the thermal melting point (Tm) of a specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH, and polynucleotide concentration) at which 50% of the probes complementary to a given sequence hybridize to the given sequence at equilibrium. A given sequence is generally present in excess at the Tm, so 50% of the probes are occupied at equilibrium.

[0068] "NtNTP2" is used herein to refer to (i) an NtNTP2-S polynucleotide or an NtNTP2-T polynucleotide, or a combination of NtNTP2-S and NtNTP2-T polynucleotides, or (ii) an NtNTP2-S or NtNTP2-T polypeptide, or a combination of NtNTP2-S and NtNTP2-T polypeptides.

[0069] "Stringent hybridization conditions" are conditions that allow a probe, primer, or oligonucleotide to hybridize only to its specific sequence. Stringent conditions vary depending on the sequence. Stringent conditions typically include: (1) low ionic strength and high temperature wash, e.g., 15 mM sodium chloride, 1.5 mM sodium citrate, 0.1% sodium dodecyl sulfate at 50°C; (2) denaturing agents during hybridization, e.g., 50% (v / v) formamide, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer (750 mM sodium chloride, 75 mM sodium citrate, pH 6.5) at 42°C; or (3) 50% formamide. Washes also typically involve a wash in 0.2×SSC (sodium chloride / sodium citrate) at 42° C. containing 5×SSC (0.75 M NaCl, 75 mM sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5×Denhardt's solution, sonicated salmon sperm DNA (50 μg / mL), 0.1% SDS, and 10% dextran sulfate, and a high stringency wash consisting of 50% formamide at 55° C., followed by 0.1×SSC containing EDTA at 55° C. Preferably, conditions are such that sequences at least about 65%, 70%, 75%, 85%, 90%, 95%, 98%, or 99% homologous to each other typically remain hybridized to each other.

[0070] "Moderately stringent conditions" use wash solutions and hybridization conditions that are less stringent, such that polynucleotides hybridize to the entire polynucleotide, fragments, derivatives, or analogs. One example includes hybridization in 6xSSC, 5xDenhardt's solution, 0.5% SDS, and 100 μg / mL denatured salmon sperm DNA at 55°C, followed by one or more washes in 1xSSC, 0.1% SDS at 37°C. Temperature, ionic strength, etc., can be adjusted to accommodate experimental factors such as probe length. Other moderate stringency conditions have been described (see Ausubel et al., Current Protocols in Molecular Biology, Volumes 1-3, John Wiley & Sons, Inc., Hoboken, NJ (1993); Kriegler, Gene Transfer and Expression: A Laboratory Manual, Stockton Press, New York, NY (1990); Perbal, A Practical Guide to Molecular Cloning, 2nd edition, John Wiley & Sons, New York, NY (1988)).

[0071] "Low stringency conditions" use wash solutions and hybridization conditions that are less stringent than those for moderate stringency, such that polynucleotides hybridize to the entire polynucleotide, fragments, derivatives, or analogs. Non-limiting examples of low stringency hybridization conditions include hybridization in 35% formamide, 5xSSC, 50 mM Tris HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg / mL denatured salmon sperm DNA, 10% (wt / vol) dextran sulfate at 40°C, followed by one or more washes in 2xSSC, 25 mM Tris HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS at 50°C. Other conditions of low stringency, such as those for cross-species hybridization, have been well described (see Ausubel et al., 1993; Kriegler, 1990).

[0072] "Operably linked" means that the expression of a gene is under the control of a spatially linked promoter. The promoter can be located 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the promoter and the gene can be approximately the same as the distance between the promoter and the gene it controls in the gene from which it is derived. As is known in the art, variations in this distance can be adjusted without loss of promoter function. "Operably linked" refers to the association of polynucleotide fragments in a single fragment, such that one function is controlled by the other. For example, a promoter is operably linked to a polynucleotide fragment when it is capable of controlling the transcription of the polynucleotide fragment.

[0073] The term "plant" refers to any plant at any stage of its life cycle or development, and its progeny. The term includes reference to whole plants, plant organs, plant tissues, such as leaves, plant propagules, plant seeds, plant cells, and their progeny. Plant cells include, but are not limited to, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and pollen grains. Suitable species, cultivars, hybrids, and varieties of tobacco plants are described herein.

[0074] "Polynucleotide," "polynucleotide sequence," or "polynucleotide fragment" are used interchangeably herein and refer to a polymer of RNA or DNA that is single- or double-stranded and optionally contains synthetic, non-natural, or altered nucleotide bases. Nucleotides (usually found in their 5'-monophosphate form) are designated by the following single-letter designations: "A" for adenylate or deoxyadenylate (in RNA or DNA, respectively), "C" for cytidylate or deoxycytidylate, "G" for guanylate or deoxyguanylate, "U" for uridylate, "T" for deoxythymidylate, "R" for purine (A or G), "Y" for pyrimidine (C or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and "N" for any nucleotide. Polynucleotides can be, but are not limited to, genomic DNA, complementary DNA (cDNA), mRNA, or antisense RNA, or fragments thereof. Moreover, polynucleotides can be single-stranded or double-stranded, a mixture of single- and double-stranded regions, a hybrid molecule containing DNA and RNA, or a hybrid molecule having a mixture of single- and double-stranded regions or fragments thereof. Additionally, polynucleotides can be composed of triple-stranded regions containing DNA, RNA, or both, or fragments thereof. Polynucleotides can contain one or more modified bases, such as phosphothioates, and can be peptide nucleic acids (PNAs). Generally, polynucleotides can be assembled from isolated or cloned fragments of cDNA, genomic DNA, oligonucleotides, or individual nucleotides, or combinations of the foregoing. While the polynucleotides described herein are presented as DNA sequences, polynucleotides also include their corresponding RNA sequences and their complementary (e.g., fully complementary) DNA or RNA sequences, including their reverse complements. Polynucleotides of the present disclosure are set forth in the accompanying sequence listing.

[0075] "Polypeptide" or "polypeptide sequence" refers to a polymer of amino acids in which one or more amino acid residues are artificial chemical analogues of a corresponding naturally occurring amino acid, as well as to naturally occurring polymers of amino acids. These terms also include modifications, including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation. The polypeptides of the present disclosure are set forth in the accompanying sequence listing.

[0076] "Promoter" refers to a synthetic or naturally occurring molecule capable of conferring, activating, or enhancing expression of a polynucleotide in a cell. The term typically refers to a polynucleotide element / sequence located upstream and operably linked to a double-stranded polynucleotide fragment. A promoter can be derived entirely from the region adjacent to a native gene of interest or can be composed of different elements derived from different native promoters or synthetic polynucleotide segments. A promoter can contain one or more specific transcription control sequences to further enhance expression and / or alter its spatial and / or transient expression. A promoter can also contain distal enhancer or repressor elements, located as many as several thousand base pairs from the start site of transcription. Promoters can be derived from sources including viruses, bacteria, fungi, plants, insects, and animals. A promoter can constitutively or differentially control expression of gene components depending on the cell, tissue, or organ in which expression occurs, the developmental stage in which expression occurs, or in response to external stimuli such as physiological stress, pathogens, metal ions, or inducers.

[0077] As used interchangeably herein, "tissue-specific promoter" and "tissue-preferred promoter" refer to a promoter that is expressed primarily, although not necessarily exclusively, in one tissue or organ, but can also be expressed in one particular cell. A "developmentally regulated promoter" refers to a promoter whose function is determined by developmental events. A "constitutive promoter" refers to a promoter that causes a gene to be expressed in most cell types at most times. An "inducible promoter" selectively expresses an operably linked DNA sequence in response to the presence of an endogenous or exogenous stimulus, for example, a chemical compound (a chemical inducer), or in response to environmental, hormonal, chemical, and / or developmental signals. Examples of inducible or regulated promoters include promoters regulated by light, heat, pressure, waterlogging or drought, pathogens, plant hormones, wounding, or chemicals such as ethanol, jasmonic acid, salicylic acid, or safeners.

[0078] As used herein, "recombinant" refers to the artificial combination of two otherwise separate segments of sequence, for example, by chemical synthesis or by the manipulation of isolated segments of polynucleotides by recombinant genetic techniques. The term also includes reference to a cell or vector that has been modified by the introduction of a heterologous polynucleotide, or a cell derived from a cell so modified, but does not encompass the alteration of a cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation or transduction or transposition), such as those that occur without deliberate human intervention.

[0079] "Recombinant construct" refers to a combination of polynucleotides that are not normally found together in nature. Thus, a recombinant construct may contain control and coding sequences from different sources, or control and coding sequences from the same source but arranged in a manner different from that normally found in nature. A recombinant construct may be a recombinant DNA construct.

[0080] As used interchangeably herein, "control sequence" and "control element" refer to polynucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence that influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Control sequences include promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms "control sequence" and "control element" are used interchangeably herein.

[0081] " Site-specific nuclease " refers to an enzyme that can specifically recognize and cleave DNA sequences. Site-specific nucleases can be engineered. Examples of engineered site-specific nucleases include zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), CRISPR / Cas9-based systems, and meganucleases.

[0082] The term "tobacco" is used collectively to refer to tobacco crops (e.g., tobacco plants that are field-grown and not hydroponically grown), tobacco plants, and parts thereof, including, but not limited to, roots, stems, leaves, flowers, and seeds, prepared and / or obtained as described herein. "Tobacco" is understood to include Nicotiana tabacum plants and parts thereof.

[0083] The term "tobacco product" refers to consumer tobacco products, including, but not limited to, smoking materials (e.g., cigarettes, cigars, and pipe tobacco), snuff, chewing tobacco, gum, and lozenges, as well as components, materials, and ingredients for the manufacture of consumer tobacco products. Preferably, these tobacco products are made from tobacco leaves and stems harvested from tobacco plants and cut, dried, cured, and / or fermented according to conventional tobacco preparation techniques. The tobacco within the tobacco product may be combined with a binder, as described herein.

[0084] "Transcription terminator," "termination sequence," or "terminator" refers to a DNA sequence located downstream of a coding sequence and includes polyadenylation recognition sequences and other sequences encoding regulatory signals that can affect mRNA processing or gene expression. Polyadenylation signals are usually characterized by affecting the addition of polyadenylic acid moieties to the 3' end of a pre-mRNA.

[0085] "Transgenic" refers to any cell, cell line, callus, tissue, plant part, or plant whose genome has been altered by the presence of a heterologous polynucleotide, such as a recombinant construct, including those original transgenic events, as well as those produced from original transgenic events by sexual crossing or asexual propagation. The term does not encompass alterations of the genome (chromosomal or extrachromosomal) by conventional plant breeding methods or by natural events (e.g., random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation).

[0086] A "transgenic plant" refers to a plant that contains one or more heterologous polynucleotides in its genome, i.e., a plant containing recombinant genetic material not normally found therein and that has been introduced into the plant (or an ancestor of the plant) through human manipulation. For example, a heterologous polynucleotide can be stably integrated into the genome so that the polynucleotide is transmitted to successive generations. A heterologous polynucleotide can be integrated into the genome alone or as part of a recombinant construct. Commercial development of genetically improved germplasm has also progressed to the introduction of multiple traits into crop plants, often referred to as gene stacking. In this approach, multiple genes that confer different characteristics of interest can be introduced into a plant. Gene stacking can be achieved by many means, including, but not limited to, co-transformation, retransformation, and cross-breeding lines carrying different transgenes. Thus, a plant grown from a plant cell into which recombinant DNA has been introduced by transformation is a transgenic plant, as are all progeny of the plant that contain the introduced transgenes (whether produced sexually or asexually). The term transgenic plant is understood to encompass whole plants or trees as well as parts of the plants or trees, such as grains, seeds, flowers, leaves, roots, fruit, pollen, stems, etc. Each heterologous polynucleotide may confer a different trait to the transgenic plant.

[0087] "Transcription activator-like effector" or "TALE" refers to a polypeptide structure that recognizes and binds to specific DNA sequences. A "TALE DNA-binding domain," also known as an RVD module, refers to a DNA-binding domain containing a tandem array of 33-35 amino acid repeats, each of which specifically recognizes a single base pair in DNA. RVD modules can be arranged in any order to assemble an array that recognizes a defined sequence. The binding specificity of a TALE DNA-binding domain is determined by the RVD array followed by a single truncated repeat of 20 amino acids. A TALE DNA-binding domain can have 12-27 RVD modules, each of which contains an RVD and recognizes a single base pair in DNA. Specific RVDs that recognize each of the four possible DNA nucleotides (A, T, C, and G) have been identified. Because TALE DNA-binding domains are modular, four different DNA nucleotide-recognizing repeats can be linked together to recognize any specific DNA sequence. These targeted DNA binding domains can then be combined with catalytic domains to create functional enzymes, including artificial transcription factors, methyltransferases, integrases, nucleases, and recombinases.

[0088] As used interchangeably herein, "transcription activator-like effector nuclease" or "TALEN" refers to an engineered fusion polypeptide of the catalytic domain of a nuclease, such as the endonuclease FokI, and an engineered TALE DNA-binding domain that can target conventional DNA sequences.

[0089] "TALEN monomer" refers to an engineered fusion polypeptide having a catalytic nuclease domain and an engineered TALE DNA binding domain. Two TALEN monomers can be designed to target and cleave the TALEN target region.

[0090] "Transgene" refers to a gene or genetic material containing a genetic sequence that has been isolated from one organism and introduced into a different organism. This non-native DNA segment may retain the ability to produce RNA or polypeptides in the transgenic organism, or may alter the normal function of the transgenic organism's genetic code. Introduction of a transgene has the potential to alter the phenotype of an organism.

[0091] A "variant" or "mutant" with respect to a polynucleotide refers to a polynucleotide that differs from a wild-type polynucleotide (such as SEQ ID NO: 3 or SEQ ID NO: 11) by one or more nucleic acid deletions, additions, substitutions, or side chain modifications. Exemplary polynucleotide variants or mutants are set forth in SEQ ID NOs: 4, 5, 6, 13, 14, and 15. A "variant" or "mutant" with respect to a polypeptide refers to a polypeptide that differs in sequence by one or more amino acid insertions, deletions, or conservative substitutions. A variant or mutant may retain all, some, or none of the biological function or activity compared to a polypeptide that does not contain one or more amino acid insertions, deletions, or conservative substitutions. Conservative amino acid substitutions, i.e., replacing one amino acid with a different amino acid with similar properties (e.g., hydrophilicity, degree and distribution of charged regions), are recognized in the art as typically resulting in minor changes. Exemplary polypeptide variants or mutants are set forth in SEQ ID NOs: 8 and 16.

[0092] The term "variety" in the context of plants refers to a group of plants that share certain characteristics that distinguish them from other plants of the same species. While possessing one or more distinctive traits, varieties are further characterized by very little overall variation among individuals within the variety. Varieties are often sold commercially.

[0093] A "vector" refers to a polynucleotide vehicle containing a combination of polynucleotide components to enable the delivery of polynucleotides, polynucleotide constructs, polynucleotide conjugates, and the like. A vector can be a viral vector, bacteriophage, bacterial artificial chromosome, or yeast artificial chromosome. A vector can be a DNA or RNA vector. Suitable vectors include episomes capable of extrachromosomal replication, such as circular double-stranded nucleotide plasmids, linear double-stranded nucleotide plasmids, and vectors of any other origin. As used herein, an "expression vector" is a polynucleotide vehicle containing a combination of polynucleotide components to enable the expression of polynucleotides, polynucleotide constructs, polynucleotide conjugates, and the like. Suitable expression vectors include episomes capable of extrachromosomal replication, such as circular double-stranded nucleotide plasmids, linear double-stranded nucleotide plasmids, and functionally equivalent expression vectors of any other origin. An expression vector contains at least a promoter, as defined below, located upstream and operably linked to a polynucleotide, polynucleotide construct, or polynucleotide conjugate.

[0094] "Zinc finger" refers to a polypeptide structure that recognizes and binds to DNA sequences. Zinc finger domains are the most common DNA-binding motif in the human proteome. A single zinc finger contains approximately 30 amino acids, and the domain typically functions by binding to three consecutive DNA base pairs through interactions of one amino acid side chain per base pair.

[0095] "Zinc finger nuclease" or "ZFN" refers to a chimeric polypeptide molecule comprising at least one zinc finger DNA binding domain operatively linked to at least one nuclease or portion of a nuclease that, when fully assembled, is capable of cleaving DNA.

[0096] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have the meanings commonly understood by those skilled in the art. For example, any nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and polypeptide and polynucleotide chemistry and hybridization described herein, as well as the techniques thereof, are well known and commonly used in the art. The meaning and scope of terms should be clear, but in the event of any potential ambiguity, the definitions provided herein shall take precedence over any dictionary or external definitions. Furthermore, unless otherwise required by context, singular terms shall include the plural, and plural terms shall include the singular.

[0097] In one embodiment, an isolated polynucleotide is provided that comprises, consists of, or consists essentially of a sequence having at least 70% sequence identity to any sequence described herein, including any polynucleotide set forth in the Sequence Listing. Suitably, the isolated polynucleotide comprises, consists of, or consists essentially of a sequence having at least 70%, 75%, 80%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity thereto.

[0098] Preferably, the polynucleotides described herein encode active polypeptides having at least about 45%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more of the function or activity of the polypeptides set forth in the sequence listing.

[0099] In another embodiment, an isolated polynucleotide is provided that comprises, consists of, or consists essentially of a polynucleotide having at least 70% sequence identity to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 (provided the listed mutations are maintained), SEQ ID NO:5 (provided the listed mutations are maintained), SEQ ID NO:6 (provided the listed mutations are maintained), SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13 (provided the listed mutations are maintained), SEQ ID NO:14 (provided the listed mutations are maintained), or SEQ ID NO:15 (provided the listed mutations are maintained). Preferably, the isolated polynucleotide is at least about 70%, 75%, 80%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% identical to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 (provided the listed mutations are maintained), SEQ ID NO:5 (provided the listed mutations are maintained), SEQ ID NO:6 (provided the listed mutations are maintained), SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13 (provided the listed mutations are maintained), SEQ ID NO:14 (provided the listed mutations are maintained), or SEQ ID NO:15 (provided the listed mutations are maintained). Comprising, consisting of, or consisting essentially of a sequence having 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% sequence identity.

[0100] In another embodiment, an isolated polynucleotide is provided that comprises, consists of, or consists essentially of a polynucleotide having substantial homology (i.e., sequence similarity) or substantial identity to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 (provided the listed mutations are maintained), SEQ ID NO:5 (provided the listed mutations are maintained), SEQ ID NO:6 (provided the listed mutations are maintained), SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13 (provided the listed mutations are maintained), SEQ ID NO:14 (provided the listed mutations are maintained), or SEQ ID NO:15 (provided the listed mutations are maintained).

[0101] In another embodiment, the fragment is at least about 70%, 75%, 80%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.10%, 99.11%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.12%, 99.13%, 99.14%, 99.15%, 99.16%, 99.17%, 99.18%, 99.19%, 99.20%, 99.21%, 99.22%, 99.23%, 99.24%, 99.25%, 99.26%, 99.27%, 99.28%, 99.29 ... Fragments of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 (provided the listed mutations are maintained), SEQ ID NO:5 (provided the listed mutations are maintained), SEQ ID NO:6 (provided the listed mutations are maintained), SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13 (provided the listed mutations are maintained), SEQ ID NO:14 (provided the listed mutations are maintained), SEQ ID NO:15 (provided the listed mutations are maintained), having 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% sequence identity, having substantial homology (i.e., sequence similarity) thereto, or having substantial identity thereto are provided.

[0102] In another embodiment, a polynucleotide comprising a sufficient or substantial degree of identity or similarity to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 (provided the listed mutations are maintained), SEQ ID NO:5 (provided the listed mutations are maintained), SEQ ID NO:6 (provided the listed mutations are maintained), SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13 (provided the listed mutations are maintained), SEQ ID NO:14 (provided the listed mutations are maintained), or SEQ ID NO:15 (provided the listed mutations are maintained) that encodes a polypeptide that functions as NtNTP2 is provided.

[0103] In another embodiment, there is provided a polymer of polynucleotides comprising, consisting of, or consisting essentially of a polynucleotide designated herein as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15.

[0104] Preferably, the Ntntp2 polynucleotides described herein can encode a functional NtNTP2. Alternatively, the Ntntp2 polynucleotides described herein can contain at least one mutation, preferably at least one mutation that encodes a stop codon that causes the encoded polypeptide to terminate or terminate its translation prematurely, resulting in a non-functional fragment of NtNTP2. Exemplary such polynucleotides are disclosed herein.

[0105] Polynucleotides described herein can include polymers of nucleotides, which can be native or denatured deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Thus, polynucleotides can be, but are not limited to, genomic DNA, complementary DNA (cDNA), mRNA, or antisense RNA, or fragments thereof. Moreover, polynucleotides can be single-stranded or double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, hybrid molecules containing DNA and RNA, or hybrid molecules with a mixture of single-stranded and double-stranded regions or fragments thereof. Additionally, polynucleotides can be composed of triple-stranded regions containing DNA, RNA, or both, or fragments thereof. Polynucleotides can contain one or more modified bases, such as phosphothioates, and can be peptide nucleic acids. Generally, polynucleotides can be assembled from isolated or cloned fragments of cDNA, genomic DNA, oligonucleotides, or individual nucleotides, or combinations of the foregoing. Although the polynucleotides described herein are shown as DNA sequences, they include their corresponding RNA sequences and their complementary (e.g., perfectly complementary) DNA or RNA sequences, including their reverse complements.

[0106] Although the polynucleotides described herein generally contain phosphodiester linkages, in some cases, polynucleotide analogs may have alternative backbones, including, for example, phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphosphoramidite linkages, as well as peptide polynucleotide backbones and linkages. Other analog polynucleotides include those with normal backbones, non-ionic backbones, and non-ribose backbones. Modifications of the ribose-phosphate backbone may be made for a variety of reasons, such as to increase the stability and half-life of such molecules in physiological environments or as probes on biochips. Mixtures of natural polynucleotides and analogs may be made; alternatively, mixtures of different polynucleotide analogs and mixtures of natural polynucleotides and analogs may be made.

[0107] A variety of polynucleotide analogs are known, including, for example, phosphoramidate, phosphorothioate, phosphorodithioate, O-methylphosphoramidite linkages, and peptide polynucleotide backbones and linkages. Other analog polynucleotides include those with normal backbones, non-ionic backbones, and non-ribose backbones. Polynucleotides containing one or more carbocyclic sugars are also included.

[0108] Other analogs include peptide polynucleotides, which are peptide polynucleotide analogs. In contrast to the polyvalent phosphodiester backbone of natural polynucleotides, these backbones are substantially non-ionic under neutral conditions. This can result in advantages. First, peptide polynucleotide backbones may exhibit improved hybridization kinetics. Peptide polynucleotides have a larger change in melting temperature for mismatched bases compared to perfectly matched base pairs. DNA and RNA typically exhibit a 2-4°C decrease in melting temperature for internal mismatches. With non-ionic peptide polynucleotide backbones, this decrease approaches 7-9°C. Similarly, due to their non-ionic nature, hybridization of bases attached to these backbones is relatively insensitive to salt concentration. Furthermore, peptide polynucleotides may not be degraded, or may be degraded to a lesser extent, by cellular enzymes, and therefore may be more stable.

[0109] Among the uses of the disclosed polynucleotides and their fragments are the use of the fragments as probes in hybridization assays or as primers for use in amplification assays.Such fragments generally comprise at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more consecutive nucleotides of a DNA sequence.In other embodiments, the DNA fragments comprise at least about 10, 15, 20, 30, 40, 50, or 60 or more consecutive nucleotides of a DNA sequence.Therefore, in one aspect, a method for detecting polynucleotides is also provided, comprising the use of probes or primers or both.Exemplary primers are described herein.

[0110] The basic parameters that influence the selection of hybridization conditions and guidance for devising suitable conditions are described by Sambrook, J., E.F. Fritsch, and T. Maniatis (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Using knowledge of the genetic code combined with the polypeptide sequences described herein, a set of degenerate oligonucleotides can be prepared. Such oligonucleotides are useful, for example, as primers in polymerase chain reactions (PCR), in which DNA fragments are isolated and amplified. In certain embodiments, degenerate primers can be used as probes for genetic libraries. Such libraries include cDNA libraries, genomic libraries, and even electronic expressed sequence tag or DNA libraries. The homologous sequences identified by this method can then be used as probes to identify homologs of the sequences identified herein.

[0111] Also of potential use are polynucleotides and oligonucleotides (e.g., primers or probes) that hybridize to the polynucleotides described herein under low stringency conditions, typically under moderately stringent conditions, and generally under high stringency conditions. The basic parameters that influence the selection of hybridization conditions and guidance for designing suitable conditions are described in Sambrook, J., E.F. Fritsch, and T. Maniatis (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY), and can be easily determined by those skilled in the art, for example, based on the length or base composition of the polynucleotide.

[0112] One method for achieving moderately and highly stringent conditions is defined herein. Naturally, the wash temperature and wash salt concentration can be adjusted as needed to achieve the desired level of stringency by applying basic principles governing hybridization reactions and duplex stability, known to those skilled in the art and further described below (see, e.g., Sambrook, J., E.F. Fritsch, and T. Maniatis (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY)). When hybridizing a polynucleotide to a polynucleotide of unknown sequence, the hybrid length is assumed to be the length of the hybridizing polynucleotide. When hybridizing a polynucleotide of known sequence, the hybrid length can be determined by aligning the polynucleotide sequences and identifying the region of optimal sequence complementarity. For hybrids expected to be less than 50 base pairs in length, the hybridization temperature should be 5-10°C lower than the melting temperature of the hybrid, where the melting temperature is determined by the following equation: For hybrids less than 18 base pairs in length, the melting temperature (°C) = 2 (number of A+T bases) + 4 (number of G+C bases). For hybrids greater than 18 base pairs in length, the melting temperature (°C) = 81.5 + 16.6 (log10 [Na+]) + 0.41 (% G+C) - (600 / N), where N is the number of bases in the hybrid and [Na+] is the sodium ion concentration in the hybridization buffer ([Na+] = 0.165 M for 1 × standard sodium citrate). Typically, each such hybridizing polynucleotide has a length that is at least 25% (generally at least 50%, 60%, or 70%, most commonly at least 80%) of the length of the polynucleotide to which it hybridizes, and has at least 60% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity with the polynucleotide to which it hybridizes.

[0113] As those skilled in the art will understand, linear DNA has two possible orientations: 5'-3' and 3'-5'. For example, if a first sequence is arranged in the 5'-3' direction and a second sequence is arranged in the 5'-3' direction within the same polynucleotide molecule / strand, the first and second sequences are oriented in the same direction, i.e., have the same orientation. Typically, the target promoter sequence and gene under the control of a given promoter are arranged in the same orientation. However, if the second sequence is arranged in the 3'-5' direction within the same polynucleotide molecule / strand relative to the first sequence arranged in the 5'-3' direction, the first and second sequences are oriented in the antisense direction, i.e., have an antisense orientation. Alternatively, two sequences that are oriented in an antisense direction relative to each other can be described as having the same orientation when the first sequence (5'-3' direction) and the reverse complementary sequence of the first sequence (the first sequence arranged in the 5'-3' direction) are arranged within the same polynucleotide molecule / strand. The sequences set forth herein are presented in the 5'-3' orientation.

[0114] Fragments of the polynucleotides described herein are also disclosed and can range from at least about 25 nucleotides, about 50 nucleotides, about 75 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 600 nucleotides, about 700 nucleotides, about 800 nucleotides, about 900 nucleotides, about 1000 nucleotides, about 1100 nucleotides, about 1200 nucleotides, about 1300 nucleotides, or about 1400 nucleotides, up to the full-length polynucleotide.

[0115] In another aspect, an isolated polypeptide is provided that comprises, consists of, or consists essentially of a polypeptide having at least 77% sequence identity to any polypeptide described herein, including any polypeptide set forth in the Sequence Listing. Suitably, the isolated polypeptide comprises, consists of, or consists essentially of a sequence having at least 77%, 78%, 79%, 80%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% sequence identity thereto.

[0116] In one embodiment, a polypeptide encoded by SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:12, or SEQ ID NO:16 is provided.

[0117] In another embodiment, an isolated polypeptide is provided comprising, consisting of, or consisting essentially of a sequence having at least 77%, 78%, 79%, 80%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% sequence identity to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:12, or SEQ ID NO:16.

[0118] A polypeptide can comprise a sequence that comprises a sufficient or substantial degree of identity or similarity to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:12, or SEQ ID NO:16 for function as an NtNTP2. A fragment of a polypeptide typically retains some or all of the NtNTP2 function or activity of the full-length sequence.

[0119] As discussed herein, polypeptides can include mutations such as mutations that encode stop codons, as in SEQ ID NOs: 8 and 16. SEQ ID NO: 8 has a mutation at amino acid position 211 that mutates amino acid W211 of NtNtp2-S to a stop codon. SEQ ID NO: 16 has a mutation at amino acid position 212 that mutates amino acid W212 of NtNtp2-T to a stop codon.

[0120] Although exemplary mutations are disclosed herein, it will be understood by those skilled in the art that advantageous phenotypes may be obtained by other mutations in the NtNtp2 polynucleotide sequences described herein that result in truncation of the expressed polypeptide. Similarly, advantageous phenotypes may be obtained by modulating (e.g., reducing or suppressing) the expression or activity of NtNtp2 using other genetic techniques described herein.

[0121] Mutants can be produced by introducing any kind of alteration (e.g., amino acid insertion, deletion, or substitution; changes in glycosylation status; changes affecting refolding or isomerization, three-dimensional structure, or self-association status), whether intentionally engineered or naturally isolated, provided they still possess some or all of their function or activity. Preferably, this function or activity is modulated, or more preferably, reduced or eliminated.

[0122] Deletion refers to the removal of one or more amino acids from a polypeptide. Insertion refers to the introduction of one or more amino acid residues into a predetermined site within a polypeptide. Insertion can include the intrasequence insertion of single or multiple amino acids. Substitution refers to the replacement of an amino acid in a polypeptide with another amino acid having similar properties (e.g., similar hydrophobicity, hydrophilicity, antigenicity, tendency to form or disrupt an α-helical or β-sheet structure). Amino acid substitutions are typically of single residues but can be clustered depending on the functional constraints imposed on the polypeptide and can range from about 1 to about 10 amino acids. Amino acid substitutions are preferably conservative amino acid substitutions, as described below. Amino acid substitutions, deletions, and / or insertions can be performed using peptide synthesis techniques (e.g., solid-phase peptide synthesis) or by recombinant DNA engineering. Methods for manipulating DNA sequences to create substitution, insertion, or deletion mutations in polypeptides are well known in the art. Variants can have alterations that produce silent changes and result in functionally equivalent polypeptides. As long as secondary binding of the substance is maintained, deliberate amino acid substitutions can be made based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and amphipathic properties of the residues. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids with uncharged polar head groups with similar hydrophilicity values ​​include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine. Conservative substitutions can be made, for example, according to the following table. Amino acids in the same block in the second row and preferably in the same family in the third row can be substituted for each other.

[0123] JPEG2025533986000002.jpg45127

[0124] The polypeptide may be a mature or immature polypeptide, or a polypeptide derived from an immature polypeptide. The polypeptide may be linear or cyclized using known methods. The polypeptide typically contains at least 10, at least 20, at least 30, or at least 40 consecutive amino acids.

[0125] Fragments of the disclosed polypeptides are also disclosed. Polypeptide fragments can range from at least about 25 amino acids, about 50 amino acids, about 75 amino acids, about 100 amino acids, about 150 amino acids, about 200 amino acids, about 250 amino acids, about 300 amino acids, about 400 amino acids, about 500 amino acids, up to the full-length polypeptides described herein. The encoded polypeptide fragments may retain all, some, or none of the biological activity of the full-length polypeptides.

[0126] Recombinant constructs can be used to transform plants or plant cells to modulate the expression, function, or activity of NtNTP2 polypeptides. Recombinant Ntntp2 polynucleotide constructs can include an Ntntp2 polynucleotide encoding one or more Ntntp2 polynucleotides described herein, operably linked to a regulatory region suitable for expressing the NtNTP2 polypeptide. Thus, an Ntntp2 polynucleotide can include a coding sequence encoding an NtNTP2 polypeptide described herein. Plants or plant cells in which the expression, function, or activity of an NtNTP2 polypeptide is modulated can include mutant, non-natural, transgenic, artificial, or genetically engineered plants or plant cells. Preferably, transgenic plants or plant cells contain genomes that have been altered by stable integration of recombinant DNA. Recombinant DNA includes DNA that has been genetically engineered and constructed outside the cell, including DNA containing natural DNA, cDNA, or synthetic DNA. Transgenic plants can include plants regenerated from the originally transformed plant cell, as well as progeny transgenic plants from subsequent generations or crosses of the transformed plants. Suitably, the transgenic modification alters the expression or function or activity of an Ntntp2 polynucleotide or NtNTP2 polypeptide described herein compared to a control plant.

[0127] The NtNTP2 polypeptide encoded by the recombinant Ntntp2 polynucleotide may be a native NtNTP2 polypeptide or may be heterologous to the cell. In some cases, the recombinant construct contains an Ntntp2 polynucleotide operably linked to a regulatory region that regulates expression. Examples of suitable regulatory regions are described herein.

[0128] Also provided is a vector containing recombinant polynucleotide constructs, including recombinant Ntntp2 polynucleotide constructs.Suitable vector backbones include those commonly used in the art, such as plasmid, virus, artificial chromosome, bacterial artificial chromosome, yeast artificial chromosome or bacteriophage artificial chromosome.Suitable expression vectors include but are not limited to plasmid and viral vectors, such as bacteriophage, baculovirus and retrovirus.Many vectors and expression systems are commercially available.

[0129] A vector may contain, for example, an origin of replication, a scaffold attachment region, or a marker. Marker genes can confer a selectable phenotype to plant cells. For example, markers can confer biocide resistance, such as resistance to antibiotics (e.g., kanamycin, G418, bleomycin, or hygromycin) or herbicides (e.g., glyphosate, chlorsulfuron, or phosphinothricin). In addition, expression vectors can contain tag sequences designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as luciferase, beta-glucuronidase, green fluorescent polypeptide, glutathione S-transferase, polyhistidine, c-myc, or hemagglutinin sequences, are typically expressed as a fusion with the encoded polypeptide. Such tags can be inserted anywhere within the polypeptide, including at either the carboxyl or amino terminus.

[0130] Plants or plant cells can be transformed by having a recombinant Ntntp2 polynucleotide integrated into their genome so that they are stably transformed. The plants or plant cells described herein can be stably transformed. Stably transformed cells typically retain the introduced Ntntp2 polynucleotide with each cell division. Plants or plant cells can be transiently transformed so that the recombinant Ntntp2 polynucleotide is not integrated into their genome. Transiently transformed cells typically lose all or part of the introduced recombinant Ntntp2 polynucleotide with each cell division, so that the introduced recombinant Ntntp2 polynucleotide is not detected in daughter cells after a sufficient number of cell divisions.

[0131] Many methods for transforming plant cells are available in the art, including biolistics, gene gun techniques, Agrobacterium-mediated transformation, viral vector-mediated transformation, freeze-thaw methods, particle bombardment, direct DNA uptake, sonication, microinjection, plant virus-mediated transfer, and electroporation. Agrobacterium systems for integrating foreign DNA into plant chromosomes have been extensively studied, modified, and developed in plant genetic engineering. Naked recombinant DNA molecules containing DNA sequences corresponding to the subject purified polypeptides, operably linked in sense or antisense orientation to regulatory sequences, are ligated to appropriate T-DNA sequences by conventional methods. These are introduced into protoplasts by polyethylene glycol or electroporation, both of which are standard techniques. Alternatively, such vectors containing recombinant DNA molecules encoding the subject purified polypeptides are introduced into living Agrobacterium cells, which then introduce the DNA into plant cells. Transformation with naked DNA without T-DNA vector sequences can be achieved by fusion of protoplasts with DNA-containing liposomes or by electroporation. Naked DNA without T-DNA vector sequences can also be used to transform cells by inert high-velocity particle bombardment.

[0132] If cells or cultured tissues are used as recipient tissues for transformation, plants can be regenerated from the transformed cultures, if desired, by techniques known to those skilled in the art.

[0133] The selection of a regulatory region to be included in a recombinant construct depends on several factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level, and cell- or tissue-preferential expression. Regulating the expression of a coding sequence by appropriately selecting and positioning a regulatory region relative to the coding sequence is a routine matter for those skilled in the art. Transcription of Ntntp2 polynucleotides can be regulated in a similar manner. Some suitable regulatory regions initiate transcription only or primarily in certain cell types. Methods for identifying and characterizing regulatory regions within plant genomic DNA are known in the art.

[0134] Suitable promoters include tissue-specific promoters that are recognized by tissue-specific factors present in different tissues or cell types (e.g., root-specific promoters, shoot-specific promoters, xylem-specific promoters), or present during different developmental stages, or in response to different environmental conditions. Suitable promoters include constitutive promoters that can be activated in most cell types without the need for specific inducers. Examples of suitable promoters for controlling RNAi polypeptide production include the cauliflower mosaic virus 35S (CaMV / 35S), SSU, OCS, lib4, usp, STLS1, B33, nos, or ubiquitin or phaseolin promoters. Those skilled in the art can generate multiple variants of recombinant promoters.

[0135] A tissue-specific promoter is a transcriptional control element that is only active in specific cells or tissues, such as plant tissues or reproductive tissues, at specific times during plant development. Tissue-specific expression can be advantageous, for example, when expression of a polynucleotide in a specific tissue is preferred. Examples of tissue-specific promoters under developmental control include promoters that can initiate transcription only (or mainly) in specific tissues, such as plant tissues (e.g., roots or leaves) or reproductive tissues (e.g., fruit, ovule, seed, pollen, pistil, flower, or any embryonic tissue). Reproductive tissue-specific promoters can be, for example, anther-specific, ovule-specific, embryo-specific, endosperm-specific, integument-specific, seed and seed coat-specific, pollen-specific, petal-specific, sepal-specific, or a combination thereof.

[0136] Suitable leaf-specific promoters include pyruvate, the orthophosphate dikinase (PPDK) promoter from C4 plants (maize), the cab-m1Ca+2 promoter from maize, the Arabidopsis myb-related gene promoter (Atmyb5), the ribulose bisphosphate carboxylase (RBCS) promoter (e.g., the tomato RBCS1, RBCS2, and RBCS3A genes, which are expressed in leaves and seedlings grown under artificial light, RBCS1 and RBCS2, which are expressed in developing tomato fruit, or the ribulose bisphosphate carboxylase promoter, which is expressed at high levels almost exclusively in the mesophyll cells of leaf blades and sheaths).

[0137] Suitable senescence-specific promoters include tomato promoters active during fruit ripening, senescence, and leaf abscission, maize promoters of genes encoding cysteine ​​proteases, the 82E4 promoter, and the promoter of the SAG gene. Suitable anther-specific promoters can be used. Suitable root-preferred promoters known to those skilled in the art can be selected. Suitable seed-preferred promoters include both seed-specific promoters (promoters active during seed development, such as promoters of seed storage polypeptides) and seed germination promoters (promoters active during seed germination). Such seed-preferred promoters include Cim1 (cytokinin-induced message), cZ19B1 (maize 19kDa zein), milps (myo-inositol-1-phosphate synthase), mZE40-2 (also known as Zm-40), nuclc, and celA (cellulose synthase). Gama-zein is an endosperm-specific promoter. Glob-1 is an embryo-specific promoter. In dicotyledonous plants, seed-specific promoters include bean beta-phaseolin, napin, beta-conglycinin, soybean lectin, cruciferin, etc. In monocotyledonous plants, seed-specific promoters include the maize 15 kDa zein promoter, 22 kDa zein promoter, 27 kDa zein promoter, g-zein promoter, 27 kDa gamma-zein promoter (e.g., the gzw64A promoter; see GenBank Accession No. S78780), waxy promoter, shrunken1 promoter, shrunken2 promoter, globulin1 promoter (see GenBank Accession No. L22344), Itp2 promoter, cim1 promoter, maize end1 and end2 promoters, nuc1 promoter, Zm40 promoter, eep1 and eep2, lec1, thioredoxin H promoter, mlip15 promoter, PCNA2 promoter, and shrunken-2 promoter.

[0138] Examples of inducible promoters include promoters that respond to pathogen attack, anaerobic conditions, high temperature, light, drought, low temperature, or high salinity. Pathogen-inducible promoters include those from pathogenesis-related polypeptides (PR polypeptides) and are induced following infection by a pathogen (e.g., PR polypeptides, SAR polypeptides, beta-1,3-glucanases, chitinases).

[0139] In addition to plant promoters, other suitable promoters may be derived from bacterial origin, such as the octopine synthase promoter, the nopaline synthase promoter, and other promoters derived from Ti plasmids, or may be derived from viral promoters (e.g., the 35S and 19S RNA promoters of the cauliflower mosaic virus (CaMV), the constitutive promoters of the tobacco mosaic virus, the cauliflower mosaic virus (CaMV) 19S and 35S promoters, or the figwort mosaic virus 35S promoter).

[0140] Suitable methods for introducing polynucleotides into plant cells and subsequent integration into the plant genome include microinjection (Crossway et al., Biotechniques 4:320-334 (1986)), electroporation (Riggs et al., Proc. Natl. Acad. Sci. USA 83:5602-5606 (1986)), Agrobacterium-mediated transfer (U.S. Patent Nos. 5,981,840 and 5,563,055), direct gene transfer (Paszkowski et al., EMBO J. 3:2717-2722 (1984)), and ballistic particle acceleration (e.g., U.S. Patent Nos. 4,945,050, 5,879,918, 5,886,244, 5,932,782; Tomes et al., in Plant Cell, Tissue, and See, for example, Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin) (1995), and McCabe et al., Biotechnology 6:923-926 (1988).

[0141] Disclosed are plants or plant cells comprising mutations in one or more Ntntp2 polynucleotides or NtNTP2 polypeptides described herein, which mutations result in modulated function or activity of NtNTP2 (including complete loss of function or activity). Preferably, the mutations reduce or suppress Ntntp2 expression or activity. Aside from the specific mutations described herein, the mutant plant or plant cell can have one or more additional mutations, either in the same Ntntp2 polynucleotide or NtNTP2 polypeptide described herein, or in one or more other polynucleotides or polypeptides within the genome. Aside from mutations, other techniques can be utilized by those skilled in the art to modulate the function or activity of NtNTP2, as described in detail herein.

[0142] Also provided is a method for modulating the level of NtNTP2 polypeptide in a plant or plant material, said method comprising introducing into the genome of said plant one or more mutations that modulate expression of at least one Ntntp2 gene, said at least one Ntntp2 gene being selected from the sequences according to the present disclosure.

[0143] Also provided are methods for identifying plants that do not have reduced nitrate levels compared to control plants grown under the same fertilization conditions, have increased biomass compared to control plants grown under the same fertilization conditions, and have an increased NUE response compared to control plants grown under the same fertilization conditions, comprising screening a polynucleotide sample from a plant of interest for the presence of one or more mutations in the Ntntp2 sequence described herein. The plant may also have increased root development compared to control plants grown under the same fertilization conditions.

[0144] Also disclosed are plants or plant cells that are heterozygous or homozygous for one or more mutations in one or more Ntntp2 genes according to the present disclosure, wherein said mutations result in modulation of the expression of the Ntntp2 gene or the function or activity of the NtNTP2 polypeptide encoded thereby.

[0145] Numerous techniques, including sexual crossing, can be used to combine mutations into one plant. A plant having one or more favorable heterozygous or homozygous mutations in the Ntntp2 gene that regulate the expression of the Ntntp2 gene or the function or activity of the NtNTP2 polypeptide encoded thereby can be crossed with a plant having one or more favorable heterozygous or homozygous mutations in one or more other genes that regulate the expression or the function or activity of the polypeptide encoded thereby. In one embodiment, crossing is performed with the aim of introducing one or more favorable heterozygous or homozygous mutations in the Ntntp2 gene into the same plant.

[0146] The function or activity of one or more NtNTP2 polypeptides of the present disclosure in a plant is increased or decreased if the function or activity is lower or higher than the function or activity of the same polypeptide in a plant that has not been modified to modulate the function or activity of the polypeptide and that has been grown, harvested, and optionally dried using the same protocols.

[0147] In some embodiments, mutations are introduced into plants or plant cells using mutagenesis techniques, and the introduced mutations are identified or selected using methods known to those skilled in the art (e.g., Southern blot analysis, DNA sequencing, PCR analysis, or phenotypic analysis). Mutations that affect Ntntp2 gene expression or disrupt the function of the encoded NtNTP2 polypeptide can be determined using methods well known in the art. Insertional mutations in Ntntp2 gene exons usually result in null mutants. Mutations in conserved residues can be particularly effective in reducing or suppressing the metabolic function of the encoded NtNTP2 polypeptide. For example, it will be understood that mutations in one or more highly conserved regions are likely to alter NtNTP2 polypeptide function, while mutations outside those highly conserved regions are likely to have little or no effect on NtNTP2 polypeptide function. In addition, mutations in a single nucleotide can create a stop codon, resulting in a truncated NtNTP2 polypeptide and, depending on the extent of truncation, reduced or complete loss of function. Preferably, the mutation results in reduced expression of Ntntp2 and reduced biological function of NtNTP2, more preferably the mutation results in complete loss of expression of Ntntp2 and complete loss of biological function of NtNTP2.

[0148] Also disclosed are methods for obtaining mutant Ntntp2 polynucleotides and mutant NtNTP2 polypeptides.Any plant of interest, including plant cells or plant materials or plant leaves, can be genetically modified by various known methods for inducing mutagenesis, including site-directed mutagenesis, oligonucleotide-directed mutagenesis, chemically induced mutagenesis, radiation-induced mutagenesis, mutagenesis using modified bases, mutagenesis using gapped duplex DNA, double-strand break mutagenesis, mutagenesis using repair-deficient host strains, mutagenesis by total gene synthesis, DNA shuffling and other equivalent methods.

[0149] Mutant NtNTP2 polypeptides can be used to generate mutant, non-naturally occurring, or transgenic plants (e.g., mutant, non-naturally occurring, transgenic, artificial, or genetically engineered plants) or plant cells containing one or more mutant polypeptides. Suitably, mutant NtNTP2 polypeptides may retain all, some, or none of the function of the unmutated polypeptide. Thus, the function of a mutant NtNTP2 polypeptide may be increased, decreased, or nearly the same as that of the unmutated polypeptide. In certain embodiments, it is preferred that mutant NtNTP2 polypeptides have reduced function or retain no function at all.

[0150] Mutations in Ntntp2 polynucleotides and NtNTP2 polypeptides can include artificial mutations, synthetic mutations, or genetically engineered mutations.Mutations in the Ntntp2 polynucleotides and NtNTP2 polypeptides described herein can be mutations that have been obtained or can be obtained through a process that includes in vitro or in vivo manipulation steps.Mutations in the Ntntp2 polynucleotides and NtNTP2 polypeptides described herein can be mutations that have been obtained or can be obtained through a process that includes human intervention.

[0151] Methods for randomly introducing mutations into polynucleotides can include chemical mutagenesis and radiation mutagenesis. Chemical mutagenesis involves the use of exogenously added chemicals, such as mutagenic, teratogenic, or carcinogenic organic compounds, to induce mutations. Mutagens that primarily cause point mutations, as well as short deletions, insertions, missense mutations, simple sequence repeats, transversions, and / or transitions, can be used to induce mutations, including chemical mutagens or radiation. Mutagens include ethyl methanesulfonate, methyl methanesulfonate, N-ethyl-N-nitrosourea, triethylmelamine, N-methyl-N-nitrosourea, procarbazine, chlorambucil, cyclophosphamide, diethyl sulfate, acrylamide monomer, melphalan, nitrogen mustard, vincristine, dimethylnitrosamine, N-methyl-N'-nitro-nitrosoguanidine, nitrosoguanidine, 2-aminopurine, 7,12 dimethyl-benz(a)anthracene, ethylene oxide, hexamethylphosphoramide, bisulfane, diepoxyalkanes (diepoxyoctane, diepoxybutane, etc.), 2-methoxy-6-chloro-9[3-(ethyl-2-chloro-ethyl)aminopropylamino]acridine dihydrochloride, and formaldehyde.

[0152] Spontaneous mutations at loci that may not be directly caused by mutagens are also contemplated, provided that they result in the desired phenotype. Suitable mutagens may also include, for example, ionizing radiation (e.g., X-rays, gamma rays, fast neutron irradiation, and UV radiation). The dosage of mutagenic chemicals or radiation is experimentally determined for each type of plant tissue to obtain a mutation frequency that is below the threshold level characterized by lethality or reproductive sterility. Any method of plant polynucleotide preparation known to those skilled in the art can be used to prepare plant polynucleotides for mutation screening.

[0153] The mutation process may involve one or more plant cross-breeding steps.

[0154] After mutation, screening can be performed to identify mutations that result in premature stop codons or otherwise create non-functional genes. After mutation, screening can be performed to identify mutations that create functional genes that can be expressed at increased or decreased levels. Screening for mutants can be performed by sequencing or by using one or more probes or primers specific to the Ntntp2 gene or NtNTP2 polypeptide. Specific mutations in Ntntp2 polynucleotides that can result in regulated Ntntp2 gene expression, regulated mRNA stability, or regulated polypeptide stability can also be created. Such plants are referred to herein as "non-natural" or "mutant" plants. Typically, mutant or non-natural plants will contain at least a portion of exogenous, synthetic, or man-made nucleotides (e.g., DNA or RNA) that were not present in the plant prior to manipulation. The exogenous nucleotide can be a single nucleotide, two or more nucleotides, two or more contiguous nucleotides, or two or more non-contiguous nucleotides (e.g., at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, or 1500 or more contiguous or non-contiguous nucleotides).

[0155] In addition to mutagenesis, compositions that can regulate the expression, function, or activity of one or more Ntntp2 polynucleotides or NtNTP2 polypeptides include sequence-specific polynucleotides that can interfere with the transcription of one or more endogenous genes, sequence-specific polynucleotides that can interfere with the translation of RNA transcripts (e.g., double-stranded RNA, siRNA, ribozymes), sequence-specific polypeptides that can interfere with the stability of one or more polypeptides, sequence-specific polynucleotides that can interfere with the enzymatic function of one or more polypeptides, or the binding function of one or more polypeptides with respect to substrates or regulatory polypeptides, antibodies that show specificity for one or more polypeptides, small molecule compounds that can interfere with the stability of one or more polypeptides or the enzymatic function of one or more polypeptides or the binding function of one or more polypeptides, zinc finger polypeptides that bind one or more polynucleotides, and meganucleases that function on one or more polynucleotides.Gene editing, genetic editing, and genome editing technologies are well known in the art.

[0156] Zinc finger polypeptides can be used to regulate the expression, function, or activity of one or more of the Ntntp2 polynucleotides described herein. In various embodiments, a genomic DNA sequence containing part or all of the coding sequence of an Ntntp2 polynucleotide is modified by zinc finger nuclease-mediated mutagenesis. The genomic DNA sequence is searched for a unique site for zinc finger polypeptide binding. Alternatively, the genomic DNA sequence is searched for two unique sites for zinc finger polypeptide binding, where both sites are on opposite strands and are located close to each other, for example, separated by 1, 2, 3, 4, 5, 6, or more base pairs. Thus, zinc finger polypeptides that bind to Ntntp2 polynucleotides are provided. The zinc finger polypeptides can be engineered to recognize selected target sites within a gene. Zinc finger polypeptides can include any combination of motifs derived from natural and non-natural zinc finger DNA-binding domains by a process of truncation or extension or site-directed mutagenesis coupled with a selection method, such as, but not limited to, phage display selection, bacterial two-hybrid selection, or bacterial one-hybrid selection. The term "non-natural zinc finger DNA-binding domain" refers to a zinc finger DNA-binding domain that binds a three-base pair sequence within a polynucleotide target and that does not occur in the cell or organism containing the polynucleotide to be modified. Methods for designing zinc finger polypeptides that bind specific polynucleotides unique to a target gene are known in the art.

[0157] In other embodiments, the zinc finger polypeptide can be selected to bind to a regulatory sequence of an NtNTP2 polynucleotide. More specifically, the regulatory sequence can include a transcription initiation site, a start codon, an exon region, an exon-intron boundary, a terminator, or a stop codon. Thus, the present disclosure provides mutant, non-naturally occurring, or transgenic plants or plant cells generated by zinc finger nuclease-mediated mutagenesis near or within one or more Ntntp2 polynucleotides described herein, and methods for producing such plants or plant cells by zinc finger nuclease-mediated mutagenesis. Methods for delivering zinc finger polypeptides and zinc finger nucleases to plants are similar to those described below for delivering meganucleases.

[0158] In another aspect, a method for generating mutant, non-natural, or transgenic or genetically modified plants using meganucleases such as I-CreI is described. Natural meganucleases as well as recombinant meganucleases can be used to specifically cause double-strand breaks at a single site or at a relatively small number of sites within the genomic DNA of a plant, allowing for the cleavage of one or more Ntntp2 polynucleotides described herein. The meganuclease can be an engineered meganuclease with altered DNA recognition properties. Meganuclease polypeptides can be delivered to plant cells by a variety of different mechanisms known in the art.

[0159] The present disclosure encompasses the use of meganucleases to inactivate an Ntntp2 polynucleotide described herein (or any combination thereof described herein) in a plant cell or plant. In particular, the present disclosure provides a method for inactivating an Ntntp2 polynucleotide in a plant using a meganuclease, the method comprising: (a) providing a plant cell containing an Ntntp2 polynucleotide described herein; (b) introducing a meganuclease or a construct encoding the meganuclease into the plant cell; and (c) allowing the meganuclease to substantially inactivate the Ntntp2 polynucleotide.

[0160] Meganucleases can be used to cleave meganuclease recognition sites within the coding region of Ntntp2 polynucleotides. Such cleavage frequently results in deletion of DNA at the meganuclease recognition site after mutagenic DNA repair by non-homologous end joining. Such mutations within the gene coding sequence are typically sufficient to inactivate the gene. This method for modifying plant cells involves first delivering a meganuclease expression cassette into the plant cell using a suitable transformation method. For maximum efficiency, it is desirable to link the meganuclease expression cassette to a selectable marker and select successfully transformed cells in the presence of a selection agent. This approach results in integration of the meganuclease expression cassette into the genome, which may not be desirable if the plant is likely to require regulatory approval. In such cases, the meganuclease expression cassette (and the linked selectable marker gene) can be segregated in subsequent plant generations using conventional breeding techniques.

[0161] Following delivery of the meganuclease expression cassette, the plant cells are initially cultured under conditions typical for the particular transformation procedure used. This may mean culturing the transformed cells in medium at a temperature below 26°C, often in the dark. These standard conditions are used for a period of time, preferably 1-4 days, to allow the plant cells to recover from the transformation process. At any point after this initial recovery period, the culture temperature can be increased to stimulate the function of the engineered meganuclease, causing cleavage of the meganuclease recognition site and mutations to occur.

[0162] One method of gene editing involves the use of transcription activator-like effector nucleases (TALENs), which induce double-strand breaks to which cells can respond using repair mechanisms. NHEJ rejoins DNA from either side of a double-strand break, where there is little or no sequence overlap for annealing. This repair mechanism induces errors in the genome due to insertions or deletions, or chromosomal rearrangements. Such errors can result in non-functional gene products being coded at that location. In certain applications, it may be desirable to precisely remove the Ntntp2 polynucleotide from the plant genome. This application is possible using a pair of engineered meganucleases, each of which cleaves meganuclease recognition sites on either side of the intended deletion. TALENs can also be used, which can recognize and bind to genes and introduce double-strand breaks into the genome. Therefore, in another embodiment, methods are contemplated for generating mutant, non-natural, or transgenic or genetically modified plants as described herein using TAL effector nucleases.

[0163] Another method of gene editing involves the use of the bacterial CRISPR / Cas system. Bacteria and archaea exhibit chromosomal elements called clustered regularly interspaced short palindromic repeats (CRISPR), which are part of the adaptive immune system that protects against viral and plasmid DNA invasion. In the type II CRISPR system, CRISPR RNA (crRNA) functions with a transactivating crRNA (tracrRNA) and a CRISPR-associated (Cas) polypeptide to introduce a double-stranded break in the target DNA. Target cleavage by Cas9 requires base pairing between the crRNA and tracrRNA, and between the crRNA and the target DNA. Target recognition is facilitated by the presence of a short motif called a protospacer adjacent motif (PAM), which matches the sequence NGG. This system can be utilized for genome editing. Cas9 is typically programmed by a duplex RNA consisting of a crRNA and a tracrRNA. However, the core components of these RNAs can be combined into a single hybrid "guide RNA" for Cas9 targeting. The use of non-coding RNA guides to target DNA for site-specific cleavage promises to be much simpler than existing technologies such as TALEN. Using the CRISPR / Cas method, retargeting of nuclease complexes requires only the introduction of new RNA sequences, without the need to redesign the specificity of polypeptide transcription factors. CRISPR / Cas technology was implemented in plants in accordance with the methods of International Application WO2015 / 189693A1, which discloses a virus-mediated genome editing platform that is broadly applicable across plant species. The RNA2 genome of tobacco rattle virus (TRV) was engineered to carry guide RNA and deliver it to Nicotiana benthamiana plants overexpressing Cas9 endonuclease. In the context of the present disclosure, guide RNAs can be derived from any of the sequences disclosed herein, and the teachings of WO2015 / 189693A1 can be applied to edit the genome of plant cells and obtain desired mutant plants.The rapid development of technology has led to a wide variety of protocols with broad applicability in the plant kingdom, which have been thoroughly catalogued in many recent scientific review articles (e.g., Schiml et al. Plant Methods 2016 12:8, and Khatodia et al. Front Plant Sci. 2016;7:506). A review of the CRISPR / Cas system, focusing specifically on its application in plants, is presented by Bortesi and Fischer (Biotechnology Advances (2015) 33,1,41-52). Bortesi and Fischer also compare CRISPR / Cas technology, zinc finger nucleases, and TALENs. More recent developments in the use of CRISPR / Cas to manipulate plant genomes are reviewed in Liu et al. (2017) Acta Pharmaceutica Sinica B 7,3,292-302 and Curr. Op. in Plant Biol. (2017) 36,1-8. CRISPR / Cas9 plasmids for use in plants are listed on "addgene," a non-profit plasmid repository (addgene.org), and CRISPR / Cas plasmids are commercially available.

[0164] Antisense technology is another well-known method that can be used to regulate the expression or activity of NtNTP2 polypeptide.The polynucleotide of the gene to be suppressed is cloned and operably linked to a control region and a transcription termination sequence so that the antisense strand of RNA is transcribed.The recombinant construct is then transformed into plant cells, and the antisense strand of RNA is produced.The polynucleotide does not need to be the entire sequence of the gene to be suppressed, but will typically be substantially complementary to at least a portion of the sense strand of the gene to be suppressed.

[0165] Polynucleotides can be transcribed into ribozymes or catalytic RNAs that affect mRNA expression. Ribozymes can be designed to specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. Heterologous polynucleotides can encode ribozymes designed to cleave specific mRNA transcripts, thereby preventing polypeptide expression. Hammerhead ribozymes are useful for destroying specific mRNAs, but various ribozymes can be used that cleave mRNAs at site-specific recognition sequences. Hammerhead ribozymes cleave mRNAs at locations dictated by adjacent regions that form complementary base pairs with the target mRNA. The only requirement is that the target RNA contain a 5'-UG-3' polynucleotide. The construction and production of hammerhead ribozymes are known in the art. Hammerhead ribozyme sequences can be embedded in stable RNAs, such as transfer RNAs (tRNAs), to enhance cleavage efficiency in vivo.

[0166] In one embodiment, sequence-specific polynucleotides capable of interfering with the translation of RNA transcripts interfere with RNA. RNA interference, or RNA silencing, is an evolutionarily conserved process that allows specific mRNAs to be targeted for enzymatic degradation. Double-stranded RNA (dsRNA) is introduced or produced by cells (e.g., by double-stranded RNA viruses or interfering RNA polynucleotides) to initiate the interfering RNA pathway. The double-stranded RNA can be converted into multiple small interfering RNA duplexes, each 21-24 bp in length, by the double-stranded RNA-specific endonuclease RNase III. The siRNA can then be recognized by an RNA-induced silencing complex, which promotes siRNA unwinding through an ATP-dependent process. The unwound antisense strand of the siRNA guides the activated RNA-induced silencing complex to the targeted mRNA, which contains a sequence complementary to the siRNA antisense strand. The targeted mRNA and the antisense strand can form an A-form helix, and the major groove of the A-form helix can be recognized by the activated RNA-induced silencing complex. The target mRNA can be cleaved by the activated RNA-induced silencing complex at a single site defined by the binding site at the 5' end of the siRNA strand, and the activated RNA-induced silencing complex can be recycled to catalyze another cleavage event.

[0167] Interfering RNA expression vectors can contain interfering RNA constructs that encode interfering RNA polynucleotides that exhibit RNA interference by reducing the expression level of mRNA, pre-mRNA, or related RNA variants.As further described herein, expression vectors can contain a promoter located upstream and operably linked to the interfering RNA construct.Interfering RNA expression vectors can include a suitable minimal core promoter, the interfering RNA construct of interest, an upstream (5') control region, a downstream (3') control region that includes transcription termination and polyadenylation signals, and other sequences such as various selectable markers that are known to those skilled in the art.

[0168] The double-stranded RNA molecule can include an siRNA molecule assembled from a single oligonucleotide with a stem-loop structure, in which the self-complementary sense and antisense regions of the siRNA molecule are connected by a polynucleotide or non-polynucleotide linker, and a circular single-stranded RNA with two or more loop structures, and a stem comprising the self-complementary sense and antisense strands, and the circular RNA can be processed either in vivo or in vitro to generate active siRNA molecules capable of mediating interfering RNA.

[0169] The use of small hairpin RNA molecules is also contemplated. These contain a specific antisense sequence in addition to the reverse complementary (sense) sequence, typically separated by a spacer or loop sequence. Cleavage of the spacer or loop provides a single-stranded RNA molecule and its reverse complement, which can anneal to form a double-stranded RNA molecule (optionally with an additional processing step that can result in the addition or removal of one, two, three, or more nucleotides from the 3' or 5' end of one or both strands). The spacer can be long enough to allow the antisense and sense sequences to anneal to form a double-stranded structure (or stem) before cleavage of the spacer (and optionally with a subsequent processing step that can result in the addition or removal of one, two, three, four, or more nucleotides from the 3' or 5' end of one or both strands). The spacer sequence is typically an unrelated polynucleotide that, when annealed to a double-stranded polynucleotide, is positioned between the two complementary polynucleotide regions that make up the small hairpin RNA. The spacer sequence generally contains from about 3 to about 100 nucleotides.

[0170] Any RNA polynucleotide of interest can be generated by selecting a suitable sequence composition, loop size, and stem length to generate a hairpin duplex. Suitable ranges for designing the stem length of the hairpin duplex include stem lengths of at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, such as about 14-30 nucleotides, about 30-50 nucleotides, about 50-100 nucleotides, about 100-150 nucleotides, about 150-200 nucleotides, about 200-300 nucleotides, about 300-400 nucleotides, about 400-500 nucleotides, about 500-600 nucleotides, and about 600-700 nucleotides. Suitable ranges for designing the loop length of a hairpin duplex include loop lengths of about 4 to 25 nucleotides, about 25 to 50 nucleotides, or longer if the stem length of the hairpin duplex is substantial. In certain embodiments, the double-stranded RNA or ssRNA molecule is about 15 to about 40 nucleotides in length. In another embodiment, the siRNA molecule is a double-stranded RNA or ssRNA molecule about 15 to about 35 nucleotides in length. In another embodiment, the siRNA molecule is a double-stranded RNA or ssRNA molecule about 17 to about 30 nucleotides in length. In another embodiment, the siRNA molecule is a double-stranded RNA or ssRNA molecule about 19 to about 25 nucleotides in length. In another embodiment, the siRNA molecule is a double-stranded RNA or ssRNA molecule about 21 to about 23 nucleotides in length. In certain embodiments, hairpin structures with duplex regions longer than 21 nucleotides can promote effective siRNA-directed silencing, regardless of loop sequence and length. Exemplary sequences for RNA interference are described herein.

[0171] Target mRNA sequences are typically about 14 to about 50 nucleotides in length. Thus, the target mRNA can be scanned for a region of about 14 to about 50 nucleotides in length that meets one or more of the following criteria: an A+T / G+C ratio of about 2:1 to about 1:2; an AA or CA dinucleotide at the 5' end; a sequence of at least 10 consecutive nucleotides unique to the target mRNA (i.e., the sequence is not present in other mRNA sequences from the same plant); and no "run" of more than three consecutive guanine (G) nucleotides or more than three consecutive cytosine (C) nucleotides. These criteria can be evaluated using various techniques known in the art, for example, computer programs such as BLAST can be used to search publicly available databases to determine whether a selected sequence is unique to the target mRNA. Alternatively, sequences can be selected (and siRNA sequences designed) using commercially available computer software (e.g., commercially available OligoEngine, Target Finder, and siRNA Design Tool).

[0172] In one embodiment, target mRNA sequences are selected that are about 14 to about 30 nucleotides in length and meet one or more of the above criteria. In another embodiment, sequences are selected that are about 16 to about 30 nucleotides in length and meet one or more of the above criteria. In a further embodiment, sequences are selected that are about 19 to about 30 nucleotides in length and meet one or more of the above criteria. In another embodiment, sequences are selected that are about 19 to about 25 nucleotides in length and meet one or more of the above criteria.

[0173] In exemplary embodiments, the siRNA molecule comprises a specific antisense sequence complementary to at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more consecutive nucleotides of any one of the polynucleotides described herein.

[0174] The specific antisense sequence contained in siRNA molecule can be identical or substantially identical to complement.In one embodiment, the specific antisense sequence contained in siRNA molecule is at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complement of target mRNA sequence.The method for determining sequence identity is known in the art, and can be determined, for example, by using the BLASTN program of University of Wisconsin Computer Group (GCG) software or the one provided on NCBI website.

[0175] One method for inducing double-stranded RNA-silencing in plants is transformation with a gene construct that generates a hairpin RNA (see Nature (2000) 407, 319-320). Such a construct contains the reversed region of the target gene sequence separated by an appropriate spacer. Inserting a functional plant intron region as a spacer fragment further improves the efficiency of gene silencing induction, as it generates an intron-spliced ​​hairpin RNA (Plant J. (2001), 27, 581-590). Preferably, the stem length is about 50 nucleotides to about 1 kilobase. Methods for generating intron-spliced ​​hairpin RNAs have been well described in the art (see, for example, Bioscience, Biotechnology, and Biochemistry (2008) 72, 2, 615-617).

[0176] Interfering RNA molecules having a double-stranded or duplex structure, such as double-stranded RNA or small hairpin RNA, can have blunt ends or 3' or 5' overhangs. As used herein, "overhang" refers to unpaired nucleotides that protrude from a duplex structure when the 3' end of one RNA strand extends beyond the 5' end of the other strand (3' overhang), or vice versa (5' overhang). The nucleotides comprising the overhang can be ribonucleotides, deoxyribonucleotides, or modified versions thereof. In one embodiment, at least one strand of an interfering RNA molecule has a 3' overhang that is about 1 to about 6 nucleotides in length. In other embodiments, the 3' overhang is about 1 to about 5 nucleotides, about 1 to about 3 nucleotides, or about 2 to about 4 nucleotides in length.

[0177] When an interfering RNA molecule contains a 3' overhang at one end of the molecule, the other end can be blunt-ended or have an overhang (5' or 3'). When an interfering RNA molecule contains overhangs at both ends of the molecule, the lengths of the overhangs can be the same or different. In one embodiment, an interfering RNA molecule contains 3' overhangs of about 1 to about 3 nucleotides at both ends of the molecule. In a further embodiment, an interfering RNA molecule is a double-stranded RNA with 3' overhangs of two nucleotides at both ends of the molecule. In yet another embodiment, the nucleotides comprising the overhangs of the interfering RNA are TT dinucleotides or UU dinucleotides.

[0178] Interfering RNA molecules can contain one or more 5' or 3' cap structures. The term "cap structure" refers to a chemical modification incorporated at either end of an oligonucleotide, which may further protect the molecule from exonuclease degradation and facilitate intracellular delivery or localization.

[0179] Another modification that can be applied to interfering RNA molecules is the chemical linkage of one or more moieties or conjugates to the interfering RNA molecule to enhance the function, cellular distribution, cellular uptake, bioavailability, or stability of the interfering RNA molecule. Polynucleotides can be synthesized or modified by methods well established in the art. Chemical modifications can include 2' modifications, the introduction of unnatural bases, covalent binding with ligands, and the replacement of phosphate bonds with thiophosphate bonds. In this embodiment, the integrity of the double-stranded structure is strengthened by at least one, typically two, chemical linkages.

[0180] One or both nucleotides of the two single strands may be modified to modulate the activity of cellular enzymes, such as, but not limited to, certain nucleases. Techniques for reducing or inhibiting the activity of cellular enzymes are known in the art and include, but are not limited to, 2'-amino modifications, 2'-fluoro modifications, 2'-alkyl modifications, uncharged backbone modifications, morpholino modifications, 2'-O-methyl modifications, and phosphoramidates.

[0181] Ligand can be combined with interfering RNA molecule, for example, to enhance its cellular absorption.In certain embodiments, hydrophobic ligand is combined with molecule to promote direct penetration of cell membrane.In certain cases, the combination of cationic ligand with oligonucleotide often leads to improved resistance to nuclease.

[0182] "Targeted Induced Local Lesions In Genomes" (TILLING) is another mutagenesis technique that can be used to generate and / or identify Ntntp2 polynucleotides encoding Ntntp2 polypeptides with altered expression, function, or activity. TILLING also allows for the selection of plants carrying such mutants. TILLING combines high-density mutagenesis with high-throughput screening methods. The TILLING method is well known in the art (see McCallum et al., (2000) Nat Biotechnol 18:455-457, and Stemple (2004) Nat Rev Genet 5(2):145-50).

[0183] Various embodiments are directed to expression vectors comprising one or more of the Ntntp2 polynucleotides described herein or an interfering RNA construct comprising one or more Ntntp2 polynucleotides.

[0184] Various embodiments are directed to expression vectors that include one or more of the Ntntp2 polynucleotides described herein or one or more interfering RNA constructs.

[0185] Various embodiments are directed to expression vectors comprising one or more Ntntp2 polynucleotides or one or more interfering RNA constructs encoding one or more interfering RNA polynucleotides described herein that are capable of self-annealing to form a hairpin structure, wherein the construct comprises: (a) one or more of the Ntntp2 polynucleotides described herein; (b) a second sequence encoding a spacer element that forms the loop of the hairpin structure; and (c) a third sequence comprising a reverse complementary sequence of the first sequence and positioned in the same orientation as the first sequence, wherein the second sequence is positioned between the first sequence and the third sequence, and the second sequence is operably linked to the first sequence and the third sequence.

[0186] The disclosed sequences can be used to construct various Ntntp2 polynucleotides that do not form hairpin structures.For example, double-stranded RNA can be formed by (1) transcribing the first strand of DNA by operably linking with a first promoter, and (2) transcribing the reverse complementary sequence of the first strand of the DNA fragment by operably linking with a second promoter.Each strand of the polynucleotide can be transcribed from the same expression vector or from different expression vectors.The RNA duplex with RNA interference can be enzymatically converted into siRNA to regulate RNA levels.

[0187] Thus, various embodiments are directed to expression vectors comprising one or more Ntntp2 polynucleotides or interfering RNA constructs described herein that encode an interfering RNA polynucleotide capable of self-annealing, wherein the construct comprises (a) one or more Ntntp2 polynucleotides described herein and (b) a second sequence that comprises a complementary (e.g., reverse complementary) sequence of the first sequence and is positioned in the same orientation as the first sequence.

[0188] Various compositions and methods are provided for modulating the endogenous expression levels of one or more of the NtNTP2 polypeptides described herein (or any combination thereof as described herein) by promoting co-suppression of gene expression.

[0189] Various compositions and methods are provided for regulating endogenous gene expression levels by regulating mRNA translation. Host plant cells can be transformed with an expression vector comprising a promoter operably linked to an Ntntp2 polynucleotide, the promoter being positioned in an antisense orientation relative to the promoter that enables expression of an RNA polynucleotide having a sequence complementary to a portion of the mRNA.

[0190] Various expression vectors for regulating mRNA translation can include a promoter operably linked to the Ntntp2 polynucleotide, where the sequence is positioned in an antisense orientation relative to the promoter. The length of the antisense RNA polynucleotide can vary and can be about 15-20 nucleotides, about 20-30 nucleotides, about 30-50 nucleotides, about 50-75 nucleotides, about 75-100 nucleotides, about 100-150 nucleotides, about 150-200 nucleotides, and about 200-300 nucleotides.

[0191] Alternatively, genes can be targeted for inactivation by introducing transposons (e.g., IS elements) into the genome of the target plant. These mobile genetic elements can be introduced by sexual cross-fertilization, and insertion mutants can be screened for loss of polypeptide function. The disrupted genes in the parent plant can be introduced into other plants by crossing the parent plant with a plant that has not been subjected to transposon-induced mutagenesis, for example, by sexual cross-fertilization. Any standard breeding technique known to those skilled in the art can be utilized. In one embodiment, one or more genes can be inactivated by inserting one or more transposons. Mutations can result in homozygous disruption of one or more genes, heterozygous disruption of one or more genes, or a combination of both homozygous and heterozygous disruption when multiple genes are disrupted. Suitable transposable elements include retrotransposons, retroposons, and SINE-like elements. Such methods are known to those skilled in the art.

[0192] Alternatively, genes can be targeted for inactivation by introducing into plants ribozymes derived from a number of small circular RNAs capable of self-cleavage and replication. These RNAs can replicate either alone (viroid RNA) or together with helper viruses (satellite RNA). Examples of suitable RNAs include those derived from avocado sunblotch viroid, as well as satellite RNAs derived from tobacco ringspot virus, lucerne transient streak virus, velvet tobacco mottle virus, nightshade mottle virus, and subterranean clover mottle virus. A variety of target RNA-specific ribozymes are known to those skilled in the art.

[0193] A mutant or non-naturally occurring plant or plant cell can have any combination of one or more mutations in one or more genes that result in the modulation of the expression, function, or activity of those genes or their gene products. For example, a mutant or non-naturally occurring plant or plant cell can have a single mutation in a single gene, multiple mutations in a single gene, a single mutation in two or more, three or more, or four or more genes, or multiple mutations in two or more, three or more, or four or more genes. Examples of such mutations are described herein. As a further example, a mutant or non-naturally occurring plant or plant cell can have one or more mutations in a specific portion of the Ntntp2 gene, such as in a region of the gene encoding the active site of an Ntntp2 polypeptide or a portion thereof. As a further example, a mutant or non-naturally occurring plant or plant cell can have one or more mutations in a region outside one or more Ntntp2 genes, for example, in a region upstream or downstream of the gene it controls if the function or expression of the Ntntp2 gene is modulated. The upstream element can include a promoter, enhancer, or transcription factor. Some elements, such as enhancers, can be located upstream or downstream of the gene they regulate. Elements have been found to be located hundreds of thousands of base pairs upstream or downstream of the gene they regulate, so they do not need to be located near the gene they regulate. Mutant or non-naturally occurring plants or plant cells can have one or more mutations located within the first 100 nucleotides of a gene, the first 200 nucleotides of a gene, the first 300 nucleotides of a gene, the first 400 nucleotides of a gene, the first 500 nucleotides of a gene, the first 600 nucleotides of a gene, the first 700 nucleotides of a gene, the first 800 nucleotides of a gene, the first 900 nucleotides of a gene, the first 1000 nucleotides of a gene, the first 1100 nucleotides of a gene, the first 1200 nucleotides of a gene, the first 1300 nucleotides of a gene, the first 1400 nucleotides of a gene, or the first 1500 nucleotides of a gene.The mutant or non-naturally occurring plant or plant cell can have one or more mutations located within the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, or fifteenth set of 100 nucleotides of the gene, or a combination thereof. Disclosed are mutant or non-naturally occurring plants or plant cells (such as mutant, non-naturally occurring, or transgenic plants or plant cells described herein) that comprise mutant NtNTP2 polypeptides.

[0194] In one embodiment, seeds from the plant are mutagenized and then grown into first-generation mutant plants. The first-generation plants are then self-pollinated, and seeds from the first-generation plants are grown into second-generation plants and then screened for mutations at those loci. While mutagenized plant material can be screened for mutations, the advantage of screening second-generation plants is that all somatic mutations correspond to germline mutations. Those skilled in the art will understand that a variety of plant materials, including but not limited to seeds, pollen, plant tissues, or plant cells, can be mutagenized to create mutant plants. However, the type of mutagenized plant material can affect the screening of plant polynucleotides for mutations. For example, if pollen is subjected to mutagenesis before pollination of a non-mutagenized plant, the seeds resulting from that pollination will grow into first-generation plants. All cells of the first-generation plants will contain the mutations created in the pollen, and therefore these first-generation plants can then be screened for mutations without waiting until the second generation.

[0195] Ntntp2 polynucleotides prepared from individual plants, plant cells, or plant materials can optionally be pooled to facilitate screening for mutations in a population of plants derived from the mutagenized plant tissues, cells, or materials. One or more subsequent generations of plants, plant cells, or plant materials can be screened. The size of the optionally pooled population depends on the sensitivity of the screening method used.

[0196] After the samples are optionally pooled, they can be subjected to Ntntp2 polynucleotide-specific amplification techniques, such as PCR. Any one or more primers or probes specific to the Ntntp2 gene or sequences immediately adjacent to the Ntntp2 gene can be used to amplify sequences within the optionally pooled samples. Preferably, one or more primers or probes are designed to amplify the region of the locus where beneficial mutations are most likely to occur. Most preferably, primers are designed to detect mutations within the region of the Ntntp2 polynucleotide. Additionally, primers and probes preferably avoid known polymorphic sites to facilitate screening for point mutations. To facilitate detection of the amplification product, one or more primers or probes can be labeled using any conventional labeling method. Primers or probes can be designed based on the sequences described herein using methods well understood in the art.

[0197] To facilitate detection of the amplification products, primers or probes may be labeled using any conventional labeling method, which may be designed based on the sequences described herein using methods well understood in the art.

[0198] Polymorphisms can be identified by means known in the art, several of which are described in the literature.

[0199] In some embodiments, plants may be regenerated or grown from plants, plant tissues, or plant cells. Any suitable method for regenerating or cultivating plants from plant cells or plant tissues can be used, including, but not limited to, tissue culture or regeneration from protoplasts. Preferably, plants can be regenerated by cultivating transformed plant cells on callus induction medium, shoot induction medium, and / or root induction medium. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants are then grown and pollinated with either the same transformed line or a different line, and the resulting hybrids with expression of the desired phenotypic characteristics are identified. Two or more generations are cultivated to ensure that the expression of the desired phenotypic characteristics is stably maintained and inherited, and then the seeds are harvested to ensure that the expression of the desired phenotypic characteristics is achieved. Therefore, as used herein, "transformed seeds" refers to seeds containing a nucleotide construct stably integrated into the plant genome.

[0200] Thus, in a further aspect, a method for preparing a mutant plant is provided. The method includes providing at least one cell of a plant containing an Ntntp2 gene encoding a functional NtNTP2 polypeptide. Then, the at least one cell of the plant is treated under conditions effective to modulate (reduce) the function of an Ntntp2 polynucleotide described herein. The at least one cell of the mutant plant is then grown in a mutant plant, where the mutant plant has a modulated (reduced or suppressed) level of NtNTP2 polypeptide compared to that of a control plant. In one embodiment of this method for producing a mutant plant, the treating step involves subjecting at least one cell to a chemical mutagen, as described above, and under conditions effective to obtain at least one mutant plant cell. In another embodiment of this method, the treating step involves subjecting at least one cell to a radiation source under conditions effective to obtain at least one mutant plant cell. The term "mutant plant" includes mutant plants whose genotype is altered compared to a control plant, preferably by means other than genetic engineering or genetic modification.

[0201] In certain embodiments, a mutant plant, mutant plant cell, or mutant plant material can contain one or more mutations that naturally occur in another plant, plant cell, or plant material and confer a desired trait. This mutation can be incorporated (e.g., introgressed) into another plant, plant cell, or plant material (e.g., a plant, plant cell, or plant material having a different genetic background than the plant from which the mutation originated) to confer the trait thereto. Thus, by way of example, a naturally occurring mutation in a first plant can be introduced into a second plant (e.g., a second plant having a different genetic background than the first plant). Thus, one skilled in the art can search for and identify plants that naturally harbor one or more mutant alleles of the genes described herein in their genome that confer a desired trait. Naturally occurring mutant alleles can be transferred into a second plant by a variety of methods, including breeding, backcrossing, and introgression, to produce a line, variety, or hybrid having one or more mutations in the genes described herein. The same technique can be applied to the introgression of one or more non-naturally occurring mutations from a first plant to a second plant. Plants exhibiting desired traits can be screened out from a pool of mutant plants. Preferably, selection is performed using knowledge of the Ntntp2 polynucleotide described herein. Consequently, screening for genetic characteristics compared to a control is possible. Such screening procedures may involve the application of conventional amplification and / or hybridization techniques as discussed herein. Accordingly, a further aspect of the present disclosure relates to a method for identifying a mutant plant, the method comprising the steps of (a) providing a sample containing an Ntntp2 polynucleotide from a plant; and (b) determining the Ntntp2 polynucleotide sequence, wherein a difference in the sequence of the Ntntp2 polynucleotide compared to the Ntntp2 polynucleotide of a control plant indicates that the plant is a mutant plant.In another aspect, there is provided a method for identifying mutant plants that (i) do not have reduced nitrate levels compared to control plants grown under the same fertilization conditions, (ii) have increased biomass compared to control plants grown under the same fertilization conditions, and (iii) have increased NUE response compared to control plants grown under the same fertilization conditions, the method comprising: (a) providing a sample from the plant to be screened; (b) determining whether the sample contains one or more mutations in one or more of the Ntntp2 polynucleotides described herein; and (c) determining the nitrate levels, biomass, and NUE response compared to control plants grown under the same fertilization conditions.

[0202] In another aspect, a method is provided for preparing a mutant plant having (i) no reduced nitrate levels compared to a control plant grown under the same fertilization conditions, (ii) increased biomass compared to a control plant grown under the same fertilization conditions, and (iii) an increased NUE response compared to a control plant grown under the same fertilization conditions, the method comprising: (a) providing a sample from a first plant; (b) determining whether the sample contains one or more mutations in one or more of the Ntntp2 polynucleotides described herein that result in (i) reduced nitrate levels compared to a control plant grown under the same fertilization conditions, (ii) increased biomass compared to a control plant grown under the same fertilization conditions, and (iii) an increased NUE response compared to a control plant grown under the same fertilization conditions; and (c) transferring the one or more mutations into a second plant. The mutant plant may also have increased root development compared to a control plant grown under the same fertilization conditions.

[0203] The mutation can be transferred to the second plant using various methods known in the art (e.g., by genetic engineering, genetic manipulation, introgression, plant breeding, backcrossing, etc.). In one embodiment, the first plant is a native plant. In one embodiment, the second plant has a different genetic background from the first plant.

[0204] In another aspect, a method is provided for preparing a mutant plant having (i) reduced nitrate levels compared to a control plant grown under the same fertilization conditions, (ii) increased biomass compared to a control plant grown under the same fertilization conditions, and (iii) an increased NUE response compared to a control plant grown under the same fertilization conditions, the method comprising: (a) providing a sample from a first plant; (b) determining whether the sample contains one or more mutations in one or more of the Ntntp2 polynucleotides described herein that result in reduced nitrate levels, increased biomass, and an increased NUE response compared to a control plant grown under the same fertilization conditions; and (c) introgressing the one or more mutations from the first plant into a second plant. The mutant plant may also have increased root development compared to a control plant grown under the same fertilization conditions. In one embodiment, the introgressing step comprises plant breeding, optionally including backcrossing, etc. In one embodiment, the first plant is a wild-type plant. In one embodiment, the second plant has a different genetic background from the first plant. In one embodiment, the first plant is not a cultivar or elite cultivar. In one embodiment, the second plant is a cultivar or elite cultivar.

[0205] A further aspect relates to mutant plants (including mutant plants of cultivars or elite cultivars) obtained or obtainable by the methods described herein. In certain embodiments, a "mutant plant" may have one or more mutations localized only to a particular region of the plant, such as within the sequence of one or more Ntntp2 polynucleotides described herein. In accordance with this embodiment, the remainder of the genomic sequence of the mutant plant will be the same or substantially the same as that of the plant prior to mutagenesis.

[0206] In certain embodiments, the mutant plant may have one or more mutations localized to multiple genomic regions of the plant, such as within the sequence of one or more Ntntp2 polynucleotides described herein and one or more additional regions of the genome, such that the remaining genomic sequence of the mutant plant will no longer be the same or substantially the same as that of the plant prior to mutagenesis. In certain embodiments, the mutant plant may not have one or more mutations in one or more, two or more, three or more, four or more, or five or more exons of the polynucleotides described herein; may not have one or more mutations in one or more, two or more, three or more, four or more, or five or more introns of the polynucleotides described herein; may not have one or more mutations in the promoter of the polynucleotides described herein; may not have one or more mutations in the 3' untranslated region of the polynucleotides described herein; may not have one or more mutations in the 5' untranslated region of the polynucleotides described herein; may not have one or more mutations in the coding region of the polynucleotides described herein; may not have one or more mutations in the non-coding region of the polynucleotides described herein; or any combination of two or more, three or more, four or more, five or more, or six or more of these portions.

[0207] In a further aspect, there is provided a method for identifying plants, plant cells, or plant materials containing mutations in a gene encoding an Ntntp2 polynucleotide described herein, comprising: (a) subjecting a plant, plant cell, or plant material to mutagenesis; (b) obtaining a sample from said plant, plant cell, or plant material, or progeny thereof; and (c) determining the polynucleotide sequence of the Ntntp2 gene or a variant or fragment thereof, wherein said sequence differences indicate one or more mutations therein. This method also allows for the selection of plants having mutations occurring in genomic regions that affect expression of the Ntntp2 gene in plant cells, such as the transcription start site, start codon, intronic region, exon-intron boundary, terminator, or stop codon.

[0208] The mutant, non-native, or transgenic plants or portions thereof according to the present disclosure have an advantageous phenotype in which there is no significant difference in nitrate levels compared to control plants grown under the same fertilization conditions, the leaf biomass yield is higher compared to control plants grown under the same fertilization conditions, and the NUE of the plants is higher compared to control plants grown under the same fertilization conditions. The morphological difference observed between the mutant, non-native, or transgenic plants compared to the control is increased root development compared to control plants grown under the same fertilization conditions.

[0209] No significant differences in nitrate levels (in the dry leaf blades and midribs from mid-stem leaves) were observed between -S and -T mutant, non-native, or transgenic plants compared to controls. Therefore, reducing the activity of both -S and -T forms of NtNTP2 is not expected to have a significant effect on nitrate levels.

[0210] The mutant, non-naturally occurring, or transgenic plant or part thereof according to the present disclosure produces more biomass (e.g., leaf biomass) compared to a control. Preferably, the leaf biomass is green, dried, or dried-processed, more preferably green. The increase in biomass can be at least about 5%, at least about 9%, at least about 10%, at least about 13%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 26%, at least about 27%, at least about 28%, at least about 29%, at least about 30%, at least about 31%, at least about 34%, at least about 35%, at least about 36%, or at least about 37% or more compared to a control grown under the same conditions. The amount of biomass produced can be greater under a nitrogen starvation regime compared to a standard fertilization regime. For example, under a standard fertilization regime or a nitrogen starvation regime, the increase in biomass can be at least about 5% or more compared to a control grown under the same conditions. In one embodiment, the increase in biomass under nitrogen starvation conditions is at least about 28% compared to a control grown under the same conditions. Thus, loss of NtNTP2 activity results in improved yield under different nitrogen regimes.

[0211] The NUE index (i.e., units of biomass (expressed as kilograms per hectare, assuming a plant population of 12,000 plants per hectare) produced per unit of nitrogen fertilization (expressed as kilograms of nitrogen per hectare)) determined for a mutant, non-native or transgenic plant or portion thereof according to the present disclosure when grown under nitrogen-deficient conditions can be increased by at least about 5%, at least about 9%, at least about 10%, at least about 13%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 21%, or at least about 22% or more compared to a control. Under standard fertilization regimes, the NUE index can be increased by at least about 5%, at least about 9%, at least about 10%, at least about 13%, or at least about 14%, at least about 20%, at least about 25%, or at least about 28% or more compared to a control grown under the same conditions. In one embodiment, the increase in the NUE index under nitrogen starvation conditions is at least about 28% compared to a control grown under the same conditions. Thus, loss of NtNTP2 activity results in improved NUE under different nitrogen regimes. Thus, impairment of NTP2 protein activity can increase the plant's ability to adapt to nitrogen starvation, thereby increasing the plant's NUE, which is expressed as biomass per unit of applied nitrogen fertilization.

[0212] Thus, a mutant, non-naturally occurring, or transgenic plant or portion thereof according to the present disclosure has an advantageous phenotype, does not have a significantly different nitrate level compared to a control plant grown under the same fertilization conditions, and has a biomass yield that is at least about 5%, at least about 9%, at least about 10%, at least about 13%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 26%, at least about 27%, at least about 28%, at least about 30%, at least about 31%, at least about 32%, at least about 33%, at least about 34%, at least about 35%, at least about 36%, at least about 37%, at least about 38%, at least about 39%, at least about 40%, at least about 41%, at least about 42%, at least about 43%, at least about 44%, at least about 45%, at least about 46%, at least about 47%, at least about 48%, at least about 49%, at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, The plant's NUE is increased by at least about 5%, at least about 9%, at least about 10%, at least about 13%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 21%, or at least about 22% or more compared to a control. A mutant, non-native or transgenic plant or part thereof can have increased root development compared to a control plant grown under the same fertilization conditions.

[0213] In one embodiment, under standard fertilization conditions, a plant or plant part (e.g., a leaf) (i) has no reduced nitrate levels compared to a control plant grown under the same fertilization conditions, (ii) has at least a 5% increase in biomass compared to a control plant grown under the same fertilization conditions, and (iii) has at least a 5% increase in NUE response compared to a control plant grown under the same fertilization conditions. The plant or part thereof may have increased root development compared to a control plant grown under the same fertilization conditions.

[0214] In another embodiment, under nitrogen starvation conditions, the plant or plant part (e.g., leaf) (i) does not have reduced nitrate levels compared to a control plant grown under the same fertilization conditions, (ii) has at least a 5% increase in biomass compared to a control plant grown under the same fertilization conditions, and (iii) has at least a 5% increase in NUE response compared to a control plant grown under the same fertilization conditions. The plant or part thereof may have increased root development compared to a control plant grown under the same fertilization conditions.

[0215] In an embodiment, the phenotype varies depending on the fertilization. Thus, in one embodiment, under standard fertilization conditions, a plant or a part of a plant (e.g., a leaf) (i) does not have a reduced nitrate level compared to a control plant, (ii) has at least a 5% increase in biomass compared to a control plant, and (iii) has at least a 5% increase in NUE response compared to a control plant. In another embodiment, under nitrogen starvation conditions, a plant or a part of a plant (e.g., a leaf) (i) does not have a reduced nitrate level compared to a control plant, (ii) has at least a 5% increase in biomass compared to a control plant, and (iii) has at least a 5% increase in NUE response compared to a control plant. The plant or part thereof may have increased root development compared to a control plant grown under the same fertilization conditions.

[0216] Thus, the plants of the present disclosure can achieve increased yield with less fertilization, thus improving NUE. Less fertilization can be achieved with reduced TSNAs.

[0217] According to the present disclosure, "standard conditions" are 254 nitrogen units (1 unit expressed as kilograms per hectare) and "nitrogen-deficient conditions" are 55 nitrogen units (1 unit expressed as kilograms per hectare).

[0218] Plants according to the present disclosure include monocotyledonous and dicotyledonous plants and plant cell lines, including, but not limited to, species belonging to one of the following families: Acanthaceae, Alliaceae, Alstroemeriaceae, Amaryllidaceae, Apocynaceae, Arecaceae, Asteraceae, Berberidaceae, Bixaceae, Brassicaceae, Bromeliaceae, Cannabaceae, Caryophyllaceae, Cephalotaxaceae, Chenopodiaceae, Colchicaceae, Cucurbitaceae, eae, Dioscoreaceae, Ephedraceae, Erythroxylaceae, Euphorbiaceae, Fabaceae, Lamiaceae, Linaceae, Lycopodiaceae, Malvaceae, Melanthiaceae, Musaceae, Myrtac eae, Nyssaceae, Papaveraceae, Pinaceae, Plantaginaceae, Poaceae, Rosaceae, Rubiaceae, Salicaceae, Sapindaceae, Solanaceae, Taxaceae, Theaceae, or Vitaceae.

[0219] Abelmoschus, Abies, Acer, Agrostis, Allium, Alstroemeria, Ananas, Andrographis, Andropogon, Artemisia, Arundo, At clothing、Berberis、Beta、Bixa、Brassica、Calendula、Camellia、Camptotheca、Cannabis、Capsicum、Carthamus、Catharanthus、Cephal otaxus、Chrysanthemum、Cinchona、Citrullus、Coffea、Colchicum、Coleus、Cucumis、Cucurbit、Cynodon、Datura、Dianthus、Digit alis, Dioscorea, Elaeis, Ephedra, Erianthus, Erythroxylum, Eucalyptus, Festuca, Fragaria, Galanthus, Glycine, Gossypium, He lianthus, Hevea, Hordeum, Hyoscyamus, Jatropha, Lactuca, Linum, Lolium, Lupinus, Lycopersicon, Lycopodium, Manihot, Medicag o Mentha, Miscanthus, Musa, Nicotiana, Oryza, Panicum, Papaver, Parthenium, Pennisetum, Petunia, Phalaris, Phleum, Pinus, Po a.Poinsettia.Populus.Rauwolfia.Ricinus.Rosa.Saccharum.Salix.Sanguinaria.Scopolia.Secale.Solanum.Sorghum.Spartin a、Spinacea、Tanacetum、Taxus、Theobroma、Triticosecale、Trit icum, Uniola, Veratrum, Vinca, Vitis, and Zea.

[0220] Suitable species include Panicum spp., Sorghum spp., Miscanthus spp., Saccharum spp., Erianthus spp., Populus spp., Andropogon gerardii (low-grass grass), Pennisetum purpureum (cattail), Phalaris arundinacea (reed canary grass), Cynodon dactylon (horsetail grass), Festuca arundinacea (tall fescue), Spartina pectinata (prairie cordgrass), Medicago sativa (alfalfa), Arundo donax (bamboo), Secale cereale (rye), Salix spp. (willow), Eucalyptus spp. (eucalyptus), Triticosecale (threat thyme), bamboo, Helianthus annuus (sunflower), Carthamus tinctorius (safflower), Jatropha curcas (jatropha), Ricinus communis (castor bean), Elaeis guineensis (palm), Linum usitatissimum (flax), Brassica juncea, Beta vulgaris (sugar beet), Manihot esculenta (cassava), Lycopersicon esculentum (tomato), Lactuca sativa (lettuce), Musyclise alca (banana), Solanum tuberosum (potato), Brassica oleracea (broccoli, cauliflower, Brussels sprouts), Camellia sinensis (tea), Fragaria ananassa (strawberry), Theobroma cacao (cocoa), Coffea ycliseca (coffee), Vitis vinifera (grape), Ananas comosus (pineapple), Capsicum annum (chili peppers and sweet peppers), Allium cepa (onions), Cucumis melo (melons), Cucumis sativus (cucumbers), Cucurbita maxima (pumpkins), Cucurbita moschata (squash), Spinaceaoleracea (spinach), Citrullus lanatus (watermelon), Abelmoschus esculentus (okra), Solanum melongena (eggplant), Rosa spp. (rose), Dianthus caryophyllus (carnation), Petunia spp. (petunia), Poinsettia pulcherrima (poinsettia), Lupinus albus (lupine), Uniola paniculata (oats), bentgrass (Agrostis spp.), Populus tremuloides (poplar), Pinus spp. (pine), Abies spp. (fir), Acer spp. (maple), Hordeum vulgare (barley), Poa pratensis (bluegrass), Lolium spp. (rye), and Phleum pratense (timothy), Panicum virgatum (switchgrass), Sorghum virgatum (sorghum, sudangrass), Miscanthus giganteus (miscanthus), Saccharum species (energy cane), Populus balsamifera (poplar), Zea mays (corn), Glycine max (soybean), Brassica napus (canola), Triticum aestivum (wheat), Gossypium hirsutum (cotton), Oryza sativa (rice), Helianthus annuus (sunflower), Medicago sativa (alfalfa), Beta vulgaris (sugar beet), or Pennisetum glaucum (pearl millet).

[0221] Suitable species can include Nicotiana species, including N. rustica and N. tabacum (e.g., LA B21, LN KY171, TI 1406, Basma, Galpao, Perique, Beinhart 1000-1, and Petico).The rest of which is N. acaulis、N. acuminata、N. african、N. alata、N. ameghinoi、N. amplexicaulis、N.arentsii、N. attenuata、N. azambujae、N. benavidesii、N. benthamiana、N. bigelovii、N. bonariensis、N. cavicola、N. clevelandii、N. cordifolia、N. corymbosa、N. debneyi、N. excelsior、N. forgetiana、N. fragrance、N. glauca、N. glutinous、N. goodspeed、N. gossei、N. hybrid、N. ingulba、N. kawakamii、N. knightiana、N. langsdorffii、N. linearis、N. longiflora、N. maritima、N. megalosiphon、N. miersii、N. noctiflora、N. nudicaulis、N. obtusifolia、N. occidentalis、N. western is subsp. hesperis、N. otophora、N. paniculata、N. pauciflora、N. petunioides、N. plumbaginifolia、N. quadrivalvis、N. raimondii、N. repanda、N. rosulata、N. rosulata subsp. ingulba、N. rotundifolia、N. setchelli、N. simulans、N. solanifolia、N. spegazzinii、N. stocktonii、N. suaveolens、N. sylvestris、N. thyrsiflora、N. tomentosa、N. tomentosiformis、N. trigonophylla、N. umbratica、N. undulata、N. velutina, N. wigandioides, Nx sanderae, and other specimens of N. wigandioides. tobaccoである。

[0222] The use of tobacco cultivars and elite tobacco cultivars is also contemplated herein. Thus, a transgenic, non-natural, or mutant plant can be a tobacco cultivar or elite tobacco cultivar that contains one or more introduced genes, or one or more genetic mutations, or a combination thereof. The genetic mutations (e.g., one or more polymorphisms) can be mutations that do not naturally occur in a particular tobacco cultivar or cultivar (e.g., elite tobacco cultivar), or can be genetic mutations that occur naturally, provided that the mutations do not naturally occur in a particular tobacco cultivar or cultivar (e.g., elite tobacco cultivar).

[0223] Particularly useful N. tabacum varieties include burley-type, dark-type, flue-cured-type, and orient-type tobaccos. Non-limiting examples of varieties or cultivars include BD 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CD 263, DF911, DT 538 LC Galpao tobacco, GL 26H, GL 350, GL 600, GL 737, GL 939, GL 973, HB 04P, HB 04P LC, HB3307PLC, Hybrid 403LC, Hybrid 404LC, Hybrid 501 LC, K 149, K 326, K 346, K 358, K394, K 399, K 730, KDH 959, KT 200, KT204LC, KY10, KY14, KY 160, KY 17, KY 171, KY 907, KY907LC, KY14xL8 LC, Little Crittenden, McNair 373, McNair 944, msKY 14xL8, Narrow Leaf Madole, Narrow Leaf Madole LC, NBH 98, N-126, N-777LC, N-7371LC, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC7, NC 606, NC 71, NC 72, NC 810, NC BH 129, NC 2002, Neal Smith Madole, OXFORD 207, PD 7302 LC, PD 7309 LC, PD 7312 LC, "Perique" cigarettes, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H51, RGH 4, RGH 51, RS 1410, Speight 168, Speight 172, Speight 179, Speight 210, Speight 220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight G-70, SpeightH-6, Speight H20, Speight NF3, TI 1406, TI 1269, TN 86, TN86LC, TN 90, TN 97, TN97LC, TN D94, TN D950, TR(Tom Rosson)Madole, VA 309, VA359, AA 37-1, B13P, Xanthi(Mitchell-Mor), Bel-W3, 79-615, Samsun Holmes NN, KTRDC2, KTRDC2, PO3, RG11, KY8959, KY9, MD 609, PG01, PG04, PO1, PO2, PO3, RG11, RG 8. VA509 81, DVH 405, Galpao Comum, HB04P, Hicks Broadleaf, Kabakulak Elassona, Kutsage E1, LA BU 21, NC 2326, NC 297, PVH 2110, Red Russian, Samsun, Saplak, Simmaba, Talgar 28, Wislica, Yayaldag, Prilep HC-72, Prilep P23, Prilep PB 156 / 1, Prilep P12-2 / 1, Yaka JK-48, Yaka JB 125 / 3、TI-1068、KDH-960、TI-1070、TW136、Basma、TKF 4028、L8、TKF 2002、GR141、Basma xanthi、GR149、GR153、Petit Havana is a nice place to stay with a lot of snow (low converter) is a selection.

[0224] Embodiments are also directed to compositions and methods for generating mutant, non-naturally occurring, hybrid, or transgenic plants that have been modified to regulate the expression or function of the Ntntp2 polynucleotides described herein (or any combination thereof as described herein). Advantageously, the resulting mutant, non-naturally occurring, hybrid, or transgenic plants can be similar or substantially identical to the control plant in overall appearance. Various phenotypic characteristics, such as the degree of maturity, number of leaves per plant, stalk height, leaf insertion angle, leaf size (width and length), internode distance, and blade-to-midrib ratio, can be assessed by field observation.

[0225] One aspect relates to seeds of the mutant, non-naturally occurring, hybrid, or transgenic plants described herein. A further aspect relates to pollen or ovules of the mutant, non-naturally occurring, hybrid, or transgenic plants described herein. Additionally, mutant, non-naturally occurring, hybrid, or transgenic plants described herein are provided that further comprise a polynucleotide that confers male sterility. Also provided are tissue cultures of regenerable cells of the mutant, non-naturally occurring, hybrid, or transgenic plants described herein, or parts thereof, which cultures regenerate plants capable of expressing all of the morphological and physiological characteristics of the parent. Regenerable cells include cells from leaves, pollen, embryos, cotyledons, hypocotyls, roots, root tips, anthers, flowers and their parts, ovules, shoots, stems, stalks, pith, and capsules, or callus or protoplasts derived therefrom.

[0226] Mutant, non-naturally occurring, or transgenic plant leaves or plant leaf portions obtained according to the present disclosure may be similar or substantially identical in visual appearance to corresponding control plant leaves or plant leaf portions. In one embodiment, the leaf number is substantially the same as the control. In another embodiment, the chlorophyll content is substantially the same as a control plant grown under the same fertilization conditions. In other embodiments, the leaf size, morphology, number, or color is substantially the same as a control plant grown under the same fertilization conditions.

[0227] The polynucleotides and recombinant constructs described herein can be used to modulate the expression or function or activity of an Ntntp2 polynucleotide or NtNTP2 polypeptide described herein.

[0228] Plants carrying mutant alleles of one or more Ntntp2 polynucleotides described herein (or any combination thereof as described herein) can be used in plant breeding programs to generate useful lines, varieties, and hybrids containing leaves of desirable genotypes and phenotypes. In particular, mutant alleles are introgressed into commercially important varieties as described above. Accordingly, provided are plant breeding methods that include crossing a mutant, non-native, or transgenic plant described herein with a plant containing a different genetic identity. The method may further include crossing the progeny plant with another plant, and, optionally, repeating the crossing until progeny have the desired genotype and phenotype. One goal served by such breeding methods is to introduce desirable genetic traits into other varieties, breeding lines, hybrids, or cultivars, particularly those of commercial interest. Another goal is to facilitate stacking genetic modifications of different genes in a single plant variety, line, hybrid, or cultivar. Intraspecific as well as interspecific crosses are contemplated. The progeny plants resulting from such crosses are also referred to as breeding lines and are examples of the disclosed non-naturally occurring plants.

[0229] In one embodiment, a method for producing a non-naturally occurring plant is provided, comprising: (a) crossing a mutant or transgenic plant with a second plant to obtain progeny tobacco seeds; and (b) cultivating the progeny tobacco seeds under plant cultivation conditions to obtain a non-naturally occurring plant. The method may further comprise: (c) crossing the previous generation non-naturally occurring plant with itself or another plant to obtain progeny tobacco seeds; and (d) cultivating the progeny tobacco seeds of step (c) under plant cultivation conditions to obtain additional non-naturally occurring plants; and repeating the crossing and cultivating steps of (c) and (d) multiple times to generate additional generations of the non-naturally occurring plant. The method may optionally comprise, prior to step (a), providing a parent plant that comprises a characterized genetic identity and is not identical to the mutant or transgenic plant. In some embodiments, depending on the breeding program, the crossing and growing steps are repeated 0-2, 0-3, 0-4, 0-5, 0-6, 0-7, 0-8, 0-9, or 0-10 times to generate generations of the non-naturally occurring plant. Backcrossing is an example of such a method in which the progeny is crossed with one of the parents or another plant genetically similar to that parent to obtain a next-generation progeny plant with a genetic identity closer to that of one of the parents. Plant breeding, particularly plant breeding techniques, are well known and can be used in the disclosed methods. The present disclosure further provides non-naturally occurring plants produced by these methods. Certain embodiments exclude the step of selecting the plant. Preferably, leaves or leaf portions are harvested from the produced plants.

[0230] In some embodiments of the methods described herein, lines resulting from breeding and screening for variant Ntntp2 genes are evaluated in the field using standard field procedures. Control genotypes, including the original, unmutagenized parent, are included, and entries are arranged in the field in a randomized complete block design or other suitable field design. For tobacco, standard agronomic methods are used, for example, the tobacco is harvested, weighed, and sampled for chemical and other general testing before and during curing. Statistical analysis of the data is performed to confirm the similarity of the selected lines to the parent lines. Cytogenetic analysis of the selected plants is optionally performed to confirm chromosome complement and chromosome pairing relationships.

[0231] DNA fingerprinting, single nucleotide polymorphism, microsatellite markers, or similar techniques can be used in marker-assisted selection (MAS) breeding programs to introgress or breed mutant alleles of the Ntntp2 gene into other tobacco plants, as described herein. For example, breeders can create segregating populations from hybridization of genotypes containing the mutant Ntntp2 allele of interest with agronomically desirable genotypes. F2 or backcross generation plants can be screened using markers developed from the genomic sequence or a fragment thereof using one of the techniques listed herein. Plants identified as carrying the mutant Ntntp2 allele can be backcrossed or self-pollinated to create a second population to be screened. Depending on the expected inheritance pattern, it may be necessary to self-pollinated selected plants before each backcross cycle to help identify the desired individual plants. Backcrossing or other breeding procedures can be repeated until the desired phenotype of the recurrent parent is restored.

[0232] According to the present disclosure, in a breeding program, successful crosses produce fertile F1 plants. The selected F1 plants can be crossed with one of the parents, and the first backcross generation plants are self-pollinated to produce a population that is again screened for variant Ntntp2 gene expression (e.g., a null version of the gene). The backcross, self-pollination, and screening process is repeated, for example, at least four times until the final screening produces a plant that is fertile and reasonably similar to the recurrent parent. If desired, the plant is self-pollinated, and then the progeny is again screened to confirm that the plant exhibits variant Ntntp2 gene expression. In some embodiments, the F2 generation plant population is screened for variant Ntntp2 gene expression, and plants that do not express NtNTP2 polypeptide due to a defect in the Ntntp2 gene are identified, e.g., according to standard methods, e.g., by using PCR methods with primers based on polynucleotide sequence information for the Ntntp2 polynucleotides described herein (or any combination thereof described herein).

[0233] Hybrid tobacco varieties can be produced by preventing self-pollination of a female parent plant (i.e., seed parent) of a first variety and allowing pollen from a male parent plant of a second variety to fertilize the female parent plant, resulting in the formation of F1 hybrid seeds in the female plant. Self-pollination of female plants can be prevented by removing the stamens of flowers at an early stage of flower development. Alternatively, pollen formation can be prevented in female parent plants using the formation of male sterility. For example, male sterility can be produced by cytoplasmic male sterility (CMS) or transgenic male sterility, where a transgene suppresses microspore production and / or pollen formation, or self-incompatibility. Female parent plants containing CMS are particularly useful. In embodiments where the female parent plant is CMS, pollen is harvested from a male fertile plant and manually applied to the stigma of a CMS female parent plant, and the resulting F1 seeds are harvested.

[0234] The varieties and lines described herein can be used to form single-cross tobacco F1 hybrids. In such embodiments, plants of the parent varieties can be grown as a substantially homogeneous, adjacent population to promote natural cross-pollination from the male parent plants to the female parent plants. The F1 seeds formed in the female parent plants can be selectively harvested by conventional means. Two parent plant varieties can also be grown in large quantities, and a blend of F1 hybrid seeds formed in the female parent and seeds formed in the male parent as a result of self-pollination can be harvested. Alternatively, a three-way cross can be performed, in which a single-cross F1 hybrid is used as the female parent and crossed with a different male parent. As another alternative, a double-cross hybrid can be created, in which the F1 progeny of two different single crosses are crossed with themselves.

[0235] A population of mutant, non-naturally occurring, or transgenic plants can be screened or selected for those members of the population that have the desired trait or phenotype. For example, a population of progeny from a single transformation event can be screened for those plants that have the desired level of expression or function of the NtNTP2 polypeptide encoded thereby. Physical and biochemical methods can be used to identify expression or activity levels. These include Southern analysis or PCR amplification for detecting polynucleotides; Northern blots, S1 RNase protection, primer extension, or RT-PCR amplification for detecting RNA transcripts; enzymatic assays for detecting enzyme or ribozyme activity of polypeptides and polynucleotides; and polypeptide gel electrophoresis, Western blots, immunoprecipitation, and enzyme immunoassays for detecting polypeptides. Other techniques, such as in situ hybridization, enzyme staining, and immunostaining and enzyme assays, can also be used to detect the presence or expression, function, or activity of NtNTP2 polypeptides or Ntntp2 polynucleotides.

[0236] Described herein are mutant, non-native, or transgenic plant cells and plants that contain one or more recombinant Ntntp2 polynucleotides, one or more Ntntp2 polynucleotide constructs, one or more double-stranded RNAs, one or more conjugates, or one or more vectors / expression vectors.

[0237] One or more of the following additional genetic modifications may be present in a mutant, non-native, or transgenic plant leaf or portion of a plant leaf:

[0238] One or more genes involved in the conversion of nitrogenous metabolic intermediates can be modified to result in reduced levels of at least one tobacco-specific nitrosamine (TSNA). Non-limiting examples of such genes include those encoding nicotine demethylases such as CYP82E4, CYP82E5, and CYP82E10, as described in WO2006 / 091194, WO2008 / 070274, WO2009 / 064771, and WO2011 / 088180, and nitrate reductases as described in WO2016046288.

[0239] One or more genes involved in the uptake or transport of heavy metals can be modified to reduce heavy metal content. Non-limiting examples include genes in the family of polypeptides associated with multidrug resistance, the family of cation diffusion facilitators (CDFs), the family of Zrt-Irt-like polypeptides (ZIPs), the family of cation exchangers (CAXs), the family of copper transporters (COPTs), the family of heavy metal ATPases (e.g., HMAs described in WO2009 / 074325 and WO2017 / 129739), the family of macrophage polypeptides related to natural resistance (NRAMPs), and other members of the ATP-binding cassette (ABC) transporter family (e.g., MRPs) described in WO2012 / 028309, which are involved in the transport of heavy metals such as cadmium.

[0240] Another exemplary modification can result in plants with regulated expression or function of isopropylmalate synthase, resulting in changes in sucrose ester composition that can be used to alter the beneficial profile (see WO2013029799).

[0241] Another exemplary modification can result in a plant with regulated expression or function of threonine synthase, such that the level of methionine can be regulated (see WO2013029800).

[0242] Other exemplary modifications can result in plants with regulated expression or function of one or more of neoxanthin synthase, lycopene beta cyclase, and 9-cis-epoxycarotenoid dioxygenase to modulate beta-damascenone content and alter the scent profile (see WO2013064499).

[0243] Another exemplary modification may result in plants having regulated expression or function of members of the CLC family of chloride channels that regulate nitrate levels therein (see WO2014096283 and WO2015197727).

[0244] Other exemplary modifications can result in plants in which the expression or function of one or more asparagine synthetases is modulated to regulate the level of asparagine in the leaves and the level of acrylamide in the aerosol produced upon heating or burning of the leaves (see WO2017042162).

[0245] Other examples of modifications include modulating herbicide tolerance; for example, glyphosate is the active ingredient in numerous broad-spectrum herbicides. Glyphosate-tolerant transgenic plants have been developed by transferring the aroA gene (glyphosate EPSP synthase from Salmonella typhimurium and E. coli). Sulfonylurea-tolerant plants have been produced by transforming mutant ALS (acetolactate synthase) genes from Arabidopsis. Mutant photosystem II OB polypeptides from Amaranthus hybridus have been transferred to plants to produce atrazine-tolerant transgenic plants, and bromoxynil-tolerant transgenic plants have been produced by incorporating the bxn gene from Klebsiella pneumoniae bacteria.

[0246] Another exemplary modification results in plants that are resistant to insects. Bacillus thuringiensis (Bt) toxins can provide an effective method for delaying the emergence of Bt-resistant pests, as recently demonstrated in broccoli, where the cry1Ac and cry1C Bt genes in cones controlled diamondback moths resistant to either single polypeptide, significantly slowing the evolution of resistant insects.

[0247] Another exemplary modification results in plants that are resistant to diseases caused by pathogens (e.g., viruses, bacteria, fungi). Plants expressing the Xa21 gene (resistance to bacterial leaf spot) have been engineered along with plants expressing both a Bt fusion gene and a chitinase gene (resistance to yellow stem borer and pod disease).

[0248] Another exemplary modification results in altered fertility, such as male sterility.

[0249] Another exemplary modification results in plants that are tolerant to abiotic stresses (e.g., drought, temperature, salinity); tolerant transgenic plants have been created by transferring acylglycerol phosphate enzymes from Arabidopsis, genes encoding mannitol dehydrogenase and sorbitol dehydrogenase, involved in the synthesis of mannitol and sorbitol, improving tolerance to drought.

[0250] Another exemplary modification results in a plant in which the activity of one or more endogenous glycosyltransferases (e.g., N-acetylglucosaminyltransferase, β(1,2)-xylosyltransferase, and α(1,3)-fucosyltransferase) is modulated (see WO / 2011 / 117249).

[0251] Another exemplary modification results in a plant in which the activity of one or more nicotine N-demethylases is modulated so that the levels of nornicotine and nornicotine metabolites formed during the drying process can be controlled (see WO2015169927).

[0252] Other exemplary modifications can result in plants with improved polypeptide and oil storage capacity, increased photosynthetic efficiency, extended shelf life, increased carbohydrate content, and fungal resistance. Also contemplated are transgenic plants with modulated expression of S-adenosyl-L-methionine (SAM) and / or cystathionine gamma synthase (CGS).

[0253] One or more genes involved in the nicotine synthesis pathway can be modified to result in a plant or plant part that has regulated nicotine levels when subjected to a curing process. The nicotine synthesis genes can be selected from the group consisting of A622, BBLa, BBLb, JRE5L1, JRE5L2, MATE1, MATE2, MPO1, MPO2, MYC2a, MYC2b, NBBl, nic1, nic2, NUP1, NUP2, PMT1, PMT2, PMT3, PMT4, and QPT, or one or more combinations thereof.

[0254] One or more genes involved in regulating the amount of one or more alkaloids can be modified to result in a plant or plant part that produces regulated levels of alkaloids. The alkaloid level regulating genes can be selected from the group consisting of BBLa, BBLb, JRE5L1, JRE5L2, MATE1, MATE2, MYC2a, MYC2b, nic1, nic2, NUP1 and NUP2, or a combination of two or more thereof.

[0255] Leaf material, such as the lamina and midrib, can be incorporated into or used in the manufacture of various consumable products, including, but not limited to, aerosol-forming materials, aerosol-forming devices, smoking articles, smokable articles, smokeless products, medical or cosmetic products, intravenous preparations, tablets, powders, and tobacco products. Examples of aerosol-forming materials include tobacco compositions, tobacco, tobacco extracts, cut tobacco, cut fillers, flue-cured tobacco, expanded tobacco, homogenized tobacco, reconstituted tobacco, and pipe tobacco. Smoking articles and smokable articles are types of aerosol-forming devices. Examples of smoking articles or smokable articles include cigarettes, cigarillos, and cigars. Examples of smokeless products include chewing tobacco and snuff. In certain aerosol-forming devices, rather than combustion, the tobacco composition or another aerosol-forming material is heated by one or more electric heating elements to produce an aerosol. In another type of heated aerosol-forming device, the aerosol is produced by the transfer of heat from a combustible fuel element or heat source to a physically separated aerosol-forming material that may be located within, around, or downstream of the heat source. Smokeless tobacco products and various tobacco-containing aerosol-forming materials may contain tobacco in any form, including dry particles, pieces, granules, powders, or slurries, as well as deposited on, mixed with, surrounded by, or combined with other components in any form, such as flakes, films, tabs, foams, or beads. As used herein, the term "smoke" is used to describe the type of aerosol produced by a smoking article, such as a cigarette, or by burning an aerosol-forming material.

[0256] In one example, leaf material, such as the blades and midribs, may be processed according to the method described in U.S. Patent Application Publication No. 20190142058A1, which prepares a cast sheet of homogenized tobacco material by pulping the cellulose fibers with water, grinding a tobacco blend of one or more tobacco types into tobacco particles, combining the pulped cellulose fibers with the tobacco particles and a binder to form a slurry, homogenizing the slurry, casting the slurry to form a cast sheet of homogenized tobacco material from the slurry, discarding the undesired portion of the cast sheet, and introducing the discarded undesired portion of the cast sheet into the slurry. Thus, leaf material, such as the blades and midribs, can be combined with binders such as natural pectins (such as fruit pectins, citrus pectins, or tobacco pectins), guar gums (such as hydroxyethyl guar and hydroxypropyl guar), locust bean gums (such as hydroxyethyl locust bean gum and hydroxypropyl locust bean gum), alginates, starches (such as modified or derivatized starches), celluloses (such as methylcellulose, ethyl cellulose, ethylhydroxymethylcellulose, carboxymethylcellulose), tamarind gum, dextran, puralon, konjac flour, xanthan gum, and the like. Thus, tobacco material can include the leaf material and binders described herein. In one embodiment, cured plant leaf material is also provided. Processes for curing green tobacco leaves are known to those skilled in the art and include, but are not limited to, air drying, flame drying, hot air drying, and sun drying, as described herein.

[0257] In another embodiment, a tobacco product is described that includes a tobacco-containing aerosol-forming material, including plant leaf material, preferably cured leaf. The tobacco product described herein can be a blended tobacco product, which can further include unmodified tobacco.

[0258] Mutant, non-native, or transgenic plant leaves or plant leaf portions may have other uses, for example, in agriculture. For example, the mutant, non-native, or transgenic plant leaves or plant leaf portions described herein can be used to produce animal feed and human food.

[0259] The present disclosure also provides a method for producing seeds, including cultivating a mutant plant, a non-natural plant, or a transgenic plant described herein and collecting seeds from the cultivated plant.Seeds from the plants described herein can be prepared by means known in the art and packaged in packaging material to form an article of manufacture.Packaging materials such as paper and cloth are well known in the art.The seed package has a label, for example, a tag or label fixed to the packaging material, and a label describing the nature of the seeds therein is printed on the package.

[0260] Compositions, methods, and kits for genotyping plants for identification, selection, or breeding can include means for detecting the presence of Ntntp2 polynucleotides (or any combination thereof as described herein) in a sample of polynucleotides. Accordingly, compositions are described that include one or more primers for specifically amplifying at least a portion of one or more Ntntp2 polynucleotides, and optionally one or more probes and optionally one or more reagents for carrying out the amplification or detection.

[0261] Thus, disclosed are Ntntp2 gene-specific oligonucleotide primers or probes comprising about 10 or more contiguous polynucleotides corresponding to the Ntntp2 polynucleotides described herein. Such primers or probes can comprise or consist of more than about 15, 20, 25, 30, 40, 45, or 50 contiguous polynucleotides that hybridize (e.g., specifically hybridize) to the polynucleotides described herein. In some embodiments, the primers or probes can comprise, or consist of, about 10-50 contiguous nucleotides, about 10-40 contiguous nucleotides, about 10-30 contiguous nucleotides, or about 15-30 contiguous nucleotides, which can be used in sequence-dependent methods of Ntntp2 gene identification (e.g., Southern hybridization) or isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques) or Ntntp2 gene detection (e.g., as one or more amplification primers in amplification or detection). One or more specific primers or probes can be designed and used to amplify or detect part or all of a polynucleotide. As a specific example, two primers can be used in a PCR protocol to amplify an NtNTP2 polynucleotide fragment. PCR can also be performed using one primer derived from the Ntntp2 polynucleotide sequence and a second primer that hybridizes to a sequence upstream or downstream of the polynucleotide sequence (e.g., a promoter sequence, the 3' end of a pre-mRNA, or a sequence derived from a vector). Examples of temperature and isothermal techniques useful for in vitro amplification of polynucleotides are well known in the art. The sample can be or can be derived from a plant, a plant cell or plant material produced from or derived from a plant, or a tobacco product, the plant cell or plant material described herein.

[0262] In a further aspect, there is also provided a method of detecting an Ntntp2 polynucleotide as described herein (or any combination thereof as described herein) in a sample, the method comprising the steps of: (a) providing a sample containing or suspected of containing an Ntntp2 polynucleotide; (b) contacting said sample with one or more primers or one or more probes to specifically detect at least a portion of the Ntntp2 polynucleotide; and (c) detecting the presence of an amplification product, wherein the presence of the amplification product is indicative of the presence of the Ntntp2 polynucleotide in the sample.

[0263] In a further embodiment, the use of one or more primers or probes for specifically detecting at least a portion of an Ntntp2 polynucleotide is also provided. A kit for detecting at least a portion of an Ntntp2 polynucleotide is also provided, which comprises one or more primers or probes for specifically detecting at least a portion of an Ntntp2 polynucleotide. The kit may include reagents for Ntntp2 polynucleotide amplification (e.g., PCR) or reagents for probe hybridization detection techniques (e.g., Southern blot, Northern blot, in situ hybridization, or microarray). The kit may include reagents for antibody binding detection techniques such as Western blot, ELISA, SELDI mass spectrometry, or test strips. The kit may include reagents for DNA sequencing. The kit may include reagents and instructions for using the kit.

[0264] In some embodiments, the kits may include instructions for one or more of the described methods. The described kits may be useful for genetic identity determination using co-dominant scoring, phylogenetic studies, genotyping, haplotyping, genealogy analysis, or plant breeding, among other things.

[0265] The present disclosure also provides methods for genotyping plants, plant cells, or plant material containing the Ntntp2 polynucleotides described herein. Genotyping provides a means of distinguishing between chromosomal pair homologs and can be used to identify segregants in plant populations. Molecular marker methods can be used for phylogenetic studies, characterizing genetic relationships between crop varieties, identifying crosses or somatic hybrids, localizing chromosomal segments affecting single genetic traits, map-based cloning, and quantitative inheritance studies. Specific methods of genotyping can employ any number of molecular marker analysis techniques, including amplified fragment length polymorphism (AFLP). AFLP is the product of allelic differences between amplified fragments caused by polynucleotide variability. Thus, the present disclosure further provides a means for tracking the segregation of one or more Ntntp2 genes or polynucleotides, as well as chromosomal sequences genetically related to these Ntntp2 genes or polynucleotides, using techniques such as AFLP analysis.

[0266] The present disclosure also provides a method for improving the agronomic properties of a plant by reducing or suppressing the expression or activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, wherein said NtNTP2-T and NtNTP2-S are selected from the group consisting of (i) an NtNTP2-S polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO:3, or (ii) an NtNTP2-S polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO:11. The plant may comprise or consist of an NtNTP2-T polynucleotide sequence, or (iii) a polypeptide encoded by the polynucleotide described in (i) or (ii), or (iv) an NtNTP2-S polypeptide having at least 77% sequence identity to SEQ ID NO: 7, or (v) an NtNTP2-T polypeptide having at least 77% sequence identity to SEQ ID NO: 12, wherein the expression or activity of NtNTP2-T, or the expression or activity of NtNTP2-T and NtNTP2-S, is reduced or suppressed compared to a control plant. Preferably, the agronomic traits are (i) no reduction in nitrate levels, (ii) increased biomass (e.g., leaf biomass) under both standard and nitrogen-starved conditions, and (iii) increased NUE response, measured as biomass per unit of nitrogen fertilization applied. The expression or activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, can be reduced or suppressed using any of the methods described herein. As an example, one or more sequence-specific polynucleotides can be used that can interfere with the transcription of NtNTP2-T, or NtNTP2-T and NtNTP2-S. As a further example, one or more sequence-specific polypeptides can be used that can interfere with the stability of NtNTP2-T, or NtNTP2-T and NtNTP2-S. As an example, one or more sequence-specific polynucleotides can be used that can interfere with the enzymatic activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, or the binding activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, toward a substrate or regulatory protein.As a further example, gene-edited NtNTP2-T, or NtNTP2-T and NtNTP2-S, can be used. Preferably, NtNTP2-T, or NtNTP2-T and NtNTP2-S, are gene-edited using a bacterial CRISPR / Cas system. As a further example, at least one genetic change in the NtNTP2-T polynucleotide sequence, or at least one genetic change in the NtNTP2-T polynucleotide and NtNTP2-S polynucleotide sequences, or at least one genetic change in the NtNTP2-T polypeptide sequence, or at least one genetic change in the NtNTP2-T polypeptide sequence and NtNTP2-S polypeptide sequence can be used. Preferably, the at least one genetic change may be at least one genetic change that causes the encoded polypeptide to terminate or stop translation earlier than in a control plant. As a further example, the at least one genetic change can reduce or suppress the expression or activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S. The at least one genetic alteration can comprise at least one nonsense mutation in an NtNTP2-T polynucleotide or polypeptide, or at least one nonsense mutation in an NtNTP2-T polynucleotide or polypeptide and at least one nonsense mutation in an NtNTP2-S polynucleotide or polypeptide. For example, the mutation can be a single nucleotide polymorphism in NtNTP2-S at nucleotide positions 632, 633, or 632 and 633 of SEQ ID NO: 3; preferably, the single nucleotide polymorphism is a "g" to "a" mutation at nucleotide positions 632, 633, or 632 and 633 of SEQ ID NO: 3. The mutant NtNTP2-S polynucleotide sequence can comprise, consist of, or consist essentially of SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.The mutation may be a single nucleotide polymorphism in NtNTP2-T at nucleotide position 636 of SEQ ID NO: 11, preferably the single nucleotide polymorphism is a "g" to "a" mutation at nucleotide position 635 or 636 of SEQ ID NO: 11, or a "g" to "a" mutation at nucleotide positions 635 and 636 of SEQ ID NO: 11. The mutant NtNTP2-T polynucleotide sequence may comprise, consist of, or consist essentially of SEQ ID NO: 13, or SEQ ID NO: 14, or SEQ ID NO: 15. The mutant NtNTP2-T polypeptide, or the mutant NtNTP2-T polypeptide and the mutant NtNTP2-S polypeptide, may each have at least one nonsense mutation at position W212, or positions W212 and W211, respectively. The mutant NtNTP2-T polypeptide, or the mutant NtNTP2-T polypeptide and the mutant NtNTP2-S polypeptide, may comprise, consist of, or consist essentially of SEQ ID NO: 16, or either SEQ ID NO: 8 and SEQ ID NO: 16, respectively. The sequences deposited in the database are described herein and may change over time. Preferably, the current version of the sequence database is relied upon. Alternatively, the publication in effect as of the filing date is relied upon. As known to those skilled in the art, the accession number may be a versioned / dated accession number. The citable accession number for the current database entry is the same as herein, but omitting the decimal point and any trailing digits. GenBank is the NIH genetic sequence database, an annotated collection of all publicly available DNA sequences (National Center for Biotechnology Information, US National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894 USA; Nucleic Acids Research, 2013 Jan;41(D1):D36-42), to which the accession numbers provided relate unless otherwise specified. Preferably, the current publication is relied upon.More preferably, the publication available on the effective filing date is relied upon. Most preferably, the referenced GenBank database publication is NCBI-GenBank Release 241:15 December 2020. Preferably, the current version of the sequence database is relied upon. Alternatively, the publication in effect on the filing date is relied upon. For the avoidance of doubt, reliance is placed on the UniProt Knowledgebase (UniProtKB) Release 2021_01 of the UniProt Consortium European Bioinformatics Institute (EBI), SIB Swiss Institute of Bioinformatics, and Protein Information Resource (PIR), published on February 10, 2021. UniProt (Universal Protein Resource) is a comprehensive catalog of information about proteins (“UniProt: the universal protein knowledgebase” Nucleic Acids Res. 45:D158-D169(2017)).

[0267] The present invention is further described in the following examples, which are provided to describe the invention in more detail. These examples describe preferred modes presently contemplated for carrying out the invention and are intended to illustrate, but not limit, the invention. [Example]

[0268] Example 1 - EMS mutant population screening for ntp2 mutations and ntp2-S W211stop / ntp2-T W212stop double mutant breeding To identify specific mutations in the EMS-generated AA37 mutant population, primers were designed to cover portions of the Ntntp2-S and Ntntp2-T gene sequences. The resulting amplified fragments were sequenced. The primer pairs used to identify ntp2-stop mutants are reported in Table 1.

[0269] Point mutations leading to stop codons and thus truncated, non-functional forms of the protein are considered to be of interest. A list of identified stop mutants is reported in Table 2. The table reports details of the stop codon mutations identified during the EMS screening. The F seq and R seq columns indicate the SNP (single nucleotide polymorphism) mutations (5' and 3' of the mutation, respectively). The original wild-type codon and corresponding amino acid (codon ori and AS ori columns), as well as the corresponding mutant form (codon mut and AS mut columns) are also shown.

[0270] TaqMan assays were used to screen for different ntp2 mutations and genotypes. Table 3 reports the details of the primers and probes used to genotype the AA37 ntp2 W211stop and W212stop double mutant strains. The Identity column indicates the identified gene and phenotype (wt indicates the wild-type genotype, mut indicates the mutant genotype, and tAg and tgA indicate two different mutations identified in the NtNtp2-S gene). The F Primer and R Primer columns indicate the primer sequences of the forward and reverse primers, respectively. The Probe column reports the sequence of the probe used (underlined bases indicate discriminants between the wt mutation and different mutations).

[0271] The double mutant Ntntp2-S W211stop / Ntntp2-T W212stop in the AA37 background is generated by crossing the single mutant plant Ntntp2-S W211stop (tgA mutation) and the single mutant plant Ntntp2-T W212stop.

[0272] Example 2 - Design and execution of field trials Two-season field trials will be conducted. Seeding, sawing, and seedling cultivation in a greenhouse will be conducted in accordance with ID-160: Burley and Dark Tobacco Production Guide, 2021-2022 (uky.edu) for Burley and Dark tobaccos, 2022 Flue-Cured Tobacco Guide, NC State Extension Publications (ncsu.edu) for Virginia tobacco standards. Ten plant plots per genotype will be transplanted in a randomly distributed field design according to the growing season, with 7 to 19 replicas per genotype. The first field trial will be grown under burley conditions, with a total applied nitrogen input of 250 units, where 1 unit is expressed as kilograms per hectare. The plants will be top-cut before flowering, and at harvest, five mid-stem leaves per plant will be harvested and hung to air-dry for the drying process. Two identical, randomly distributed fields were run with different nitrogen inputs: one under burley conditions (254 nitrogen units, 1 unit expressed in kilograms per hectare), and one under nitrogen-deficient Virginia conditions (55 nitrogen units, i.e., 25% less nitrogen input than under burley conditions). Nineteen replicas per field per genotype were grown. Plants were topped before flowering and the stems were desiccated a few weeks later.

[0273] Example 3 - Analysis of dried material After drying, the number of plants per plot and the weight of the dried leaf material are recorded for biomass detection. Standard drying procedures are described in ID-160: Burley and Dark Tobacco Production Guide, 2021-2022 (uky.edu) for Burley and dark tobacco, and the 2022 Flue-Cured Tobacco Guide | NC State Extension Publications (ncsu.edu) for Virginia tobacco. All leaves are separated from the stems and weighed, and material from the edge plants is removed to avoid position effects. Representative leaf blade samples from 10-15 mid-stem leaves per plot are collected for nitrate level determination. Samples are freeze-dried and powdered. Nitrite-nitrate content (referred to in this report as nitrate level) is measured using the Cayman chemical Nitrate / Nitrite Colorimetric Assay Kit (item no. 780001) according to the supplier's instructions, as described in FASEB Journal (1992) 6, 3051-3064; Anal. Biochem. (1982) 126, 131-138; and Methods (1995) 7, 48-54.

[0274] Example 4 - NtNtp2 gene and protein sequences Two NtNtp2 genes are present in the tobacco genome, one on chromosome 8 (-S forms Ntab-TN90_AYMYSS948 in the publicly available TN90 genome) and the other on chromosome 21 (-T forms Ntab-TN90_AYMYSS1317). The genomic, transcript, gene, and protein sequences of the NtNtp2 gene are presented in the accompanying list of sequences.

[0275] The NtNTP2-T deduced protein sequence was BLASTed with protein databases from different plant species (Solanum melongena, Arabidopsis thaliana, Nicotiana benthamiana, and Solanum lycopersicum), and the highest homologies are reported in Table 4. Homologous proteins (predicted proteins) and the degree of identity expressed as percentage of identical residues are reported. Table 5 reports the degree of identity with the respective predicted coding regions (CDS), expressed as percentage of identical residues.

[0276] Example 5 - Plant phenotype and nitrate levels in the ntp2-S W211stop / ntp2-T W212stop double mutant AA37 tobacco plants were grown in the field under the Burley formula (254 nitrogen units, as described above) for two consecutive growing seasons. At harvest, no morphological differences between the double mutant and wild-type out-segregant genotypes were evident by observing the plants in the field, as shown in Figure 1.

[0277] Nitrate levels in dried leaf blades and midribs from leaves located mid-stem were measured as an average per plot (n = 7–8 plots of 10 plants each) and are reported in Figure 2. No significant differences in nitrate levels between the out-segregant wt and double ntp2 mutant genotypes were detected (two-tailed Student's test p-value = 0.21361 for leaf blade data and p-value = 0.8485846 for midrib data).

[0278] In contrast, in Arabidopsis, ntp2 insertion mutants exhibit 50–64% less nitrate content in the petiole and midrib, and a statistically significant 13% more nitrate in the leaf blade compared to the wild type (Chiu et al. (2004) supra).

[0279] These results show that there is no statistically significant difference in nitrate content in the leaf blades, nor in the midribs, between the homozygous mutant and wild-type plants.

[0280] We conclude that impairing both -S and -T NtNTP2 protein activity has no obvious effect on nitrate levels in the blades and midribs of AA37 tobacco cured leaves from plants grown under burley conditions.

[0281] Example 6 - Ntp2-S W211stop / ntp2-T W212stop mutant yield effect. Two corresponding field experiments were performed under burley and Virginia fertilized conditions (254 and 55 nitrogen units, respectively, i.e., 100% and 25% of the nitrogen input). The double mutant and out-segregant wild-type plants grown under burley conditions did not show significant phenotypic differences (see Figure 3, upper panel). When grown under nitrogen-starved conditions (Virginia formula, 25% nitrogen units compared to burley conditions), the ntp2 double mutant plants had more developed leaves and appeared slightly larger than their out-segregant wild-type counterparts (see Figure 3, lower panel).

[0282] Plants were top-cut, stems were desiccated, and leaf biomass was recorded from all commercially valuable leaf stages. The yield data reported in Figure 4 demonstrate the yield phenotype of the ntp2 double-stop mutant under different nitrogen regimes. Under a standard burley fertilization regime, ntp2 double-stop mutant plants produced 16.2% more leaf biomass than their out-segregating wild-type counterparts (p-value = 0.00654 by a two-tailed Stuart test). Under a nitrogen-starvation regime, the increase in biomass was even higher compared to the wild-type, reaching 28.3% (p-value = 0.003184).

[0283] It is concluded that the phenotype characterizing the loss of NtNTP2 activity is improved yield in the different nitrogen regimes tested.

[0284] Chiu et al. (2004) demonstrated that homozygous Arabidopsis Atntp2 insertion mutants develop wider and longer leaves compared to wild-type plants due to increased cell proliferation. Interestingly, our field results suggest that loss of function of the NtNTP2 protein in tobacco AA37 plants not only results in higher yields under standard fertilization regimes, but also limits biomass loss due to cultivation under nitrogen starvation. Indeed, as shown in Figure 4, ntp2 double-stop mutant plants exhibit a reduced yield difference between standard and nitrogen-starved conditions compared to the out-segregant wild-type genotype (30.8% compared to 37.3%), and the mutants have statistically significantly higher drought biomass compared to wild-type plants under all conditions (see Figure 4).

[0285] During the second experiment, segregation studies were performed to define the contribution of the -S and -T mutations to the yield phenotype. Figure 5 reports the total dry processed leaf biomass data, expressed in grams per plant, for the different segregating phenotypes of the Ntntp2 mutation. Ntntp2-S W211stop and Ntntp2-T W212stop double mutant plants (sstt) show a 9.4% increase in average total dry processed leaf biomass per plant compared to the out-segregant wild type (ssTT). No ntp2 loss-of-function biomass effect is detected in experiments performed on the ntp2-S W211stop single mutant (ssTT in Figure 5).

[0286] Therefore, loss of function of the NTP2-S protein is not sufficient to obtain this phenotype. Loss of function of the NTP2-T protein alone is sufficient to generate a yield-improving phenotype in AA37 tobacco plants (SStt), resulting in a 13.9% increase in yield compared to the double outsegregant wild type (SSTT), with a p-value of 0.04545133.

[0287] Example 7 - Ntp2-S W211stop / ntp2-T W212stop mutant NUE From the dry-process biomass data reported in Figure 4, the difference in biomass between standard-fertilized and nitrogen-deficient conditions (25% N units compared to standard conditions) is reduced in ntp2 double-stop mutant plants compared to the out-segregant wild type (30.8% compared to 37.3%, respectively). Therefore, the NUE index, i.e., the units of biomass produced per unit of nitrogen fertilization (expressed as kilograms of nitrogen per hectare, assuming a number of 12,000 plants per hectare), was calculated, as shown in Table 6. The total harvested dry-process biomass (biomass) per hectare, expressed in kilograms, and the available nitrogen units (N units) under the different fertilization regimes, expressed as kilograms of nitrogen per hectare, considering 12,000 plants per hectare, and the NUE index, calculated as biomass per unit of applied N, are reported per ntp2 genotype (genotype).

[0288] As expected, both genotypes increase their NUE index, intended as biomass per unit of nitrogen fertilization applied, when grown under nitrogen-deficient conditions.

[0289] As shown in Table 6 and Figure 6 , under nitrogen-deficient conditions, the ntp2 double stop mutant plants increased the NUE index by more than 16% compared with the out-segregant wild-type genotype (3.97 vs. 4.61), and under normal nitrogen conditions, the ntp2 double stop mutant plants increased the NUE index by more than 28% compared with the out-segregant wild-type genotype (11.49 vs. 14.75).

[0290] Therefore, impairment of NTP2 protein activity in tobacco increases the plant's ability to adapt to nitrogen starvation and increases plant NUE.

[0291] Example 8 - Screening To select potential candidate targets for increasing NUE in tobacco, microarray data were obtained to identify candidate genes differentially expressed in green and mature leaves in different tobacco cultivars. Expression dynamics during air-curing of Swiss burley material, which notoriously exhibits low NUE, were compared with corresponding profiles of other more nitrogen-use-efficient tobacco cultivars, such as Virginia, along its maturity and respective early curing processes. Gene candidates were selected based on literature searches and their implications for nitrogen assimilation pathways and transport. The focus was on genes differentially expressed between Virginia and burley. The Ntntp2 gene was identified as highly expressed in burley green mature leaves and at harvest, and its expression level increased during curing in Virginia, reaching burley levels, as shown in Figure 7.

[0292] Example 9 - Root phenotype To further understand the mechanism responsible for increased NUE in NtNTP2 mutants, root development was monitored in seedlings grown on agar plates and young plantlets grown in hydroponics. The results are shown in Figure 8. In both cases, NtNTP2-T single homozygous mutants, and NtNTP2-S and -T double mutant plants, showed increased root development, expressed as the number of lateral roots (A) or the maximum length of submerged roots (B). Thus, impaired NtNTP2 activity results in increased root development.

[0293] Example 10 - Mutant Ntntp2-S W211Stop / Ntntp2-T W212Stop root phenotype in greenhouse experiments Ntntp2-S W211stop / Ntntp2-T W212stop BC2S2 TN90 and K326 mutant plants and their wild-type outsegregant controls were grown in a greenhouse in a hydroponic solution containing 50% of the normal nitrogen fertilization (N50%). Four to six weeks after transplanting, the number of primary roots sprouting from the central stele per plant was recorded along with their average diameter. Both TN90 (burley tobacco type) and K326 (Virginia tobacco type) mutant plants exhibited a statistically significant increase in lateral primary roots compared to their respective outsegregant controls (+39.7% for TN90 with a p-value of 0.00083 and +47.7% for K326 with a p-value of 0.000587), as shown in Figure 9.

[0294] For TN90 plants, the diameter of the lateral primary roots of plants grown at 50% N was measured using a thickness gauge (Mitutoyo ABSOLUTE, Mitutoyo Europe GmbH, Borsigstraße 8-10 D-41469 Neuss). The mutant plants produced 20% thinner primary roots compared to the outsegregant wild type, as shown in Figure 10.

[0295] Strikingly, impairment of NtNTP2 activity leads to altered root development, producing more numerous and thinner roots compared to wild-type plants grown under the same conditions, as summarized in Figure 11. This may increase the plant's ability to take up nutrients from the soil.

[0296] Example 11 - Transgenic constructs for RNAi plants A fragment of the coding region of the NtNtp2-T gene is selected to design an RNA interference (RNAi) construct. The RNAi loop is synthesized as shown in Figure 12. The DNA sequence is shown in SEQ ID NO: 45. The RNAi loop is cloned via Hind III-Avr II restriction sites into a binary vector carrying an MMV promoter and translator enhancer (see WO2012 / 098111) to obtain the construct shown in Figure 12.

[0297] Nicotiana tabacum TN90 cells were transformed with Agrobacterium tumefaciens carrying a binary vector for RNAi of NtNtp2, and plants were regenerated on kanamycin. TN90 T2 seedlings, transgenic for the RNAi construct (RNAi-T2) and transgenic for the empty vector (control plants, CT-T2), were selected on kanamycin and transplanted. Compared to standard practice, they were grown in a greenhouse in a hydroponic solution with 50% nitrogen fertilization (N50%). Four to six weeks after transplanting, the number of primary roots sprouting from the central stele per plant was recorded, along with their average diameter. Transgenic plants of the RNAi constructs exhibit a statistically verified higher number of lateral primary roots compared to their respective outsegregant controls (+39.7% for TN90 with a p-value of 0.00083 and +47.7% for K326 with a p-value of 0.000587), as shown in Figure 14.

[0298] The diameter of the lateral primary roots of RNAi and control plants grown at 50% N was measured using a thickness gauge (Mitutoyo ABSOLUTE, Mitutoyo Europe GmbH, Borsigstraße 8-10 D-41469 Neuss). The RNAi plants produced thinner primary roots compared to the outsegregant wild-type plants, as shown in Figure 15.

[0299] Example 12 - Conclusion Impairing NtNTP2 protein activity did not determine a decrease in nitrate levels in cured leaf blades or midribs of AA37 tobacco plants grown under burley conditions, nor did it determine any major changes in the amounts of other measured chemical compounds.

[0300] The phenotype of the Ntntp2 double stop mutation or the Ntntp2‐T homozygous mutation in tobacco is an increase in drought‐stressed leaf biomass under both standard and nitrogen‐starvation conditions when compared with out‐segregant wild‐type plants.

[0301] An additional phenotype of the Ntntp2 double stop mutation or the NtNTP2-T homozygous mutation in tobacco is an increased plant NUE response, expressed as kilograms of dry processed leaf biomass produced per kilogram of nitrogen input per hectare. This makes the Ntntp2 gene a good target for NUE solutions.

[0302] The phenotype of RNAi-modified NtNtp2-T tobacco plants, in which NtNTP2 expression and / or activity is impaired, is altered root development, producing more and thinner roots than wild-type plants grown under the same conditions, which may increase the plants' ability to take up nutrients from the soil.

[0303] Any publications cited or described herein provide relevant information disclosed prior to the filing date of the present application. Nothing herein should be construed as an admission that the inventors are not entitled to antedate such disclosure. All publications mentioned in the above specification are incorporated herein by reference. Various modifications and variations of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the present invention has been described in connection with certain preferred embodiments, it should be understood that the present invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described methods for carrying out the invention that are obvious to those skilled in the art of cell biology, molecular biology, plant biology, or related fields are intended to be within the scope of the following claims.

[0304] JPEG2025533986000003.jpg35160

[0305] JPEG2025533986000004.jpg129160

[0306] JPEG2025533986000005.jpg53160

[0307] JPEG2025533986000006.jpg48160

[0308] JPEG2025533986000007.jpg48160

[0309] JPEG2025533986000008.jpg52156

[0310] array SEQ ID NO:1 - NtNtp2-S genome sequence JPEG2025533986000009.jpg169160 SEQ ID NO:2 - NtNtp2-S transcript sequence (start and stop codons are shown in bold) JPEG2025533986000010.jpg50160 JPEG2025533986000011.jpg65160 SEQ ID NO: 3 - NtNtp2-S gene sequence JPEG2025533986000012.jpg97160 SEQ ID NO: 4 - NtNtp2-S gene sequence of SEQ ID NO: 3 with g to a mutation (g to a mutation at nucleotide 632) shown in bold JPEG2025533986000013.jpg49160 JPEG2025533986000014.jpg49160 SEQ ID NO: 5 - NtNtp2-S gene sequence of SEQ ID NO: 3 with g to a mutation (g to a mutation at nucleotide 633) shown in bold JPEG2025533986000015.jpg98160 SEQ ID NO: 6 - NtNtp2-S gene sequence of SEQ ID NO: 3 with g to a mutations shown in bold (g to a mutations at nucleotides 632 and 633) JPEG2025533986000016.jpg58160 JPEG2025533986000017.jpg41160 SEQ ID NO:7 - NtNtp2-S polypeptide sequence encoded by SEQ ID NO:3 JPEG2025533986000018.jpg35160 SEQ ID NO:8 - NtNtp2-S truncated polypeptide encoded by SEQ ID NO:4, or SEQ ID NO:5, or SEQ ID NO:6, with a stop codon at position W211 of SEQ ID NO:7 JPEG2025533986000019.jpg13160 SEQ ID NO:9 - NtNTP2-T genomic sequence JPEG2025533986000020.jpg113160 JPEG2025533986000021.jpg56160 SEQ ID NO: 10 - NtNtp2-T transcript sequence (start and stop codons shown in bold) JPEG2025533986000022.jpg113160 SEQ ID NO: 11 - NtNtp2-T gene sequence JPEG2025533986000023.jpg50160 JPEG2025533986000024.jpg49160 SEQ ID NO:12 - NtNtp2-T polypeptide sequence encoded by SEQ ID NO:11 JPEG2025533986000025.jpg32160 SEQ ID NO: 13 - NtNtp2-T gene sequence of SEQ ID NO: 11 with g to a mutation shown in bold (g to a mutation at nucleotide 636 resulting in a tga stop codon) JPEG2025533986000026.jpg96160 SEQ ID NO: 14 - NtNtp2-T gene sequence of SEQ ID NO: 11 with g to a mutation shown in bold (g to a mutation at nucleotide 635 resulting in a tag stop codon) JPEG2025533986000027.jpg13160 JPEG2025533986000028.jpg85160 SEQ ID NO: 15 - NtNtp2-T gene sequence of SEQ ID NO: 11 with gg to aa mutations shown in bold (g to a mutation at nucleotide 635 resulting in a taa stop codon and g to a mutation at nucleotide 636) JPEG2025533986000029.jpg98160 SEQ ID NO:16 - NtNtp2-T truncated polypeptide sequence encoded by SEQ ID NO:13, or SEQ ID NO:14, or SEQ ID NO:15, with a stop codon at position W212 of SEQ ID NO:12 JPEG2025533986000030.jpg14160 SEQ ID NO: 17-NtNtp2-S forward primer gaatagcagtaaatctggtgacg SEQ ID NO: 18-NtNtp2-S reverse primer cacaccatgttaagagtattttaag SEQ ID NO: 19-NtNtp2-T forward primer tgaggccgtcaatattaataatgt SEQ ID NO: 20-NtNtp2-T reverse primer acaccatgttaagagtatcttcga SEQ ID NO: 21 - ntp2-T sequence of the 5' position of the W212 stop SNP mutation acggagctg SEQ ID NO: 22 - ntp2-T sequence of the 3' position of the W212 stop SNP mutation gcttatggtg SEQ ID NO: 23 - ntp2-T sequence of the 5' position of the W212 stop SNP mutation acggagct SEQ ID NO: 24 - ntp2-T sequence of the 3' position of the W212 stop SNP mutation ggcttatggtg SEQ ID NO: 26 NtNTP2-S wild type reverse primer cggagcttttcttgtatcggtacc SEQ ID NO: 27-NtNTP2-S wild type forward primer agcatagggactttgacagcagtt SEQ ID NO: 28 NtNTP2-S wild-type probe agctgggcttacgg SEQ ID NO: 29 NtNTP2-S mutant tAg forward primer agcatagggactttgacagcagtt SEQ ID NO: 30 NtNTP2-S mutant tAg reverse primer cggagcttttcttgtatcggtacc SEQ ID NO: 31 NtNTP2-S mutant tAg probe agctaggcttacggtgt SEQ ID NO: 32 NtNTP2-S mutant tgA forward primer agcatagggactttgacagcagtt SEQ ID NO: 33 NtNTP2-S mutant tgA reverse primer cggagcttttcttgtatcggtacc SEQ ID NO: 34 NtNTP2-S mutant tga probe agctgagcttacggtgt SEQ ID NO: 35 NtNTP2-T wild type forward primer catagggactttgacagcagtaacc SEQ ID NO: 36 NtNTP2-T wild type reverse primer ccgagcttttcttgtatcggtact SEQ ID NO: 37 NtNTP2-T wild-type probe agctgggcttatgg SEQ ID NO: 38 NtNTP2-T mutant forward primer catagggactttgacagcagtaacc SEQ ID NO: 39 NtNTP2-T mutant reverse primer ccgagcttttcttgtatcggtact SEQ ID NO: 40 NtNTP2-T mutant probe agctgagcttatggtg SEQ ID NO: 41 - ntp2-S Sequence of the 5' position of the W211 stop SNP mutation acggagctg SEQ ID NO: 42 - ntp2-S Sequence at the 3' position of the W211 stop SNP mutation gcttacggtg SEQ ID NO: 43 - ntp2-S Sequence at the 5' position to the W211 stop SNP mutation acggagct SEQ ID NO: 44 - ntp2-S Sequence at the 3' position of the W211 stop SNP mutation ggcttacggtg SEQ ID NO: 45 DNA sequence of synthetic RNAi loop with 35S CaMV terminator JPEG2025533986000031.jpg86160

Claims

1. A mutant, non-naturally occurring or transgenic plant or part of said plant, in which the expression or activity of NtNTP2-T is reduced or suppressed, or the expression or activity of NtNTP2-T and NtNTP2-S is reduced or suppressed, wherein said NtNTP2-T and NtNTP2-S are: (i) an NtNTP2-S polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO:3; or (ii) an NtNTP2-T polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO: 11; or (iii) a polypeptide encoded by a polynucleotide according to (i) or (ii); or (iv) an NtNTP2-S polypeptide having at least 77% sequence identity to SEQ ID NO: 7; or (v) comprising or consisting of an NtNTP2-T polypeptide having at least 77% sequence identity to SEQ ID NO: 12; A mutant, non-naturally occurring or transgenic plant or part of said plant, in which the expression or activity of said NtNTP2-T, or the expression or activity of said NtNTP2-T and said NtNTP2-S, is reduced or suppressed compared to a control plant.

2. The plant or the part of the plant is (i) nitrate levels are not reduced compared to said control plants grown under the same fertilization conditions; (ii) increased biomass compared to the control plant grown under the same fertilization conditions; (iii) the mutant, non-native or transgenic plant or part of said plant of claim 1, which has an increased NUE response, expressed as biomass per unit of nitrogen applied, compared to said control plant grown under the same fertilization conditions.

3. The mutant, non-naturally occurring or transgenic plant or part of the plant, in which the expression or activity of NtNTP2-T, or the expression or activity of NtNTP2-T and NtNTP2-S, is reduced or suppressed, (i) one or more sequence-specific polynucleotides capable of interfering with the transcription of NtNTP2-T, or NtNTP2-T and NtNTP2-S, and / or (ii) one or more sequence-specific polypeptides that may interfere with the stability of NtNTP2-T, or NtNTP2-T and NtNTP2-S, and / or (iii) one or more sequence-specific polynucleotides capable of interfering with the enzymatic activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, or the binding activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, toward a substrate or regulatory protein; and / or (iv) gene-edited NtNTP2-T, or NtNTP2-T and NtNTP2-S, and / or (v) a mutant, non-naturally occurring or transgenic plant or part of said plant according to claim 1 or claim 2, comprising at least one genetic change in the NtNTP2-T polynucleotide sequence, or at least one genetic change in the NtNTP2-T polynucleotide and NtNTP2-S polynucleotide sequences, or at least one genetic change in the NtNTP2-T polypeptide sequence, or at least one genetic change in the NtNTP2-T polypeptide sequence and NtNTP2-S polypeptide sequence, preferably at least one genetic change that causes the encoded polypeptide to terminate or stop translation earlier than in the control plant.

4. The at least one genetic alteration is at least one mutation, preferably 3(v) A mutant, non-naturally occurring or transgenic plant or part of a plant according to claim 3(v), wherein the at least one genetic alteration comprises at least one nonsense mutation in the NtNTP2-T polynucleotide or the NtNTP2-T polypeptide, or at least one nonsense mutation in the NtNTP2-T polynucleotide or the NtNTP2-T polypeptide and at least one nonsense mutation in the NtNTP2-S polynucleotide or the NtNTP2-S polypeptide.

5. 5. A mutant, non-naturally occurring or transgenic plant or part of a plant according to claim 4, comprising a single nucleotide polymorphism in NtNTP2-S at nucleotide position 632, or 633, or 632 and 633 of SEQ ID NO:3, preferably wherein said single nucleotide polymorphism is a "g" to "a" mutation at nucleotide position 632, or 633 of SEQ ID NO:3, or a "g" to "a" mutation at nucleotide positions 632 and 633 of SEQ ID NO:

3.

6. 6. The mutant, non-naturally occurring, or transgenic plant or part of said plant of claim 5, wherein said variant NtNTP2-S polynucleotide sequence comprises, consists of, or consists essentially of SEQ ID NO:4, or SEQ ID NO:5, or SEQ ID NO:

6.

7. 5. A mutant, non-naturally occurring or transgenic plant or part of a plant according to claim 4, comprising a single nucleotide polymorphism in NtNTP2-T at nucleotide position 636 of SEQ ID NO:11, preferably wherein said single nucleotide polymorphism is a mutation from "g" to "a" at nucleotide position 635 or 636 of SEQ ID NO:11, or a mutation from "g" to "a" at nucleotide positions 635 and 636 of SEQ ID NO:

11.

8. 8. The mutant, non-naturally occurring or transgenic plant or part of said plant of claim 7, wherein said mutant NtNTP2-T polynucleotide sequence comprises, consists of or consists essentially of SEQ ID NO: 13, or SEQ ID NO: 14, or SEQ ID NO:

15.

9. 5. The mutant, non-naturally occurring or transgenic plant or part of said plant of claim 4, wherein said mutant NtNTP2-T polypeptide, or said mutant NtNTP2-T polypeptide and mutant NtNTP2-S polypeptide, respectively, has at least one nonsense mutation at position W212, or at positions W212 and W211, respectively.

10. 10. The mutant, non-naturally occurring or transgenic plant or part of a plant of claim 9, wherein the mutant NtNTP2-T polypeptide, or the mutant NtNTP2-T polypeptide and mutant NtNTP2-S polypeptide, comprises, consists of or consists essentially of either SEQ ID NO: 16, or SEQ ID NO: 8 and SEQ ID NO: 16, respectively, and optionally the mutant NtNTP2-T polypeptide, or the mutant NtNTP2-T polypeptide and mutant NtNTP2-S polypeptide are truncated.

11. 11. A mutant, non-naturally occurring or transgenic plant or part of a plant according to any one of claims 1 to 10, wherein the plant part is selected from (i) a green leaf or part thereof, or (ii) a dried leaf or part thereof, preferably air-dried, preferably sun-dried or flame-dried, or (iii) a dried leaf or part thereof, preferably air-dried, more preferably sun-dried or flame-dried and hot air-dried through an air flue.

12. 1. A method for preparing a plant or part of said plant, comprising the steps of: (a) The following (i) an NtNTP2-S polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO:3; or (ii) an NtNTP2-T polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO: 11; or (iii) a polypeptide encoded by a polynucleotide according to (i) or (ii); or (iv) an NtNTP2-S polypeptide having at least 77% sequence identity to SEQ ID NO: 7; or (v) providing a plant comprising an NtNTP2-T polypeptide having at least 77% sequence identity to SEQ ID NO: 12; (b) reducing the expression or activity of the NtNTP2-T, or the combination of the NtNTP2-T and NtNTP2-S, in the plant; (c) obtaining a plant or part of said plant that (i) does not have reduced nitrate levels compared to a control plant grown under the same fertilization conditions, (ii) has increased biomass compared to said control plant grown under the same fertilization conditions, and (iii) has increased NUE response compared to said control plant grown under the same fertilization conditions.

13. A mutant, non-naturally occurring or transgenic plant or part thereof obtained or obtainable by the method of claim 12, or A mutant, non-native or transgenic plant or part thereof, which has no significant difference in nitrate levels compared to a control plant grown under the same fertilization conditions, has a higher biomass yield compared to said control plant grown under the same fertilization conditions, and has a higher NUE compared to said control plant grown under the same fertilization conditions.

14. A tobacco product or smoking article comprising a mutant, non-naturally occurring or transgenic plant or part of said plant according to any one of claims 1 to 11, or comprising a plant or part of said plant according to claim 12.

15. 1. A method for improving the agronomic properties of a plant, said method comprising reducing or suppressing the expression or activity of NtNTP2-T, or NtNTP2-T and NtNTP2-S, wherein said NtNTP2-T and NtNTP2-S are: (i) an NtNTP2-S polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO:3; or (ii) an NtNTP2-T polynucleotide sequence comprising, consisting of, or consisting essentially of a sequence having at least 70% sequence identity to SEQ ID NO: 11; or (iii) a polypeptide encoded by a polynucleotide according to (i) or (ii); or (iv) an NtNTP2-S polypeptide having at least 77% sequence identity to SEQ ID NO: 7; or (v) comprising or consisting of an NtNTP2-T polypeptide having at least 77% sequence identity to SEQ ID NO: 12; The method, wherein the expression or activity of the NtNTP2-T, or the expression or activity of the NtNTP2-T and the NtNTP2-S, is reduced or suppressed compared to a control plant.

Images