Methods for generating CAR-T cells

Abstract

The present disclosure provides improved methods for generating engineered immune cells (e.g., CAR-T cells). The resulting engineered immune cells and compositions comprising them are useful for treating a variety of diseases, including infectious diseases, autoimmune diseases, and tumors.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 433,693, filed December 19, 2022, the contents of which are incorporated herein by reference in their entirety. [Background technology]

[0002] The present invention relates generally to improved methods for generating engineered immune cells and populations thereof, including T cells expressing chimeric antigen receptors (CAR-T cells).

[0003] The generation of engineered immune cells (e.g., CAR-T cells) typically involves immune cell activation, followed by viral transduction and expansion. However, certain processes for the activation and / or expansion of engineered immune cells or populations thereof, e.g., CAR-T cells, can result in their progressive maturation and an associated loss of potent immune cell subsets (e.g., naive T cells or stem cell memory T cells) in the population. This can ultimately reduce the long-term efficacy of treatments using engineered immune cells generated by such methods. However, T cell activation can be important, inter alia, for transduction efficiency (e.g., with certain viral vectors that require proliferation for viral uptake). Thus, there remains a need for improved methods of generating engineered immune cells and populations thereof that, for example, improve immune cell transduction efficiency, increase the number of engineered immune cells generated (e.g., after expansion), and / or increase the number of potent immune cell subsets in the population. Summary of the Invention

[0004] The present disclosure provides, inter alia, methods for generating populations of engineered immune cells, methods for expanding populations of naive T cells or subsets of stem cell memory T cells, compositions comprising engineered immune cells generated by such methods, populations of immune cells and cytokines, and methods for expanding populations of gamma delta T cells.

[0005] In one aspect, the disclosure provides a method of generating a population of engineered immune cells, the method comprising: (i) culturing a population of immune cells; (ii) contacting the population of immune cells with a nucleic acid molecule comprising a nucleotide sequence encoding a heterologous amino acid sequence, thereby providing a population of engineered immune cells; and (iii) harvesting the population of engineered immune cells, wherein step (i) and / or step (ii) is performed at least in part in the presence of (a) IL-15 and (b) at least one of IL-1b and IL-12.

[0006] In some embodiments, step (i) is performed in the absence of a stimulatory agent comprising a CD3 binding domain and / or a TCR binding domain.

[0007] In some embodiments, step (i) and / or step (ii) is performed at least in part in the presence of IL-15, IL-1b, and IL-12.

[0008] In some embodiments, the population of immune cells comprises T cells.

[0009] In some embodiments, the heterologous amino acid sequence comprises a chimeric antigen receptor (CAR), thereby providing a population of engineered immune cells that express the CAR.

[0010] In some embodiments, the nucleic acid molecule is a viral vector. In some embodiments, the viral vector is a retroviral vector.

[0011] In some embodiments, step (i) and / or step (ii) are performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12, wherein the presence of (a) IL-15 and (b) IL-1b and / or IL-12 expands a subset of naive T cells or stem cell memory T cells.

[0012] In one aspect, the disclosure provides a method of generating a population of engineered immune cells, the method comprising: (i) culturing a population of immune cells; (ii) contacting the population of immune cells with a nucleic acid molecule comprising a nucleotide sequence encoding a heterologous amino acid sequence, thereby providing a population of engineered immune cells; (iii) culturing the population of engineered immune cells obtained from step (ii); and (iv) harvesting the population of engineered immune cells for storage or administration, wherein steps (i), (ii), and / or (iii) are performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12.

[0013] In some embodiments, step (i) is performed in the absence of a stimulatory agent comprising a CD3 binding domain and / or a TCR binding domain.

[0014] In some embodiments, step (i), step (ii), and / or step (iii) are performed at least in part in the presence of IL-15, IL-1b, and IL-12.

[0015] In some embodiments, the population of immune cells comprises T cells.

[0016] In some embodiments, the heterologous amino acid sequence comprises a chimeric antigen receptor (CAR), thereby providing a population of engineered immune cells that express the CAR.

[0017] In some embodiments, the nucleic acid molecule is a viral vector. In some embodiments, the viral vector is a retroviral vector.

[0018] In some embodiments, step (iii) results in the expansion of the population of engineered immune cells.

[0019] In some embodiments, step (i), step (ii), and / or step (iii) are performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12, wherein the presence of (a) IL-15 and (b) IL-1b and / or IL-12 expands a subset of naive T cells or stem cell memory T cells.

[0020] In one aspect, the disclosure provides a method of expanding a population of a subset of naive T cells or stem cell memory T cells, the method comprising contacting a population of immune cells with (a) IL-15 and (b) IL-1b and / or IL-12.

[0021] In one aspect, the disclosure provides a composition comprising a population of immune cells and (a) IL-15 and (b) IL-1b and / or IL-12. In some embodiments, the composition comprises IL-15, IL-1b, and IL-12.

[0022] In some embodiments, the population of immune cells comprises engineered immune cells.

[0023] In some embodiments, the population of engineered immune cells expresses a chimeric antigen receptor (CAR).

[0024] In some embodiments, the population of immune cells comprises T cells.

[0025] In one aspect, the disclosure provides a method of expanding a population of gamma delta T cells, comprising contacting the population of gamma delta T cells with IL-12. In some embodiments, the method further comprises contacting the population of gamma delta T cells with IL-15 or IL-1b. [Brief explanation of the drawings]

[0026] [Figure 1A] Figure 1 shows the results of Example 1. The cytokine cocktail induced T cell aggregation. T cell morphology on day 2. [Figure 1B] Figure 1 shows the results of Example 1. Cytokine cocktail induced T cell aggregation. Time-lapse images (N=8) of the total object area of ​​T cells and aggregates from 0 to 96 hours after IL-2 with cytokine cocktail or TransACT™ supplementation. [Figure 1C] Figure 1 shows the results of Example 1. Cytokine cocktail induced T cell aggregation. Time-lapse images (N=8) of the total object area of ​​T cells and aggregates from 0 to 96 hours after IL-2 with cytokine cocktail or TransACT™ supplementation. [Figure 2] Figure 1 shows the results of Example 2. Genetically engineered T cells were produced using a cytokine cocktail. (A) Microscopic image, and (B) mCherry-positive cells after production. [Figure 3] Figure 1 shows the results of Example 3. Potential cytokines were evaluated and single cytokines were removed from the cytokine cocktail. (A) Cell counts, and (B) mCherry-positive cells (N=4, *p<0.05). p-values ​​were calculated by one-way ANOVA followed by Tukey's test. [Figure 4A] Figure 1 shows the results of Example 4. Design of Experiments (DOE) analysis to identify key cytokines required for engineered T cell production. Culture conditions. [Figure 4B] Figure 1 shows the results of Example 4. Design of Experiments (DOE) analysis to identify key cytokines required for engineered T cell production. Cell counts. [Figure 4C] Figure 1 shows the results of Example 4. Design of Experiments (DOE) analysis to identify key cytokines required for engineered T cell production. mCherry positive cells. [Figure 4D] Figure 1 shows the results of Example 4. Design of Experiments (DOE) analysis to identify key cytokines required for engineered T cell manufacturing. Number of mCherry-positive cells after manufacturing. [Figure 4E] Figure 1 shows the results of Example 4. Design of Experiments (DOE) analysis to identify key cytokines required for engineered T cell production. Correlation between predicted mCherry-positive cells from the jackknife method (X-axis) and actual mCherry-positive cells (Y-axis). [Figure 4F] Figure 1 shows the results of Example 4. Design of Experiments (DOE) analysis to identify key cytokines required for engineered T cell production. Log values ​​of each source calculated by -log(p-value) from likelihood ratio test (N=4). [Figure 5A] Figure 1 shows the results of Example 5. IL-1b, IL-12, and IL-15 promoted the production of genetically engineered T cells. (A) Cell counts, and (B) mCherry-positive cells after production (N=4, *p<0.0002). p values ​​were calculated by one-way ANOVA followed by Tukey's test. [Figure 5B] Figure 1 shows the results of Example 5. IL-1b, IL-12, and IL-15 promoted the production of genetically engineered T cells. (A) Cell counts, and (B) mCherry-positive cells after production (N=4, *p<0.0002). p values ​​were calculated by one-way ANOVA followed by Tukey's test. [Figure 6]

[0023] Figure 6 shows the results of Example 6. The naive / stem cell memory population was much higher when CAR-T cells were produced using IL-1b, IL-12, and IL-15 compared to when CAR-T cells were produced using IL-2 and TransACT™. (A) CAR-positivity rate, and (B) naive / stem cell memory population. The naive / stem cell memory population was identified as both the CD45RA-positive and CCR7-positive populations. [Figure 7] Figure 7 shows the results of Example 7. IL-1b, IL-12, and IL-15 slightly induced T cell proliferation. (A) Cell number and (B) cell cycle (N=4, *p<0.001) after 2 days of culture with IL-1b, IL-12, and IL-15, and IL-2 and TransACT™, respectively. p values ​​were calculated by one-way ANOVA followed by Tukey's test. [Figure 8] Figure 1 shows the results of Example 8. IL-1b, IL-12, and IL-15 slightly increased cell size. (A) Diameter, (B) FSC, and (C) SSC after 2 days of culture with IL-1b, IL-12, and IL-15, and IL-2 and TransACT™, respectively (N=4, *p<0.0005). p-values ​​were calculated by one-way ANOVA followed by Tukey's test. [Figure 9] CD3 expression after 2 days of culture with IL-1b, IL-12, and IL-15, and IL-2 and TransACT™, respectively, is shown. [Figure 10] Activation marker expression is shown for (A) HLA-DR-positive cells, (B) CD25-positive cells, (C) CD38-positive cells, and (D) CD69-positive cells after 2 days of culture with IL-1b, IL-12, and IL-15, and IL-2 and TransACT™, respectively. [Figure 11] Senescence marker expression is shown for (A) CTLA-4-positive cells, (B) LAG-3 cells, (C) PD-1-positive cells, and (D) TIM-3-positive cells after 2 days of culture with IL-1b, IL-12, and IL-15, and IL-2 and TransACT™, respectively. [Figure 12] Exhaustion marker expression after 2 days of culture with IL-1b, IL-12, and IL-15, and IL-2 and TransACT™, respectively: (A) CD28-positive cells, (B) CD57-positive cells, and (C) KLRG1-positive cells. [Figure 13] The amounts of metabolites in the supernatant after 2 days of culture with IL-1b, IL-12, and IL-15, and IL-2 and TransACT™, respectively, are shown: (A) glucose, (B) lactate, (C) glutamine, and (D) NH4++. [Figure 14] 1 shows the results of a glucose uptake assay, with the Y-axis representing the amount of glucose taken up into cells after treatment with a glucose uptake probe. [Figure 15] The amount of Ca++ in the supernatant after 2 days of culture with IL-1b, IL-12, and IL-15, and IL-2 and TransACT™, respectively, is shown. [Figure 16] Demonstrates long-term proliferation of CAR-T cells. [Figure 17] Figure 1 shows the results of Example 12. IL-1b, IL-12, and IL-15 promoted the production of genetically engineered gamma delta T cells. [Figure 18] Co-culture assay of CAR-T cells. Cell cumulation (A) and killing activity (B) were confirmed after 24 hours of co-culture. [Figure 19] 1 shows the results of an in vivo assay using a xenograft model. [Figure 20] The cell concentration of gamma delta T cells cultured with either IL-12 or IL-15 is shown. DETAILED DESCRIPTION OF THE INVENTION

[0027] It will be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below at varying levels of detail in order to provide a substantial understanding of the present technology.

[0028] The present disclosure is not limited in terms of the specific embodiments described in this application, which are intended as single illustrations of individual aspects of the disclosure. Not all various embodiments of the present disclosure are described herein. As will be apparent to those skilled in the art, many modifications and variations of the present disclosure can be made without departing from its spirit and scope. Functionally equivalent methods and apparatuses within the scope of the present disclosure, in addition to those enumerated herein, will become apparent to those skilled in the art from the foregoing description. Such modifications and variations are intended to fall within the scope of the appended claims. The present disclosure is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled.

[0029] In practicing the present techniques, many conventional techniques in molecular biology, protein biochemistry, cell biology, microbiology, and recombinant DNA are used. For example, see Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; Ausubel et al. eds. (2007) Current Protocols in Molecular Biology series, Methods in Enzymology series (Academic Press, Inc., NY); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis, U.S. Patent No. 4,683,195; and Hames and Higgins 10 eds. (1984) Nucleic Acids Hybridization, Anderson (1999) Nucleic Acid Hybridization, Hames and Higgins eds. (1984) Transcription and Translation, Immobilized Cells and Enzymes (IRL Press (1986)), Perbal (1984) A Practical Guide to Molecular Cloning, Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory), Makrides ed.See (2003) Gene Transfer and Expression in Mammalian Cells, Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London), and Herzenberg et al. eds. (1996) Weir's Handbook of Experimental Immunology.

[0030] The generation of engineered immune cells (e.g., CAR-T cells) typically involves immune cell activation, followed by viral transduction and expansion. However, certain processes for the activation and / or expansion of engineered immune cells or populations thereof, e.g., CAR-T cells, can result in their progressive maturation and an associated loss of potent immune cell subsets (e.g., naive T cells or stem cell memory T cells) in the population. This can ultimately reduce the long-term efficacy of treatments using engineered immune cells generated by such methods. However, T cell activation can be important, inter alia, for transduction efficiency (e.g., with certain viral vectors that require proliferation for viral uptake). Thus, there remains a need for improved methods of generating engineered immune cells and populations thereof that, for example, improve immune cell transduction efficiency, increase the number of engineered immune cells generated (e.g., after expansion), and / or increase the number of potent immune cell subsets in the population.

[0031] Embodiments relate, inter alia, to improved methods for generating engineered immune cells, e.g., CAR-T cells, for cell therapy. Specifically, the improved methods include (i) culturing a population of immune cells, (ii) contacting the population of immune cells with a nucleic acid molecule comprising a nucleotide sequence encoding a heterologous amino acid sequence, thereby providing a population of engineered immune cells, and (iii) harvesting the population of engineered immune cells, wherein step (i) and / or step (ii) are performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12. In some embodiments, step (i) is performed in the absence of a stimulatory agent comprising a CD3-binding domain (e.g., without immune cell activation, such as T cell activation). Unexpectedly, it has been found by the inventors of the present technology that the at least partial presence of (a) IL-15 and (b) IL-1b and / or IL-12 during step (i) and / or step (ii) can significantly improve the transduction efficiency, increase the number of, and / or expand the population of the generated high-potency T cells (e.g., naive T cells, stem cell memory T cells).

[0032] definition Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this disclosure belongs. The following references provide those skilled in the art with general definitions of many of the terms used in this disclosure: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994), The Cambridge Dictionary of Science and Technology (Walker ed., 1988), The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991), and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless otherwise specified. The terms used herein are merely for the purpose of describing particular embodiments and are not intended to limit the disclosure.

[0033] As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise.

[0034] As used herein, the term "about" or "approximately" refers to a range within an acceptable error of a particular value as determined by a person skilled in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can refer to within 3 or more than 3 standard deviations, according to the practice in the art. Alternatively, "about" can refer to a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can refer to within one order of magnitude, within 5 times, or within 2 times of a value.

[0035] As used herein, the term "administration" of an agent to a subject includes any route of introduction or delivery of the agent to a subject to perform its intended function. Administration can be performed by any suitable route, including, but not limited to, intravenous, intramuscular, intraperitoneal, subcutaneous, and other suitable routes described herein. Administration includes self-administration and administration by another.

[0036] As used herein, the term "activated" refers to a state of T cells that has been stimulated sufficiently to induce cytokine production, detectable effector function, and / or detectable cell proliferation.

[0037] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. An antibody can be an intact immunoglobulin derived from natural or recombinant sources, or an immunoreactive portion of an intact immunoglobulin. The antibodies of the present disclosure can exist in a variety of forms in which the antigen-binding portion of the antibody is expressed as part of a continuous polypeptide chain, including, for example, single-domain antibody fragments (sdAbs), single-chain antibodies (scFvs), and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, NY; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

[0038] As used herein, "antibody fragment" or "antigen-binding fragment" refers to Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, sdAbs (V L or V H Camelidae V HHThe term "scFv" refers to a fusion protein comprising at least one antibody fragment comprising a light chain variable region and at least one antibody fragment comprising a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region are contiguously linked via a short flexible polypeptide linker, and can be expressed as a single-chain polypeptide, wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless otherwise specified, as used herein, an scFv refers to a fusion protein comprising at least one antibody fragment comprising a light chain variable region and at least one antibody fragment comprising a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region are contiguously linked via a short flexible polypeptide linker, and wherein the scFv retains the specificity of the intact antibody from which it is derived. L Variable region and V H The scFv may have a variable region, L -Linker-V H or V H -Linker-V L The term "linker" refers to a synthetic sequence (e.g., an amino acid sequence) that connects or links two sequences, e.g., links two polypeptide domains. In some embodiments, the linker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acid residues.

[0039] As used herein, "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformation, which usually determines the class to which the antibody belongs.

[0040] As used herein, "antibody light chain" refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (κ) light chain and lambda (λ) light chain refer to the two major antibody light chain isotypes.

[0041] As used herein, the term "synthetic antibody" refers to an antibody produced using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be taken to mean an antibody produced by synthesis of a DNA molecule encoding the antibody, which DNA molecule expresses an antibody protein or an amino acid sequence that specifies the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence techniques that are available and well known in the art.

[0042] As used herein, the term "antigen" or "Ag" is defined as a molecule that elicits an immune response. This immune response may involve either antibody production or the activation of specific immunologically competent cells, or both. Those skilled in the art will understand that any macromolecule, including virtually any protein or peptide, can function as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. Thus, those skilled in the art will understand that any DNA containing a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response encodes an "antigen," as that term is used herein. Furthermore, those skilled in the art will understand that an antigen need not be encoded solely by the full-length nucleotide sequence of a gene. It is readily apparent that the present technology includes, but is not limited to, the use of partial nucleotide sequences of two or more genes, and that these nucleotide sequences may be arranged in various combinations to encode a polypeptide that elicits a desired immune response. Furthermore, those skilled in the art will understand that an antigen need not be encoded by a "gene" at all. It is readily apparent that antigens can be synthesized or obtained from biological samples. Such biological samples may include, but are not limited to, tissue samples, tumor samples, cells, or biological fluids.

[0043] The term "autoantigen," according to the present disclosure, refers to any self-antigen that is mistakenly recognized as foreign by the immune system. Autoantigens include, but are not limited to, cellular proteins, phosphoproteins, cell surface proteins, cellular lipids, nucleic acids, and glycoproteins, including cell surface receptors.

[0044] As used herein, the term "autoimmune disease" is defined as a disorder resulting from an autoimmune response. Autoimmune diseases are the result of an inappropriate and excessive response to a self-antigen (autoantigen). Examples of autoimmune diseases include, but are not limited to, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, celiac disease, Crohn's disease, diabetes mellitus (type 1), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, ankylosing spondylitis, thyroiditis, autoimmune vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis, among others.

[0045] As used herein, the term "autologous" is intended to refer to any material derived from the same individual that is later reintroduced into the individual. "Allogeneic" refers to a graft derived from a different animal of the same species. "Xenogeneic" refers to a graft derived from an animal of a different species.

[0046] As used herein, the term "comprising" is intended to mean that the compositions and methods include the recited elements, but do not exclude other elements. "Consisting essentially of," when used to define compositions and methods, is intended to mean excluding other elements that are of some essential importance to the composition or method. "Consisting of" is intended to mean excluding other component elements that are not insignificant to the claimed compositions and substantial method steps. Embodiments defined by each of these transitional terms are within the scope of this disclosure. Thus, it is intended that the methods and compositions may include (comprise) additional steps and components, or may include (consist essentially of) insignificant steps and compositions, or may contemplate (consist) only of the recited method steps or compositions.

[0047] As used herein, the term "tumor" or "cancer" is defined as a disease characterized by the rapid and uncontrollable growth of abnormal cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colon cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, etc.

[0048] As used herein, a "control" is a substitute sample used in an experiment for comparison purposes. A control can be "positive" or "negative." For example, if the purpose of an experiment is to determine the correlation of the efficacy of a therapeutic agent for treating a particular type of disease, a positive control (a composition known to exhibit the desired therapeutic effect) and a negative control (a subject or sample that does not receive therapy or receives a placebo) are typically used.

[0049] "Costimulatory ligand," as that term is used herein, includes a molecule on an antigen-presenting cell (e.g., dendritic cell, B cell, macrophage, monocyte, etc.) that specifically binds to a cognate costimulatory molecule on a T cell, thereby providing signals that mediate T cell responses, including, but not limited to, proliferation, activation, differentiation, etc., in addition to the primary signal provided, for example, by binding of the TCR / CD3 complex to a peptide-loaded MHC molecule. Co-stimulatory ligands include CD7, B7-1 (CD80), B7-2 (CD86), B7-H1 (PD-L1), B7-DC (PD-L2), B7-H2, B7-H3, B7-H4, B7-H6, B7-H7 / HHLA2, BTLA, 4-1BBL, OX40L, PDCD6, VISTA (B7-H5, PD-1H), GITRL (TNFSF18), inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD27 ligand ( TNFSF7), CD28, CD28H (IGPR-1), CD30L, CD40, CD70, CD83, CTLA-4, HLA-G, MICA, MICB, HVEM, TIM-1 / KIM-1 / HAVCR, TIM-4, semaphorin 4A, galectin-9, butyrophilin-like BTN1A1 (butyrophilin), BTN2A1, BTN2A2 (butyrophilin 2A2), BTN3A1 / 2, BTN3A2, BTN3A3, BTNL2 / butyrophil Illin-like 2, BTNL3, BTNL4, BTNL6, BTNL8, BTNL9, BTNL10, CD277 / BTN3A1, LAIR1, LAIR2, CD96, CD155 / PVR, CRTAM, DNAM-1 (CD226), nectin-2 (CD112), nectin-3, PVRIG, TIGIT, LILRA3 (CD85e), LILRA4 (CD85g, ILT7), LILRB3 (CD85a, ILT5), LILRB2 (CD85d) , ILT4), LILRB1 (CD85j, ILT2), LILRB4 (CD85k, ILT3), B-cell activating factor (BAFF) (BLyS, TNFSF13B), TL1A (TNFSF15), TNF-alpha, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, toll-like receptors (TLRs), and ligands that specifically bind to B7-H3.Costimulatory ligands also include, inter alia, antibodies that specifically bind to costimulatory molecules present on T cells.

[0050] As used herein, the term "costimulatory molecule" or "costimulatory domain" refers to a portion of a CAR that comprises the intracellular domain of a costimulatory molecule. A costimulatory molecule is a cell surface molecule other than an antigen receptor or an Fc receptor that, upon binding to an antigen, provides a second signal required for efficient activation and function of T lymphocytes. Examples of such costimulatory molecules include CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, CD40L, PD-1, PDL-1, ICOS (CD278), LFA-1, CD2, CD7, LIGHT, NKD2C, B7-H3, CTLA-4, GITR (TNFRSF18), TIM-1, TIM-2, TIM-3, TIM-4, CD160, CD200, CD300a (LMIR1), CD300d (LMIR4), CLECL1 (DCAL-1), DAP12, Dectin-1 (CLEC7A), DPPIV (CD26), EphB6, integrin alpha4beta1, integrin alpha4beta7 / LPAM-1, LAG-3, TSLP R, and B-cell activating factor receptor (BAFF). R) (TNFRSF13C), DR3 (TNFRSF25), lymphotoxin-alpha (TNF-beta), RELT (TNFRSF19L), TACI (TNFRSF13B), TNFR2 (TNFRSF1B), 2B4 (CD244, SLAMF4), BLAME (SLAMF8), CD2, CD2F-10 (SLAMF9), CD48 (SLAMF2), CD58 (LFA-3), CD84 (SLAMF5), CD229 (SLAMF3), CRACC (SLAMF7), NTB-A (SLAMF6), SLAM (CD150), and ligands that specifically bind to CD83. Thus, although the present disclosure provides exemplary costimulatory domains derived from CD28 and 4-1BB, other costimulatory domains are contemplated for use with the CARs described herein. The inclusion of one or more costimulatory signaling domains can enhance the potency and proliferation of T cells expressing the CAR receptor. The intracellular signaling domain and the costimulatory signaling domain can be linked in tandem to the carboxyl terminus of the transmembrane domain in any order.

[0051] As used herein, a "costimulatory signal" refers to a signal that, in combination with a primary signal, such as TCR / CD3 ligation, results in T cell proliferation and / or up- or down-regulation of key molecules.

[0052] A "disease" is a state of health in an animal in which the animal is unable to maintain homeostasis and, if the disease is not ameliorated, the animal's health continues to deteriorate. In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but the animal's health is less favorable than it would be if the disorder were not present. If left untreated, a disorder does not necessarily cause a further deterioration in the animal's health.

[0053] As used herein, "effective amount" means an amount that provides a therapeutic or prophylactic benefit.

[0054] As used herein, "endogenous" refers to any material that is derived from or produced within an organism, cell, tissue, or system.

[0055] As used herein, the term "exogenous" refers to any material that is introduced from or produced outside an organism, cell, tissue, or system.

[0056] As used herein, the term "expression" is defined as the transcription and / or translation of a particular nucleotide sequence driven by its promoter.

[0057] As used herein, the term "heterologous nucleic acid molecule or polypeptide" refers to a nucleic acid molecule (e.g., a cDNA, DNA, or RNA molecule) or polypeptide that is not normally present in a cell or a sample obtained from a cell. The nucleic acid can be from another organism or can be, for example, an mRNA molecule that is not normally expressed in the cell or sample.

[0058] As used herein, a "host cell" is a cell used to receive, maintain, replicate, and amplify a vector. A host cell can also be used to express a polypeptide encoded by a vector. The nucleic acid contained in the vector is replicated when the host cell divides, thereby amplifying the nucleic acid.

[0059] As used herein, the term "immune cell" refers to any cell that plays a role in a subject's immune response. Immune cells are of hematopoietic origin and include lymphocytes, e.g., B cells and T cells, natural killer cells, myeloid cells, e.g., monocytes, macrophages, dendritic cells, eosinophils, neutrophils, mast cells, basophils, and granulocytes. As used herein, the term "engineered immune cell" refers to an immune cell that has been genetically modified. As used herein, the term "native immune cell" refers to an immune cell that is naturally present in the immune system.

[0060] As used herein, the term "isolated" refers to something that has been altered to remove it from its native state. For example, a nucleic acid or peptide naturally occurring in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from coexisting materials in its native state is. An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-native environment, such as, for example, a host cell. As used herein, a "purified" or "substantially purified" cell is a cell that is essentially free of other cell types. A substantially purified cell also refers to a cell that has been separated from other cell types with which it is normally associated in its native state. In some instances, a population of substantially purified cells refers to a homogenous population of cells. In other instances, the term simply refers to cells that have been separated from the cells with which they are naturally associated in their native state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.

[0061] As used herein, the term "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may contain introns.

[0062] As used herein, the term "operably linked" refers to the functional linkage between a regulatory sequence that allows the expression of a heterologous nucleic acid sequence and a heterologous nucleic acid sequence.For example, if a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence, the first nucleic acid sequence is operably linked to the second nucleic acid sequence.For example, if a promoter affects the transcription or expression of the coding sequence, the promoter is operably linked to the coding sequence.Generally, operably linked DNA sequences are contiguous and, if necessary to join two protein coding regions, are in the same reading frame.

[0063] "Parenteral" administration of the immunogenic compositions includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), intracisternal, intrathecal, or intrasternal injection, administration, or infusion techniques.

[0064] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal or cells thereof amenable to the methods described herein, whether in vitro or in situ. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0065] As used herein, the term "polynucleotide" is defined as a chain of nucleotides. Furthermore, a nucleic acid is a polymer of nucleotides. Therefore, as used herein, nucleic acid and polynucleotide are interchangeable. Those skilled in the art have the general knowledge that nucleic acids are polynucleotides and can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences obtained by recombinant means, i.e., any means available in the art, including, but not limited to, cloning nucleic acid sequences from recombinant libraries or cell genomes using conventional cloning techniques such as PCR, and synthetic means.

[0066] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, with no limit on the maximum number of amino acids that can comprise a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, commonly referred to in the art as peptides, oligopeptides, and oligomers, and longer chains, commonly referred to in the art as proteins, of which many types exist. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, and fusion proteins, among others. A polypeptide can be a natural peptide, a recombinant peptide, a synthetic peptide, or a combination thereof.

[0067] As used herein, the term "promoter" is defined as a DNA sequence recognized by a cell's synthetic machinery or introduced synthetic machinery necessary to initiate specific transcription of a polynucleotide sequence. A "constitutive" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the production of the gene product in a cell under most or all physiological conditions of the cell. An "inducible" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the production of the gene product in a cell substantially only if an inducer corresponding to the promoter is present in the cell. A "tissue-specific" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoded by or specified by a gene, causes the production of the gene product in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0068] As used herein, a "regulatory sequence" or "regulatory region" of a nucleic acid molecule refers to a cis-acting nucleotide sequence that positively or negatively influences the expression of an operably linked gene. Regulatory regions include sequences of nucleotides that confer inducible (i.e., require a substance or stimulus for increased transcription) expression of a gene. When an inducer is present or at increased concentrations, gene expression can increase. Regulatory regions also include sequences that confer repression of gene expression (i.e., a substance or stimulus decreases transcription). When a repressor is present or at increased concentrations, gene expression can decrease. Regulatory regions are known to affect, regulate, or control many in vivo biological activities, including cell proliferation, cell growth and death, cell differentiation, and immunomodulation. Regulatory regions typically bind one or more trans-acting proteins, resulting in either increased or decreased transcription of the gene.

[0069] Specific examples of gene regulatory regions are promoters and enhancers. A promoter is a sequence located around the transcription or translation start site, typically located 5' of the translation start site. A promoter is usually located within 1 Kb of the translation start site, but may be located farther away, for example, 2 Kb, 3 Kb, 4 Kb, 5 Kb or more, up to 10 Kb, including 10 Kb. Enhancers are known to affect gene expression when located 5' or 3' of a gene, or when located in or part of an exon or intron. Enhancers can also function at a considerable distance from the gene, for example, about 3 Kb, 5 Kb, 7 Kb, 10 Kb, 15 Kb, or more. In addition to promoter regions, regulatory regions also include, but are not limited to, sequences that facilitate translation, splicing signals for introns, maintaining the correct reading frame of the gene to allow in-frame translation of the mRNA, and stop codons, leader sequences and fusion partner sequences, internal ribosome binding site (IRES) elements to create multigene or polycistronic messages, polyadenylation signals to provide accurate polyadenylation of transcripts of the gene of interest, and stop codons, which may optionally be included in the expression vector.

[0070] As used herein, the term "sample" refers to a clinical sample obtained from a subject. In certain embodiments, the sample is obtained from a biological source (i.e., a "biological sample"), such as tissue, body fluid, or microorganism collected from a subject. Sample sources include, but are not limited to, mucus, sputum, bronchoalveolar lavage fluid (BAL), bronchial lavage fluid (BW), whole blood, body fluid, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue.

[0071] As used herein, the term "secreted" with respect to a polypeptide means a polypeptide that is released from the cell via the secretory pathway through the endoplasmic reticulum, the Golgi apparatus, and as vesicles that transiently fuse with the cytoplasmic membrane, releasing the protein outside the cell. Small molecules, such as drugs, can also be secreted by diffusion through the membrane to the outside of the cell.

[0072] The term "specifically binds" as used herein with respect to an antibody refers to an antibody that recognizes a specific antigen but does not substantially recognize or bind to other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to antigens from one or more species. However, such cross-species reactivity does not in itself change the antibody's classification as specific. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross-reactivity does not in itself change the antibody's classification as specific. In some cases, the terms "specific binding" or "specifically binds" can be used in reference to the interaction of an antibody, protein, or peptide with a second chemical species, meaning that the interaction is dependent on the presence of a specific structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than proteins in general. If an antibody is specific for epitope "A," the presence of a molecule containing epitope A (or free, unlabeled A) in a reaction involving labeled "A" and the antibody reduces the amount of labeled A bound to the antibody. As used herein, the terms "specific binding," "specifically binds to," or "is specific for" a particular molecule (e.g., an antigen) refer to, for example, a specific binding activity of about 10 to the molecule to which it binds. -4 M, 10 -5 M, 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M, or 10-12 K of M d It can be exhibited by a molecule having

[0073] As used herein, the term "stimulation" refers to a primary response induced by the binding of a stimulatory molecule (e.g., a TCR / CD3 complex) to its cognate ligand, thereby mediating a signal transduction event, such as, but not limited to, signal transduction through the TCR / CD3 complex. Stimulation may mediate changes in the expression of certain molecules, such as downregulation of TGFβ and / or rearrangement of cytoskeletal structure.

[0074] "Stimulatory molecule," as that term is used herein, means a molecule on a T cell that specifically binds to a cognate stimulatory ligand present on an antigen-presenting cell.

[0075] As used herein, a "stimulatory ligand" or "stimulatory agent" refers to a ligand that, when present on an antigen-presenting cell (e.g., dendritic cell, B cell, macrophage, monocyte, etc.), is capable of specifically binding to a cognate binding partner (herein referred to as a "stimulatory molecule") on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, etc. Stimulatory agents are well known in the art and include, among others, TCR binding domains (e.g., peptide-loaded MHC class I molecules), CD3 binding domains (e.g., anti-CD3 antibodies), mannose receptor family binding domains (e.g., anti-CD206 antibodies, anti-mannose-6-phosphate receptor (M6PR) antibodies), CD28 binding domains (e.g., superagonist anti-CD28 antibodies), CD2 binding domains (e.g., superagonist anti-CD2 antibodies), CD27 binding domains (e.g., For example, superagonist anti-CD27 antibodies), CD30 binding domains (e.g., superagonist anti-CD30 antibodies), CD40L binding domains (e.g., superagonist anti-CD40L antibodies), CD226 binding domains (e.g., superagonist anti-CD226 antibodies), 4-1BB binding domains (e.g., superagonist anti-4-1BB antibodies), OX40 binding domains (e.g., superagonist anti-OX40 antibodies), and concanavalin A (ConA).

[0076] The term "therapeutically effective amount" refers to an amount of a subject compound that will elicit the biological or medical response in a tissue, system, or subject that is being sought by a researcher, veterinarian, physician, or other clinician. The term "therapeutically effective amount" includes an amount of compound that, when administered, is sufficient to prevent the onset of, or alleviate to some extent, one or more of the signs or symptoms of the disorder or disease being treated. The therapeutically effective amount will vary depending on the compound, the disease and its severity, and the age, weight, etc., of the subject being treated.

[0077] As used herein, the terms "transfected" or "transformed" or "transduced" refer to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transformed" or "transduced" or "introduced" cell is one into which exogenous nucleic acid has been transfected, transformed, transduced, or introduced. This cell includes the primary subject cell and its progeny.

[0078] As used herein, the term "separate" therapeutic use refers to the administration of at least two active ingredients simultaneously or substantially simultaneously by different routes.

[0079] As used herein, the term " consecutive " therapeutic use refers to the administration of at least two active ingredients at different times, and the administration route is the same or different.More specifically, consecutive use refers to the administration of one of the active ingredients before the administration of the other or before the administration of the other starts.Therefore, one of the active ingredients can be administered a few minutes, a few hours, or a few days before the administration of the other active ingredient.In this case, there is no simultaneous treatment.

[0080] As used herein, the term "T cells" includes naive T cells, memory T cells, activated T cells, anergic T cells, tolerant T cells, and antigen-specific T cells. As a more specific example, T cells of the subject matter of the present disclosure include CD4 + T cells, CD8 + T cells, T helper cells, cytotoxic T cells, central memory T cells, stem cell memory T cells, effector memory T cells (e.g., T EMCytotoxic T cells (CTLs or killer T cells) are a subset of T lymphocytes that can induce the death of infected somatic or tumor cells. In certain embodiments, CAR-expressing T cells express Foxp3 to achieve and maintain a T regulatory phenotype. In some embodiments, CAR-T cells are any immune cells derived from pluripotent stem cells (e.g., induced pluripotent stem (iPS) cells).

[0081] As used herein, "treating" or "treatment" encompasses the treatment of a disease or disorder described herein in a subject, such as a human, and includes (i) inhibiting the disease or disorder, i.e., arresting its onset, (ii) relieving the disease or disorder, i.e., causing regression of the disorder, (iii) slowing the progression of the disorder, and / or (iv) inhibiting, alleviating, or slowing the progression of one or more symptoms of the disease or disorder. Therapeutic effects of treatment include, but are not limited to, inhibiting disease recurrence, alleviating symptoms, diminishing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the disease state, and remission or improved prognosis.

[0082] As used herein, a "vector" is a replicable nucleic acid capable of expressing one or more heterologous proteins when the vector is transformed into an appropriate host cell. Reference to a vector includes a vector into which a nucleic acid encoding a polypeptide or a fragment thereof can be introduced, typically by restriction digestion and ligation. Reference to a vector also includes a vector containing a nucleic acid encoding a polypeptide. A vector is used to introduce a nucleic acid encoding a polypeptide into a host cell for amplification of the nucleic acid or for expression / display of the polypeptide encoded by the nucleic acid. Although vectors typically remain episomal, they can be designed to enable integration of a gene or portion thereof into a chromosome of the genome. Vectors can include viral vectors. A viral vector is an engineered virus operably linked to an exogenous gene to transfer the exogenous gene into a cell (as a vehicle or shuttle).

[0083] The viral vector of this technology can be retroviral vector.One advantage that retroviral vector offers is their ability to convert their single-stranded RNA genome into double-stranded DNA molecules, and stably integrate double-stranded DNA molecules into target cell genome.Therefore, retroviral vector can be used to permanently modify the host cell nuclear genome.

[0084] The retroviral vectors of the present technology may be derived from any member of the Retroviridae family, such as spumaviruses or foamy viruses (e.g., human and simian viruses), betaretroviruses (e.g., MMTV), gammaretroviruses (e.g., MLV), alpharetroviruses (e.g., ALV), deltaretroviruses (e.g., BLV and HTLV-1), lentiviruses (e.g., HIV-1), and epsilonretroviruses (e.g., WDSV and WEHV1 / 2), or derivatives thereof.

[0085] Any method known to those of skill in the art for inserting heterologous nucleic acid sequences into a vector (e.g., a retroviral vector) can be used to construct expression vectors containing a nucleic acid encoding any of the polypeptides provided herein.

[0086] Chimeric antigen receptor (CAR) A CAR is an engineered receptor that includes an extracellular domain and an intracellular domain. The extracellular domain includes an antigen-binding portion. In some embodiments, the extracellular domain also includes a hinge domain. In some embodiments, the intracellular domain, also known as the cytoplasmic domain, includes a CD3 zeta chain and / or a costimulatory signaling region. A costimulatory signaling region refers to the portion of a CAR that includes the intracellular domain of a costimulatory molecule. A costimulatory molecule is a cell surface molecule other than an antigen receptor or its ligand that is required for an efficient response of lymphocytes to antigens.

[0087] A linker or spacer domain can be incorporated between the extracellular and transmembrane domains of a CAR, or between the cytoplasmic and transmembrane domains of a CAR. As used herein, the term "spacer domain" generally refers to any oligopeptide or polypeptide that functions to link a transmembrane domain to either the extracellular or cytoplasmic domain of a polypeptide chain. A spacer domain can contain up to 300 amino acids, preferably 10-100 amino acids, and most preferably 25-50 amino acids.

[0088] antigen binding part The selection of the antigen-binding moiety depends on the type and number of ligands that define the surface of the target cell. For example, the antigen-binding domain can be selected to recognize a ligand that acts as a cell surface marker on the target cell associated with a particular disease state. Thus, examples of cell surface markers that can act as ligands for the antigen moiety domain in the CAR of the presently disclosed subject matter include those associated with viral, bacterial, and parasitic infections (e.g., pathogen antigens), autoimmune diseases (e.g., autoantigens), and cancer cells (e.g., tumor-specific or tumor-associated antigens).

[0089] In one embodiment, the CAR of the presently disclosed subject matter can be engineered to target a tumor antigen of interest by engineering a desired antigen-binding moiety that specifically binds to an antigen on a tumor cell. The tumor antigen can be a protein produced by a tumor cell that elicits an immune response, e.g., a T cell-mediated immune response. The choice of antigen-binding moiety of the presently disclosed subject matter will depend on the specific type of cancer being treated. Tumor antigens are well known in the art and include, for example, glioma-associated antigens, carcinoembryonic antigen (CEA), beta-human chorionic gonadotropin, alpha-fetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, mut These include hsp70-2, M-CSF, prostase, prostate-specific antigen (PSA), PAP, NY-ESO-1, LAGE-1a, p53, prostein, PSMA, Her2 / neu, survivin and telomerase, prostate cancer tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrin B2, CD22, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor, CA125, CA19-9, MUC-1, WT-1, glypican 3 (GPC3), and mesothelin.

[0090] In one embodiment, the tumor antigen comprises one or more antigenic cancer epitopes associated with malignant tumors. Malignant tumors express several proteins that can serve as target antigens for immune attack. These molecules include, but are not limited to, tissue-specific antigens such as MART-1, tyrosinase, and GP100 in melanoma, and prostatic acid phosphatase (PAP) and prostate-specific antigen (PSA) in prostate cancer. Other target molecules belong to the group of transformation-related molecules, such as the oncogene HER-2 / Neu / ErbB-2. Yet another group of target antigens are carcinoembryonic antigens, such as carcinoembryonic antigen (CEA). In B-cell lymphomas, tumor-specific idiotypic immunoglobulins constitute truly tumor-specific immunoglobulin antigens unique to individual tumors. B-cell differentiation antigens, such as CD19, CD20, and CD37, are other candidate target antigens in B-cell lymphomas. Some of these antigens (CEA, HER-2, CD19, CD20, idiotype) have been used as targets for passive immunotherapy using monoclonal antibodies with limited success.

[0091] The type of tumor antigen referred to in the subject matter of the present disclosure may be tumor-specific antigen (TSA) or tumor-associated antigen (TAA).TSA is specific to tumor cells and does not occur in other cells in the body.TAA-associated antigens are not specific to tumor cells, but are instead expressed on normal cells under conditions that cannot induce a state of immune tolerance to the antigen.The expression of antigens on tumors can occur under conditions that allow the immune system to respond to the antigen.TAA can be an antigen that is expressed on normal cells during fetal development when the immune system is immature and unable to respond, or it can be an antigen that is usually present at very low levels on normal cells but is expressed at much higher levels on tumor cells.

[0092] Non-limiting examples of TSA or TAA antigens include differentiation antigens such as MART-1 / MelanA (MART-I), gp100 (Pmel 17), tyrosinase, TRP-1, TRP-2, and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, and p15; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor suppressor genes such as p53, Ras, and HER-2 / neu; unique tumor antigens resulting from chromosomal translocations such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, and MYL-RAR; and viral antigens such as Epstein-Barr virus antigen EBVA and human papillomavirus (HPV) antigens E6 and E7. Other protein-based large antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, p185erbB2, p180erbB-3, cMet, nm-23H1, PSA, TAG-72, CA19-9, CA72-4, CAM17.1, NuMa, K-ras, beta-catenin, CDK4, Mum-1, p15, p16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG, BCA225, BTAA, CA125, CA19-9, CA These include 15-3, CA27.29, BCAA, CA195, CA242, CA-50, CAM43, CD68, P1, CO-029, FGF-5, G250, Ga733, EpCAM, glypican 3 (GPC3), HTgp-175, M344, MA-50, mesothelin, MG7-Ag, MOV18, MUC-1, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90, Mac-2 binding protein, cyclophilin C-related protein, TAAL6, TAG72, TLP, TPS, and WT-1. In one embodiment, the antigen binding portion of the CAR targets an antigen including, but not limited to, cMet, CD19, CD20, CD22, ROR1, mesothelin, CD33 / IL3Ra, cMet, PSMA, glycolipid F77, EGFRvIII, GD-2, MY-ESO-1 TCR, MAGE A3 TCR, etc.

[0093] According to the desired antigen to be targeted, the CAR of the present disclosure can be engineered to include the appropriate antigen binding moiety specific to the desired antigen target.For example, if CD19 is the desired antigen to be targeted, the antibody against CD19 can be used as the antigen binding moiety for incorporation into the CAR of the present technology.

[0094] Transmembrane domain Regarding the transmembrane domain, CAR can be designed to include a transmembrane domain fused to the extracellular domain of CAR. In one embodiment, a transmembrane domain that is naturally associated with one of the domains of CAR is used. In some cases, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domain to the transmembrane domain of the same or different surface membrane protein, thereby minimizing interaction with other members of the receptor complex.

[0095] The transmembrane domain can be derived from either natural or synthetic sources. If the source is natural, the domain can be derived from any membrane-bound or transmembrane protein. Particularly useful transmembrane regions in the present technology can be derived from (i.e., include at least one transmembrane region thereof) the α, β, or ζ chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, or an immunoglobulin such as IgG4. Alternatively, the transmembrane domain can be synthetic, in which case it will primarily contain hydrophobic residues such as leucine and valine. Preferably, triplets of phenylalanine, tryptophan, and valine will be found at each end of the synthetic transmembrane domain. Optionally, a short oligopeptide or polypeptide linker, preferably 2-10 amino acids in length, can form the link between the transmembrane domain and the cytoplasmic signaling domain of the CAR. A glycine-serine doublet provides a particularly suitable linker.

[0096] Cytoplasmic domain The cytoplasmic domain, also known as the intracellular signaling domain, of the CAR of the presently disclosed subject matter is involved in activating at least one of the normal effector functions of the immune cell in which the CAR is placed. The term "effector function" refers to a specialized function of a cell. For example, the effector function of a T cell can be cytolytic activity or helper activity, including cytokine secretion. Thus, the term "intracellular signaling domain" refers to a portion of a protein that transmits an effector function signal and instructs the cell to perform a specialized function. While the entire intracellular signaling domain can usually be used, it is often not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such a truncated portion can be used in place of the intact chain, so long as it transmits the effector function signal. Thus, the term intracellular signaling domain is intended to include any truncated portion of the intracellular signaling domain sufficient to transduce an effector function signal.

[0097] Examples of intracellular signaling domains for use in the CARs of the presently disclosed subject matter include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivatives or variants of these sequences and any synthetic sequences having the same functional capability.

[0098] It is known that signals generated via the TCR alone are insufficient for full activation of T cells, and that secondary or costimulatory signals are also required. Thus, T cell activation can be said to be mediated by two distinct classes of cytoplasmic signaling sequences: sequences that initiate antigen-dependent primary activation via the TCR (primary cytoplasmic signaling sequences) and sequences that act in an antigen-independent manner to provide secondary or costimulatory signals (secondary cytoplasmic signaling sequences).

[0099] Primary cytoplasmic signaling sequences regulate the primary activation of the TCR complex in either a stimulatory or inhibitory manner. Primary cytoplasmic signaling sequences that act in a stimulatory manner may contain signaling motifs known as immunoreceptor tyrosine-based activation motifs, or ITAMs.

[0100] Examples of ITAMs containing primary cytoplasmic signaling sequences that are particularly useful in the presently disclosed subject matter include those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. It is particularly preferred that the cytoplasmic signaling molecule of a CAR of the presently disclosed subject matter comprises a cytoplasmic signaling sequence derived from CD3ζ.

[0101] In some embodiments, the cytoplasmic domain of the CAR can be designed to include a CD3ζ signaling domain, alone or in combination with any other desired cytoplasmic domain(s) useful in the context of the CAR of the present technology. For example, the cytoplasmic domain of the CAR can include a CD3ζ chain portion and a costimulatory signaling region. The costimulatory signaling region refers to a portion of the CAR that includes the intracellular domain of a costimulatory molecule. A costimulatory molecule is a cell surface molecule other than an antigen receptor or its ligand that is required for the efficient response of lymphocytes to antigens. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0102] The cytoplasmic signaling sequences within the cytoplasmic signaling portion of the CAR of the presently disclosed subject matter can be linked to each other in random or specified order. Optionally, a short oligopeptide or polypeptide linker, preferably 2-10 amino acids in length, can form the linkage. A glycine-serine doublet provides a particularly suitable linker.

[0103] In one embodiment, the cytoplasmic domain is designed to comprise the signaling domain of CD3ζ and the signaling domain of CD28. In another embodiment, the cytoplasmic domain is designed to comprise the signaling domain of CD3ζ and the signaling domain of 4-1BB. In yet another embodiment, the cytoplasmic domain is designed to comprise the signaling domain of CD3ζ and the signaling domains of CD28 and 4-1BB.

[0104] Methods for generating engineered immune cells of the present technology In one aspect, the disclosure provides a method of generating a population of engineered immune cells, the method comprising: (i) culturing a population of immune cells (the culturing step); (ii) contacting the population of immune cells with a nucleic acid molecule comprising a nucleotide sequence encoding a heterologous amino acid sequence, thereby providing a population of engineered immune cells (the transduction step); and (iii) harvesting the population of engineered immune cells, wherein step (i) and / or step (ii) are performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12.

[0105] In some embodiments, step (i) and / or step (ii) are performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12, wherein the presence of (a) IL-15 and (b) IL-1b and / or IL-12 expands a subset of naive T cells or stem cell memory T cells.

[0106] In some embodiments, the heterologous amino acid sequence comprises a chimeric antigen receptor (CAR), thereby providing a population of engineered immune cells (e.g., CAR-T cells) that express the CAR.

[0107] The engineered immune cells of the presently disclosed subject matter can be T cells. T cells can be lymphocytes that mature in the thymus and are primarily involved in cell-mediated immunity. T cells participate in the adaptive immune system. The T cells of the presently disclosed subject matter can be any type of T cell, including, but not limited to, naive T cells, T helper cells, cytotoxic T cells, memory T cells (including central memory T cells, stem cell memory T cells (or stem-like memory T cells)), and two types of effector memory T cells, e.g., TEM cells and TEMRA cells, regulatory T cells (also known as suppressor T cells), natural killer T cells, mucosal-associated invariant T cells, γδ T cells, and αβ T cells. Cytotoxic T cells (CTLs or killer T cells) are a subset of T lymphocytes that can induce the death of infected somatic cells or tumor cells. The engineered immune cells can also be any T cell derived from a pluripotent stem cell (e.g., an induced pluripotent stem (iPS) cell) (iPS-derived T cell).

[0108] In some embodiments, the T cells are αβ T cells, γδ T cells, or iPS-derived T cells. In some embodiments, the T cells are αβ T cells. In some embodiments, the T cells are γδ T cells. In some embodiments, the T cells are iPS-derived T cells.

[0109] The population of immune cells of the present technology can be obtained from any source known in the art, including, but not limited to, peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments of the present technology, the population of immune cells can be obtained from a blood unit collected from a subject using various techniques known to those skilled in the art, such as apheresis. In some embodiments, the population of immune cells can be isolated from peripheral blood lymphocytes by lysing red blood cells and depleting monocytes.

[0110] Procedures for separation include, but are not limited to, density gradient centrifugation (e.g., using a PERCOLL® gradient); counterflow centrifugal elutriation; resetting; binding to particles that modify cell density; magnetic separation with antibody-coated magnetic beads; affinity chromatography; cytotoxic agents conjugated to or used in conjunction with mAbs, including, but not limited to, complement and cytotoxins; and panning with antibodies bound to solid matrices, e.g., plates, chips, or any other convenient technique.

[0111] Techniques for separation and analysis include, but are not limited to, flow cytometry, which can have various degrees of sophistication, such as multiple color channels, low-angle and obtuse-angle light scatter detection channels, impedance channels, and fluorescence-activated cell sorting (FACS).

[0112] In some embodiments, specific subpopulations of immune cells, such as αβ T cells or γδ T cells, can be further isolated by positive or negative selection techniques (e.g., using selection techniques well known to those of skill in the art).

[0113] In some embodiments, the population of immune cells may be enriched for T cells expressing CD4 and / or CD8 prior to step (i). These selection techniques are well known to those skilled in the art. Non-limiting examples include CD4 + Cells can be enriched by negative selection by treating the mixture of cells with a monoclonal antibody cocktail containing antibodies against CD14, CD20, CD11b, CD16, HLA-DR, and CD8. In certain embodiments, regulatory T cells can be depleted with anti-CD25 conjugated beads.

[0114] In some embodiments, immune cells (e.g., before culturing, after harvesting) may be frozen, optionally after a washing step. The freezing and subsequent thawing step can provide a more homogenous product by removing granulocytes and some monocytes in the cell population. After a washing step (e.g., to remove plasma and platelets), the cells may be suspended in a freezing solution. Freezing solutions and parameters are known in the art. In certain embodiments, cryopreserved cells may be thawed, washed, and allowed to stand at room temperature for about 1 hour before culturing (e.g., step (i) described herein).

[0115] Populations of immune cells can be collected at any time necessary for subsequent activation, transduction, expansion, and / or formulation for use in cell therapy for any disease and / or condition that may benefit from immune cell therapy. In some embodiments, a blood sample or apheresis can be taken from a generally healthy subject. In some embodiments, a blood sample or apheresis can be taken from a generally healthy subject who is at risk for developing a disease but has not yet developed the disease, and the cells of interest are isolated and frozen for later use. In some embodiments, a sample can be collected from a patient shortly after diagnosis of a particular disease described herein, but before any treatment. In further embodiments, cells can be isolated from a blood sample or apheresis from a subject before, during, or after any relevant treatment modality, including, but not limited to, treatment with agents such as antivirals, chemotherapy, radiation, immunotherapy (e.g., checkpoint inhibitors), or immunosuppressants.

[0116] In some embodiments of the present technology, a population of immune cells may be obtained from a patient immediately after treatment. In this regard, it has been observed that after certain cancer treatments, particularly treatment with drugs that damage the immune system, the quality of the obtained immune cells (e.g., T cells) may be optimal or improved for ex vivo manipulation (e.g., transduction, expansion) immediately after treatment, during the period when the patient would normally be recovering from the treatment.

[0117] Cultivation step The methods for generating a population of engineered immune cells described herein can include a culturing step, i.e., culturing the population of immune cells. In some embodiments, the culturing step is performed at least in part in the presence of IL-12 and / or IL-15. In some embodiments, the culturing step is performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12. In some embodiments, the culturing step is performed at least in part in the presence of IL-12 and IL-15. In some embodiments, the culturing step is performed at least in part in the presence of IL-12 and IL-1b. In some embodiments, the culturing step is performed at least in part in the presence of IL-15, IL-1b, and IL-12.

[0118] In some embodiments, the culturing step is carried out for about 1 hour to about 72 hours, about 1 hour to about 60 hours, about 1 hour to about 48 hours, about 12 hours to about 72 hours, about 12 hours to about 60 hours, about 12 hours to about 48 hours, about 24 hours to about 72 hours, about 24 hours to about 60 hours, or about 24 hours to about 48 hours. In some embodiments, the culturing step is carried out for about 1 hour, about 5 hours, about 10 hours, about 12 hours, about 16 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours. In some embodiments, the culturing step is carried out for about 12 hours. In some embodiments, the culturing step is carried out for about 24 hours. In some embodiments, the culturing step is carried out for about 48 hours. In some embodiments, the culturing step is carried out for about 72 hours.

[0119] In some embodiments, the culturing step is carried out at about 30°C to about 40°C. In some embodiments, the culturing step is carried out at about 30°C. In some embodiments, the culturing step is carried out at about 32°C. In some embodiments, the culturing step is carried out at about 35°C. In some embodiments, the culturing step is carried out at about 37°C. In some embodiments, the culturing step is carried out at about 39°C.

[0120] The generation of engineered immune cells (e.g., CAR-T cells) typically involves the activation of the immune cells. However, many processes for the activation of engineered immune cells, such as CAR-T cells, can result in their progressive maturation and the associated loss of populations of potent immune cell subsets (e.g., naive T cells or stem cell memory T cells). This may ultimately reduce the long-term efficacy of treatments using engineered immune cells. Immune cells, such as T cells, can be activated by contacting the immune cells with a stimulatory agent. Thus, the methods of the present disclosure can be performed without the presence of a stimulatory agent (e.g., a stimulatory agent comprising a CD3-binding domain). In some embodiments, step (i) (e.g., the culturing step) of the methods described herein is performed without the presence of a stimulatory agent comprising a CD3-binding domain.

[0121] Transduction step The methods of generating a population of engineered immune cells described herein can include a transduction step, i.e., contacting a population of immune cells (e.g., T cells) with a nucleic acid molecule (e.g., a viral vector) comprising a nucleotide sequence encoding a heterologous amino acid sequence. In some embodiments, the transduction step is performed at least in part in the presence of IL-12 and / or IL-15. In some embodiments, the transduction step is performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12. In some embodiments, the transduction step is performed at least in part in the presence of IL-12 and IL-15. In some embodiments, the transduction step is performed at least in part in the presence of IL-12 and IL-1b. In some embodiments, the transduction step is performed at least in part in the presence of IL-15, IL-1b, and IL-12.

[0122] The nucleic acid molecule comprising the nucleotide encoding heterologous amino acid sequence can be based on any RNA vector or DNA vector known in the art.The method of introducing nucleic acid molecule into host cell is known to those skilled in the art.For example, nucleic acid molecule can be transferred into host cell by physical, chemical or biological means.

[0123] Physical methods for introducing nucleic acid molecules into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like.

[0124] Biological methods for introducing a nucleic acid molecule of interest into a host cell include the use of DNA vectors and RNA vectors. Viral vectors, and particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian cells, such as human cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus type I, adenoviruses, and adeno-associated viruses, etc. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362. In some embodiments, the nucleic acid molecule is a viral vector (e.g., a retroviral vector). In some embodiments, the nucleic acid molecule is a retroviral vector.

[0125] Chemical means for introducing nucleic acid molecules into host cells include macromolecule complexes, nanocapsules, microspheres, beads, and colloidal dispersion systems such as lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0126] When a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of nucleic acid molecules into host cells (in vitro, ex vivo, or in vivo). In another embodiment, the nucleic acid molecule can be associated with a lipid. The lipid-associated nucleic acid can be encapsulated in the aqueous interior of the liposome, interspersed within the lipid bilayer of the liposome, bound to the liposome via a linking molecule associated with both the liposome and the oligonucleotide, entrapped in the liposome, complexed with the liposome, dispersed in a solution containing lipids, mixed with lipids, combined with lipids, contained as a suspension in lipids, contained in or complexed with micelles, or otherwise associated with lipids. The lipid, lipid / DNA, or lipid / expression vector-associated compositions are not limited to any particular structure in solution. For example, they can exist in a bilayer structure, as micelles, or with a "collapsed" structure. They may simply be scattered in the solution and form aggregates that are not uniform in size or shape.Lipid is a fatty substance that can be naturally occurring lipid or synthetic lipid.For example, lipid includes the lipid droplets that naturally occur in cytoplasm, as well as the class of compounds that contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

[0127] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine ("DMPC") can be obtained from Sigma (St. Louis, Mo.), dicetyl phosphate ("DCP") can be obtained from K & K Laboratories (Plainview, NY), cholesterol ("Choi") can be obtained from Calbiochem-Behring, and dimyristyl phosphatidylglycerol ("DMPG") and other lipids can be obtained from Avanti Polar Lipids, Inc. (Birmingham, Ala.). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at approximately -20°C. Chloroform is used as the sole solvent because it evaporates more readily than methanol. "Liposome" is a generic term that encompasses a variety of unilamellar and multilamellar lipid vesicles formed by the formation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having a vesicular structure with a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before forming a closed structure, trapping water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5:505-10). However, compositions with structures in solution that differ from the typical vesicular structure are also encompassed. For example, lipids may assume a micellar structure or simply exist as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also contemplated.

[0128] Regardless of the method used to introduce exogenous nucleic acid into a host cell, various assays can be performed to confirm the presence of the recombinant DNA sequence in the host cell. Such assays include, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR, and "biochemical" assays, such as detecting the presence or absence of specific peptides by immunological means (ELISA and Western blot), or by the assays described herein to identify agents within the scope of the present invention.

[0129] Retroviral vectors are particularly well developed and used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370 (1990); Anderson et al., U.S. Pat. No. 5,399,346). In some embodiments, for the initial genetic modification of immune cells (e.g., T cells) to generate engineered immune cells (e.g., CAR-T cells), retroviral vectors containing nucleotide molecules encoding heterologous amino acid sequences are used for transduction. For example, a polynucleotide encoding a CAR can be cloned into a retroviral vector, and expression can be driven from its endogenous promoter, the retroviral long terminal repeat, or an alternative internal promoter. Retroviral gene transfer (transduction) has also proven effective for the subsequent genetic modification of cells to provide cells containing an antigen-presenting complex comprising at least two costimulatory ligands. Combining a retroviral vector with an appropriate packaging line is also suitable, in which case the capsid protein will function to infect human cells. Various amphotropic virus-producing cell lines are known, including, but not limited to, PA12 (Miller, et al., Mol. Cell. Biol. 5:431-437 (1985)), PA317 (Miller, et al., Mol. Cell. Biol. 6:2895-2902 (1986)), and CRIP (Danos, et al., Proc. Natl. Acad. Sci. USA 85:6460-6464 (1988)). Non-amphotropic particles, such as those pseudotyped with VSVG, RD114, or GALV envelopes, and any others known in the art, are also suitable.

[0130] Possible methods of transduction include direct co-culture of immune cells (e.g., T cells) with producer cells, e.g., by the method of Bregni, et al., Blood 80:1418-1422 (1992), or culture with viral supernatant alone or concentrated vector stocks with or without appropriate growth factors and polycations, e.g., by the method of Xu, et al., Exp. Hemat. 22:223-230 (1994) and Hughes, et al., J. Clin. Invest. 89:1817 (1992). In some embodiments, contacting the population of immune cells (e.g., T cells) with the retroviral vector is carried out in the presence of a soluble additive, a cationic amphipathic peptide, e.g., vectofusin-1.

[0131] In some embodiments, the retroviral vector expressing a CAR can be an oncoretroviral vector, a gammaretroviral vector, a lentiviral vector, or a spumaretroviral vector. In some embodiments, the retroviral vector can be a gammaretroviral vector. In some embodiments, the gammaretroviral vector is selected from a pMSGV vector, a pMSCV vector, a pSFG vector, or a combination of any two or more thereof.

[0132] In one embodiment, contacting a population of immune cells (e.g., T cells) with a nucleic acid molecule (e.g., a retroviral vector) comprising a nucleotide molecule encoding a heterologous amino acid sequence (e.g., a CAR or a fluorescent protein) is performed for about 1 to about 72 hours, e.g., about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, about 24 hours, about 25 hours, about 26 hours, about 27 hours, about 28 hours, or about 30 hours. about 29 hours, about 30 hours, about 31 hours, about 32 hours, about 33 hours, about 34 hours, about 35 hours, about 36 hours, about 37 hours, about 38 hours, about 39 hours, about 40 hours, about 41 hours, about 42 hours, about 43 hours, about 44 hours, about 45 hours, about 46 hours, about 47 hours, about 48 hours, about 49 hours, about 50 hours, about 51 hours, about 52 hours, about 53 hours, about 54 hours, about 55 hours, about 56 hours, about 57 hours, about 58 hours, about 59 hours, about 60 hours, about 61 hours, about 62 hours, about 63 hours, about 64 hours, about 65 hours, about 66 hours, about 67 hours, about 68 hours, about 69 hours, about 70 hours, about 71 hours, or about 72 hours. In some embodiments, immune cells may be contacted with a nucleic acid molecule (e.g., a retroviral vector) comprising a heterologous amino acid sequence (e.g., a CAR) for about 16 to 28 hours, e.g., 24 hours.

[0133] Culture conditions Suitable conditions for immune cell culture (e.g., in the culturing and / or transduction steps) include an appropriate medium (e.g., Minimal Essential Medium or RPMI Medium 1640, or X-vivo 15 (Lonza)) that may contain factors necessary for viability and / or proliferation, including, but not limited to, serum (e.g., fetal bovine or human serum), certain cytokines, growth factors, or additives for cell growth known to those of skill in the art.

[0134] Other additives for cell growth include, but are not limited to, detergents, plasmanate, and reducing agents such as N-acetyl-cysteine ​​and 2-mercaptoethanol. Media include RPMI1640, AIM-V, DMEM, MEM, α-MEM, F-12, IMDM, Advanced DMEM / F12, X-Vivo10™, X-Vivo15™, X-Vivo20™, TheraPEAK™ X-Vivo10, TheraPEAK™ X-Vivo15™, TheraPEAK™ X-Vivo20™, CTS™ Optimizer™ T Cell Expansion SFM, CTS Optimizer Pro Serum Free, which have amino acids (e.g., L-glutamine), sodium pyruvate, and vitamins, and are either serum-free or supplemented with an appropriate amount of serum (or plasma, e.g., CTS™ Immune Cell SR) or a predetermined set of hormones, and / or an amount of cytokine(s) sufficient for the growth and / or proliferation of T cells, and / or an antibiotic (e.g., streptomycin) useful in the culture method. These may include Corning Lymphocyte Serum-free Medium, 4Cell Nutri-T Medium, LymphoONE™ T-Cell Expansion Xeno-Free Medium, ImmunoCult™-XF T Cell Expansion Medium, ExCellerate Human T Cell Expansion Medium, Stemline T Cell Expansion Medium, CAR T-Cell Medium, TexMACS™ Medium, Corning Lymphocyte Serum-free Medium, Corning 88-581-CM Medium, CellGenix T Cell Medium, SmarT™ T cell Expansion Medium, StemSpan™ Serum-Free Expansion Medium, and OptiPEAK T Lymphocyte XPR.The target cells are maintained under conditions necessary to support growth, eg, an appropriate temperature (eg, room temperature or 37° C.) and atmosphere (eg, air plus 5% CO 2 ).

[0135] In any of the above embodiments, (a) IL-15 and (b) IL-1b and / or IL-12 are present. In any of the above embodiments, IL-15, IL-1b, and IL-12 are present. In any of the above embodiments, IL-12 and / or IL-15 are present. In any of the above embodiments, IL-12 and IL-15 are present. In any of the above embodiments, IL-12 and IL-1b are present.

[0136] In any of the above embodiments, IL-15 is present at a concentration of about 1 to about 100 μg / mL, about 1 to about 90 μg / mL, about 1 to about 80 μg / mL, about 1 to about 70 μg / mL, about 1 to about 60 μg / mL, about 1 to about 50 μg / mL, about 5 to about 100 μg / mL, about 5 to about 90 μg / mL, about 5 to about 80 μg / mL, about 5 to about 70 μg / mL, about 5 to about 60 μg / mL, about 5 to about 50 μg / mL, about 10 to about 100 μg / mL, about 10 to about 90 μg / mL, about 10 to about 80 μg / mL, about 10 to about 70 μg / mL, about 10 to about 60 μg / mL, or about 10 to about 50 μg / mL. In any of the above embodiments, IL-15 is present at a concentration of about 1 μg / mL, about 5 μg / mL, about 10 μg / mL, about 15 μg / mL, about 20 μg / mL, about 25 μg / mL, about 30 μg / mL, about 35 μg / mL, about 40 μg / mL, about 45 μg / mL, or about 50 μg / mL. In any of the above embodiments, IL-15 is present at a concentration of about 5 μg / mL. In any of the above embodiments, IL-15 is present at a concentration of about 10 μg / mL. In any of the above embodiments, IL-15 is present at a concentration of about 25 μg / mL. In any of the above embodiments, IL-15 is present at a concentration of about 50 μg / mL.

[0137] In any of the above embodiments, IL-1b is present at a concentration of about 1 to about 100 μg / mL, about 1 to about 90 μg / mL, about 1 to about 80 μg / mL, about 1 to about 70 μg / mL, about 1 to about 60 μg / mL, about 1 to about 50 μg / mL, about 5 to about 100 μg / mL, about 5 to about 90 μg / mL, about 5 to about 80 μg / mL, about 5 to about 70 μg / mL, about 5 to about 60 μg / mL, about 5 to about 50 μg / mL, about 10 to about 100 μg / mL, about 10 to about 90 μg / mL, about 10 to about 80 μg / mL, about 10 to about 70 μg / mL, about 10 to about 60 μg / mL, or about 10 to about 50 μg / mL. In any of the above embodiments, IL-1b is present at a concentration of about 1 μg / mL, about 5 μg / mL, about 10 μg / mL, about 15 μg / mL, about 20 μg / mL, about 25 μg / mL, about 30 μg / mL, about 35 μg / mL, about 40 μg / mL, about 45 μg / mL, or about 50 μg / mL. In any of the above embodiments, IL-1b is present at a concentration of about 5 μg / mL. In any of the above embodiments, IL-1b is present at a concentration of about 10 μg / mL. In any of the above embodiments, IL-1b is present at a concentration of about 25 μg / mL. In any of the above embodiments, IL-1b is present at a concentration of about 50 μg / mL.

[0138] In any of the above embodiments, IL-12 is present at a concentration of about 1 to about 100 μg / mL, about 1 to about 90 μg / mL, about 1 to about 80 μg / mL, about 1 to about 70 μg / mL, about 1 to about 60 μg / mL, about 1 to about 50 μg / mL, about 5 to about 100 μg / mL, about 5 to about 90 μg / mL, about 5 to about 80 μg / mL, about 5 to about 70 μg / mL, about 5 to about 60 μg / mL, about 5 to about 50 μg / mL, about 10 to about 100 μg / mL, about 10 to about 90 μg / mL, about 10 to about 80 μg / mL, about 10 to about 70 μg / mL, about 10 to about 60 μg / mL, or about 10 to about 50 μg / mL. In any of the above embodiments, IL-12 is present at a concentration of about 1 μg / mL, about 5 μg / mL, about 10 μg / mL, about 15 μg / mL, about 20 μg / mL, about 25 μg / mL, about 30 μg / mL, about 35 μg / mL, about 40 μg / mL, about 45 μg / mL, or about 50 μg / mL. In any of the above embodiments, IL-12 is present at a concentration of about 5 μg / mL. In any of the above embodiments, IL-12 is present at a concentration of about 10 μg / mL. In any of the above embodiments, IL-12 is present at a concentration of about 25 μg / mL. In any of the above embodiments, IL-12 is present at a concentration of about 50 μg / mL.

[0139] In some embodiments, the presence of (a) IL-15 and (b) IL-1b and / or IL-12 in the culturing step and / or transduction step reduces, e.g., about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, or about 30% to about 35% of the total cells in the culture and / or transduction step compared to a control (e.g., a culture and / or transduction step without IL-15 and IL-1b and / or IL-12). %, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 95% to about 100%, or more, significantly increasing transduction efficiency.

[0140] Transduction efficiency may be measured by methods known in the art, including, but not limited to, methods using FACS, PCR, or image analysis.

[0141] In some embodiments, the presence of (a) IL15 and (b) IL-1b and / or IL-12 in the culturing and / or transduction steps increases the expression of IL-1b and / or IL-12 by, for example, about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% or more of the total IL-1b and / or IL-12 compared to a control (e.g., an equivalent method of generating a population of engineered immune cells, such as the use of IL-2 plus TransAct™ activation). The population of high-potency T cells (e.g., naive T cells or stem cell memory T cells) is significantly increased by about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 95% to about 100%, or more. In some embodiments, high-potency T cells include, but are not limited to, naive T cells and / or stem cell memory T cells.

[0142] The immunophenotype of T cells can be measured by methods known in the art, including, but not limited to, methods using FACS, PCR, or image analysis. In some embodiments, T cell phenotype can be measured using an anti-CD4 antibody (e.g., clone SK3, catalog number 344604, BioLegend), an anti-CD8 antibody (e.g., clone SK1, catalog number 344710, BioLegend), an anti-CCR7 antibody (e.g., clone G043H7, catalog number 353204, BioLegend), an anti-CD45RA antibody (e.g., clone L48, catalog number 337167, BD Biosciences), an anti-CD27 antibody (e.g., clone O323, catalog number 302836, BioLegend), and an anti-CD95 antibody (e.g., clone DX2, catalog number 305612, BioLegend). CCR7 / CD45RA-negative cells were defined as effector memory T cells, CCR7-positive CD45RA-negative cells were defined as central memory T cells, CCR7-negative CD45RA-positive cells were defined as effector T cells, CCR7 / CD45RA / CD27 / CD95-positive cells were defined as stem cell memory T cells, and other CCR7 / CD45RA-positive cells were defined as naive T cells.

[0143] In some embodiments, the presence of (a) IL15 and (b) IL-1b and / or IL-12 in the culturing and / or transduction steps significantly increases the number of engineered immune cells produced (cell count) compared to a control (e.g., a culturing and / or transduction step without IL-15 and IL-1b and / or IL-12), e.g., about 2 to about 10-fold, about 3 to about 10-fold, about 4 to about 10-fold, about 5 to about 10-fold, about 6 to about 10-fold, or more. Cell count can be measured by methods known in the art, including, but not limited to, methods using a hemocytometer and / or an automated cell counter.

[0144] In some embodiments, the presence of one or more of IL-12, IL-15, and IL-1b in the culturing and / or transduction steps significantly increases the number of gamma delta T cells (e.g., engineered gamma delta T cells) generated compared to a control (e.g., a culturing and / or transduction step without one or more of IL-12, IL-15, and IL-1b), e.g., by about 2 to about 15-fold, about 3 to about 15-fold, about 4 to about 15-fold, about 5 to about 15-fold, about 6 to about 15-fold, or more. Cell numbers can be measured by methods known in the art, including, but not limited to, methods using a hemocytometer and / or automated cell counts.

[0145] Storage / Formulation / Administration The engineered immune cells (e.g., CAR-T cells) from the transduction step can be stored, formulated, and / or harvested for administration according to protocols well known in the art. Thus, in some embodiments, the methods of the present technology can further include storing the population of engineered immune cells and / or administering at least some of the cells of the population of engineered immune cells to a subject in need thereof.

[0146] In some embodiments, engineered immune cells (e.g., CAR-T cells) can be formulated for long-term storage. In some embodiments, engineered immune cells (e.g., CAR-T cells) can be cryopreserved. Methods for cryopreservation are well known to those of skill in the art. For example, engineered immune cells (e.g., CAR-T cells) can be suspended in a cell cryopreservation solution containing a cryoprotectant (e.g., dimethyl sulfoxide) and human serum albumin and subjected to freezing at −80° C. for 1 day, and the cryopreserved cells can be further stored in liquid nitrogen (LN) (e.g., below −150° C.). Many factors during cryopreservation can affect the quality of engineered immune cells (e.g., CAR-T cells) and, ultimately, the outcome of cell therapy. These factors include, for example, (1) formulation and introduction of the freezing medium, (2) cooling rate, (3) storage conditions, (4) thawing conditions, and (5) post-thaw processing. Optimizing such factors to achieve the desired outcome of cell therapy is within the capabilities of those of skill in the art.

[0147] formulation The engineered immune cells (e.g., CAR-T cells) of the present technology and compositions comprising them can be conveniently provided as sterile liquid preparations, such as isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which can be buffered to a selected pH. Liquid preparations are usually easier to prepare than gels, other viscous compositions, and solid compositions. In addition, liquid compositions are somewhat more convenient for administration, particularly by injection. On the other hand, viscous compositions can be formulated within an appropriate viscosity range to provide longer contact times with specific tissues. Liquid or viscous compositions can contain a carrier, which can be a solvent or dispersion medium, for example, water, saline, phosphate-buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof.

[0148] Sterile injectable solutions can be prepared by incorporating the compositions of the presently disclosed subject matter in the required amount of an appropriate solvent with various amounts of other ingredients, if desired. Such compositions can be in admixture with a suitable carrier, diluent, or excipient, such as sterile water, saline, glucose, dextrose, or the like. These compositions can also be lyophilized. These compositions can contain auxiliary substances, such as wetting agents, dispersing or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity-enhancing additives, preservatives, flavoring agents, coloring agents, and the like, depending on the desired route of administration and preparation. Standard textbooks, such as "REMINGTON'S PHARMACEUTICAL SCIENCE," 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations without undue experimentation.

[0149] Various additives can be added to enhance the stability and sterility of the composition, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Prevention of microbial action can be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. The use of absorption-delaying agents, such as aluminum monostearate and gelatin, can bring about sustained absorption of injectable pharmaceutical forms. However, according to the presently disclosed subject matter, any vehicle, diluent, or additive used must be compatible with the engineered immune cells (e.g., CAR-T cells) of the presently disclosed subject matter.

[0150] The composition can be isotonic, i.e., have the same osmotic pressure as blood and tears. The desired isotonicity of the composition of the presently disclosed subject matter can be achieved using sodium chloride or other pharmaceutically acceptable agents, such as dextrose, boric acid, sodium tartrate, propylene glycol, or other inorganic or organic solutes. Sodium chloride is particularly suitable for buffers containing sodium ions.

[0151] If desired, the viscosity of the composition can be maintained at a selected level using a pharmaceutically acceptable thickening agent. Methylcellulose can be used because it is readily and economically available and easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, carbomer, etc. The concentration of the thickening agent can depend on the selected drug. The important point is to use an amount that will achieve the selected viscosity. Obviously, the selection of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, for example, a liquid dosage form (e.g., whether the composition is formulated into a solution, suspension, gel, or other liquid form such as a time-release form or liquid-filled form).

[0152] Those skilled in the art will recognize that the components of the composition should be selected to be chemically inert and not affect the viability or efficacy of the engineered immune cells (e.g., CAR-T cells) described in the presently disclosed subject matter. This does not present any challenge to those skilled in the art familiar with chemical and pharmaceutical principles, or can be easily circumvented by reference to standard textbooks or by simple experimentation (without undue experimentation) given the present disclosure and the documents cited herein.

[0153] One consideration regarding the therapeutic use of engineered immune cells (e.g., CAR-T cells) of the presently disclosed subject matter is the amount of cells needed to achieve optimal efficacy. The amount of cells administered will vary depending on the subject being treated. In certain embodiments, about 10 2 ~about 10 12 pieces, about 10 3 ~about 10 11 pieces, about 10 4 ~about 10 10 pieces, about 10 5 ~about 10 9 pieces, or about 10 6 ~about 10 8The engineered immune cells (e.g., CAR-T cells) of the presently disclosed subject matter are administered to a subject. More effective cells can be administered in even smaller numbers. In some embodiments, at least about 1 x 10 8 , about 2×10 8 , about 3×10 8 , about 4×10 8 , about 5×10 8 , about 1×10 9 , about 5×10 9 , about 1×10 10 , about 5×10 10 , about 1×10 11 , about 5×10 11 , about 1×10 12 One or more engineered immune cells (e.g., CAR-T cells) of the presently disclosed subject matter are administered to a human subject. The precise determination of what will be considered an effective dose may be based on individual factors for each subject, including the size, age, sex, weight, and condition of the particular subject. Dosage amounts can be readily ascertained by one skilled in the art from this disclosure and knowledge in the art. Generally, engineered immune cells (e.g., CAR-T cells) are administered to a patient at a dose that is non-toxic or tolerable.

[0154] Those skilled in the art can readily determine the amounts of cells and optional additives, vehicles, and / or carriers in the compositions administered in the methods of the presently disclosed subject matter. Typically, any additives (in addition to the active cell(s) and / or agent(s)) are present in a phosphate buffered saline solution in an amount of about 0.001% to about 50% by weight, with the active ingredient being present in micrograms to milligrams, such as about 0.0001% to about 5% by weight, about 0.0001% to about 1% by weight, about 0.0001% to about 0.05% by weight, about 0.001% to about 20% by weight, about 0.01% to about 10% by weight, or about 0.05% to about 5% by weight. For any composition administered to animals or humans, and for any particular method of administration, toxicity should be determined, such as by determining the lethal dose (LD) and LD50 in a suitable animal model, e.g., a rodent such as a mouse, and determining the dosage of the composition(s), the concentration of the components in the composition, and the timing of administering the composition(s), to elicit a suitable response. Such determinations do not require undue experimentation from the knowledge of those skilled in the art, this disclosure, and the documents cited herein. Additionally, the time of sequential administration can be ascertained without undue experimentation.

[0155] Administration The engineered immune cells (e.g., CAR-T cells) of the presently disclosed subject matter can be provided systemically or directly to a subject to treat various diseases, including, but not limited to, infectious diseases, autoimmune diseases, or tumors. In certain embodiments, the engineered immune cells (e.g., CAR-T cells) are directly injected into an organ of interest. Additionally or alternatively, the engineered immune cells (e.g., CAR-T cells) are indirectly provided to an organ of interest, for example, by administration into the circulatory system or into a tissue of interest. Growth and differentiation agents can be provided before, during, or after administration of the cells and compositions to increase the production of engineered immune cells (e.g., CAR-T cells) in vitro or in vivo.

[0156] The engineered immune cells (e.g., CAR-T cells) of the presently disclosed subject matter can be administered systemically or locally in any physiologically acceptable vehicle, typically intravascularly, intraperitoneally, intrathecally, or intrapleurally, although they may also be introduced into bone or other convenient sites where the cells can find a suitable site for regeneration and differentiation (e.g., the thymus). In certain embodiments, at least 1 x 10 5 cells can be administered, ultimately reaching 1 × 10 10 In certain embodiments, at least 1×10 6 Individual cells can be administered. A cell population containing engineered immune cells (e.g., CAR-T cells) can include a population of purified cells. Those skilled in the art can easily determine the percentage of engineered immune cells (e.g., CAR-T cells) in a cell population using various well-known methods, such as fluorescence-activated cell sorting (FACS). The purity range of a cell population containing engineered immune cells (e.g., CAR-T cells) can be about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to about 100%. The dosage can be easily adjusted by those skilled in the art (e.g., a decrease in purity may require an increase in dosage). Engineered immune cells (e.g., CAR-T cells) can be introduced by injection, catheter, or the like. If desired, factors including, but not limited to, interleukins such as IL-2, IL-3, IL-6, IL-11, IL-7, IL-12, IL-15, IL-21, and other interleukins, colony stimulating factors such as G-, M-, and GM-CSF, interferons such as gamma interferon, can also be included.

[0157] In certain embodiments, the compositions of the presently disclosed subject matter include pharmaceutical compositions comprising engineered immune cells (e.g., CAR-T cells) and a pharmaceutically acceptable carrier. Administration can be autologous or non-autologous. For example, engineered immune cells (e.g., CAR-T cells) and compositions comprising them can be obtained from one subject and administered to the same subject or a different compatible subject. Peripheral blood-derived immune cells of the presently disclosed subject matter or their progeny (e.g., derived in vivo, ex vivo, or in vitro) can be administered via catheter administration, systemic injection, local injection, local injection, including intravenous injection, or parenteral administration. When administered, the pharmaceutical compositions of the presently disclosed subject matter can be formulated in a unit dosage form for injection (solution, suspension, emulsion).

[0158] In another aspect, the disclosure provides a method of generating a population of engineered immune cells, the method comprising: (i) culturing a population of immune cells (the culturing step); (ii) contacting the population of immune cells with a nucleic acid molecule comprising a nucleotide sequence encoding a heterologous amino acid sequence, thereby providing a population of engineered immune cells (the transduction step); (iii) culturing the population of engineered immune cells obtained from step (ii) (the ex vivo expansion step); and (iv) harvesting the population of engineered immune cells for storage or administration, wherein steps (i), (ii), and / or (iii) are performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12.

[0159] In some embodiments, step (i) is performed in the absence of a stimulatory agent (eg, a stimulatory agent that comprises a CD3 binding domain).

[0160] In some embodiments, step (i), step (ii), and / or step (iii) are performed at least in part in the presence of IL-15, IL-1b, and IL-12.

[0161] In some embodiments, step (i), step (ii), and / or step (iii) are performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12, wherein the presence of (a) IL-15 and (b) IL-1b and / or IL-12 expands a subset of naive T cells or stem cell memory T cells.

[0162] In some embodiments, step (iii) results in the expansion of the population of engineered immune cells.

[0163] In some embodiments, for the ex vivo expansion step, the engineered immune cells may be cultured for about 3 hours to about 21 days, or any integer value in between. Several stimulation cycles may also be desired, such that the culture time of the engineered immune cells may be 60 days or longer. In some embodiments, the population of engineered immune cells obtained from step (ii) may be cultured for about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days. Conditions suitable for T cell culture for ex vivo expansion are essentially the same as those discussed above for the culture and / or transduction steps.

[0164] In another aspect, the disclosure provides a method of expanding a population of a subset of naive T cells or stem cell memory T cells, the method comprising contacting a population of immune cells with (a) IL-15 and (b) IL-1b and / or IL-12.

[0165] In some embodiments, the presence of (a) IL-15 and (b) IL-1b and / or IL-12 in the culturing step, transduction step, and / or ex vivo expansion step reduces, e.g., about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, or about 25% to about 30% of the total IL-15-containing antibody, compared to a control (e.g., a culturing step, transduction step, and / or ex vivo expansion step without IL-15 and IL-1b and / or IL-12). Significantly increasing transduction efficiency by about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 95% to about 100%, or more.

[0166] In some embodiments, the presence of (a) IL15 and (b) IL-1b and / or IL-12 in the culturing, transduction, and / or ex vivo expansion steps reduces the expression of IL-1b and / or IL-12 by, for example, about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% or more of the IL-1b and / or IL-12 compared to a control (e.g., an equivalent method of generating a population of engineered immune cells, such as using IL-2 plus TransAct™ activation). The present invention significantly increases the population of high-potency T cells by about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 95% to about 100%, or more. In some embodiments, high-potency T cells include, but are not limited to, naive T cells and / or stem cell memory T cells.

[0167] In some embodiments, the presence of (a) IL15 and (b) IL-1b and / or IL-12 in the culturing and / or transduction steps significantly increases the number of engineered immune cells produced (cell count) compared to a control (e.g., a culturing and / or transduction step without IL-15 and IL-1b and / or IL-12), e.g., about 2 to about 10-fold, about 3 to about 10-fold, about 4 to about 10-fold, about 5 to about 10-fold, about 6 to about 10-fold, or more. Cell count can be measured by methods known in the art, including, but not limited to, methods using a hemocytometer and / or an automated cell counter.

[0168] In another aspect, the disclosure provides a method of expanding a population of gamma delta T cells, the method comprising contacting the population of gamma delta T cells with IL-12 and / or IL-15. In some embodiments, the gamma delta T cells are contacted with IL-12. In some embodiments, the gamma delta T cells are contacted with IL-15. In some embodiments, the gamma delta T cells are contacted with IL-12 and IL-15. In some embodiments, the gamma delta T cells are contacted with IL-12 and IL-1b. In some embodiments, the gamma delta T cells are contacted with IL-15 and IL-1b. In some embodiments, the gamma delta T cells are contacted with IL-12, IL-15, and IL-1b.

[0169] In some embodiments, the presence of one or more of IL-12, IL-15, and IL-1b with the gamma delta T cells significantly increases the number of gamma delta T cells generated, e.g., by about 2 to about 15 fold, about 3 to about 15 fold, about 4 to about 15 fold, about 5 to about 15 fold, about 6 to about 15 fold, or more, compared to a control (e.g., no contact of the gamma delta T cells with one of IL-12, IL-15, and IL-1b). Cell number can be measured by methods known in the art, including, but not limited to, using a hemocytometer and / or an automated cell counter. [Example]

[0170] General Experimental Methods The following materials and methods were used in the examples below.

[0171] Basal cell culture medium was prepared by adding 2.6% OpTmizer Expansion Basal Supplement (Thermo Fisher Scientific), 1% L-glutamine (Thermo Fisher Scientific), 1% streptomycin, and 2% CTS Immune Cell SR (Thermo Fisher Scientific) to OpTmizer CTS T-Cell Expansion Basal Medium (Thermo Fisher Scientific). SK-Hep culture medium: MEM, L-Gln(+) (Thermo Fisher Scientific) was prepared by adding 10% FBS (Biosera Co., Ltd.), 1% non-essential amino acids (Fujifilm Wako Pure Chemical Industries, Ltd.), 1% penicillin-streptomycin solution (Fujifilm Wako Pure Chemical Industries, Ltd.), and 1 mM sodium pyruvate (Fujifilm Wako Pure Chemical Industries, Ltd.). GSU-Luc cell culture medium: RPMI1640 (Thermo Fisher Scientific) was prepared by adding 10% FBS (Biosera Co., Ltd.) and 1% penicillin-streptomycin solution (Fujifilm Wako Pure Chemical Industries, Ltd.).

[0172] The cytokines used were MACS GMP® recombinant human IL-1b (Miltenyi Biotec.), MACS GMP® recombinant human IL-2 (Miltenyi Biotec.), MACS GMP® recombinant human IL-3 (Miltenyi Biotec.), MACS GMP® recombinant human IL-4 (Miltenyi Biotec.), MACS GMP® recombinant human IL-6 (Miltenyi Biotec.), MACS GMP® recombinant human IL-7 (Miltenyi Biotec.), MACS GMP® recombinant human IL-12 (Miltenyi Biotec.), MACS GMP® recombinant human IL-15 (Miltenyi Biotec.), and MACS GMP® recombinant human IL-21 (Miltenyi Biotec.). The cytokine cocktail contained all of the above cytokines.

[0173] Generation of genetically engineered T cells: After thawing Leukopak (Hemacare) or gamma delta T cells (Hemacare), cells were diluted to 4.0 × 10 in basal medium. 6 The cell suspension was diluted to 17.5:1 or less cells / mL. The cell suspension:MACS GMP T-Cell TransACT™ (Miltenyi Biotec) was seeded into a culture bag and cultured for 2 days (activation step). The activated cells were diluted into basal medium using a LOVO Cell processing system (Fresenius Kabi) or a centrifuge, and then transfected with RetroNectin® (Takara Bio Co., Ltd.) and the mCherry gene. (atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtga(SEQ ID NO: 1)) or a CAR gene 5 cells / cm 2 The transduced cells were seeded at less than 2.2 × 10 cells / ml and cultured for 24 hours (transduction step). 6 cells / cm 2 The cells were seeded at 0.1% CO2 and cultured for 4 days or more to generate mCherry gene-expressing T cells or CAR gene-expressing T cells.

[0174] Flow cytometry was used to determine T cell transduction rates and immunophenotypes: Dead cells were removed from samples using Zombie-NIR Fixable Viability Dye (BioLegend). The mCherry and CAR gene transduction rates of T cells were determined using a BD FACSCanto II flow cytometer (BD Biosciences). Anti-CAR antibodies were used to measure CAR transduction rates. T cell immunophenotypes were measured using anti-CD4 (BioLegend), anti-CD8 (BioLegend), anti-CCR7 (BioLegend), anti-CD45RA (BD Biosciences), anti-CD27 (BioLegend), and anti-CD95 (BioLegend) antibodies. CCR7 / CD45RA / CD27 / CD95-positive cells in the CD4+ or CD8+ T cell population were used as stem cell memory T cells, and the remaining CCR7 / CD45RA-positive cells were used as naive T cells.

[0175] Determination of surface marker expression on T cells using flow cytometry: The expression levels of several surface markers on T cells were determined by defining them using anti-CD3 antibody (BioLegend), anti-HLA-DR antibody (BioLegend), anti-CD25 antibody (BD Biosciences), anti-CD38 antibody (BioLegend), anti-CD69 antibody (BioLegend), anti-CD152 (CTLA4) antibody (BD Biosciences), anti-CD223 (LAG3) antibody (BioLegend), anti-CD279 (PD1) antibody (Thermo), anti-CD366 (TIM3) antibody (BD Biosciences), anti-CD28 antibody (BioLegend), anti-CD57 antibody (Miltenyi Biotech), and anti-KLRG1 antibody (BioLegend) on a BD FACSCanto II flow cytometer (BD Biosciences). Forward scatter (FSC) and side scatter (SSC) were also assessed on a BD FACSCanto II flow cytometer.

[0176] Cell cycle analysis: Cell cycle was calculated using a NucleoCounter® NC-3000 (Cheomometec) according to the manufacturer's instructions.

[0177] Metabolite analysis: Supernatants after the activation step were collected and analyzed using BioProfile® FLEX2 (Nova Biomedical) according to the manufacturer's instructions.

[0178] Glucose uptake assay: Measurement of glucose uptake was performed using the Glucose Uptake Assay Kit-Green (Dojindo) according to the manufacturer's instructions.

[0179] Co-culture assay: CAR-T cells (effector cells) and luciferase-expressing SK-HEP-1 cells were seeded into cell culture plates with SK-HFP-1 culture medium at a ratio of 1:1 (0.1M:0.1M per well) of effector to target. After 24 hours of incubation, the effector cells were harvested and counted using an NC-200 instrument. In addition, luciferase activity derived from target cells was measured to determine the target cell killing rate.

[0180] In vivo experiments: GSU-Luc cells were subcutaneously inoculated into NSG mice (Charles River Japan). Seven days after inoculation, CAR-T cells or PBS were intravenously administered to the mice. Tumor volume was determined using a caliper.

[0181] Example 1: T cell aggregation was slightly induced by the cytokine cocktail T cells were cultured without cytokines, with a cytokine cocktail (containing IL-1b, IL-2, IL-3, IL-4, IL-6, IL-7, IL-12, IL-15, and IL-21), or with IL-2 and TransACT™. On day 2, no T cell aggregation was observed when T cells were cultured without cytokines, but T cell aggregation was observed when T cells were cultured with the cytokine cocktail or IL-2 and TransACT™ (Figure 1A). When T cells were cultured with the cytokine cocktail, the size of the aggregates was smaller than when they were cultured with IL-2 and TransACT™ (Figures 1B and 1C).

[0182] Example 2: Generation of genetically engineered T cells with the addition of a cytokine cocktail to the culture medium Genetically engineered T cells were generated as described above (Figure 2A). After generation, the mCherry transduction rate was measured by flow cytometry (Figure 2B). mCherry-positive cells were detected in the cytokine cocktail group, but the positivity was lower than in the IL-2 and TransACT™ groups.

[0183] Example 3: IL-1b, IL-3, IL-7, IL-12, and IL-15 were candidates for generating genetically engineered T cells. Single cytokines were removed from the cytokine cocktail to clarify which cytokines triggered the generation of engineered T cells. Removal of IL-7 or IL-15 significantly reduced cell numbers compared to the cytokine cocktail (Figure 3A). In addition, removal of IL-1b, IL-3, or IL-12 reduced the percentage of mCherry-positive cells. Meanwhile, removal of IL-4 significantly increased mCherry transduction efficiency (Figure 3B). Considering the above results, IL-1b, IL-3, IL-7, IL-12, and IL-15 were candidates for the generation of engineered T cells.

[0184] Example 4: DOE analysis The effects of selected candidate cytokines from Example 3 were statistically evaluated by design of experiments (DoE) analysis using JMP® version 15.0.0 (SAS Institute Inc.).

[0185] The source, level, and response were defined as follows: Based on these components, the experiment was designed (Figure 4A). -Source: IL-1b, IL-3, IL-7, IL-12, and IL-15 -Levels: 0, 10, and 50 μg / mL concentrations -Response: mCherry-positive cells after culture The mCherry-positive cells were calculated by the cell proliferation count and transduction rate of mCherry (Figure 4B-D). The predicted mCherry-positive cells were calculated by the jackknife method, and the p-value was 0.0074, so this experiment performed well (Figure 4E). Considering the above results, IL-1b, IL-12, and IL-15 had a positive effect on the number of mCherry-positive cells (Figure 4F).

[0186] Example 5: IL-1b, IL-12, and IL-15 synergistically promoted some genetically engineered T cells. mCherry-positive T cells were generated using a combination of IL-1b, IL-12, and IL-15. IL-15 and IL-1b or IL-12 synergistically promoted cell number and mCherry-positive cells. Furthermore, mCherry-positive cells were increased when generated using IL-1b, IL-12, and IL-15 compared with cells generated using IL-15 and either IL-1b or IL-12 (Figures 5A and 5B).

[0187] Example 6: IL-1b, IL-12, and IL-15 induced naive / stem cell memory enriched CAR-T cells CAR-T cells were generated using IL-2 and TransACT™, or IL-1b, IL-12, and IL-15. After CAR-T cell generation, the CAR gene transduction rate was measured by flow cytometry (Figure 6A).

[0188] Additionally, T cell phenotypes were also measured as described above (Figure 6B). CD45RA-positive and CCR7-positive naive / stem cell memory T cells were increased in the IL-1b, IL-12, and IL-15 groups compared to the IL-2 and TransACT™ groups (Figure 6B).

[0189] Example 7: IL-1b, IL-12, and IL-15 slightly increased cell proliferation and cell size T cells were cultured for 2 days with IL-2 and TransACT™, as well as IL-1b, IL-12, and IL-15. After culture, cell number, cell cycle, and cell diameter were measured using an NC-3000 (Figures 7A-7B and 8A).

[0190] In addition, FSC and SSC were also measured by flow cytometry (Figure 8B). Cell proliferation and cell size increased in the IL-1b, IL-12, and IL-15 groups compared to the no-additive group. However, they decreased in the IL-1b, IL-12, and IL-15 groups compared to the IL-2 and TransACT™ groups.

[0191] Example 8: IL-1b, IL-12, and IL-15 did not cause a decrease in CD3 expression T cells were cultured for 2 days with IL-2 and TransACT™, as well as IL-1b, IL-12, and IL-15. After culture, CD3 expression was measured by flow cytometry. CD3 expression did not decrease in the IL-1b, IL-12, and IL-15 groups.

[0192] Example 9: Expression of cell surface markers CD3 expression was downregulated in T cells stimulated with IL-2 and TransACT™, whereas CD3 expression in cells stimulated with cytokines was unchanged (Figure 9), indicating that cytokine stimulation did not occur via CD3 ζ signaling because cell surface CD3 molecules are internalized upon TCR-CD3 stimulation.

[0193] We assessed the expression levels of several surface markers known to be functional for T cells. HLA-DR, CD25, CD38, and CD69 are known activation markers (Figures 10A-D), CTLA4, LAG3, PD1, and TIM3 are known exhaustion markers (Figures 11A-D), and CD28, CD57, and KLRG1 are known senescence markers (Figures 12A-C). Comparing cytokine-stimulated cells with cells stimulated with IL-2 and TransACT™, we observed similar expression of activation and senescence markers in both types of cells, but the expression of exhaustion markers in cytokine-stimulated cells was lower than that in cells stimulated with IL-2 and TransACT™.

[0194] Example 10: IL-1b, IL-12, and IL-15 did not promote glycolysis and glutaminolysis T cells were cultured for 2 days with IL-2 and TransACT™, as well as IL-1b, IL-12, and IL-15. After culture, glucose, lactose, glutamine, NH4+, and Ca++ in the supernatant were measured using BioProfile FLEX2 (Figures 13A-13D and Figure 15). In addition, a glucose uptake test was also performed (Figure 14). As a result, glycolysis and gluaminolysis were promoted in the IL-1b, IL-12, and IL-15 groups compared to the no-additive group. However, these were further increased in the IL-2 and TransACT™ groups compared to the IL-1b, IL-12, and IL-15 groups.

[0195] Example 11: Long-term expansion of CAR-T cells CAR-T cells were generated using IL-2 and TransACT™, or IL-1b, IL-12, and IL-15. After generation, CAR-T cells were cultured with IL-2, or IL-1b, IL-12, and IL-15. Cell numbers after long-term culture were increased in the IL-1b, IL-12, and IL-15 group compared to the IL-2 and TransACT™ group (Figure 16).

[0196] Example 12: IL-1b, IL-12, and IL-15 promoted genetically engineered gamma delta T cells mCherry-positive gamma delta T cells were generated using a combination of IL-1b, IL-12, and IL-15. 50 ng / mL of IL-1b, 10 or 50 ng / mL of IL-12, and 10 or 50 ng / mL of IL-15 promoted mCherry-positive gamma delta T cells (Figure 17).

[0197] Example 13: CAR-T cell co-culture experiment CAR-T cells from three different donors generated with IL-2 and TransAct™ or IL-1b, IL-12, and IL-15 were cocultured with SK-Hep-1 tumor cell line cells for one day to confirm their efficacy. After coculture, CAR-T cell proliferation was greater in CAR-T cells generated with IL-1b, IL-12, and IL-15 than in CAR-T cells generated with IL-2 and TransAct™ (Figure 18A). Additionally, CAR-T cells generated with IL-1b, IL-12, and IL-15 exhibited higher killing activity compared with CAR-T cells generated with IL-2 and TransAct™ (Figure 18B). These results indicated that CAR-T cells generated with IL-1b, IL-12, and IL-15 had a more potent phenotype.

[0198] Example 14: In vivo studies with CAR-T cells generated by IL-1b, IL-12, and IL-15 CAR-T cells generated with IL-1b, IL-12, and IL-15 were administered to NSG mice 7 days after tumor cell inoculation. The CAR-T cells demonstrated in vivo efficacy (Figure 19).

[0199] Example 15: Gamma delta T cell proliferation with IL-12 or IL-15 Thaw gamma delta T cells (Hemacare) and dilute the cells to 4.0 x 10 6 The cells were diluted to 0.1 cells / mL or less. Cells were cultured in cytokine-containing culture medium for 7 days. Gamma delta T cells cultured with IL-12 or IL-15 without TransAct™ showed cell proliferation (Figure 20).

Claims

1. 1. A method for generating a population of engineered immune cells, said method comprising: (i) culturing a population of immune cells; (ii) contacting the population of immune cells with a nucleic acid molecule comprising a nucleotide sequence encoding a heterologous amino acid sequence, thereby providing the population of engineered immune cells; (iii) harvesting the population of engineered immune cells; The foregoing method, wherein step (i) and / or step (ii) is at least partially carried out in the presence of (a) IL-15 and (b) IL-1b and / or IL-12.

2. 2. The method of claim 1, wherein step (i) is performed in the absence of a stimulatory agent comprising a CD3 binding domain and / or a TCR binding domain.

3. 2. The method of claim 1, wherein step (i) and / or step (ii) is performed at least in part in the presence of IL-15, IL-1b, and IL-12.

4. The method of claim 1 , wherein the population of immune cells comprises T cells.

5. 10. The method of claim 1, wherein the heterologous amino acid sequence comprises a chimeric antigen receptor (CAR), thereby providing the engineered population of immune cells that express the CAR.

6. The method of claim 1 , wherein the nucleic acid molecule is a viral vector.

7. The method of claim 6 , wherein the viral vector is a retroviral vector.

8. 2. The method of claim 1, wherein step (i) and / or step (ii) is performed at least in part in the presence of (a) IL-15 and (b) IL-1b and / or IL-12, and wherein the presence of (a) IL-15 and (b) IL-1b and / or IL-12 expands a subset of naive T cells or stem cell memory T cells.

9. 1. A method for generating a population of engineered immune cells, said method comprising: (i) culturing a population of immune cells; (ii) contacting the population of immune cells with a nucleic acid molecule comprising a nucleotide sequence encoding a heterologous amino acid sequence, thereby providing the population of engineered immune cells; (iii) culturing the population of engineered immune cells obtained from step (ii); and (iv) harvesting the population of engineered immune cells for storage or administration; The foregoing methods, wherein step (i), step (ii), and / or step (iii) are at least partially carried out in the presence of (a) IL-15 and (b) IL-1b and / or IL-12.

10. 10. The method of claim 9, wherein step (i) is performed in the absence of a stimulatory agent comprising a CD3 binding domain and / or a TCR binding domain.

11. 10. The method of claim 9, wherein step (i), step (ii), and / or step (iii) is performed at least in part in the presence of IL-15, IL-1b, and IL-12.

12. 10. The method of claim 9, wherein the population of immune cells comprises T cells.

13. 10. The method of claim 9, wherein the heterologous amino acid sequence comprises a chimeric antigen receptor (CAR), thereby providing the engineered population of immune cells that express the CAR.

14. The method of claim 9 , wherein the nucleic acid molecule is a viral vector.

15. The method of claim 14, wherein the viral vector is a retroviral vector.

16. 10. The method of claim 9, wherein step (iii) results in expansion of the engineered population of immune cells.

17. 10. The method of claim 9, wherein step (i), step (ii), and / or step (iii) are performed at least in part in the presence of (a) IL-15 and (b) IL-lb and / or IL-12, and wherein the presence of (a) IL-15 and (b) IL-lb and / or IL-12 expands a subset of naive T cells or stem cell memory T cells.

18. 1. A method for expanding a population of a subset of naive T cells or stem cell memory T cells, the method comprising contacting a population of immune cells with (a) IL-15 and (b) IL-1b and / or IL-12.

19. A composition comprising a population of immune cells and (a) IL-15 and (b) IL-1b and / or IL-12.

20. 20. The composition of claim 19, wherein the composition comprises IL-15 as well as IL-1b and IL-12.

21. 20. The composition of claim 19, wherein the population of immune cells comprises engineered immune cells.

22. 22. The composition of claim 21, wherein the engineered population of immune cells expresses a chimeric antigen receptor (CAR).

23. 20. The composition of claim 19, wherein the population of immune cells comprises T cells.

24. A method of increasing a population of gamma delta T cells, the method comprising contacting the population of gamma delta T cells with IL-12.

25. 25. The method of claim 24, wherein the method further comprises contacting the population of gamma delta T cells with IL-15 or IL-1b.

Images