Gene vector regulation by cardiomyocyte-expressed microRNAs

Gene therapy vectors with microRNA binding sites and compositions of MYOCD and ASCL1 enhance the efficiency and safety of reprogramming cells into cardiomyocytes, addressing the limitations of current direct cardiac reprogramming methods and improving heart disease models.

JP2026076236APending Publication Date: 2026-05-11TENAYA THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
TENAYA THERAPEUTICS INC
Filing Date
2026-01-20
Publication Date
2026-05-11

AI Technical Summary

Technical Problem

Current methods for direct cardiac reprogramming lack effective and efficient vector systems for reprogramming cells into cardiomyocytes, necessitating improved strategies for gene therapy vectors.

Method used

Development of gene therapy vectors with microRNA binding sites that selectively suppress transgene expression in cardiomyocytes and cardiac progenitor cells, utilizing vectors like AAV to enhance cell-type specificity and safety, and compositions including MYOCD and ASCL1 with microRNAs to increase reprogramming efficiency.

Benefits of technology

The vectors enhance the efficacy and safety of in vivo gene therapy by specifically reprogramming cells into cardiomyocytes, improving cardiac function and reducing fibrosis in models of heart disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026076236000001_ABST
    Figure 2026076236000001_ABST
Patent Text Reader

Abstract

Providing gene vector regulation using microRNAs expressed in cardiomyocytes. [Solution] This disclosure provides vectors and methods of using them for cell-type-specific repression of the expression of transgenes (e.g., cardiomyocyte reprogramming factors) using microRNA binding sites. The present invention generally relates to vectors and methods of using them for cell-type-specific repression of the expression of transgenes (e.g., cardiomyocyte reprogramming factors). This disclosure provides vectors comprising microRNA binding sites configured to promote specific repression of the expression of transgenes (e.g., cardiomyocyte reprogramming factors) in cardiomyocytes and cardiomyocyte progenitor cells compared to cardiac fibroblasts.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 62 / 984,183, filed on 2 March 2020, the contents of which are incorporated herein by reference in their entirety.

[0002] Sequence listing reference This application was filed electronically via EFS-Web and includes a sequence listing filed electronically in .txt format. The .txt file contains a sequence listing titled "TENA_017_01WO_SeqList_ST25.txt", created on February 25, 2021, with a size of 230 kilobytes. The sequence listing contained in this .txt file is part of this specification and is incorporated herein by reference in its entirety.

[0003] This disclosure generally relates to gene therapy vectors. [Background technology]

[0004] Direct cardiac reprogramming has emerged as a strategy for creating new cardiomyocytes, leading to improved cardiac function in patients diagnosed with or at risk of cardiomyopathy, heart failure, or other heart diseases. Various combinations of genetic and chemical reprogramming factors have been shown to facilitate the reprogramming of other cells (e.g., fibroblasts) into cardiac cells (particularly cardiomyocytes). For example, a combination of three cardiac development transcription factors—GATA4, MEF2C, and TBX5 (GMT)—can be used to reprogram dermal or cardiac fibroblasts into induced cardiomyocyte (iCM)-like cells in mice. When GATA4, MEF2C, TBX5, MESP1, and MYOCD (GMTMM) are expressed together as a cocktail of factors, they change the cell morphology from spindle-shaped to rod-shaped, and the cells spontaneously increase Ca 2+Induce vibration. HAND2, NKX2.5, microRNAs miR-1 and miR-133, JAK or TGF-β have been shown to promote such reprogramming. In humans, addition of ETS2 and MESP1 to GMT induces heart-specific gene expression and sarcomere formation. As outlined in Srivastava and DeWitt. Cell 166:1386-96 (2016), other combinations of factors for direct reprogramming have been described in the art. However, there remains a need in the art for alternative and improved reprogramming methods such as vectors or vector systems and means for implementing those methods. The present disclosure addresses this unmet need.

Prior Art Documents

Non-Patent Documents

[0005]

Non-Patent Document 1

Summary of the Invention

[0006] The present invention generally relates to vectors for cell-type specifically suppressing the expression of transgenes (e.g., cardiomyocyte reprogramming factors) and methods of using them. The present disclosure provides vectors comprising microRNA binding sites configured to promote specific suppression of transgene (e.g., cardiomyocyte reprogramming factor) expression in cardiomyocytes and cardiac progenitor cells compared to cardiac fibroblasts. In some embodiments, the microRNA is selected by measuring the expression of one or more microRNAs in cardiac fibroblasts against an identified microRNA that is expressed during the programming process and optionally expressed in the later stages of the reprogramming process, by treating cardiac fibroblasts with an effective amount of a composition that induces reprogramming of cardiac fibroblasts to cardiomyocytes. In some embodiments, the selected microRNA is expressed in cardiac fibroblasts only after a predetermined time. In some embodiments, tissue and cell-type specific expression suppression enables expression in a target cell type (e.g., cardiac fibroblasts) while suppressing expression in a non-target cell type (e.g., cardiomyocytes). In some embodiments, the microRNA binding site enables expression in the target cell for a time sufficient to cause an effective conversion of the target cell to a non-target cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] [Figure 1] Shows a vector map according to one embodiment. [Figure 2A] Shows suppression of GFP transgene expression evaluated by flow cytometry analysis 4 days after transduction of iPSC-CMs with AAV at MOI 160k. [Figure 2B] Shows the lack of suppression of GFP transgene expression evaluated by flow cytometry analysis 4 days after transduction of hCFs with AAV at MOI 160k. [Figure 3] Shows suppression of GFP transgene expression evaluated by flow cytometry analysis 4 days after transduction of iPSC-CMs with AAV at MOI 500k. [Figure 4]The expression levels of microRNAs measured by qPCR after treatment with the MyΔ3A reprogramming cocktail are shown, compared to human iPSC-CMs. [Figure 5A] This shows the flow cytometry analysis of iPSC-CM four days after transduction using AAV (MOI 500k). [Figure 5B] This shows the flow cytometry analysis of hCF two days after transduction by AAV (MOI 160k). [Figure 5C] This shows immunofluorescence analysis three weeks after AAV reprogramming of MOI 640k. [Figure 6A] Throughout the study, MyΔ3A with the miR-208 target cassette demonstrates its effectiveness against myocardial infarction, as measured by dynamic echocardiographic data of ejection fraction %. [Figure 6B] The echocardiographic data at the end of the in vivo trial, 8 weeks after injection, shows a significant increase in all groups compared to the negative control encoding GFP (n=10-13 mice / group). [Figure 6C] This shows an analysis of fibrosis based on trichrome staining, in which muscle is stained red and fibrous tissue is stained blue. Quantification of the percentage of fibrous cardiac cross-sections across all groups showed a significant reduction in all treatment groups (n=6-8 hearts / group, 5 cross-sections / heart). [Figure 6D] Representative trichrome-stained cardiac cross-sections of negative controls and AAV5z:MyΔ3A_208_4 are shown. [Figure 7] This graph shows the change in ejection percentage in treated and untreated pigs with ischemic injury up to 9 weeks after injection. [Figure 8] This shows the flow cytometry analysis of iPSC-CM four days after transduction using AAV (MOI 500k). [Figure 9] This graph shows the ejection fraction percentage in a study of ischemic injury in rats four weeks after injection. [Modes for carrying out the invention]

[0008] The inventors have recognized that the cell type specificity of a gene therapy vector can be enhanced by including a selected microRNA binding site within the vector. The vectors of this disclosure utilize binding sites to microRNAs expressed in cardiomyocytes or cardiomyocyte progenitor cells to suppress the expression of transgenes in those cell types. These vectors may enhance the efficacy and / or safety of in vivo gene therapy. In some embodiments, expression is tolerated and / or maintained in the target cell type, while being suppressed in other cell types (e.g., skeletal muscle). In some embodiments, the target cell type is cardiac fibroblasts. In some embodiments, the target cell type is cells that can be reprogrammed into cardiomyocytes (e.g., for in vivo cell reprogramming). In some embodiments, the target cell type is cells with functional defects due to loss-of-function mutations in genes (e.g., for gene replacement therapy). Some embodiments of the vectors of this disclosure utilize microRNA binding sites to microRNAs expressed later in the reprogramming process. In such embodiments, the selection of microRNA binding sites enables the expression of cardiomyocyte reprogramming factors from the vector without early expression suppression.

[0009] This disclosure further provides compositions and methods for generating cardiomyocytes from non-cardiomyocytes, for example, by directly reprogramming cells into cardiomyocytes. The ability of selected microRNAs to reprogram cells into cardiomyocytes is limited or nonexistent, but is increased when the selected microRNAs are expressed together with MYOCD and ASCL1, or MYOCD alone. Furthermore, the ability of MYOCD, ASCL1, or MYOCD and ASCL1 to reprogram cells into cardiomyocytes is increased by the expression of selected microRNAs. Accordingly, this disclosure provides compositions that can express MYOCD and microRNAs, or MYOCD, ASCL1, and microRNAs, as well as methods for using them. Advantageously, the reprogramming of differentiated cells (e.g., fibroblasts) into cardiomyocytes is enhanced compared to the expression of these factors alone.

[0010] This disclosure provides compositions such as vectors comprising a microRNA, a MYOCD protein, and one or more polynucleotides collectively encoding the ASCL1 protein, optionally. When a single vector is used, the coding polynucleotides may be provided in any 5' to 3' order within the vector, and on the same or different polynucleotide chains within the vector. This disclosure further provides vector systems comprising two or more vectors. Some vectors are polycistronic vectors, such as, but not limited to, 2A-binding polycistronic vectors, including, for example, vectors containing the MYOCD-2A-ASCL1 or ASCL1-2A-MYOCD polynucleotides.

[0011] Vectors include, but are not limited to, lipid nanoparticles, transposons, adeno-associated virus (AAV) vectors, adenoviruses, retroviruses, embedded lentiviral vectors (LVVs), and non-embedded LVVs, encompassing both viral and nonviral vectors. Each polynucleotide optionally has a heterologous sequence that shares sequence identity with the native human polynucleotide sequence of the corresponding gene, or encodes a protein that is identical to or shares sequence identity with the corresponding native human protein. In some embodiments, the MYOCD protein encoded by the MYOCD polynucleotide is an engineered myocardin. For example, a MYOCD may be designed to include an internal deletion that reduces its size while maintaining its function.

[0012] This disclosure further provides methods for using the aforementioned vectors and vector systems. These methods include inducing a cardiomyocyte phenotype in differentiated cells (in vivo or in vitro) and treating heart disease in subjects with or at risk of developing heart disease. This disclosure further provides kits containing vectors and vector systems with instructions for use in the treatment of heart disease.

[0013] This disclosure provides methods and compositions for generating iCM cells (in vivo, in vitro, or ex vivo) by reprogramming other cell types. In particular, the inventors have discovered that differentiated cells, such as fibroblasts, can be reprogrammed into cardiomyocytes by the expression of microRNA and MYOCD and / or ASCL1.

[0014] MicroRNAs ("miRNAs") are small non-coding RNA molecules that function in RNA silencing and post-transcriptional regulation of gene expression through base pairing with complementary sequences within messenger RNA (mRNA) molecules. Standard nomenclature uses the prefix "miR" followed by a dash and a number. "miR-" indicates the mature form of the miRNA. "mir-" indicates primary mRNA (pri-miRNA) or precursor miRNA (pre-miRNA), and "MIR" indicates the coding gene. Nearly identical miRNAs are annotated with an additional lowercase letter. The species of origin is specified by a three-letter prefix; for example, humans are "hsa-". miRNA genes that lead to the same mature miRNA but are located at different locations in the genome are indicated by an additional dash-number suffix, e.g., miR-194-1 and mir-194-2. Natural human miRNAs are typically transcribed as pri-miRNAs of over 100 nucleotides, which are then processed to form pre-miRNAs, and these are further processed to form mature miRNAs.

[0015] miRNAs can be expressed from vectors, such as viral vectors, by operably linking the sequence encoding the pre-miRNA to an active promoter in the host cell. For example, Cell Biolabs' pMXs retroviral expression vector is designed to clone and express individual pri-miRNAs while maintaining a putative hairpin structure, ensuring biologically relevant interactions with endogenous processing mechanisms and regulatory partners, resulting in appropriately cleaved microRNAs. In addition to the pre-miRNA, the pri-miRNA may contain its own flanking sequence of approximately 150 bp on each 5' or 3' end, or different flanking sequences may be used to generate the same mature miRNA according to methods known in the art. Examples of target microRNAs include miR-133a-2, miR-133a-1, miR-19b-2, miR-19b-1, miR-326, miR-1-1, miR-1298, miR-133b, miR-1-2, miR-92a-2, miR-20b, miR-20a, miR-141, miR-155, miR-17, hsa-let-7c, miR-202, This includes miR-200a, miR-206, miR-509-1, miR-509-2, miR-124-3, miR-124-2, miR-378a, miR-378e, miR-378h, miR-378i, miR-137, miR-671, miR-24-1, miR-182, miR-302d, miR-96, miR-30c-2, and miR-146b. Table 1 shows the pri-miRNA sequences used to express mature miRNAs. Mature miRNA sequences are shown in uppercase. [Table 1-1] [Table 1-2] [Table 1-3]

[0016] Myocardin (MYOCD) is a smooth muscle and cardiac muscle-specific transcriptional coactivator of serum response factors. When ectopically expressed in non-muscle cells, MYOCD can induce smooth muscle differentiation through association with serum response factors. Du et al. MYOCD is a critical serum response factor cofactor in the transcriptional program regulating smooth muscle cell differentiation.Mol.Cell.Biol.23:2425-37(2003).

[0017] Achaete-scute family bHLH transcription factor 1 (ASCL1) is primarily known for its role in the development of the nervous system, neurons, and neuroendocrine systems. In the context of cellular reprogramming, ASCL1 is known in the art as a factor associated with the conversion of non-neuronal cells into functional neurons. In fact, expression of ASCL1 in combination with other reprogramming factors has been used in the art to convert human induced pluripotent stem cells (hiPSCs) from a cardiomyocyte phenotype to a neuronal type (Tuj1+cTnT-) or neuronal-like phenotype (Tuj1+cTnT+), which is the reverse effect of cardiomyocyte reprogramming. In contrast, this disclosure provides compositions and methods derived from generating iCM cells from fibroblasts using ASCL1.

[0018] I. Definition As used herein, the term “functional cardiomyocyte” refers to a differentiated cardiomyocyte capable of transmitting or receiving electrical signals. In some embodiments, cardiomyocytes transmit action potentials and / or Ca 2+ If a cell exhibits electrophysiological characteristics such as transients, it is said to be a functional cardiomyocyte.

[0019] As used herein, “differentiated non-cardiac cells” are cells that cannot differentiate into all cell types of an adult organism (i.e., not pluripotent cells) and may refer to cells of cell lineages other than the cardiac lineage (e.g., the neural or connective tissue lineage). Differentiated cells include, but are not limited to, pluripotent, compound pluripotent, unipotent, progenitor cells, and terminally differentiated cells. In certain embodiments, less potent cells are considered “differentiated” with respect to more potent cells.

[0020] As used herein, “protein-coding gene” refers to a component of a vector, meaning a polynucleotide that codes for a protein other than the gene relevant to the function of the vector. For example, the term protein-coding gene includes polynucleotides that code for human proteins or functional variants thereof that have reprogramming activity. With respect to a vector, the phrase “vector without other protein-coding genes” is intended to mean that the vector contains a polynucleotide that codes for the enumerated target protein, but does not contain a polynucleotide that codes for another protein that has reprogramming activity, such as another protein known in the art to promote either pluripotency or cardiomyocyte phenotype. The phrase “vector without other protein-coding genes” does not exclude polynucleotides that code for proteins necessary for the function of the vector, which may be optionally present, nor does it exclude non-protein-coding polynucleotides. Such a vector may contain non-coding polynucleotide sequences and polynucleotides that code for RNA molecules (such as microRNAs). Conversely, if only specific protein-coding genes are enumerated, it means that there may be other protein-coding genes present, such as protein-coding genes that code for proteins that further promote reprogramming.

[0021] Somatic cells are the cells that make up the body of an organism. Somatic cells include the cells that make up organs, skin, blood, bones, and connective tissue, but do not include germ cells.

[0022] The terms “cardiac pathology” or “cardiac dysfunction” are used interchangeably and refer to impairments of the heart’s pumping function. These include, for example, impaired contractility, impaired relaxation (sometimes called diastolic dysfunction), abnormal or improper function of heart valves, diseases of the myocardium (sometimes called cardiomyopathy), diseases such as angina pectoris, myocardial ischemia and / or myocardial infarction characterized by insufficient blood supply to the myocardium, infiltrative diseases such as amyloidosis and hemochromatosis, global or localized hypertrophy (which may occur, for example, in certain cardiomyopathy or systemic hypertension), and abnormal intercardiac transmission.

[0023] As used herein, the term “cardiomyopathy” refers to any disease or dysfunction of the myocardium (heart muscle) in which the heart becomes abnormally enlarged, thickened, and / or hardened. As a result, the heart muscle is usually unable to pump blood effectively. The etiology of the disease or disorder may be, for example, inflammatory, metabolic, toxic, invasive, fibrous, hematological, hereditary, or of unknown cause. There are two common types of cardiomyopathy: ischemic (caused by oxygen deficiency) and non-ischemic.

[0024] As used herein, the term “gene of interest” refers to a reprogramming factor or a nucleic acid encoding a reprogramming factor. For example, if the reprogramming factor is a protein, the gene of interest is, as will be apparent from the context, either a protein or a polynucleotide sequence encoding a corresponding protein. The introduction, administration, or other use of the gene of interest should be understood to refer to any means that increases the expression or activity of the gene, gene product, or functional variant of a gene product. Accordingly, in some embodiments, the Disclosure provides a method for generating iCM cells, comprising introducing a polynucleotide of interest, e.g., ASCL1 and / or MYOCD, as a nucleic acid (e.g., deoxyribonucleotide (DNA) or ribonucleotide (RNA)) into target cells as a polynucleotide (e.g., deoxyribonucleotide (DNA) or ribonucleotide (RNA)). The polynucleotide can be introduced into cells by any of the various means known in the Art, including, but not limited to, a virus, a non-viral vector, contacting cells with the naked polynucleotide or a polynucleotide complexed with a transfection reagent, or by electroporation. Using a target gene as a nucleic acid may include the use of gene editing methods, such as indirect modification of the expression or activity of the target gene, for example, gene editing of a locus encoding an endogenous gene, expression of a transcription factor or regulatory factor, contact of a cell with a small molecule activator of the target gene, or a DNA or RNA-based method for modifying the expression or activity of the target gene as a nucleic acid. In some embodiments, the methods of the present disclosure include desuppressing the transcription of a target gene by editing a regulatory region (enhancer or promoter), modifying a splice site, removing or inserting a microRNA recognition site, administering an antagonist to repress microRNA, administering a microRNA mimetic, or any other various means of modulating the expression or activity of the target gene.

[0025] As used herein, “microRNA” refers to mature microRNA. A polynucleotide encoding microRNA generally refers to any polynucleotide whose expression in a host cell leads to the formation of mature microRNA in that cell. A polynucleotide encoding microRNA may share 100% sequence identity with the corresponding preRNA. One or more substitutions in the loop between stems encoding the mature microRNA sequence are sometimes acceptable. While either strand of the double helix may act as a functional miRNA, typically only one strand is incorporated into the RNA-induced silencing complex (RISC), where the miRNA and its mRNA target interact. Conventional techniques for using microRNA are provided, for example, in Lawrie, ed. (2013) MicroRNAs in Medicine.

[0026] As used herein, the terms “subject” or “patient” refer to any animal, such as a domesticated animal, a zoo animal, or a human. A “subject” or “patient” may be a mammal, such as a dog, cat, horse, livestock, a zoo animal, or a human. A subject or patient may also be any domesticated animal, such as a bird, a pet, or a farm animal. Specific examples of “subject” and “patient” include, but are not limited to, individuals with heart disease or impairment, and individuals with characteristics or symptoms associated with heart disease.

[0027] Unless otherwise indicated, the implementation of this disclosure will utilize conventional techniques of tissue culture, immunology, molecular biology, cell biology, and recombinant DNA that are within the scope of the art.

[0028] Unless otherwise indicated by the context, it is particularly intended that the various features of the present invention described herein may be used in any combination. Furthermore, this disclosure is also intended that in some embodiments, any feature or combination of features described herein may be excluded or omitted. For example, where the specification states that a complex comprises components A, B, and C, it is particularly intended that any one of A, B, or C, or any combination thereof, may be omitted and discarded individually or in any combination.

[0029] All numerical expressions, including ranges for pH, temperature, time, concentration, and molecular weight, are approximations that change (+) or (-) as needed, in increments of 1.0 or 0.1, or alternatively by variations of + / - 15%, or alternatively by 10%, or alternatively by 5%, or alternatively by 2%. It should be understood that the term "approximately" is often preceded by all numerical expressions, although this is not always explicitly stated. Such range formats should be understood as being used for convenience and brevity, and should be interpreted flexibly to include all individual numbers or subranges contained within that range, as if each number or subrange were explicitly listed, rather than just the numbers explicitly listed as the limits of the range. For example, a ratio in the range of approximately 1 to approximately 200 should be understood to include the explicitly listed limits of approximately 1 and approximately 200, but also to include individual ratios such as approximately 2, approximately 3, and approximately 4, as well as subranges such as approximately 10 to approximately 50, and approximately 20 to approximately 100. Furthermore, although not always explicitly stated, it should be understood that the reagents described herein are merely examples, and their equivalents are known in the art.

[0030] When used herein and in the appended claims, it should be noted that the singular forms "a," "an," and "the" refer to multiple objects unless the context explicitly indicates otherwise. Therefore, for example, a reference to "cardiomyocytes" refers to multiple cardiomyocytes.

[0031] As used herein, "and / or" means all possible combinations of one or more of the related enumerated items, and the absence of any combination as interpreted alternatively (or).

[0032] When used in relation to the compositions of the present invention, "administer," "to administer," etc., refer to both direct administration, which may be in vitro administration to non-cardiac cells, in vivo administration to non-cardiac cells, administration to a subject by a medical professional, or self-administration by the subject, and / or indirect administration, which may be the act of prescribing the compositions of the present invention. When used herein in relation to cells, it refers to introducing the composition into cells. Typically, an effective amount is administered, and the amount can be determined by those skilled in the art. Any method of administration can be used. Small molecules can be administered to cells, for example, by adding the small molecules to a cell culture medium or by in vivo injection into a site of cardiac injury. Administration to a subject can be achieved, for example, by intravascular injection, intramyocardial delivery, etc.

[0033] As used herein, the term “cardiac cells” refers to any cells present in the heart that perform cardiac functions, such as cardiac contraction or blood supply, or maintain the structure of the heart. As used herein, cardiac cells include cells present in the epicardium, cardiomyocyte, or endocardium of the heart. Cardiac cells also include, for example, cardiomyocytes or myocardial cells, and cells of the cardiovascular system, such as cells of the coronary arteries or veins. Other non-limiting examples of cardiac cells include epithelial cells, endothelial cells, fibroblasts, cardiac stem cells or progenitor cells, cardiac conduction system cells, and cardiac pacemaking cells that make up the cardiomyocyte, blood vessels, and cardiac cell supporting structures. Cardiac cells may be derived from stem cells, for example, embryonic stem cells or induced pluripotent stem cells.

[0034] As used herein, the terms “cardiomyocyte” or “cardiomyocytes” refer to sarcomere-containing striated muscle cells naturally found in the mammalian heart, in contrast to skeletal muscle cells. Cardiomyocytes are characterized by the expression of specialized molecules such as proteins including myosin heavy chain, myosin light chain, and cardiac α-actinin. As used herein, the term “cardiomyocyte” is a comprehensive term that includes any subpopulation or subtype of cardiomyocytes, such as atrial, ventricular, and pacemaker cardiomyocytes.

[0035] The term "cardiomyocyte-like cell" is intended to refer to cells that share characteristics with cardiomyocytes, but not all of them. For example, cardiomyocyte-like cells may differ from cardiomyocytes in the expression of certain cardiac genes.

[0036] The terms “culture” or “cell culture” refer to the maintenance of cells in an artificial in vitro environment. “Cell culture system” is used herein to refer to culture conditions in which a population of cells can grow as a monolayer or in a suspension. “Culture medium” is used herein to refer to a nutrient solution for culturing, growing, or proliferating cells. A medium can be characterized by functional properties such as the ability to maintain cells in a particular state (e.g., pluripotent state, quiescent state, etc.), or the ability to mature cells, or in some embodiments, the ability to promote the differentiation of progenitor cells into a particular lineage of cells (e.g., cardiomyocytes).

[0037] As used herein, “expression” or “to express” refers to the process by which a polynucleotide is transcribed into mRNA, and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. If the polynucleotide originates from genomic DNA, expression may include the splicing of mRNA in eukaryotic cells. The level of gene expression can be determined by measuring the amount of mRNA or protein in a cell or tissue sample.

[0038] As used herein, “expression cassette” is a DNA polynucleotide comprising one or more polynucleotides encoding a protein or nucleic acid, configured to express a polynucleotide in a host cell. Typically, polynucleotide expression is under the control of specific regulatory elements, including constitutive or inducible promoters, tissue-specific regulatory elements, and enhancers. Such polynucleotides are said to be “operatically ligated” or “operatably ligated” to a regulatory element (e.g., a promoter).

[0039] The term “inducible cardiomyocyte” or the abbreviation “iCM” refers to non-cardiomyocytes (and their offspring) transformed into cardiomyocytes (and / or cardiomyocyte-like cells). The methods of this disclosure can be used, for example, in conjunction with any currently known or subsequently discovered methods for generating inducible cardiomyocytes to enhance other techniques.

[0040] As used herein, the term “non-cardiac cells” refers to any cells or cell populations in a cell preparation that do not meet the criteria for “cardiac cells” as defined and used herein. Non-limiting examples of non-cardiac cells include somatic cells, cardiac fibroblasts, non-cardiac fibroblasts, cardiac progenitor cells, and stem cells.

[0041] The term "pharmaceutically acceptable" is used herein to mean a compound, substance, composition, and / or dosage form that is suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, within the bounds of sound medical judgment.

[0042] As used herein in the context of damaged cardiac tissue, terms such as “regenerate” and “regenerate” are given their usual meanings, but also refer to the process of growing and / or developing new cardiac tissue in a damaged heart or cardiac tissue, for example, due to ischemia, infarction, reperfusion, or other disease. In some embodiments, cardiac tissue regeneration includes the generation of cardiomyocytes.

[0043] As used herein, the terms “reprogramming” or “transdifferentiation” refer to the generation of a specific lineage of cells (e.g., cardiac cells) from a different type of cell (e.g., fibroblasts) without an intermediate process of dedifferentiation into cells exhibiting the characteristics of pluripotent hepatocytes. As used herein, “reprogramming” includes transdifferentiation, dedifferentiation, and the like.

[0044] As used herein, “reprogramming activity” means the ability of a protein or polynucleotide to induce or promote the reprogramming of a cell into cardiomyocytes or cardiomyocyte-like cells, either alone or in combination with other proteins or polynucleotides that have reprogramming activity, when induced by or expressed by a cell. For example, if the expression of a first protein in a cell without other factors induces or promotes the reprogramming of the cell, then the first protein has reprogramming activity. However, if the first protein promotes reprogramming in combination with a second protein, i.e., when both the first and second proteins are expressed together, then the first protein also has reprogramming activity, as the term is used herein.

[0045] As used herein, the term “reprogramming efficiency” refers to the number of cells in a sample that have been successfully reprogrammed into cardiomyocytes, relative to the total number of cells in the sample.

[0046] As used herein, the term “reprogramming factor” includes factors introduced for intracellular expression to assist in the reprogramming of cells into induced cardiomyocytes. Reprogramming factors include proteins and nucleic acids (e.g., RNA such as microRNA, siRNA, or shRNA).

[0047] The term "stem cell" refers to a cell that has the ability to self-replicate and produce differentiated offspring. The term "pluripotent stem cell" refers to a stem cell that can produce cells from all three germ layers (endoderm, mesoderm, and ectoderm), but does not have the ability to produce a complete organism.

[0048] "Treatment," "to treat," and "to treat" are defined as using a drug to act on a disease, disorder, or condition and / or its symptoms in order to reduce or improve any adverse or other undesirable effects of the disease, disorder, condition and / or its symptoms.

[0049] Where used herein, terms such as “effective dose” refer to an amount sufficient to induce a desired physiological outcome (e.g., cell reprogramming or disease treatment). An effective dose may be administered in one or more doses, applications, or applications. Such delivery depends on many variables, including the duration of use of individual dosing units, the bioavailability of the composition, and the route of administration. However, it is understood that the specific amount of a composition (e.g., a reprogramming factor) for any particular subject will depend on a variety of factors, including the activity of the particular drug being used, the subject’s age, weight, general health status, sex, and diet, administration time, excretion rate, combination of compositions, the severity of the particular disease being treated, and the form of administration.

[0050] As used herein, the term “its equivalent” with reference to a polypeptide or nucleic acid sequence refers to a polypeptide or nucleic acid that differs from the reference polypeptide or nucleic acid sequence but retains essential properties (e.g., biological activity). A typical variant of a polynucleotide differs in its nucleotide sequence from another reference polynucleotide. Changes in the variant's nucleotide sequence may or may not alter the amino acid sequence of the polypeptide encoded by the reference polynucleotide. Nucleotide changes can result in amino acid substitutions, deletions, additions, fusions, and cleavages in the polypeptide encoded by the reference sequence. Generally, the differences are limited so that the sequences of the reference polypeptide and the variant are very similar overall and identical in many regions.

[0051] The term “isolated” means that cells, tissues, polynucleotides, peptides, polypeptides, proteins, antibodies, or fragments thereof have been separated from the cells and other components with which they normally associate in nature. For example, isolated cells are cells separated from tissues or cells of a different phenotype or genotype. As will be apparent to those skilled in the art, polynucleotides, peptides, polypeptides, proteins, or cells that do not exist in nature do not require “isolation” to distinguish them from their naturally occurring counterparts.

[0052] As used herein, “nucleic acid” and “polynucleotide” are used interchangeably and refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. Non-limiting examples of polynucleotides include linear and cyclic nucleic acids, messenger RNA (mRNA), cDNA, recombinant polynucleotides, vectors, probes, and primers.

[0053] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein and refer to polymeric forms of amino acids of any length, which may include genetically encoded and non-genetically encoded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having a modified peptide backbone. The term includes, but is not limited to, fusion proteins having heterologous amino acid sequences, fusions with heterologous and homologous leader sequences having or not having an N-terminal methionine residue, and immunolabeled proteins.

[0054] As used herein, the term “polynucleotide” preceded by a gene name (e.g., “MYOCD polynucleotide”) refers to a polynucleotide sequence that codes for the corresponding protein (e.g., “MYOCD protein”).

[0055] As used herein, the term “protein” preceded by a gene name (e.g., “MYOCD protein”) refers to either a native protein or a functional variant thereof. A “native protein” is a protein encoded by a genomic copy of a gene in an organism, preferably an organism for which a vector is intended (e.g., a human, rodent, primate, or animal for veterinary purposes), either as a functional isoform of a gene or a functional allele variation.

[0056] As used herein, a “functional variant” of a protein is a variant having any number of amino acid substitutions that retains the functional attributes of the protein, including, for example, the ability of the protein to induce reprogramming of cells into cardiomyocytes in combination with other factors. Functional variants can be identified computationally or experimentally using in vitro or in vivo assays, such as variants having only conserved substitutions.

[0057] As used herein, the term “progenitor cell” refers to a cell that is committed to differentiating into a specific type of cell or forming a specific type of tissue. Like stem cells, progenitor cells can further differentiate into one or more types of cells, but they are more mature and their differentiation potential is more limited / constrained than that of stem cells.

[0058] The term "vector" refers to a complex of macromolecules or molecules, including polynucleotides or proteins, that are delivered to a host cell either in vitro or in vivo.

[0059] As used herein, the term “viral vector” typically refers to either a nucleic acid molecule containing a virus-derived nucleic acid element that facilitates the movement of nucleic acid molecules or their integration into a cell’s genome, or a viral particle that mediates nucleic acid transfer. Viral particles typically contain various viral components in addition to nucleic acids, and sometimes cellular components as well.

[0060] The term "genetic modification" refers to permanent or transient genetic changes induced within a cell after the introduction of a new nucleic acid (i.e., an exogenous nucleic acid for the cell). Genetic changes can be achieved by integrating the new nucleic acid into the genome of a cardiac cell, or by temporarily or stably maintaining the new nucleic acid as an extrachromosomal element. If the cell is a eukaryotic cell, permanent genetic changes can be achieved by introducing nucleic acid into the cell's genome. Appropriate methods of genetic modification include viral infection, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate precipitation, and direct microinjection.

[0061] The term "stem cell" refers to a cell that has the ability to self-replicate and produce differentiated offspring. The term "pluripotent stem cell" refers to a stem cell that can produce cells from all three germ layers (endoderm, mesoderm, and ectoderm) but does not have the ability to produce a complete organism. In some embodiments, a composition for inducing the phenotype of cardiomyocytes can be used on a population of cells to induce reprogramming. In other embodiments, the composition induces the phenotype of cardiomyocytes.

[0062] The term "induced pluripotent stem cells" is given its usual meaning, and further refers to differentiated mammalian somatic cells (e.g., adult somatic cells such as skin cells) that have been reprogrammed to exhibit at least one feature of pluripotency. See, for example, Takahashi et al. (2007) Cell 131(5):861-872, Kim et al. (2011) Proc. Natl. Acad. Sci. 108(19):7838-7843, and Sell (2013) Stem Cells Handbook.

[0063] Unless otherwise stated, abbreviations used throughout this specification have the following meanings: AHCF, adult human cardiac fibroblasts; APCF, adult porcine cardiac fibroblasts; α-MHC-GFP, α-myosin heavy chain green fluorescent protein; CF, cardiac fibroblasts; cm, centimeter; CO, cardiac output; EF, ejection fraction; FACS, fluorescence-activated cell sorting; GFP, green fluorescent protein; GMT, Gata4, Mef2c, and Tbx5; GMTc, Gata4, Mef2c, Tbx5, TGF-βi, WNTi; GO, gene ontology; HCF, human cardiac fibroblasts iCM, induced cardiomyocytes; kg, kilograms; μg, micrograms; μl, microliters; mg, milligrams; ml, milliliters; MI, myocardial infarction; msec, milliseconds; min, minutes; MyAMT, myocardial infarction, Ascl1, Mef2c, and Tbx5; MyA, myocardial infarction and Ascl1; MyMT, myocardial infarction, Mef2c, and Tbx5; MyMTc, myocardial infarction, Mef2c, Tbx5, TGF-βi, WNTi; MRI, magnetic resonance imaging; PBS, phosphorus Acid-buffered saline; PBST, phosphate-buffered saline, Triton; PFA, paraformaldehyde; qPCR, quantitative polymerase chain reaction; qRT-PCR, quantitative reverse transcriptase polymerase chain reaction; RNA, ribonucleic acid; RNA-seq, RNA sequencing; RT-PCR, reverse transcriptase polymerase chain reaction; sec, seconds; SV, stroke volume; TGF-β, transforming growth factor beta; TGF-βi, transforming growth factor beta inhibitor; WNT, wingless-Int; WNTi , wingless-Int inhibitors; YFP, yellow fluorescent protein; 4F, Gata4, Mef2c, TBX5, and myocardin; 4Fc, Gata4, Mef2c, TBX5, and myocardin + TGF-βi and WNTi; 7F, Gata4, Mef2c, and Tbx5, Esrrg, myocardin, Zfpm2, and Mesp1; 7Fc, Gata4, Mef2c, and Tbx5, Esrrg, myocardin, Zfpm2, and Mesp1 + TGF-βi and WNTi.

[0064] The detailed description of this disclosure has been divided into various sections for the convenience of the reader, and any disclosure found in any section may be combined with the disclosure in another section. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the invention pertains. Any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of the invention, but preferred methods and materials are described herein. All publications referenced herein are incorporated herein by reference to disclose and describe methods and / or materials in relation to those cited herein.

[0065] II. Transgenes and MicroRNA Binding Sites The vectors of this disclosure may be designed to deliver one or more transgenes to cells, including but not limited to BMPR2, COL1A1, COL1A2, COL3A1, ELN, FGF1, FGF4, GGF2, HGF, OPRL1, PCSK9, RXFP1, SDF1, TGFBR2, TIMP3, TIMP4, VEGFA, and / or others. That is, the vector may contain a polynucleotide sequence encoding one or more of BMPR2, COL1A1, COL1A2, COL3A1, ELN, FGF1, FGF4, GGF2, HGF, OPRL1, PCSK9, RXFP1, SDF1, TGFBR2, TIMP3, TIMP4, VEGFA, and / or others. The vectors of this disclosure are not limited to any particular set of transgenes. The transgenes may be protein-coding, DNA-coding, or RNA-coding. One or more transgenes may include a gene editing system, such as a CRISPR-Cas system.

[0066] Reprogramming Factors In some embodiments, one or more transgenes include one or more reprogramming factors (e.g., cardiomyocyte reprogramming factors). A vector may be used to deliver all of the factors necessary to achieve a selected desired cell reprogramming, or a selected set of such reprogramming factors. For example, multiple vectors may be administered simultaneously, with only one of them containing a selected microRNA binding site. If the expression of multiple factors is required to collectively produce the desired effect, the same or similar effects and / or safety benefits may be observed if only specific members of a set of factors are controlled by the microRNA binding site, or if all of them are controlled by the microRNA binding site.

[0067] In some embodiments, the Disclosure provides reprogramming factors and compositions thereof that can modulate the expression of one or more genes, such as polynucleotides or proteins of interest. Surprisingly, the inventors have found that differentiated cells can be reprogrammed into iCM cells using one or more reprogramming factors that modulate the expression of one or more genes, such as polynucleotides or proteins of interest, such as ASCL1 and / or MYOCD, and optionally polynucleotides encoding microRNA, where one or more of the aforementioned polynucleotides include a selected microRNA binding site. In some embodiments, the one or more reprogramming factors are provided as polynucleotides (e.g., RNA, mRNA, or DNA polynucleotides) encoding one or more transgenes. In some embodiments, the one or more reprogramming factors are provided as proteins. In some embodiments, the polynucleotide encoding microRNA shares complete identity with the corresponding premicroRNA.

[0068] In some embodiments, one or more reprogramming factors provided herein modulate (e.g., increase or decrease) the expression of one or more target proteins. In some embodiments, one or more target proteins are known to be involved in the differentiation, proliferation, and / or function of cardiomyocytes. In some embodiments, one or more target polynucleotides or proteins are MYOCD / MYOCD and / or ASCL1 / ASCL1. Table 2 provides exemplary gene sequences useful in the compositions and methods of the present disclosure. Where two or more isoforms of a given target gene are known, embodiments of the present disclosure are understood to include compositions and methods comprising alternative isoforms of each target gene. The compositions and methods of the present disclosure are not limited to the disclosed sequences, and are provided for illustrative and explanatory purposes only and are not limiting.

[0069] In some embodiments, the disclosure provides reprogramming factors that modulate the expression of one or more target genes selected from ASCL1, MYOCD, MEF2C, and TBX5. In some embodiments, the reprogramming factors disclosed herein modulate the expression of one or more target genes selected from ASCL1, MYOCD, MEF2C, AND TBX5, CCNB1, CCND1, CDK1, CDK4, AURKB, OCT4, BAF60C, ESRRG, GATA4, GATA6, HAND2, IRX4, ISLL, MESP1, MESP2, NKX2.5, SRF, TBX20, ZFPM2, and MIR-133.

[0070] In some embodiments, the reprogramming factors disclosed herein regulate the expression of one or more target genes selected from GATA4, MEF2C, and TBX5 (i.e., GMT). In some embodiments, the reprogramming factors disclosed herein regulate the expression of one or more target genes selected from MYOCD, MEF2C, and TBX5 (i.e., MyMT). In some embodiments, the reprogramming factors disclosed herein regulate the expression of one or more target genes selected from MYOCD, ASCL1, MEF2C, and TBX5 (i.e., MyAMT). In some embodiments, the reprogramming factors disclosed herein regulate the expression of one or more target genes selected from MYOCD and ASCL1 (i.e., MyA). In some embodiments, the reprogramming factors disclosed herein regulate the expression of one or more target genes selected from GATA4, MEF2C, TBX5, and MYOCD (i.e., 4F). In other embodiments, the reprogramming factors disclosed herein regulate the expression of one or more target genes selected from GATA4, MEF2C, TBX5, ESRRG, MYOCD, ZFPM2, and MESP1 (i.e., 7F).

[0071] In some embodiments, the disclosure provides reprogramming factors that modulate the expression of one or more target genes selected from ASCL1, MYOCD, MEF2C, TBX5, DLX3, DLX6, GATA2, and GATA5. [Table 2]

[0072] Manipulated myocardine (MYOCD) In another embodiment, the Disclosure relates to engineered variants of MYOCD, such as engineered MYOCD expressed from a smaller open reading frame, as described in U.S. Provisional Patent Application No. 62 / 788,479. The Applicant has found that MYOCD containing the internal deletion retains the expression and function of the MYOCD protein and can be used alone or in combination with other reprogramming factors (for example, to generate cardiomyocytes from fibroblasts). In some embodiments of the Disclosure, the engineered MYOCD protein contains at least 50 amino acid deletions in the region corresponding to amino acids 414-764 of the native MYOCD (SEQ ID NO: 3). In some embodiments, the engineered MYOCD is selected from one or three MYOCD variants having the internal deletion: MyΔ1 (SEQ ID NO: 14) having deletions of residues 414-763; MyΔ2 (SEQ ID NO: 15) having deletions of residues 439-763; and preferably MyΔ3 (SEQ ID NO: 16) having deletions of residues 560-763.

[0073] In some embodiments, the MYOCD polynucleotide is an engineered MYOCD polynucleotide. "MYOCD" or "myocardin" refers to either an engineered MYOCD protein or, preferably, a native MYOCD. In some embodiments, the engineered MYOCD polynucleotide encodes an engineered MYOCD protein having a length of up to 500, 550, 600, 650, 700, 750, 800, 850, or any number in between. In some embodiments, the engineered MYOCD protein includes an SRF interaction domain, an SAP domain, and a TAD domain. In some embodiments, the engineered MYOCD protein further includes a Mef2C interaction domain. In some embodiments, the manipulated MYOCD polynucleotide encodes a manipulated MYOCD with at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, or 350 amino acid deletions in the region corresponding to amino acids 414-764 of natural myocardin (SEQ ID NO: 3). Various sequences used for manipulating myocardin are provided in Table 3. In some embodiments, since interspecific conservation of MYOCD begins at residue 5, approximately four N-terminal residues of MYOCD are omitted or modified. In some embodiments, further residues from the N-terminus of MYOCD are omitted or modified. [Table 3]

[0074] In some embodiments, the manipulated myocardin protein includes one or more of the following: Mef2c interaction domain, SRF domain, SAP domain, LZ domain, and TAD domain. In some embodiments, the manipulated myocardin protein includes the Mef2c interaction domain, SRF domain, SAP domain, LZ domain, and TAD domain. In some embodiments, the manipulated myocardin protein includes the Mef2c interaction domain, SRF domain, SAP domain, and TAD domain. In some embodiments, the manipulated myocardin protein includes the SRF domain, SAP domain, LZ domain, and TAD domain. In some embodiments, the manipulated myocardin protein includes the SRF domain, SAP domain, and TAD domain.

[0075] In some embodiments, the engineered MYOCD is provided as a polynucleotide encoding the engineered MYOCD, and optionally as one or more other proteins of interest. In some embodiments, the polynucleotide is RNA, DNA, or mRNA polynucleotide. In some embodiments, the MYOCD polynucleotide shares identity with one of the isoforms of MYOCD. In some embodiments, the MYOCD polynucleotide encodes an engineered MYOCD protein that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from MyΔ1 (SEQ ID NO: 14), MyΔ2 (SEQ ID NO: 15), and MyΔ3 (SEQ ID NO: 16). In some embodiments, the engineered MYOCD protein comprises at least two, three, four, or five of the following: Mef2c interaction domains, SRF domains, SAP domains, LZ domains, and TAD domains. In some embodiments, the Mef2c interaction domain is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 17. In some embodiments, the SRF domain is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 18.In some embodiments, the SAP domain is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to Sequence ID No. 19. In some embodiments, the LZ domain is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 20. In some embodiments, the TAD domain is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11.

[0076] In some embodiments, the manipulated MYOCD protein comprises two or more fragments of native MYOCD linked by a linker. Generally, the linker refers to either a peptide bond or a polypeptide sequence. In some embodiments, other linkers are used, such as any of the various chemical linkers used in peptide chemistry known in the art. The reference to “peptide bond” means that two sequences are joined together to produce a complex sequence without the interposition of amino acid residues. For example, MyΔ3 (SEQ ID NO: 16) contains MYOCD1-559 (SEQ ID NO: 13) linked to MYOCD764-986 (SEQ ID NO: 11) by a peptide bond. In some embodiments, the linker is any of the various polypeptides used as linkers in the art, including, but not limited to, glycine-serine linkers such as G, GG, GGG, GSS, GGS, GGSGGS (SEQ ID NO: 30), GSSGGS (SEQ ID NO: 31), GGSGSS (SEQ ID NO: 32), GGSGGSGGS (SEQ ID NO: 33), GGSGGSGGSGGS (SEQ ID NO: 34). In some embodiments, the linker is a domain of a protein other than MYOCD.

[0077] Throughout this disclosure, polynucleotide expression may refer to any means known in the art for increasing the expression of a gene of interest. In some embodiments, the gene of interest is encoded by messenger RNA (mRNA). The mRNA may be synthetic or natural. In some embodiments, the mRNA is chemically modified in various ways known in the art. For example, it can be used as described in Warren, L. et al. Cell Stem Cell 7:618-30 (2010), WO2014081507A1, WO2012019168, WO2012045082, WO2012045075, WO2013052523, WO2013090648, US9572896B2. In some embodiments, the expression of the gene of interest is increased by delivery of polynucleotides to cells. In some embodiments, the polynucleotide encoding the gene of interest is delivered by a virus or a non-viral vector. In some embodiments, the gene of interest is encoded in DNA polynucleotides and is optionally delivered by any viral or nonviral method known in the art. In some embodiments, the disclosure provides a method comprising contacting cells with lipid nanoparticles containing DNA or mRNA encoding the gene of interest. In some embodiments, the method of the disclosure comprises contacting cells with a virus containing DNA or RNA encoding the gene of interest (e.g., a DNA genome, a negative-sense RNA genome, a positive-sense RNA genome, or a double-stranded RNA genome). In some embodiments, the virus is selected from retroviruses, adenoviruses, AAVs, non-integrated lentiviral vectors (LVVs), and integrated LVVs. In some embodiments, cells are transfected with a plasmid. In some embodiments, the plasmid contains polynucleotides encoding reprogramming factors. In some embodiments, the plasmid contains transposons containing reprogramming factors.

[0078] In some embodiments, the reprogramming factor is provided as a polynucleotide encoding one or more proteins of interest. In some embodiments, the polynucleotide is RNA, DNA, or mRNA polynucleotide. In some embodiments, the polynucleotide comprises a nucleic acid sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the nucleotide sequence of human ASCL1 (SEQ ID NO: 2) over at least 100, 200, 300, 400, or 500 nucleotides. In some embodiments, the ASCL1 polynucleotide shares identity with any of the ASCL1 isoforms. In some embodiments, the ASCL1 polynucleotide encodes an ASCL1 protein that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of human ASCL1 (SEQ ID NO: 1).

[0079] In some embodiments, the compositions and methods of the present disclosure provide iCM cells or recombinant viruses or nonviral vectors comprising or administering a MYOCD polynucleotide. In some embodiments, the MYOCD polynucleotide encodes a MYOCD protein that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of human MYOCD (SEQ ID NO: 3). In some embodiments, the MYOCD polynucleotide shares at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the nucleotide sequence of human MYOCD (SEQ ID NO: 4) over at least 100, 200, 300, 400, or 500 nucleotides. In some embodiments, the MYOCD polynucleotide shares identity with any of the isoforms of MYOCD.

[0080] In some embodiments, the manipulated MYOCD is provided as a polynucleotide encoding the manipulated MYOCD.

[0081] In some embodiments, the MYOCD polynucleotide encodes a MYOCD protein that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the manipulated MYOCD (e.g., SEQ ID NO: 14).

[0082] In some embodiments, the MYOCD polynucleotide encodes a MYOCD protein that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the manipulated MYOCD (e.g., SEQ ID NO: 15).

[0083] In some embodiments, the MYOCD polynucleotide encodes a MYOCD protein that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the manipulated MYOCD (e.g., SEQ ID NO: 16).

[0084] In some embodiments, the polynucleotide encoding the protein of interest is synthetic mRNA. Synthetic mRNA provides the genetic information to create the protein of interest and can be chemically modified to avoid inducing an immune response. Zangi et al. (2013) Nature Biotech 31:898-907. Because mRNA is not integrated into the host cell genome, synthetic mRNA acts for a certain period and then disappears as the cell divides. In some embodiments, synthetic mRNA is modified, for example, with pseudouridine and / or 5-methylcytidine to reduce the innate antiviral response to single-stranded RNA.

[0085] In some embodiments, polynucleotides encoding one or more proteins of interest can be modified by codon optimization or other means, as long as the functional activity of the encoded gene is preserved. In some embodiments, the polynucleotides encode modifications or variants of one or more genes of interest, including cleavage, insertion, deletion, or fragmentation, as long as the functional activity of the encoded gene is preserved.

[0086] In some embodiments, polynucleotides encoding one or more proteins of interest are included in the expression cassette. In some embodiments, the expression cassette includes one or more polynucleotides encoding one or more proteins of interest. For example, in some embodiments, the expression cassette includes 2, 3, 4, 5, 6, 7, 8, 9, or 10 polynucleotides encoding 2, 3, 4, 5, 6, 7, 8, 9, or 10 genes of interest.

[0087] It is understood that when two or more target proteins are to be expressed in a cell, one or more polynucleotides or expression cassettes can be used. For example, a polycistronic expression cassette can be used in which one expression cassette can contain multiple polynucleotides expressing multiple proteins. In some embodiments, a polycistronic expression cassette contains two or more polynucleotides in a single open reading frame, and these polynucleotides are linked by the 2A region of an aftovirus foot-and-mouth disease virus (FMDV) polyprotein, as described in Donnelly et al. J. Gen. Virol. 82:1013-15 (2001) and its improved version known in the art. The 2A region generates a ribosome "skip" from one codon to the next without forming a peptide bond. In some embodiments, the polynucleotides include internal cleavage sites so that post-translational cleavage produces two or more peptides.

[0088] In some embodiments, the multicistronic vectors of this disclosure comprise a polynucleotide sequence encoding multiple polypeptides linked by a linker containing a peptide capable of inducing ribosome skipping or self-cleavage. In some embodiments, the linker comprises a 2A peptide. As used herein, the term “2A peptide” refers to a class of ribosome skipping or self-cleaving peptides configured to produce two or more proteins from a single open reading frame. A 2A peptide is a viral oligopeptide 18-22 residues long that mediates the “cleavage” of polypeptides during translation in eukaryotic cells. “2A peptide” may also refer to peptides having a variety of amino acid sequences. In this disclosure, if a lentiviral vector comprises two or more 2A peptides, it will be understood that the 2A peptides may be identical or different from each other. Detailed methodologies for the design and use of 2A peptides are provided by Szymczak-Workman et al., *Design and Construction of 2A Peptide-Linked Multicistronic Vectors*, Cold Spring Harb, Protoc, 2012 Feb 1;2012(2):199-204. While 2A peptides are often referred to as self-cleaving peptides in the literature, mechanistic studies have shown that the observed "self-cleavage" is actually a result of ribosomes skipping the formation of a glycyl-prolyl peptide bond at the C-terminus of the 2A peptide. (Donnelly et al., J Gen Virol, 2001 May;82(Pt5):1027-41). This invention is neither theoretically bound nor limited to a specific mechanistic understanding of 2A peptide function.

[0089] Exemplary 2A peptides include, but are not limited to, those listed in Table 4. [Table 4]

[0090] Optionally, one or more linkers further include sequences encoding the residue Gly-Ser-Gly, which in some embodiments is located at the N-terminus of the 2A peptide. The N-terminus of the 2A peptide means that the residue-encoding sequence is upstream of the sequence encoding the 2A peptide. Generally, the Gly-Ser-Gly motif is either immediately at the N-terminus of the 2A peptide, or 1 to 10 other amino acid residues are inserted between the motif and the 2A peptide. In some embodiments, the polynucleotide sequence encoding this motif is GGA AGC GGA. As with any polynucleotide encoding a peptide, the nucleotide sequence can be modified without altering the encoded peptide sequence. Amino acid residue substitutions are within the scope of the art, and the term 2A peptide refers to the aforementioned variants that retain the desired skipping / self-cleavage activity but optionally have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more substitutions compared to the reference 2A peptide sequence. Exemplary 2A peptides are described in Kim et al. PLOS ONE 6(4):e18556. In some embodiments, two or more different 2A peptides are used in the same construct. Various 2A peptides have been reported to result in improved expression. See Liu et al. Sci Rep. 2017;7:2193.

[0091] In some embodiments, the Disclosure provides an expression cassette comprising, in 5' to 3' order, a promoter, a polynucleotide encoding MYOCD-2A-ASCL1, and a polyadenylated sequence. In some embodiments, the expression cassette comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 35. In some embodiments, the Disclosure provides recombinant AAV (rAAV) comprising an expression cassette, an import plasmid comprising an expression cassette, or rAAV particles comprising an expression cassette. In some embodiments, rAAV comprises polynucleotides that are at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 35. In some embodiments, the Disclosure provides recombinant lentivirus (rLV) comprising an expression cassette, an import plasmid comprising an expression cassette, or rLV particles comprising an expression cassette. In some embodiments, the rLV comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 35.

[0092] In some embodiments, the Disclosure provides an expression cassette comprising, in 5' to 3' order, a promoter, a polynucleotide encoding MyΔ3-2A-ASCL1, and a polyadenylated sequence. In some embodiments, the expression cassette comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 37. In some embodiments, the Disclosure provides an rAAV comprising an expression cassette, an import plasmid comprising an expression cassette, or rAAV particles comprising an expression cassette. In some embodiments, the rAAV comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 37. In some embodiments, the Disclosure provides recombinant rLVs comprising an expression cassette, transfer plasmids comprising an expression cassette, or rLV particles comprising an expression cassette. In some embodiments, the rLV comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 37.

[0093] In some embodiments, the Disclosure provides an expression cassette comprising, in 5' to 3' order, a promoter, a polynucleotide encoding ASCL1-2A-MYOCD, and a polyadenylated sequence. In some embodiments, the expression cassette comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 39. In some embodiments, the Disclosure provides an rAAV comprising an expression cassette, an import plasmid comprising an expression cassette, or rAAV particles comprising an expression cassette. In some embodiments, the rAAV comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 39. In some embodiments, the Disclosure provides recombinant rLVs comprising an expression cassette, transfer plasmids comprising an expression cassette, or rLV particles comprising an expression cassette. In some embodiments, the rLV comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 39.

[0094] In some embodiments, the Disclosure provides an expression cassette comprising, in 5' to 3' order, a promoter, a polynucleotide encoding ASCL1-2A-MyΔ3, and a polyadenylated sequence. In some embodiments, the expression cassette comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41. In some embodiments, the Disclosure provides an rAAV comprising an expression cassette, an import plasmid comprising an expression cassette, or rAAV particles comprising an expression cassette. In some embodiments, the rAAV comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41. In some embodiments, the Disclosure provides recombinant rLVs comprising an expression cassette, transfer plasmids comprising an expression cassette, or rLV particles comprising an expression cassette. In some embodiments, the rLV comprises a polynucleotide that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41.

[0095] In some embodiments, the Disclosure provides an expression cassette comprising a polynucleotide encoding a protein sequence that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 57-64 (e.g., any one of MYOCD-2A-ASCL1, MyΔ3-2A-ASCL1, ASCL1-2A-MYOCD, and ASCL1-2A-MyΔ3).

[0096] In some embodiments, one or more reprogramming factors include one or more microRNAs. MicroRNAs useful as reprogramming factors include miR-133a-2, miR-133a-1, miR-19b-2, miR-19b-1, miR-326, miR-1-1, miR-1298, miR-133b, miR-1-2, miR-92a-2, miR-20b, miR-20a, miR-141, miR-155, miR-17, hsa-let-7c, miR -202, miR-200a, miR-206, miR-509-1, miR-509-2, miR-124-3, miR-124-2, miR-378a, miR-378e, miR-37 Includes 8h, miR-378i, miR-137, miR-671, miR-24-1, miR-182, miR-302d, miR-96, miR-30c-2, and miR-146b.

[0097] In some embodiments, the microRNA is selected from the group consisting of miR-19b-1, miR-19b-2, miR-137, miR-133a-2, miR-671, miR-24-1, miR-182, miR-302d, miR-96, miR-30c-2, miR-146b, and miR-133a-2.

[0098] In some embodiments, the microRNAs are miR-133a-2, miR-133a-1, miR-19b-2, miR-19b-1, miR-326, miR-1-1, miR-1298, miR-133b, miR-1-2, miR-92a-2, miR-20b, miR-20a, miR-141, miR-155, miR-17, hsa-let-7c, miR-202, The selection is made from the group consisting of miR-200a, miR-206, miR-509-1, miR-509-2, miR-124-3, miR-124-2, miR-378a, miR-378e, miR-378h, miR-378i, miR-137, miR-671, miR-24-1, miR-182, miR-302d, miR-96, miR-30c-2, and miR-146b.

[0099] In some embodiments, the microRNA is selected from the group consisting of miR-133a-2, miR-133a-1, miR-19b-2, miR-19b-1, miR-326, miR-1-1, miR-1298, miR-133b, miR-1-2, miR-92a-2, miR-20b, miR-20a, miR-141, miR-155, miR-17, hsa-let-7c, miR-202, miR-200a, miR-206, miR-509-1, miR-509-2, miR-124-3, miR-124-2, miR-378a, miR-378e, miR-378h, and miR-378i.

[0100] In some embodiments, the microRNAs are miR-133a-2, miR-133a-1, miR-19b-2, miR-19b-1, miR-326, miR-1-1, miR-1298, miR-133b, miR-1-2, miR-92a-2, miR-20b, miR-20a, miR-141, miR-155, miR-17, hsa-let-7c, miR-202, The selection is made from the group consisting of miR-200a, miR-206, miR-509-1, miR-509-2, miR-124-3, miR-124-2, miR-378a, miR-378e, miR-378h, miR-378i, miR-137, miR-671, miR-24-1, miR-182, miR-302d, miR-96, miR-30c-2, and miR-146b.

[0101] In some embodiments, two microRNAs are combined with MYOCD and / or ASCL1 to induce reprogramming of differentiated cells (e.g., fibroblasts) into cardiomyocytes. Possible combinations of microRNAs include one of the following at the 5' position: miR-133a-2, miR-133-a1, miR-19b-2, miR-19b-1, miR-326, miR-1-1, miR-1298, miR-133-b, miR-1-2, miR-20-b, and miR-20-a, followed by one of the following at the 3' position: miR-133a-2, miR-133-a1, miR-19b-2, miR-19b-1, miR-326, miR-1-1, miR-1298, miR-133-b, miR-1-2, miR-20-b, and miR-20-a. In some embodiments, multiple miRNAs are combined, such as at least three, four, or five miRNAs. Multiple copies of the same miRNA can be used, such as one, two, three, four, five, or more copies of the same microRNA.

[0102] The microRNA of interest may be provided by any means, including but not limited to shRNA, siRNA, or microRNA mimetic (optionally including modifications such as phosphothiolate backbone, locked nucleic acid, and cholesterol modifications). In some embodiments, the microRNA of interest is expressed from a polynucleotide encoding the microRNA as a pre-miRNA. The polynucleotide encoding the microRNA is generally operably ligated to a promoter. The microRNA can be expressed on its own transcript or on a transcript shared with one or more other factors (e.g., polynucleotides encoding the protein of interest). In some embodiments, the MYOCD polynucleotide and / or ASCL1 polynucleotide are positioned with the polynucleotide encoding the microRNA in the vector so that the microRNA and MYOCD and / or ASCL1 are expressed from the same transcript. In some embodiments, the pre-miRNA sequence is 5' relative to the protein-coding sequence (e.g., MYOCD, ASCL1, MYOCD-2A-ASCL1, or ASCL1-2A-MYOCD). In some embodiments, the pre-miRNA sequence is 3' relative to the protein-coding sequence (e.g., MYOCD, ASCL1, MYOCD-2A-ASCL1, or ASCL1-2A-MYOCD). The polynucleotide encoding the microRNA may be inserted into the 5' or 3' untranslated region (UTR). The polynucleotide encoding the microRNA may be inserted into an intron.

[0103] Table 1 provides exemplary pre-miRNA sequences useful in the compositions and methods of this disclosure. In some embodiments, one, two, three, four or more substitutions and / or insertions in the stem or loop of the pre-miRNA are permitted. In some embodiments, the polynucleotide comprises a sequence that is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to a native microRNA (e.g., native human microRNA). In some embodiments, the polynucleotide comprises a sequence that is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs. 65-99. In some embodiments, the polynucleotide comprises a sequence that is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs. 100-134.

[0104] In some embodiments, the polynucleotide is hsa-pri-miR-133a-2, hsa-pri-miR-133a-1, hsa-pri-miR-19b-2, hsa -pri-miR-19b-1, hsa-pri-miR-326, hsa-pri-miR-1-1, hsa-pri-miR-1298, hsa-pri-miR-133b, hs a-pri-miR-1-2, hsa-pri-miR-92a-2, hsa-pri-miR-20b, hsa-pri-miR-20a, hsa-pri-miR-141, hsa -pri-miR-155, hsa-pri-miR-17, hsa-pri-let-7c, hsa-pri-miR-202, hsa-pri-miR-200a, hsa-pri- miR-206, hsa-pri-miR-509-1, hsa-pri-miR-509-2, hsa-pri-miR-124-3, hsa-pri-miR-124-2, hsa -pri-miR-378a, hsa-pri-miR-378e, hsa-pri-miR-378h, hsa-pri-miR-378i, hsa-pri-miR-137, hsa -Includes a sequence that is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the following: hsa-pri-miR-671, hsa-pri-miR-24-1, hsa-pri-miR-182, hsa-pri-miR-302d, hsa-pri-miR-96, hsa-pri-miR-30c-2, and hsa-pri-miR-146b.

[0105] In some embodiments, the polynucleotides are hsa-MIR-133a-2, hsa-MIR-133a-1, hsa-MIR-19b-2, hsa-MIR-19b-1, hsa-MIR-326, hsa-MIR-1-1, hsa-MIR-1298, hsa-MIR-133b, hsa-MIR-1-2, hsa-MIR-92a-2, hsa-MIR-20b, hsa-MIR-20a, hsa-MIR-141, hsa-MIR-155, hsa-MIR-17, hsa-let-7c, hsa-MIR-202, hsa-MIR-200a, hsa-MIR-20 6. A sequence that is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the following: hsa-MIR-509-1, hsa-MIR-509-2, hsa-MIR-124-3, hsa-MIR-124-2, hsa-MIR-378a, hsa-MIR-378e, hsa-MIR-378h, hsa-MIR-378i, hsa-MIR-137, hsa-MIR-671, hsa-MIR-24-1, hsa-MIR-182, hsa-MIR-302d, hsa-MIR-96, hsa-MIR-30c-2, and hsa-MIR-146b.

[0106] microRNA binding site In one embodiment, the disclosure provides a vector comprising a polynucleotide including a polynucleotide sequence encoding one or more transgenes and a microRNA binding site for a microRNA, wherein the microRNA binding site is operably ligated to the polynucleotide sequence encoding one or more transgenes, and the microRNA is expressed at a higher level in cardiomyocytes or cardiomyocyte progenitor cells compared to cardiac fibroblasts. The microRNA binding site can be operably ligated to the polynucleotide by inserting the microRNA binding site into a sequence encoding mRNA transcripts encoding one or more transgenes. The insertion site may be in a coding region or a non-coding region. Insertion into a coding region can be generated by selecting an acceptable position in the encoded protein (e.g., a loop) and using in-frame insertion to ensure that the binding site is inserted. The binding site can be inserted in the 3' untranslated region (3'UTR), i.e., between the end of the last transgene and a polyadenylation site. The binding site can also be inserted between a pair of transgenes or in the 5'UTR.

[0107] MicroRNA binding sites can also be indirectly bound to one or more transgenes via gene regulatory circuits. For example, a microRNA binding site can be operably ligated to a transcriptional enhancer, a translational enhancer, or a cofactor. In some embodiments, the vector encodes multiple mRNA transcripts. MicroRNA binding sites can be provided to some or all of these transcripts. For example, a microRNA binding site can be operably ligated to a polynucleotide encoding an mRNA transcript encoding ASCL1, a polynucleotide encoding an mRNA transcript encoding myocardin, or both.

[0108] In some embodiments, the microRNA binding site promotes the specific suppression of the expression of one or more transgenes in cardiomyocytes or cardiomyocyte progenitor cells compared to cardiac fibroblasts.

[0109] In some embodiments, microRNA is expressed at a lower level in cardiac fibroblasts compared to the expression level of microRNA in cardiomyocytes and / or the expression level of microRNA in cardiac fibroblasts treated with cardiomyocyte reprogramming factor for more than about 7 days, more than about 1 week, more than about 2 weeks, more than about 3 weeks, or more than about 4 weeks, and / or is expressed at a lower level in cardiac fibroblasts treated with cardiomyocyte reprogramming factor for less than about 7 days, less than about 1 week, less than about 2 weeks, less than about 3 weeks, or less than about 4 weeks.

[0110] In some embodiments, the microRNA is miR-208. In some embodiments, the microRNA is miR-1. In some embodiments, the microRNA is miR-133. In some embodiments, the microRNA is miR-208a. In some embodiments, the microRNA is miR-208b.

[0111] In some embodiments, the microRNA is miR-208b-3p. In some embodiments, the microRNA binding site is [ka] In some embodiments, the microRNA binding site is AAAATATATGTAATCGTCTTAA (SEQ ID NO: 136), which shares more than 70% identity with the microRNA and does not share a mismatch in the underlined seed region containing the sequence CGTCTTA.

[0112] In some embodiments, the microRNA binding site is ACAAACCTTTTGTTCGTCTTAT (SEQ ID NO: 135). In some embodiments, the microRNA binding site is TGAAACCTTTTGTTCGTCTTAT (SEQ ID NO: 137). In some embodiments, the polynucleotide includes at least two microRNA binding sites for microRNA. In some embodiments, the polynucleotide includes at least three microRNA binding sites for microRNA.

[0113] In some embodiments, the polynucleotide includes at least four microRNA binding sites for microRNA. In some embodiments, the polynucleotide includes at least five microRNA binding sites for microRNA. In some embodiments, the polynucleotide includes at least six microRNA binding sites for microRNA. In some embodiments, the polynucleotide includes up to six microRNA binding sites for microRNA. In some embodiments, the polynucleotide includes one, two, three, four, five, or six microRNA binding sites for microRNA. In some embodiments, one or more transgenes include one or more cardiomyocyte reprogramming factors. In some embodiments, one or more cardiomyocyte reprogramming factors include two or more of MYOCD, ASCL1, GATA4, MEF2C, TBX5, miR-133, and MESP1. In some embodiments, one or more cardiomyocyte reprogramming factors include three or more of MYOCD, ASCL1, GATA4, MEF2C, TBX5, miR-133, and MESP1. In some embodiments, one or more cardiomyocyte reprogramming factors comprise four or more of MYOCD, ASCL1, GATA4, MEF2C, TBX5, miR-133, and MESP1. In some embodiments, one or more cardiomyocyte reprogramming factors comprise five or more of MYOCD, ASCL1, GATA4, MEF2C, TBX5, miR-133, and MESP1. In some embodiments, one or more cardiomyocyte reprogramming factors comprise MYOCD and ASCL1. In some embodiments, the polynucleotide sequence encodes the MYOCD-2A-ASCL1 protein.

[0114] This disclosure is not limited to vectors encoding cardiomyocyte reprogramming factors. In fact, the vectors described herein may deliver other genes whose expression is undesirable in selected non-target cells. For example, but not limited to, vectors may be used to deliver gene therapy to cells other than cardiomyocytes. Target cells may be cardiac fibroblasts or any other cell type. In some embodiments, the vectors of this disclosure are useful for transduction of cells in organs other than the heart (e.g., lungs, brain, liver, muscle, etc.).

[0115] In some embodiments, MYOCD includes internal deletions. An exemplary MYOCD gene is provided in International Patent Application No. PCT / US2019 / 049150, which is incorporated herein by reference in its entirety.

[0116] In some embodiments, the polynucleotide comprises, in 5' to 3' order, a promoter, sequences encoding MYOCD and ASCL1, a microRNA binding site, and a polyadenylation sequence.

[0117] In some embodiments, the polynucleotide includes a sequence encoding miR-133.

[0118] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector, a retroviral vector, a lentiviral vector, an adenovirus vector, a herpes simplex virus vector, etc. In some embodiments, the AAV vector is an AAV9 vector. In some embodiments, the AAV vector is an AAV5 vector.

[0119] In another aspect, the present disclosure provides a method for reprogramming cardiac fibroblasts into cardiomyocytes, comprising: a) treating cardiac fibroblasts with an effective amount of a composition that induces reprogramming of cardiac fibroblasts into cardiomyocytes; and selecting a microRNA specifically expressed in the induced cardiomyocytes by measuring the expression of one or more microRNAs in the cardiac fibroblasts, wherein the selected microRNA is expressed in the cardiac fibroblasts only after a predetermined time; b) generating a vector comprising a polynucleotide containing one or more microRNA binding sites for the selected microRNA, which are operably ligated to a polynucleotide encoding one or more cardiomyocyte reprogramming factors; and c) contacting cardiac fibroblasts with an effective amount of the vector.

[0120] In some embodiments, the microRNA binding site suppresses the expression of one or more cardiomyocyte reprogramming factors in cardiomyocytes. In some embodiments, the microRNA binding site suppresses the expression of one or more cardiomyocyte reprogramming factors in skeletal muscle cells. In some embodiments, the microRNA binding site suppresses the expression of one or more cardiomyocyte reprogramming factors in cardiomyocytes.

[0121] In some embodiments, the microRNA is miR-208. In some embodiments, the microRNA is miR-1. In some embodiments, the microRNA is miR-133. In some embodiments, the microRNA is miR-208a. In some embodiments, the microRNA is miR-208b.

[0122] In some embodiments, the microRNA is miR-208b-3p. In some embodiments, the microRNA binding site is [ka] It shares >70%, >75%, >80%, >90%, >95%, >99%, or >100% identity with respect to and does not share a mismatch in the underlined seed region containing the sequence CGTCTTA. In some embodiments, the microRNA binding site is AAAATATATGTAATCGTCTTAA (SEQ ID NO: 136). In some embodiments, the microRNA binding site is ACAAACCTTTTGTTCGTCTTAT (SEQ ID NO: 135). In some embodiments, the microRNA binding site is TGAAACCTTTTGTTCGTCTTAT (SEQ ID NO: 137). In some embodiments, the polynucleotide includes at least two microRNA binding sites for the microRNA.

[0123] In some embodiments, the AAV vector is

[0124] Includes a 3'UTR that shares >70%, >75%, >%80%, >90%, >95%, >99%, or >100% identity with respect to ACAAACCTTTTGTTCGTCTTATAAAACAAACCTTTTGTTCGTCTTATAAAACAAACCTTTTGTTCGTCTTAT (Sequence ID 138).

[0125] In some embodiments, the AAV vector is Includes a 3'UTR that shares >70%, >75%, >%80%, >90%, >95%, >99%, or >100% identity with ACAAACCTTTTGTTCGTCTTATAAAACAAACCTTTTGTTCGTCTTAT (Sequence ID 139).

[0126] In some embodiments, the AAV vector is Includes a 3'UTR that shares >70%, >75%, >%80%, >90%, >95%, >99%, or >100% identity with respect to AAAATATATGTAATCGTCTTAAAAAAAATATATGTAATCGTCTTAAAAAAAATATATGTAATCGTCTTAA (sequence ID 140).

[0127] In some embodiments, the polynucleotide comprises at least four microRNA binding sites for microRNA. In some embodiments, the polynucleotide comprises up to six microRNA binding sites for microRNA. In some embodiments, the polynucleotide comprises four microRNA binding sites for microRNA. In another embodiment, the disclosure provides a method for reprogramming cardiac fibroblasts into cardiomyocytes, comprising contacting the cardiac fibroblasts with an effective amount of the vector described in any one of claims 1 to 28.

[0128] In some embodiments, the method induces the expression of at least one marker of the cardiomyocyte phenotype in cardiac fibroblasts. In some embodiments, the microRNA binding site is a microRNA binding site for miR-1, miR-133, miR-208a, miR-208b, and / or miR-208b-3p. In some embodiments, the microRNA binding site is a microRNA binding site for miR-1. In some embodiments, the microRNA binding site is a microRNA binding site for miR-133.

[0129] In some embodiments, the microRNA binding site is a microRNA binding site for miR-208a. In some embodiments, the microRNA binding site is a microRNA binding site for miR-208b. In some embodiments, the microRNA binding site is a microRNA binding site for miR-208b-3p. In some embodiments, the polynucleotide contains a sequence encoding miR-133.

[0130] In some embodiments, heart failure is due to myocardial infarction. In some embodiments, heart failure is heart failure with reduced ejection fraction (HFrEF). In some embodiments, the method increases the ejection fraction of the subject compared to the subject before administration.

[0131] In some embodiments, the method increases the ejection rate of subjects compared to untreated control subjects. In some embodiments, the method increases the ejection rate in subjects to at least about 28%, 29%, 30%, 31%, or 32%. In some embodiments, the ejection rate is evaluated at a predetermined time after administration of the AAV vector, optionally at 8 weeks. In some embodiments, the method reduces scar tissue formation in subjects compared to subjects before administration. In some embodiments, the method reduces scar tissue formation in subjects compared to untreated control subjects. In some embodiments, the method reduces scar tissue formation in subjects to at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%. In some embodiments, scar tissue formation is evaluated at a predetermined time after administration of the AAV vector, optionally at 8 weeks.

[0132] III. Vectors In some embodiments, reprogramming factors used to reprogram cells into the cardiac lineage can be introduced into selected cells or a selected population of cells by a vector. In some embodiments, the vector is a nucleic acid vector such as a plasmid (e.g., a DNA plasmid or RNA plasmid), a transposon, a cosmid, a bacterial or yeast artificial chromosome, or a viral vector. In some embodiments, the vector is a non-nucleic acid vector such as a nanoparticle. In some embodiments, the vectors described herein include peptides such as cell-permeable peptides or intracellularly integrated sequences. Cell-permeable peptides are small peptides that can pass through the plasma membrane. Exemplary cell-permeable peptides include, but are not limited to, Antennapedia sequences, TAT, HIV-Tat, penetratin, Antp-3A (Antp variant), buforin II, transportan, MAP (model amphiphilic peptide), K-FGF, Ku70, prions, pVEC, Pep-1, SynB1, Pep-7, I-IN-1, BGSC (bis-guanidinium-spermidine-cholesterol), and BGTC (bis-guanidinium-tren-cholesterol).

[0133] Techniques in the field of recombinant genetics can be used for such recombinant expression. A basic text disclosing the general methods of recombinant genetics is Sambrook. Examples include et al., Molecular Cloning, A Laboratory Manual (3rd ed. 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al., eds., 1994). In some embodiments, the vector does not contain a mammalian origin of replication. In some embodiments, the expression vector is introduced via a vector that is not integrated into the genome and / or does not contain a mammalian origin of replication.

[0134] In some cases, expression vectors encode or include, in addition to one or more reprogramming factors, marker genes that facilitate the identification or selection of transfected, transduced, or infected cells. Examples of marker genes include, but are not limited to, genes encoding fluorescent proteins such as enhanced green fluorescent protein, Ds-Red (DsRed: Discosoma sp. red fluorescent protein (RFP); Bevis et al. (2002) Nat. Biotechnol. 20(11):83-87), yellow fluorescent protein, mCherry, and cyanofluorescent proteins, as well as genes encoding proteins that confer resistance to selective agents, such as neomycin resistance genes, puromycin resistance genes, and blastosidine resistance genes.

[0135] In one embodiment, the expression vector further comprises a suicide gene. The expression of the suicide gene may be regulated by the same or different promoters expressing nucleotides encoding at least one proliferation and / or cell cycle re-entry factor polypeptide. Suicide genes are genes that enable negative selection of cells. In the methods described herein, the suicide gene is used as a safety system, allowing cells expressing the gene to be killed by the introduction of a selector. This is desirable when the recombinant gene induces mutations that cause uncontrolled cell proliferation. Numerous suicide gene systems have been identified, including the herpes simplex virus thymidine kinase (tk or TK) gene, cytosine deaminase gene, varicella-zoster virus thymidine kinase gene, nitroreductase gene, Escherichia coli (E. coli) gpt gene, and E. coli Deo gene (see also, e.g., Yazawa K, Fisher WE, Brunicardi FC: Current progress in suicide gene therapy for cancer. World J.Surg. (2002) 26(7):783-9). In one embodiment, the suicide gene is a TK gene. In one embodiment, the TK gene is a wild-type TK gene. In another embodiment, the TK gene is a mutant of the gene, for example, sr23tk. Cells expressing the TK protein can be killed using ganciclovir. In yet another embodiment, the nucleic acid encoding the tetracycline-activated protein and the suicide gene are regulated by a single promoter.

[0136] A. Nucleic acid vectors 1. Viral vector Suitable viral vectors include viral vectors (e.g., vaccinia virus; poliovirus; adenovirus (e.g., Li et al. (1994) Invest Opthalmol Vis Sci35:2543-2549; Borras et al. (1999) Gene Ther6:515-524; Li and Davidson, (1995) Proc.Natl.Acad.Sci.92:7700-7704; Sakamoto et al. (1999) Hum Gene Ther5:1088-1097; WO94 / 12649; WO93 / 03769; WO93 / 19191; WO94 / 28938; WO95 / 11984, and WO95 / 00655); adeno-associated viruses (e.g., Ali et al. (1998) Hum Gene Ther 9(l):81-86,1998,Flannery et al.(1997)Proc.Natl.Acad.Sci.94:6916-6921;Bennett et al. (1997) Invest Opthalmol Vis Sci38:2857-2863; Jomary et al. (1997) Gene Ther4:683-690; Rolling et al. (1999), Hum Gene Ther10:641-648; Ali et al. (1996) Hum Mol Genet.5:591-594; WO93 / 09239, Samulski et al. (1989) J.Vir.63:3822-3828; Mendelson et al. (1988) Virol.166:154-165; and Flotte et al. (1993) Proc.Natl.Acad.Sci.90:10613-10617; SV40; Herpes simplex virus; Human immunodeficiency virus (e.g., Miyoshi et al.) al. (1997) Proc. Natl. Acad. Sci. 94:10319-10323; Takahashi et al. (1999) J Virol 73:7812-7816); retroviral vectors (e.g., vectors derived from retroviruses such as mouse leukemia virus, splenic necrosis virus, and Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary cancer virus) are included, but are not limited thereto. Numerous suitable expression vectors are known to those skilled in the art, and many are commercially available. The following vectors are provided as examples for eukaryotic cells: pXT1, pSG5 (Stratagene), pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia), and pAd (Life Technologies). However, any other vector may be used as long as it is compatible with the cells of this disclosure.

[0137] The ability of certain viruses to infect cells, enter cells via receptor-mediated endocytosis, and stably and efficiently express viral genes makes them attractive candidates for introducing foreign nucleic acids into cells (such as mammalian cells). Viral vectors may contain regulatory sequences, such as promoters, for the expression of the polypeptide of interest. While many viral vectors are integrated into the host cell genome, such integration can be prevented by deleting or modifying segments that would otherwise enable it. Furthermore, in some embodiments, the vector does not contain a mammalian origin of replication. A non-limiting example of viral vectors that can be used to deliver nucleic acids encoding transcription factors to selected cells is described below. In some embodiments, the viral vector is derived from a replication-deficient virus.

[0138] Generally, other useful viral vectors are based on non-cellular eukaryotic viruses in which non-essential genes are replaced with the polypeptide of interest. Non-cellular viruses include certain retroviruses whose life cycle involves the reverse transcription of genomic viral RNA into DNA and subsequent incorporation of the provirus into the host cell DNA. Generally, retroviruses are replication-deficient (e.g., they can be directed to synthesize the desired transcript but cannot produce infectious particles). Such genetically modified retroviral expression vectors are generally useful for highly efficient transduction of polynucleotides in vivo.

[0139] In some embodiments, polynucleotides encoding reprogramming factors can be contained within infectious viruses engineered to express specific binding ligands. The viral particles then specifically bind to homologous receptors on target cells, delivering their contents to the cells. In some embodiments, the viruses are modified to confer specific viral targeting, for example, to preferentially infect fibroblasts, cardiac cells, or more specifically cardiac fibroblasts (CFs). In the case of AAVs, the targeting of the viral vector can be altered by mutating the capsid protein. In the case of lentiviruses, targeting can be modified by using different envelope proteins; this is known as "pseudotyping."

[0140] a. Retroviral vectors In some embodiments, the viral vector is a retroviral vector. Retroviruses can integrate their genes into the host genome, introduce large amounts of foreign genetic material, infect a wide range of species and cell types, and be packaged into specific cell lines (Miller et al., Am.J.Clin.Oncol., 15(3):216-221, 1992). In some embodiments, the retroviral vector is modified so as not to integrate into the host cell genome.

[0141] Recombinant retroviruses may contain viral polypeptides (e.g., retroviral env) that assist in entry into target cells. Such viral polypeptides are well-established in the art, for example, U.S. Patent No. 5,449,614. The viral polypeptide may be a bidirectional viral polypeptide, e.g., a bidirectional env, that assists in entry into cells of multiple species, including cells other than the original host species. The viral polypeptide may be a heterodirectional viral polypeptide that assists in entry into cells other than the original host species. In some embodiments, the viral polypeptide is a homodirectional viral polypeptide, e.g., a homodirectional env, that assists in entry into cells of the original host species.

[0142] Examples of viral polypeptides that can assist retroviruses in entering cells include, but are not limited to, MMLV bidirectional env, MMLV allodirectional env, MMLV heterodirectional env, vesicular stomatitis virus-g protein (VSV-g), HIV-1 env, gibbon leukemia virus (GALV) env, RD114, FeLV-C, FeLV-B, MLV10A1 env genes, and their variants, including chimeric ones. Yee et al. (1994) Methods Cell Biol, Pt A:99-l 12(VSV-G); U.S. Patent No. 5,449,614. In some cases, viral polypeptides are genetically modified to promote expression or enhance binding to receptors.

[0143] A retroviral construct may be derived from a set of retroviruses, e.g., MMLV, HIV-1, SIV, FIV, or another retrovirus described herein. A retroviral construct may encode all the viral polypeptides necessary for two or more replication cycles of a particular virus. In some cases, the efficiency of viral entry is improved by the addition of other factors or other viral polypeptides. In other cases, the viral polypeptide encoded by the retroviral construct does not support two or more replication cycles (e.g., U.S. Patent No. 6,872,528). In such situations, the addition of other factors or other viral polypeptides helps to facilitate viral entry. In one exemplary embodiment, the recombinant retrovirus is an HIV-1 virus containing the VSV-g polypeptide but not the HIV-1env polypeptide.

[0144] Retroviral constructs may include promoters, multicloning sites, and / or resistance genes. Examples of promoters include, but are not limited to, CMV, SV40, EFla, β-actin, retroviral LTR promoters, and inducible promoters. Retroviral constructs may also include packaging signals (e.g., packaging signals derived from MFG vectors; psi packaging signals). Examples of some retroviral constructs known in the art include, but are not limited to, pMX, pBabeX, or their derivatives. Onishi et al. (1996) Experimental Hematology, 24:324-329. In some cases, the retroviral construct is a self-inactivated lentiviral vector (SIN) vector. Miyoshi et al. (1998) J. Virol 72(10):8150-8157. In some cases, the retroviral construct is LL-CG, LS-CG, CL-CG, CS-CG, CLG, or MFG. Miyoshi et al. (1998) J. Virol72(10):8150-8157; Onishi et al. (1996) Experimental Hematology, 24: 324-329; Riviere et al. (1995) Proc. Natl. Acad. Sci., 92:6733-6737.

[0145] Retroviral vectors can be constructed by inserting nucleic acids (e.g., those encoding the target polypeptide or RNA) into the viral genome in place of several viral sequences, thereby generating replication-deficient viruses. To produce virions, a packaging cell system is constructed that contains the gag, pol, and env genes but lacks the LTR and packaging components (Mann et al., Cell 33:153-159, 1983). When a recombinant plasmid containing cDNA along with retroviral LTRs and packaging sequences is introduced into a specific cell line (e.g., by calcium phosphate precipitation), the packaging sequence enables the packaging of the recombinant plasmid's RNA transcript into viral particles, which are then secreted into the culture medium (Nicolas and Rubinstein, In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt, eds., Stoneham: Butterworth, pp. 494-513, 1988; Temin, In: Gene Transfer, Kucherlapati (ed.), New York: Plenum Press, pp. 149-188, 1986; Mann et al., Cell, 33: 153-159, 1983). The culture medium containing the recombinant retrovirus is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors can infect various types of cells. However, integration and stable expression typically occur with host cell division (Paskind et al., Virology, 67:242-248, 1975).

[0146] b. Adenovirus vectors In some embodiments, the viral vector is an adenovirus vector. The adenovirus gene structure contains a linear double-stranded DNA virus of approximately 36 kb, and large fragments of adenovirus DNA can be replaced with foreign sequences up to 7 kb (Grunhaus et al., Seminar in Virology 200(2):535-546, 1992). Reprogramming factors can be introduced into cells using adenovirus-assisted transfection. Increased transfection efficiency in cell systems using adenovirus-coupled systems has been reported (Kelleher). and Vos, Biotechniques, 17(6):1110-7, 1994; Cotten et al., Proc Natl Acad Sci USA, 89(13): 6094-6098, 1992; Curiel, Nat Immun, 13(2-3): 141-64, 1994).

[0147] c. Adeno-associated virus (AAV) vector In some embodiments, the viral vector is an AAV vector. AAV is an attractive vector system because it has a high integration frequency and can infect non-dividing cells. Therefore, it is useful, for example, for the delivery of polynucleotides to mammalian cells in tissue culture or in vivo (Muzyczka, Curr Top Microbiol Immunol, 158:97-129, 1992). Details relating to the generation and use of rAAV vectors are described in U.S. Patents 5,139,941 and 4,797,368, which are incorporated herein by reference in their entirety.

[0148] AAV is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb long and contains two 145-nucleotide reverse end repeats (ITRs). AAV has multiple serotypes. The nucleotide sequences of the AAV serotype genomes are known. For example, the complete genome of AAV-1 is available under GenBank accession number NC_002077, the complete genome of AAV-2 is available under GenBank accession number NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983), the complete genome of AAV-3 is available under GenBank accession number NC_1829, the complete genome of AAV-4 is available under GenBank accession number NC_001829, the genome of AAV-5 is available under GenBank accession number AF085716, the complete genome of AAV-6 is available under GenBank accession number NC_001862, at least portions of the genomes of AAV-7 and AAV-8 are available under GenBank accession numbers AX753246 and AX753249, respectively, and the genome of AAV-9 is available under Gao et al. The AAV-10 genome is provided in al., J. Virol., 78:6381-6388 (2004), the AAV-11 genome in Mol. Ther., 13(1):67-76 (2006), and the AAV-11 genome in Virology, 330(2):375-383 (2004). The sequence of the AAV rh.74 genome is provided in U.S. Patent No. 9,434,928, incorporated herein by reference. Cis-acting sequences that direct viral DNA replication (rep), capsid formation / packaging, and chromosome integration in host cells are contained within the AAV ITR. Three AAV promoters (named p5, pl9, and p40 from their relative map locations) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. Two rep promoters (p5 and pi9), coupled with distinct splicing of a single AAV intron (nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene.The rep protein possesses multiple enzymatic properties that ultimately contribute to the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins: VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are involved in the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are outlined in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0149] AAV possesses unique and attractive properties as a vector for delivering foreign DNA to cells, such as in gene therapy. AAV infection of cells in culture is non-cellular, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV infects many mammalian cells, enabling the potential to target many different tissues in vivo. Additionally, AAV can transduce slowly dividing and non-dividing cells and essentially persist as a transcriptionally active nuclear episome (extrachromosomal element) for the lifespan of those cells. Since the AAV proviral genome is inserted into plasmids as cloned DNA, the construction of recombinant genomes is possible. Furthermore, because the signals directing AAV replication and genomic capsid formation are contained within the ITR of the AAV genome, some or all of approximately 4.3kb inside the genome (encoding the replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. To generate AAV vectors, the rep and cap proteins can be provided in trans. Another important characteristic of AAV is that it is a highly stable and potent virus. Because AAV can easily withstand the conditions used to inactivate adenoviruses (56-65°C for several hours), refrigeration of AAV is not very important. AAV can also be freeze-dried. Finally, AAV-infected cells are not resistant to co-infection.

[0150] The AAV DNA in the rAAV genome may originate from any AAV serotype capable of inducing recombinant viruses, including but not limited to AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, and AAVrh74. The production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692. Other types of rAAV variants, e.g., rAAV with capsid mutations, are also intended. Nucleotide sequences of genomes of various AAV serotypes are known in the art. The AAV vectors of this disclosure include AAV vectors of serotypes AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV39, AAV43, AAV.rh74, and AAV.rh8. Exemplary AAV vectors are provided in US7,105,345; US15 / 782,980; US7,259,151; US6,962,815; US7,718,424; US6,984,517; US7,718,424; US6,156,303; US8,524,446; US7,790,449; US7,906,111; US9,737,618; US Application No. 15 / 433,322; US7,198,951, each incorporated in its entirety by reference.

[0151] In some embodiments, AAV expression vectors are pseudotyped to enhance targeting. AAV5, AAV7, and AAV8 can be used to facilitate gene transfer and maintain expression in fibroblasts. In some cases, the AAV2 genome is packaged into capsids that produce pseudotyped vectors AAV2 / 5, AAV2 / 7, and AAV2 / 8, respectively, as described in Balaji et al. J Surg Res. 2013 Sep;184(1):691-698. In some embodiments, AAV9 may be used to target expression in myofibroblast-like lines, as described in Piras et al. Gene Therapy 23:469-478 (2016). In some embodiments, AAV1, AAV6, or AAV9 is used, and in some embodiments, the AAV is engineered as described in Asokari et al. Hum Gene Ther. 2013 Nov;24(11):906-913; Pozsgai et al. Mol Ther. 2017 Apr 5;25(4):855-869; Kotterman, MA and DVSchaffer (2014) Engineering Adeno-Associated Viruses for Clinical Gene Therapy. Nature Reviews Genetics, 15:445-451; and US2016 / 0340393A1, Schaffer et al. In some embodiments, the viral vector is an AAV engineered to enhance infectivity of target cells, as described in US2018 / 0066285A1.

[0152] d. Lentiviral vectors In some embodiments, the viral vector is a lentiviral vector. Lentiviruses are complex retroviruses that, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural functions. Information regarding lentiviral vectors is found, for example, in Naldini et al., Science 272(5259):263-267, 1996; Zufferey et al., Nat Biotechnol 15(9):871-875, 1997; Blomer et al., J Virol. 71(9):6641-6649, 1997; and U.S. Patents 6,013,516 and 5,994,136, each of which is incorporated herein by reference in whole. Some examples of lentiviruses include human immunodeficiency virus: HIV-1, HIV-2, and simian immunodeficiency virus: SIV. Lentiviral vectors are produced by attenuating HIV virulence genes. For example, the genes env, vif, vpr, vpu, and nef are removed to make the vector biologically safe. The lentivirus used may also have defects in replication and / or integration.

[0153] Recombinant lentiviral vectors can infect non-dividing cells and can be used for both in vivo and ex vivo gene transfer and nucleic acid sequence expression. For example, a recombinant lentivirus that can infect non-dividing cells, in which a suitable host cell is transfected with two or more vectors carrying packaging functions, i.e., gag, pol, and env, and rev and tat, is described in U.S. Patent No. 5,994,136, which is incorporated herein by reference in its entirety. Those skilled in the art can target recombinant viruses by conjugating the envelope protein with an antibody or specific ligand that targets a receptor of a particular cell type. For example, a target-specific vector can be generated by inserting the nucleic acid segment of interest (including a regulatory region) into a viral vector, along with another gene encoding a ligand for a receptor on a particular target cell type.

[0154] Lentiviral vectors are known in the art and are all incorporated herein by reference, Naldini et al., (1996 and 1998), Zufferey See et al., (1997), Dull et al., 1998, U.S. Patents 6,013,516 and 5,994,136. Generally, these vectors are plasmid-based or virus-based and are configured to carry sequences essential for the uptake, selection, and transfer of foreign nucleic acids into host cells. In some cases, lentiviral vectors are introduced into cells simultaneously with one or more lentiviral packaging plasmids, including but not limited to pMD2.G, pRSV-rev, pMDLG-pRRE, and pRRL-GOI. When lentiviral vectors are introduced into cells alone or in combination with lentiviral packaging plasmids, the lentiviral vectors may be packaged into lentiviral particles.

[0155] 2. Method for preparing viral vectors Generally, viral vectors are produced by introducing a viral DNA or RNA construct into producer cells. In some cases, producer cells do not express exogenous genes. In other cases, producer cells are “packaging cells” containing one or more exogenous genes, e.g., one or more gag, pol, or env polypeptides and / or one or more retroviral gag, pol, or env polypeptides. Retroviral packaging cells may contain a viral polypeptide that helps invade target cells, e.g., a gene encoding VSV-g. In some cases, packaging cells contain one or more lentiviral proteins, e.g., a gene encoding gag, pol, env, vpr, vpu, vpx, vif, tat, rev, or nef. In some cases, packaging cells contain a gene encoding an adenovirus protein such as E1A or E1B or another adenovirus protein. For example, the proteins supplied by packaging cells may be retroviral proteins such as gag, pol, and env; lentiviral proteins such as gag, pol, env, vpr, vpu, vpx, vif, tat, rev, and nef; and adenoviral proteins such as ElA and E1B. In many cases, packaging cells supply proteins derived from a virus different from the virus from which the viral vector originates. Methods for producing recombinant viruses from packaging cells and for their use are well established. See, for example, U.S. Patents 5,834,256, 6,910,434, 5,591,624, 5,817,491, 7,070,994, and 6,995,009.

[0156] Packaging cell lines include, but are not limited to, cell lines that are readily transfectable. Packaging cell lines can be based on 293T cells, NIH3T3, COS, or HeLa cell lines. Packaging cells are often used to package viral vector plasmids that lack at least one gene encoding a protein necessary for viral packaging. Any cell capable of supplying a protein or polypeptide lacking the protein encoded by such a viral vector or plasmid can be used as a packaging cell. Examples of packaging cell lines include, but are not limited to, Platinum-E, Platinum-A, BOSC23 (ATCC CRL11554), and Bing (ATCC CRL11270). Morita et al. (2000) Gene Therapy 7(12):1063-1066; Onishi et al. (1996) Experimental Hematology, 24:324-329, U.S. Patent No. 6,995,009. Commercially available packaging strains, such as the Ampho-Pak293 cell line, Eco-Pak2-293 cell line, RetroPack PT67 cell line, and the Retro-X Universal Packaging System (all available from Clontech), are also useful.

[0157] 3. Plasmid Viral vector plasmids (or constructs) include pMXs, pMxs-IB, pMXs-puro, pMXs-neo (pMXs-IB is a vector that carries a blastosidine resistance gene instead of the puromycin resistance gene found in pMXs-puro) Kimatura et al. (2003) Experimental Hematology 31:1007-1014; MFG Riviere et al. (1995) Proc. Natl. Acad. Sci., 92:6733-6737; pBabePuro; Morgenstern et al. (1990) Nucleic Acids Research 18:3587-3596; retroviruses such as LL-CG, CL-CG, CS-CG, CLG Miyoshi et al. (1998) J.Vir. 72:8150-8157, and adenoviruses such as pAdexl Kanegae et al. Examples include al. (1995) Nucleic Acids Research 23:3816-3821. In exemplary embodiments, the retroviral construct includes blastosidine (e.g., pMXs-IB), puromycin (e.g., pMXs-puro, pBabePuro), or neomycin (e.g., pMXs-neo). Morgenstern et al. (1990) Nucleic Acids Research 18:3587-3596.

[0158] In some embodiments, the viral vector or plasmid includes a transposon or transposition element containing a polynucleotide encoding a reprogramming factor. Delivery of polynucleotides via DNA transposons such as piggyBac and Sleeping Beauty offers advantages in terms of ease of use, larger cargo delivery capacity, rapid to clinical use, and production costs. In particular, the piggyBac DNA transposon offers the potential advantages of enabling stable, high-level expression of polynucleotides over long periods, being significantly mutagenic, non-carcinogenic, and fully reversible.

[0159] 4. Direct translation from introduced RNA If one or more transgenes are transiently expressed in selected cells, the target gene can be introduced as an RNA molecule, which is then translated into a protein within the cell's cytoplasm. For example, the target protein can be translated from an introduced RNA molecule having an open reading frame (ORF) for a polypeptide, flanked by a 5' untranslated region (UTR) containing a translation initiation signal (e.g., a strong Kozak translation initiation signal) and a 3' untranslated region ending with an oligo (dT) sequence for template addition of the poly-A terminus. Such RNA molecules do not possess promoter sequences utilized in most expression vectors and expression cassettes. The RNA molecule can be introduced into selected cells by various techniques, including electroporation or endocytosis of RNA complexed with a cationic vehicle. See, for example, Warren et al., Cell Stem Cell 7:618-30 (2010), which is incorporated in its entirety herein by reference.

[0160] Protein translation can last for several days, especially if the RNA molecule is stabilized by the incorporation of modified ribonucleotides. For example, incorporating 5-methylcytidine (5mC) into cytidine, or pseudouridine (psi) into uridine, improves the in vivo half-life of the introduced RNA, leading to increased protein translation. If high levels of expression are desired, or if expression lasting for several days or more is required, the RNA can be repeatedly introduced into selected cells. The protein-coding RNA can also include a 5' cap, a nuclear localization signal, or a combination thereof.

[0161] Such RNA molecules include, for example, 3'-O-Me-m7G(5')ppp(5')G The desired polynucleotide can be prepared by in vitro transcription of a template using a ribonucleotide blend containing ARCA cap analogues, adenosine triphosphate and guanosine triphosphate, 5-methylcytidine triphosphate and pseudouridine triphosphate. The RNA molecule can also be treated with phosphatase to reduce cytotoxicity.

[0162] MicroRNAs can be expressed from expression cassettes or expression vectors introduced into cells or cell populations. Alternatively, microRNAs can be directly introduced into cells via delivery vehicles such as liposomes, microvesicles, or exosomes. A single RNA can contain both a protein-coding sequence and a microRNA.

[0163] B. Non-nucleic acid vectors In certain embodiments, the vector comprises lipid particles, as described in Kanasty R, Delivery materials for siRNA therapeutics Nat Mater. 12(11):967-77 (2013), which is incorporated herein by reference. In some embodiments, the lipid-based vector is lipid nanoparticles, which are lipid particles with a size of about 1 to about 100 nanometers.

[0164] In some embodiments, the lipid-based vector is a lipid or a liposome. A liposome is an artificial spherical vesicle containing a lipid bilayer.

[0165] In some embodiments, the lipid-based vector is a small nucleic acid lipid particle (SNALP). SNALP consists of small (less than 200 nm in diameter) lipid-based nanoparticles that encapsulate nucleic acids. In some embodiments, SNALP is useful for delivering RNA molecules such as siRNA. In some embodiments, SNALP formulations deliver nucleic acids to specific target tissues such as the heart.

[0166] In some embodiments, one or more polynucleotides are delivered via a polymer vector. In some embodiments, the polymer vector is a polymer or polymerosome. Polymers encompass any long repeating chain of monomers and include, for example, linear polymers, branched polymers, dendrimers, and polysaccharides. Linear polymers consist of a single sequence of monomers, while branched polymers include side chains of monomers. Dendrimers are also branched molecules, arranged symmetrically around a core of the molecule. Polysaccharides are high molecular weight carbohydrate molecules, composed of long monosaccharide units linked together. Polymerosomes are artificial vesicles composed of synthetic amphiphilic copolymers that form a vesicle membrane, which may have a hollow or aqueous core within the vesicle membrane.

[0167] Various polymer-based systems can be adapted as vehicles for administering DNA or RNA encoding one or more reprogramming factors. Examples of polymer-based systems include poly(D,L-lactic acid-coglycolic acid) (PLGA), poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(L-lactic acid-coglycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), and PLGA-b-poly(ethylene glycol)-PLGA(PLGA-b PEG-PLGA), PLLA-bPEG-PLLA, PLGA-PEG-maleimide (PLGA-PEG-mal), poly(D,L-lactide)-cocaprolactone), poly(D,L-lactide-cocaprolactone-coglycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkylcyanoacralate, polyurethane, poly-L-lysine (PL L), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acid), polyacid anhydride, poly(esteramide), poly(ester amide), poly(ester ether), polycarbonate; polyalkylenes such as polyethylene and polypropylene; polyalkylene glycols such as poly(ethylene glycol) (PEG); polyalkylene oxide (PEO); polyalkylene terephthalates such as poly(ethylene terephthalate); polyvinyl alcohol (PVA), polyvinyl ether; polyvinyl esters such as poly(vinyl acetate); polyvinyl halides such as poly(vinyl chloride) (PVC); polyvinylpyrrolidone, polysiloxane, polystyrene (PS), polyurethane; alkylcellulose, hydroxyalkylcellulose, cellulose ether, cellulose ester, nitrocellulose, hydroxypropylcellulose, carboxymethylcellulose, and other derivatized celluloses;Acrylic acid polymers, such as poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate), poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate), poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate)) (polyacrylic acid) and their copolymers and mixtures; polydioxanone and its copolymers, polyhydroxyalkanoates, polypropyl Examples include lenfmarate, polyoxymethylene, poloxamer, poly(ortho)ester, poly(butyric acid), poly(valeric acid), poly(lactidoco-caprolactone), trimethylene carbonate, polyvinylpyrrolidone, polyorthoester, polyphosphazene, poly([β]-aminoester (PBAE), and polyphosphoester, as well as blends and / or block copolymers of two or more such polymers. Polymer-based systems may also include nanoparticles based on cyclodextrin polymers (CDP), such as CDP-adamantane (AD)-PEG conjugate and CDP-AD-PEG-transferrin conjugate;

[0168] In some embodiments, lipid-based vectors include a lipid encapsulation system. The lipid encapsulation system can be designed to provide the required circulation time and biodegradability, as well as to facilitate desirable tissue distribution and cell penetration characteristics. The lipid encapsulation may include reverse micelles and / or further include a polymer matrix, as described in, for example, U.S. Patent No. 8,193,334, which is incorporated herein by reference. In some embodiments, the particles include lipophilic delivery compounds that enhance particle delivery to tissue, including preferred methods. Such compounds are disclosed in U.S. Patent No. 2013 / 0158021, which is incorporated herein by reference in whole. Such compounds may generally include lipophilic groups and conjugated amino acids or peptides (including linear or cyclic peptides), and their isomers. In some embodiments, the lipid encapsulation includes one or more of phospholipids, cholesterol, polyethylene glycol (PEG) lipids, and lipophilic compounds.

[0169] The particles, whether lipids, polymers, or both, may contain additional components useful for enhancing the properties of in vivo nucleic acid delivery (including compounds disclosed in US8,450,298 and US2012 / 0251560, respectively, which are incorporated herein by reference). The delivery vehicle may preferentially accumulate in specific tissues, thereby providing a tissue-targeting effect, but in some embodiments, the delivery vehicle further comprises at least one cell-targeting ligand or tissue-targeting ligand. Functionalized particles containing exemplary targeting ligands are disclosed in US2010 / 0303723 and 2012 / 0156135, which are incorporated herein by reference in their entirety.

[0170] The delivery vehicle can be designed not only to provide the necessary circulation time and biodegradability, but also to facilitate the desired tissue distribution and cell penetration characteristics of the delivery system described herein. For example, the lipid particles may be aminolipids disclosed in US2011 / 0009641, which are incorporated herein by reference.

[0171] Lipid or polymer particles may have a size in the range of about 50 nm to about 5 μm (e.g., average size). In some embodiments, the particles are in the range of about 10 nm to about 100 μm, or about 20 nm to about 50 μm, or about 50 nm to about 5 μm, or about 70 nm to about 500 nm, or about 70 nm to about 200 nm, or about 50 nm to about 100 nm. Particles can be selected to avoid rapid clearance by the immune system. In certain embodiments, the particles may be spherical or non-spherical.

[0172] C. Promoter and Enhancer In some embodiments, nucleic acids encoding reprogramming factors can be operably ligated to promoters and / or enhancers to promote the expression of reprogramming factors. Depending on the host / vector system used, any of a number of suitable transcription and translational regulatory elements, including constitutive and inducible promoters, transcriptional enhancer elements, and transcriptional terminators, can be used in the expression vector (e.g., Bitter et al. (1987) Methods in Enzymology, 153:516-544).

[0173] A separate promoter and / or enhancer may be used for each polynucleotide. In some embodiments, the same promoter and / or enhancer is used for two or more polynucleotides within a single open reading frame. Vectors that use this configuration of genetic elements are called “polycistronic.” An example of a polycistronic vector includes an enhancer and promoter operably linked to a single open reading frame containing two or more polynucleotides linked by a 2A region, thereby translatibly generating multiple polypeptides simultaneously upon expression of the open reading frame. The 2A region is thought to mediate the generation of multiple polypeptide sequences by codon skipping. However, this disclosure also relates to polycistronic vectors that utilize post-translational cleavage to generate polypeptides for two or more genes of interest from the same polynucleotide. Exemplary 2A sequences, vectors, and related methods are provided in US2004 / 0265955A1, which is incorporated herein by reference. Other polycistronic vectors in this disclosure utilize internal promoters, splicing, restarts, internal ribosome entry sites (IRESs), proteolytically cleavable sites (e.g., Fusagen), and gene fusions.

[0174] Non-limiting examples of suitable eukaryotic promoters (promoters functional in eukaryotic cells) include CMV, pre-early CMV, HSV thymidine kinase, early and late SV40, retroviral long-terminal repeats (LTRs), and mouse metallothionein-I. In some embodiments, promoters capable of giving cardiac-specific expression are used. Non-limiting examples of suitable cardiac-specific promoters include desmin (Des), α-myosin heavy chain (α-MHC), myosin light chain 2 (MLC-2), cardiac troponin T (cTnT), and cardiac troponin C (cTnC). Non-limiting examples of suitable neuron-specific promoters include synapsin I (SYN), calcium / calmodulin-dependent protein kinase II, tubulin alpha I, neuron-specific enolase and platelet-derived growth factor beta chain promoters, and hybrid promoters obtained by fusing cytomegalovirus enhancer (E) to their neuron-specific promoters.

[0175] Examples of suitable promoters for driving expression reprogramming factors include, but are not limited to, retroviral long-terminal repeat (LTR) elements; constitutive promoters such as CMV, HSV1-TK, SV40, EF-1a, β-actin, and phosphoglycerol kinase (PGK); inductive promoters such as those containing Tet operator elements; heart-specific promoters, e.g., desmin (Des), α-myosin heavy chain (α-MHC), myosin light chain 2 (MLC-2), cardiac troponin T (cTnT), and cardiac troponin C (cTnC); neuron-specific promoters, e.g., nestin, neuronal nucleus (NeuN), microtubule-associated protein 2 (MAP2), beta-III tubulin, neuron-specific enolase (NSE), oligodendrocyte lineage (Oligl / 2), and glial fibrillary acidic protein (GFAP); and pancreas-specific promoters, e.g., Pax4, Nkx2.2, Ngn3, insulin, glucagon, and somatostatin.

[0176] In some embodiments, polynucleotides are operably ligated to cell type-specific transcription regulators (TREs), which include promoters and enhancers. Suitable TREs include, but are not limited to, those derived from the following genes: myosin light chain 2, α-myosin heavy chain, AE3, cardiac troponin C, and cardiac actin. Franz et al.(1997)Cardiovasc.Res.35:560-566;Robbins et al.(1995)Ann.NYAcad.Sci.752:492-505;Linn et al.(1995)Circ.Res.76:584-591;Parmacek et al. al. (1994) Cell. Biol. 14:1870-1885; Hunter et al. (1993) Hypertension 22: 608-617; and Sartorelli et al. (1992) Proc. Natl. Acad. Sci. USA 89: 4047-4051.

[0177] A promoter may be naturally associated with a gene or nucleic acid segment. Similarly, in the case of RNA (e.g., microRNA), the promoter may be naturally associated with a microRNA gene (e.g., the miRNA-302 gene). Such a naturally associated promoter can be called a “natural promoter” and can be obtained by isolating a 5’ non-coding sequence located upstream of the coding segment and / or exon. Similarly, an enhancer may be naturally associated with a nucleic acid sequence; however, the enhancer can be located either downstream or upstream of that sequence.

[0178] Alternatively, certain advantages can be obtained by placing a coding nucleic acid segment under the control of a recombinant or heterologous promoter, where these promoters refer to promoters not typically associated with nucleic acids in their natural environment. Recombinant or heterologous enhancers also refer to enhancers not typically associated with nucleic acid sequences in their natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and "not naturally occurring" promoters or enhancers, i.e., promoters or enhancers containing different elements of different transcriptional regulatory regions and / or mutations that alter expression. In addition to synthetically generating promoter and enhancer nucleic acid sequences, sequences may also be generated using recombinant cloning and / or nucleic acid amplification techniques, including PCR®, in connection with the compositions disclosed herein (see U.S. Patents 4,683,202 and 5,928,906, incorporated herein by reference, respectively).

[0179] The promoters used may be constitutive, inducible, developmental stage-specific, tissue-specific, and / or useful under appropriate conditions for directing high-level expression of nucleic acid segments. For example, the promoter may be a constitutive promoter such as the CMV promoter, the CMV cytomegalovirus pre-early promoter, the CAG promoter, the EF-1α promoter, the HSV1-TK promoter, the SV40 promoter, the β-actin promoter, the PGK promoter, or a combination thereof. Examples of eukaryotic promoters that can be used include, but are not limited to, constitutive promoters, such as viral promoters such as the CMV, SV40, and RSV promoters, and controllable promoters, such as inducible or repressive promoters such as the tet promoter, the hsp70 promoter, and synthetic promoters regulated by CRE. In some embodiments, the promoter comprises a CMV early enhancer element, a chicken β-actin promoter, and an SV-40 intron. Other examples of promoters that can be used include the human EF1α elongation factor promoter, the CMV cytomegalovirus pre-early promoter, the CAG chicken realbumin promoter, viral promoters associated with any of the viral vectors described herein, or promoters homologous to any of the promoters described herein (e.g., from another species). Examples of prokaryotic promoters that can be used include, but are not limited to, SP6, T7, T5, tac, bla, trp, gal, lac, or maltose promoters.

[0180] In some embodiments, internal ribosome entry site (IRES) elements can be used to create multiple gene or polycistronic messages. IRES elements can bypass the ribosome scanning model of 5' methylation cap-dependent translation and initiate translation at an internal site (Pelletier and Sonenberg, Nature 334(6180):320-325 (1988)). IRES elements from two members of the Picornaviridae family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, Nature 334(6180):320-325 (1988)), as have IRESs from mammalian messages (Macejak & Samow, Nature 353:90-94 (1991)). IRES elements can be ligated into heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, to create a polycistronic message. Thanks to the IRES element, ribosomes can access each open reading frame for efficient translation. Multiple genes can be efficiently expressed using a single promoter / enhancer that transcribes a single message (see U.S. Patents 5,925,565 and 5,935,819 incorporated herein by reference).

[0181] D. Vector delivery to cells Viral vectors can be introduced into target cells (e.g., fibroblasts) by any method known in the art, including but not limited to the calcium phosphate method, lipofection (e.g., Feigner et al. (1987) Proc. Natl. Acad. Sci. 84:7413-7417), electroporation, microinjection, Fugene transfection, nucleofection, and any other method described herein.

[0182] Examples of procedures include those described by Stadtfeld and Hochedlinger, Nature Methods 6(5):329-330 (2009); Yusa et al., Nat. Methods 6:363-369 (2009); Woltjen, et al., Nature 458, 766-770 (9 Apr. 2009)). Such methods include DNA delivery, for example, by exovivotransfection using Fugen 6 (Roche) or lipofectamine (Invitrogen) as an option (e.g., Wilson et al., Science, 244:1344-1346, 1989, Nabel & Baltimore, Nature 326:711-713, 1987); and microinjection (e.g., Harland and Weintraub, J. Cell). By injection (e.g., U.S. Patent No. 5,789,215, all of which are incorporated herein by reference), including (e.g., U.S. Patent Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466, and 5,580,859, each of which is incorporated herein by reference); by electroporation (e.g., U.S. Patent No. 5,384,253, Tur-Kaspa et al., Mol. Cell Biol., 6:716-718, 1986, all of which are incorporated herein by reference); et al., Proc. Nat'l Acad. Sci. USA, 81:7161-7165, 1984); by calcium phosphate precipitation (e.g., Graham & Van Der Eb, Virology, 52:456-467, 1973; Chen and Okayama, Mol. Cell Biol., 7(8):2745-2752, 1987; Rippe et al., Mol. Cell Biol., 10:689-695, 1990); by use of DEAE-dextran followed by polyethylene glycol (e.g., Gopal, Mol. Cell Biol., 5:1188-1190, 1985); by direct ultrasonic loading (e.g., Fechheimer et al., Proc. Nat'l Acad. Sci. USA, 84:8463-8467, 1987); by liposome-mediated transfection (e.g., Nicolau & Sene, Biochim Biophys. Acta, 721:185-190, 1982, Fraley et al., Proc. Nat'l Acad.Sci.USA,76:3348-3352,1979;Nicolau et al.,Methods Enzymol.,149:157-176,1987,Wong et al.,Gene,10:87-94,1980,Kaneda et al.,Science,243:375-378,1989,Kato et al.,Biol.Chem.,266:3361-3364,1991), receptor-mediated transfection (e.g., Wu and Wu,Biochemistry,27:887-892,1988;Wu and This includes, but is not limited to, DNA delivery by endocytosis of RNA complexed with a cationic vehicle (Warren et al., Cell Stem Cell 7:618-30 (2010)) and any combination of such methods. Each of the aforementioned references is incorporated herein by reference in its entirety.

[0183] Depending on whether the nucleic acid molecule is introduced into the host in vitro or in vivo, various techniques can be used to introduce the nucleic acid molecule of this disclosure into cells. Such techniques include nucleic acid molecule-calcium phosphate precipitate transfection, transfection of nucleic acid molecules associated with DEAE, transfection or infection with the aforementioned viruses containing the nucleic acid molecule of interest, liposome-mediated transfection, and the like. Other examples include the N-TER® nanoparticle transfection system by Sigma-Aldrich; the FectoFly® transfection reagent for insect cells by Polyplus Transfection; Polyethyleneamine "Max" by Polysciences, Inc.; a unique non-viral transfection tool by Cosmo Bio Co. Ltd.; Lipofectamine® by Invitrogen; SatisFection® transfection reagent by Stratagene; Lipofectamine® transfection reagent by Invitrogen; FuGENE® HD transfection reagent by Roche Applied Science; GMP-compliant in vivo-jetPEI® transfection reagent by Polyplus Transfection; and Insect GeneJuice® transfection reagent by Novagen.

[0184] IV. Therapeutic composition Reprogramming using microRNA and one or both of ASCL1 and MYOCD can, in some cases, be combined with other reprogramming strategies to improve outcomes. In some embodiments, target tissue or initiation cells express or are induced to express the OCT4 polypeptide. Each target tissue or initiation cell can be treated or incubated with a reprogramming composition containing one or more WNT agonists, GSK3 inhibitors, TGF-beta inhibitors, epigenetic modifiers, adenylyl cyclase agonists, OCT4 expression activators, and any combination thereof. The composition may contain at least two such agents, or at least three such agents, or at least four such agents, or at least five such agents, or at least six such agents. For example, the composition may contain SB431542 (ALK4 / 5 / 7 inhibitor), CHIR99021 (GSK3 inhibitor), Parnate (LSD1 / KDM1 inhibitor, also known as tranylcypromine), and forskolin (adenylyl cyclase activator).

[0185] In certain embodiments, reprogramming is enhanced by the administration of one or more anti-inflammatory agents, such as anti-inflammatory steroids or non-steroidal anti-inflammatory drugs (NSAIDs).

[0186] Anti-inflammatory steroids for use in the present invention include corticosteroids, particularly those having glucocorticoid activity, such as dexamethasone and prednisone. Non-steroidal anti-inflammatory drugs (NSAIDs) for use in the present invention generally act by blocking the production of prostaglandins, cyclooxygenase-1 (COX-1) and / or cyclooxygenase-2 (COX-2) that cause inflammation and pain. Conventional NSAIDs function by blocking both COX-1 and COX-2. COX-2 selective inhibitors block only the COX-2 enzyme. In certain embodiments, the NSAID is a COX-2 selective inhibitor, such as celecoxib (Celebrex®), rofecoxib (Vioxx), and valdecoxib (Bextra). In certain embodiments, the anti-inflammatory agent is an NSAID prostaglandin inhibitor, such as piroxicam.

[0187] To prepare the composition, a vector and / or cell is generated, and the vector or cell is purified as necessary or desired. The vector, cell, and / or other agent can be suspended in a pharmaceutically acceptable carrier. If the composition contains only the compound and no cells, the composition can be lyophilized. These compounds and cells can be adjusted to appropriate concentrations and optionally combined with other agents. The absolute weight of a given compound and / or other agent included in a unit dose can vary widely. The dosage and frequency of administration can be optimized by those skilled in the art.

[0188] For example, about 10 2 ~10 10 vector genomes (vg) can be administered. In some embodiments, the dosage is at least about 10 2 vg, about 10 3 vg, about 10 4 vg, about 10 5 vg, about 10 6 vg, about 10 7 vg, about 10 8 vg, about 10 9 vg, about 10 9 vg, about 1010 The vector genome is vg or higher. In some embodiments, the dose is about 10 2 vg, about 10 3 vg, about 10 4 vg, about 10 5 vg, about 10 6 vg, about 10 7 vg, about 10 8 vg, about 10 9 vg, about 10 9 vg, about 10 10 It is a vector genome of vg or higher.

[0189] It is understood that the amount of vectors and cells used in treatment varies not only with the specific carrier selected, but also with the route of administration, the nature of the condition being treated, and the patient's age and condition. Ultimately, the healthcare provider can determine the appropriate dosage. Pharmaceutical compositions can be formulated in appropriate ratios of each compound in a single unit dosage form for administration, with or without cells. Cells or vectors may be provided separately, mixed with a liquid solution of the compound composition, or administered separately.

[0190] One or more suitable unit dosage forms containing compounds and / or reprogrammed cells can be administered by a variety of routes, including parenteral (including subcutaneous, intravenous, intramuscular, and intraperitoneal), intracranial, intraspinal, oral, rectal, cutaneous, transdermal, intrathoracic, intrapulmonary, and intranasal (respiratory) routes.

[0191] The vectors of the present invention can be prepared in many forms, including aqueous solutions, suspensions, tablets, hard or soft gelatin capsules, and other sustained-release formulations such as liposomes and molded polymer gels. Administration of the vectors often involves parenteral or topical administration in aqueous solutions.

[0192] Liquid pharmaceutical compositions may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or dry powders for reconstitution with water or other suitable vehicles before use. Such liquid pharmaceutical compositions may contain conventional additives such as suspending agents, emulsifiers, non-aqueous vehicles (which may include edible oils), or preservatives.

[0193] The vector can be formulated for parenteral administration (e.g., by injection such as bolus injection or continuous infusion) and may be provided in unit dosage forms in ampoules, pre-filled syringes, small infusion containers, or multi-dose containers with added preservatives. The pharmaceutical composition may take the form of a suspension, solution, or emulsion in an oily or aqueous vehicle and may contain formulation agents such as suspending agents, stabilizers, and / or dispersants. Suitable carriers include physiological saline, phosphate-buffered saline, and other materials commonly used in the art.

[0194] The composition also contains other components such as drugs useful in treating heart diseases, conditions, and injuries, for example, anticoagulants (e.g., dalteparin (Fragmin), danaparoid (Orgalan), enoxaparin (Robenox), heparin, tinzaparin (Inohep), and / or warfarin (Coumadin)), antiplatelet agents (e.g., aspirin, ticlopidine, clopidogrel, or dipyridamole), angiotensin-converting enzyme inhibitors (e.g., benazepril (Rotensin), captopril (Capoten), enalapril (Vasotec), fosinopril (Monop (Lil), lisinopril (Plinivir, Zestril), moexipril (Univasc), perindopril (Aceon), quinapril (Acupril), ramipril (Artes), and / or trandolapril (Mavic)), angiotensin II receptor blockers (e.g., candesartan (Atacand), eprosartan (Tebeten), irbesartan (Avapro), losartan (Cozar), telmisartan (Micardis), and / or valsartan (Diovan)), beta-blockers (e.g., acebutrol (Sectral), atenolol ( Tenormin), betaxolol (Kerlon), bisoprolol / hydrochlorothiazide (Diac), bisoprolol (Zebeta), carteolol (Caltrol), metoprolol (Lopressor, Toprol XL), nadolol (Colgard), propranolol (Inderal), sotalol (Betapace), and / or timolol (Brocadren)), calcium channel blockers (e.g., amlodipine (Norvasc, Lotrel), bepridil (Bascol), diltiazem (Carzizem, Thiazac), felodipine (Plenzil), nifezi Pine (Adalat, Procardia), nimodipine (Nimotop), nisoldipine (Slur), verapamil (Calan, Isobutin, Vereran), diuretics (e.g., amiloride (Midamol), bumetanide (Bumex), chlorothianide (Diuryl), chlorthalidone (Hygroton), furosemide (Lasix), hydrochlorothiazide (Esidorix, Hydrodiuryl), indapamide (Rozole), and / or spironolactone (Aldactone)), vasodilators (e.g., isosorbide dinitrate (Isodil), nesiritide (Natrecol),It may also contain hydralazine (aprezoline, nitrate, and / or minoxidil), statins, nicotinic acid, gemfibrozil, clofibrate, digoxin, digitoxin, lanoxine, or any combination thereof.

[0195] Additional agents such as antibacterial agents, antimicrobial agents, antiviral agents, biological response modifiers, growth factors, immunomodulators, monoclonal antibodies, and / or preservatives may also be included. The compositions of the present invention may also be used in combination with other forms of therapy.

[0196] The viral and nonviral vectors described herein can be administered to a subject to treat a disease or disorder. Such compositions may be administered as a single dose, multiple doses, sequentially, or intermittently, depending, for example, the physiological state of the recipient and other factors known to those skilled in the art, regardless of whether the purpose of administration is to respond to traumatic injury or for a more sustained therapeutic purpose. Administration of the compounds and compositions of the present invention may be essentially continuous over a pre-selected period or in a series of intervald doses. Both topical and systemic administration are possible. In some embodiments, topical delivery of viral or nonviral vectors is achieved. In some embodiments, topical delivery of cells and / or vectors is used to generate a population of cells within the heart. In some embodiments, such a localized population functions as cardiac "pacemaker cells."

[0197] V. Reprogramming Methods As described herein, target cells (e.g., non-cardiac cells) can be reprogrammed in vivo into a cardiac lineage (e.g., cardiomyocyte lineage) by administration of a virus or non-viral vector to a target tissue or cell. In some embodiments, the target cells are fibroblasts. In some embodiments, the target cells are cardiac fibroblast (CF) cells.

[0198] In some embodiments, one or more vectors containing polynucleotides encoding one or more reprogramming factors, such as ASCL1, MYOCD, MEF2C, TBX5, BAF60C, ESRRG, GATA4, GATA6, HAND2, IRX4, ISLL, MEF2C, MESP1, MESP2, NKX2.5, SRF, TBX20, ZFPM2, miR-133, or any combination thereof, are administered to the subject. In some embodiments, the reprogramming factors are selected from the group consisting of ASCL1, MYOCD, and microRNAs selected from Table 1, or any combination thereof. In certain embodiments, the reprogramming factors are ASCL1 and MYOCD (MyA), and microRNAs selected from Table 1. In certain embodiments, the reprogramming factors are ASCL1, MYOCD, MEF2C, and TBX5 (MyAMT), and microRNAs selected from Table 1. In some embodiments, the reprogramming factors are GATA4, MEF2C, and TBX5 (GMT), as well as microRNAs selected from Table 1. In other specific embodiments, the reprogramming factors are MYOCD, MEF2C, and TBX5 (i.e., MyMT), as well as microRNAs selected from Table 1. In other specific embodiments, the reprogramming factors are GATA4, MEF2C, TBX5, and MYOCD (i.e., 4F), as well as microRNAs selected from Table 1. In other embodiments, the reprogramming factors are GATA4, MEF2C, and TBX5, ESRRG, MYOCD, ZFPM2, and MESP1 (i.e., 7F), as well as microRNAs selected from Table 1.

[0199] In some embodiments, the vector induces or suppresses the expression of more marker genes in cardiomyocytes, such as TNNT2, ACTN2, ATP2A2, MYH6, RYR2, MYH7, ACTCL, MYBPC3, PIN, MB, LMOD2, MYL2, MY13, COX6A2, ATP5AL, TTN, TNNI3, PDK4, MYCZ2, CACNALC, SCN5A, MYOCD, and NPPA.

[0200] VI. Treatment method The vectors described herein can be used in methods for treating subjects having heart disease or cardiac disease. "To treat" or "to treat a condition or subject requiring treatment" means (1) taking steps to obtain beneficial or desirable outcomes, including clinical outcomes such as symptom relief; (2) preventing the disease, for example, preventing the development of clinical symptoms of the disease in patients who may be predisposed to the disease but have not yet experienced or shown symptoms of the disease; (3) inhibiting the disease, for example, preventing or reducing the onset of the disease or its clinical symptoms; (4) mitigating the disease, for example, causing regression of the disease or its clinical symptoms; or (5) delaying the disease. Beneficial or desirable clinical outcomes for the purposes of the present invention include, but are not limited to, the generation of induced cardiomyocytes and / or the promotion of myocardial regeneration.

[0201] Subjects requiring treatment with the compositions, cells, and methods of this disclosure include, but are not limited to, individuals with congenital heart disease, individuals with degenerative muscle disease, and individuals with conditions resulting in ischemic cardiac tissue (e.g., individuals with coronary artery disease). In some examples, the methods are useful for treating degenerative muscle disease or conditions (e.g., familial cardiomyopathy, dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, or coronary artery disease with ischemic cardiomyopathy). In some cases, the subject method is useful in treating individuals with heart or cardiovascular disease or disorder, such as cardiovascular disease, aneurysm, angina pectoris, arrhythmia, atherosclerosis, cerebrovascular disease (stroke), cardiovascular disease, congenital heart disease, congestive heart failure, myocarditis, coronary valvular disease, dilated artery disease, diastolic dysfunction, endocarditis, hypertension, cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, coronary artery disease with ischemic cardiomyopathy, mitral valve prolapse, myocardial infarction (heart attack), or venous thromboembolism.

[0202] Subjects suitable for treatment with the compositions, cells, and methods of this disclosure include individuals having cardiac conditions, including but not limited to conditions resulting in ischemic cardiac tissue (e.g., individuals with coronary artery disease) (e.g., mammalian subjects such as humans, non-human primates, and domestic mammals, and non-human experimental mammalian subjects such as mice and rats).

[0203] In some cases, individuals suitable for treatment are those suffering from heart or cardiovascular disease or condition, such as cardiovascular disease, aneurysm, angina pectoris, arrhythmia, atherosclerosis, cerebrovascular disease (stroke), cardiovascular disease, congenital heart disease, congestive heart failure, myocarditis, coronary valvular disease, dilated cardiomyopathy, diastolic dysfunction, endocarditis, hypertension, cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, coronary artery disease with ischemic cardiomyopathy, mitral valve prolapse, myocardial infarction (heart attack), or venous thromboembolism. In some cases, individuals suitable for treatment by the subject method include those with degenerative muscle disease, such as familial cardiomyopathy, dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, or coronary artery disease resulting in ischemic cardiomyopathy.

[0204] Subjects requiring treatment with the compositions, cells, and methods of this disclosure include, but are not limited to, individuals with congenital heart disease, individuals with degenerative muscle disease, and individuals with conditions resulting in ischemic cardiac tissue (e.g., individuals with coronary artery disease). In some examples, the methods are useful for treating degenerative muscle disease or conditions (e.g., familial cardiomyopathy, dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, or coronary artery disease with ischemic cardiomyopathy). In some cases, the subject method is useful in treating individuals with heart or cardiovascular disease or disorder, such as cardiovascular disease, aneurysm, angina pectoris, arrhythmia, atherosclerosis, cerebrovascular disease (stroke), cardiovascular disease, congenital heart disease, congestive heart failure, myocarditis, coronary valvular disease, dilated artery disease, diastolic dysfunction, endocarditis, hypertension, cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, coronary artery disease with ischemic cardiomyopathy, mitral valve prolapse, myocardial infarction (heart attack), or venous thromboembolism.

[0205] Subjects suitable for treatment with the compositions, cells and methods of this disclosure include individuals having cardiac conditions, including but not limited to conditions resulting in ischemic cardiac tissue (e.g., individuals with coronary artery disease) (e.g., mammalian subjects such as humans and non-human primates, and non-human mammalian subjects for laboratory use such as mice and rats). In some examples, subjects suitable for treatment have heart or cardiovascular diseases or conditions, such as cardiovascular disease, aneurysm, angina pectoris, arrhythmia, atherosclerosis, cerebrovascular disease (stroke), cardiovascular disease, congenital heart disease, congestive heart failure, myocarditis, coronary valvular disease, dilated artery disease, diastolic dysfunction, endocarditis, hypertension, cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, coronary artery disease with ischemic cardiomyopathy, mitral valve prolapse, myocardial infarction (heart attack), or venous thromboembolism. In some cases, individuals suitable for treatment by the subject method include those with degenerative muscle diseases, such as familial cardiomyopathy, dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, or coronary artery disease resulting from ischemic cardiomyopathy.

[0206] Examples of diseases and conditions that can be treated with reprogrammed cells and / or compositions (containing any of the compounds described herein, with or without reprogrammed cells) include any heart disease or cardiac dysfunction. Treatable diseases and conditions include those resulting from genetic defects, physical injury, environmental injury or conditioning, poor health, obesity, and other disease risk factors.

[0207] Ischemic cardiomyopathy is a chronic disease caused by coronary artery disease (a disease in which the coronary arteries on the surface of the heart become narrowed or blocked due to atherosclerosis). Coronary artery disease often causes episodes of myocardial ischemia, in which oxygen-rich blood is not adequately supplied to the heart muscle.

[0208] Non-ischemic cardiomyopathy is generally classified into three groups, primarily based on its clinical and pathological characteristics: dilated cardiomyopathy, hypertrophic cardiomyopathy, and restrictive and infiltrative cardiomyopathy.

[0209] In another embodiment, the heart disease is a genetic disorder such as Duchenne muscular dystrophy and Emery-Dreyfus dilated cardiomyopathy.

[0210] For example, heart disease can be selected from the group consisting of congestive heart failure, myocardial infarction, myocardial ischemia, myocarditis, and arrhythmia. In some embodiments, the subject has diabetes. In some embodiments, the subject does not have diabetes. In some embodiments, the subject suffers from diabetic cardiomyopathy.

[0211] For therapeutic purposes, recombinant viruses, nonviral vectors, and / or pharmaceutical compositions may be administered topically or systemically. Reprogrammed cell populations may be introduced by injection, catheter, implantable device, etc. Recombinant viruses or reprogrammed cell populations may be administered in any physiologically acceptable excipient or carrier that does not adversely affect the cells. For example, recombinant viruses, nonviral vectors, and / or pharmaceutical compositions may be administered intravenously or via intracardiac routes (e.g., epicardial or intramyocardial). Methods of administering recombinant viruses, nonviral vectors, cardiomyocytes, and pharmaceutical compositions (e.g., compositions containing vectors) of this disclosure to a subject, particularly a human subject, include injection, implantation, or infusion of the pharmaceutical composition (e.g., a composition containing a viral vector) or cells to a target site of the subject. Injection may include direct injection into muscle, and infusion may include intravascular injection. Vectors or pharmaceutical compositions may be inserted into a delivery device that facilitates the introduction of the pharmaceutical composition or cells into a subject by injection or implantation. Such delivery devices include tubes, such as catheters. The tube may further contain a needle, such as a syringe, through which the cells of the present invention can be introduced to a desired location in the target. In some embodiments, the pharmaceutical composition or cells are delivered by a microneedle patch, for example, as described in Tang et al. Cardiac cell-integrated microneedle patch for treating myocardial infarction. Science Advances 28 Nov 2018: Vol.4, no.11, eaat9365.

[0212] In some embodiments, the viral vectors of this disclosure can be used to treat subjects in need. In some embodiments, recombinant viruses can be administered to subjects in need, and the administration of recombinant viruses to subjects treats cardiovascular diseases in those subjects.

[0213] Recombinant viruses can be administered topically or systemically. Recombinant viruses can be engineered to target specific cell types by selecting an appropriate capsid protein or by pseudotyping the virus with a protein of a different viral type. Recombinant viruses can be first tested in appropriate animal models to determine the suitability of various therapeutic dosing regimens and dosages of viral particle compositions. At some level, recombinant viruses are evaluated for their ability to infect target cells in vivo. Recombinant viruses can also be evaluated to determine whether they migrate to target tissues, whether they induce an immune response in the host, or whether the appropriate number or dose of recombinant viruses to administer. Depending on the disease being treated, it may or may not be desirable for recombinant viruses to produce an immune response. Generally, if repeated administration of viral particles is required, it is advantageous that the viral particles are not immunogenic. For experimental purposes, viral particle compositions can be administered to immunodeficient animals (such as nude mice or animals that have been chemically or irradiated to be immunodeficient). After the infection period, target tissue or cells can be collected and evaluated to determine whether the tissue or cells are infected and whether the desired phenotype (such as induced cardiomyocytes) has been induced in the target tissue or cells.

[0214] Recombinant viruses can be administered by various routes, including but not limited to direct injection into the heart or cardiac catheterization. Alternatively, recombinant viruses can be administered systemically, such as by intravenous infusion. When direct injection is used, it can be performed by either open-heart surgery or minimally invasive surgery. In some cases, recombinant viruses are delivered into the pericardial cavity by injection or infusion. Injected or infused recombinant viruses can be tracked in various ways. For example, recombinant viruses labeled with or expressing detectable labels (such as green fluorescent protein or beta-galactosidase) can be easily detected. Recombinant viruses can be manipulated to cause target cells to express marker proteins such as surface-expressed proteins or fluorescent proteins. Alternatively, infection of target cells with recombinant viruses can be detected by the expression of cell markers not expressed by the animals used in the study (e.g., human-specific antigens when cells are injected into experimental animals). The presence and phenotype of target cells can be assessed by fluorescence microscopy (e.g., for green fluorescent protein or beta-galactosidase), immunohistochemistry (e.g., using antibodies against human antigens), ELISA (using antibodies against human antigens), or RT-PCR analysis using primers and hybridization conditions that induce specific amplification of RNA exhibiting the cardiac phenotype.

[0215] VIII. Kit Various kits containing any of the compositions, compounds, and / or pharmaceuticals described herein are described herein. A kit may contain any of the compounds described herein in dry or hydrated form, mixed together or individually packaged. The compounds and / or pharmaceuticals described herein may be packaged separately in separate vials, bottles, or other containers. Alternatively, any of the compounds and / or pharmaceuticals described herein may be packaged together as a single composition, or as two or more compositions that can be used together or separately.

[0216] The vector can be provided in the form of a delivery device within any kit. Alternatively, the delivery device can be included separately in the kit, and the instructions may describe how to assemble the delivery device before administration to the subject.

[0217] The kit may provide additional factors, such as any of the supplemental factors or drugs described herein, for the compositions of the preceding sections or other parts of this specification.

[0218] The following non-limiting embodiments illustrate some of the experimental work involved in the development of the present invention. [Examples]

[0219] Example 1 In this example, an adeno-associated virus (AAV) vector expressing two transgenes, myocardin (MYOCD) and ASCL1 (collectively referred to as "MyA"), was used. The MyA reprogramming cocktail facilitates direct reprogramming of cardiac fibroblasts into induced cardiomyocytes (iCM) in vivo and in vitro (data not shown). The myocardin transgene used in this vector, called MyΔ3 (SEQ ID NO: 16), has an internal deletion that reduces the gene size without apparent impact on gene function (data not shown).

[0220] The inventors designed a microRNA-based system that expresses MyA in target cells (cardiac fibroblasts) while suppressing MyA expression in non-target cells (cardiomyocytes). The test vector was engineered to include a microRNA binding site for each of several selected microRNAs at the 3'UTR of the polynucleotide encoding the MyΔ3-2A-ASCL1 transgene. The microRNA binding site was intended to suppress MyA expression in cells expressing the selected microRNA. In some experiments described below, a green fluorescent protein (GFP) reporter system was used instead of MyA.

[0221] miR-1 binding site Two miR-1 binding sites were tested: the complete complement of miR-1 (miR1_4) and the native miR-1 binding site of the 3'UTR or human MYOCD (MymiR1_4). For each binding site, mismatch negative controls were generated with mutated seed sequences (underlined) (miR1_4mut, MymiR1_4mut). [ka]

[0222] In each vector, the binding site to be tested was inserted four times in tandem into the 3'UTR of the AAVCAG-GFP vector. The vectors were packaged in AAV and used to infect iPSC-CM. iPSC-CM are pluripotent stem cells induced to form cardiomyocytes, and are used experimentally because maintaining primary cardiomyocytes in culture is not practical. Both GFP-miR1_4 and GFP-MymiR1_4 were repressed in iPSC-CM compared to the control constructs GFP-miR1_4mut and GFP-MymiR1_4mut (Figure 2A). GFP reporter expression was still observed in human cardiac fibroblast (hCF) cells (Figure 2B). The miR1_4 and GFP-MymiR1_4 constructs expressed the GFP reporter at approximately the same levels as their miR-1 mismatch controls. Therefore, the miR-1 microRNA binding site selectively represses transgene expression in CM cells compared to CF cells.

[0223] miR1_4 and miR1_4mut sequences are used in AAVMy Δ3 The binding site was inserted into the 3'UTR of cassette A to evaluate the effect of the combination of myocardialin and ASCL1 (MyA) on cardiomyocyte reprogramming. Reprogramming efficiency was determined by measuring the expression of seven genes related to cardiomyocyte phenotype. The data in Table 5 demonstrate that the MyA vector containing the miR-1 microRNA binding site induced the expression of the CM phenotype on day 7 after transduction of hCF cells with the vector. [Table 5]

[0224] Test vector My Δ3 A_miR1_4 is My Δ3 A_miR1_4mut or Parent My Δ3 It exhibited reprogramming activity at a level 5 to 10 times lower than that of cassette A.

[0225] Next, vectors with one, two, or three miR-1 binding sites were compared with vectors with four miR-1 binding sites. As shown in Table 6, vector My has only one miR-1 binding site. Δ3 A_miR1_1 is My Δ3 It showed higher efficacy than A_miR1_4, but the parent My Δ3 It remained less potent than vector A. [Table 6-1]

[0226] My Δ3 We generated constructs containing two (miR1_1mis2) or three (miR1_1mis3) mismatches outside the seed region within a single miR-1 binding site in the 3'UTR of A, thereby reducing the targeting of these miR-1 binding sites without eliminating them. [ka]

[0227] These constructs increased reprogramming efficacy compared to MyΔ3A_miR1_1 (Table 7), but did not sufficiently suppress transgene expression in cardiomyocytes (Figure 3). [Table 6-2]

[0228] miR-208a / b binding site The inventors of this invention, My Δ3During the reprogramming process of cardiomyocytes induced by A, an increase in the expression of microRNAs miR-1 and miR-133 was observed to precede the increase in the expression of miR-208a / b (Figure 4). MicroRNA miR-208a / b was detected in iPSC-CMs but not in hCFs that had undergone reprogramming for up to 3 weeks. An AAVCAG-GFP vector with a 4X tandem array of a perfectly complementary miR-208b binding site (208_4) was generated together with a mismatch negative control vector (208_4mut) with a mutated seed region and used for the infection of human iPSC-CMs. GFP-208_4 suppressed the expression of the transgene as did GFP-miR1_4 (Figure 5A). In hCFs, both GFP-208_4 and GFP-208_4mut expressed the transgene at lower levels compared to GFP-miR1_4 and GFP-miR1_4mut (Figure 5B). My Δ3 A_208_4 and My Δ3 Both A_208_4 and My Δ3 A_208_4 and My Δ3 A_208_4mut were able to drive robust reprogramming as evaluated by the expression of RNA markers 21 days after transduction of hCF cells (Table 7 and Figure 5C). My

Table 7

[0229] In vivo tests in mice In in vivo tests, My Δ3 A_208_4 was packaged into either an AAV5 capsid with a wild-type capsid sequence or an AAV5z capsid, a variant with high infectivity for cardiac fibroblasts (data not shown), and tested in mice using a mouse model of left anterior descending (LAD) ligation myocardial infarction (MI), with injection of the AAV vector into the epicardium at the time of injury. The vector design and dosage are summarized in Table 8.

Table 8

[0230] Efficacy was evaluated by echocardiography at weeks 2, 4, 6, and 8 after injection. All three test substances significantly maintained cardiac function (ejection fraction) compared to the GFP-encoding control (Figure 6A). After 8 weeks, all three test substances significantly maintained cardiac function (ejection fraction), but there was no statistically significant difference in reprogramming efficiency between MyA and MyA+miR-208 binding site vectors (Figure 6B). AAV5:My Δ3 A and AAV5: My Δ3 A_208_4 was equally effective in MI when delivered with the same viral capsid, AAV5.

[0231] As shown in the representative micrograph (Figure 6D), terminal scar analysis by trichrome staining and quantification of the percentage of fibrous tissue per cardiac cross-section showed that all three treatment groups exhibited a significant reduction in scar area (Figure 6C).

[0232] In vivo trials in pigs The vector was further tested in a porcine myocardial infarction (MI) model. Δ3 A_208_4 was packaged in an AAV5z capsid and injected epicardially into the border region of the porcine heart 28 days after a 90-minute balloon occlusion to induce ischemic injury. In parallel, the formulation buffer was also injected into infarcted pigs, with each group consisting of 10 animals. Echocardiography was performed at 3, 5, 7, and 9 weeks post-injection. Δ3 Pigs administered with A_208_4 showed a significant improvement in ejection fraction compared to controls at 5, 7, and 9 weeks post-injection (Figure 7). Thus, treatment with a non-myocardial cell targeting reprogramming cocktail resulted in a mean 10% improvement in cardiac function above baseline.

[0233] Improvement of miR-1 and miR-208a / b binding sites We tested variants of the miR-208 binding site that disrupt the RNA hairpin predicted at the microRNA binding site by introducing substitutions at two 5' nucleotide positions, and the results are shown in Table 9. [ka] [Table 9]

[0234] Further sequence variants outside the seed region were tested to identify microRNA binding sites that suppressed expression in iPSC-CMs while enabling transgene expression in hCFs, resulting in high-quality iCMs three weeks after reprogramming (see Table 10). [Table 10-1] [Table 10-2]

[0235] Some of the miR-208 binding sites in these sets were tested for their ability to repress transgene expression in iPSC-CMs (Figure 8) and to maintain or increase in vitro reprogramming efficacy compared to the parent vector (Table 9). 208MED13, an insertion based on the native miR-208 targeting site of the MED13 transcript, functioned well, enhancing reprogramming efficacy while maintaining iPSC-CM repression.

[0236] Example 2 In this example, two transgenes, myocardin with internal deletion (MYOCD) and ASCL1 (My Δ3 A) and an adeno-associated virus (AAV) vector expressing a polynucleotide encoding microRNA-133 (i.e., a combination of the three factors of MyA133) were used. This sequence encoding miR-133 is linked to the CAG promoter and MYOCD(MyA133). Δ3)It is inserted into the intron between the code arrays.

[0237] As shown in Table 11, the addition of miR133 to My Δ3A increased reprogramming as evaluated by the RNA expression of cardiomyocytes on day 21 after transduction with an AAV vector at an MOI of 640k. The microRNA binding sites of both 208_4 and 208MED13 retained the reprogramming effect of the vector, and 208MED13 showed better results than 208_4.

Table 11

[0238] The results were confirmed using two different virus doses in independently induced hCF cell lines, as shown in Table 12.

Table 12

[0239] The addition of miR-133 enhanced the expression of many heart markers by approximately two-fold after 3 weeks of in vitro reprogramming. The addition of miR-133a also showed no difference in efficacy between the My Δ3 A cassette and the My Δ3 A_208MED13 cassette, indicating that the cassette was not suppressed early by the addition of miR-133a.

[0240] My with the 208MED13 miR-208 microRNA binding site Δ3 A and My Δ3 A+133 vectors were tested in a rat LAD ligation model of ischemic injury. Virus injection was performed 2 weeks after ligation, and the treated animals were randomized to ensure equivalent baseline ejection rates between the treatment groups. The data shown in Figure 9 demonstrate that all test substances maintained ejection rates compared to the vehicle control (HBSS) (n = 10 rats / group). Irrespective of the inclusion of miR-133a in the cassette, My Δ3 A and MyΔ3 No significant difference was identified between this study and A_208MED13.

[0241] Materials and methods Isolation of primary adult human fibroblasts. To isolate adult human cardiac fibroblasts (AHCF), adult human left ventricles were cut into small pieces and digested in cardiac fibroblast digestion medium (10 μg / ml liberase TH, 10 μg / ml liberase TM, 1 unit / ml DNase I, 0.01% polaxomer) at 37°C for 1 hour. After digestion, the cells were filtered through a 70 μM strainer into a 50 mL Falcon tube. The cells were pelleted by spin-down at 1200 × g for 5 minutes and placed in fibroblast growth medium. The medium was changed every 2 days. After 4 days, AHCFs were frozen or re-seed on plates for viral transduction.

[0242] Cell reprogramming. For in vitro cardiac reprogramming, place AHCF in a culture dish or plate with 5 × 10⁶ cells. 3 / cm 2 Cells were seeded in fibroblast growth medium at a density of (-1 day). One day after seeding (day 0), the fibroblast growth medium was removed and viral medium was added. One day after viral transduction (day 1), the viral medium was replaced every two days until day 4 with iCM medium consisting of 4 parts Dulbecco's modified Eagle medium (DMEM), 1 part Gibco® medium 199, 10% FBS, 1% non-essential amino acids, and 1% penicillin / streptomycin. On day 4, the medium was changed to 75% iCM medium and 25% RPMI and B27. On day 7, the medium was changed to 50% iCM and 50% RPMI + B27. On day 11, the medium was changed to 25% iCM medium and 75% RPMI and B27. On day 14, the culture medium was replaced daily with RPMI, B27, and FFV (10 ng / ml rhFGF, 15 ng / ml rhFGF-10, and 5 ng / ml rhVEGF) until day 21.

[0243] Immunocytochemistry. For immunocytochemistry, cells were fixed with 4% paraformaldehyde for 20 minutes and permeabilized with 0.1% Triton®-X100 for 30 minutes at room temperature. After washing the cells three times with PBS, they were blocked with 1% bovine serum albumin (BSA) for 1 hour. The cells were then incubated for 1 hour with either a 1:200 dilution of mouse monoclonal anti-cardiac troponin T (cTnT) antibody (Thermo Scientific, MA5-12960) or a 1:200 dilution of mouse anti-α-actinin antibody (Sigma, A7811) in 1% BSA. After washing three times with PBS, the cells were incubated for 1 hour with a 1:200 dilution of donkey anti-mouse Alexa Fluor594 (Invitrogen, A21203) in 1% BSA. Next, cells were imaged and quantified using a cell imaging multimode reader, Cytation® 5 (BioTek).

[0244] Quantification and statistical analysis. All data are presented as mean values ​​including the standard error (SEM) of the mean, with n=2-3 per group. P-values ​​were calculated using either an independent / two-way t-test or a one-way analysis of variance (ANOVA). Statistical analysis was performed using the GraphPad Prism® 7 software package (GraphPad Software®). P-values ​​less than 0.05 were considered significant in all cases after adjustment for multiple pairwise comparisons.

[0245] MI surgery, epicardial injection of AAV, and echocardiography. Mouse surgery was performed on 9-10 week old CHARLES RIVER® CD-1 IGS male mice. Mice were anesthetized with 2.4% isoflurane / 97.6% oxygen and placed supine on a heated pad (37°C). Animals were intubated with a 20-gauge intravenous catheter and ventilated with a mouse ventilator (MINIVENT®, Harvard Apparatus, Inc.). MI was induced by permanently ligating the left anterior descending artery (LAD) with a 7-0 prolene suture. 20 μl of AAV (total 1.2E11 GC) was injected into the myocardium through an insulin syringe equipped with a built-in 29-gauge needle (BD). The entire volume was injected along the boundary between the infarct zone (IZ) and the border zone (BZ) based on the whitened infarct area after coronary artery occlusion. After injection, the chest was closed with sutures. All surgical procedures were performed under sterile conditions. Rat infarcts were generated as described above, but viral administration was performed 2 weeks after LAD ligation, with three 30 μl injections totaling 3 E11 GC. Cardiac function was assessed by two-dimensional transthoracic echocardiography of conscious mice using the VISUALSONICS® VEVO® 3100 imaging system. Ejection fraction (EF), end-systolic volume (ESV), and end-diastolic volume (EDV) were used as indicators of cardiosystolic function. All pig procedures and echocardiograms were performed at Charles River, Mattawan. Male castrated Yucatan minipigs were balloon-occluded under observation for 90 minutes, and thoracotomy-epidermal injection was performed 28 days after occlusion. The test substance or formulation buffer was delivered to the border zone in 10 injections of 500 μl each to obtain a total dose of E14 GC.

[0246] Example 3 The mRNA and protein stability of various forms of untargeted constructs in the presence of endogenous miR-208 is evaluated in human iPSC-derived cardiomyocytes (hiPSC-CM). hiPSC-CM are infected with AAV containing the following cassettes.

[0247] My Δ3 A_208

[0248] My Δ3 A_208mut

[0249] My Δ3 A-CMVInt-133_MED13

[0250] My Δ3 A-CMVInt-133_208

[0251] My Δ3 A-CMVInt_208

[0252] Cells are collected on days 4 and 14 after transduction. RNA levels of the MyΔ3A transcript are measured by qRT-PCR. ASCL1 protein levels are evaluated by Western blotting. Effective detargeting results in reduced protein levels compared to constructs containing the mutated miR-208 site.

[0253] The mRNA and protein stability of these same constructs are also evaluated according to different levels of miR-208. HEK293 cells that do not express endogenous miR-208 are infected with the above constructs. After 2 days, they are transfected with different levels of miR-208a or miR-208b. Cells are collected 4 days after transfection. Δ3 The RNA level of transcript A is measured by qRT-PCR. The protein level of ASCL1 is evaluated by Western blotting. From these results, the relative dose response of each untargeted construct is determined.

[0254] Expression from various non-targeted constructs will also be evaluated in an in vivo pig model. The following seven cassettes will be created using AAV. [Table 13]

[0255] A pool of seven constructs is delivered to three separate sites in the hearts of six healthy Yorkshire pigs by open-thoracic epicardial injection. Each injection site is marked with glass bead sutures for identification at necropsy. The animals are euthanized at 4 weeks (n=3) or 12 weeks (n=3) post-injection. Biopsy punches from each injection site are collected at necropsy for RNA and DNA analysis. RNA expression against the delivered vector genome is compared for each of the seven vectors at both time points. In certain embodiments, for example, the following are provided: (Item 1) A vector comprising a polynucleotide including a polynucleotide sequence encoding one or more transgenes and a microRNA binding site for a microRNA, wherein the microRNA binding site is operably ligated to the polynucleotide sequence encoding the one or more transgenes, and the microRNA is expressed at a higher level in cardiomyocytes or cardiomyocyte progenitor cells compared to cardiac fibroblasts. (Item 2) The vector according to item 1, wherein the microRNA binding site promotes the specific suppression of the expression of one or more transgenes in cardiomyocytes or cardiomyocyte progenitor cells compared to cardiac fibroblasts. (Item 3) The vector according to item 1 or 2, wherein the microRNA is expressed at a lower level in cardiac fibroblasts and / or at a lower level in cardiac fibroblasts treated with the cardiomyocyte reprogramming factor for less than about 7 days, compared to the expression level of the microRNA in cardiomyocytes and / or the expression level of the microRNA in cardiac fibroblasts treated with the cardiomyocyte reprogramming factor for more than about 7 days. (Item 4) The vector described in any one of items 1 to 3, wherein the microRNA is miR-208. (Item 5) The vector described in any one of items 1 to 3, wherein the microRNA is miR-1. (Item 6) The vector described in any one of items 1 to 3, wherein the microRNA is miR-133. (Item 7) The vector described in item 4, wherein the microRNA is miR-208a. (Item 8) The vector described in item 4, wherein the microRNA is miR-208b. (Item 9) The vector described in item 8, wherein the microRNA is miR-208b-3p. (Item 10) The microRNA binding site is [ka] A vector as described in item 9 that shares more than 70% identity with the given vector and does not share a mismatch in the underlined seed region containing the sequence CGTCTTA. (Item 11) The vector described in item 9, wherein the microRNA binding site is AAAATATATGTAATCGTCTTAA (sequence number 136). (Item 12) The vector described in item 9, wherein the microRNA binding site is ACAAACCTTTTGTTCGTCTTAT (Sequence ID 135). (Item 13) The vector described in item 9, wherein the microRNA binding site is TGAAACCTTTTGTTCGTCTTAT (Sequence ID 137). (Item 14) The vector according to any one of items 1 to 13, wherein the polynucleotide comprises at least two microRNA binding sites for the microRNA. (Item 15) The vector according to item 14, wherein the polynucleotide comprises at least four microRNA binding sites for the microRNA. (Item 16) The vector according to item 14 or 15, wherein the polynucleotide comprises up to six microRNA binding sites for the microRNA. (Item 17) The vector according to item 16, wherein the polynucleotide comprises four microRNA binding sites for the microRNA. (Item 18) A vector according to any one of items 1 to 17, comprising one or more transgenes, wherein the transgene contains one or more cardiomyocyte reprogramming factors. (Item 19) The vector according to item 18, wherein the one or more cardiomyocyte reprogramming factors include two or more of MYOCD, ASCL1, GATA4, MEF2C, TBX5, miR-133, and MESP1. (Item 20) The vector described in item 18, wherein the one or more cardiomyocyte reprogramming factors include three or more of the following: MYOCD, ASCL1, GATA4, MEF2C, TBX5, miR-133, and MESP1. (Item 21) The vector according to item 18, wherein the one or more cardiomyocyte reprogramming factors include MYOCD and ASCL1. (Item 22) The vector described in item 21, wherein the aforementioned polynucleotide sequence encodes the MYOCD-2A-ASCL1 protein. (Item 23) The vector described in any one of items 20 to 22, wherein the aforementioned MYOCD includes an internal deletion. (Item 24) The vector according to item 23, wherein the polynucleotide comprises, in order from 5' to 3', a sequence encoding a promoter, MYOCD and ASCL1, the microRNA binding site, and a polyadenylation sequence. (Item 25) The vector according to any one of items 18 to 24, wherein the polynucleotide comprises a sequence encoding miR-133. (Item 26) The vector according to item 24 or 25, wherein the polynucleotide comprises a sequence that is at least 95% identical to SEQ ID NO: 138, SEQ ID NO: 139, or SEQ ID NO: 140. (Item 27) The vector described in any one of items 1 to 26, wherein the vector is a viral vector. (Item 28) The vector described in item 27 is an adeno-associated virus (AAV) vector. (Item 29) A method for reprogramming cardiac fibroblasts into cardiomyocytes, a) Selecting microRNAs specifically expressed in the induced cardiomyocytes by treating cardiac fibroblasts with an effective amount of a composition that induces reprogramming of cardiac fibroblasts into cardiomyocytes, and measuring the expression of one or more microRNAs in the cardiac fibroblasts, wherein the selected microRNAs are expressed in the cardiac fibroblasts only after a predetermined time. b) To generate a vector comprising a polynucleotide containing one or more microRNA binding sites for the selected microRNA, which is operably linked to one or more polynucleotides encoding cardiomyocyte reprogramming factors, c) A method comprising contacting cardiac fibroblasts with an effective amount of the vector. (Item 30) The method according to item 29, wherein the microRNA binding site suppresses the expression of one or more cardiomyocyte reprogramming factors in cardiomyocytes. (Item 31) The method according to item 29 or 30, wherein the microRNA binding site suppresses the expression of one or more cardiomyocyte reprogramming factors in skeletal muscle cells. (Item 32) The method according to any one of items 29 to 31, wherein the microRNA binding site suppresses the expression of one or more cardiomyocyte reprogramming factors in cardiomyocyte progenitor cells. (Item 33) The method according to any one of items 29 to 32, wherein the microRNA is miR-208. (Item 34) The method according to any one of items 29 to 32, wherein the microRNA is miR-1. (Item 35) The method according to any one of items 29 to 32, wherein the microRNA is miR-133. (Item 36) The method according to item 33, wherein the microRNA is miR-208a. (Item 37) The method according to item 33, wherein the microRNA is miR-208b. (Item 38) The method according to item 37, wherein the microRNA is miR-208b-3p. (Item 39) The microRNA binding site is [ka] The method described in item 38, which shares more than 70% identity with the given sequence and does not share a mismatch in the underlined seed region containing the sequence CGTCTTA. (Item 40) The method according to item 38, wherein the microRNA binding site is AAAATATATGTAATCGTCTTAA (Sequence ID 136). (Item 41) The method according to item 38, wherein the microRNA binding site is ACAAACCTTTTGTTCGTCTTAT (Sequence ID 135). (Item 42) The method according to item 38, wherein the microRNA binding site is TGAAACCTTTTGTTCGTCTTAT (Sequence ID 137). (Item 43) The method according to any one of items 29 to 42, wherein the polynucleotide comprises at least two microRNA binding sites for the microRNA. (Item 44) The method according to item 43, wherein the polynucleotide comprises at least four microRNA binding sites for the microRNA. (Item 45) The method according to item 43, wherein the polynucleotide comprises up to six microRNA binding sites for the microRNA. (Item 46) The method according to item 43, wherein the polynucleotide comprises four microRNA binding sites for the microRNA. (Item 47) A method for reprogramming cardiac fibroblasts into cardiomyocytes, comprising contacting the cardiac fibroblasts with an effective amount of the vector described in any one of items 1 to 28. (Item 48) The method according to item 47, wherein the method induces the expression of at least one marker of the cardiomyocyte phenotype in the cardiac fibroblasts. (Item 49) The method according to item 48, wherein at least one marker of the cardiomyocyte phenotype is the messenger RNA level of ASCL1, MYOCD, CASQ2, NPPA, or TNNT2. (Item 50) A method for promoting the formation of cardiomyocytes in a subject requiring the promotion of cardiomyocyte formation, comprising administering a vector described in any one of items 1 to 28 to the subject. (Item 51) A method for treating heart failure in a subject requiring treatment for heart failure, comprising administering a vector described in any one of items 1 to 28 to the subject. (Item 52) A method for treating heart failure in a subject requiring treatment for heart failure, comprising administering to the subject an AAV vector comprising a polynucleotide including, in the order from 5' to 3', a promoter, a sequence encoding MYOCD and ASCL1, a microRNA binding site, and a polyadenylated sequence, wherein the microRNA binding site is a microRNA binding site for miR-1, miR-133, miR-208a, miR-208b, and / or miR-208b-3p. (Item 53) The method according to item 52, wherein the microRNA binding site is a microRNA binding site for miR-1. (Item 54) The method according to item 52, wherein the microRNA binding site is a microRNA binding site for miR-133. (Item 55) The method according to item 52, wherein the microRNA binding site is a microRNA binding site for miR-208a. (Item 56) The method according to item 52, wherein the microRNA binding site is a microRNA binding site for miR-208b. (Item 57) The method according to item 52, wherein the microRNA binding site is a microRNA binding site for miR-208b-3p. (Item 58) The method according to any one of items 52 to 57, wherein the polynucleotide comprises a sequence encoding miR-133. (Item 59) The method according to any one of items 52 to 58, wherein the heart failure is due to myocardial infarction. (Item 60) The method according to any one of items 52 to 59, wherein the aforementioned heart failure is heart failure with reduced ejection fraction (HFrEF). (Item 61) The method according to any one of items 52 to 60, wherein the method increases the ejection fraction in the subject compared to the subject before administration. (Item 62) The method according to any one of items 52 to 61, wherein the method increases the ejection fraction in the subject compared to an untreated control. (Item 63) The method according to any one of items 52 to 62, wherein the method increases the ejection rate in the subject to at least about 28%, 29%, 30%, 31%, or 32%. (Item 64) The method according to any one of items 61 to 64, wherein the ejection fraction is evaluated 8 weeks after a predetermined time interval following administration of the AAV vector. (Item 65) The method according to any one of items 52 to 64, wherein the method reduces scar tissue formation in the subject compared to the subject before administration. (Item 66) The method according to any one of items 52 to 65, wherein the method reduces scar tissue formation in the subject compared to an untreated control. (Item 67) The method according to item 65 or 66, wherein the method reduces scar tissue formation in the subject to at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%. (Item 68) The method according to any one of items 65 to 67, wherein scar tissue formation is evaluated at a predetermined time after administration of the AAV vector, optionally at 8 weeks.

Claims

[Claim 1] The invention described in the specification.