Recombinant poxvirus-based vaccine against SARS-CoV-2 virus
Recombinant poxviruses encoding SARS-CoV-2 proteins, synthesized chemically for safety and reproducibility, address the need for improved vaccines by inducing effective immune responses against the virus, including T-cell immunity.
Patent Information
- Application Number
- JP2026034131
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-11-16
- Filing Date
- 2026-03-04
- Publication Date
- 2026-05-19
AI Technical Summary
There is a need for improved methods and vaccines against the SARS-CoV-2 virus, particularly due to its high mutation rate and the inefficacy of existing vaccines in providing comprehensive protection.
Development of recombinant poxviruses encoding SARS-CoV-2 viral proteins, such as the spike, membrane, and nucleocapsid proteins, which are synthesized chemically to ensure safety and reproducibility, and are used in immunogenic formulations to induce an immune response.
The recombinant poxviruses provide a safe and effective means to generate an immune response against SARS-CoV-2, offering protection and reducing the progression of the virus through T-cell immunity.
Smart Images

Figure 2026083277000076 
Figure 2026083277000077 
Figure 2026083277000078
Abstract
Description
[Technical Field]
[0001] Cross-reference with related applications This application claims priority and benefit of U.S. Provisional Application No. 62 / 981,997 filed February 26, 2020, and U.S. Provisional Application No. 63 / 114,514 filed November 16, 2020, whose entire contents are incorporated by reference thereby.
[0002] Sequence List This application includes a sequence listing, which was electronically submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on 25 February 2021, named 104545-0047-WO1_SL.txt, and has a size of 766,833 bytes. [Background technology]
[0003] Background of this disclosure On December 31, 2019, the Wuhan Health Commission reported a cluster of atypical pneumonia cases in Wuhan, China. The first patient began exhibiting symptoms of the disease in mid-December 2019. Clinical isolates were found to contain a novel coronavirus. As of January 28, 2020, there were more than 4,500 confirmed cases by laboratory and more than 100 known deaths. This novel coronavirus, now referred to as SARS-CoV-2 or 2019-nCoV, is related to severe acute respiratory syndrome coronavirus (SARS-CoV), but the nucleotide-level similarity is only about 80%. Ralph et al. J Infect Dev Ctries. 2020 Jan 31; 14 (1): 3-17.
[0004] Coronaviruses are enveloped single-stranded RNA viruses with positive-sense RNA genomes ranging in length from 25.5 kb to approximately 32 kb. Spheroidal viral particles range in diameter from 70 nm to 120 nm and contain four structural proteins. Despite the fact that much effort is being made to provide methods for vaccines and delivery vectors against SARS-CoV-2, there is still a need to provide additional and improved approaches against this coronavirus.
Prior Art Documents
Non-Patent Documents
[0005]
Non-Patent Document 1
Summary of the Invention
Means for Solving the Problems
[0006] Summary of the Disclosure Aspects of the disclosure provide recombinant poxviruses comprising nucleic acids encoding SARS-CoV-2 viral proteins, methods for producing such viruses, and use of such viruses as immunogens in immunogenic formulations, for example, against the SARS-CoV-2 virus. Another aspect of the disclosure provides recombinant synthetic poxviruses comprising nucleic acids encoding SARS-CoV-2 viral proteins, methods for producing such viruses, and use of such viruses as immunogens in immunogenic formulations, for example, against the SARS-CoV-2 virus. In some embodiments, the synthetic poxvirus is assembled and replicated from chemically synthesized DNA that is safe, reproducible, and free of contaminants. Chemical genome synthesis does not rely on a natural template, allowing for extensive structural and functional modification of the viral genome. Chemical genome synthesis is particularly useful when a natural template is not available for genetic replication or modification by conventional molecular biology methods.
[0007] In one embodiment, the present disclosure relates to a recombinant poxvirus comprising nucleic acid encoding a SARS-CoV-2 viral protein, wherein the SARS-CoV-2 protein is selected from the group consisting of a spike protein (S), a membrane protein (M), and a nucleocapsid protein (N), or a combination of two or more of the said proteins.
[0008] In another aspect, the Disclosure relates to a pharmaceutical composition comprising the recombinant poxvirus of the Disclosure.
[0009] In another aspect, the Disclosure relates to cells infected with the recombinant poxvirus of the Disclosure.
[0010] In another aspect, the present disclosure relates to a method for selecting cells expressing the SARS-CoV-2 viral protein, comprising the steps of infecting the cells with the recombinant poxvirus of the present disclosure, and selecting the infected cells expressing the SARS-CoV-2 viral protein.
[0011] In another aspect, the Disclosure relates to a method for inducing an immune response to the SARS-CoV-2 virus in subjects who need to induce an immune response to the SARS-CoV-2 virus or subjects who are at risk from the SARS-CoV-2 virus, the method comprising the step of administering to the subjects an immunologically effective amount of the recombinant poxvirus of the Disclosure.
[0012] In another aspect, the present disclosure relates to a method for generating recombinant poxvirus of the present disclosure, comprising the steps of (a) infecting a host cell with a poxvirus; (b) transfecting the infected cell from step (a) with a nucleic acid encoding the SARS-CoV-2 viral protein to generate a recombinant poxvirus; and (c) selecting a recombinant poxvirus wherein the nucleic acid encoding the SARS-CoV-2 viral protein, when transfected, is located in a region of the poxvirus that is not essential for poxvirus replication.
[0013] For illustrative purposes, drawings and various embodiments of this disclosure are provided. However, it should be understood that this disclosure is not limited to the exact arrangements and means shown in the drawings. In embodiments of the present invention, for example, the following items are provided. (Item 1) A recombinant poxvirus comprising nucleic acid encoding a SARS-CoV-2 viral protein, wherein the SARS-CoV-2 protein is selected from the group consisting of a spike protein (S), a membrane protein (M), and a nucleocapsid protein (N), or a combination of two or more of the said proteins. (Item 2) An orthopoxvirus, a recombinant poxvirus as described in item 1. (Item 3) The recombinant poxvirus described in item 2, wherein the orthopoxvirus is selected from the group consisting of camelpox (CMLV) virus, cowpox virus (CPXV), paradoxal paradoxal virus (ECTV), horsepox virus (HPXV), monkeypox virus (MPXV), vaccinia virus (VACV), smallpox virus (VARV), rabbitpox virus (RPXV), raccoonpox virus, skunkpox virus, gerbilpox virus, uassingishoo disease virus, and volepox virus. (Item 4) The aforementioned orthopoxvirus is the horsepox virus, a recombinant poxvirus as described in item 2. (Item 5) The aforementioned horsepox virus is strain MNR-76, a recombinant poxvirus as described in item 4. (Item 6) The recombinant poxvirus described in item 2, wherein the orthopoxvirus is a vaccinia virus. (Item 7) The aforementioned vaccinia viruses include Western Reserve, Western Reserve Clone 3, Tian Tian, Tian Tian clone TP5, Tian Tian clone TP3, NYCBH, and NYCBH clone Acambis. 2000 (ACAM 2000), Wyeth, Copenhagen, Lister, Lister 107, Lister-LO, Lister GL-ONC1, Lister GL-ONC2, Lister GL-ONC3, Lister GL-ONC4, Lister CTC1, Lister IMG2 (Turbo FP635), IHD-W, LC16m18, Lederle, Tashkent clone TKT3, Tashkent clone TKT4, USSR, Evans, Praha, L-IVP, V-VET1 or LIVP 6.1.1, Ikeda, EM-63, Malbran, Duke, 3737, CV-1, Connaught Laboratories, Serro 2, CM-01, NYCBH Dryvax clone DPP13, NYCBH Dryvax clone DPP15, NYCBH Dryvax clone DPP20, NYCBH Recombinant poxviruses as described in item 6, selected from the group of strains consisting of Dryvax clone DPP17, NYCBH Dryvax clone DPP21, VACV-IOC, Mulford 1902, vasocalanthinous vaccinia virus Ankara (CVA), modified vascinia Ankara (MVA), and MVA-BN. (Item 8) A recombinant poxvirus as described in any one of items 1 to 7, wherein the SARS-CoV-2 protein is the S protein. (Item 9) A recombinant poxvirus as described in any one of items 1 to 8, wherein the amino acid sequence of the SARS-CoV-2 virus protein is modified compared to the wild-type protein. (Item 10) A recombinant poxvirus as described in item 8, wherein the SARS-CoV-2 virus S protein has been modified to infect mice. (Item 11) The recombinant poxvirus according to item 8, wherein the amino acid sequence of the SARS-CoV-2 virus S protein comprises one or more substitutions selected from Y459H, D614G, S943P, K986P, and V987P relative to the wild-type S protein (SEQ ID NO: 47). (Item 12) A recombinant poxvirus according to any one of items 1 to 11, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located in a region of the poxvirus that is not essential for the replication of the poxvirus. (Item 13) The recombinant poxvirus described in item 12, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located at the thymidine kinase (TK) locus of the poxvirus. (Item 14) The recombinant poxvirus described in item 12, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located at the B22R homologous gene locus of the poxvirus. (Item 15) A recombinant poxvirus according to any one of items 1 to 14, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is operably linked to a promoter. (Item 16) The recombinant poxvirus described in item 15, wherein the promoter is a poxvirus-specific promoter. (Item 17) The recombinant poxvirus described in item 16, wherein the poxvirus-specific promoter is the vaccinia virus initial promoter. (Item 18) The recombinant poxvirus described in item 16, wherein the poxvirus-specific promoter is the vaccinia virus late promoter. (Item 19) The recombinant poxvirus described in item 16, wherein the poxvirus-specific promoter is the tandemvaccinia virus early and late promoters. (Item 20) A synthetic poxvirus, a recombinant poxvirus as described in any one of items 1 through 19. (Item 21) TNX-2200(synVACVΔA2K105 SARS-CoV2-Spike-co ), TNX-2200 clone 1.1.1.1.1, TNX-2200 clone 2.1.1.1.1, TNX-1800 (scHPXVΔ200 SARS-COV2-Spike-co Recombinant poxviruses as described in item 20, selected from the group consisting of TNX-1800a, TNX-1800a-1, TNX-1800b, and TNX-1800b-2. (Item 22) TNX-1800b-2, a recombinant poxvirus as described in item 21. (Item 23) TNX-1800a-1, a recombinant virus as described in item 21. (Item 24) Recombinant poxvirus as described in item 20, comprising any one of sequence numbers 63, 64, or 65. (Item 25) A pharmaceutical composition comprising a recombinant poxvirus as described in any one of items 1 to 24 and a pharmaceutically acceptable carrier. (Item 26) The aforementioned recombinant poxvirus is TNX-2200(synVACVΔA2K105 SARS-CoV2-Spike-co ), TNX-2200 clone 1.1.1.1.1, TNX-2200 clone 2.1.1.1.1, TNX-1800 (scHPXVΔ200 SARS-COV2-Spike-coA pharmaceutical composition according to item 25, selected from the group consisting of TNX-1800a, TNX-1800a-1, TNX-1800b, and TNX-1800b-2. (Item 27) The pharmaceutical composition according to item 25, wherein the recombinant poxvirus comprises one of sequence numbers 63, 64, or 65. (Item 28) The pharmaceutical composition according to item 26, wherein the recombinant poxvirus is TNX-1800b-2. (Item 29) The pharmaceutical composition according to item 26, wherein the recombinant poxvirus is TNX-1800a-1. (Item 30) Cells infected with any of the recombinant poxviruses listed in items 1 through 29. (Item 31) A mammalian cell, as described in item 30. (Item 32) The cells described in item 31, wherein the mammalian cells are Vero cells, Vero E6 cells, or BSC-40 cells. (Item 33) The cells described in item 31, wherein the mammalian cells are Vero adherent cells, Vero suspension cells, BHK-21 cells, ACE2 knockout Vero cells, or MRC-5 cells. (Item 34) MRC-5 cells, as described in item 33, grown in the presence of 5% fetal bovine serum. (Item 35) The cells described in item 30 are tori cells. (Item 36) The cells described in item 35, wherein the aforementioned chicken cells are chicken embryo fibroblasts, duck embryo-derived cells, EB66® cells, AGE1.CRpIX® cells, or DF-1 cells. (Item 37) These are adherent cells, as described in item 30. (Item 38) These are suspension cells, as described in item 30. (Item 39) A method for selecting cells expressing the SARS-CoV-2 viral protein, comprising the steps of: infecting the cells with a recombinant poxvirus described in any one of items 1 to 24; and selecting the infected cells expressing the SARS-CoV-2 viral protein. (Item 40) The aforementioned recombinant poxvirus is TNX-2200(synVACVΔA2K105 SARS-CoV2-Spike-co ), TNX-2200 clone 1.1.1.1.1, TNX-2200 clone 2.1.1.1.1, TNX-1800 (scHPXVΔ200 SARS-COV2-Spike-co A method for selecting cells expressing the SARS-CoV-2 viral protein described in item 39, selected from the group consisting of TNX-1800a, TNX-1800a-1, TNX-1800b, and TNX-1800b-2. (Item 41) A method for selecting cells expressing the SARS-CoV-2 viral protein described in item 39, wherein the recombinant poxvirus comprises one of sequence numbers 63, 64, or 65. (Item 42) A method for selecting cells expressing the SARS-CoV-2 viral protein described in item 40, wherein the recombinant poxvirus is TNX-1800b-2. (Item 43) A method for selecting cells expressing the SARS-CoV-2 viral protein described in item 40, wherein the recombinant poxvirus is TNX-1800a-1. (Item 44) A method for inducing an immune response to the SARS-CoV-2 virus in a subject, comprising the step of administering to the subject an immunologically effective amount of a recombinant poxvirus described in any one of items 1 to 24 or a pharmaceutical composition described in any one of items 25 to 29. (Item 45) A method for inducing an immune response to the SARS-CoV-2 virus in a subject, as described in item 44, wherein the immunologically effective amount of recombinant poxvirus is administered by a random cutting method. (Item 46) A method for inducing an immune response to the SARS-CoV-2 virus in a subject, as described in item 44, wherein the immune response comprises an antibody capable of neutralizing the SARS-CoV-2 virus. (Item 47) A method for inducing an immune response to the SARS-CoV-2 virus in a subject, as described in item 44, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting the subject from the SARS-CoV-2 virus. (Item 48) A method for inducing an immune response to the SARS-CoV-2 virus in a subject, according to item 44, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents the progression of the virus after SARS-CoV-2 infection in the subject. (Item 49) A method for inducing an immune response to the SARS-CoV-2 virus in a subject, as described in item 44, wherein the immune response is a T-cell immune response. (Item 50) A method for inducing an immune response to SARS-CoV-2 virus and poxvirus, wherein the subject is subjected to an immunologically effective amount of recombinant poxvirus as described in any one of items 1 to 24 or a pharmaceutical composition as described in any one of items 25 to 29. A method comprising the step of administering a drug. (Item 51) The immunologically effective dose of recombinant poxvirus is administered by the random cutting method, in an immune response to SARS-CoV-2 virus and poxvirus as described in item 50. A method to induce it. (Item 52) A method for inducing an immune response to the SARS-CoV-2 virus and poxvirus according to item 50, wherein the immune response comprises antibodies capable of neutralizing the SARS-CoV-2 virus and the poxvirus. (Item 53) A method for inducing an immune response to the SARS-CoV-2 virus and poxvirus according to item 50, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting the subject from the SARS-CoV-2 virus and the poxvirus. (Item 54) A method for inducing an immune response to SARS-CoV-2 virus and poxvirus according to item 50, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents the progression of SARS-CoV-2 virus infection and / or poxvirus infection in the subject. (Item 55) A method for inducing an immune response to SARS-CoV-2 virus and poxvirus as described in item 50, wherein the immune response is a T-cell immune response. (Item 56) A method for inducing an immune response to SARS-CoV-2 virus and poxvirus as described in any one of items 50 to 55, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus. (Item 57) A method for inducing T-cell immunity against the SARS-CoV-2 virus, comprising the step of administering to a subject an immunologically effective amount of a recombinant poxvirus according to any one of items 1 to 24 or a pharmaceutical composition according to any one of items 25 to 29. (Item 58) A method for inducing T-cell immunity against the SARS-CoV-2 virus, as described in item 57, wherein the immunologically effective amount of recombinant poxvirus is administered by a random cutting method. (Item 59) A method for inducing T-cell immunity against the SARS-CoV-2 virus, as described in item 57, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting the subject from the SARS-CoV-2 virus. (Item 60) A method for inducing T-cell immunity against the SARS-CoV-2 virus according to item 57, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents the progression of the SARS-CoV-2 infection in the subject. (Item 61) A method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus, comprising the step of administering to the subject an immunologically effective amount of a recombinant poxvirus described in any one of items 1 to 24 or a pharmaceutical composition described in any one of items 25 to 29. (Item 62) The immunologically effective dose of recombinant poxvirus is administered by the random cutting method, providing T-cell immunity against SARS-CoV-2 virus and poxvirus as described in item 61. A method to induce it. (Item 63) The immunologically effective amount of recombinant poxvirus can protect the subject from the SARS-CoV-2 virus and the poxvirus, as described in item 61. The present invention relates to a method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus. (Item 64) A method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus according to item 61, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents the progression of SARS-CoV-2 infection and / or poxvirus infection in the subject. (Item 65) A method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus as described in any one of items 61 to 64, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus. (Item 66) A method for producing a recombinant poxvirus as described in any one of items 1 to 65, (d) A step of infecting host cells with the poxvirus; (e) Transfecting the infected cells of step (a) with nucleic acids encoding SARS-CoV-2 viral proteins to produce recombinant poxvirus; and (f) A step of selecting a recombinant poxvirus, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located in a region of the poxvirus that is not essential for the replication of the poxvirus when transfected. Methods that include... (Item 67) The method according to any one of items 39 to 66, wherein the SARS-CoV-2 protein is selected from the group consisting of the S spike protein, the M protein and the N protein, or two or more combinations of the proteins. (Item 68) The method according to any one of items 39 to 67, wherein the poxvirus is an orthopoxvirus. (Item 69) The method according to item 68, wherein the orthopoxvirus is selected from the group consisting of camelpox (CMLV) virus, cowpox virus (CPXV), paradoxical limb disease virus (ECTV), horsepox virus (HPXV), monkeypox virus (MPXV), vaccinia virus (VACV), smallpox virus (VARV), rabbitpox virus (RPXV), raccoonpox virus, skunkpox virus, gerbilpox virus, uassingishoo disease virus, and volepox virus. (Item 70) The method according to item 68, wherein the orthopox virus is the horsepox virus. (Item 71) The method according to item 70, wherein the horsepox virus is strain MNR-76. (Item 72) The method according to item 68, wherein the orthopox virus is a vaccinia virus. (Item 73) The aforementioned vaccinia viruses include Western Reserve, Western Reserve Clone 3, Tian Tian, Tian Tian clone TP5, Tian Tian clone TP3, NYCBH, and NYCBH clone Acambis. 2000, Wyeth, Copenhagen, Lister, Lister 107, Lister-LO, Lister GL-ONC1, Lister GL-ONC2, Lister GL-ONC3, Lister GL-ONC4, Lister CTC1, Lister IMG2 (Turbo FP635), IHD-W, LC16m18, Lederle, Tashkent clone TKT3, Tashkent clone TKT4, USSR, Evans, Praha, L-IVP, V-VET1 or LIVP The method described in item 72, selected from the group of strains consisting of 6.1.1, Ikeda, EM-63, Malbran, Duke, 3737, CV-1, Connaught Laboratories, Serro 2, CM-01, NYCBH Dryvax clone DPP13, NYCBH Dryvax clone DPP15, NYCBH Dryvax clone DPP20, NYCBH Dryvax clone DPP17, NYCBH Dryvax clone DPP21, VACV-IOC, vasocalanthinous vaccinia virus Ankara (CVA), modified vaccinia Ankara (MVA), and MVA-BN. (Item 74) The method according to any one of items 39 to 73, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located in a region of the poxvirus that is not essential for the replication of the poxvirus. (Item 75) The method according to item 74, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located at the thymidine kinase (TK) gene locus of the poxvirus. (Item 76) The method according to item 74, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located at the B22R homologous gene locus of the poxvirus. (Item 77) The method according to any one of items 39 to 76, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is operably linked to a promoter. (Item 78) The method according to item 77, wherein the promoter is a poxvirus-specific promoter. (Item 79) The method according to item 78, wherein the poxvirus-specific promoter is the vaccinia virus initial promoter. (Item 80) The method according to item 78, wherein the poxvirus-specific promoter is the vaccinia virus late promoter. (Item 81) The method according to item 78, wherein the poxvirus-specific promoter is the tandemvaccinia virus early and late promoters. (Item 82) The method according to any one of items 39 to 81, wherein the poxvirus is a synthetic poxvirus. (Item 83) A method for reducing or preventing the progression of SARS-CoV-2 virus infection in a subject in need or at risk thereof, comprising the step of administering to the subject an immunologically effective amount of a recombinant poxvirus as described in any one of items 1 to 24 or a pharmaceutical composition as described in any one of items 25 to 29. (Item 84) A method for reducing or preventing the progression of SARS-CoV-2 virus and poxvirus infection in subjects where it is necessary or at risk, wherein the subjects are given an immunologically effective amount of recombinant poxvirus as described in any one of items 1 to 24. A method comprising the step of administering a pharmaceutical composition described in any one of items 25 to 29. (Item 85) A method for reducing or preventing the progression of SARS-CoV-2 virus and poxvirus, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus. (Item 86) A vaccine against the SARS-CoV-2 virus comprising a recombinant virus as described in items 1 to 24 or a pharmaceutical composition as described in items 25 to 29. (Item 87) A bivalent vaccine against SARS-CoV-2 virus and poxvirus, comprising a recombinant virus as described in items 1 to 24 or a pharmaceutical composition as described in items 25 to 29. (Item 88) A bivalent vaccine against SARS-CoV-2 virus and poxvirus, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus. [Brief explanation of the drawing]
[0014] [Figure 1] Schematic diagrams of the linear dsDNA synthetic HPXV (GenBank accession number KY349117) and synthetic VACV (synVACV) (GenBank accession number MN974381) genomes. The thymidine kinase (TK) locus is shown in orange. In HPXV, the TK locus is located at genome positions 92077-92610 and has gene ID HPXV095 (Sequence ID 1). In VACV, the TK locus is located at genome positions 83823-84344 and has gene ID synVACV_105 (Sequence ID 2).
[0015] [Figure 2] A schematic diagram of the HPXV TK locus (HPXV095), approximately 4kb in size, located between the HPXV094 and HPXV096 adjacent regions.
[0016] [Figure 3]Sequence alignment of the TK locus of synthetic HPXV and synthetic VACV ACAM2000. Nucleotide similarity of approximately 99% is shown. Figure 3 shows sequence numbers 34-36, in order of appearance.
[0017] [Figure 4] Schematic diagram of linear dsDNA HPXV showing the generation of a PCR fragment encoding a SARS-CoV-2 expression cassette. The expression cassette is introduced into the TK locus of the HPXV genome and contains the SARS-CoV-2 Spike S gene, which is operatively linked to the early and late vaccinia virus promoters inserted upstream of it.
[0018] [Figure 5] Schematic diagram of recombination insertion using left and right recombination flanking arms of synthetic expression cassettes encoding HPXV and VACV, ACAM 2000 rescue virus, and SARS-CoV-2 Spike S protein.
[0019] [Figure 6] A schematic diagram of a method for generating recombinant HPXV, comprising the steps of (1) infecting BSC-40 cells with HPXV expressing a yfpgpt cassette at the HPXV095 locus; (2) transfecting the infected cells with the synthesized expression cassette 24 hours after infection; (3) collecting cell lysates 48 hours after infection / transfection and releasing recombinant HPXV expressing progeny HPXV viruses and SARS-CoV-2 Spike S protein (rHPXV-SARS S) through repeated freeze / thaw rounds; and (4) selecting cells containing rHPXV-SARS S.
[0020] [Figure 7]This is a schematic diagram of the selection and purification of recombinant HPXV containing the SARS-CoV-2 S protein, comprising: (1) a pre-infection / transfection step; (2) a cell collection and cell lysis step to release control HPXV and rHPXV-SARS S progeny; (3) a plate titer determination step of progeny viruses against BSC-40 cells; and (4) a step of searching for non-fluorescent plaques using a fluorescence microscope. Viral progeny in which the yfpgpt cassette has been replaced with SARS-CoV-2 S are non-fluorescent.
[0021] [Figure 8] Early, late, and overlapping early / late vaccinia virus promoters. The core, spacer, and initiation factor (init) are shown. Panel A shows the early promoter nucleotide sequence (SEQ ID NO: 3); specific nucleotides required for optimal expression are indicated using 4-base coding; non-essential nucleotides are indicated by N; purines must be present within the init region. Panel B shows the late promoter nucleotide sequence (SEQ ID NO: 4); high expression is provided by the T-run and TAAAT init sequences. Panel B shows the synthetic early / late promoter nucleotide sequence (SEQ ID NO: 5); the elements of the early and late promoters are shown above and below the sequence, respectively.
[0022] [Figure 9] Nucleotide sequences of overlapping early / late vaccinia virus promoter variations containing different spacers on the 3' side of the late promoter. Panel A shows a 38-nucleotide spacer (SEQ ID NO: 40; full-length sequences of promoter and spacer are described in SEQ ID NO: 37), Panel B shows a 99-nucleotide spacer (SEQ ID NO: 41; full-length sequences of promoter and spacer are described in SEQ ID NO: 38), and Panel C shows a 160-nucleotide spacer (SEQ ID NO: 42; full-length sequences of promoter and spacer are described in SEQ ID NO: 39).
[0023] [Figure 10] This is a schematic diagram of a method for generating recombinant scHPXV or synVACV containing nucleic acids encoding the SARS-CoV-2 S protein, comprising the steps of (1) infecting BSC-40 cells with rescue HPXV or VACV virus, and (2) transfecting infected BSC-40 cells with a PCR-generated fragment at the TK locus, wherein the PCR-generated fragment comprises an engineered SARS-CoV-2 S gene expression cassette. The SARS-CoV-2 S gene contains one or more modifications (at least Y459H is present). The resulting modified S protein is adapted for infection in mice. To generate a full-length transcript during the early phase of infection, the vaccinia early transcription terminator signal (ETTS) (T5NT (SEQ ID NO: 14)) is also removed from the SARS-CoV-2 S gene by coding silent mutagenesis.
[0024] [Figure 11] Western blots of SARS-CoV-2 spike protein expression from BSC-40 cells infected with synVACVΔA2K105yfp-gpt or synVACVΔA2K105SARSCoV2-SPIKE-co::nm(TNX-2200) clones 1.1.1.1.1 or 2.1.1.1.1. "Mock" represents a negative control group without the virus. "Mr" is a set of molecular weight markers in kilodaltons (kDa). The labels on the right identify various proteins: "S multimer": spike multimer protein; "FL SG": full-length glycosylated spike protein; "FL S": full-length spike protein; "VACV I3": single-stranded DNA-binding I3 protein (internal control); "SPIKE-co::nm": spike protein without codon-optimized markers, indicating the absence of YFP-GPT expression.
[0025] [Figure 12]Western blots of spike protein expression from BSC-40 cells infected with synthetic TNX-801, TNX-1800a-1, or TNX-1800b-2. "Mock" represents a negative control group without the virus. "kDa" is kilodalton (molecular weight). Labels on the right identify various proteins: "S multimer": spike multimer protein; "FL SG": full-length glycosylated spike protein; "FL S": full-length spike protein; "VACV I3": single-stranded DNA-binding I3 protein (internal control).
[0026] [Figure 13] Schematic diagram of the skin reaction ("take") on day 7 in African green monkeys (AGMs) vaccinated with 2.9 × 10⁶ PFU of TNX-801. Panel A shows a female AGM (animal #: 1F 16986), Panel B shows a female AGM (animal #: 1F 16994), Panel C shows a male AGM (animal #: 1M 16975), and Panel D shows a male AGM (animal #: 1M 16977).
[0027] [Figure 14] Schematic diagram of the skin reaction ("take") on day 7 in African green monkeys (AGMs) vaccinated with 1.06 × 10⁶ PFU of TNX-801. Panel A shows a female AGM (animal #: 2F 16985), Panel B shows a female AGM (animal #: 1F 16991), Panel C shows a male AGM (animal #: 2M 16980), and Panel D shows a male AGM (animal #: 1M 16983).
[0028] [Figure 15]Schematic diagram of the skin reaction ("take") on day 7 in African green monkeys (AGMs) vaccinated with 2.9 × 10⁶ PFU of TNX-1800b-2. Panel A shows a female AGM (animal #: 3F 16988), Panel B shows a female AGM (animal #: 3F 16995), Panel C shows a male AGM (animal #: 3M 16976), and Panel D shows a male AGM (animal #: 3M 16982).
[0029] [Figure 16] Schematic diagram of the skin reaction ("take") on day 7 in African green monkeys (AGMs) vaccinated with 1.06 × 10⁶ PFU of TNX-1800b-2. Panel A shows a female AGM (animal #: 4F 16989), Panel B shows a female AGM (animal #: 4F 16990), Panel C shows a male AGM (animal #: 4M 16972), and Panel D shows a male AGM (animal #: 4M 16973).
[0030] [Figure 17] Schematic diagram of the skin reaction ("take") on day 7 in African green monkeys (AGMs) vaccinated with 0.6 × 10⁶ PFU of TNX-1800a-1. Panel A shows a female AGM (animal #: 5F 16992), Panel B shows a female AGM (animal #: 5F 16993), Panel C shows a male AGM (animal #: 5M 16979), and Panel D shows a male AGM (animal #: 5M 16981).
[0031] [Figure 18] Stained plates showing the cytopathic effects in BSC-40 cells, HeLa cells, and HEK293 cells 48 hours after infection with TNX-801, TNX-1800b-2, TNX-1200, or TNX-2200.
[0032] [Figure 19A]Time-course viral proliferation curves in BSC-40 cells, HeLa cells, and HEK293 cells. Figure 19A shows cells infected with TNX-1200; Figure 19B shows cells infected with TNX-2200; Figure 19C shows cells infected with TNX-801; and Figure 19D shows cells infected with TNX-1800b-2. [Figure 19B] Time-course viral proliferation curves in BSC-40 cells, HeLa cells, and HEK293 cells. Figure 19A shows cells infected with TNX-1200; Figure 19B shows cells infected with TNX-2200; Figure 19C shows cells infected with TNX-801; and Figure 19D shows cells infected with TNX-1800b-2. [Figure 19C] Time-course viral proliferation curves in BSC-40 cells, HeLa cells, and HEK293 cells. Figure 19A shows cells infected with TNX-1200; Figure 19B shows cells infected with TNX-2200; Figure 19C shows cells infected with TNX-801; and Figure 19D shows cells infected with TNX-1800b-2. [Figure 19D] Time-course viral proliferation curves in BSC-40 cells, HeLa cells, and HEK293 cells. Figure 19A shows cells infected with TNX-1200; Figure 19B shows cells infected with TNX-2200; Figure 19C shows cells infected with TNX-801; and Figure 19D shows cells infected with TNX-1800b-2.
[0033] [Figure 20A] Time-course viral replication curves in BSC-40 cells infected with synthetic horsepox virus (HPXV). Figure 20A shows viral titers (PFU / mL) measured in cells infected with TNX-801, scHPXVΔ095yfp-gpt, TNX-1800a-1, scHPXVΔ200yfp-gpt, or TNX-1800b-2; Figure 20B shows the magnification change from input in infected cells. [Figure 20B]Time-course viral replication curves in BSC-40 cells infected with synthetic horsepox virus (HPXV). Figure 20A shows viral titers (PFU / mL) measured in cells infected with TNX-801, scHPXVΔ095yfp-gpt, TNX-1800a-1, scHPXVΔ200yfp-gpt, or TNX-1800b-2; Figure 20B shows the magnification change from input in infected cells.
[0034] [Figure 21A] Time-course viral replication curves in BSC-40 cells infected with synthetic vaccinia virus (VACV). Figure 21A shows viral titers (PFU / mL) measured in cells infected with TNX-1200, TNX-2200, or synVACVΔA2K105yfp-gpt; Figure 21B shows the magnification change from input in infected cells. [Figure 21B] Time-course viral replication curves in BSC-40 cells infected with synthetic vaccinia virus (VACV). Figure 21A shows viral titers (PFU / mL) measured in cells infected with TNX-1200, TNX-2200, or synVACVΔA2K105yfp-gpt; Figure 21B shows the magnification change from input in infected cells.
[0035] [Figure 22] Schematic diagram of linear dsDNA HPXV showing the generation of a PCR fragment encoding a SARS-CoV-2 expression cassette. The expression cassette is introduced into the TK locus of the HPXV genome and contains DNA encoding the SARS-CoV-2 Spike S gene protein, with the SARS-CoV-2 Spike S DNA operatively ligated to the vaccinia virus early and late promoters inserted upstream of it. The expression cassette further includes 1kb HPXV left flanking arms (e.g., HPXV092, HPXV093, and HPXV094) and 1kb HPXV right flanking arms (e.g., HPXV096). [Modes for carrying out the invention]
[0036] Detailed explanation of this disclosure General technology Unless otherwise defined herein, scientific and technical terms used in this application shall have the meaning generally understood by those skilled in the art. In general, the nomenclature used in conjunction with pharmacology, cell and tissue culture, molecular biology, cell and cancer biology, neurobiology, neurochemistry, virology, immunology, microbiology, genetics, and protein and nucleic acid chemistry, as well as the techniques thereof, are well known and commonly used in the art. In case of any conflict, this specification, including its definitions, shall prevail.
[0037] Unless otherwise noted, the implementation of this disclosure will utilize conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, virology, and immunology, which are within the scope of the art of those skilled in the art. Such techniques are described in Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989) Cold Spring Harbor Press;Oligonucleotide Synthesis (MJ Gait, ed., 1984);Methods in Molecular Biology, Humana Press;Cell Biology: A Laboratory Notebook (JE Cellis, ed., 1998) Academic Press;Animal Cell Culture (RI Freshney, ed., 1987);Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press;Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and D.G. Newell, eds., 1993-1998) J. Wiley and Sons;Methods in Enzymology (Academic Press, Inc.);Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987);Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987);PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994);Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001);Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (2002);Harlow and Lane Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998);Coligan et al., Short Protocols in Protein Science, John Wiley & Sons, NY (2003);Short Protocols in Molecular Biology (Wiley and Sons, 1999) are fully described in the literature such as
[0038] Enzyme reactions and purification techniques are carried out according to the manufacturer's specifications, as is commonly achieved in the art or as described herein. The nomenclature used in conjunction with analytical chemistry, biochemistry, immunology, molecular biology, synthetic organic chemistry, and medicinal chemistry and pharmaceutical chemistry described herein, as well as their laboratory procedures and techniques, are well known and commonly used in the art. Standard techniques are used for chemical synthesis and chemical analysis.
[0039] Throughout this specification and its embodiments, the word “comprise,” or variations such as “comprises” or “comprising,” is understood to mean including the integer or group of integers mentioned, but not to mean excluding any other integer or group of integers.
[0040] The term "including" is used to mean "includes but not limited to." "Include" and "includes but not limited to" are interchangeable.
[0041] Any example following the term "e.g." or "for example" is meant to be neither thorough nor limiting.
[0042] Unless the context requires otherwise, singular terms are assumed to include plural forms, and plural terms are assumed to include singular forms.
[0043] The articles “a,” “an,” and “the” are used herein to refer to one or more (i.e., at least one) of the grammatical objects of the article. For example, “an element” means one element or more than one element. References to “about” values or parameters herein include (and describe) embodiments of the value or parameter itself. For example, a description referring to “about X” includes a description of “X.” A numerical range includes the number that defines the range.
[0044] While the numerical ranges and parameters representing the broad scope of this disclosure are approximations, the numerical values shown in specific examples are reported as accurately as possible. However, any numerical value inherently contains certain errors that inevitably arise from the standard deviation found in its respective test measurement. Furthermore, it should be understood that all ranges disclosed herein encompass any and all subranges contained within them. For example, the stated range "1 to 10" should be considered to include any and all subranges between (and including) the minimum value of 1 and the maximum value of 10; that is, all subranges starting with a minimum value of 1 or greater, e.g., 1 to 6.1, and ending with a maximum value of 10 or less, e.g., 5.5 to 10.
[0045] While exemplary methods and materials are described herein, similar or equivalent methods and materials may also be used in the practice or testing of this disclosure. Materials, methods, and examples are illustrative and not intended to be limiting. definition Unless otherwise specified, the following terms shall be understood to have the following meanings:
[0046] The terms “chimera,” “engineered,” or “modified” (e.g., chimerapoxvirus, engineered polypeptide, modified polypeptide, engineered nucleic acid, modified nucleic acid) or their grammatical variations are used herein interchangeably to refer to a non-native sequence that has been engineered to have one or more changes compared to its native sequence.
[0047] As used herein, the terms “replication-essential gene” or “replication-essential region” refer to a gene or region that is essential for the replication of an organism and is therefore considered fundamental to life. In the case of viruses, a gene or region is considered essential (i.e., has a role in cell culture) if its deletion results in a decrease of more than one-tenth of the viral titer in either a single-step or multi-step growth curve. The majority of essential genes are thought to encode proteins that maintain central metabolism, proteins that replicate DNA, proteins that translate genes into proteins, proteins that maintain the basic structure of cells, and proteins that mediate intracellular and extracellular transport processes. Typically, genes involved in virion production, actin tail formation, and extracellular virion release are also considered essential. Two main strategies are used to identify essential genes on a genome-wide basis: targeted deletion of genes and random mutagenesis using transposons. In the first case, individual genes (or ORFs) are systematically deleted from the genome. In random mutagenesis, transposons are randomly inserted into as many locations as possible within the genome with the aim of inactivating a targeted gene. However, no insertion mutants that can survive or proliferate are found in essential genes. (Zhang, R., 2009 & Gerdes, S., 2006).
[0048] The terms “expression cassette” or “transcription unit,” as used herein, define a nucleic acid sequence region containing one or more genes to be transcribed. The nucleotide sequences encoding the gene(s) to be transcribed, and the polynucleotide sequences containing the regulatory elements contained within the expression cassette, are operably linked to one another. The genes are transcribed from a promoter, and the transcription is terminated by at least one polyadenylation signal. In some embodiments, each of one or more genes is transcribed from one promoter. In some embodiments, one or more genes are transcribed from a single promoter; in this case, the different genes are at least transcriptionally linked. More than one protein or product may be transcribed and expressed from each transcription unit (multicistronic transcription unit). Each transcription unit contains the regulatory elements necessary for the transcription and translation of any selected sequence contained within the unit. Each transcription unit may contain the same or different regulatory elements.
[0049] "Homologous," in all its grammatical forms and spelling variations, refers to the relationship between two proteins that share a "common evolutionary origin," including proteins from the same superfamily within the same species of organism, as well as homologous proteins from different species. Such proteins (and the nucleic acids that encode them) possess sequence homology, which is reflected in their sequence similarity, whether through percentage identity or the presence of specific residues or motifs and conserved positions. "Homologous" can also refer to nucleic acids native to a virus.
[0050] In general usage and in this application, the term “homogenetic” may refer to sequence similarity when modified by adverbs such as “highly,” and may or may not be related to a common evolutionary origin.
[0051] "Heterologous" can refer to nucleic acids that are non-native to the virus in all of their grammatical forms and spelling variants. This means that the nucleic acid is derived from a different species or a different strain than the nucleic acid of the organism in which it is described as being heterologous. In non-limiting examples, the viral genome of synVACV contains heterologous terminal hairpin loops. These heterologous terminal hairpin loops can be derived from different viral species or different VACV strains.
[0052] As used herein, "host cell" includes individual cells or cell cultures that can or have been recipients of the viruses of the present disclosure. Host cells include the progeny of a single host cell, which progeny may not necessarily be identical (either in morphology or in genomic DNA complement) to the original parent cell due to natural, accidental or deliberate mutations. Host cells include cells transfected and / or transformed in vivo with the poxviruses of the present disclosure.
[0053] An "immunologically effective amount" refers to the amount of a composition of interest comprising at least one antigen or an immunogenic portion thereof that is administered and is capable of inducing an immunological response in a host cell or an antibody-mediated immune response to the composition. The immunologically effective amount of the recombinant poxviruses disclosed herein refers to the amount of poxvirus particles necessary to deliver a SARS-CoV-2 viral protein and elicit an immune response against said SARS-CoV-2 viral protein. In some embodiments, the immunologically effective amount of the recombinant poxviruses of the present disclosure is an amount that falls within the range of 10 2 ~10 9 PFU. In some embodiments, the immunologically effective amount of the recombinant poxviruses of the present disclosure is about 10 3 ~10 5 PFU. In some embodiments, the immunologically effective amount of the recombinant poxviruses of the present disclosure is about 10 5 PFU.
[0054] The terms “operative linkage” and “operatively linked” (or “operably linked”), as used herein, are interchangeable and refer to a state in which two or more components (e.g., sequence elements) are located proximal to each other and are arranged such that both components may function normally and at least one of the components may mediate a function exerted on at least one of the other components. For example, the nucleic acid encoding the SARS-CoV-2 viral protein may be operatively linked to a promoter. The nucleic acid sequence encoding the SARS-CoV-2 viral protein may be cis-operatively linked to a poxvirus-specific promoter nucleic acid sequence, but they do not need to be directly adjacent. For example, a linker sequence may be located between both sequences.
[0055] As used herein, the term “Multiple Infections” or “MOI” refers to the average number of viruses per infected cell. MOI is determined by dividing the number of viruses added (ml added × plaque-forming units (PFU)) by the number of cells added (ml added × cells / ml).
[0056] The terms “patient,” “subject,” or “individual” are used interchangeably herein and refer to either human or non-human animals. These terms include mammals, e.g., humans, primates, domestic animals (including cattle, pigs, camels, etc.), companion animals (e.g., dogs, cats, etc.), and rodents (e.g., mice and rats).
[0057] As is known in the art, “polynucleotide” or “nucleic acid,” when used interchangeably herein, refers to a chain of nucleotides of any length, including DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or analogs thereof, or any substrate that can be incorporated into the chain by DNA or RNA polymerase. Polynucleotides may include modified nucleotides, e.g., methylated nucleotides and their analogs. Modifications to the nucleotide structure, where present, may be introduced before or after the assembly of the chain. Non-nucleotide components may be interspersed in the nucleotide sequence. Polynucleotides may be further modified after polymerization, for example, by conjugation with labeling components. Other types of modifications include, for example, "caps," substitution of one or more naturally occurring nucleotides with analogs, internucleotide modifications, such as those by uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.) and charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those involving pendant portions such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those involving intercalators (e.g., acridine, psoralens, etc.), those involving chelators (e.g., metals, radioactive metals, boron, oxidizing metals, etc.), those involving alkylating agents, those involving modified linkages (e.g., alpha-anomeric nucleic acids, etc.), and unmodified forms of polynucleotides. Furthermore, any of the hydroxyl groups normally present in sugars may be replaced by, for example, phosphonate groups, phosphate groups, protected by standard protecting groups, activated to prepare further linkage to further nucleotides, or conjugated to a solid support. The 5' and 3' terminal OH groups may be phosphorylated or substituted with amines or organic cap groups of 1 to 20 carbon atoms. Other hydroxyls may be derivatized to standard protecting groups.Polynucleotides may also include similar forms of ribose or deoxyribose sugars commonly known in the art, such as 2'-O-methyl-, 2'-O-allyl, 2'-fluoro- or 2'-azid-ribose, carbocyclic sugar analogs, alpha- or beta-anomeric sugars, epimeric sugars, such as arabinose, xylose or lyxose, pyranose sugars, furanose sugars, sedoheptulose, acyclic analogs and debasalized nucleoside analogs, such as methylriboside. One or more phosphodiester linkages may be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments in which the phosphate is replaced by P(O)S ("thioate"), P(S)S ("dithioate"), (O)NR2 ("amidate"), P(O)R, P(O)OR', CO, or CH2 ("formacetal"), where each R or R' is independently H, or a substituted or unsubstituted alkyl (1-20C) optionally containing an ether and (-O-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl. Not all linkages in a polynucleotide need to be identical. The preceding description applies to all polynucleotides mentioned herein, including RNA and DNA.
[0058] The terms “polypeptide,” “oligopeptide,” “peptide,” and “protein” are used interchangeably herein to refer to chains of amino acids of any length. The chains may be linear or branched, may contain modified amino acids, and / or be interrupted by non-amino acids. These terms also encompass amino acid chains that are naturally modified or modified by intervention, e.g., disulfide bond formation, glycosylation, lipid addition, acetylation, phosphorylation, or any other operation or modification, e.g., conjugation with a labeling component. Polypeptides, including one or more analogs of amino acids (e.g., non-natural amino acids), as well as other modifications known in the Art, are also included in this definition. It is understood that polypeptides can exist as single chains or as associated chains.
[0059] "Percent (%) sequence identity" or "sequence ~% identical to ~" with respect to a reference polypeptide (or nucleotide) sequence is defined as the percentage of amino acid residues (or nucleic acids) in a candidate sequence that are identical to the amino acid residues (or nucleic acids) in the reference polypeptide (nucleotide) sequence, after the sequences have been aligned and gaps introduced as necessary to achieve maximum percent sequence identity, with no conservative substitutions considered part of the sequence identity. Alignment aimed at determining percent amino acid sequence identity can be achieved in various ways within the scope of the art of a person skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. A person skilled in the art can determine appropriate parameters for aligning sequences, including any algorithm necessary to achieve maximum alignment over the entire length of the sequences being compared.
[0060] As outlined elsewhere in this specification, certain positions in the viral genome can be altered. “Position,” as used herein, refers to a location within the genome sequence. The corresponding position is generally determined by alignment with other parent sequences.
[0061] As used herein, “purify” and its grammatical variations refer to the removal of at least one impurity from a mixture containing a polypeptide and one or more impurities, either completely or partially, thereby improving the level of purity of the polypeptide in the composition (i.e., by reducing the amount of impurities (ppm) in the composition). As used herein, “purified” refers to a virus that is substantially free of cellular material and culture medium from the cell or tissue source from which the virus originates. The term “substantially free of cellular material” includes a viral preparation in which the virus has been isolated from the cellular components of the cell from which it is isolated or recombinantly produced. Thus, a virus substantially free of cellular material includes a protein preparation having about 30%, 20%, 10%, or less than 5% (dry weight) of cellular protein (also referred to herein as “contamination protein”). The virus may also be substantially free of culture medium, i.e., the culture medium occupies about 20%, 10%, or less than 5% of the volume of the viral preparation. The virus can be purified using conventional methods known to those skilled in the art, including but not limited to chromatography and centrifugation.
[0062] As used herein, the term “recombinant poxvirus” refers to a poxvirus that contains exogenous or heterologous sequences in its genome, generated by artificial manipulation of the viral genome, i.e., by recombinant DNA technology. Recombinant poxviruses contain exogenous polynucleotide sequences encoding the polypeptide of interest. In some embodiments, recombinant poxviruses contain nucleic acids encoding the SARS-CoV-2 viral protein.
[0063] As used herein, the terms “rescue poxvirus,” “rescue virus,” or “rescue system” refer to a virus or system that relies on a helper virus to provide the mechanism necessary to produce a recombinant virus by assembling a fragmented genome and simultaneously incorporating a targeted gene or expression cassette. Rice et al. Viruses. 2011 Mar; 3(3): 217-232.
[0064] As used herein, the term “residue” refers to an amino acid unit in a linear polypeptide chain with respect to polypeptides. This is the remainder of each amino acid after water has been removed in the formation of the polypeptide from α-amino acids, i.e., NH2-CHR-COOH, i.e., -NH-CHR-C-.
[0065] The term "sequence similarity," in all its grammatical forms, refers to the degree of identity or correspondence between nucleic acid or amino acid sequences, whether or not they share a common evolutionary origin.
[0066] As used herein, “synthetic virus” means a virus originally derived from synthetic DNA (e.g., chemically synthesized DNA, PCR-amplified DNA, engineered DNA, polynucleotides containing nucleoside analogs, or combinations thereof), and includes its offspring, which may not necessarily be completely identical (morphologically or in terms of genomic DNA complement) to the original parent synthetic virus due to natural, accidental, or planned mutations. In some embodiments, synthetic virus means a virus whose viral genome is substantially entirely derived from synthetic DNA (e.g., chemically synthesized DNA, PCR-amplified DNA, engineered DNA, polynucleotides containing nucleoside analogs, or combinations thereof). In preferred embodiments, synthetic virus is derived from chemically synthesized DNA.
[0067] As used herein, “substantially pure” means a material that is at least 50% pure (i.e., free of impurities), more preferably at least 90% pure, more preferably at least 95% pure, even more preferably at least 98% pure, and most preferably at least 99% pure.
[0068] The term “vaccine,” as used herein, refers to a composition comprising at least one immunologically active component that induces an immunological response in an animal, and one or more additional components, which are not essential but may optionally enhance the immunological activity of the active component. A vaccine may further comprise other components typical of a pharmaceutical composition. The immunologically active component of a vaccine may comprise whole viral particles in their original form, or as attenuated particles (modified live vaccine), or as particles inactivated by an appropriate method (dead or inactivated vaccine). In other embodiments, the immunologically active component of a vaccine may comprise the appropriate element of the organism that most stimulates the immune system (subunit vaccine). The immunologically active component may be a viral envelope protein. The immunologically active component may be a protein that forms part of a nucleocapsid. In some embodiments, the immunologically active component of a vaccine against SARS-CoV-2 is an envelope protein. Non-limiting examples of such proteins include spike proteins (S), membrane proteins (M), and hemagglutinin-esterase proteins (HE). In some embodiments, the immunologically active component of a vaccine against SARS-CoV-2 is the nucleocapsid protein (N).
[0069] The term “viral vector,” as used herein, describes a genetically modified virus manipulated by recombinant DNA technology so that its entry into a host cell can result in a specific biological activity, such as the expression of an exogenous target gene carried by the vector. The viral vector may or may not be replication competent in target cells, tissues, or organisms. The viral vector may incorporate sequences derived from the genome of any known organism. The sequences may be incorporated in their native form or modified in any way to obtain the desired activity. For example, sequences may include insertions, deletions, or substitutions. The viral vector may also incorporate insertion sites into exogenous polynucleotide sequences. In some embodiments, the viral vector is a poxvirus. In some embodiments, the viral vector is a horsepox virus vector. In some embodiments, the viral vector is a synthetic horsepox virus vector.
[0070] As used herein, the terms “wild-type virus,” “wild-type genome,” “wild-type protein,” or “wild-type nucleic acid” refer to sequences of amino acids or nucleic acids that are naturally present in a particular population (e.g., a particular virus species).
[0071] Each embodiment described herein may be used individually or in combination with any other embodiment described herein. overview
[0072] Poxviruses are large (approximately 200 kbp) DNA viruses that replicate in the protoplasm of infected cells. The Orthopoxvirus (OPV) genus includes several poxviruses that differ greatly in their ability to infect different hosts. For example, vaccinia virus (VACV) can infect a wide range of hosts, while variolens variolens (VARV), the causative agent of smallpox, infects only humans. A common feature of many, though not all, poxviruses is their ability to "reactivate" non-genetically within a host. Non-genetic reactivation refers to the process by which a cell infected with one poxvirus can promote the recovery of a second "dead" virus (e.g., one inactivated by heat) that is non-infectious on its own.
[0073] Because the viral life cycle requires the transcription of initial genes via RNA polymerase encoded by the virus, which is then packaged within the virion, purified poxvirus DNA is not infectious. However, this drawback can be overcome if the viral DNA is transfected into cells that have been previously or subsequently infected with a helper poxvirus, providing the necessary factors for transcribing, replicating, and packaging the transfected genome in trans (Sam CK, Dumbell KR. Expression of poxvirus DNA in coinfected cells and marker rescue of thermosensitive mutants by subgenomic fragments of DNA. Ann Virol (Inst Past). 1981; vol. 132: pp. 135-135). This method produces mixed viral progeny, but the desired virus can be obtained by reactivating it in cell lines that support the proliferation of both viruses, and then eliminating the helper virus by plating the viral mixture onto cells that do not support the proliferation of the helper virus (Scheiflinger F, Dorner F, Falkner FG. Construction of chimeric vaccinia viruses by molecular cloning and packaging. Proceedings of the National Academy of Sciences of the United States of America. 1992; Vol. 89 (No. 21): pp. 9977-9981). Preparation of poxvirus
[0074] Any synthetic poxvirus disclosed in US2018 / 0251736 and WO2019 / 213452, each of which is incorporated herein by reference in its entirety, may be used in this disclosure.
[0075] In one embodiment, the disclosure provides a recombinant poxvirus comprising nucleic acid encoding a SARS-CoV-2 viral protein, wherein the SARS-CoV-2 protein is selected from the group consisting of a spike protein (S), a membrane protein (M), and a nucleocapsid protein (N), or a combination of two or more of the said proteins.
[0076] In some embodiments, the poxvirus belongs to the subfamily Chordopoxvirinae. In some embodiments, the poxvirus belongs to a genus of the subfamily Chordopoxvirinae selected from Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Leporipoxvirus, Molluscipoxvirus, Orthopoxvirus, Parapoxvirus, Suipoxvirus, or Yatapoxvirus. In some embodiments, the recombinant poxvirus is Orthopoxvirus. In some embodiments, the orthopoxvirus is selected from the group consisting of camelpox virus (CMLV), cowpox virus (CPXV), paradoxal paradoxal virus (ECTV, "mouse pox factor"), horsepox virus (HPXV), monkeypox virus (MPXV), rabbitpox virus (RPXV), raccoonpox virus, skunkpox virus, gerbilpox virus, uasingisoo virus, vaccinia virus (VACV), smallpox virus (VARV), and volepox virus (VPV). In some embodiments, the poxvirus is parapoxvirus. In some embodiments, the parapoxvirus is selected from Orff virus (ORFV), pseudocowpox virus (PCPV), bovine popular stomatitis virus (BPSV), squirrel parapoxvirus (SPPV), red deer parapoxvirus, Ausdyk virus, chamois contagious ecythema virus, reindeer parapoxvirus, or sealpox virus. In some embodiments, the poxvirus is Molluscipoxvirus. In some embodiments, Molluscipoxvirus is molluscum contagiousum virus (MCV). In some embodiments, the poxvirus is Yatapoxvirus. In some embodiments, Yatapoxvirus is selected from Tanapox virus or Yabasal tumor virus (YMTV).In some embodiments, the poxvirus is Capripoxvirus. In some embodiments, Capripoxvirus is selected from sheeppox, goatpox, or Lumpy Skin disease virus. In some embodiments, the poxvirus is Suipoxvirus. In some embodiments, Suipoxvirus is porcine poxvirus. In some embodiments, the poxvirus is Leporipoxvirus. In some embodiments, Leporipoxvirus is selected from myxoma virus, Schoepp's fibroma virus (SFV), squirrel fibroma virus, or tularemia fibroma virus. In some embodiments, the horsepox virus is strain MNR-76. In another embodiment, the poxvirus is VACV. In some embodiments, VACV is Western Reserve, Western Reserve Clone 3, Tian Tian, Tian Tian Clone TP5, Tian Tian Clone TP3, NYCBH, NYCBH Clone Acambis 2000, Wyeth, Copenhagen, Lister, Lister 107, Lister-LO, Lister GL-ONC1, Lister GL-ONC2, Lister GL-ONC3, Lister GL-ONC4, Lister CTC1, Lister IMG2 (Turbo FP635), IHD-W, LC16m18, Lederle, Tashkent Clone TKT3, Tashkent Clone TKT4, USSR, Evans, Praha, L-IVP, V-VET1 or LIVP6.1.1, Ikeda, EM-63, Malbran, Duke, 3737, CV-1, Connaught Laboratories, Serro 2. The strains are selected from a group consisting of CM-01, NYCBH Dryvax clone DPP13, NYCBH Dryvax clone DPP15, NYCBH Dryvax clone DPP20, NYCBH Dryvax clone DPP17, NYCBH Dryvax clone DPP21, VACV-IOC, vasocalanthinous vaccinia virus Ankara (CVA), modified vaccinia Ankara (MVA), and MVA-BN.New poxviruses (e.g., orthopoxviruses) are constantly being discovered. It is understood that the poxviruses of this disclosure may be based on such newly discovered poxviruses.
[0077] Chemical viral genome synthesis opens up the possibility of introducing numerous useful modifications into the resulting genome, or into specific parts thereof. Modifications may improve the ease of cloning for generating viruses, provide sites for introducing recombinant gene products, improve the ease of identifying reactivated viral clones, and / or confer a large number of other useful features (e.g., introducing desired antigens, producing oncolytic viruses). In some embodiments, modifications may include attenuation or deletion of one or more virulence factors. In some embodiments, modifications may include the addition or insertion of one or more virulence regulatory genes, or regulatory factors encoded by those genes.
[0078] To date, cloning and sequencing of poxvirus terminal hairpins has been difficult. As a result, some of the published genome sequences (e.g., VACV, ACAM 2000, and HPXV MNR-76) are incomplete. The published sequence of the HPXV genome is also incomplete, possibly lacking about 60 bp from the terminal end. In exemplary embodiments, a 129 nt ssDNA fragment was chemically synthesized using the published sequence of the VACV terminal hairpin as a guide and ligated into a dsDNA fragment containing the left and right ends of the HPXV genome. In some embodiments, the poxvirus terminal hairpins of this disclosure are derived from VACV. In some embodiments, the terminal hairpins are derived from CMLV, CPXV, ECTV, HPXV, MPXV, RPXV, raccoonpox virus, skunkpox virus, gerbilpox virus, uasingisyu disease virus, or VPV. In some embodiments, the terminal hairpin is based on the terminal hairpin of any poxvirus whose genome has been fully sequenced or for which a natural isolate is available for genome sequencing. In some embodiments, the poxvirus is a synthetic version of HPXV, including the terminal hairpin of VACV (see GenBank accession number KY349117; see US2018 / 0251736 incorporated herein by reference).
[0079] In some embodiments, modifications introduced into the poxvirus genome may include the deletion of one or more restriction sites. In some embodiments, modifications may include the introduction of one or more restriction sites. In some embodiments, restriction sites deleted from or added to the genome are, for example, AanI, AarI, AasI, AatI, AatII, AbaSI, AbsI, Acc65I, AccI, AccII, AccIII, AciI, ACLI, AcuI, AfeI, AflII, AflIII, AgeI, AhdI, AleI, AluI, AlwI, AlwNI, ApaI, ApaLI, ApeKI, ApoI, AscI, AseI, AsiSI, AvaI, AvaII, AvrII, BaeGI, BaeI, BamHI BanI, BanII, BbsI, BbvCI, BbvI, BccI, BceAI, BcgI, BciVI, BclI, BcoDI, BfaI, BfuAI, BfuCI, BglI, B glII, BlpI, BmgBI, BmrI, BmtI, BpmI, Bpu10I, BpuEI, BsaAI, BsaBI, BsaHI, BsaI, BsaJI, BsaWI, BsaXI , BseRI, BseYI, BsgI, BsiEI, BsiHKAI, BsiWI, BslI, BsmAI, BsmBI, BsmFI, BsmI, BsoBI, Bsp1286I, Bs pCNI, BspDI, BspEI, BspHI, BspMI, BspQI, BsrBI, BsrDI, BsrFαI, BsrGI, BsrI, BssHII, BssSαI, BstAP I, BstBI, BstEII, BstNI, BstUI, BstXI, BstYI, BstZ17I, Bsu36I, BtgI, BtgZI, BtsαI, BtsCI, BtsIMu tI, Cac8I, ClaI, CspCI, CviAII, CviKI-1, CviQI, DdeI, DpnI, DpnII, DraI, DrdI, EaeI, EagI, EarI, Ec iI, Eco53kI, EcoNI, EcoO109I, EcoP15I, EcoRI, EcoRV, FatI, FauI, Fnu4HI, FokI, FseI, FspEI, FspI, HaeII, HaeIII, HgaI, HhaI, HincII, HindIII, HinfI, HinP1I, HpaI, HpaII, HphI, Hpy166II, Hpy188I,Hpy188III, Hpy99I, HpyAV, HpyCH4III, HpyCH4IV, HpyCH4V, I-CeuI, I-SceI, KasI, KpnI, LpnPI, MboI, MboII, MfeI, MluCI, MluI, MlyI, MmeI, MnlI, MscI, MseI, MslI, MspA1I, MspI, MspJI, MwoI, NaeI, NarI, NciI, NcoI, NdeI, NgoMIV, NheI, NlaIII, NlaIV, NmeAIII, NotI, NruI, NsiI, NspI, PacI, PaeR7I, PciI, PflFI, PflMI, PleI, PluTI, PmeI, PmlI, PpuMI, PshA One or more restriction sites may be selected from, but are not limited to, I, PsiI, PspGI, PspOMI, PspXI, PstI, PvuI, PvuII, RsaI, RsrII, SacI, SacII, SalI, SapI, Sau3AI, Sau96I, SbfI, ScrFI, SexAI, SfaNI, SfcI, SfiI, SfoI, SgrAI, SmaI, SmlI, SnaBI, SpeI, SphI, SrfI, SspI, StuI, StyD4I, StyI, SwaI, TaqαI, TfiI, TseI, Tsp45I, TspMI, TspRI, Tth111I, XbaI, XcmI, XhoI, XmaI, XmnI, or ZraI. It is understood that any desired restriction site or combination of restriction sites may be inserted into or mutated into the genome, and / or excluded from the genome. In some embodiments, one or more AarI sites are deleted from the viral genome. In some embodiments, one or more BsaI sites are deleted from the viral genome. In some embodiments, one or more restriction sites are completely excluded from the genome (e.g., all AarI sites in the viral genome may be excluded). In some embodiments, one or more AvaI restriction sites are introduced into the viral genome. In some embodiments, one or more StuI sites are introduced into the viral genome. In some embodiments, one or more modifications may involve the incorporation of recombineering targets, including but not limited to loxP or FRT sites.
[0080] In some embodiments, poxvirus modifications include, but are not limited to, fluorescent markers such as green fluorescent protein (GFP), high-sensitivity GFP, yellow fluorescent protein (YFP), cyan / blue fluorescent protein (BFP), red fluorescent protein (RFP), or variants thereof; and selectable markers such as drug resistance markers (e.g., E. coli xanthine-guanine phosphoribosyltransferase gene (GPT), Streptomyces alboniger puromycin acetyltransferase gene (PAC), neomycin phosphotransferase I gene (NPTI), neomycin phosphotransferase II gene (NPTII), hygromycin phosphotransferase (HPT), sh These include, but are not limited to, the ble gene; protein or peptide tags, e.g., MBP (maltose-binding protein), CBD (cellulose-binding domain), GST (glutathione-S-transferase), poly(His), FLAG, V5, c-Myc, HA (hemagglutinin), NE-tags, CAT (chloramphenicol acetyltransferase), DHFR (dihydrofolate reductase), HSV (herpes simplex virus), VSV-G (vesicular stomatitis virus glycoprotein), luciferase, protein A, protein G, streptavidin, T7, thioredoxin, yeast two-hybrid tags, e.g., B42, G This may include, but is not limited to, AL4, LexA, or VP16; it may also include the introduction of localization tags, e.g., NLS-tags, SNAP-tags, Myr-tags, etc. It is understood that other selectable markers and / or tags known in the art may be used. In some embodiments, the modification includes one or more selectable markers (e.g., fluorescent markers such as YFP, drug selection markers such as gpt) to assist in the selection of reactivated viral clones. In some embodiments, one or more selectable markers are deleted from the reactivated clones after the selection step.
[0081] In some embodiments, the poxvirus is synthetic horsepox virus (scHPXV). In some embodiments, the synthetic horsepox virus is produced by recombination of duplicated DNA fragments of the viral genome, and functional poxvirus reactivation is carried out in cells that were previously infected with a helper virus. In short, a duplicate DNA fragment containing all or substantially all of the horsepox viral genome is chemically synthesized and transfected into helper virus-infected cells. The transfected cells are cultured to produce mixed viral progeny containing the helper virus and reactivated horsepox virus. The mixed viral progeny are then plated onto host cells that do not support the growth of the helper virus but do grow the synthetic poxvirus in order to eliminate the helper virus and recover the synthetic poxvirus.
[0082] In some embodiments, substantially all of the synthetic poxvirus genome is derived from chemically synthesized DNA. In some embodiments, about 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, over 99%, or 100% of the synthetic poxvirus genome is derived from chemically synthesized DNA. In some embodiments, the poxvirus genome is derived from a combination of chemically synthesized DNA and naturally occurring DNA.
[0083] The number of duplicate DNA fragments used to produce a synthetic poxvirus depends on the size of the poxvirus genome. Practical considerations, such as the decrease in recombination efficiency as the number of fragments increases, and the difficulty in synthesizing very large DNA fragments as the number of fragments decreases, also provide information about the number of duplicate fragments to be used. In some embodiments, the poxvirus genome may be synthesized as a single fragment. In some embodiments, the poxvirus genome is assembled from 2 to 14 duplicate DNA fragments. In some embodiments, the poxvirus genome is assembled from 4 to 12 duplicate DNA fragments. In some embodiments, the poxvirus genome is assembled from 6 to 10 duplicate DNA fragments. In some embodiments, the synthetic poxvirus genome is assembled from 8 to 12 duplicate DNA fragments. In some embodiments, the synthetic poxvirus genome is assembled from 10 duplicate DNA fragments. In exemplary embodiments of this disclosure, synthetic horsepox virus (scHPXV) is reactivated from 10 chemically synthesized duplicate double-stranded DNA fragments. In some embodiments, all fragments comprising the poxvirus genome are chemically synthesized. In some embodiments, one or more fragments are chemically synthesized, and one or more fragments are derived from naturally occurring DNA (e.g., by PCR amplification or by well-established recombinant DNA techniques).
[0084] In some embodiments, the terminal hairpin loop is synthesized separately and ligated into fragments containing the left and right ends of the poxvirus genome. In some embodiments, the terminal hairpin loop may be derived from a naturally occurring template. In some embodiments, the terminal hairpin of the synthetic poxvirus is derived from VACV. In some embodiments, the terminal hairpin of the recombinant synthetic poxvirus is derived from CMLV, CPXV, ECTV, HPXV, MPXV, RPXV, raccoonpox virus, skunkpox virus, gerbilpox virus, uachingisiophlebitis virus, or VPV. In some embodiments, the terminal hairpin of recombinant scHPXV is derived from VACV. In some embodiments, the terminal hairpin of recombinant scHPXV is derived from CMLV, CPXV, ECTV, HPXV, MPXV, RPXV, raccoonpox virus, skunkpox virus, gerbilpox virus, uachingisiophlebitis virus, or VPV. In some embodiments, the terminal hairpin of the poxvirus is based on the terminal hairpin of any poxvirus whose genome has been fully sequenced, or for which a natural isolate of that genome is available for sequencing.
[0085] The size of the overlapping fragments used to generate the poxviruses of this disclosure depends on the size of the poxvirus genome. A wide variation in fragment size is possible, and it is understood that various practical considerations, such as the ability to chemically synthesize very large DNA fragments, provide information regarding the selection of fragment size. In some embodiments, the fragments are in the size range of about 2000 bp to about 50000 bp. In some embodiments, the fragments are in the size range of about 3000 bp to about 45000 bp. In some embodiments, the fragments are in the size range of about 4000 bp to 40000 bp. In some embodiments, the fragments are in the size range of about 5000 bp to 35000 bp. In some embodiments, the largest fragments are approximately 20,000 bp, 21,000 bp, 22,000 bp, 23,000 bp, 24,000 bp, 25,000 bp, 26,000 bp, 27,000 bp, 28,000 bp, 29,000 bp, 30,000 bp, 31,000 bp, 32,000 bp, 33,000 bp, 34,000 bp, 35,000 bp, 36,000 bp, 37,000 bp, 38,000 bp, 39,000 bp, 40,000 bp, 41,000 bp, 42,000 bp, 43,000 bp, 44,000 bp, 45,000 bp, 46,000 bp, 47,000 bp, 48,000 bp, 49,000 bp, or 50,000 bp. In some embodiments, scHPXV is reactivated from 10 chemically synthesized duplicate double-stranded DNA fragments ranging in size from approximately 8500 bp to approximately 32000 bp (Table 2).
[0086] The poxviruses of this disclosure can be grown in any substrate that allows the virus to grow to a titer that enables the use of the recombinant poxviruses described herein. The poxviruses of this disclosure can be grown in cells susceptible to poxvirus infection (e.g., bird cells, bat cells, bovine cells, camel cells, canary cells, cat cells, deer cells, horse cells, wild bird cells, gerbil cells, goat cells, human cells, monkey cells, pig cells, rabbit cells, raccoon cells, seal cells, sheep cells, skunk cells, vole cells, etc.). In some embodiments, the poxvirus is grown in adherent cells. In some embodiments, the poxvirus is grown in suspension cells. In some embodiments, the poxvirus is grown in mammalian cells. Such methods are well known to those skilled in the art. Representative mammalian cells include, but are not limited to, BHK, MRC, BGMK, BRL3A, BSC-40, CEF, CEK, CHO, COS, CVI, HaCaT, HEL, HeLa cells, HEK293, human osteosarcoma cell line 143B, MDCK, NIH / 3T3, and Vero cells. For viral isolation, recombinant poxviruses are typically removed from cell cultures by well-known clarification procedures, such as gradient centrifugation and column chromatography, separated from cellular components, and may be further purified as needed using procedures well-known to those skilled in the art, such as plaque assays. In some embodiments, poxviruses are grown in Vero cells. In some embodiments, poxviruses are grown in ACE2 knockout Vero cells. In some embodiments, poxviruses are grown in Vero adherent cells. In other embodiments, poxviruses are grown in Vero suspension cells. In some embodiments, poxviruses are grown in BSC-40 cells. In some embodiments, the poxvirus is grown in BHK-21 cells. In some embodiments, the poxvirus is grown in MRC-5 cells. In some embodiments, the poxvirus is grown in MRC-5 cells in the presence of 5% serum, including, but not limited to, fetal bovine serum.In some embodiments, poxviruses are grown in chicken cells. Such methods are well known to those skilled in the art. Typical chicken cells include, but are not limited to, chicken embryo fibroblasts, DF-1 cells (see, e.g., Himly et al., Virology, (1998) 248: 295-304), duck embryo-derived cells, EB66® cells (see, e.g., Leon et al. Vaccine, (2016) 34: 5878-5885), AGE1.CRpIX® cells, AGE1.CR cells, DF-1 cells (see, e.g., Lohr et al., Vaccine, (2009) 36: 4975-4982), etc. In some embodiments, poxviruses are grown in chicken embryo fibroblasts. In some embodiments, poxviruses are grown in duck embryo-derived cells. In some embodiments, poxviruses are grown in EB66® cells. In some embodiments, the poxvirus is grown in AGE1.CRpIX® cells. In some embodiments, the poxvirus is grown in DF-1 cells.
[0087] In some embodiments, a method for producing a synthetic poxvirus includes the steps of (i) chemically synthesizing duplicate DNA fragments corresponding to substantially the entirety of the poxvirus viral genome and, if necessary, chemically synthesizing terminal hairpin loops from another virus or another strain of virus; (ii) transfecting the duplicate DNA fragments into helper virus-infected cells; (iii) culturing the cells to produce a mixture of the helper virus and synthetic poxvirus particles in the cells; and (iv) plating the mixture onto a poxvirus-specific host cell to recover the synthetic poxvirus.
[0088] In some embodiments, a method for producing synthetic horsepox virus comprises the steps of (i) chemically synthesizing duplicate DNA fragments corresponding to substantially the entire viral genome of horsepox virus and chemically synthesizing terminal hairpin loops from another poxvirus (e.g., VACV, strain WB, or NYCBH clone ACAM 2000); (ii) transfecting the duplicate DNA fragments into helper virus-infected cells; (iii) culturing the cells to produce a mixture of the helper virus and synthetic horsepox virus particles in the cells; and (iv) plating the mixture onto a host cell specific to horsepox virus to recover the synthetic horsepox virus.
[0089] In some embodiments, the poxvirus is a synthetic varicella-pox virus. In some embodiments, the synthetic varicella-pox virus genome is based on a publicly available genome sequence described for varicella-pox virus (GenBank deposit DQ792504), and the terminal hairpin is based on a publicly available genome sequence similar to that of VACV strain NYCBH clone ACAM2000 (GenBank deposit MN974380). In some embodiments, the synthetic varicella-pox virus includes a sequence deposited with GenBank under accession number KY349117; see US2018 / 0251736 incorporated herein by reference. In some embodiments, the synthetic varicella-pox virus is characterized by a nucleic acid encoding the SARS-CoV-2 virus S protein, including the sequence described in Sequence ID No. 43.
[0090] In some embodiments, the poxvirus is a synthetic recombinant vaccinia virus (synVACV). In some embodiments, the synthetic vaccinia genome is based on the publicly available genome sequence described for VACV strain NYCBH clone ACAM2000 (GenBank deposit AY313847; Osborne JD et al. Vaccine. 2007; 25 (52): 8807-32). In some embodiments, the synthetic vaccinia genome is based on a publicly available genome sequence similar to that of VACV strain NYCBH clone ACAM2000 (GenBank deposit MN974380; see WO2019 / 213452 incorporated herein by reference). In some embodiments, the synthetic vaccinia virus includes a sequence deposited with GenBank under accession number MN974381 (see WO2019 / 213452 incorporated herein by reference). In some embodiments, the synthetic vaccinia virus is characterized by a nucleic acid encoding the SARS-CoV-2 virus S protein, which includes the sequence described in SEQ ID NO: 44. Generation of recombinant poxvirus containing SARS-CoV-2 protein
[0091] Any synthetic poxvirus disclosed in US2018 / 0251736 and WO2019 / 213452 may be used to generate recombinant poxviruses containing the SARS-CoV-2 protein disclosed herein.
[0092] In one embodiment, the disclosure relates to a recombinant poxvirus comprising nucleic acid encoding a SARS-CoV-2 viral protein, wherein the SARS-CoV-2 protein is selected from the group consisting of a spike protein (S), a membrane protein (M), and a nucleocapsid protein (N), or a combination of two or more of the said proteins. In some embodiments, the nucleotide sequence of the SARS-CoV-2 virus is one of the published genome sequences, including but not limited to the Wuhan strain, UK strain B.1.1.7, South Africa strain B.1.351, Brazil strain B.1.1.28, other novel variants, and any of the genome sequences of those variants. In some embodiments, the nucleotide sequence of the SARS-CoV-2 virus is selected from the group consisting of GenBank accession numbers NC045512.2, LC521925.1, MN988668.1, MN985325.1, MN975262.1, MN938384.1, LR757998.1, LR757996.1, LR757995.1, and MN908947.3. In some embodiments, the nucleotide sequence of the SARS-CoV-2 virus is characterized by the sequence described in GenBank accession number MN988668.1; SEQ ID NO: 46. In some embodiments, the nucleotide sequence of the SARS-CoV-2 virus is further selected from the group consisting of GenBank accession number QQX99439 (e.g., B.1.1.7 United Kingdom variant), TEGALLY (e.g., B.1.351 South Africa variant), YP_009724390 (e.g., Wuhan variant), and FARIA (e.g., B.1.1.28 Brazil variant).
[0093] The SARS-CoV-2 virus envelope is covered with a characteristic spike-shaped glycoprotein (S), as well as envelope proteins (E) and membrane proteins (M). The S protein mediates attachment to and entry into host cells. The helix nucleocapsid, composed of the viral genome capsidized by the nucleocapsid protein (N), resides within the viral envelope. In some embodiments, the poxvirus or synthetic poxvirus contains nucleic acids encoding the SARS-CoV-2 envelope proteins. Non-limiting examples of such proteins include the spike protein (S), membrane protein (M), and hemagglutinin-esterase protein (HE). In some embodiments, the poxvirus or synthetic poxvirus contains nucleic acids encoding the S protein (SEQ ID NO: 9). In some embodiments, the poxvirus or synthetic poxvirus contains nucleic acids encoding the S protein (SEQ ID NO: 47). In some embodiments, the poxvirus or synthetic poxvirus contains nucleic acids encoding the M protein (SEQ ID NO: 10). In some embodiments, the poxvirus or synthetic poxvirus includes nucleic acid encoding the M protein (SEQ ID NO: 48). In some embodiments, the poxvirus or synthetic poxvirus includes nucleic acid encoding the N protein (SEQ ID NO: 11). In some embodiments, the poxvirus or synthetic poxvirus includes nucleic acid encoding the N protein (SEQ ID NO: 49). In some embodiments, the poxvirus or synthetic poxvirus includes nucleic acid encoding the HE protein (Protein E or HE of Wuhan-HU-1, commissioned LC521925.1; SEQ ID NO: 12). In some embodiments, the poxvirus or synthetic poxvirus includes a combination of S protein and M protein. In some embodiments, the poxvirus or synthetic poxvirus includes a combination of S protein and N protein. In some embodiments, the poxvirus or synthetic poxvirus includes a combination of M protein and N protein.
[0094] In some embodiments, the SARS-CoV-2 virus is referred to as the Wuhan seafood market pneumonia virus (Wuhan seafood market pneumonia virus). SARS-CoV-2 (2019)-nCoV isolate, GenBank accession number LC521925.1; Sequence ID No. 13. In some embodiments, the SARS-CoV-2 virus is referred to as Wuhan seafood market pneumonia virus 2019. This is a virus 2019-nCoV isolate, GenBank accession number MN988668.1; sequence number 46.
[0095] In some embodiments, the amino acid sequence of the SARS-CoV-2 virus protein is modified compared to the wild-type protein.
[0096] In some embodiments, the nucleotide sequence encoding the S protein is modified from the wild-type nucleotide sequence. In some embodiments, the amino acid sequence of the S protein is modified from the wild-type protein (Protein S of Wuhan-HU-1, contract LC521925.1; SEQ ID NO: 9). In some embodiments, the amino acid sequence of the S protein is modified from the wild-type protein (Protein S of Wuhan-HU-1, contract MN988668.1; SEQ ID NO: 47). In some embodiments, the amino acid sequence of the S protein is modified from the wild-type protein (Protein S of Wuhan-Hu-1, contract NC_045512.2; SEQ ID NO: 53). In some embodiments, the amino acid sequence of the SARS-CoV-2 virus protein is modified from the wild-type protein so that the modified protein is adapted to infect mice. Roberts et al. PLoS Pathog, the entire text of which is incorporated herein by reference. See 3 (1): e5. doi: 10.1371. In some embodiments, the tyrosine at position 459 in the S protein is substituted with histidine (Y459H) compared to the wild-type protein (SEQ ID NO: 47). In some embodiments, the S protein contains one or more mutations that enhance antibody-dependent efficacy. In some embodiments, the aspartic acid at position 614 in the S protein is substituted with glycine (D614G) compared to the wild-type protein (SEQ ID NO: 47). See Korber et al. bioRxiv 2020.04.29.069054, which is incorporated herein by reference in its entirety. In some embodiments, the S protein contains one or more mutations in the fusion core of the HR1 region. In some embodiments, the serine at position 943 in the S protein is substituted with proline (S943P) compared to the wild-type protein (SEQ ID NO: 47). In some embodiments, the S protein includes one or more mutations that stabilize the S protein to an antigenically optimal pre-fusion conformation resulting in increased expression, conformational uniformity, and induction of a potent antibody response. In some embodiments, the mutation that stabilizes the S protein to a pre-fusion conformation is located at the beginning of the central helix. See Pallesen et al. Proc Natl Acad Sci USA. 2017; 114 (35), the whole of which is incorporated herein by reference. In some embodiments, compared to the wild-type protein (SEQ ID NO: 47), the lysine at position 986 in the S protein is substituted with proline (K986P). In some embodiments, compared to the wild-type protein (SEQ ID NO: 47), the valine at position 987 in the S protein is substituted with proline (V987P). In some embodiments, compared to the wild-type protein (SEQ ID NO: 47), the S protein includes one or a combination of the substitutions Y459H, D614G, S943P, K986P, and V987P.
[0097] In some embodiments, the amino acid sequence of the M protein is modified from that of the wild-type protein (Wuhan-HU-1 protein M, commissioned LC521925.1; SEQ ID NO: 10). In some embodiments, the amino acid sequence of the M protein is modified from that of the wild-type protein (Wuhan-HU-1 protein M, commissioned MN988668.1; SEQ ID NO: 48). In some embodiments, the glutamic acid at position 11 in the M protein is substituted with lysine compared to the wild-type protein (SEQ ID NO: 10). In some embodiments, the glutamic acid at position 11 in the M protein is substituted with lysine compared to the wild-type protein (SEQ ID NO: 48).
[0098] In some embodiments, the amino acid sequence of the N protein is modified from that of the wild-type protein (Wuhan-HU-1 protein N, commissioned LC521925.1; SEQ ID NO: 11). In some embodiments, the amino acid sequence of the N protein is modified from that of the wild-type protein (Wuhan-HU-1 protein N, commissioned MN988668.1; SEQ ID NO: 49).
[0099] In some embodiments, the nucleic acid sequence encoding the SARS-CoV-2 viral protein is modified from the wild-type protein. In some embodiments, the nucleic acid sequence encoding the SARS-CoV-2 viral protein is modified from the wild-type protein (SEQ ID NO: 9). In some embodiments, the nucleic acid sequence encoding the SARS-CoV-2 viral protein is modified from the wild-type protein (SEQ ID NO: 47). In some embodiments, the nucleic acid sequence encoding the SARS-CoV-2 viral protein is modified from the wild-type protein for efficient expression of the transgene in the poxvirus. In some embodiments, heterologous gene-coding sequences containing the vaccinia early transcription terminator signal (ETTS) (also known as TTTTTNT; T5NT (SEQ ID NO: 14)) are removed. See Earl et al. Journal of Virology, 1990; 2448-2451, which is incorporated herein by reference in its entirety. In some embodiments, the poxvirus genome retains two duplicate endogenous ETTS. In some embodiments, heterologous gene coding sequences containing the vaccinia early transcription terminator signal (ETTS) (also known as T5NT (SEQ ID NO: 14)) are removed from the nucleic acid sequence encoding the SARS-CoV-2 virus S protein (Wuhan-HU-1 protein S, contract MN988668.1; SEQ ID NO: 47).
[0100] In some embodiments, the nucleic acid encoding the SARS-CoV-2 virus protein is operationally ligated to the promoter. In some embodiments, the promoter is a poxvirus-specific promoter. In some embodiments, the promoter is located between the left adjacent arm and the ATG of the transgene expression cassette. In some embodiments, the poxvirus promoter is a vaccinia virus early promoter. In some embodiments, the poxvirus promoter is an optimized vaccinia virus early promoter (AAAATTGAAANNNTANNNNNNNNNNNNNNNNNN; SEQ ID NO: 3). In some embodiments, the poxvirus promoter is a synthetic vaccinia virus late promoter (TTTTTTTTTTTTTTTTTTTTNNNNNNTAAATG; SEQ ID NO: 4). In some embodiments, the poxvirus promoter is a duplicate synthetic early / late promoter (AAAAATTGAAATTTTATTTTTTTTTTTTTTGGAATATAAATA; SEQ ID NO: 5). See Figure 8. See also Chakrabarti et al. BioTechniques 23: 1094–1097, which is incorporated herein by reference in its entirety.
[0101] In some embodiments, the vaccinia virus late promoter nucleotide sequence includes the sequence described in SEQ ID NO: 6 (TTTTATTTTTTTTTTTTGGAATATAAATA). In some embodiments, the vaccinia virus late promoter is the sequence described in SEQ ID NO: 6. In some embodiments, the vaccinia virus late promoter nucleotide sequence includes the sequence described in SEQ ID NO: 7 (AAAATTGAAAAAATA). In some embodiments, the poxvirus promoter is a duplicated synthetic early / late promoter including the sequence described in SEQ ID NO: 8 (TTTTATTTTTTTTTTTTGGAATATAAATATCCGGTAAAATTGAAAAAATA). In some embodiments, the poxvirus promoter is a duplicated synthetic early / late promoter including a 3' nucleic acid spacer sequence of 38-160 nucleotides between the RNA start site and ATG, 3' to the early promoter. In some embodiments, the spacer is 160 nucleotides long and results in enhanced expression levels. See Figure 9. See Di Pilato et al. Journal of General Virology (2015), 96, 2360-2371, which is incorporated herein by reference in its entirety. In some embodiments, the vaccinia virus late promoter and spacer include the sequence described in SEQ ID NO: 39.
[0102] In some embodiments, the SARS-CoV-2 protein is inserted into a gene that is not essential for replication. In some embodiments, the SARS-CoV-2 protein is inserted into the thymidine kinase (TK) locus of horsepox virus or synthetic horsepox virus (gene ID HPXV095; positions 992077-92610; SEQ ID NO: 1). In some embodiments, the SARS-CoV-2 protein is inserted into the thymidine kinase (TK) locus of vaccinia virus or synthetic vaccinia virus (gene ID synVACV_105; positions 83823-84344; SEQ ID NO: 2). The TK locus provides a stable insertion site for the foreign gene of interest. The TK locus also provides a selection marker for identifying clones into which the nucleic acid encoding the SARS-CoV-2 protein has been inserted. Clones into which the nucleic acid encoding the SARS-CoV-2 protein is inserted lack the TK gene and therefore cannot grow in the presence of 5-bromo-2-deoxyuridine (BrdU), an analog of pyrimidine deoxynucleoside thymidine.
[0103] An exemplary method for generating the recombinant poxvirus of this disclosure, which contains the S protein of the SARS-CoV-2 virus, includes: a) Infect cells (e.g., Vero cells or BSC-40 cells) with a poxvirus (e.g., horsepox virus). b) An expression cassette comprising a nucleotide fragment containing a nucleotide sequence encoding an S protein, wherein the resulting S protein comprises any one of the following amino acid substitutions: (i) Y459H, so the resulting S protein is adapted to infection in mice; (ii) D614G; (iii) S943P; (iv) K986P or (v) V987P, or a combination thereof, and the nucleotide sequence encoding the S protein contains deletions of two T5NT (SEQ ID NO: 14) sequences. c) Obtain nucleotide fragments containing the vaccinia virus early / late promoters and position them upstream of the modified S protein. This expression cassette, containing the vaccinia virus early / late promoters and the engineered S gene, is referred to as the "engineered SARS-CoV-2 S gene expression cassette." d) Transfect infected cells (e.g., Vero cells or BSC-40 cells) with a PCR-generated nucleotide fragment containing the "engineered SARS-CoV-2 S gene expression cassette." The helper virus catalyzes recombination between fragments that share adjacent homologous sequences (sequences between the left and right arms). Thus, recombination between the left homologous sequence (arm) (HPXV094) and the right homologous sequence (arm) (HPXV096) inserts the expression cassette into the TK gene. The left and right arms are approximately 400 bp sequences adjacent to the TK locus and are specific to the poxvirus produced. See Figure 10. Method of Disclosure
[0104] Any synthetic poxvirus disclosed in US2018 / 0251736 and WO2019 / 213452 may be used in any method disclosed herein.
[0105] Any recombinant poxvirus containing nucleic acids encoding the SARS-CoV-2 viral protein described herein may be used in any of the methods disclosed herein.
[0106] In one embodiment, the present disclosure relates to a method for selecting cells expressing the SARS-CoV-2 viral protein, comprising the steps of infecting the cells with the recombinant poxvirus of the present disclosure, and selecting the infected cells expressing the SARS-CoV-2 viral protein.
[0107] In another aspect, the Disclosure relates to a method for inducing an immune response to the SARS-CoV-2 virus in a subject, comprising the step of administering to the subject an immunologically effective amount of the recombinant poxvirus of the Disclosure.
[0108] In another aspect, the Disclosure relates to a method for generating the recombinant poxvirus of the Disclosure, (a) A step of infecting host cells with a poxvirus; (b) Transfecting the infected cells from step (a) with nucleic acids encoding SARS-CoV-2 viral proteins to produce recombinant poxvirus; and (c) A step of selecting a recombinant poxvirus, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located in a region of the poxvirus that is not essential for poxvirus replication when transfected. This includes methods.
[0109] In some embodiments, the recombinant poxvirus of this disclosure is used as a vaccine to express the SARS-CoV-2 viral protein. Methods for assessing the safety, immunogenicity, and protective capacity of recombinant poxviruses are known in the art. See Kremer M et al. 2012. p 59-92. In Isaacs SN (ed), Vaccinia virus and poxvirology, vol 890. Humana Press, Totowa, NJ. In some embodiments, immunization is via a subcutaneous route. In some embodiments, immunization is via an intramuscular route. In some embodiments, immunization is via an intranasal route. In some embodiments, immunization is by random dissection. In some embodiments, about 10 4 ~about 10 8 Recombinant poxviruses in the PFU range are used. In some embodiments, about 10 4 PFU, approx. 10 5 PFU, approx. 10 6 PFU, approx. 10 7PFU or about 10 8 PFU's recombinant poxvirus is used for immunization. 5 Recombinant poxviruses in PFUs are used for immunization. The appropriate PFU dosage for each subject can be determined by a physician. In some embodiments, one dose is administered to the subject. In some embodiments, more than one dose is administered to the subject.
[0110] In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to the SARS-CoV-2 virus in a subject, comprising the step of administering an immunologically effective amount of recombinant poxvirus or a pharmaceutical composition to the subject. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to the SARS-CoV-2 virus in a subject, wherein an immunologically effective amount of recombinant poxvirus is administered by a random cutting method. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to the SARS-CoV-2 virus in a subject, wherein the immune response comprises an antibody capable of neutralizing the SARS-CoV-2 virus. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to the SARS-CoV-2 virus in a subject, wherein an immunologically effective amount of recombinant poxvirus is capable of protecting the subject from the SARS-CoV-2 virus. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to the SARS-CoV-2 virus in a subject, wherein an immunologically effective amount of recombinant poxvirus reduces or prevents viral progression after SARS-CoV-2 infection in the subject. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to the SARS-CoV-2 virus in a subject, wherein the immune response is a T-cell immune response.
[0111] In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to SARS-CoV-2 virus and poxvirus, comprising the step of administering an immunologically effective amount of recombinant poxvirus or a pharmaceutical composition to a subject. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to SARS-CoV-2 virus and poxvirus, wherein the immunologically effective amount of recombinant poxvirus is administered by a random cutting method. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to SARS-CoV-2 virus and poxvirus, wherein the immune response comprises antibodies capable of neutralizing SARS-CoV-2 virus and poxvirus. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to SARS-CoV-2 virus and poxvirus, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting a subject from SARS-CoV-2 virus and smallpox virus. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to SARS-CoV-2 virus and poxvirus, wherein an immunologically effective amount of recombinant poxvirus reduces or prevents the progression of SARS-CoV-2 virus infection and / or poxvirus infection in a subject. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to SARS-CoV-2 virus and poxvirus, wherein the immune response is a T-cell immune response. In some embodiments, recombinant poxvirus is useful in a method for inducing an immune response to SARS-CoV-2 virus and poxvirus, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus.
[0112] In some embodiments, recombinant poxvirus is useful in a method for inducing T-cell immunity against the SARS-CoV-2 virus, comprising the step of administering an immunologically effective amount of recombinant poxvirus or a pharmaceutical composition to a subject. In some embodiments, recombinant poxvirus is useful in a method for inducing T-cell immunity against the SARS-CoV-2 virus, wherein the immunologically effective amount of recombinant poxvirus is administered by a random cutting method. In some embodiments, recombinant poxvirus is useful in a method for inducing T-cell immunity against the SARS-CoV-2 virus, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting a subject from the SARS-CoV-2 virus. In some embodiments, recombinant poxvirus is useful in a method for inducing T-cell immunity against the SARS-CoV-2 virus, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents viral progression after SARS-CoV-2 infection in a subject.
[0113] In some embodiments, recombinant poxvirus is useful in a method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus, comprising the step of administering an immunologically effective amount of recombinant poxvirus or a pharmaceutical composition to a subject. In some embodiments, recombinant poxvirus is useful in a method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus, wherein the immunologically effective amount of recombinant poxvirus is administered by a random cutting method. In some embodiments, recombinant poxvirus is useful in a method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting a subject from SARS-CoV-2 virus and poxvirus. In some embodiments, recombinant poxvirus is useful in a method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents viral progression after SARS-CoV-2 infection and / or smallpox virus infection in a subject. In some embodiments, recombinant poxviruses are useful in methods for inducing T-cell immunity against SARS-CoV-2 virus and poxviruses, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus.
[0114] In some embodiments, recombinant poxvirus is useful in a method for reducing or preventing the progression of SARS-CoV-2 virus infection in subjects who need to reduce or prevent the progression of SARS-CoV-2 virus infection or who are at risk of the progression of SARS-CoV-2 virus infection, the method comprising the step of administering an immunologically effective amount of recombinant poxvirus or a pharmaceutical composition to the subject.
[0115] In some embodiments, recombinant poxvirus is useful in a method for reducing or preventing the progression of SARS-CoV-2 virus and poxvirus infection in subjects at risk of progression of SARS-CoV-2 virus and poxvirus infection, the method comprising the step of administering an immunologically effective amount of recombinant poxvirus or a pharmaceutical composition to the subjects. In some embodiments, recombinant poxvirus is useful in a method for reducing or preventing the progression of SARS-CoV-2 virus and poxvirus infection, the method wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus.
[0116] In some embodiments, recombinant poxviruses are useful in vaccines against the SARS-CoV-2 virus, which include recombinant viruses or pharmaceutical compositions.
[0117] In some embodiments, recombinant poxviruses are useful in bivalent vaccines against SARS-CoV-2 virus and poxviruses, comprising recombinant virus or pharmaceutical composition. In some embodiments, recombinant poxviruses are useful in bivalent vaccines against SARS-CoV-2 virus, where the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] Table 1-7 Table 1-8 Table 1-9 Table 1-10 Table 1-11 Table 1-12 Table 1-13 Table 1-14 Table 1-15 Table 1-16 Table 1-17 Table 1-18 Table 1-19 Table 1-20 Table 1-21 Table 1-22 Table 1-23 Table 1-24 Table 1-25 Table 1-26 Table 1-27 Table 1-28 Table 1-29 Table 1-30 Table 1-31 Table 1-32 Table 1-33 Table 1-34 Table 1-35 Table 1-36 Table 1-37 Table 1-38 Table 1-39 Table 1-40 Table 1-41 Table 1-42 Table 1-43 Table 1-44 Table 1-45 Table 1-46 Table 1-47 Table 1-48 Table 1-49 Table 1-50 Table 1-51 Table 1-52 Table 1-53 Table 1-54 Table 1-55 Table 1-56 Table 1-57
Table 1-58
Table 1-59
Table 1-60
Table 1-61
Table 1-62
Table 1-63
Table 1-64
Example
[0118] (Example 1) Generation of synthetic horsepox virus Generate synthetic horsepox virus (scHPXV) according to the method disclosed in US2018 / 0251736, which is hereby incorporated by reference in its entirety.
[0119] The design of the synthetic HPXV genome is based on the previously described genome sequence for HPXV (strain MNR-76; GenBank commissioned DQ792504) (Tulman ER, Delhon G, Afonso CL, Lu Z, Zsak L, Sandybaev NT, et al. Genome of horsepox virus. Journal of virology. 2006; 80 (18): 9244-58). The 212,633 bp genome is divided into 10 overlapping fragments. These fragments are designed to share at least 1.0 kbp of overlapping sequences (i.e., homology) with each adjacent fragment to provide sites for homologous recombination to drive the assembly of the full genome. The generated fragments are shown in Table 2. These overlapping sequences provide sufficient homology to accurately carry out recombination between co-transfected fragments. [Table 2]
[0120] The resulting synthesized HPXV was deposited with GenBank under accession number KY349117.
[0121] Introducing a yfp / gpt cassette under the control of the early and late poxvirus promoters into the HPXV095 / J2R locus within GA_fragment_3 facilitates the visualization of HPXV (scHPXV YFP-gpt::095) reactivation under a fluorescence microscope. SFV-catalyzed recombination and reactivation of poxvirus DNA for assembling recombinant poxviruses has been previously described (Yao XD et al.). Journal of virology. 2003; 77 (13): 7281-90; and Yao XD et al. Methods Mol Biol. 2004; 269: 51-64; the entirety of each disclosure is incorporated herein by reference). Several biological features make this an intriguing model system. First, SFV has a narrow host range and productively infects rabbit cells and certain monkey cell lines, such as BGMK. It can infect cells such as BSC-40, but proliferation there is very poor. Second, SFV proliferates more slowly than orthopoxviruses, taking approximately 4-5 days to form transformed “lesions” within a cell monolayer, which is a very different characteristic from orthopoxviruses, which produce plaques in culture within 1-2 days. This difference in replication between lepolipoxvirus and orthopoxvirus makes it possible to distinguish these viruses by performing a reactivation assay in BGMK cells and plating the progeny onto BSC-40 cells. In some embodiments, other helper viruses (e.g., fowlpox virus, but not limited to these) may be used. In some embodiments, different cell combinations may be used.
[0122] BGMK cells were infected with SFV at a MOI of 0.5, and then transfected with 5 μg of digested GA_HPXV fragments 2 hours later. Five days after transfection, all infectious particles were recovered by cell lysis and replated onto BSC-40 cells, which efficiently support only HPXV proliferation. The resulting reactivated scHPXV YFP-gpt::095 plaques were visualized under a fluorescence microscope. Visualization was enabled by a yfp / gpt selectable marker at the HPXV095 / J2R locus within fragment_3. Viral plaques were detected in the BSC-40 monolayer within 48 hours of transfection. The efficiency of recovering scHPXV YFP-gpt::095 depends on several factors, including DNA transfection efficiency, but ranges up to a few PFU / μg of transfected DNA.
[0123] Introducing a yfp / gpt cassette under the control of the early and late poxvirus promoters, similarly into the HPXV200 locus within GA_fragment_7, facilitates the visualization of HPXV (scHPXV YFP-gpt::200) reactivation under a fluorescence microscope. SFV-catalyzed recombination and reactivation of poxvirus DNA for assembling recombinant poxviruses has been previously described (Yao XD et al.). Journal of virology. 2003; 77 (13): 7281-90; and Yao XD et al. Methods Mol Biol. 2004; 269: 51-64; the entirety of each disclosure is incorporated herein by reference). Several biological features make this an intriguing model system. First, SFV has a narrow host range and productively infects rabbit cells and certain monkey cell lines, such as BGMK. It can infect cells such as BSC-40, but proliferation there is very poor. Second, SFV proliferates more slowly than orthopoxviruses, taking approximately 4-5 days to form transformed “lesions” within a cell monolayer, which is a very different characteristic from orthopoxviruses, which produce plaques in culture within 1-2 days. This difference in replication between lepolipoxvirus and orthopoxvirus makes it possible to distinguish these viruses by performing a reactivation assay in BGMK cells and plating the progeny onto BSC-40 cells. In some embodiments, other helper viruses (e.g., fowlpox virus) may be used. In some embodiments, different cell combinations may be used.
[0124] BGMK cells were infected with SFV at a MOI of 0.5, and then transfected with 5 μg of digested GA_HPXV fragments 2 hours later. Five days after transfection, all infectious particles were recovered by cell lysis and replated onto BSC-40 cells, which efficiently support only HPXV proliferation. The resulting reactivated scHPXV YFP-gpt::200 plaques were visualized under a fluorescence microscope. Visualization was enabled by a yfp / gpt selectable marker in the HPXV200 locus within fragment_7. Viral plaques were detected in the BSC-40 monolayer within 48 hours of transfection. The efficiency of recovering scHPXV YFP-gpt::200 depended on several factors, including DNA transfection efficiency, but ranged up to a few PFU / μg of transfected DNA. (Example 2) Generation of synthetic vaccinia virus, strain ACAM2000
[0125] The synthetic vaccinia virus ACAM2000 was produced using the method disclosed in WO2019 / 213452, which is incorporated herein by reference in its entirety.
[0126] The design of the synthetic VACV (synVACV) genome was based on the previously described genome sequence for VACV ACAM2000 (GenBank commissioned AY313847) (Osborne JD et al. Vaccine. 2007; 25(52):8807-32). The genome was divided into nine overlapping fragments (Figure 1). These fragments were designed to share at least 1.0 kbp of overlapping sequences (i.e., homology) with each adjacent fragment to provide a site for homologous recombination to drive the assembly of the full genome (Table 3). These overlapping sequences provided sufficient homology to accurately carry out recombination between co-transfected fragments (Yao XD, Evans DH. Journal of Virology. 2003;77(13):7281-90). [Table 3]
[0127] The resulting synthesized VACV, ACAM 2000, was deposited with GenBank under accession number MN974381. (Example 3) Generation of manipulated SARS-CoV-2 S protein
[0128] Nucleotide sequence alignment of synthetic HPXV (accession number KY349117) and synthetic VACV (accession number MN974381) demonstrates 99% nucleotide sequence identity across the entire 4Kb TK locus, as well as collinearity (start and stop) of the TK gene sequences used to construct the ΔTK insertion locus or knockout TK locus. See Figure 3.
[0129] The TK gene is not essential for viral replication in tissue cultures. The TK gene also provides a stable insertion site for the desired foreign gene(s), and a selection marker (TK-) in the presence of the nucleotide analog 5-bromodeoxyuridine (5-BrdU).
[0130] The high level of sequence identity between synthetic HPXV and synthetic VACV allows for the use of the same expression cassette with two different rescue viruses through PCR sequencing to generate expression cassettes containing promoter / gene sequences. Virus-specific sequences (recombination left and right flanking arms corresponding to HPXV094 and HPXV096, respectively) enable recombination of the expression cassette into the viral TK locus to rescue transfected PCR fragments containing the manipulated SARS-CoV-2 S protein. See Figures 2 and 5.
[0131] We will perform nucleotide sequence alignment of the spike (S) gene of different SARS-CoV-2 isolates. The virus isolates to be aligned are those published under the following accession numbers: NC045512.2, LC521925.1, MN988668.1, MN985325.1, MN975262.1, MN938384.1, LR757998.1, LR757996.1, LR757995.1, and MN908947.3. The S gene alignment will demonstrate 100% nucleotide-level homology of the S gene of different virus isolates. All virus isolate sequences are isolates with complete genome sequence entries from China, Japan, and the United States. Initial indications from sequence analysis of the isolates appear to show little viral drift. However, if drift is ultimately observed, the same technique can be used with modified viruses and their protein and nucleic acid sequences.
[0132] The nucleotide sequence encoding the SARS-CoV-2 S protein includes the nucleotide sequence described in SEQ ID NO: 9 or SEQ ID NO: 47. SARS-CoV-2 is not well adapted for infection of mice. Therefore, genomic adaptive mutations are introduced to adapt the virus for infection of mice. In particular, mutations are introduced in the nucleotide sequence, and these mutations result in an S protein containing the Y459H substitution. Table 4 shows genomic adaptive mutations in the SARS-CoV virus that can be adapted and introduced to other regions of the SARS-CoV-2 virus. See Roberts A et al. PLoS Pathog. 2007 Jan; 3 (1): e5. doi: 10.1371.
[0133] Table 4 lists six mutations found in the SARS-CoV virus (referred to as MA15) produced from 15 passages, which are lethal to mice after intranasal inoculation. The labels in Table 4 are as follows: ORF a Open Reading Frame; CDS b: Code sequence, a sequence of nucleotides corresponding to the amino acid sequence within a protein (including the start and stop codon positions); nsp c : Non-structural protein, cleavage product of ORF 1ab; Main pro : Major 3C-like proteases; Hel: Helicase; RBM d : Receptor-binding motif (amino acids 424-494). [Table 4]
[0134] To efficiently express a transgene from a poxvirus vector, heterologous gene-coding sequences containing vaccinia early transcription terminator signals (ETTS) should be removed, in one embodiment of this disclosure, by encoding silent mutagenesis to generate a full-length transcript during the early phase of infection. These sequences include: TTTTTNT(T5NT); SEQ ID NO: 14. Removal of ETTS within the S protein-coding sequence positively affects the generation of a robust immune response. Earl PL et al. See J Virol. 1990 May; 64 (5): 2448-51.
[0135] Other examples of mutations introduced into the S protein (SEQ ID NO: 47) in other embodiments of this disclosure include: D614G, S943P, K986P, and V987P. In these embodiments, one or more of these mutations may be introduced into the S protein.
[0136] Poxvirus replication occurs in the protoplasm of infected cells. The virus does not enter the nucleus of the infected cell during the replication cycle and therefore does not utilize the host cell's transcription machinery. Because the site of replication is the protoplasm, poxviruses encode their own transcription mechanisms, including viral RNA polymerase, and their own regulatory promoter recognition signals. Therefore, for efficient high-level expression from eukaryotic transgenes, expression must be driven by the poxvirus promoter. Poxvirus gene expression is controlled by early, mid, and late promoters, which can be defined as early (8 hours before infection) and late (8 hours after infection). DNA synthesis occurs 8 hours after infection and is referred to as the temporal boundary for the onset of late gene expression. The highest level of transgene antigenic loading is usually achieved by using a combination of early and late promoter signals. The promoter used to control the transcription of the S protein is a duplicate synthetic early / late promoter containing the sequence (TTTTATTTTTTTTTTTTGGAATATAAATATCCGGTAAAATTGAAAAAATA, SEQ ID NO: 8), which is 3' to the early promoter and contains a 160-nucleotide spacer between the RNA start site and the ATG (SEQ ID NO: 42). See Figure 9. See Di Pilato et al. Journal of General Virology (2015), 96, 2360-2371, which is incorporated herein by reference in its entirety. Spacers greater than 50 nt are thought to provide greater space for the transcription mechanism and potentially accelerate gene expression, while spacers greater than 99 nt are thought to provide advantages for early gene expression.
[0137] The resulting expression cassette contains a modified SARS-CoV-2 S protein adapted to mouse infection, with the ETTS sequence removed and regulated under the transcription of overlapping tandem early / late promoters. (Example 4) Generation of recombinant poxvirus containing manipulated SARS-CoV-2 S protein
[0138] An exemplary method for generating recombinant horsepox virus containing the S protein of the SARS-CoV-2 virus is shown in Figures 6 and 7 and includes: (a) As described above, infect cells (e.g., Vero cells or BSC-40 cells) with rescue synthetic horsepox virus and rescue synthetic VACV. (b) 24 hours after infection, transfection is performed on infected cells (e.g., Vero cells or BSC-40 cells) with a nucleotide fragment generated by PCR containing the "manipulated SARS-CoV-2 S gene expression cassette". Recombination of the expression cassette occurs through the left and right adjacent arms, and the expression cassette is inserted into the TK locus. Thus, the HPXV-095 TK locus is knocked out and the expression cassette is inserted into the TK locus. After 30 minutes at 25°C, 7.2 ml of Eagle Medium containing 8% fetal bovine serum is added, and the monolayer is incubated at 37°C for 3.5 hours. The culture medium is then removed and replaced with 8 ml of fresh Eagle Medium containing 8% fetal bovine serum, and incubation is continued at 37°C for 2 days. Cells are scraped from the vial, pelletized by centrifugation (2,000 × g, 5 minutes), and resuspended in 0.5 ml of Eagle Medium containing 2.5% fetal bovine serum. (c) Transfected cells were collected 48 hours after infection, and the recombinant synthetic horsepox virus progeny viruses, including the engineered SARS-CoV-2 S gene and synthetic VACV, were released by repeated freeze / thaw cycles. (d) Selection of recombinant viruses. Thymidine kinase-negative poxvirus recombinants are selected. - Cells (for example, TK - Vero cells or TK -In BSC-40 cells, plaques are selected using a 1% low-melting-point agarose stratification containing 25 μg / ml BrdU by plaque assay. After 3 days at 37°C, the cell monolayer is stained with 0.005% neutral red, and plaques are picked using a sterile Pasteur pipette and placed in 0.5 ml of Eagle medium containing 2.5% fetal bovine serum. Recombinant virus progeny are then TK - Identification is performed by proliferation in cells. If the SARS-CoV-2 S gene is inserted into the viral thymidine kinase (TK) gene, the virus containing the inserted DNA is identified as TK. - Therefore, selection can be made based on this (Mackett et al., (1982)). Confirmation of the S gene is performed by PCR sequence analysis.
[0139] Once a recombinant poxvirus is identified, the expression of the polypeptide encoded by the inserted gene can be assayed using various methods. These methods include, but are not limited to, black plaque assays (in situ enzyme immunoassays performed on viral plaques), Western blot analysis, radioimmunoprecipitation (RIPA), and enzyme immunoassays (EIA). Antibodies that recognize SARS-CoV-2 S may be used.
[0140] The sequence of one embodiment of synthetic horsepox virus containing nucleic acid encoding the SARS-CoV-2 virus S protein is SEQ ID NO: 43. The sequence of one embodiment of synthetic vaccinia virus containing nucleic acid encoding the SARS-CoV-2 virus S protein is SEQ ID NO: 44. (Example 5) Immunization of mice with recombinant poxvirus containing manipulated SARS-CoV-2 S protein
[0141] Primary chicken embryo fibroblast (CEF) cells, prepared from 10-day-old embryos, are grown in minimal essential medium supplemented with 10% FBS and used for recombinant poxvirus propagation and titer determination.
[0142] BALB / c mice were injected with recombinant synthetic horsepox virus expressing SARS-CoV-2 protein. 5 PFU, 10 6 PFU, 10 7 PFU or 10 8 It is used in PFU and immunized by single-shot and prime-boost vaccinations via random inoculation, intranasal, intramuscular, or subcutaneous injection. Animals inoculated with non-recombinant virus (WT) or phosphate-buffered saline (Mock) are used as controls.
[0143] Four weeks after immunization, as described, the animals were given SARS-CoV-2 10 times. 4 50% tissue culture infectious dose (TCID) 50 ) The antigen is administered intranasally (Subbarao, K et al. (2004) J. Virol. 78, 3572-3577). Two days later, the lungs and nasal turbinates of four animals from each group were removed, and SARS-CoV-2 titers were determined. (Example 6) Human immunization using recombinant poxvirus containing a modified SARS-CoV-2 S protein
[0144] For subjects at risk of infection with SARS-CoV-2 S, recombinant poxvirus containing the modified SARS-CoV-2 S protein described herein is used (standard dose, 2.5 × 10⁶). 5 ~12.5×10 5 Vaccine is administered typically to the upper arm using a bifurcated needle in a random dissection technique (plaque-forming units). Recombinant poxviruses containing the engineered SARS-CoV-2 S protein are used as a single-dose, one-shot vaccine (e.g., 1 × 10⁻⁶). 6 It can also be administered as PFU's TNX-1800, in which case vials containing 100 doses are manufactured. This vaccination protects the subject from infection. However, further vaccination may be useful to boost immunity.
[0145] The methodology for the clinical trials testing the vaccine has been previously described (Sadoff, J. et al. (2020) Safety and immunogenicity of the Ad26.COV2.S COVID-19 vaccine candidate: interim results of a phase 1 / 2a, double-blinded, randomized, placebo-controlled trial, MedRxiv, Pages 1-28; the entire text is incorporated herein by reference). A multicenter, phase 1 / 2a, randomized, double-blind, placebo-controlled clinical trial designed to assess the safety, reactogenicity, and immunogenicity of recombinant poxviruses containing the engineered SARS-CoV-2 S protein will be conducted. The engineered SARS-CoV-2 S protein will be administered, for example, at a dose of approximately 5 × 10⁶ per vaccine dose. 10 ~1 × 10 11 The vaccine is administered at a dose level of individual viral particles (vp) as a single dose, or in a two-dose schedule with, for example, a 56-day interval between doses, in healthy adults (18–55 years) and healthy elderly individuals (≥65 years). The vaccine, which has extracted S-specific antibody levels, is measured, for example, by ELISA, and the neutralizing titer is measured, for example, by a microneutralization assay (see, for example, the method in Example 11). CD4+ T-helper (Th)1 and Th2, as well as the CD8+ immune response, are assessed, for example, by intracellular cytokine staining (ICS). (Example 7) Generation of codon-optimized SARS-CoV-2 spike protein (SARS-CoV-2-Spike-co)
[0146] The SARS-CoV-2 spike protein (SEQ ID NO: 45) was codon-optimized for expression during poxvirus infection (SARS-CoV-2-Spike-co; SEQ ID NO: 50) and synthesized by GenScript. The synthesized DNA also contains the early / late promoters of poxvirus synthesis at nucleotide positions 10-48. The synthesized DNA was subcloned into plasmids containing homology to either the HPXV095 locus (SEQ ID NO: 51) or the HPXV200 locus (SEQ ID NO: 52). The synthesized DNA was inserted using homologous recombination by replacing a selectable marker that had been pre-inserted into synthetic VACV (synVACV) or synthetic HPXV (scHPXV). Selectable markers were inserted into either the HPXV095 gene or the A2K105 gene as fusions of yellow fluorescent protein (YFP) and guanine phosphoribosyltransferase (GPT), respectively (see the method disclosed in US2018 / 0251736, which is incorporated herein by reference in its entirety). (Example 8) Generation of synthetic vaccinia virus TNX-2200
[0147] Synthetic vaccinia virus TNX-2200 is generated by replacing a YFP-GPT selectable marker in the thymidine kinase (TK) locus (also known as the A2K105 locus) with, for example, a codon-optimized SARS-CoV-2 Spike (SARS-CoV-2-co) nucleotide sequence using homologous recombination. One exemplary procedure is as follows:
[0148] A plasmid containing approximately 20 μg of SARS-CoV-2-Spike-co nucleotide sequence, which is adjacent to approximately 400 nucleotides homologous to the A2K105 gene, was linearized using the restriction enzyme SacI. After restriction enzyme digestion, the linearized plasmid was further purified to remove any remaining enzymes. SynVACV(synVACVΔA2K105) expressing YFP-GPT at the A2K105 locus was introduced into BSC-40 cells. yfp-gpt The cells were infected with ) at a MOI of 0.1 for 1 hour. After infection, the viral inoculum was replaced with OptiMEM medium and incubated at 37°C for a further 30 minutes. Approximately 5 μg of purified linearized plasmid was mixed with Lipofectamine 2000 (ThermoFisher Scientific) in a ratio of 1 μg of DNA to 3 μL of Lipofectamine 2000 in 2 mL of OptiMEM. DNA-lipid complexes were formed during incubation for approximately 10 minutes. This was then added to virus-infected BSC-40 cells.
[0149] BSC-40 cells were incubated for 48 hours to induce homologous recombination. After 48 hours, the virus-infected cells were removed by scraping the plate, and the mixture was transferred to a conical tube. The cells were thawed after three rounds of freezing and thawing at -80°C. 1 × 10 -2 ~1 × 10 -5 An appropriate dilution of infection / transfection mixture, within a possible range, was plated onto BSC-40 cells, followed by agar stratification. The infected cell plates were incubated until non-fluorescent "recombinant" plaques were visible. These non-fluorescent plaques were marked, the agar plugs were picked, and added to 10 mM Tris pH 8.0 solution. The plaques were then used to infect BSC-40 cells in a second round of infection. This plaque picking process and infection of BSC-40 cells was repeated until YFP was undetectable in the infected cells (purification in the range of 4-6 rounds). Primers to amplify the A2K105 locus (sA2K J2R flanking forward primer (Flank PCR analysis using the forward primer 5'-3':ATGCGATTCAAAAAAGAATCAGC (SEQ ID NO: 56) and the sA2K J2R flanking reverse primer (Flank Reverse Primer 5'-3':CAATTTCCTCAAAATACATAAACGG (SEQ ID NO: 57)) confirmed that the SARS-CoV-2 Spike gene was inserted into the A2K105 locus.
[0150] Western blot analysis was performed, synVACVΔA2K105 yfp-gpt or synVACVΔA2K105 SARSCoV2-SPIKE-co::nm SARS-Spike-co protein expression in BSC-40 cells infected with (TNX-2200) clone 1.1.1.1.1 or 2.1.1.1.1 was tested (Figure 11). BSC-40 cells were infected with a virus or virus-free inoculum (Mock) with an indicated MOI of 1.0, and protein lysates were collected using RIPA lysis buffer at the indicated time. Protein lysates were separated using SDS-PAGE, and the proteins were then transferred to a nitrocellulose membrane. The membranes were subsequently blotted with anti-SARS-CoV-2 Spike (ProSci) or anti-VACV 13 antibody. Primary antibody binding was detected by blotting the membrane with IRDye secondary antibody (LI-COR) detectable in 800 nm or 680 nm channels. SARS-CoV-2 Spike antibodies detected different forms of SARS-CoV-2 spike protein, including full-length form, glycosylated full-length form, cleaved form, and multimeric form.
[0151] synVACVΔA2K105 SARSCoV2-SPIKE-co::nm Viral genomic DNA was isolated from clones 1.1.1.1.1 and 2.1.1.1.1 (TNX-2200), and DNA sequencing was performed using next-generation sequencing (NGS) on the Illumina MiSeq platform. CLC Genomics We used Workbench software (Qiagen) to analyze the sequencing data using a new assembly and mapped it to the reference software. (Example 9) Generation of synthetic horsepox virus TNX-1800a
[0152] Synthetic vaccinia virus TNX-1800a was generated by replacing the YFP-GPT selectable marker at the scHPXV (see Example 7) thymidine kinase (TK) locus (also known as the HPXV095 locus) with a codon-optimized SARS-CoV-2 Spike (SARS-CoV-2-co) nucleotide sequence, for example, using homologous recombination. One exemplary procedure is as follows:
[0153] Approximately 20 μg of plasmid containing a SARS-CoV-2-Spike-conucleotide sequence adjacent to the HPXV095 gene, with approximately 400 nucleotides homologous, was linearized using the restriction enzyme SacI. After restriction enzyme digestion, the linearized plasmid was further purified to remove any residual enzymes. BSC-40 cells were infected with scHPXV expressing YFP-GPT at the HPXV095 locus at a MOI of 0.1 for 1 hour. After infection, the viral inoculum was replaced with OptiMEM medium and incubated at 37°C for a further 30 minutes. Approximately 5 μg of the purified linearized plasmid was mixed with Lipofectamine 2000 (ThermoFisher Scientific) in a ratio of 1 μg of DNA to 3 μL of Lipofectamine 2000 in a total volume of 2 mL of OptiMEM. DNA-lipid complexes were formed during an incubation period of approximately 10 minutes. Next, it was added to BSC-40 cells infected with the virus.
[0154] BSC-40 cells were incubated for 48-72 hours to induce homologous recombination. Subsequently, virus-infected cells were removed by scraping the plate, and the mixture was transferred to a conical tube. The cells were thawed after three rounds of freezing and thawing at -80°C. 1 × 10 -2~1 × 10 -5 An appropriate dilution of infection / transfection mixture, within a possible range, was plated onto BSC-40 cells, followed by agar stratification. The infected cell plates were incubated until non-fluorescent "recombinant" plaques were visible. These non-fluorescent plaques were marked, the agar plugs were picked, and added to 10 mM Tris pH 8.0 solution. The plaques were then used to infect BSC-40 cells in a second round of infection. This plaque picking process and infection of BSC-40 cells were repeated until YFP was undetectable in the infected cells (plaque purification in the range of 4–6 rounds). Due to the low efficiency of homologous recombination in HPXV-infected cells, one non-fluorescent plaque was isolated.
[0155] PCR analysis using primers that amplify the HPXV095 locus (sA2K / HPXV J2R flanking forward primer (Flank Forward Primer) 5'-3':TATCGCATTTTCTAACGTGATGG (SEQ ID NO: 58) and sA2K / HPXV J2R flanking reverse primer (Flank Reverse Primer) 5'-3':CCTCATTTGCACTTTCTGGTTC (SEQ ID NO: 59)) was performed to confirm that the SARS-Spike-co gene was inserted into the HPXV095 locus. The viral genomic DNA was subsequently isolated from sucrose-purified viral particle preparations and used for next-generation sequencing using the Illumina MiSeq platform. Sequence data were analyzed by novel assembly using CLC Genomics Workbench software (Qiagen) and mapped to reference software. (Example 10) Generation of synthetic horsepox virus TNX-1800b
[0156] Synthetic vaccinia virus TNX-1800b was generated by replacing the YFP-GPT selectable marker at the scHPXV (see Example 7) HPXV200 locus (also known as the smallpox virus B22R homolog locus) with a codon-optimized SARS-CoV-2 Spike (SARS-CoV-2-co) nucleotide sequence, for example, using homologous recombination. One exemplary procedure is as follows:
[0157] Approximately 20 μg of plasmid containing SARS-CoV-2-Spike-co, which has approximately 400 nucleotides homologous to the HPXV200 gene adjacent to it, was linearized using the restriction enzyme SacI. After restriction enzyme digestion, the linearized plasmid was further purified to remove any residual enzymes. BSC-40 cells were infected with scHPXV expressing YFP-GPT at the HPXV200 locus at a MOI of 0.1 for 1 hour. After infection, the viral inoculum was replaced with OptiMEM medium and incubated at 37°C for a further 30 minutes. Approximately 5 μg of the purified linearized plasmid was mixed with Lipofectamine 2000 (ThermoFisher Scientific) in a ratio of 1 μg of DNA to 3 μL of Lipofectamine 2000 in a total volume of 2 mL of OptiMEM. DNA-lipid complexes were formed during an incubation period of approximately 10 minutes. Next, it was added to BSC-40 cells infected with the virus.
[0158] BSC-40 cells were incubated for 48-72 hours to induce homologous recombination. Subsequently, virus-infected cells were removed by scraping the plate, and the mixture was transferred to a conical tube. The cells were thawed after three rounds of freezing and thawing at -80°C. 1 × 10 -2 ~1 × 10 -5An appropriate dilution of infection / transfection mixture, within a possible range, was plated onto BSC-40 cells, followed by agar stratification. The infected cell plates were incubated until non-fluorescent "recombinant" plaques were visible. These non-fluorescent plaques were marked, the agar plugs were picked, and added to 10 mM Tris pH 8.0 solution. These plaques were subsequently used to infect BSC-40 cells in a second round of infection. One non-fluorescent plaque was isolated due to the lower efficiency of homologous recombination in HPXV-infected cells compared to VACV-infected cells. The plaque picking process was repeated by infecting BSC-40 cells until YFP was undetectable (approximately 4–6 rounds of plaque purification).
[0159] PCR analysis using primers that amplify the HPXV200 locus (sHPXV 200 flanking forward primer (Flank Forward Primer) 5'-3':ATAGCCACAATTATTGACGGGC (SEQ ID NO: 60) and sHPXV 200 flanking reverse primer (Flank Reverse Primer) 5'-3':ggatgatatggtaatgtaactaccgatac (SEQ ID NO: 61)) was performed to confirm that the SARS-Spike-co gene was inserted into the HPXV200 locus. The viral genomic DNA was subsequently isolated from sucrose-purified viral particle preparations and used for next-generation sequencing using the Illumina MiSeq platform. The sequences were analyzed by novel assembly using CLC Genomics Workbench software (Qiagen) and mapped to reference software. (Example 11) SARS-CoV-2 spike protein analysis in TNX-1800a and TNX-1800b
[0160] Western blot analysis was performed to assess SARS-Spike-co protein expression in BSC-40 cells infected with TNX-801, TNX-1800a (clone TNX-1800a-1), and TNX-1800b (clone TNX-1800b-2) (Figure 12). BSC-40 cells were infected with the indicated MOI virus, and protein lysates were collected using RIPA buffer at the indicated time. Protein lysates were separated using SDS-PAGE, and the proteins were then transferred to nitrocellulose membranes. The membranes were subsequently blotted with anti-SARS-CoV-2 Spike (ProSci), anti-VACV 13, or anti-tubulin antibodies. Binding of the primary antibody was detected using fluorescently tagged secondary antibodies. SARS-CoV-2 Spike antibodies detected different forms of SARS-CoV-2 spike protein, including full-length form, glycosylated full-length form, cleaved form, and multimeric form. (Example 12) Immunization of African green monkeys with recombinant poxvirus containing manipulated SARS-CoV-2 S protein
[0161] The methods for immunization and testing of candidate vaccines in African green monkeys have been previously described (Hartman, A. et al. (2020) SARS-CoV-2 infection of African green monkeys result in mild respiratory disease discernible by PET / CT imaging and shedding of infectious virus from both respiratory and gastrointestinal tracts. PLOS Pathogens 16(9): e1008903; the entire report is incorporated herein by reference). African green monkeys (AGMs) were randomly divided into six groups (n=4) and vaccinated with different strains of synthetic horsepox virus (HPXV). See Table 5 for strains and doses. On day 0, AGMs were vaccinated percutaneously using a bifurcated needle in a random cutting method. [Table 5]
[0162] When the injection site of AGM was monitored and vaccinated with TNX-801, TNX-1800b-2, or TNX-1800a-1, skin reactions known as "take" were observed after 7 days, regardless of the dose that elicited an immune response, including a T-cell immune response (Figures 13-17). "Take" has been previously described as a biomarker of a positive vaccine response indicating protective immunity (e.g., T-cell immunity) against vaccinia viruses such as smallpox (Jenner, E., 1800, 2). nd Ed. ”An Inquiry into the Causes and Effects "Take" is a functional T-cell immunity criterion validated by the eradication of smallpox, a respiratory infectious disease caused by variolae vaccinae, in the 1960s. The presence of "take" at the AGM site after vaccination with TNX-1800b-2 or TNX-1800a-1 predicts activation of the T-cell immune response due to the introduction of the SARS-CoV-S protein, the COVID-19 antigen. The T-cell immune response is activated when naive T cells are presented with an antigen (e.g., SARS-CoV-2 S protein), which leads to the differentiation and proliferation of naive T cells. This response also leads to immunological memory by generating memory T cells, which provide protection from subsequent antigen administrations and an accelerated immune response. On day 60, SARS-CoV-2 antigen was administered to vaccinated AGMs via the intratracheal route, demonstrating that antigen administration induced protective immunity against the virus through vaccination. On day 88, the surviving animals were euthanized.
[0163] Fourteen days after vaccination with the HPXV strain shown in AGM, a microneutralization assay was performed to assess the anti-SARS-CoV-2 neutralizing titer in serum. The assay was initially performed in two replicates, and a third replicate was performed if the first two replicates did not fall within a 2-fold dilution. Serum samples were dispensed onto a master plate and then thermally inactivated at 56°C for 30–60 minutes. The master plate can be stored at 4–8°C for 7 days or at -20°C for 3 months.
[0164] Vero E6 cells (ATCC) are divided into 2 x 10 cells per well. 4Serum test samples were seeded at the specified concentrations into 96-well plates, and 18–24 hours later, the serum test samples were added. On the assay day, the master plate was thawed, and the nine serum test samples were serially diluted 2-fold from 1:5 to 1:640 on separate 96-well plates / dilution blocks (columns 1–9). In addition, each 96-well plate / dilution block contained positive control serum (column 10), viral control (column 11), and cell control (column 12). After dilution, equivolutes of viral stock (1,000 TCID50 / mL) were added to columns 1–11. Furthermore, assay quality control (QC) plates consisting of positive control serum (columns 1–2), negative control (columns 3–4), viral input-back titer (columns 5–6), viral control (VC; columns 7–9), and cell control (CC; columns 10–12) were simultaneously set up. At least two QC plates were used per assay. Test plates and QC plates were incubated in a 5% CO2 incubator at 37°C for 2–2.5 hours. After incubation, aliquots of the mixture (serum and virus) were transferred from both the test plates and QC plates (including the control) onto 96-well plates pre-seed with Vero E6 cells, and incubated for 72 ± 4 hours. After incubation, the plates were removed from the incubator and allowed to stand at room temperature for 20–40 minutes. 100 μL of Cell Titer-Glo (Promega) was added to all wells of the plate, gently mixed, and incubated at room temperature for 10–30 minutes. Luminescence was measured using a suitable photometer. The plate cutoff value was calculated using the following formula: (Average of VC wells + Average of CC wells) / 2 The titer was calculated using the following method. Samples whose luminescence was above or below the plate cutoff were positive and negative for the neutralizing antibody, respectively. Each replicate was assigned a titer that was the reciprocal of the dilution of the last positive dilution (i.e., 1:80 = titer reported as 80). The titer is reported as the median and geometric mean titer of the acceptable replicate titers.
[0165] Table 6 shows the levels of anti-SARS-CoV-2 neutralizing titers measured 14 days after single-dose vaccination in vaccinated AGMs. AGMs vaccinated with TNX-1800b-2 and TNX1800a-1 produced antibodies with a neutralizing titer against SARS-CoV-2 (≥1:40 titer). No anti-SARS-CoV-2 neutralizing titer was produced in control animals vaccinated with TNX-801 (scHPXV without an S protein expression cassette) or in the placebo group (≤1:10 titer). (2.9 × 10⁶ titers for TNX-801 and TNX-1800) 6 PFU and 1.06×10 6 All PFU doses were well-tolerated. [Table 6] (Example 13) Viral proliferation curves measured in cells infected with recombinant poxvirus containing the manipulated SARS-CoV-2 S protein.
[0166] BSC-40 cells, HeLa cells, and HEK293 cells were seeded in 6-well plates and subsequently infected with TNX-801, TNX-1800, TNX-1200, or TNX-2200 at a MOI of 0.01. 48 hours after infection, cells were fixed and stained with 5% formaldehyde containing crystal violet. BSC-40 cells infected with TNX-801 and BSC-40 cells infected with TNX-1800 showed significant cytopathic effects, while HeLa cells showed only mild cytopathic effects, and HEK293 cells showed no cytopathic effects (Figure 18). BSC-40 cells, HeLa cells, and HEK293 cells infected with TNX-1200, as well as BSC-40 cells, HeLa cells, and HEK293 cells infected with TNX-2200, showed significant cytopathic effects in all infected cell lines (Figure 18). Viral titers (PFU / mL) in BSC-40 cells, HeLa cells, and HEK293 cells were measured over time at 24, 48, and 72 hours after infection with TNX-801, TNX-1800, TNX-1200, or TNX-2200 (Figures 19A-D), which correspond to the viral cytopathic effects shown in Figure 18.
[0167] In BSC-40 cells, HPXV clones (e.g., TNX-801, scHPXVΔ095) were added. yfp-gpt TNX-1800a-1, scHPXVΔ200 yfp-gpt , or TNX-1800b-2; (Figure 20A~B))) or VACV clone (e.g., TNX-1200, TNX-2200 or synVACVΔA2K105) yfp-gpt (Figures 21A-B) were used to infect cells with an MOI of 0.01. Viral titers (PFU / mL) were measured at 0, 3, 6, 12, 24, 48, and 72 hours to determine viral replication in infected cells. The presence of the SARS-CoV-2 spike protein slowed HPXV clone virus replication by approximately 0.5 log, while VACV clone virus replication slowed by approximately 1 log.
[0168] The cytopathic effects observed in Vero and BSC-40 cells infected with various HPXV and VACV clones suggest that these cell lines can be used to produce viruses (e.g., TNX-1800 and TNX-801). (Example 14) SARS-CoV-2 Spike Synthetic DNA Expression Cassette and Generation of Recombinant scHPXV Transfected with the Cassette
[0169] As illustrated in Figure 22, the SARS-CoV-2 Spike(S) nucleotide sequence (SEQ ID NO: 45) is modified by removing the Early Transcription Terminator Signal (T5NT) (SEQ ID NO: 14) using silent coding mutagenesis that preserves the SARS-CoV-2 Spike(S) protein coding sequence.
[0170] Select the location of the insertion site of the xenotransgene SARS-CoV-2 Spike(S) within the DNA nucleotide sequence of the synthetic chimeric (sc) horsepox genome (e.g., TK locus HPXV095; positions 992077-92610; SEQ ID NO: 1). Identify the proximal DNA nucleotide sequences to the left and right of the selected HPXV insertion site, defining the left and right adjacent arms (see Figure 22). Use these arms to drive homologous nucleotide site-specific recombination between the rescue virus and the xenotransgene. Also select the DNA nucleotide sequences encoding a poxvirus-based promoter, e.g., a vaccinia virus early / late promoter, to drive high levels of SARS-CoV-2 Spike(S) gene expression.
[0171] Next, an exemplary DNA nucleotide sequence of a SARS-CoV-2 Spike(S) synthetic expression cassette was synthesized (e.g., by a commercial vendor (e.g., Genewiz)), which is approximately 6kb and has a left adjacent arm, modified CoVID-SARS-2. Includes vaccinia virus early / late promoters operably ligated to the Spike(S) nucleic acid sequence, and DNA nucleotide sequences of the right flanking arm. See Figure 22.
[0172] Next, the SARS-CoV-2 Spike(S) synthetic expression cassette DNA is transfected into cells infected with scHPXV (e.g., BSC-40 cells). Recombinant horsepox virus progeny containing the SARS-CoV-2 Spike(S) synthetic expression cassette are selected using a medium containing BrdU to prevent viral amplification of the parental virus, which retains the original viral genomic DNA sequence at the insertion site. The recombinant virus is purified using sequential round plaque purification. The purified virus-derived nucleotide sequence across the entire SARS-CoV-2 Spike(S) xenotransferencase is confirmed by sequence analysis (e.g., PCR sequencing). See SEQ ID NO: 63.
[0173] For example, similar constructs and steps can be carried out using horsepox virus to generate recombinant scHPXV containing a spike protein expression cassette adapted for mice using the vaccinia TK locus synVACV 105 (see SEQ ID NO: 64) and vaccinia virus; or to generate recombinant vaccinia virus containing a spike protein expression cassette adapted for mice using positions 83823-84344 (see SEQ ID NO: 2) (see SEQ ID NO: 65). (Example 15) Efficacy of recombinant poxvirus containing an expression cassette encoding the SARS-CoV-2 S protein in immunized African green monkeys antigen-administered with SARS-CoV-2.
[0174] On day 0, African green monkeys (AGMs) were percutaneously vaccinated using a bifurcated needle in the irregular cutting method as described in Example 12. Table 7 shows the levels of anti-SARS-CoV-2 neutralizing titer measured at 0, 7, 15, 21, 29, 41, and 47 days after single-dose vaccination in vaccinated AGMs. Antibodies with a neutralizing titer against SARS-CoV-2 (≥1:40 titer) were produced in AGMs vaccinated with TNX-1800b-2 and AGMs vaccinated with TNX1800a-1. Anti-SARS-CoV-2 neutralizing titer (≤1:10 titer) was not produced in control animals vaccinated with TNX-801 (scHPXV without an S protein expression cassette) and in the placebo group. 2.9 × 10 6 PFU and 1.06×10 6 Both TNX-801 and TNX-1800 in PFU doses were well-tolerated. [Table 7-1] [Table 7-2]
[0175] On day 41, the vaccinated AGM was anesthetized and approximately 2 x 10 6 TCID 50 Wild-type SARS-CoV-2 from animals was administered via 1. the intranasal route and 2. the intratracheal route (also called inoculation). The volume of the virus was divided equally between the two routes (1 × 10⁻¹⁰). 6A TCID50 / mL viral stock was used (1 mL per route). For the intranasal route, the AGM was anesthetized, and 500 μL was slowly pipetted into each nostril, followed by inhalation. For the intratracheal route, the AGM was anesthetized, and a tube was inserted into the trachea. After positioning the end of the tube approximately midway through the trachea, a syringe containing the virus-containing inoculum was attached to the tube, and the inoculum was slowly dripped into the trachea. The tube was then rinsed with an equal volume of PBS. After inoculation of the AGM, the animals were returned to their home cages and monitored until they recovered from anesthesia.
[0176] On days 41 and 47, oropharyngeal swab and tracheal lavage fluid samples were collected from the vaccinated AGMs. The samples were processed by RT-qPCR to determine the SARS-CoV-2 copy number. Table 8 shows the SARS-CoV-2 copy numbers from the oropharyngeal swab samples. Table 9 shows the SARS-CoV-2 copy numbers from the tracheal lavage fluid samples. On day 47, protective immunity against SARS-CoV-2 developed in AGMs vaccinated with TNX-1800b-2 and AGMs vaccinated with TNX-1800a-1. [Table 8-1] [Table 8-2] [Table 9-1] [Table 9-2] Exemplary embodiments: 1. A recombinant poxvirus comprising nucleic acid encoding a SARS-CoV-2 viral protein, wherein the SARS-CoV-2 protein is selected from the group consisting of a spike protein (S), a membrane protein (M), and a nucleocapsid protein (N), or a combination of two or more of the said proteins. 2. The recombinant poxvirus described in Embodiment 1, which is an orthopoxvirus. 3. The recombinant poxvirus according to Embodiment 2, wherein the orthopoxvirus is selected from the group consisting of camelpox (CMLV) virus, cowpox virus (CPXV), paradoxal paradoxal virus (ECTV), horsepox virus (HPXV), monkeypox virus (MPXV), vaccinia virus (VACV), smallpox virus (VARV), rabbitpox virus (RPXV), raccoonpox virus, skunkpox virus, gerbilpox virus, uassingishoo disease virus, and volepox virus. 4. The recombinant poxvirus according to Embodiment 2, wherein the orthopoxvirus is a horsepox virus. 5. The recombinant poxvirus according to Embodiment 4, wherein the horsepox virus is strain MNR-76. 6. The recombinant poxvirus according to Embodiment 2, wherein the orthopoxvirus is a vaccinia virus. 7. The aforementioned vaccinia virus is Western Reserve, Western Reserve Clone 3, Tian Tian, Tian Tian clone TP5, Tian Tian clone TP3, NYCBH, NYCBH clone Acambis 2000 (ACAM 2000), Wyeth, Copenhagen, Lister, Lister 107, Lister-LO, Lister GL-ONC1, Lister GL-ONC2, Lister GL-ONC3, Lister GL-ONC4, Lister CTC1, Lister IMG2 (Turbo FP635), IHD-W, LC16m18, Lederle, Tashkent clone TKT3, Tashkent clone TKT4, USSR, Evans, Praha, L-IVP, V-VET1 or LIVP 6.1.1, Ikeda, EM-63, Malbran, Duke, 3737, CV-1, Connaught Laboratories, Serro 2. CM-01, NYCBH Dryvax clone DPP13, NYCBH Recombinant poxvirus according to Embodiment 6, selected from the group of strains consisting of Dryvax clone DPP15, NYCBH Dryvax clone DPP20, NYCBH Dryvax clone DPP17, NYCBH Dryvax clone DPP21, VACV-IOC, Mulford 1902, vasocalanthinous vaccinia virus Ankara (CVA), modified vascinia Ankara (MVA), and MVA-BN. 8. The recombinant poxvirus according to any one of Embodiments 1 to 7, wherein the SARS-CoV-2 protein is the S protein. 9. The recombinant poxvirus according to any one of Embodiments 1 to 8, wherein the amino acid sequence of the SARS-CoV-2 virus protein is modified from that of the wild-type protein. 10. The recombinant poxvirus according to Embodiment 8, wherein the SARS-CoV-2 virus S protein is modified to infect mice. 11. The recombinant poxvirus according to Embodiment 8, wherein the amino acid sequence of the SARS-CoV-2 virus S protein comprises one or more substitutions selected from Y459H, D614G, S943P, K986P, and V987P relative to the wild-type S protein (SEQ ID NO: 47). 12. The recombinant poxvirus according to any one of Embodiments 1 to 11, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located in a region of the poxvirus that is not essential for the replication of the poxvirus. 13. The recombinant poxvirus according to Embodiment 12, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located at the thymidine kinase (TK) gene locus of the poxvirus. 14. The recombinant poxvirus according to Embodiment 12, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located at the B22R homologous gene locus of the poxvirus. 15. The recombinant poxvirus according to any one of Embodiments 1 to 14, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is operably linked to a promoter. 16. The recombinant poxvirus according to Embodiment 15, wherein the promoter is a poxvirus-specific promoter. 17. The recombinant poxvirus according to Embodiment 16, wherein the poxvirus-specific promoter is the vaccinia virus initial promoter. 18. The recombinant poxvirus according to Embodiment 16, wherein the poxvirus-specific promoter is a vaccinia virus late promoter. 19. The recombinant poxvirus according to Embodiment 16, wherein the poxvirus-specific promoter is the tandemvaccinia virus early and late promoters. 20. A recombinant poxvirus according to any one of Embodiments 1 to 19, which is a synthetic poxvirus. 21. TNX-2200(synVACVΔA2K105 SARS-CoV2-Spike-co ), TNX-2200 clone 1.1.1.1.1, TNX-2200 clone 2.1.1.1.1, TNX-1800 (scHPXVΔ200 SARS-COV2-Spike-co Recombinant poxvirus according to Embodiment 20, selected from the group consisting of TNX-1800a, TNX-1800a-1, TNX-1800b, and TNX-1800b-2. 22. The recombinant poxvirus according to Embodiment 21, which is TNX-1800b-2. 23. The recombinant virus described in Embodiment 21, which is TNX-1800a-1. 24. Recombinant poxvirus according to Embodiment 20, comprising any one of sequence numbers 63, 64, or 65. 25. A pharmaceutical composition comprising a recombinant poxvirus and a pharmaceutically acceptable carrier as described in any one of Embodiments 1 to 24. 26. The recombinant poxvirus is TNX-2200(synVACVΔA2K105 SARS-CoV2-Spike-co), TNX-2200 clone 1.1.1.1.1, TNX-2200 clone 2.1.1.1.1, TNX-1800 (scHPXVΔ200 SARS-COV2-Spike-co A pharmaceutical composition according to Embodiment 25, selected from the group consisting of TNX-1800a, TNX-1800a-1, TNX-1800b, and TNX-1800b-2. 27. The pharmaceutical composition according to Embodiment 25, wherein the recombinant poxvirus comprises any one of Sequence ID No. 63, 64, or 65. 28. The pharmaceutical composition according to Embodiment 26, wherein the recombinant poxvirus is TNX-1800b-2. 29. The pharmaceutical composition according to Embodiment 26, wherein the recombinant poxvirus is TNX-1800a-1. 30. Cells infected with the recombinant poxvirus described in any one of Embodiments 1 to 29. 31. A cell according to embodiment 30, which is a mammalian cell. 32. The cell according to Embodiment 31, wherein the mammalian cell is a Vero cell, a Vero E6 cell, or a BSC-40 cell. 33. The cell according to Embodiment 31, wherein the mammalian cell is a Vero adherent cell, a Vero suspension cell, a BHK-21 cell, an ACE2 knockout Vero cell, or an MRC-5 cell. 34. MRC-5 cells according to Embodiment 33, grown in the presence of 5% fetal bovine serum. 35. A cell according to embodiment 30, which is a bird cell. 36. The cell according to Embodiment 35, wherein the chicken cell is a chicken embryo fibroblast, a duck embryo-derived cell, an EB66® cell, an AGE1.CRpIX® cell, or a DF-1 cell. 37. The cells according to embodiment 30, which are adherent cells. 38. A cell according to embodiment 30, which is a suspension cell. 39. A method for selecting cells expressing the SARS-CoV-2 viral protein, comprising the steps of infecting the cells with a recombinant poxvirus described in any one of Embodiments 1 to 24, and selecting the infected cells expressing the SARS-CoV-2 viral protein. 40. The recombinant poxvirus mentioned above is TNX-2200(synVACVΔA2K105 SARS-CoV2-Spike-co ), TNX-2200 clone 1.1.1.1.1, TNX-2200 clone 2.1.1.1.1, TNX-1800 (scHPXVΔ200 SARS-COV2-Spike-co A method for selecting cells expressing the SARS-CoV-2 viral protein described in Embodiment 39, selected from the group consisting of TNX-1800a, TNX-1800a-1, TNX-1800b, and TNX-1800b-2. 41. A method for selecting cells expressing the SARS-CoV-2 viral protein according to Embodiment 39, wherein the recombinant poxvirus comprises any one of SEQ ID NOs. 63, 64, or 65. 42. A method for selecting cells expressing the SARS-CoV-2 viral protein according to Embodiment 40, wherein the recombinant poxvirus is TNX-1800b-2. 43. A method for selecting cells expressing the SARS-CoV-2 viral protein according to Embodiment 40, wherein the recombinant poxvirus is TNX-1800a-1. 44. A method for inducing an immune response to the SARS-CoV-2 virus in a subject, comprising the step of administering to the subject an immunologically effective amount of a recombinant poxvirus described in any one of Embodiments 1 to 24 or a pharmaceutical composition described in any one of Embodiments 25 to 29. 45. A method for inducing an immune response to the SARS-CoV-2 virus in a subject according to Embodiment 44, wherein the immunologically effective amount of recombinant poxvirus is administered by a random cutting method. 46. A method for inducing an immune response to the SARS-CoV-2 virus in a subject, according to Embodiment 44, wherein the immune response comprises an antibody capable of neutralizing the SARS-CoV-2 virus. 47. A method for inducing an immune response to the SARS-CoV-2 virus in a subject, according to Embodiment 44, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting the subject from the SARS-CoV-2 virus. 48. A method for inducing an immune response to the SARS-CoV-2 virus in a subject, according to Embodiment 44, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents the progression of the virus after SARS-CoV-2 infection in the subject. 49. A method for inducing an immune response to the SARS-CoV-2 virus in a subject, according to Embodiment 44, wherein the immune response is a T-cell immune response. 50. A method for inducing an immune response to the SARS-CoV-2 virus and poxvirus, comprising the step of administering to the subject an immunologically effective amount of a recombinant poxvirus described in any one of Embodiments 1 to 24 or a pharmaceutical composition described in any one of Embodiments 25 to 29. 51. A method for inducing an immune response to SARS-CoV-2 virus and poxvirus according to Embodiment 50, wherein the immunologically effective amount of recombinant poxvirus is administered by a random cutting method. 52. A method for inducing an immune response to the SARS-CoV-2 virus and poxvirus according to Embodiment 50, wherein the immune response comprises antibodies capable of neutralizing the SARS-CoV-2 virus and the poxvirus. 53. A method for inducing an immune response to the SARS-CoV-2 virus and poxvirus according to Embodiment 50, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting the subject from the SARS-CoV-2 virus and the poxvirus. 54. A method for inducing an immune response to SARS-CoV-2 virus and poxvirus according to Embodiment 50, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents the progression of SARS-CoV-2 virus infection and / or poxvirus infection in the subject. 55. A method for inducing an immune response to SARS-CoV-2 virus and poxvirus according to Embodiment 50, wherein the immune response is a T-cell immune response. 56. A method for inducing an immune response to SARS-CoV-2 virus and poxvirus according to any one of Embodiments 50 to 55, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus. 57. A method for inducing T-cell immunity against the SARS-CoV-2 virus, comprising the step of administering to a subject an immunologically effective amount of a recombinant poxvirus according to any one of Embodiments 1 to 24 or a pharmaceutical composition according to any one of Embodiments 25 to 29. 58. A method for inducing T-cell immunity against SARS-CoV-2 virus according to Embodiment 57, wherein the immunologically effective amount of recombinant poxvirus is administered by a random cutting method. 59. A method for inducing T-cell immunity against SARS-CoV-2 virus according to Embodiment 57, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting the subject from SARS-CoV-2 virus. 60. A method for inducing T-cell immunity against the SARS-CoV-2 virus according to Embodiment 57, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents the progression of the SARS-CoV-2 infection in the subject. 61. A method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus, comprising the step of administering to the subject an immunologically effective amount of a recombinant poxvirus according to any one of Embodiments 1 to 24 or a pharmaceutical composition according to any one of Embodiments 25 to 29. 62. A method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus according to Embodiment 61, wherein the immunologically effective amount of recombinant poxvirus is administered by a random cutting method. 63. A method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus according to Embodiment 61, wherein the immunologically effective amount of recombinant poxvirus is capable of protecting the subject from the SARS-CoV-2 virus and the poxvirus. 64. A method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus according to Embodiment 61, wherein the immunologically effective amount of recombinant poxvirus reduces or prevents the progression of SARS-CoV-2 infection and / or poxvirus infection in the subject. 65. A method for inducing T-cell immunity against SARS-CoV-2 virus and poxvirus according to any one of Embodiments 61 to 64, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus. 66. A method for generating a recombinant poxvirus according to any one of Embodiments 1 to 65, (a) A step of infecting host cells with a poxvirus; (b) Transfecting the infected cells from step (a) with nucleic acids encoding SARS-CoV-2 viral proteins to produce recombinant poxvirus; and (c) A step of selecting a recombinant poxvirus, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located in a region of the poxvirus that is not essential for the replication of the poxvirus when transfected. Methods that include... 67. The method according to any one of embodiments 39 to 66, wherein the SARS-CoV-2 protein is selected from the group consisting of the S spike protein, the M protein and the N protein, or two or more combinations of the proteins. 68. The method according to any one of embodiments 39 to 67, wherein the poxvirus is an orthopoxvirus. 69. The method according to Embodiment 68, wherein the orthopoxvirus is selected from the group consisting of camelpox (CMLV) virus, cowpox virus (CPXV), paradoxical limb disease virus (ECTV), horsepox virus (HPXV), monkeypox virus (MPXV), vaccinia virus (VACV), smallpox virus (VARV), rabbitpox virus (RPXV), raccoonpox virus, skunkpox virus, gerbilpox virus, uassingishoo disease virus, and volepox virus. 70. The method according to Embodiment 68, wherein the orthopox virus is the horsepox virus. 71. The method according to Embodiment 70, wherein the horsepox virus is strain MNR-76. 72. The method according to Embodiment 68, wherein the orthopox virus is a vaccinia virus. 73. The aforementioned vaccinia viruses include Western Reserve, Western Reserve Clone 3, Tian Tian, Tian Tian clone TP5, Tian Tian clone TP3, NYCBH, NYCBH clone Acambis 2000, Wyeth, Copenhagen, Lister, and Lister 107, Lister-LO, Lister GL-ONC1, Lister GL-ONC2, Lister GL-ONC3, Lister GL-ONC4, Lister CTC1, Lister IMG2 (Turbo FP635), IHD-W, LC16m18, Lederle, Tashkent clone TKT3, Tashkent clone TKT4, USSR, Evans, Praha, L-IVP, V-VET1 or LIVP 6.1.1, Ikeda, EM-63, Malbran, Duke, 3737, CV-1, Connaught Laboratories, Serro 2, CM-01, NYCBH Dryvax clone DPP13, NYCBH Dryvax clone DPP15, NYCBH Dryvax clone DPP20, NYCBH Dryvax clone DPP17, NYCBH The method according to Embodiment 72, selected from the group of strains consisting of Dryvax clone DPP21, VACV-IOC, vasocalanthinal vaccinia virus Ankara (CVA), modified vascinia Ankara (MVA), and MVA-BN. 74. The method according to any one of embodiments 39 to 73, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located in a region of the poxvirus that is not essential for the replication of the poxvirus. 75. The method according to Embodiment 74, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located at the thymidine kinase (TK) gene locus of the poxvirus. 76. The method according to Embodiment 74, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is located at the B22R homologous gene locus of the poxvirus. 77. The method according to any one of embodiments 39 to 76, wherein the nucleic acid encoding the SARS-CoV-2 viral protein is operably linked to a promoter. 78. The method according to Embodiment 77, wherein the promoter is a poxvirus-specific promoter. 79. The method according to Embodiment 78, wherein the poxvirus-specific promoter is the vaccinia virus initial promoter. 80. The method according to Embodiment 78, wherein the poxvirus-specific promoter is a vaccinia virus late promoter. 81. The method according to Embodiment 78, wherein the poxvirus-specific promoter is the tandemvaccinia virus early and late promoters. 82. The method according to any one of embodiments 39 to 81, wherein the poxvirus is a synthetic poxvirus. 83. A method for reducing or preventing the progression of SARS-CoV-2 virus infection in a subject where such reduction is needed or at risk, comprising the step of administering to the subject an immunologically effective amount of a recombinant poxvirus described in any one of Embodiments 1 to 24 or a pharmaceutical composition described in any one of Embodiments 25 to 29. 84. A method for reducing or preventing the progression of SARS-CoV-2 virus and poxvirus infection in subjects where such reduction is needed or at risk, comprising the step of administering to the subjects an immunologically effective amount of a recombinant poxvirus described in any one of Embodiments 1 to 24 or a pharmaceutical composition described in any one of Embodiments 25 to 29. 85. A method for reducing or preventing the progression of SARS-CoV-2 virus and poxvirus, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus or monkeypox virus. 86. A vaccine against the SARS-CoV-2 virus comprising a recombinant virus as described in Embodiments 1 to 24 or a pharmaceutical composition as described in Embodiments 25 to 29. 87. A bivalent vaccine against SARS-CoV-2 virus and poxvirus, comprising the recombinant virus described in Embodiments 1 to 24 or the pharmaceutical composition described in Embodiments 25 to 29. 88. A bivalent vaccine against SARS-CoV-2 virus and poxvirus, wherein the poxvirus is vaccinia virus, smallpox virus, horsepox virus, or monkeypox virus.
Claims
[Claim 1] The invention described herein.