Treatment using gene therapy

AAV vectors encoding AP-4 complex proteins address the lack of treatment for AP-4-HSP by restoring protein function in neurons, effectively treating the symptoms of this hereditary disorder.

JP2026086417APending Publication Date: 2026-05-26UNIV OF SHEFFIELD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026003420
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-03-26
Filing Date
2026-01-13
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

There is no disease-modifying treatment for AP-4-related hereditary spastic paraplegia (AP-4-HSP), a rare and progressive disorder characterized by spasticity, intellectual disability, and other severe symptoms, with a significant decrease in AP4B1 protein levels, affecting approximately 199 children worldwide.

Method used

Development of expression vectors, particularly adeno-associated virus (AAV) vectors, containing nucleic acid molecules encoding the AP-4 complex proteins, specifically adapted for expression in mammalian neurons, to functionally replace dysfunctional AP-4 proteins and treat AP-4-HSP symptoms.

Benefits of technology

The AAV vectors effectively restore AP-4 protein function, potentially halting the progression of AP-4-HSP symptoms by promoting correct protein sorting and autophagosome formation, offering a therapeutic approach for this currently untreatable condition.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026086417000016
    Figure 2026086417000016
  • Figure 2026086417000017
    Figure 2026086417000017
  • Figure 2026086417000018
    Figure 2026086417000018
Patent Text Reader

Abstract

This provides a novel treatment to improve patient outcomes for patients suffering from AP-4-HSP. [Solution] This disclosure relates to a transcription cassette comprising a nucleic acid molecule comprising a nucleotide sequence encoding an AP-4 subunit, a vector comprising the transcription cassette, a pharmaceutical composition comprising the vector, and a vector or composition for use in the treatment of AP-4-hereditary spastic paraplegia.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This disclosure relates to a transcription cassette comprising a nucleic acid molecule containing a nucleotide sequence encoding at least one subunit of heterotetramer adapter protein complex 4 (AP-4), a vector comprising the transcription cassette, a pharmaceutical composition comprising the vector, and a vector or composition for use in the treatment of AP-4 hereditary spastic paraplegia. [Background technology]

[0002] Hereditary spastic paraplegia (HSP) is a rare, hereditary, progressive lower limb spastic disorder with an overall prevalence of 0.5 to 5.5 cases per 100,000 people. In young patients, HSP is often characterized by leg weakness and spasticity (rigidity), which can lead to further complications later in life and may require assistance with a cane, walker, or wheelchair. There are various genotypes of HSP, including autosomal dominant, autosomal recessive, X-linked, and maternal (mitochondrial) types, with the most common autosomal dominant type affecting 75-80% of HSP patients. Various diagnostic methods for identifying gene mutations involved in different forms of HSP, such as autosomal recessive HSP (AR-HSP) caused by mutations in the KIAA1840 (US10519503) or ZFYVE26 (US2017152562), or autosomal dominant HSP caused by mutations in SPG3A, are disclosed in CN1958605.

[0003] AP-4-related hereditary spastic paraplegia (AP-4-HSP), sometimes known as AP-4 deficiency syndrome or adapter protein complex 4 (AP-4) deficiency, is caused by a loss-of-function mutation in any one of the four genes encoding the protein subunits of the AP-4 adapter complex

[10] . AP-4-HSP is inherently autosomal recessive. AP-4-HSP caused by mutations in the AP4B1 gene is sometimes called spastic paraplegia type 47 (SPG47) or hereditary spastic paraplegia type 47 (HSP47) and results in a significant decrease in AP4B1 protein levels [2]. AP-4-HSP can also be caused by mutations in three other AP-4 subunits. AP4M1 mutations cause AP-4-HSP, sometimes called SPG50 or HSP50; AP4E1 mutations cause AP-4-HSP, sometimes called SPG51 or HSP51; and AP4S1 mutations cause AP-4-HSP, sometimes called SPG52 or HSP51. The characteristics of AP-4-HSP are very similar regardless of the gene that gives rise to the causative mutation. AP-4-HSP typically develops in early childhood and presents with spasticity, moderate to severe intellectual disability, speech impairment or absence of speech, cerebellar myelopathy, seizures, shy personality, and, in severe cases, quadriplegia

[11] . AP-4-HSP has been characterized in 199 children worldwide to date [1], but the incidence is most likely underreported. AP-4-HSP is progressive and there is no disease-modifying treatment. Therefore, there is a need to develop new therapies to improve patient outcomes for patients with AP-4-HSP.

[0004] AP4B1 is one component of the AP-4 heterotetramer (Figure 1A). The complete AP-4 complex consists of two large adaptins (epsilon-type subunit AP4E1 and beta-type subunit AP4B1), a medium adaptin (mu-type subunit AP4M1), and a small adaptin (sigma-type AP4S1). The AP-4 complex forms a non-clathrin-associated coat on vesicles that deviate from the trans-Golgi network (TGN) and may be involved in the targeting of proteins from the trans-Golgi network to the endosomal-lysosomal system (Figure 1B). It is also involved in protein sorting to the basolateral membrane within epithelial cells and proper asymmetric localization of proteins within neurons. AP-4-positive TGN-derived vesicles are essential for the correct spatial formation of autophagosomes; therefore, loss of the AP-4 complex may impede autophagosome formation in distal axons. Thus, the AP-4 complex is key to normal brain function.

[0005] Adeno-associated virus (AAV) vectors are publicly known in the art and offer various advantages over retroviral or lentiviral vectors, including a milder immune response, the ability to infect a wide range of cells, and storage outside the chromosome within cells, although the desired DNA is not integrated into the genome, resulting in potential disruption and knockout of other genes. AAV contains a single-stranded DNA genome of approximately 4.8 kilobases (kb) containing three genes with coding sequences that have inverted repeats on both sides, which are necessary for genome replication and packaging. The use of AAV and modified AAV vectors is publicly known in the art and is disclosed in WO2019 / 032898, WO2020041498, or WO2019 / 028306. AAV vectors have completed various Phase I and Phase II clinical trials for gene delivery in approved therapies for the treatment of cystic fibrosis and congestive heart failure, as well as spinal muscular atrophy.

[0006] We disclose expression vectors containing AP-4 nucleic acid molecules operably linked to an expression regulatory sequence adapted for expression in mammalian neurons, such as motor neurons, and the use of modified expression vectors for delivery in the prevention or treatment of HSP-related symptoms and for functionally replacing dysfunctional AP-4 proteins. This disclosure relates to the development of modified vectors, such as AAV vectors, containing nucleic acid molecules encoding the AP-4 complex protein. [Overview of the Initiative]

[0007] According to aspects of the present invention, an isolated nucleic acid molecule is provided, comprising an isolated nucleic acid molecule comprising a transcription cassette containing a promoter adapted for expression in mammalian neurons, wherein the cassette further comprises a nucleic acid molecule comprising a nucleotide sequence encoding at least one protein of the AP-4 complex.

[0008] In a preferred embodiment of the present invention, the expression cassette comprises a nucleic acid molecule containing a nucleotide sequence, the nucleotide sequence being: i) A nucleotide sequence or polymorphic sequence variant described in Sequence ID No. 1 (AP4B1), ii) A nucleotide sequence in which the sequence is degenerate as a result of the gene coding for the nucleotide sequence defined in (i), iii) A nucleic acid molecule whose complementary strand hybridizes to the sequence of Sequence ID No. 1 (AP4B1) under stringent hybridization conditions, and the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide containing the AP-4 complex, iv) A nucleotide sequence encoding a polypeptide containing the amino acid sequence represented by Sequence ID No. 2 (AP4B1), v) A nucleotide sequence encoding a polypeptide containing an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue represented in iv), and the polypeptide forms a complex with a polypeptide containing the AP-4 complex.

[0009] Nucleic acid molecule hybridization occurs when two complementary nucleic acid molecules undergo a certain amount of mutual hydrogen bonding. The stringency of hybridization can vary depending on the environmental conditions surrounding the nucleic acid, the nature of the hybridization method, and the composition and length of the nucleic acid molecules used. Calculations regarding the hybridization conditions required to achieve a specific degree of stringency are discussed in Sambrook et al., *Molecular Cloning: A Laboratory Manual* (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001), and Tijssen, *Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes Part I, Chapter 2* (Elsevier, New York, 1993). m This is the temperature at which 50% of a given strand of nucleic acid molecule hybridizes with its complementary strand. The following is an illustrative, but not limited, set of hybridization conditions.

[0010] Very high stringency (allowing sequences that share at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to hybridize) Hybridization: 5x SSC, 16 hours at 65°C Two washes: 2 x SSC, 15 minutes each at room temperature (RT). Two washes: 0.5x SSC, 20 minutes each at 65°C.

[0011] High stringency (allowing sequences sharing at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89% identity to hybridize) Hybridization: 5x - 6x SSC, 65°C - 70°C for 16 - 20 hours Two washes: 2x SSC, 5 - 20 minutes each at RT Two washes: 1x SSC, 30 minutes each at 55°C - 70°C

[0012] Low stringency (allowing sequences sharing at least 50%, 55%, 60%, 65%, 70%, or 75% identity to hybridize) Hybridization: 6x SSC, RT - 55°C for 16 - 20 hours At least two washes: 2x - 3x SSC, 20 - 30 minutes each at RT - 55°C

[0013] In a preferred embodiment of the present invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence, the nucleotide sequence being i) the nucleotide sequence set forth in SEQ ID NO: 3 (AP4E1), or a polymorphic sequence variant, and ii) a nucleotide sequence that is degenerate as a result of the genetic code with respect to the nucleotide sequence defined in (i), and iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 3 (AP4E1) under stringent hybridization conditions and which encodes a polypeptide that forms a complex with a polypeptide comprising an AP - 4 complex, and iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 4 (AP4E1), and v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by addition, deletion, or substitution of at least one amino acid residue represented in iv), and the polypeptide forms a complex with a polypeptide comprising an AP-4 complex, selected from the group consisting of: a nucleotide sequence.

[0014] In a preferred embodiment of the present invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence, and the nucleotide sequence is i) the nucleotide sequence set forth in SEQ ID NO: 5 (AP4M1), or a polymorphic sequence variant; and ii) a nucleotide sequence that is degenerate as a result of the genetic code with respect to the nucleotide sequence defined in (i); and iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 5 (AP4M1) under stringent hybridization conditions, and the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide comprising an AP-4 complex; and iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 (AP4M1); and v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by addition, deletion, or substitution of at least one amino acid residue represented in iv), and the polypeptide forms a complex with a polypeptide comprising an AP-4 complex, selected from the group consisting of: a nucleotide sequence.

[0015] In a preferred embodiment of the present invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence, and the nucleotide sequence is i) the nucleotide sequence set forth in SEQ ID NO: 7 (AP4S1), or a polymorphic sequence variant; and ii) a nucleotide sequence that is degenerate as a result of the genetic code with respect to the nucleotide sequence defined in (i); and iii) A nucleic acid molecule whose complementary strand hybridizes to the sequence of Sequence ID No. 7 (AP4S1) under stringent hybridization conditions, and the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide containing the AP-4 complex, iv) A nucleotide sequence encoding a polypeptide containing the amino acid sequence represented by Sequence ID No. 8 (AP4S1), A nucleotide sequence is selected from the group consisting of a nucleotide sequence that encodes a polypeptide containing an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue represented in iv), and the polypeptide forms a complex with a polypeptide containing the AP-4 complex.

[0016] In a preferred embodiment of the present invention, the cassette is adapted for expression in motor neurons.

[0017] In a preferred embodiment of the present invention, the nucleic acid molecule comprises or consists of the nucleotide sequence represented by SEQ ID NO: 1 or a polymorphic sequence variant thereof.

[0018] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence represented in SEQ ID NO: 2.

[0019] In a preferred embodiment of the present invention, the nucleic acid molecule comprises or consists of the nucleotide sequence represented by SEQ ID NO: 3 or a polymorphic sequence variant thereof.

[0020] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 4.

[0021] In a preferred embodiment of the present invention, the nucleic acid molecule comprises or consists of the nucleotide sequence represented by Sequence ID No. 5 or a polymorphic sequence variant thereof.

[0022] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence represented in SEQ ID NO: 6.

[0023] In a preferred embodiment of the present invention, the nucleic acid molecule comprises or consists of the nucleotide sequence represented by SEQ ID NO: 7 or a polymorphic sequence variant thereof.

[0024] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 8.

[0025] Polypeptides disclosed herein may have different amino acid sequences due to one or more substitutions, additions, deletions, or cleavages that may exist in any combination. Preferred variants include those that differ from the reference polypeptide due to conservative amino acid substitutions. Such substitutions involve replacing a given amino acid with another amino acid having similar characteristics. The following non-exclusive list of amino acids is considered a conservative substitution (similar): a) alanine, serine, and threonine; b) glutamic acid and aspartic acid; c) asparagine and glutamine; d) arginine and lysine; e) isoleucine, leucine, methionine, and valine; and f) phenylalanine, tyrosine, and tryptophan. Most preferred are variants that retain or enhance the same biological function and activity as the original reference polypeptide being altered. In one embodiment, the polypeptide has at least 70% identity with the full-length amino acid sequence or nucleotide sequence illustrated herein, more preferably at least 75% identity, and even more preferably at least 80%, 85%, 90%, 95% identity, and at least 99% identity.

[0026] In a preferred embodiment of the present invention, the promoter is a constitutive promoter.

[0027] In alternative embodiments of the present invention, the promoter is a regulated promoter, such as an inducible or cell-specific promoter.

[0028] In preferred embodiments of the present invention, the promoter is selected from the group comprising a chicken beta-actin (CBA) promoter, a chicken beta-actin hybrid promoter (CBh), a CAG promoter, neuron and glial-specific promoters including synapsin 1, Hb9, MeP229, and GFAP promoter sequences, and AP-4 subunit-specific promoter regions including AP4B1, AP4E1, AP4M1, and AP4S1.

[0029] In a preferred embodiment of the present invention, the promoter sequence comprises a nucleic acid, which includes the nucleotide sequence described in SEQ ID NO: 27, or a nucleotide sequence that is a polymorphic variant of SEQ ID NO: 27.

[0030] In an alternative embodiment of the present invention, the promoter sequence comprises a nucleic acid, which includes the nucleotide sequence described in SEQ ID NO: 30, or a nucleotide sequence that is a polymorphic variant of SEQ ID NO: 30.

[0031] According to a further aspect of the present invention, A transcription cassette is provided, comprising a first nucleic acid molecule containing the nucleotide sequence described in Sequence ID No. 27, or a nucleotide sequence that is a polymorphic sequence variant of Sequence ID No. 27, wherein the nucleic acid molecule is operably linked to a second nucleic acid molecule that is a transcription promoter and contains a nucleotide sequence encoding a polypeptide, and the first nucleic acid molecule regulates the transcription of the second nucleic acid molecule.

[0032] In a preferred embodiment of the present invention, the first nucleic acid molecule, including the promoter, comprises or consists of the nucleotide sequence described in Sequence ID No. 27.

[0033] In an alternative embodiment of the present invention, the first nucleic acid molecule comprises a nucleotide sequence described in SEQ ID NO: 30, or a nucleotide sequence that is a polymorphic variant of SEQ ID NO: 30.

[0034] In a preferred embodiment of the present invention, the second nucleic acid molecule comprises a nucleotide sequence encoding at least one polypeptide of the AP-4 complex.

[0035] In a preferred embodiment of the present invention, the second nucleic acid molecule includes or consists of the nucleotide sequence represented in SEQ ID NO: 1 or a polymorphic sequence variant thereof.

[0036] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence represented in SEQ ID NO: 2.

[0037] In a preferred embodiment of the present invention, the nucleic acid molecule comprises or consists of the nucleotide sequence represented by SEQ ID NO: 3 or a polymorphic sequence variant thereof.

[0038] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 4.

[0039] In a preferred embodiment of the present invention, the nucleic acid molecule comprises or consists of the nucleotide sequence represented by Sequence ID No. 5 or a polymorphic sequence variant thereof.

[0040] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence represented in SEQ ID NO: 6.

[0041] In a preferred embodiment of the present invention, the nucleic acid molecule comprises or consists of the nucleotide sequence represented by SEQ ID NO: 7 or a polymorphic sequence variant thereof.

[0042] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 8.

[0043] A “promoter” or “transcription promoter” is recognized in the art and, for clarity, is provided only as an example and not as an limitation, and includes the following characteristics: The enhancer element is a cis-acting nucleic acid sequence often found at 5' relative to the transcription start site of a gene (the enhancer may also be found at 3' relative to the gene sequence or even located within an intron sequence). The enhancer functions to increase the transcription rate of the gene to which the enhancer is ligated. Enhancer activity responds to trans-acting transcription factors (polypeptides) that have been shown to bind specifically to the enhancer element. The binding / activity of transcription factors (see Eukaryotic Transcription Factors, by David S Latchman, Academic Press Ltd, San Diego) responds to several physiological / environmental cues, is constitutive or regulated, and may also be cell / tissue specific. Promoter elements also include so-called TATA boxes and RNA polymerase initiation selection (RIS) sequences that function to select transcription start sites. These sequences also bind to polypeptides that function to facilitate transcription initiation selection by RNA polymerase, in particular.

[0044] As used herein, a first nucleic acid comprising a promoter sequence and a second nucleotide sequence encoding a polypeptide are said to be "operably ligated" when they are covalently bonded in such a way that they arrange for the expression or transcription of the second nucleic acid molecule under the control of the first nucleic acid molecule comprising a regulatory sequence. If it is desired that the coding sequence be translated into a functional protein, the two DNA sequences are said to be operablely ligated if the induction of a promoter in the 5' regulatory sequence results in the transcription of the coding sequence and the production of mRNA. Thus, a promoter region will be operablely ligated to a coding sequence if the promoter region is capable of causing the transcription of its DNA sequence so that the resulting transcript is translated into the desired protein or polypeptide.

[0045] A further aspect of the present invention provides an expression vector comprising a transcription cassette according to the present invention.

[0046] Viruses are commonly used as vectors for the delivery of exogenous genes. Commonly employed vectors include recombinant modified enveloped or non-enveloped DNA and RNA viruses, such as Baculobilidiae, Parvoviridiae, Picornobilidiae, Herpesviridiae, Poxviridae, Adenoviridiae, Picornobilidiae, or Retroviridae, such as lentiviruses. Chimeric vectors that utilize the advantageous elements of each parent vector's properties may also be employed (see, e.g., Feng, et al (1997) Nature Biotechnology 15:866-870). Such viral vectors may be wild-type or may be modified by recombinant DNA technology to have replication defects, conditional replication, or replication ability. Conditional replication viral vectors are used to achieve selective expression in specific cell types while avoiding harmful broad-spectrum infection. Examples of conditional replication vectors are described in Pennsylvania, E. (1996) Science 274:342-343; Russell, and SJ (1994) Eur.J.of Cancer 30A(8):1165-1171.

[0047] Preferred vectors are derived from adenoviruses, adeno-associated viruses, or retroviral genomes.

[0048] In a preferred embodiment of the present invention, the expression vector is a virus-based expression vector.

[0049] In a preferred embodiment of the present invention, the virus-based vector is an adeno-associated virus [AAV].

[0050] In a preferred embodiment, the virus-based vector is selected from the group consisting of: AAV2, AAV3, AAV6, AAV13, AAV1, AAV4, AAV5, AAV6, AAV9, and rhAAV10.

[0051] In a preferred embodiment of the present invention, the virus-based vector is AAV9.

[0052] In a preferred embodiment of the present invention, the AAV vector is based on a single-stranded AAV virus.

[0053] In an alternative embodiment of the present invention, the AAV vector is based on a self-complementary AAV virus.

[0054] Naturally occurring AAV serotypes typically contain a single-stranded genome that replicates during natural infection to form a double-stranded AAV viral genome. This is a rate-limiting step in AAV replication and expression. Recombinant forms of AAV, also known as self-complementary AAV, contain both sense and antisense genome strands adapted for immediate expression and replication.

[0055] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence described in SEQ ID NO: 19 (AP4B1).

[0056] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence described in SEQ ID NO: 20 (AP4B1).

[0057] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence described in SEQ ID NO: 21 (AP4S1).

[0058] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence described in Sequence ID No. 22 (AP4S1).

[0059] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence described in SEQ ID NO: 23 (AP4E1).

[0060] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence described in SEQ ID NO: 24 (AP4E1).

[0061] In a preferred embodiment of the present invention, the virus-based vector further comprises SEQ ID NO: 25 or 26.

[0062] In an alternative preferred embodiment of the present invention, the virus-based vector is a lentiviral vector.

[0063] A further aspect of the present invention provides a pharmaceutical composition comprising an expression vector according to the present invention and an excipient or carrier.

[0064] The expression vector composition of the present invention is administered in a pharmaceutically acceptable preparation. Such preparation may routinely contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, and auxiliary therapeutic agents. The expression vector composition of the present invention can be administered by any conventional route, including injection, or by a stepwise infusion over time.

[0065] The expression vector compositions of the present invention are administered in an effective dose. “Effective dose” is the amount of expression vector, either alone or in combination with additional doses, that produces the desired response. When treating a disease, the desired response is to inhibit the progression of the disease. This includes merely temporarily slowing the progression of the disease, but more preferably permanently halting its progression. This can be monitored by routine means. Such a dose naturally depends on individual patient parameters, including the specific condition being treated, the severity of the condition, age, physical condition, size and weight, duration of treatment, the nature of combination therapy (if any), and the specific route of administration, as well as similar factors within the knowledge and expertise of the healthcare professional. These factors are well known to those skilled in the art and can be addressed solely through routine experimentation. It is generally preferable to use the maximum dose of the individual components or their combinations, i.e., the maximum safe dose based on sound medical judgment. However, those skilled in the art will understand that a patient may claim a lower dose or tolerable dose for medical, psychological, or virtually any other reason.

[0066] The expression vector composition used in the method described above preferably contains a sterile, effective amount of the expression vector according to the present invention to produce a desired response in units of weight or volume suitable for administration to a patient. The dose of the vector administered to the subject can be selected according to different parameters, in particular, according to the mode of administration used and the condition of the subject. Other factors include the desired duration of treatment. If the response in the subject is insufficient with the initial dose applied, a higher dose (or an effectively higher dose via a different, more localized delivery route) may be employed to the extent that the patient's tolerance allows. Other protocols for the administration of vector compositions, in which the dosage, injection schedule, injection site, mode of administration, and equivalents differ from those described above, will be known to those skilled in the art. (e.g., for experimental or veterinary therapeutic purposes) are carried out under substantially the same conditions as those described above. The subjects as used herein are mammals, preferably humans, and include non-human primates, cattle, horses, pigs, sheep, goats, dogs, cats, or rodents.

[0067] When administered, the expression vector composition of the present invention is applied in a pharmaceutically acceptable amount and in a pharmaceutically acceptable composition. The term "pharmaceutically acceptable" means a non-toxic substance that does not interfere with the efficacy of the biological activity of the active agent. Such preparations may routinely contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents (e.g., those typically used in the treatment of specific disease indications). When used in pharmaceuticals, salts should be pharmaceutically acceptable, but pharmaceutically unacceptable salts may be used for convenience to prepare such pharmaceutically acceptable salts and are not excluded from the scope of the present invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, and equivalents. Furthermore, pharmaceutically acceptable salts may be prepared as alkali metal salts or alkaline earth salts such as sodium salts, potassium salts, or calcium salts.

[0068] The pharmaceutical composition containing the expression vector according to the present invention comprises acetic acid in the salt, citric acid in the salt, boric acid in the salt, and phosphoric acid in the salt. It may also contain a suitable buffering agent. The pharmaceutical composition may also optionally contain a suitable preservative such as benzalkonium chloride, chlorobutanol, parabens, and thimerosal.

[0069] Expression vector compositions may be conveniently presented in unit dosage forms and may be prepared by any method well known in the art of pharmaceuticals. All methods include the step of associating an active agent with a vector comprising one or more minor components. Preparations may be formulated according to known methods using suitable dispersants or wetting agents and suspension agents. Sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic, parenterally admissible diluents or solvents, for example, as a solution in 1,3-butanediol. Possible solvents that may be employed include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixative oils are conventionally employed as solvents or suspension media. For this purpose, any non-irritating fixative oil, including synthetic monoglycerides or diglycerides, may be employed. In addition, fatty acids such as oleic acid may be used in the preparation of injectable preparations. Carrier formulations suitable for oral, subcutaneous, intravenous, and intramuscular administration can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

[0070] According to a further aspect of the present invention, an expression vector according to the present invention is provided for use as a pharmaceutical product.

[0071] A further aspect of the present invention provides an expression vector for use in the treatment of AP-4 hereditary spastic paraplegia.

[0072] In a preferred embodiment of the present invention, the AP-4-HSP is SPG47.

[0073] In a preferred embodiment of the present invention, the AP-4-HSP is SPG50.

[0074] In a preferred embodiment of the present invention, the AP-4-HSP is SPG51.

[0075] In a preferred embodiment of the present invention, the AP-4-HSP is SPG52.

[0076] Spastic paraplegia (SPG) is used synonymously with hereditary spastic paraplegia (HSP). Therefore, SPG47 is HSP47, SPG50 is HSP50, SPG51 is HSP51, and SPG52 is HSP52.

[0077] A further aspect of the present invention provides cells transfected with an expression vector according to the present invention.

[0078] In a preferred embodiment of the present invention, the cell is a neuron.

[0079] In a preferred embodiment of the present invention, the neuron is a motor neuron.

[0080] A further aspect of the present invention provides a method for treating or preventing AP-4 hereditary spastic paraplegia, comprising administering a therapeutically effective amount of the expression vector according to the present invention to prevent and / or treat hereditary spastic paraplegia.

[0081] In the preferred method of the present invention, AP-4-HSP is spastic paraplegia type 47 (SPG47).

[0082] In the preferred method of the present invention, AP-4 HSP is spastic paraplegia type 50 (SPG50).

[0083] In the preferred method of the present invention, AP-4 HSP is spastic paraplegia type 51 (SPG51).

[0084] In the preferred method of the present invention, AP-4 HSP is spastic paraplegia type 52 (SPG52).

[0085] A further aspect of the present invention relates to a diagnostic method for determining the genotype of a subject and determining whether the subject has mutations in one or more AP-4 gene sequences, i) A step of obtaining a biological sample from the subject to be tested and extracting nucleic acids from the biological sample, ii) A step of sequencing the nucleic acid to obtain the nucleotide sequence of AP4B1, AP4E1, AP4M1, or AP4S1 in the subject, iii) A step of identifying differences in nucleotide sequences by comparing the obtained genome sequence with a normal, matched control nucleotide sequence, A diagnostic method is provided, which includes the step of determining whether a test sample is modified in the AP-4 gene sequence and whether such modification is associated with hereditary spastic paraplegia.

[0086] A preferred method of the present invention further comprises administering at least one expression vector according to the present invention for the prevention or treatment of a certain type of AP-4 hereditary spastic paraplegia.

[0087] In a preferred embodiment of the present invention, the AP-4-HSP is selected from the group consisting of SPG47, SPG50, SPG51, and SPG52. In a preferred method of the present invention, the genome sequence includes SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7, or a polymorphic sequence variant thereof.

[0088] Throughout this specification and the claims, the words “comprise” and “contain,” and their variations, such as “comprising” and “comprises,” mean “including, but not limited to,” and are not intended to exclude (and do not exclude) other parts, additives, ingredients, integers, or steps. “Essentially consisting of” means including integers that have essential integers but do not substantially affect the function of the essential integers.

[0089] Throughout this specification and the claims, singular nouns encompass plural nouns unless the context requires otherwise. In particular, where indefinite articles are used, the specification should be understood to intend both singular and plural nouns unless the context requires otherwise.

[0090] Features, integers, properties, compounds, chemical parts, or groups described in conjunction with specific aspects, embodiments, or examples of the present invention should be understood to be applicable to any other aspects, embodiments, or examples described herein, insofar as they are not incompatible therewith. [Brief explanation of the drawing]

[0091] Here, embodiments of the present invention will be described as an example only with reference to the following figures.

[0092] [Figure 1] AP4 complex and function: (A) Diagram of the AP4 heterotetramer complex, consisting of large beta and epsilon-type adaptins (referred to as AP4B1 and AP4E1, β4 and ε4), medium-sized mu-type adaptin (referred to as AP4M1, APμ4), and small sigma-adaptin (referred to as AP4S1, APσ4). (B) Diagram of AP4 complex function. 1) The AP4 heterotetramer is recruited to the trans-Golgi network (TGN), thereby recruiting their cargo proteins, including ATG9. 2) Craterin-negative vesicles are generated from the TGN. 3) The AP4 complex is detached from the vesicles and recycled back to the TGN for further vesicle formation. 4) The remaining vesicles are bound by kinesin motor proteins and transported anterogradely along microtubules to the pericellular or distal nervous compartment. 5) ATG9 vesicles assemble to promote autophagosome formation. [Figure 2]Design and validation of gene therapy vectors for AP4B1 gene replacement. (A) Schematic diagrams of the designed and already introduced AAV and LV. (B) Representative Western blots of control (WT) or AP4B1-knockout (KO) HeLa cell lysates after transfection with plasmids expressing GFP (+GFP) or hAP4B1 (+AAV-hAP4B1). hAP4B1 expression in KO cell lines restores the deficiency of AP4B1 protein expression. Restoration of AP4B1 expression also restores AP4E1 subunit protein expression to WT levels. (C) Validation of AAV-expressed V5-tagged AP4B1 in AP4B1- / - HeLa cells. (D) Non-transgenic rat cortical neurons stained with primary antibodies for cortical neuron markers MAP2 (red channel) and V5 (green channel) 10 days after treatment with either 300,000 vg / cell AAV9-V5_hAP4B1. (E) Representative Western blots of both untreated (UT) SPG47 patient fibroblasts and SPG47 patient fibroblasts treated with increased amounts of LV-V5_hAP4B1, showing the restoration of hAP4B1 expression in patient mutant cells (to the left of the dashed line). Representative Western blots of non-transgenic rat cortical neurons treated with 400,000 vg / cell AAV9 viral vector: AAV9-V5_SPG47(hAP4B1), AAV9-SPG47(hAP4B1), AAV9-GFP, and non-transduced cells. [Figure 3]Use of ATG9A as a readout to evaluate the efficacy of AB4B1 gene substitution. (A) Figure of erroneous localization of ATG9A to the TGN trans-Golgi network (TGN) in a CRISPR-generating Hela knockout cell model. Erroneous localization of ATG9A in AP4B1- / -Hela cells is restored after transfection with the AAV9 construct encoding AP4B1 (B). Representative Western blots of LV transduction patient cells show restoration of hAP4B1 expression and detection of the V5 tag (C), quantified in (D). Transduction patient cells also show restoration of ATG9A expression (E), quantified in (F). Data are presented as mean ± mean standard error (SEM), n=3. Data were analyzed by one-way ANOVA, followed by Dunnett's post-hoc multiple comparison test with controls. Stars indicate p≦0.05(*), p<0.0001(****), ns=not significant. (G) Lentiviral vector (LV)-mediated correction of mislocalization of ATG9A in primary fibroblasts from SPG47 patients. SPG47 patient cells marked with white asterisks show recovery of mislocalized ATG9A after treatment with LV-V5_hAP4B1. [Figure 4](A) Quantification of mouse Ap4b1 (pink) and human AP4B1 (green) mRNA in brain tissue by RT-qPCR 4 weeks after injection of AAV9_CBh_hAP4B1 via the cisterna magna (UT-untreated, n=3, AAV_CBh_hAP4B1, n=5). (B) Quantification of viral genome copy number by qPCR in various CNS and peripheral tissues 4 weeks after injection of 2 × 10¹⁰vg of AAV9_CBh_hAP4B1 viral vector via the cisterna magna (UT-untreated, n=3, AAV_CBh_hAP4B1, n=5). (C) Pilot safety in vivo study in wild-type mice. Body weight and rotarod measurements of wild-type mice 4 weeks after injection of 2 × 10¹⁰vg of AAV_CBh_hAP4B1 or AAV_CBh_GFP viral vector via the cisterna magna. The number N for each group is shown in parentheses. (D and E) Pilot safety in vivo study in wild-type mice. Body weight and rotarod measurements in wild-type mice 6 months after injection of 2 × 10¹⁰vg of AAV_CBh_hAP4B1 or AAV_CBh_GFP viral vector via cisterna magna. N=8(UT), 10(hAP4B1 / GFP). [Figure 5]Characterization of Ap4b1- / - mouse models. Histograms showing rotarod (A) evaluations of wild-type (WT) and Ap4b1-knockout (Ap4b1- / -) mice are displayed as latencies to fall in seconds at various points. Data are presented as mean ± mean standard error (SEM), with n=16 per group except for Ap4b1(- / -) at 242 days, where n=15. Data are analyzed by Student's t-test for WT. Stars indicate p≦0.05(*) and p<0.01(**). (B) Open field behavior evaluation of Ap4b1-knockout (Ap4b1- / -) mice compared to wild-type (WT) mice at 6, 9, and 12 months of age. Data are presented as mean ± mean standard error (SEM), where n is variable for all groups and time points as the experiment progresses. The data were analyzed by one-way ANOVA, comparing each group to the others, followed by Tukey's post-hoc multiple comparison test. A star indicates p ≤ 0.05 (*). (C) Forefoot support base measured by CatWalk assessment at 3 and 6 months of age. Data analyzed by two-way ANOVA with Sidak's post-hoc multiple comparison test. A star indicates p < 0.01 (**) and p < 0.001 (***). (D) Gait analysis [Figure 6] (A) Image demonstrating the cradle phenotype observed in Ap4b1(- / -) mice with hind limbs drawn inward toward the midline. (B) Histogram showing the presence of the cradle phenotype in wild-type (WT) and Ap4b1-knockout (Ap4b1- / -) mice at different time points. Data are presented as the number of mice in each group that exhibit or do not exhibit the cradle phenotype after tail suspension. The percentage of mice in each group that are positive for hind limb cradle is shown above. There are n=16 per group except for Ap4b1(- / -) at day 270, where n=15. [Figure 7]Coronary MRI images show reduced corpus callosum thickness in Ap4b1-ko (Ap4b1- / -) mice compared to wild-type mice (A). Thickness in μm units is quantified in (B). Preliminary data are presented as mean ± SD. Measurements are derived from four slices per mouse taken from a matching brain region. Representative image from H&E-stained coronary brain section confirming MRI findings (C). Corpus callosum thickness measurements are derived from multiple slices per mouse taken from a matching brain region. Thickness in μm units is quantified in (D). Data are presented as mean ± SD. Scale bar = 1 mm; 250 μm. Images were acquired and analyzed using NanoZoomer Digital Pathology software (Hamamatsu). [Figure 8] The state of the AP4 complex at ATG9A and AP4E1 protein levels in AP4B1 knockout mice was evaluated in brains collected from homozygous Ap4b1- / -(HZ) and wild-type (WT) mice. Increased ATG9A levels were observed in Ap4b1- / - compared to WT mice. This is a phenotype observed in human cell models, including human patient fibroblasts and iPSC-derived neurons. Another important observation is the depletion of AP4E1 units in AP4b1- / - compared to WT mice. The same observation has been reported in SPG47 cell model systems, including human cells isolated from AP4 patients. [Figure 9] Weight gain in AAV9-hAP4B1- / - mice. Group mean of untreated wild-type mice (black), untreated AP4b1- / - mice (blue), and Ap4B1- / - mice treated with 5 × 10¹³ gc / kg of AAV9-hAP4B1 intracisional injection at 1 day postnatal (red). Females and males are plotted separately. [Figure 10] AAV9-hAP4B1 treatment response as measured by a hugging assay. Cohort size varied from n=6 to n=15. Either wild-type or Ap4b1- / - knockout mice were evaluated for the hugging reflex at 2, 3, and 9 months of age, and the positive rate for hugging is plotted (red). Low dose = 2 × 10¹³ gc / kg, high dose = 5 × 10¹³ gc / kg. [Figure 11] Effect of AAV9-hAP4B1 administration to cisterna magna on latency in the rotorod test. Group mean of untreated wild-type mice (black), untreated AP4b1- / - mice (blue), and Ap4B1- / - mice treated with 5 × 10¹³ gc / kg of AAV9-hAP4B1 intracisnamal injection on postnatal day 1 (red). Females and males are plotted separately. [Figure 12] State of the AP4 complex in AP4B1 knockout mice. AP4E1 protein levels were restored in spinal cord (A) and heart (B) collected from homozygous Ap4b1- / -(HZ) and wild-type (WT) mice. [Figure 13] The AP4B1 endogenous promoter sequence and primers are described. [Figure 14] GFP expression in HeLa cells under the control of the MeP229, AP4, and hSyn promoters. The term "mock" refers to a control without GFP expression. Expression was detected under all three promoters, as shown. Experiments were performed using three replicas for each sample. Data are presented as mean ± SD. [Figure 15] Annotated sequences showing TSS locations (uppercase) and minimum promoter regions (underlined). GC-Box regions, frequently found in promoters and regulatory sequences, are shown in bold. PolII chip-seq target regions (italicized) are further highlighted.

[0093] Materials and methods Statement on Ethics All in vivo animal experiments were approved by the University of Sheffield Ethical Review Sub-Committee and the UK Animal Procedures Committee, London, UK, and conducted under project license 40 / 3739 in accordance with the Animals (Scientific Procedures) Act 1986. C57BL / 6J-Ap4b1 em5Lutzy / J mice and non-transgenic C57BL / 6J mice were maintained in a controlled facility with free access to food and water, using a 12-hour dark / 12-hour light-response cycle (on at 7am / off at 7pm). ARRIVE guidelines were followed when reporting this study.

[0094] Viral vector construction The original pAAV2 vector skeleton was published in Laughlin et al., (1983). It includes a CBh promoter with a hybrid intron region. 4 The full-length hAP4B1 cDNA was amplified by PCR from the pTRS-KS-CBh-eGFP plasmid provided by Dr. S. Gray, and after removal of the CMV promoter by restriction digestion, it was cloned into the MluI and EcoRI sites of the pAAV_CMV_MCS construct. 5 The pLXIN-SPG47 plasmid provided by [provided by] was transferred to pAAV-CBh-MCS by PCR amplification and ligation. The hAP4B1 cDNA sequence was cloned between the SalI and HindIII sites of the pAAV_CBh_MCS plasmid. A separate epitope-tagged construct (pAAV_CBh_V5-hAP4B1) was created to enable detection of hAP4B1 protein expression by ICC. A linkerless N-terminal V5 epitope tag was inserted immediately downstream of the hAP4B1 Kozak sequence by Q5-mediated site-directed mutagenesis using a serial primer strategy designed for large insertions. To investigate gene transfer in human fibroblast cell lines, the V5-hAP4B1 transgene sequence was subcloned into the pLenti_PGK_MCS_Vos lentiviral scaffold (provided by Dr. K. de Vos) downstream of the PGK promoter by restriction digestion (SalI / NotI XhoI / NotI).

[0095] pCMV3-AP4S1 was purchased from Sino Biological. Full-length human untagged AP4S1 was transferred to pAAV_CBh_MCS by PCR amplification from pCMV3-AP4S1, and AgeI and XbaI restriction sites were introduced at the 5' and 3' ends of hAP4S1, respectively. Subsequently, the hAP4S1 cDNA product was cloned between the AgeI and XbaI sites of the pAAV_CBh_MCS plasmid.

[0096] In addition to a construct that drives gene expression using a strong constitutive CBh promoter, three more putative expression vectors were generated that contained weaker promoters hypothesized to express the hAP4B1 transgene at a level closer to the endogenously found level. The promoters were MeP229 (derived from the core fragment of the endogenous Mecp2 gene promoter and amplified by PCR from the pSJG-MeP229-GFP plasmid received as a gift from Dr. S. Gray), and hSyn (a neuron-specific human synapsin 1 gene promoter, cloned by restriction digestion-ligation from scAAV-SYN1-GFP, a construct originally published by Lukashchuk and his colleagues). 6 ), and AP4B1_endo(hAP 7 ) was the result. All three promoters were cloned into pAAV_MCS_KanR between the MluI and EcoRI sites by restriction ligation. AP4B1_endo was amplified by PCR from human genomic DNA extracted from HEK293 cells.

[0097] To serve as a negative control for the V5-tagged hAP4B1 construct, only the V5 epitope was PCR-amplified from the pCIneo_V5-N vector (donated by Dr. K. de Vos) and cloned into the XbaI site of pAAV_CBh_MCS. The eGFP transgene derived from pTRS-KS-CBh-GFP was cloned into the pAAV_CBh_MCS vector by restriction digestion between the AgeI / BamHI sites to generate a GFP expression regulatory vector (pAAV_CBh_eGFP).

[0098] Initial Safety Study - Delivery of Viral Gene Therapy Constructs to Cisterna in P1 Mice

[0099] Wild-type C57Bl / 6J mice on day 1 postnatal (P1) were anesthetized with isoflurane. Induction occurred in a chamber with 5% isoflurane at 3 L O2 / min. Anesthesia was maintained for approximately 5 minutes during injection with 1–2% isoflurane at 0.3 L O2 / min via a mask. The cisterna magna was located using a Wee-Sight transilluminator venous finder (Phillips). Viral vectors (pAAV_CBh_hAP4B1 and pAAV_CBh_eGFP) were directly injected into the cisterna magna of P1 mice (n=15 per group) using a stereotactic device containing a 33-gauge Hamilton syringe with an automated perfusion pump. The solution was administered at a flow rate of 1 μL / min, with a maximum volume of solution administered per animal of 5 μL. Each animal was measured for a total of 5 × 10⁶ 10 The maximum dose of each individual vector genome was received. The experimental schedule proceeded as follows: Day 1 - Day 0 after birth, birth day (P0) - A tattoo on the sole of the foot was applied for identification purposes. Day 2 - Postnatal Day 1 (P1) - Inject up to 5 μL of viral vector or vehicle solution into the cisterna magna under isoflurane anesthesia. On day 29 (or day 170) – 28 days postnatology (P28) or P168 (6 months post-injection) – the animals were perfused under terminal anesthesia, and tissue samples were collected for analysis.

[0100] Large Cisterna Delivery of Viral Gene Therapy Constructs in P1 Mice as a Proof of Concept

[0101] After cisterna injection, the ability of our therapeutic viral vector (pAAV_CBh_hAP4B1) to mediate transgene expression in the central nervous system (CNS) of transgenic mice lacking endogenous Ap4b1 (KO C57BL / 6J-Ap4b1 em5Lutzy / J) was evaluated in a continuing study. Mice were injected via the cisterna as in the safety study described above. Two viral vectors were used: AAV9, which expresses the full-length copy of the human AP4B1 (SPG47) gene, and AAV9 expressing a V5 tag with no additional coding sequence as a viral control. Mice receiving the AAV9-hAP4B1 viral vector were injected with two different doses (a low dose of 2×10 10 vector genomes each and a high dose of 4×10 10 vector genomes each), while mice receiving AAV9-V5 were injected with only the high dose (4×10 10 vector genomes). Additionally, two groups, untreated KO C57BL / 6J-Ap4b1 em5Lutzy / J and untreated WT C57BL / 6J-Ap4b1 em5Lutzy / J, were included in the study. Restoration of phenotype was evaluated by improvement of behavioral parameters described in detail below in treated mice compared to untreated mice.

[0102] Genotyping and Colony Maintenance C57BL / 6J-Ap4b1 em5LutzyThe / J mouse was generated by Jackson Labs using a CRISPR-Cas9-mediated deletion in a 76bp region within exon 1 of the mouse Ap4b1 gene. This deletion produced frameshift mutations and cleaved mRNA transcripts. WT sequence (deletion in lowercase): TTGGCGACGATGCCATAccttggctctgaggacgtggtgaaggaactgaagaaggctctgtgtaaccctcatattcaggctgataggctgcgcTACCGGAATGTCATCCAGCGAGTTATTAGGTATCACCAACCTACCATAGAA (Sequence ID 9).

[0103] Mouse genotyping was performed based on a protocol optimized by Charles River Laboratories. Mouse genotyping was performed on genomic DNA extracted from tail or ear tissue by adding 20 μl of QuickExtract® DNA extraction solution (Lucigen) and incubation on a thermocycler at 65°C for 15 minutes, followed by 98°C for 2 minutes. Genotyping PCR was performed as separate 20 μl volume reactions for WT and KO alleles. The reaction consisted of 5 μl of 5x FIREPol® Master Mix Ready to Load, along with 7.5 mM MgCl2 (Solis Biodyne), 500 nM each of genotyping primers (P1+P2 for wild-type allele amplification, and P1+P3 for KO allele amplification (P1: 5'-TCGCCCGAGGACCCAAGAA-3' (SEQ ID NO: 10), P2: 5'-CCTATCAGCCTGAATATGAGGGTTACA-3' (SEQ ID NO: 11), P3: 5'-GCTGGATGACATTCCGGTATATG-3' (SEQ ID NO: 12)), and 1 μl of genomic DNA from the QuickExtract® protocol. Touchdown PCR was performed according to the thermal profiles shown in Table 1. Following PCR and agarose gel electrophoresis (2% agarose gel in Tris-acetate-EDTA buffer), the WT and KO allele PCR products were visualized at approximately 254 bp and 203 bp, respectively.

[0104] Heterozygous mice were reared together to produce homozygous WT (Ap4b1+ / +), KO (Ap4b1- / -), and heterozygous (Ap4b1+ / -) littermates. Table 1-C57BL / 6J-Ap4b1 em5Lutzy / J touchdown PCR conditions for genotyping [Table 1]

[0105] RT-qPCR for AP4B1 expression analysis in humans and mice The RT-qPCR preparation consisted of 2 μl of RNA diluted to a concentration of 10 ng / l in nuclease-free water, 5 μl of 2x QuantiFast SYBR Green RT-PCR Master Mix (Qiagen®), hAP4B1 (forward: 5'-CTGGTGAACGATGAGAATGT-3' (SEQ ID NO: 13), reverse: 5'-GACCCAGCAACTCTGTTAAA-3' (SEQ ID NO: 14)), mAp4b1 (forward: 5'-CTGTGCTAGGCTCCCACATC-3' (SEQ ID NO: 15), reverse: 5'-TGGCACTGGCCTTTACCATT-3' (SEQ ID NO: 16)), and 18S (forward: 5'GTAACCCGTTGAACCCCAT 3' (SEQ ID NO: 17), reverse: 5'CCATCCAATCGGTAGTAGCG 3' (SEQ ID NO: 18)) primers (all at 1 M concentration), and 0.1 μl of QuantiFast The procedure was performed using the RT mixture and H2O up to a final volume of 10 μl. Following the initial reverse transcription step of 10 minutes at 50°C and the denaturation step of 5 minutes at 95°C, the cDNA was amplified by 39 cycles of 10 seconds each at 95°C, followed by a compound annealing / extension step of 10 seconds at 60°C. This was followed by one cycle of 31 seconds at 65°C before subsequent melting curve analysis. All RT-qPCRs were performed on a Bio-Rad C1000 Touch® thermal cycler. Bio-Rad CFX Manager software was used to analyze signal intensity, relative gene expression values ​​were determined using the ΔΔCt method, and 18S rRNA was used as the reference gene.

[0106] Open field Open-field analysis was performed on mice at 6, 9, and 12 months of age. The protocol was developed by Herranz-Martin and his colleagues. 8The experiment followed the procedures established by [presumably a specific organization or organization]. Mice were placed in a translucent box measuring 60cm x 40cm x 25cm. The bottom of the box was marked with permanent ink outlining a 5x3 grid of squares. Activity was measured as the number of grid lines crossed by each mouse over a 10-minute period. For a crossing to be recorded, all four paws of the animal had to cross the grid lines. The evaluation was conducted under minimal lighting conditions, and the apparatus was cleaned with 70% ethanol between each animal. One run was recorded for each animal at each point in time.

[0107] Rotor rod A Ugo Basile 7650 accelerating rotor rod (set to accelerate at 3–37 rpm over 300 seconds) was used to measure motor function. Rotor rod training was performed for three consecutive days with two trials per day. Subsequently, the test was performed late in the morning at intervals of once every two weeks (characterization study) or once a month (proof of concept study). For each evaluation, mice were tested twice with a minimum rest period of 5 minutes between runs. The best performance, measured as latency to fall in seconds, was used for analysis. The minimum threshold for recording rotor rod activity was 3 seconds.

[0108] Gait analysis The CatWalk® gait analysis system version 7.1 was used to evaluate the gait parameters of Ap4b1-KO and WT mice. Mice were tested at 3, 6, 9, and 12 months of age. Mice were placed on the device in complete darkness, and their gait patterns were recorded. Six unforced runs were recorded for each mouse, and three were selected for analysis. Runs to be analyzed were selected based on the absence of behavioral abnormalities, such as consistent sniffing, exploring, and housing, as well as consistent mouse movement, without significant acceleration, deceleration, or deviation from a straight line. Gait data processing was performed using Noldus software. Limbs were manually assigned, and gait parameters were calculated automatically. Parameter values ​​were transferred to GraphPad Prism for statistical analysis.

[0109] antibody The primary antibodies used in this study were mouse anti-α-tubulin (1:5000, Sigma), mouse anti-GAPDH (1:10,000, Millipore), rabbit anti-V5 (1:1000, Abcam), rabbit anti-β4 (a proprietary non-commercial antibody provided by J. Hirst) (1:400), rabbit anti-ATG9A (1:1000, Abcam), sheep anti-TGN46 (Bio-Rad), and anti-MAP2.

[0110] Protein extraction and Western blotting for protein expression analysis

[0111] Tissue was collected from mice under terminal anesthesia and rapidly frozen in liquid nitrogen. The tissue was homogenized using a Downs homogenizer in ice-cold RIPA buffer containing a 1x protease inhibitor cocktail (Sigma-Aldrich) (50 mM Tris-HCl (pH 7.4), 1% v / v NP-40, 0.5% w / v sodium deoxycholate, 0.1% v / v SDS, 150 mM NaCl, 2 mM EDTA). Lysate protein concentrations were determined using a BCA assay (Thermo Scientific Pierce®). 40 μg of protein lysate was denatured by heating to 100°C for 5 minutes in the presence of 4x loading buffer (10 ml of buffer containing 240 mM Tris-HCl (pH 6.8), 8% w / v SDS, 40% glycerol, 0.01% bromophenol blue, and 10% β-mercaptoethanol). Since boiling leads to aggregation of ATG9A and loss of signal, lysates intended for use in quantifying ATG9A protein levels were heated to 50°C. The lysates were then loaded onto mini-PROTEAN® TGX® precast polyacrylamide gels (Bio-Rad) with a 4–20% gradient. The gels were run at 180 V in electrophoresis buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3) for approximately 50 minutes, or until the leading edge of the dye reached the bottom of the gel. The isolated proteins were transferred by electrophoresis to an Immobilon-P PVDF membrane (Millipore) pre-soaked in methanol. Protein transfer was performed in transfer buffer (25 mM Tris, 192 mM glycine, 5% v / v methanol) at 250 mA for 1.5 hours or at 40 mA overnight. The membrane was blocked in 5% milk / TBS-T for 1 hour. The primary antibody was diluted in 5% milk / TBS-T or 5% BSA / TBS-T and incubated with the membrane at 4°C overnight. After incubation of the primary antibody, the membrane was washed three times in TBS-T buffer for 15 minutes each. The secondary antibodies anti-mouse HRP (1:3000) and anti-rabbit HRP (1:3000) were diluted in 5% milk / TBS-T and incubated with the membrane at room temperature for 2 hours.Following incubation with the secondary antibody, the membranes were washed three times for 15 minutes each in TBS-T buffer, followed by a final 15-minute wash in PBS. Protein bands were visualized using ECL Prime Western Blotting Detection Reagent (Amersham) and a G-Box imaging system (Syngene). Protein band concentration analysis was performed using ImageJ software.

[0112] Western blotting was performed using the following protocol. Cell lysates were extracted as described above. 40 μg of protein per lane was loaded onto 10 wells of 4-12% Bis-Tris precast gel. The gel was run in 2-(N-morpholino)ethanesulfonic acid (MES) buffer and transferred to a nitrocellulose membrane in a wet state (constant amperage of 100 mA overnight). The membrane was blocked in 5% milk / TBS-T for 1 hour. Primary antibody was added at room temperature for 2 hours (1:400 anti-AP4B1 in 5% BSA), followed by four 15-minute washes in PBS-T. Secondary antibody was added in 5% milk-TBS-T at room temperature for 30 minutes. The membrane was washed five times in PBS-T for 5 minutes each, followed by a 30-minute wash in PBS. The membrane was developed using ECL Prime Western Blotting Detection Reagent (Amersham).

[0113] cell culture Human embryonic kidney (HEK) 293T cells, HeLa-M / HeLa-AP4B1 - / - Cells (donated by Dr. J. Hirst) and human fibroblast cell lines were cultured at 37°C and 5% CO2 in a growth medium consisting of Dulbecco's modified Eagle medium (DMEM, Sigma) supplemented with 10% v / v fetal bovine serum (FBS, Sigma, MI, US) and 1% v / v penicillin (100 U / ml) and streptomycin (100 U / ml) (Lonza, Basel, Switzerland).

[0114] Regarding primary cortical neuron cultures, E18 non-transgenic rat embryos and E16 mouse embryos are essentially wild-type and C57BL / 6J-Ap4b1, as described by Krichevsky et al., 2001. em5Lutzy Collected from pregnant mice. C57BL / 6J-Ap4b1 em5Lutzy / J mice and non-transgenic C57BL / 6J mice were maintained in a controlled facility with free access to food and water in a 12-hour dark / 12-hour light-response cycle (on at 7am / off at 7pm). Dissociated cortical neurons were then seeded on poly-D-lysine (SIGMA) coated plates and maintained in Neurobasal medium (Life Technologies) supplemented with 2% B27 (Life Technologies), 0.5 mM GlutaMax (Life Technologies), 100 U / ml penicillin, and 100 μg / ml streptomycin (Lonza).

[0115] AP4B1 knockout HeLa cells (HeLa-AP4B1 - / - ) was provided by Dr. J. Hirst, and its generation was, 9 It is described there.

[0116] AP4B1-deficient human fibroblasts from SPG47 patients, heterozygous family members, and age-matched homozygous wild-type controls were donated by Dr. Henry Houlden and Dr. Ivy Pin-Fang Chen.

[0117] Production of plasmids and viral constructs for off-target effects analysis The AAV2-ITR transgene transfer plasmid prepared as described above was amplified in NEB Stable e.coli cells (New England Biolabs) and purified using the Qiagen Plasmid Plus kit. The adenovirus helper gene (pHelper) and Rep-Cap gene (pAAV2 / 9) were supplied in trans and commercially obtained through Plasmid Factory. The pseudotyped AAV9 virus vector was, 6 It was produced in-house according to the protocol described in [the document].

[0118] In vitro validation of viral vectors HeLa-M cells and HeLa-AP4B1 - / - Cells were transduced 24 hours after seeding with a viral vector mixed with normal growth medium. The cells were incubated with the virus for 3 days before being harvested for analysis.

[0119] Fibroblasts were transduced with a multiplicity of infection (MOI) of 20 lentiviral particles per cell. Cells were harvested 72 hours after transduction.

[0120] Wild type and C57BL / 6J-Ap4b1 em5Lutzy Primary non-transgenic rat cortical neurons and mouse cortical neurons isolated from / J mice were transduced with 300,000 vector genomes of a viral vector three days after seeding. Cells were collected 10 days after transduction for ICC and Western blot / qPCR analysis of AP4B1 / V5-AP4B1 and ATG9A expression.

[0121] Vector map Table 2: hSYN1-hAP4B1 (Sequence ID 19) A. Overview of Vectors [Table 2] B. Vector components [Table 3]

[0122] Table 3: CBh-hAP4B1 (Sequence ID 20) A. Overview of Vectors [Table 4] B. Vector components [Table 5]

[0123] Table 4: SYN 1hAP4S1-3'UTR (SEQ ID NO: 21) A Vector Overview [Table 6] B. Vector components [Table 7]

[0124] Table 5: MeP229hAP4S1 (Sequence ID 22) A. Overview of Vectors [Table 8] B. Vector components [Table 9]

[0125] Table 6: MeP229hAP4E1 (Sequence ID 23) A Vector Overview [Table 10] B. Vector components [Table 11]

[0126] Table 7: SYN1hAP4E1 (Sequence ID 24) A. Overview of Vectors [Table 12] B. Vector components [Table 13]

[0127] Example 1 The size of the human AP4B1 cDNA open reading frame (2,800 bp) means that simple gene substitution options are technically feasible and suitable for typical viral delivery approaches, such as using single-stranded adeno-associated virus (AAV) with an insertion limit of approximately 4,000 bp. We designed an AAV vector to achieve the strongest level of transgene expression (Figure 2A):1) The expression cassette was developed with a 0.8 kb CBh promoter and a 130 bp SV40 polyA to drive the expression of human AP4B1. The CBh promoter has been reported to mediate efficient transgene expression in rodents and non-human primates. 2) A vector expressing human AP4B1 cDNA tagged with the N-terminal V5 viral epitope, enabling in vitro and in vivo detection of AP4B1 restoration in the absence of a suitable anti-AP4B1 antibody; 3) A V5-tagged AP4B1 construct expressed from a lentiviral vector, enabling in vivo validation in cell types not efficiently transfected by AAV9 (e.g., fibroblasts). All constructs have been shown to efficiently express their viral cargo, as determined by Western blotting, RT-qPCR, and immunocytochemistry, upon transfection or transduction in HeLa cells (Figure 2B, C), primary rat cortical neurons (Figure 2D), and human fibroblasts (Figure 2E). The viral constructs efficiently restore AP4B1 protein expression in both CRISPR-generating AP4B1-knockout HeLa cell lines and fibroblasts derived from SPG47 patients lacking endogenous AP4B1 (Figure 2B, C, E). Expression of V5-tagged AP4B1 in SPG47 patient fibroblasts also restores both ATG9A overexpression and mislocalization (Figure 3).

[0128] Example 2 Subarachnoid delivery of AAV9 viral vectors (AAV9-AP4B1, AAV9-V5 tagged AP4B1, or AAV9-GFP) via the cisterna magna of wild-type C57BL6 / J mice resulted in extensive transduction of multiple tissues, including the brain, through a delivery pathway known to lead to efficient gene delivery into the CNS, as described in our previous studies (Figure 4A, B). Long-term pilot safety studies in wild-type mice treated with AAV9-AP4B1 showed no apparent side effects on body weight, motor function, or clinical observations up to 6 months of age (Figure 4C-E).

[0129] Example 3 In conjunction with the development of a therapeutic viral vector, the generation of a CRISPR-based Ap4b1- knockout (EM5 Ap4b1- / -) mouse strain was outsourced to Jackson Laboratory and subsequently transferred to SITraN in Sheffield for complete characterization. Phenotypic characterization of the strain revealed that the EM5 Ap4b1- / - strain exhibited consistent progressive motor impairment, as demonstrated by rotarod, open field, and CatWalk footprint tests (Figure 5A-C), as well as hugging (Figure 6). Preliminary MRI analysis revealed that the thinning of the corpus callosum in EM5 Ap4b1- / - was a clinically significant phenotype compared to wild-type mice, as the same pathological phenotype has been reported in SPG47 patients (Figure 7A, B). This observation was confirmed by H&E staining (Figure 7C, D). Further analysis of MRI findings is ongoing to evaluate the overall size of the lateral ventricles, as well as other readouts such as changes in white matter volume and phenotypes already reported in AP4E1- / - and human AP4 cases.

[0130] The mouse model of SPG47 was generated by Jackson Labs (Bar Harbor, ME). C57BL / 6J-Ap4b1 em5Lutzy The / J model (stock number 031349) contains a mutant Ap4b1 gene with a 76bp deletion in exon 1. C57BL / 6J-Ap4b1 em4LutzyThe / J model (stock number 031062) contains a 78bp deletion + 1bp deletion in exon 1 of the mouse Ap4b1 gene. Neither is known to be a human pathogenic mutation, but it is predicted to generate a frameshift resulting in an early nonsense mutation. This strain was developed using CRISPR / Cas 9 technology and mutagenic oligonucleotides. A plasmid encoding a signal guide RNA designed to introduce a 76bp deletion into exon 1 of the Ap4b1 gene, and a cas9 nuclease, were introduced into cytoplasmic C57BL / 6J fertilized eggs with well-recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Correctly targeted offspring were identified by sequencing and PCR and further raised in C57BL / 6J to develop colonies. PCR genotyping allows for the identification of wild-type, heterozygous, and homozygous knockout mice.

[0131] Further characterization of the model was performed by the Azzouz Laboratory at the University of Sheffield. RT-PCR and qRT-PCR showed very low levels of Ap4b1 mRNA in the mutant mice, consistent with nonsense-mediated disruption. Western blotting showed the absence of a cross-reactivity band of approximately 85 kDa, normally expressed at various levels in the brain, muscle, spinal cord, liver, and heart of wild-type mice.

[0132] The em5lutzy strain has been investigated in more detail. While weight gain was similar in wild-type and Ap4b1- / - female mice, weight gain in male Ap4b1- / - mice was slower than in male wild-type mice and was significantly lower in weight at >6 months. Several behavioral assessments were performed, including gait analysis, cradle, open field test, and rotarod performance (Figures 5 and 6). All of these showed deficiencies in Ap4b1- / - mice. Gait analysis showed that the hindlimb foot angle was abnormally wide in mutant mice compared to wild-type mice (Figure 5D). In the cradle assay, mutant mice had a higher cradle rate at all ages compared to wild-type mice (Figure 6B). Open field activity was similar in wild-type and mutant mice at 6 months of age, but wild-type mice showed an age-dependent decrease that was not present in mutant mice (Figure 5B). The rotor rod showed the most consistent difference from the latency to fall onto the rotor rod, being approximately 15% lower across all ages tested from 50 to 120 days of age (Figure 5A). Further characterization is ongoing by open-field activity monitoring, catwalk, hindlimb cradle, MRI, histopathology, ATG9A localization, and protein levels. Motor deficiency is a key feature of the clinical manifestations of SPG47 / AP4B1 deficiency; therefore, these mouse phenotypes are directly related to the human disease and are appropriate markers for evaluating potential therapies.

[0133] Further morphological and histopathological studies of these Ap4b1- / - knockout mice are ongoing. Published studies of knockout mice against the Ap4e1 gene show thinning of the corpus callosum and axonal swelling in various regions of the brain and spinal cord. Immunohistochemical analysis has shown that transmembrane autophagy-related protein 9A (ATG9A) is more concentrated within the trans-Golgi network (TGN) and depleted from the peripheral cytoplasm in both neuronal types of Ap4e1 knockout mice. This leads to distal axonal swelling containing accumulated ER, defective autophagosomes, and axonal shortening observable both in vitro and in vivo.

[0134] Proof of concept: Treatment of an SPG47 mouse model with intracisional AAV9. Three studies used young or neonatal mice to study mouse C57BL / 6J-Ap4b1 em5Lutzy This was conducted to evaluate the effect of AAV9-hAP4B1 in the large tank in the / J model.

[0135] p1 mice undergo cisterna magna injection. Proof of concept was demonstrated in neonatal Ap4b1- / - mice. It was hypothesized that using neonatal mice would provide the greatest benefit in mitigating any onset signs of the disease. The experimental design (1) included four cohorts of homozygous knockout mice using one of two doses of the AAV9-HAP4B1 vector expressing human cDNA for AP4B1, an empty vector expressing the epitope tag (AAV9-V5), or untreated mice. Positive controls were untreated wild-type mice.

[0136] A stock of AAV9 viral vectors was generated by transfecting adherent human embryonic kidney HEK293T cells and purifying the vector using iodixanol gradient centrifugation. Briefly, HEK293T cells were transfected with the packaging plasmid pHelper (Stratagene, Stockport, UK), pAAV2 / 9 (courtesy of J. Wilson, University of Pennsylvania), and one of the transgene plasmids (e.g., AAV9-CBh-AP4B1) in a 2:1:1 ratio, using polyethyleneimine (1 mg / ml) in serum-free Dulbecco's Modified Eagle Medium, respectively. Three days after transfection, the supernatant containing cell-releasing virus was collected, treated with benzonase (10 units / ml, Sigma, Poole, UK) at 37°C for 2 hours, and concentrated to approximately 24 ml equivalent using an Amicon Ultra-15 Centrifugal 100K filter (Millipore, Watford, UK). An iodixanol gradient containing 15, 25, 40, and 54% iodixanol solutions in phosphate-buffered saline (PBS) / 1 mmol / l MgCl2 / 2.5 mmol / l KCl and virus solution was loaded and centrifuged at 69,000 rpm at 18°C ​​for 90 minutes. After ultracentrifugation, the virus fraction was visualized on a 10% polyacrylamide gel and stained using SYPRO Ruby (Life Technologies, Paisley, UK) according to the manufacturer's guidelines. The highest purity fraction (identifiable by the presence of three bands corresponding to VP1, VP2, and VP3) was pooled and further concentrated in a final formulation buffer consisting of PBS supplemented with an additional 35 mmol / l NaCl using an Amicon Ultra-15 Centrifugal 100K filter. Viral titers were determined by quantitative PCR assay. Table 1. Study design for P1 mouse efficacy experiments 1 [Table 14] 1. The assessment included general observation, weight and accelerated rotoring every three weeks, open field, cuddling, and catwalk tests at three-month intervals.

[0137] No mortality was observed in any of the mice in any of these cohorts. Weight gain was assessed every two weeks, with a distinct pattern of slower weight gain in untreated Ap4b1- / - mice of either sex compared to wild-type controls (Figure 9). High-dose AAV9-hAP4B1 neonatal injection restored weight gain in males to wild-type levels, while it did not affect weight gain in female mice.

[0138] Phenotype was assessed by a hugging assay, in which mice with specific neurological defects (but not wild-type mice) hugged the limbs when suspended by their tails. The data (Figure 10) clearly show an age-dependent increase in the hugging response in 83% of knockout mice compared to 7% of wild-type controls at 9 months of age (p<0.001, chi-square test). Treatment of knockout mice with high-dose AAV9-hAP4B1 vector significantly reduced the hugging response at 9 months (p<0.01), but the response did not reach the level of wild-type mice (p<0.0001). In contrast, the control vector AAV9-CBH-V5 had no effect on the hugging response. Furthermore, the use of low-dose AAV9-hAP4B1 showed no effect, and age-dependent hugging was comparable to that of untreated Ap4b1- / - mice, with a target dose of at least 5 × 10⁶. 13 This suggested a gc / kg ratio.

[0139] Phenotype was also assessed by accelerated rotaroding at 4-week intervals (Figure 11). Similar to weight gain, the data are better understood when male and female mice are considered separately. For male mice, there was a clear improvement in the performance of high-dose AAV9-hAP4B1 treated knockouts to levels comparable to wild-type mice of the same age. For female mice, the knockouts did not show defects in rotaroding performance and therefore showed no response to AAV-hAP4B1 delivery into the cisterna magna. We note that substantial differences in performance between male and female mice are known in both wild-type mice

[12] and mouse models of neurological diseases including GNAO1

[13] , ALS [14, 15], and Alzheimer's disease

[16] .

[0140] Performance was also assessed by overall activity in an open-field test in a subset of mice. This measure showed clear differences between wild-type and knockout mice, but there was no effect of treatment on activity. Similar patterns were observed in both male and female cohorts.

[0141] The state of the AP4 complex was assessed by measuring AP4E1 levels (Figure 12). An important observation was the difference in AP4b1 levels compared to WT mice. - / - This involves the depletion of the AP4E1 unit in the AP4 complex. The same observation has been reported in the SPG47 cell model system, which includes human cells isolated from AP4 patients. AAV9-AP4B1 gene transfection increases AP4E1 levels in the spinal cord (Figure 12A) and heart (Figure 12B) of AP4B1- / - mice, suggesting restoration of the AP4 complex (Figure 13).

[0142] CM delivery in P1 wild-type mice: Pilot safety study The objective of this pilot study was to evaluate the in vivo distribution, stability of virus-mediated transgene expression, and potential adverse effects of AAV9-hAP4B1 in wild-type mice (Figure 4). A single viral vector expressing a full-length copy of the human AP4B1 gene containing the N-terminal V5 viral epitope tag would be used. The viral vector was delivered directly into the cisterna magna of P1 / 2 offspring using a stereotactic device containing a 33-gauge Hamilton syringe with an automated perfusion pump. 5 μl of solution was administered at 1 μL / min. Viral distribution, expression, body weight, and motility (rotarod) were evaluated 4 weeks and 6 months after injection. Table 8 Summary of sequences [Table 15]

[0143] References 1. Harvard SPG47 registry, managed by Dr. Darius Ebrahimi-Fakhari (accessed October 2020). 2 Bauer, P. et al.Mutation in the AP4B1 Gene Cause Hereditary Spastic Paraplegia Type47(SPG47).Neurogenetics 13,73-76,doi:10.1007 / s10048-012-0314-0.(2012). 3. Laughlin, CA, Tratschin, JD, Coon, H. & Carter, BJCloning of infectious adeno-associated virus genomes in bacterial plasmids.Gene 23,65-73(1983). 4.Gray,S.J.et al.Optimizing Promoters for Recombinant Adeno-Associated Virus-Mediated Gene Expression in the Peripheral and Central Nervous System Using Self-Complementary Vectors.Hum.Gene Ther.22,1143-1153(2011). 5.Davies,A.K.et al.AP-4 vesicles contribute to spatial control of autophagy via RUSC-dependent peripheral delivery of ATG9A.Nat.Commun.9,(2018). 6.Lukashchuk,V.,Lewis,K.E.,Coldicott,I.,Grierson,A.J.& Azzouz,M.AAV9-mediated central nervous system-targeted gene delivery via cisterna magna route in mice.Mol.Ther.-Methods Clin.Dev.3,15055(2016). 7.Kim,S.,Yu,N.K.& Kaang,B.K.CTCF as a multifunctional protein in genome regulation and gene expression.Exp.Mol.Med.47,e166(2015). 8.Herranz-Martin,S.et al.Viral delivery of C9orf72 hexanucleotide repeat expansions in mice leads to repeat-length-dependent neuropathology and behavioural deficits.Dis.Model.Mech.10,859-868(2017). 9.Frazier,M.N.et al.Molecular basis for the interaction between Adaptor Protein Complex 4(AP4)β4 and its accessory protein,tepsin.Traffic 17,400-415(2016). 10.Behne R,Teinert J,Wimmer M,D’Amore A,Davies AK,Scarrott JM,Eberhardt K,Brechmann B,Chen IP,Buttermore ED,Barrett L,Dwyer S,Chen T,Hirst J,Wiesener A,Segal D,Martinuzzi A,Duarte ST,Bennett JT,Bourinaris T,Houlden H,Roubertie A,Santorelli FM,Robinson M,Azzouz M,Lipton JO,Borner GHH,Sahin M,Ebrahimi-Fakhari D.Adaptor protein complex 4 deficiency:a paradigm of childhood-onset hereditary spastic paraplegia caused by defective protein trafficking.Hum Mol Genet.2020 Jan 15;29(2):320-334.doi:10.1093 / hmg / ddz310.PMID:31915823;PMCID:PMC7001721. 11.Ebrahimi-Fakhari D,Teinert J,Behne R,Wimmer M,D'Amore A,Eberhardt K,Brechmann B,Ziegler M,Jensen DM,Nagabhyrava P,Geisel G,Carmody E,Shamshad U,Dies KA,Yuskaitis CJ,Salussohilia-FEbrami,CL D,Pearson TS,Saffari A,Ziegler A,Kolker S,Volkmann J,Wiesener A,Bearden DR,Lakhani S,Segal D,Udwadia-Hegde A,Martinuzzi A,Hirst J,Perlman S,Takiyama Y,Xiromerisiou G,Will K,Walker W,App, Gullah, R.D. N,Aksoy A,Verhelst H,Delgado MR,Kremlikova Pourova R,Sadek AA,Elkhateeb NM,Blumkin L,Brea-Fernandez AJ,Dacruz-Alvarez D,Smol T,Ghoumid J,Miguel D,Heine C,Schlump JU,Langen J,H,Baetz, H,Backharvish,HD S,Kruer MC,Lim-Melia E,Aydinli N,Alanay Y,El-Rashidy O,Nampoothiri S,Patel C,Beetz C,Bauer P,Yoon G,Guillot M,Miller SP,Bourinaris T,Houlden H,Robelin L,Anheim M,Alamri AS,Ah,Mahmood S,Habizah,Habizah P,Faghihi MA,Jansen AC,Brock S,Roubertie A,Darras BT,Agrawal PB,Santorelli FM,Gleeson J,Zaki MS,Sheikh SI,Bennett JT,Sahin M.Defining the clinical,molecular and imaging spectrum of adaptor protein complex 4-associated hereditary spastic paraplegia.Brain.2020 Oct 1;143(10):2929-2944.doi:10.1093 / brain / awz307.PMID:32979048;PMCID:PMC7780481. 12.Orsini,C.A.and B.Setlow,Sex differences in animal models of decision making.J Neurosci Res,2017.95(1-2):p.260-269. 13.Feng,H.,et al.,Mouse models of GNAO1-associated movement disorder:Allele-and sex-specific differences in phenotypes.PLoS One,2019.14(1):p.e0211066. 14.McCombe,P.A.and R.D.Henderson,Effects of gender in amyotrophic lateral sclerosis.Gend Med,2010.7(6):p.557-70. 15.Watkins,J.,et al.,Female sex mitigates motor and behavioural phenotypes in TDP-43(Q331K)knock-in mice.Sci Rep,2020.10(1):p.19220. 16.Sala Frigerio,C.,et al.,The Major Risk Factors for Alzheimer’s Disease:Age,Sex,and Genes Modulate the Microglia Response to Aβ Plaques.Cell Rep,2019.27(4):p.1293-1306.e6.

Claims

1. An isolated nucleic acid molecule comprising a transcription cassette containing a promoter adapted for expression in mammalian neurons, wherein the cassette further comprises a nucleic acid molecule containing a nucleotide sequence encoding at least one protein of the AP-4 complex.

2. A nucleic acid molecule comprising a nucleotide sequence, wherein the nucleotide sequence is i) A nucleotide sequence or polymorphic sequence variant described in Sequence ID No. 1 (AP4B1), ii) A nucleotide sequence wherein the sequence is degenerate as a result of the gene coding for the nucleotide sequence defined in (i), iii) A nucleic acid molecule wherein its complementary strand hybridizes to the sequence of Sequence ID No. 1 (AP4B1) under stringent hybridization conditions, and the nucleic acid molecule encodes a polypeptide that forms a complex with the polypeptide containing the AP-4 complex, iv) A nucleotide sequence encoding a polypeptide containing the amino acid sequence represented in Sequence ID No. 2 (AP4B1), v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue represented in iv), and the polypeptide forms a complex with the polypeptide comprising the AP-4 complex, An isolated nucleic acid molecule according to claim 1, selected from the group consisting of the following.

3. A nucleic acid molecule comprising a nucleotide sequence, wherein the nucleotide sequence is i) A nucleotide sequence or polymorphic sequence variant described in Sequence ID No. 3 (AP4E1), ii) A nucleotide sequence wherein the sequence is degenerate as a result of the gene coding for the nucleotide sequence defined in (i), iii) A nucleic acid molecule wherein its complementary strand hybridizes to the sequence of Sequence ID No. 3 (AP4E1) under stringent hybridization conditions, and the nucleic acid molecule encodes a polypeptide that forms a complex with the polypeptide containing the AP-4 complex, iv) A nucleotide sequence encoding a polypeptide containing the amino acid sequence represented by Sequence ID No. 4 (AP4E1), v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue represented in iv), and the polypeptide forms a complex with the polypeptide comprising the AP-4 complex, An isolated nucleic acid molecule according to claim 1, selected from the group consisting of the following.

4. A nucleic acid molecule comprising a nucleotide sequence, wherein the nucleotide sequence is i) A nucleotide sequence or polymorphic sequence variant described in Sequence ID No. 5 (AP4M1), ii) A nucleotide sequence wherein the sequence is degenerate as a result of the gene coding for the nucleotide sequence defined in (i), iii) A nucleic acid molecule wherein its complementary strand hybridizes to the sequence of Sequence ID No. 5 (AP4M1) under stringent hybridization conditions, and the nucleic acid molecule encodes a polypeptide that forms a complex with the polypeptide containing the AP-4 complex, iv) A nucleotide sequence encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 6 (AP4M1), v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue represented in iv), and the polypeptide forms a complex with the polypeptide comprising the AP-4 complex, An isolated nucleic acid molecule according to claim 1, selected from the group consisting of the following.

5. A nucleic acid molecule comprising a nucleotide sequence, wherein the nucleotide sequence is i) A nucleotide sequence or polymorphic sequence variant described in Sequence ID No. 7 (AP4S1), ii) A nucleotide sequence wherein the sequence is degenerate as a result of the gene coding for the nucleotide sequence defined in (i), iii) A nucleic acid molecule wherein its complementary strand hybridizes to the sequence of Sequence ID No. 7 (AP4S1) under stringent hybridization conditions, and the nucleic acid molecule encodes a polypeptide that forms a complex with the polypeptide containing the AP-4 complex, iv) A nucleotide sequence encoding a polypeptide containing the amino acid sequence represented by Sequence ID No. 8 (AP4S1), v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue represented in iv), and the polypeptide forms a complex with the polypeptide comprising the AP-4 complex, An isolated nucleic acid molecule according to claim 1, selected from the group consisting of the following.

6. The isolated nucleic acid molecule according to any one of claims 1 to 5, wherein the cassette is adapted for expression in a motor neuron.

7. The isolated nucleic acid molecule according to claim 6, wherein the promoter is selected from the group consisting of a neuron and glial-specific promoter comprising a chicken beta-actin (CBA) promoter, a chicken beta-actin hybrid promoter (CBh), a CAG promoter, synapsin 1, Hb9, MeP229, and GFAP promoter sequences, and an AP-4 subunit-specific promoter region comprising AP4B1, AP4E1, AP4M1, and AP4S1.

8. The isolated nucleic acid molecule according to claim 7, wherein the promoter sequence comprises a nucleic acid molecule containing a nucleotide sequence that is the nucleotide sequence described in SEQ ID NO: 27, or a polymorphic sequence variant of SEQ ID NO:

27.

9. An expression vector comprising an isolated nucleic acid molecule according to any one of claims 1 to 8.

10. The expression vector according to claim 9, wherein the expression vector is a virus-based expression vector.

11. The expression vector according to claim 10, wherein the virus-based vector is AAV9.

12. The expression vector according to claim 10, wherein the virus-based vector is a lentiviral vector.

13. The expression vector according to claim 9, wherein the virus-based vector comprises the nucleotide sequence described in Sequence ID No. 19 (AP4B1).

14. The expression vector according to claim 9, wherein the virus-based vector comprises the nucleotide sequence described in Sequence ID No. 20 (AP4B1).

15. The expression vector according to claim 9, wherein the virus-based vector comprises the nucleotide sequence described in Sequence ID No. 21 (AP4S1).

16. The expression vector according to claim 9, wherein the virus-based vector comprises the nucleotide sequence described in Sequence ID No. 22 (AP4S1).

17. The expression vector according to claim 9, wherein the virus-based vector comprises the nucleotide sequence described in Sequence ID No. 23 (AP4E1).

18. The expression vector according to claim 9, wherein the virus-based vector comprises the nucleotide sequence described in Sequence ID No. 24 (AP4E1).

19. The expression vector according to any one of claims 9 to 12, wherein the virus-based vector further comprises the nucleotide sequence described in SEQ ID NO: 25 or 26.

20. A pharmaceutical composition comprising an expression vector according to any one of claims 9 to 19 and an excipient or carrier.

21. An expression vector according to any one of claims 9 to 19, for use as a pharmaceutical product.

22. An expression vector according to any one of claims 9 to 19, for use in the treatment of AP-4 hereditary spastic paraplegia (AP-4-HSP).

23. The expression vector used according to claim 22, wherein the AP-4-HSP is SPG47, SPG50, SPG51, or SPG52.

24. Cells transfected with the expression vector described in any one of claims 9 to 19.

25. The cell according to claim 24, wherein the cell is a neuron.

26. The cell according to claim 25, wherein the cell is a motor neuron.

27. A method for treating or preventing AP-4 hereditary spastic paraplegia (HSP), comprising administering a therapeutically effective amount of the expression vector described in any one of claims 9 to 19 to prevent and / or treat AP-4-HSP.

28. The method according to claim 27, wherein the AP-4-HSP is SPG47, SPG50, SPG51, or SPG52.

29. A diagnostic method for determining whether a subject has a genotype and whether the subject has mutations in one or more AP-4 gene sequences, i) A step of obtaining a biological sample from the subject to be tested and extracting nucleic acids from the biological sample, ii) The step of sequencing the nucleic acid to obtain the nucleotide sequences of AP4B1, AP4E1, AP4M1, and AP4S1 in the subject, iii) A step of comparing the obtained genome sequence with a normal, matching control nucleotide sequence to identify differences in the nucleotide sequence, iv) A diagnostic method comprising the step of determining whether the test sample is modified in the AP-4 gene sequence and whether the modification is related to AP-4-HSP.

30. The diagnostic method according to claim 29, wherein the method further comprises administering at least one expression vector according to any one of claims 9 to 19 for preventing or treating AP-4-HSP.

31. The diagnostic method according to claim 29 or 30, wherein the AP-4-HSP is selected from the group consisting of SPG47, SPG50, SPG51, and SPG52.

32. The diagnostic method according to any one of claims 29 to 31, wherein the genome sequence includes SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7, or a polymorphic sequence variant thereof.

33. It is a transfer cassette, A transcription cassette comprising a first nucleic acid molecule containing the nucleotide sequence described in Sequence ID No. 27, or a nucleotide sequence that is a polymorphic sequence variant of Sequence ID No. 27, wherein the nucleic acid molecule is a transcription promoter and is operably linked to a second nucleic acid molecule containing a nucleotide sequence encoding a polypeptide, and the first nucleic acid molecule regulates the transcription of the second nucleic acid molecule.

34. The transcription cassette according to claim 33, wherein the first nucleic acid molecule comprises or consists of the nucleotide sequence described in Sequence ID No.

27.

35. The transcription cassette according to claim 33 or 34, wherein the second nucleic acid molecule comprises a nucleotide sequence encoding at least one polypeptide of the AP-4 complex.

36. The transcription cassette according to claim 35, wherein the second nucleic acid molecule includes or consists of the nucleotide sequence represented in Sequence ID No. 1 or a polymorphic sequence variant thereof.

37. The transcription cassette according to claim 35, wherein the nucleic acid molecule includes or consists of the nucleotide sequence represented in Sequence ID No. 3 or a polymorphic sequence variant thereof.

38. The transcription cassette according to claim 35, wherein the nucleic acid molecule includes or consists of the nucleotide sequence represented by Sequence ID No. 5 or a polymorphic sequence variant thereof.

39. The transcription cassette according to claim 35, wherein the nucleic acid molecule includes or consists of the nucleotide sequence represented in Sequence ID No. 7 or a polymorphic sequence variant thereof.

40. An expression vector comprising a transcription cassette according to any one of claims 33 to 39.

41. The expression vector according to claim 40, wherein the expression vector is a virus-based expression vector.

42. The expression vector according to claim 41, wherein the virus-based vector is AAV9.

43. The expression vector according to claim 41, wherein the virus-based vector is a lentiviral vector.