Chimeric polypeptides and methods for altering their localization in cell membranes
Reversible extracellular membrane localization of chimeric polypeptides using hormones regulates CAR T cell toxicity, addressing unregulated toxicity in cancer treatments and enhancing therapeutic efficacy.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- CELL DESIGN LABS INC
- Filing Date
- 2026-01-29
- Publication Date
- 2026-05-26
AI Technical Summary
Unregulated toxicity associated with chimeric antigen receptor (CAR) anti-cancer activity in clinical treatments is a limiting factor.
Reversible extracellular membrane localization of chimeric polypeptides, such as single-chain and multi-chain chimeric antigen receptors, is achieved by contacting mammalian cells with hormones or hormone analogs, allowing for controlled expression of antigen-binding domains on the cell surface.
Regulates CAR T cell toxicity by modulating the presence or absence of antigen-binding moieties on the plasma membrane, effectively controlling the elimination of cancer cells while minimizing toxic effects.
Smart Images

Figure 2026086503000001_ABST
Abstract
Description
Technical Field
[0001] [Cross - Reference to Related Applications] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 477,733, filed on March 28, 2017, and U.S. Provisional Patent Application No. 62 / 587,262, filed on November 16, 2017. The entire contents of these applications are incorporated herein by reference.
[0002] This disclosure relates to the field of biotechnology, and more particularly to the regulation of the cellular localization of chimeric polypeptides.
Background Art
[0003] Chimeric antigen receptors (CARs) are a subclass of single - chain and multi - chain polypeptides. Chimeric antigen receptors typically include, for example, an antigen - binding domain, a transmembrane domain, a co - stimulatory domain, and a CD3ζ or other signaling domain. CARs have been investigated for use in the clinical treatment of various cancers in mammals, such as blood cancers, and have achieved considerable success. However, unregulated toxicity associated with CAR anti - cancer activity has been a limiting factor.
[0004] Nuclear hormone receptors are a group of polypeptides that contain several domains including a DNA - binding motif and a ligand - binding domain. In the absence of a ligand, native nuclear hormone receptors associate with various chaperones and other interacting proteins that sequester the nuclear hormone receptor outside the nucleus. Ligand binding induces conformational and interaction partner changes in the nuclear hormone receptor, enabling nuclear translocation and transcriptional activation, or repression of nuclear hormone target genes. The classical view of steroid signaling is that these hormones bind to intracellular receptors that act as ligand - activated transcription factors, but it has been reported that steroids can also act at the cell surface by non - genomic mechanisms.
Summary of the Invention
[0005] This disclosure is based, at least in part, on the discovery that the reversible extracellular membrane localization of chimeric polypeptides containing transmembrane domains can be utilized in medical applications where the reversible expression of a target protein or peptide on the extracellular membrane is desirable. An example of the features of this disclosure is that CAR T cell-associated toxicity can be regulated by reversibly expressing the antigen-binding domain of CAR on the surface of the T cells.
[0006] This disclosure is further based, at least in part, on the finding that if the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other or separated by 1 to about 700 amino acids (e.g., 1 to about 500 amino acids), and both the transmembrane domain and the hormone receptor ligand-binding domain are not present in the same endogenous single-chain polypeptide (e.g., single-chain chimeric antigen receptor) in mammals, then contacting the mammalian cell with a hormone or hormone analog can modulate the plasma membrane localization or extracellular membrane localization of the chimeric polypeptide containing the transmembrane domain and the hormone receptor ligand-binding domain in mammalian cells. In consideration of this finding, single-chain chimeric polypeptides, single-chain chimeric antigen receptors and multi-chain chimeric antigen receptors; encoding nucleic acids; vectors containing any of these nucleic acids; mammalian cells containing any of these vectors; and methods for reversibly inducing extracellular membrane localization, as well as methods for altering the membrane localization of these single-chain chimeric polypeptides, single-chain chimeric antigen receptors and multi-chain chimeric polypeptides.
[0007] In some embodiments, reversibly inducing plasma or extracellular membrane localization of polypeptides (e.g., single-chain chimeric polypeptides, single-chain chimeric antigen receptors, and / or multi-chain chimeric antigen receptors) using one or more compositions or methods disclosed herein is useful in the field of cell-based adoptive immunotherapy, in which immune cells isolated from a subject may be modified to express synthetic proteins, and then, after being returned to the subject, these cells can perform new therapeutic functions. Non-limiting examples of such synthetic proteins include chimeric antigen receptors (CARs) and engineered T cell receptors (TCRs).
[0008] In some embodiments, reversibly inducing the plasma membrane localization or extracellular membrane localization of polypeptides (e.g., single-chain chimeric polypeptides, single-chain chimeric antigen receptors, and / or multi-chain chimeric antigen receptors) by using one or more compositions or methods disclosed herein is useful for controlling the toxic effects of chimeric antigen receptor T cells (CAR-T cells) involved in the elimination of cancer cells by regulating the presence or absence of antigen-binding moieties on the cell's plasma membrane or extracellular membrane.
[0009] This specification provides single-chain chimeric polypeptides comprising a transmembrane domain and a hormone receptor ligand-binding domain, wherein the transmembrane domain and the hormone receptor ligand-binding domain are either directly in contact with each other or separated by 1 to 500 amino acids, and neither the transmembrane domain nor the hormone receptor ligand-binding domain is present in the same endogenous single-chain polypeptide in mammals. In some embodiments of any single-chain chimeric polypeptides described herein, the transmembrane domain is derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154. In some embodiments of any single-chain chimeric polypeptides described herein, the hormone receptor ligand-binding domain is derived from the estrogen receptor, progesterone receptor, or androgen receptor. In some embodiments of any single-chain chimeric polypeptide described herein, the hormone receptor ligand-binding domain is a ligand-binding domain derived from the estrogen receptor.
[0010] In some embodiments of any single-chain chimeric polypeptide described herein, the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other. In some embodiments of any single-chain chimeric polypeptide described herein, the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 500 amino acids (e.g., 1 to 250 amino acids, or about 1 to 50 amino acids).
[0011] Furthermore, this specification provides nucleic acids comprising nucleotide sequences encoding any of the single-chain chimeric polypeptides described herein. Furthermore, this specification provides vectors comprising nucleic acids comprising nucleotide sequences encoding any of the single-chain chimeric polypeptides described herein. Furthermore, this specification provides mammalian cells comprising any of the vectors described herein.
[0012] Furthermore, this specification provides a method for inducing membrane localization of single-chain chimeric polypeptides in mammalian cells, comprising contacting mammalian cells expressing any of the single-chain chimeric polypeptides described herein with a sufficient amount of hormone or hormone analogue to induce localization of the single-chain chimeric polypeptide to the extracellular region of the cell's plasma membrane.
[0013] Furthermore, the present invention provides a method for reversibly altering the membrane localization of single-chain chimeric polypeptides in mammalian cells, comprising (a) contacting mammalian cells expressing any of the single-chain chimeric polypeptides described herein with a sufficient amount of a hormone or hormone analog to induce localization of the single-chain chimeric polypeptide to the extracellular side of the cell's plasma membrane, and (b) contacting the mammalian cells with a reduced amount of the hormone or hormone analog to cause a decrease in the level of single-chain chimeric polypeptide on the extracellular side of the cell's plasma membrane. Some embodiments of any of the methods described herein further comprise (c) contacting the mammalian cells with an increased amount of the hormone or hormone analog to cause an increase in the level of single-chain chimeric polypeptide on the extracellular side of the cell's plasma membrane compared to the level in step (b).
[0014] Some embodiments of any of the methods described herein further include introducing nucleic acids encoding single-chain chimeric polypeptides into mammalian cells to produce mammalian cells that express single-chain chimeric polypeptides. In some embodiments of any of the methods described herein, the mammalian cells are T cells (e.g., CD8 + T cells, CD4 +These are T cells selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
[0015] In some embodiments of any of the methods described herein, the mammalian cells are mammalian cells previously obtained from a subject. In some embodiments of any of the methods described herein, the subject has been identified or diagnosed with cancer. Some embodiments of any of the methods described herein further include obtaining mammalian cells from a subject. In some embodiments of any of the methods described herein, the contact step is performed in vitro. In some embodiments of any of the methods described herein, the contact step is performed in a mammal.
[0016] Furthermore, this specification provides a single-chain chimeric antigen receptor comprising an extracellular antigen-binding domain, a transmembrane domain, a hormone receptor ligand-binding domain, a costimulatory domain, and an immunoreceptor-activating tyrosine motif (ITAM), wherein the transmembrane domain and the hormone receptor ligand-binding domain are either in direct contact with each other or separated by 1 to 500 amino acids, and neither the transmembrane domain nor the hormone receptor ligand-binding domain exists in the same endogenous single-chain polypeptide in mammals. In some embodiments of any single-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain is scFv, (scFv)2, V H H domain and V NAR The domain is selected from a group of domains. In some embodiments of any single-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain is scFv.
[0017] In some embodiments of the single-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain specifically binds to a single antigen. In some embodiments of the single-chain chimeric antigen receptor described herein, the single antigen is a tumor antigen. In some embodiments of the single-chain chimeric antigen receptor described herein, the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16. In some embodiments of the single-chain chimeric antigen receptor described herein, the tumor antigen is CD19. In some embodiments of the single-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain specifically binds to two different antigens.
[0018] In some embodiments of the single-chain chimeric antigen receptors described herein, the transmembrane domain is the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD The transmembrane domain is derived from 45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154. In some embodiments of the single-chain chimeric antigen receptors described herein, the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor, progesterone receptor, or androgen receptor. In some embodiments of the single-chain chimeric antigen receptors described herein, the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor.
[0019] In some embodiments of the single-chain chimeric antigen receptors described herein, the costimulatory domain is a cytoplasmic costimulatory domain derived from CD27, CD28, 4-1BB, OX40, CD30, CD40L, CD40, PD-1, PD-L1, ICOS, LFA-1, CD2, CD7, CD160, LIGHT, BTLA, TIM3, CD244, CD80, LAG3, NKG2C, and B7-H3. In some embodiments of the single-chain chimeric antigen receptors described herein, the costimulatory domain is 4-1BB or CD28. In some embodiments of the single-chain chimeric antigen receptors described herein, ITAM includes a cytoplasmic signaling sequence derived from CD3ζ.
[0020] In some embodiments of the single-chain chimeric antigen receptors described herein, the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other. In some embodiments of the single-chain chimeric antigen receptors described herein, the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 500 amino acids (e.g., 1 to 250 amino acids or 1 to 50 amino acids).
[0021] Furthermore, this specification provides nucleic acids comprising nucleotide sequences encoding one of the single-chain chimeric antigen receptors described herein. This specification also provides vectors comprising nucleic acids comprising nucleotide sequences encoding one of the single-chain chimeric antigen receptors described herein. Furthermore, this specification provides mammalian cells comprising one of the vectors described herein.
[0022] Furthermore, the present specification provides a method for inducing membrane localization of single-chain chimeric antigen receptors in mammalian cells, comprising contacting mammalian cells expressing any of the single-chain chimeric antigen receptors described herein with a sufficient amount of hormone or hormone analogue to induce localization of the single-chain chimeric antigen-binding receptor to the extracellular side of the cell's plasma membrane.
[0023] Furthermore, this specification provides methods for altering the membrane localization of single-chain chimeric antigen receptors in mammalian cells, comprising: (a) contacting mammalian cells expressing any of the single-chain chimeric antigen receptors described herein with a sufficient amount of hormone or hormone analogue to induce localization of the single-chain chimeric antigen receptor to the extracellular side of the cell's plasma membrane; and (b) contacting the mammalian cells with an amount of hormone or hormone analogue that results in a decrease in the level of single-chain chimeric antigen receptor to the extracellular side of the cell's plasma membrane. Some embodiments of these methods further include (c) contacting the mammalian cells with an amount of hormone or hormone analogue that results in an increase in the level of single-chain chimeric antigen receptor to the extracellular side of the cell's plasma membrane compared to the level in (b).
[0024] Some embodiments of any of the methods described herein further include introducing a nucleic acid encoding a single-chain chimeric antigen receptor into mammalian cells to produce mammalian cells expressing the single-chain chimeric antigen receptor. In some embodiments of any of the methods described herein, the mammalian cells are T cells. In some embodiments of any of the methods described herein, the T cells are CD8 + T cells, CD4 + The cells are selected from the following groups: T cells, memory T cells, Treg cells, and natural killer T cells.
[0025] In some embodiments of any of the methods described herein, the mammalian cells are mammalian cells previously obtained from a subject. In some embodiments of any of the methods described herein, the subject has been identified or diagnosed with cancer. In some embodiments of any of the methods described herein, the process of obtaining mammalian cells from a subject further includes obtaining mammalian cells from a subject. In some embodiments of any of the methods described herein, the contact step is performed in vitro. In some embodiments of any of the methods described herein, the contact step is performed in a mammal. In some embodiments of any of the methods described herein, the mammal has cancer. In some embodiments of any of the methods described herein, the contact step results in the treatment of cancer in the mammal.
[0026] Furthermore, this specification provides a multi-chain chimeric antigen receptor comprising at least one first polypeptide including an extracellular antigen-binding domain, a transmembrane domain, and a hormone receptor ligand-binding domain, wherein the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other or separated by 1 to 500 amino acids, and both the transmembrane domain and the hormone receptor ligand-binding domain are not present in the same endogenous single-chain polypeptide in mammals. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the extracellular antigen-binding domain is scFv, (scFv)2, V H H domain and V NAR The domains are selected from the group consisting of domains. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the extracellular antigen-binding domain is scFv.
[0027] In some embodiments of the multi-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain specifically binds to a single antigen. In some embodiments of the multi-chain chimeric antigen receptor described herein, the single antigen is a tumor antigen. In some embodiments of the multi-chain chimeric antigen receptor described herein, the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16. In some embodiments of the multi-chain chimeric antigen receptor described herein, the tumor antigen is CD19. In some embodiments of the multi-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain specifically binds to two different antigens.
[0028] In some embodiments of the multi-chain chimeric antigen receptors described herein, the transmembrane domain is a transmembrane domain derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154. In some embodiments of the multi-chain chimeric antigen receptors described herein, the hormone receptor ligand-binding domain is a ligand-binding domain derived from the estrogen receptor, progesterone receptor, or androgen receptor. In some embodiments of the multi-chain chimeric antigen receptors described herein, the hormone receptor ligand-binding domain is a ligand-binding domain derived from the estrogen receptor.
[0029] In some embodiments of any multi-chain chimeric antigen receptors described herein, the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other. In some embodiments of any multi-chain chimeric antigen receptors described herein, the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 500 amino acids (e.g., 1 to 250 amino acids or 1 to 50 amino acids).
[0030] In some embodiments of any of the multi-chain chimeric antigen receptors described herein, at least one polypeptide further comprises a costimulatory domain. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the costimulatory domain is a cytoplasmic costimulatory domain derived from CD27, CD28, 4-1BB, OX40, CD30, CD40L, CD40, PD-1, PD-L1, ICOS, LFA-1, CD2, CD7, CD160, LIGHT, BTLA, TIM3, CD244, CD80, LAG3, NKG2C, or B7-H3. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the costimulatory domain is 4-1BB or CD28.
[0031] Furthermore, this specification provides a method for inducing membrane localization of multi-chain chimeric antigen receptors in mammalian cells, comprising contacting mammalian cells expressing any of the multi-chain chimeric antigen receptors described herein with a sufficient amount of hormone or hormone analogue to induce localization of the multi-chain chimeric antigen-binding receptor to the extracellular side of the cell's plasma membrane.
[0032] Also provided herein is a method of altering the membrane localization of a multi-chain chimeric antigen receptor in a mammalian cell, comprising: (a) contacting a mammalian cell expressing any of the multi-chain chimeric antigen receptors described herein with an amount of a hormone or hormone analog sufficient to induce the localization of the multi-chain chimeric antigen-binding receptor to the extracellular side of the cell's plasma membrane; and (b) contacting the mammalian cell with an amount of a hormone or hormone analog that results in a decrease in the level of the multi-chain chimeric antigen-binding receptor on the extracellular side of the cell's plasma membrane. Some embodiments of any of the methods described herein further comprise: (c) contacting the mammalian cell with an amount of a hormone or hormone analog that results in an increase in the level of the multi-chain chimeric antigen-binding receptor on the extracellular side of the cell's plasma membrane. Some embodiments of any of the methods described herein further comprise introducing a nucleic acid encoding a single-chain chimeric antigen receptor into the mammalian cell to generate a mammalian cell expressing the single-chain chimeric antigen receptor. In some embodiments of any of the methods described herein, the mammalian cell is a T cell. In some embodiments of any of the methods described herein, the T cell is a CD8 + T cell, a CD4 + T cell, a memory T cell, a Treg cell, and a natural killer T cell selected from the group consisting of.
[0033] In some embodiments of any of the methods described herein, the mammalian cells are mammalian cells previously obtained from a subject. In some embodiments of any of the methods described herein, the subject has been identified or diagnosed with cancer. In some embodiments of any of the methods described herein, the process further includes obtaining mammalian cells from the subject. In some embodiments of any of the methods described herein, the contact step is performed in vitro. In some embodiments of any of the methods described herein, the contact step is performed in a mammal. In some embodiments of any of the methods described herein, the mammal has cancer. In some embodiments of any of the methods described herein, the contact step results in the treatment of cancer in the mammal.
[0034] Furthermore, this specification includes: (a) administering mammalian cells expressing any single-chain chimeric antigen receptor or any multi-chain chimeric antigen receptor as described herein to a subject, wherein the antigen-binding domain specifically binds to antigens expressed by cancer in the subject; (b) administering a sufficient amount of hormone or other hormone to the subject to induce localization of the single-chain or multi-chain chimeric antigen receptor to the extracellular space of the cell's plasma membrane; (c) after (b), identifying in the subject the presence or severity of one or more symptoms associated with toxicity, the level of one or more cytokines associated with a cytokine storm, or both; and (d) identifying the presence or severity of one or more symptoms associated with the identified toxicity, or the level of one or more cytokines associated with the identified cytokine storm. The present invention provides a method for treating cancer in a subject (e.g., a human), comprising comparing (e) or both thereof with a control(s), and (e) after (e), administering to the subject an amount of a hormone or hormone analog sufficient to reduce the level of single-chain or multi-chain chimeric antigen receptors on the extracellular surface of the cell's plasma membrane, such that the presence or severity of one or more symptoms associated with toxicity, the level of one or more cytokines associated with a cytokine storm, or both, in the subject.
[0035] In some embodiments of any of the methods described herein, the amount of hormone or hormone analog administered to the subject in step (e) is reduced by at least 25% compared to the amount of hormone or hormone analog administered to the subject in step (b). In some embodiments of any of the methods described herein, the amount of hormone or hormone analog administered to the subject in step (e) is reduced by at least 50% compared to the amount of hormone or hormone analog administered to the subject in step (b). In some embodiments of any of the methods described herein, the amount of hormone or hormone analog administered to the subject in step (e) is reduced by at least 75% compared to the level of hormone or hormone analog administered to the subject in step (b). In some embodiments of any of the methods described herein, the amount of hormone or hormone analog administered to the subject in step (e) is reduced by 100% compared to the level of hormone or hormone analog administered to the subject in step (b).
[0036] In some embodiments of any of the methods described herein, one or more symptoms associated with toxicity are selected from the group consisting of high fever, swelling, chills, hypotension, tachycardia, weakness, headache, rash, sore throat, dyspnea, redness, extreme fatigue, nausea, and cerebral edema. In some embodiments of these methods, one or more cytokines associated with a cytokine storm are selected from the group consisting of tumor necrosis factor alpha, IFNγ, IL-10, IL-1β, IL-2, IL-6, IL-8, and IL-10, granulocyte-macrophage colony-stimulating factor (GM-CSF), and IL-5.
[0037] Furthermore, this specification provides single-chain chimeric polypeptides comprising an extracellular hormone receptor ligand-binding domain and a transmembrane domain, wherein the hormone receptor ligand-binding domain and the extracellular transmembrane domain are in direct contact with each other or separated by 1 to 700 amino acids, and neither the transmembrane domain nor the extracellular hormone receptor ligand-binding domain is present in a single endogenous single-chain polypeptide in mammals. In some embodiments of any single-chain chimeric polypeptide described herein, the transmembrane domain is derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154. In some embodiments of any single-chain chimeric polypeptide described herein, the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor, a progesterone receptor, or an androgen receptor. In some embodiments of any single-chain chimeric polypeptide described herein, the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor. In some embodiments of any single-chain chimeric polypeptide described herein, the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from a human estrogen receptor. In some embodiments of any single-chain chimeric polypeptide described herein, the ligand-binding domain of a human estrogen receptor has a wild-type sequence, except that it contains one or both of the amino acid substitutions at position 521 and amino acid substitutions at position 537, respectively, numbered with respect to the full-length wild-type sequence of the human hormone receptor.
[0038] In some embodiments of any single-chain chimeric polypeptide described herein, the extracellular hormone receptor ligand-binding domain and the transmembrane domain are in direct contact with each other. In some embodiments of any single-chain chimeric polypeptide described herein, the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 700 amino acids (e.g., 1 to 500 amino acids, 1 to 250 amino acids, 1 to 100 amino acids, 1 to 50 amino acids, or 1 to 25 amino acids).
[0039] In some embodiments of any single-chain chimeric polypeptide described herein, the single-chain chimeric polypeptide comprises, from the N-terminus to the C-terminus, an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, and a transmembrane domain. In some embodiments of any single-chain chimeric polypeptide described herein, the single-chain chimeric polypeptide comprises, from the C-terminus to the N-terminus, an extracellular hormone receptor ligand-binding domain, and a transmembrane domain. In some embodiments of any single-chain chimeric polypeptide described herein, the single-chain chimeric polypeptide comprises, from the N-terminus to the C-terminus, an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, and a transmembrane domain. In some embodiments of any single-chain chimeric polypeptide described herein, the single-chain chimeric polypeptide comprises, from the C-terminus to the N-terminus, an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, and a transmembrane domain.
[0040] Furthermore, this specification provides nucleic acids comprising nucleotide sequences encoding any of the single-chain chimeric polypeptides described herein. Furthermore, this specification provides vectors comprising nucleic acids comprising nucleotide sequences encoding any of the single-chain chimeric polypeptides described herein. Furthermore, this specification provides mammalian cells comprising any of the vectors described herein. In some embodiments of the mammalian cells described herein, the mammalian cells are T cells. In some embodiments of the mammalian cells described herein, the T cells are CD8 + T cells, CD4 + The cells are selected from the following groups: T cells, memory T cells, Treg cells, and natural killer T cells.
[0041] Furthermore, this specification provides a method for inducing plasma membrane localization of single-chain chimeric polypeptides in mammalian cells, comprising (a) contacting mammalian cells expressing any of the single-chain chimeric polypeptides described herein with a sufficient amount of a hormone or hormone analogue to induce the localization of the single-chain chimeric polypeptide to the extracellular region of the cell's plasma membrane.
[0042] Furthermore, this specification provides a method for reversibly altering the plasma membrane localization of single-chain chimeric polypeptides in mammalian cells, comprising: (a) contacting mammalian cells expressing any of the single-chain chimeric polypeptides described herein with a sufficient amount of a hormone or hormone analog to induce the localization of the single-chain chimeric polypeptide to the extracellular region of the cell's plasma membrane; and (b) contacting the mammalian cells with a reduced amount of the hormone or hormone analog to cause a decrease in the level of single-chain chimeric polypeptide on the extracellular region of the cell's plasma membrane. Some embodiments of any of the methods described herein further include (c) contacting the mammalian cells with an increased amount of the hormone or hormone analog to cause an increase in the level of single-chain chimeric polypeptide on the extracellular region of the cell's plasma membrane compared to the level in step (b). Some embodiments of any of the methods described herein further include, prior to step (a), introducing a nucleic acid encoding a single-chain chimeric polypeptide into mammalian cells to produce mammalian cells expressing the single-chain chimeric polypeptide.
[0043] In some embodiments of any of the methods described herein, the mammalian cell is a T cell. In some embodiments of any of the methods described herein, the T cell is CD8 + T cells, CD4 + The cells are selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells. In some embodiments of any of the methods described herein, the mammalian cells are mammalian cells previously obtained from a subject. In some embodiments of any of the methods described herein, the subject has been identified or diagnosed with cancer. Some embodiments of any of the methods described herein further include obtaining mammalian cells from a subject.
[0044] In some embodiments of any of the methods described herein, the contact step(s) is performed in vitro. In some embodiments of any of the methods described herein, the contact step(s) is performed in mammals.
[0045] Furthermore, this specification provides a single-chain chimeric antigen receptor comprising an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, a transmembrane domain, an intracellular costimulatory domain, and an intracellular immunoreceptor-activating tyrosine motif (ITAM), wherein the transmembrane domain and the extracellular hormone receptor ligand-binding domain are in direct contact with each other or separated by 1 to 700 amino acids, and both the transmembrane domain and the extracellular hormone receptor ligand-binding domain are not present in a single endogenous single-chain polypeptide in mammals. In some embodiments of any single-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain is scFv, (scFv)2, V H H domain and V NAR The domains are selected from the group consisting of domains. In some embodiments of any single-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain is scFv.
[0046] In some embodiments of the single-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain specifically binds to a single antigen. In some embodiments of the single-chain chimeric antigen receptor described herein, the single antigen is a tumor antigen. In some embodiments of the single-chain chimeric antigen receptor described herein, the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16. In some embodiments of the single-chain chimeric antigen receptor described herein, the tumor antigen is CD19. In some embodiments of the single-chain chimeric antigen receptor described herein, the extracellular antigen-binding domain specifically binds to two different antigens. In some embodiments of the single-chain chimeric antigen receptor described herein, at least one of the two different antigens is a tumor antigen. In some embodiments of the single-chain chimeric antigen receptors described herein, the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16. In some embodiments of the single-chain chimeric antigen receptors described herein, the tumor antigen is CD19.
[0047] In some embodiments of the single-chain chimeric antigen receptors described herein, the transmembrane domain is a transmembrane domain derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154. In some embodiments of the single-chain chimeric antigen receptors described herein, the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from the estrogen receptor, progesterone receptor, or androgen receptor. In some embodiments of the single-chain chimeric antigen receptors described herein, the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from the estrogen receptor. In some embodiments of the chimeric antigen receptor, the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from the human estrogen receptor. In some embodiments of the single-chain chimeric antigen receptor described herein, the ligand-binding domain of the human estrogen receptor has a wild-type sequence, except that it contains one or both of the amino acid substitutions at position 521 and amino acid substitution at position 537, respectively, which are numbered with respect to the full-length wild-type sequence of the human hormone receptor.
[0048] In some embodiments of the single-chain chimeric antigen receptors described herein, the intracellular costimulatory domain is a cytoplasmic costimulatory domain derived from CD27, CD28, 4-1BB, OX40, CD30, CD40L, CD40, PD-1, PD-L1, ICOS, LFA-1, CD2, CD7, CD160, LIGHT, BTLA, TIM3, CD244, CD80, LAG3, NKG2C, or B7-H3. In some embodiments of the single-chain chimeric antigen receptors described herein, the intracellular costimulatory domain is a cytoplasmic costimulatory domain derived from 4-1BB or CD28. In some embodiments of the single-chain chimeric antigen receptors described herein, the intracellular ITAM includes a cytoplasmic signaling sequence derived from CD3ζ.
[0049] In some embodiments of the single-chain chimeric antigen receptors described herein, the extracellular hormone receptor ligand-binding domain and the transmembrane domain are in direct contact with each other. In some embodiments of the single-chain chimeric antigen receptors described herein, the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 700 amino acids (e.g., 1 to 500 amino acids, 1 to 250 amino acids, 1 to 100 amino acids, 1 to 50 amino acids, or 1 to 25 amino acids).
[0050] In some embodiments of the single-chain chimeric antigen receptor described herein, the single-chain chimeric antigen receptor comprises, from the N-terminus to the C-terminus, an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, a transmembrane domain, an intracellular costimulatory domain, and an ITAM. In some embodiments of the single-chain chimeric antigen receptor described herein, the single-chain chimeric antigen receptor comprises, from the C-terminus to the N-terminus, an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, a transmembrane domain, an intracellular costimulatory domain, and an ITAM. In some embodiments of the single-chain chimeric antigen receptor described herein, the single-chain chimeric antigen receptor comprises, from the N-terminus to the C-terminus, an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, a transmembrane domain, an intracellular costimulatory domain, and an ITAM. In some embodiments of the single-chain chimeric antigen receptors described herein, the single-chain chimeric polypeptide comprises, from C-terminus to N-terminus, an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, a transmembrane domain, an intracellular costimulatory domain, and an ITAM.
[0051] Furthermore, this specification provides nucleic acids comprising nucleotide sequences encoding one of the single-chain chimeric antigen receptors described herein. Furthermore, this specification provides vectors comprising nucleic acids comprising nucleotide sequences encoding one of the single-chain chimeric antigen receptors described herein. Furthermore, this specification provides mammalian cells comprising one of the vectors described herein. In some embodiments of the mammalian cells described herein, the mammalian cells are T cells. In some embodiments of the mammalian cells described herein, the T cells are CD8 + T cells, CD4 + The cells are selected from the following groups: T cells, memory T cells, Treg cells, and natural killer T cells.
[0052] Furthermore, (a) in order to induce the localization of a single-chain chimeric antigen-binding receptor to the extracellular side of the plasma membrane of a mammalian cell expressing any of the single-chain chimeric antigen receptors described herein The present invention provides a method for inducing plasma membrane localization of single-chain chimeric antigen receptors in mammalian cells, comprising contacting them with a sufficient amount of a hormone or hormone analog.
[0053] Furthermore, this specification provides a method for altering the plasma membrane localization of single-chain chimeric antigen receptors in mammalian cells, comprising: (a) contacting mammalian cells expressing any of the single-chain chimeric antigen receptors described herein with a sufficient amount of a hormone or hormone analog to induce localization of the single-chain chimeric antigen receptor to the extracellular side of the cell's plasma membrane; and (b) contacting the mammalian cells with an amount of a hormone or hormone analog that results in a decrease in the level of single-chain chimeric antigen receptors on the extracellular side of the cell's plasma membrane. Some embodiments of any of the methods described herein further include (c) contacting the mammalian cells with an amount of a hormone or hormone analog that results in an increase in the level of single-chain chimeric antigen receptors on the extracellular side of the cell's plasma membrane compared to the level in (b). Some embodiments of any of the methods described herein further include, prior to step (a), introducing a nucleic acid encoding a single-chain chimeric antigen receptor into mammalian cells to produce mammalian cells expressing a single-chain chimeric antigen receptor.
[0054] In some embodiments of any of the methods described herein, the mammalian cell is a T cell. In some embodiments of any of the methods described herein, the T cell is a CD8 + T cells, CD4 +The cells are selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells. In some embodiments of any of the methods described herein, the mammalian cells are mammalian cells previously obtained from a subject. In some embodiments of any of the methods described herein, the subject has been identified or diagnosed with cancer. Some embodiments of any of the methods described herein further include obtaining mammalian cells from a subject. In some embodiments of any of the methods described herein, the contact step(s) is performed in vitro. In some embodiments of any of the methods described herein, the contact step(s) is performed in a mammal. In some embodiments of any of the methods described herein, the mammal has cancer. In some embodiments of any of the methods described herein, the contact step results in the treatment of cancer in the mammal.
[0055] Furthermore, this specification provides a multi-chain chimeric antigen receptor comprising at least one first polypeptide including an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, and a transmembrane domain, wherein the transmembrane domain and the extracellular hormone receptor ligand-binding domain are in direct contact with each other or separated by 1 to 700 amino acids, and neither the transmembrane domain nor the extracellular hormone receptor ligand-binding domain exists in a single endogenous single-chain polypeptide in mammals. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the extracellular antigen-binding domain is scFv, (scFv)2, V H H domain and V NAR The domains are selected from the group consisting of domains. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the extracellular antigen-binding domain is scFv.
[0056] In some embodiments of the multi-chain chimeric antigen receptors described herein, the extracellular antigen-binding domain specifically binds to a single antigen. In some embodiments of the multi-chain chimeric antigen receptors described herein, the single antigen is a tumor antigen. In some embodiments of the multi-chain chimeric antigen receptors described herein, the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16. In some embodiments of the multi-chain chimeric antigen receptors described herein, the tumor antigen is CD19. In one embodiment, the extracellular antigen-binding domain specifically binds to two different antigens. In some embodiments of the multi-chain chimeric antigen receptor described herein, at least one of the two different antigens is a tumor antigen. In some embodiments of the multi-chain chimeric antigen receptor described herein, the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16. In some embodiments of the multi-chain chimeric antigen receptor described herein, the tumor antigen is CD19.
[0057] In some embodiments of the multi-chain chimeric antigen receptors described herein, the transmembrane domain is a transmembrane domain derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154. In some embodiments of the multi-chain chimeric antigen receptors described herein, the hormone receptor ligand-binding domain is a ligand-binding domain derived from the estrogen receptor, progesterone receptor, or androgen receptor. In some embodiments of the multi-chain chimeric antigen receptors described herein, the hormone receptor ligand-binding domain is a ligand-binding domain derived from the estrogen receptor. In some embodiments of the multi-chain chimeric antigen receptors described herein, the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from the human estrogen receptor. In some embodiments of the multi-chain chimeric antigen receptors described herein, the ligand-binding domain of the human estrogen receptor has a wild-type sequence, except that it includes one or both of the amino acid substitutions at position 521 and amino acid substitutions at position 537, which are numbered with respect to the full-length wild-type sequence of the human hormone receptor.
[0058] In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the extracellular hormone receptor ligand-binding domain and the transmembrane domain are in direct contact with each other. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 700 amino acids (e.g., 1 to 500 amino acids, 1 to 250 amino acids, 1 to 100 amino acids, 1 to 50 amino acids, or 1 to 25 amino acids).
[0059] In some embodiments of any of the multi-chain chimeric antigen receptors described herein, at least one polypeptide further comprises an intracellular costimulatory domain. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the intracellular costimulatory domain is a cytoplasmic costimulatory domain derived from CD27, CD28, 4-1BB, OX40, CD30, CD40L, CD40, PD-1, PD-L1, ICOS, LFA-1, CD2, CD7, CD160, LIGHT, BTLA, TIM3, CD244, CD80, LAG3, NKG2C, or B7-H3. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, the intracellular costimulatory domain is a cytoplasmic costimulatory domain derived from 4-1BB or CD28.
[0060] In some embodiments of any of the multi-chain chimeric antigen receptors described herein, at least one first polypeptide comprises, from the N-terminus to the C-terminus, an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, and a transmembrane domain. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, at least one first polypeptide comprises, from the C-terminus to the N-terminus, an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, and a transmembrane domain. In some embodiments of any of the multi-chain chimeric antigen receptors described herein, at least In any of the embodiments of the multi-chain chimeric antigen receptors described herein, at least one first polypeptide comprises, from the N-terminus to the C-terminus, an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, and a transmembrane domain.
[0061] Furthermore, this specification provides nucleic acids encoding any of the multi-chain chimeric antigen receptors described herein. Furthermore, this specification provides a set of nucleic acids co-encoding any of the multi-chain chimeric antigen receptors described herein. Furthermore, this specification provides mammalian cells comprising nucleic acids encoding any of the multi-chain chimeric antigen receptors described herein. Furthermore, this specification provides mammalian cells comprising a set of nucleic acids co-encoding any of the multi-chain chimeric antigen receptors described herein. In some embodiments of the mammalian cells described herein, the mammalian cells are T cells. In some embodiments of the mammalian cells described herein, the T cells are CD8 + T cells, CD4 + The cells are selected from a group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
[0062] Furthermore, this specification provides a method for inducing plasma membrane localization of a multi-chain chimeric antigen receptor in mammalian cells, comprising (a) contacting mammalian cells expressing any of the multi-chain chimeric antigen receptors described herein with a sufficient amount of a hormone or hormone analogue to induce localization of the multi-chain chimeric antigen-binding receptor to the extracellular side of the cell's plasma membrane.
[0063] Furthermore, this specification provides a method for altering the plasma membrane localization of multi-chain chimeric antigen receptors in mammalian cells, comprising: (a) contacting mammalian cells expressing any of the multi-chain chimeric antigen receptors described herein with a sufficient amount of hormone or hormone analogue to induce localization of the multi-chain chimeric antigen receptor to the extracellular side of the cell's plasma membrane; and (b) contacting mammalian cells with an amount of hormone or hormone analogue that results in a decrease in the level of multi-chain chimeric antigen receptor to the extracellular side of the cell's plasma membrane. Some embodiments of any of the methods described herein further include (c) contacting mammalian cells with an amount of hormone or hormone analogue that results in an increase in the level of multi-chain chimeric antigen receptor to the extracellular side of the cell's plasma membrane. Some embodiments of any of the methods described herein further include, prior to step (a), introducing a nucleic acid encoding a multi-chain chimeric antigen receptor or a pair of nucleic acids that co-encode a multi-chain chimeric antigen receptor into mammalian cells to produce mammalian cells expressing a multi-chain chimeric antigen receptor. In some embodiments of any of the methods described herein, the mammalian cell is a T cell. In some embodiments of any of the methods described herein, the T cell is a CD8 + T cells, CD4 +The cells are selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells. In some embodiments of any of the methods described herein, the mammalian cells are mammalian cells previously obtained from a subject. In some embodiments of any of the methods described herein, the subject has been identified or diagnosed with cancer. Some embodiments of any of the methods described herein further include obtaining mammalian cells from a subject. In some embodiments of any of the methods described herein, the contact step is performed in vitro. In some embodiments of any of the methods described herein, the contact step is performed in a mammal. In some embodiments of any of the methods described herein, the mammal has cancer. In some embodiments of any of the methods described herein, the contact step results in the treatment of cancer in the mammal.
[0064] Furthermore, in this specification, (a) mammalian cells expressing any of the single-chain chimeric antigen receptors described herein or any of the multi-chain chimeric antigen receptors described herein are A method for treating cancer in a subject is provided, comprising: (b) administering to a subject a hormone or hormone analogue in an amount sufficient to induce localization of single-chain or multi-chain chimeric antigen receptors to the extracellular side of the plasma membrane of cells; (c) after (b), identifying in the subject the presence or severity of one or more symptoms associated with toxicity, or the level of one or more cytokines associated with a cytokine storm, or both; (d) comparing the identified presence or severity of one or more symptoms associated with toxicity, or the level of one or more cytokines associated with a cytokine storm, or both, with a control(s); and (e) after (e), administering to the subject a amount sufficient to reduce the level of single-chain or multi-chain chimeric antigen receptors to the extracellular side of the plasma membrane of cells, so as to reduce the presence or severity of one or more symptoms associated with toxicity, or the level of one or more cytokines associated with a cytokine storm, or both.
[0065] In some embodiments of any of the methods described herein, the amount of hormone or hormone analog administered to the subject in step (e) is reduced by at least 25% compared to the amount of hormone or hormone analog administered to the subject in step (b). In some embodiments of any of the methods described herein, the amount of hormone or hormone analog administered to the subject in step (e) is reduced by at least 50% compared to the amount of hormone or hormone analog administered to the subject in step (b). In some embodiments of any of the methods described herein, the amount of hormone or hormone analog administered to the subject in step (e) is reduced by at least 75% compared to the level of hormone or hormone analog administered to the subject in step (b). In some embodiments of any of the methods described herein, the amount of hormone or hormone analog administered to the subject in step (e) is reduced by 100% compared to the level of hormone or hormone analog administered to the subject in step (b).
[0066] In some embodiments of any of the methods described herein, one or more symptoms associated with toxicity are selected from the group consisting of high fever, swelling, chills, hypotension, tachycardia, weakness, headache, rash, sore throat, difficulty breathing, redness, extreme fatigue, nausea, and cerebral edema. In some embodiments of any of the methods described herein, one or more cytokines associated with a cytokine storm are selected from the group consisting of tumor necrosis factor alpha, IFNγ, IL-10, IL-1β, IL-2, IL-6, IL-8, and IL-10, granulocyte-macrophage colony-stimulating factor (GM-CSF), and IL-5.
[0067] The use of the term "a" before a noun means "one or more" of that particular noun. For example, the phrase "a mammalian cell" means "one or more mammalian cells."
[0068] The term "single-chain chimeric polypeptide" means a single-chain polypeptide comprising a first consecutive amino acid sequence (e.g., a first domain) and a second consecutive amino acid sequence (e.g., a second domain), wherein the first and second consecutive amino acid sequences are not present in the same endogenous single-chain polypeptide in mammals. In some examples, the first and second consecutive amino acid sequences are in direct contact with each other in the single-chain chimeric polypeptide. In some examples, the first and second consecutive amino acid sequences are separated by one or more intervening amino acids (e.g., one or more domains). In no case is the term "single-chain chimeric polypeptide" intended to limit the relative arrangement of the first and second consecutive amino acid sequences in the single-chain polypeptide. Non-limiting examples of single-chain chimeric polypeptides (e.g., single-chain chimeric antigen receptors) are described herein. Further examples of single-chain chimeric polypeptides (e.g., single-chain chimeric antigen receptors) are described herein. It is known in the wild.
[0069] The terms “chimeric antigen receptor” and “CAR” are used herein to mean the same thing and generally, but not exclusively, refer to artificial multimodule molecules that can induce or inhibit the activation of immune cells, comprising an extracellular domain (e.g., ligand / antigen-binding domain), a transmembrane domain, and one or more intracellular signaling domains. CAR molecules and their derivatives (e.g., CAR variants) are, for example, described in International Application PCT / US2014 / 016527; Fedorov et al. Sci Transl Med (2013); 5(215):215ra172 ;Glienke et al. Front Pharmacol (2015) 6:21;Kakarla & Gottschalk 52 Cancer J (2014) 20(2):151-5;Riddell et al. Cancer J (2014) 20(2):141-4;Pegram et al. Cancer J (2014) 20(2):127-33;Cheadle et al. Immunol Rev (2014) 257(1):91-106; Barrett et al. Annu Rev Med (2014) 65:333-47; Sadelain et al. Cancer Discov (2013) 3(4):388-98; These disclosures constitute part of this Specified by quotation in their entirety.
[0070] The term "multi-chain chimeric polypeptide" means a polypeptide comprising two or more single-chain polypeptides, where at least one of the two or more single-chain polypeptides is a single-chain chimeric polypeptide as defined and described herein. Non-limiting examples of multi-chain chimeric polypeptides (e.g., multi-chain chimeric antigen receptors) are described herein. Further examples of multi-chain chimeric polypeptides (e.g., multi-chain chimeric antigen receptors) are known in the art.
[0071] The term “transmembrane domain” refers to a polypeptide domain that, when expressed in mammalian cells, contains at least one sequence of amino acids that, when present in the corresponding endogenous polypeptide, traverses the lipid bilayer. For example, when expressed in mammalian cells, a transmembrane domain, when present in the corresponding endogenous polypeptide, may contain one, two, three, four, five, six, seven, eight, nine, or ten sequences of amino acids, each traversing the lipid bilayer. As is known in the art, a transmembrane domain may, for example, contain at least one sequence of amino acids (e.g., two, three, four, five, six, seven, eight, nine, or ten) having an α-helix secondary structure in the lipid bilayer (traversing the lipid bilayer when present in the corresponding endogenous polypeptide when expressed in mammalian cells). In some embodiments, the transmembrane domain may include two or more consecutive amino acid sequences that form a β-barrel secondary structure in the lipid bilayer (each transversing the lipid bilayer when present in the corresponding endogenous polypeptide when expressed in mammalian cells). Non-limiting examples of transmembrane domains are described herein. Further examples of transmembrane domains are known in the art.
[0072] When the phrase "extracellular to the plasma membrane" is used to describe the location of a polypeptide, it means that the polypeptide includes at least one transmembrane domain that traverses the plasma membrane and at least one domain located in extracellular space (e.g., at least one antigen-binding domain).
[0073] The term “hormone receptor ligand-binding domain” refers to a domain in a hormone receptor polypeptide that specifically binds to a hormone or hormone analog. Non-exclusive examples of hormone receptor ligand-binding domains (LBDs) are described herein. In some cases, LBDs of nuclear hormone receptors are selected from estrogen receptors, ecdysone receptors, PPARγ receptors, glucocorticoid receptors, androgen receptors, thyroid hormone receptors, mineralocorticoid receptors, progesterone receptors, vitamin D receptors, PPARα receptors, PPARβ / δ receptors, pregnane X receptors, hepatic X receptors, farnesoid X receptors, retinoid X receptors, RAR-associated orphan receptors, and retinoic acid receptors. In some cases, the polypeptide chain of the heterodimer polypeptide of the Disclosure contains a single LBD of the nuclear hormone receptor. In some cases, the polypeptide chain of the heterodimer polypeptide of the Disclosure contains multiple (e.g., two or more) LBDs of the nuclear hormone receptor. In some cases, the polypeptide chain of the heterodimer polypeptide of the Disclosure contains two LBDs of the nuclear hormone receptor. In some cases, the polypeptide chain of the heterodimer polypeptide of the Disclosure contains three LBDs of the nuclear hormone receptor. If the polypeptide chain of the heterodimer polypeptide of the Disclosure contains multiple (e.g., two or more) LBDs of the nuclear hormone receptor, in some cases, the multiple LBDs contain the same amino acid sequence. In some cases, the two or more LBDs are in tandem, either directly or separated by a linker (e.g., any of the linkers described herein).
[0074] The term "antigen-binding domain" refers to a domain that specifically binds to a target antigen. In some examples, the antigen-binding domain may be formed from amino acids present within a single-chain polypeptide. In other examples, the antigen-binding domain may be formed from amino acids present within a first single-chain polypeptide and amino acids present in one or more additional single-chain polypeptides (e.g., a second single-chain polypeptide). Non-limiting examples of antigen-binding domains are described herein, without limitation, including scFv or LBDs of growth factors. Further examples of antigen-binding domains are known in the art.
[0075] As used herein, the term “antigen” generally refers to a binding partner that is specifically recognized by the antigen-binding domains described herein. Exemplary antigens include, but are not limited to, various classes of molecules such as polypeptides and their peptide fragments, small molecules, lipids, carbohydrates, and nucleic acids. Non-exclusive examples of antigens that can be specifically bound by either the antigen or an antigen-binding domain are described herein. Further examples of antigens that can be specifically bound by either the antigen or an antigen-binding domain are known in the art.
[0076] The term “costimulatory domain” refers to a signaling domain derived from an endogenous costimulatory transmembrane polypeptide expressed in T lymphocytes that promotes downstream T cell receptor signaling and / or T cell activation. Non-exclusive examples of costimulatory domains are described herein. Further examples of costimulatory domains are known in the art. See, for example, Chen et al., Nature Reviews Immunol. 13:227-242, 2013.
[0077] The term "immunoreceptor tyrosine-based activation motif" (ITAM) refers to an amino acid motif comprising a four-amino acid consensus sequence (YxxL / I) in which tyrosine is separated from leucine or isoleucine by two other amino acids. The tyrosine residue in the four-amino acid consensus sequence becomes phosphorylated after interaction with signaling pathway kinases (e.g., lymphocyte signaling pathway kinases). Non-limiting examples of ITAMs are described herein. Further examples of ITAMs are known in the art.
[0078] The term "hormone" refers to a naturally occurring molecule that specifically binds to the ligand-binding domain of a hormone receptor and modulates the activity and / or position of the hormone receptor. A non-exclusive list of hormones is provided herein. Further examples of hormones are known in the art.
[0079] The term "hormone analog" refers to a molecule that mimics the structure of a hormone and specifically binds to the ligand-binding domain of a hormone receptor. Non-exclusive examples of hormone analogs are described herein. Further examples of hormone analogs are known in the art.
[0080] The phrase "treatment of cancer" means a reduction in the number, frequency, or severity of one or more (e.g., two, three, four, or five) cancer symptoms in a subject having cancer. Non-limiting cancer symptoms are described herein. Further cancer symptoms are known in the art.
[0081] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art in which the present invention pertains. Methods and materials are described in relation to their use in the present invention, and other preferred methods and materials known in the art may also be used. Materials, methods, and examples are illustrative and not intended to be limiting. Publications, patent applications, patents, sequences, database entries, and other references mentioned herein all constitute part of this specification by reference. In case of any conflict, including definitions, this specification shall prevail.
[0082] Other features and advantages of the present invention will become apparent from the following detailed description and drawings, as well as from the claims. [Brief explanation of the drawing]
[0083] [Figure 1] This is a diagram of the various constructs tested. Extracellular and intracellular representations are shown with respect to the cell membrane, which is represented as a gray rectangle between these representations. The extracellular scFv domain and the intracellular costimulatory domain ("Costim"), CD3 zeta domain, and mCherry domain are shown. [Figure 2] A set of flow cytometry dot plots for cells expressing one of various constructs. Cells were left untreated or treated with 500 ng / mL of 4-hydroxytamoxifen ("4-OHT"). (A) Jurkat T cells transduced using a lentiviral vector encoding a canonical CAR, or using v2, v3, and v4 CAR constructs containing anti-CD19(FMC63)ERa-LBD. (B) Primary CD4 and CD8 human T cells transduced using a lentiviral vector encoding the v4 CAR construct. [Figure 3]A set of flow cytometry dot plots for HEK-293T cells transduced using a lentiviral vector encoding an ERa-LBD-containing FMC63 CAR fusion. Cells were either left untreated or treated with 500 ng / mL of 4-OHT. [Figure 4] This is a set of flow cytometry dot plots for primary human CD4 T cells transduced using a lentiviral vector encoding an NHR LBD-CAR containing an FMC63 NHR LBD-CAR fusion and J6M0 scFv. Cells were either left untreated or treated with 500 ng / mL of 4-OHT. [Figure 5A] Figure of the V5 nuclear hormone receptor ligand-binding domain NHR-LBD CAR construct lacking the co-stimulatory domain and CD3 zeta domain, and a set of flow cytometry dot plots for cells transduced using a lentiviral vector encoding the V5 construct. Cells were left untreated or treated with 500 ng / mL 4-OHT. [Figure 5B] This is a flow cytometry diagram of a pair of untransduced Jurkat T cells or Jurkat T cells transduced using a lentiviral vector encoding a CAR in which the scFv domain is replaced with a FLAG tag. Transduced cells were either left untreated or treated with 500 ng / mL of 4-OHT. [Figure 6] This is a flow cytometry diagram of a pair of Jurkat T cells transduced using a CAR construct with a progesterone receptor LBD. The cells were either left untreated or treated with 500 ng / mL mifepristone. [Figure 7A] This graph shows T cell activation in primary human T cells transduced using a lentiviral vector encoding the J6M0-ERa-LBD CAR construct after overnight co-culture with antigen-negative targets (K562 cell line) and antigen-positive targets (MM1S cell line). [Figure 7B]This graph shows IFN-γ production by primary human T cells transduced using a lentiviral vector encoding the J6M0-ERa-LBD CAR construct after overnight co-culture with antigen-negative targets (K562 cell line) and antigen-positive targets (MM1S cell line). [Figure 8A] This is a set of flow cytometry diagrams showing the proliferation of primary human CD4 T cells transduced using a lentiviral vector encoding V4 FMC63-ERa-LBD CAR or a canonical CAR control, and co-cultured with either an antigen-negative target (K562 cell line) or an antigen-positive target (Raji cell line) while increasing the concentration of ligand 4-OHT. [Figure 8B] This graph shows the lysis of antigen-positive targets (MM1S cell line) mediated by primary human T cells transduced using a lentiviral vector encoding the J6M0-ERa-LBD CAR construct, accompanied by an increase in 4-OHT concentration. [Figure 9] This graph shows the surface expression of various CAR constructs with LBDs at different positions relative to the cell membrane, as the concentration of 4-OHT increases. [Figure 10A] This is a schematic diagram showing the timeline of the experimental procedure. [Figure 10B] This bar graph shows the surface expression of various CAR constructs before and after co-culture with 4-OHT. [Figure 11A] This is a set of flow cytometry diagrams showing Jurkat T cells transduced using FLAG-ERa-LBD CAR, either left untreated or treated with 4-OHT for 15 or 120 minutes. [Figure 11B] This is a set of flow cytometry diagrams showing human T cells transduced using a lentiviral vector encoding FMC63-ERa-LBD CAR, either left untreated or treated with 4-OHT for 2, 4, or 24 hours. [Figure 12]This is a flow cytometry diagram of a pair of primary human T cells expressing FMC63-CAR with ERa LBD. Cells were either left untreated or treated with 500 ng / mL of 4-OHT. Several samples were pretreated with 1 μM brefeldin A. [Figure 13] This diagram shows the tested v2 CAR construct and the ECD.v1 CAR (also known as LBD-ECD CAR) construct. The cell membrane is represented by a gray rectangle. The diagram shows the extracellular scFv domain, extracellular ERa LBD, transmembrane domain (embedded in the cell membrane), intracellular 4-1BB domain, and intracellular CD3γ domain. [Figure 14] This figure shows a set of flow cytometry dot plots for cells expressing the v2 CAR construct or the LBD-ECD CAR construct. Cells were left untreated or treated with 500 ng / mL of 4-hydroxytamoxifen ("4-OHT"). [Figure 15] This graph shows the destruction (% lysis) of Nalm 6 tumor cells by T cells transduced using a lentiviral vector encoding the LBD-ECD CAR construct (ECD.v1). Cells were treated with 4-OHT at concentrations of 1.5 ng / mL to 500 ng / mL. Positive controls were T cells transduced using a lentiviral vector encoding a constitutive CAR. Negative controls were T cells with the LBD-ECD CAR that were not treated with 4-OHT. [Figure 16] This figure shows a set of flow cytometry dot plots for cells expressing constitutive CARs, LBD-ECD CARs, or v2 CARs. Cells were left untreated or stimulated with CD3 / CD28-containing beads for 48 hours prior to flow cytometry. Dynabeads aCD3 / aCD28 beads were manufactured by ThermoFisher. See Trickett et al., J. Immunol. Methods 275:251-255, 2003. Each construct was fused to a cMyc tag. [Figure 17]This graph shows IL-2 production from ECD.v1 CAR-T cells or conventional CAR-T cells after overnight co-culture of T cells possessing CARs with a NALM-6 target, in or out of the presence of 4-hydroxytamoxifen. [Modes for carrying out the invention]
[0084] This specification provides single-chain chimeric polypeptides, single-chain chimeric antigen receptors (CARs), and multi-chain chimeric antigen receptors; nucleic acids encoding these; vectors containing any of these nucleic acids; mammalian cells containing any of these vectors; and methods for reversibly inducing and altering the extracellular membrane localization of these single-chain chimeric polypeptides, single-chain chimeric antigen receptors, and multi-chain chimeric polypeptides.
[0085] Furthermore, this specification provides genetically modified mammalian cells having chimeric antigen receptors (CARs). In some cases, the genetically modified mammalian cells are derived from stem cells, progenitor cells, or cells derived from stem cells or progenitor cells. In some cases, the mammalian cells are T lymphocytes or NK cells.
[0086] Non-limiting embodiments of these single-chain chimeric polypeptides, single-chain chimeric antigen receptors, and multi-chain chimeric antigen receptors, nucleic acids, vectors, mammalian cells, and methods are described below and may be used in any combination without limitation. Further embodiments of these single-chain chimeric polypeptides, single-chain chimeric antigen receptors, and multi-chain chimeric antigen receptors, nucleic acids, vectors, mammalian cells, and methods are known in the art.
[0087] In some embodiments, the compositions and / or methods disclosed herein can be used to selectively kill cancer cells in a subject in the presence of a hormone or hormone analog that binds to the LBD present in the polypeptide (e.g., single-chain chimeric polypeptide, single-chain chimeric antigen receptor, and / or multi-chain chimeric antigen receptor). In some embodiments, in the presence of a hormone or hormone analog, the polypeptide (e.g., single-chain chimeric polypeptide, single-chain chimeric antigen receptor, and / or multi-chain chimeric antigen receptor) localizes to an extracellular surface that presents an extracellular antigen-binding domain (e.g., scFv, or other antigen-binding domains described herein or known in the art). Since the polypeptide (e.g., single-chain chimeric polypeptide, single-chain chimeric antigen receptor, or multi-chain chimeric antigen receptor) can recognize the antigen to which it binds, it can selectively kill target cells (e.g., cancer cells) that express the antigen on its surface.
[0088] In some embodiments, the localization of the polypeptide (e.g., single-chain chimeric polypeptide, single-chain chimeric antigen receptor, or multi-chain chimeric antigen receptor) to the extracellular surface may cause toxicity in subjects. In some embodiments, subjects experiencing toxicity due to hormone- or hormone-analyte-induced localization of the polypeptide (e.g., single-chain chimeric polypeptide, single-chain chimeric antigen receptor, or multi-chain chimeric antigen receptor) to the extracellular surface can be treated or improved by reducing the dose of the hormone or hormone-analyte, or by eliminating all hormone or hormone-analyte treatment in the subject. Such dose reduction or elimination of hormone or hormone-analyte treatment can reduce or eliminate toxicity in the subject by removing the polypeptide (e.g., single-chain chimeric polypeptide, single-chain chimeric antigen receptor, or multi-chain chimeric polypeptide) from the cell surface and reducing or eliminating the presentation of antigen-binding domains on the cell surface.
[0089] Single-chain chimeric polypeptide Single-chain chimeric polypeptide - intracellular hormone receptor LBD In this specification, a transmembrane domain (e.g., any transmembrane domain described herein or known in the art) and a hormone receptor ligand-binding domain (e.g., a hormone receptor ligand-binding domain described herein or known in the art) are defined as follows: The present invention provides a single-chain chimeric polypeptide comprising one of the domains, wherein the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other or separated by 1 to about 800 amino acids (e.g., or any subrange of this range as described herein), and neither the transmembrane domain nor the hormone receptor ligand-binding domain is present in the same (single) endogenous single-chain polypeptide in mammals (e.g., humans).
[0090] In some examples of single-chain chimeric polypeptides, the transmembrane domain is in direct contact with the hormone receptor ligand-binding domain (i.e., there are no intervening amino acids between the transmembrane domain and the hormone receptor ligand-binding domain). In some examples of single-chain chimeric polypeptides, the transmembrane domain and the hormone receptor ligand-binding domain consist of 1 to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, and approximately 480 amino acids. Approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids Acid, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids 0 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 amino acids, approximately 16 amino acids, approximately 14 amino acids, approximately 12 amino acids, approximately 10 amino acids, approximately 8 amino acids, approximately 6 amino acids, approximately 5 amino acids, approximately 4 amino acids, or approximately 3 amino acids (including both ends);Approximately 2 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 4 50 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 24 0 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 11 5 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 amino acids, approximately 16 amino acids, approximately 14 amino acids, approximately 12 amino acids; Mino acids, approximately 10 amino acids, approximately 8 amino acids, approximately 6 amino acids, approximately 5 amino acids, or approximately 4 amino acids (including both ends); approximately 3 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 48 0 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids Approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 Amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 amino acids, approximately 16 amino acids, approximately 14 amino acids, approximately 12 amino acids, approximately 10 amino acids, approximately 8 amino acids, approximately 6 amino acids, or approximately 5 amino acids (including both ends);Approximately 4 amino acids ~ Approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 4 40 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 2 20 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 1 00 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 amino acids, approximately 16 amino acids, approximately 14 amino acids, approximately 12 amino acids, approximately 10 amino acids, approximately 8 amino acids, or approximately 6 amino acids (including both ends);Approximately 5 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 2; 60 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids Acid, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 amino acids, approximately 16 amino acids, approximately 14 amino acids, approximately 12 amino acids, approximately 10 amino acids, or approximately 8 amino acids (including both ends);Approximately 6 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 39 0 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 Amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 Amino acids, approximately 16 amino acids, approximately 14 amino acids, approximately 12 amino acids, approximately 10 amino acids, or approximately 8 amino acids (including both ends); approximately 8 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450; Amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids Acid, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 amino acids, approximately 16 amino acids, approximately 14 amino acids, approximately 12 amino acids, or approximately 10 amino acids (including both ends); approximately 10 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids Mino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, Approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 12 5 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 amino acids, approximately 16 amino acids, approximately 14 amino acids, or approximately 12 amino acids (including both ends);Approximately 12 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 4 50 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 Amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids 0 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 amino acids, approximately 16 amino acids, or approximately 14 amino acids (including both ends);Approximately 14 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids; Approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, Approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 18 amino acids, or approximately 16 amino acids (including both ends);Approximately 16 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids Acid, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids Mino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, or approximately 18 amino acids (including both ends);Approximately 18 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids Approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids Acid, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, or approximately 20 amino acids (including both ends); approximately 20 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 5; 60 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids Acid, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, or approximately 25 amino acids (including both ends); approximately 25 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 7 60 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids Acid, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, or approximately 30 amino acids (including both ends);Approximately 30 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 Amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids; 0.0 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, or approximately 35 amino acids (including both ends); approximately 35 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids Mino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids Approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 1 60 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, or approximately 40 amino acids (including both ends);Approximately 40 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids Approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, or approximately 45 amino acids (including both ends);Approximately 45 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids 1; 95 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 Amino acids, approximately 55 amino acids, or approximately 50 amino acids (including both ends); approximately 50 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 4 30 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids Mino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, or approximately 55 amino acids (including both ends);Approximately 55 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, Approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids Approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, or approximately 60 amino acids (including both ends); approximately 60 amino acids to approximately 800 amino acids, approximately 780 amino acids Acid, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids; Mino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 17 5 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, or approximately 65 amino acids (including both ends);Approximately 65 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids 0.0 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, or approximately 70 amino acids (including both ends);Approximately 70-800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids Approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids Acid, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, or approximately 75 amino acids (including both ends); approximately 75 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 72 0 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately; 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids Acid, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, or approximately 80 amino acids (including both ends); approximately 80 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids Approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, or approximately 85 amino acids (including both ends);Approximately 85 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids Approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, approximately 100 amino acids, approximately 95 amino acids, or approximately 90 amino acids (including both ends);Approximately 90 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids Approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids; 0.240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 Amino acids, approximately 100 amino acids, or approximately 95 amino acids (including both ends); approximately 95 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 Amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 2 20 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, approximately 105 amino acids, or approximately 100 amino acids (including both ends);Approximately 100 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370; Amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids Mino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, approximately 110 amino acids, or approximately 105 amino acids (including both ends); approximately 105 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids 0.0 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids Acid, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids Approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, approximately 115 amino acids, or approximately 110 amino acids (including both ends); approximately 110 amino acids to approximately 800 amino acids Approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids Approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids Approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, approximately 120 amino acids, or approximately 115 amino acids (including both ends);Approximately 115 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, Approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, approximately 125 amino acids, or approximately 120 amino acids (including both ends);Approximately 120 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, approximately 130 amino acids, or approximately 125 amino acids (including both ends); approximately 125 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately; 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids Mino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, approximately 135 amino acids, or approximately 130 amino acids (including both ends);Approximately 130 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 Amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, approximately 145 amino acids, approximately 140 amino acids, or approximately 135 amino acids (including both ends);Approximately 135 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids Mino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 1 55 amino acids, approximately 150 amino acids, approximately 145 amino acids, or approximately 140 amino acids (including both ends); approximately 140 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids Acid, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 18; 0 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, approximately 150 amino acids, or approximately 145 amino acids (including both ends); approximately 145 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 Amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 17 0 amino acids, approximately 165 amino acids, approximately 160 amino acids, approximately 155 amino acids, or approximately 150 amino acids (including both ends); approximately 150 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 5 20 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, approximately 160 amino acids, or approximately 155 amino acids (including both ends);Approximately 155 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 45 0 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids 0.0 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, approximately 165 amino acids, or approximately 160 amino acids (including both ends); approximately 160 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, Approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 37; 0 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, approximately 170 amino acids, or approximately 165 amino acids (including both ends); approximately 165 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, approximately 175 amino acids, or approximately 170 amino acids (including both ends);Approximately 170 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 4 00 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, approximately 180 amino acids, or approximately 175 amino acids (both ends) Including; approximately 175 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids 0.0 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, approximately 185 amino acids, or approximately 180 amino acids (including both ends);Approximately 180 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids; Mino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, approximately 190 amino acids, or approximately 185 amino acids (including both ends); approximately 185 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 4 80 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, approximately 195 amino acids, or approximately 190 amino acids (including both ends);Approximately 190 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 4 20 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, approximately 200 amino acids, or approximately 195 amino acids (both ends). Including; approximately 195 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids 0.0 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, approximately 210 amino acids, or approximately 200 amino acids (including both ends);Approximately 200 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490; Amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, approximately 220 amino acids, or approximately 210 amino acids (including both ends); approximately 210 amino acids to approximately 800 amino acids Mino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids Approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, approximately 230 amino acids, or approximately 220 amino acids (including both ends); approximately 2 20 amino acids ~ approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids Mino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, approximately 240 amino acids, or approximately 230 amino acids (including both ends);Approximately 230 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids 0.0 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, approximately 250 amino acids, or approximately 240 amino acids (both ends) Including; approximately 240 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 4 50 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, approximately 260 amino acids, or approximately 250 amino acids (including both ends);Approximately 250 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids Approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, approximately 270 amino acids, or approximately 260 amino acids (including both ends); approximately 260 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids; Acid, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, approximately 280 amino acids, or approximately 270 amino acids (including both ends); approximately 270 amino acids ~ approximately 80 0 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, approximately 290 amino acids, or approximately 280 amino acids (including both ends);Approximately 280 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, or approximately 290 amino acids (both ends) Including approximately 290 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, or approximately 300 amino acids (including both ends);Approximately 300 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, Approximately 320 amino acids, approximately 310 amino acids, approximately 300 amino acids, or approximately 290 amino acids (including both ends); approximately 290 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids; Approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, approximately 310 amino acids, or approximately 300 amino acids (including both ends); approximately 300 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 54 0 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, approximately 320 amino acids, or approximately 310 amino acids (including both ends); approximately 310 amino acids 0.0 amino acids ~ approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, Approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, approximately 330 amino acids, or approximately 320 amino acids (including both ends); approximately 320 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 Amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, approximately 340 amino acids, or approximately 330 amino acids Acid (including both ends); approximately 330 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids 62 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, approximately 350 amino acids, or approximately 340 amino acids (including both ends); approximately 340 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 62 0 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, approximately 360 amino acids, or approximately 350 amino acids (including both ends);Approximately 350 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids; Approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids, or approximately 360 amino acids (including both ends); approximately 360 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, approximately 380 amino acids, approximately 370 amino acids (including both ends); approximately 370 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids Mino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, approximately 390 amino acids, or approximately 380 amino acids (including both ends); approximately 380 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids Acid, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, approximately 400 amino acids, or approximately 390 amino acids (including both ends);Approximately 390 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 amino acids, approximately 410 amino acids, or Approximately 400 amino acids (including both ends); approximately 400 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids, approximately 420 Amino acids, or approximately 410 amino acids (including both ends); approximately 410 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, approximately 440 amino acids, approximately 430 amino acids 0.0 amino acids, or approximately 420 amino acids (including both ends); approximately 420 to 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, approximately 450 amino acids, or approximately 440 amino acids (including both ends);Approximately 430 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460; Amino acids, approximately 450 amino acids, or approximately 440 amino acids (including both ends); approximately 440 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, approximately 460 amino acids, or approximately 450 amino acids (including both ends); approximately 450 Amino acids ~ approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids, or approximately 460 amino acids (including both ends); approximately 460 amino acids ~ approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids Mino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, approximately 480 amino acids, approximately 470 amino acids (including both ends); approximately 470 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids Approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, approximately 490 amino acids, or approximately 480 amino acids (including both ends); approximately 480 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, approximately 500 amino acids, or approximately 490 amino acids (including both ends);Approximately 490 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, approximately 520 amino acids, or approximately 500 amino acids (including both ends); approximately 500 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 6 60 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, approximately 540 amino acids, or approximately 520 amino acids (including both ends); approximately 520 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, approximately 560 amino acids, or approximately 540 amino acids (including both ends); approximately 540 amino acids to approximately 800 Amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, approximately 580 amino acids, or approximately 560 amino acids (including both ends); approximately 560 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, approximately 600 amino acids, or approximately 580 Amino acids (including both ends); approximately 580 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, approximately 620 amino acids, or approximately 600 amino acids (including both ends); approximately 600 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids, approximately 640 amino acids, or approximately 620 amino acids (including both ends);Approximately 620 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, approximately 680 amino acids, approximately 660 amino acids; , or approximately 640 amino acids (including both ends); approximately 640 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids , approximately 680 amino acids, or approximately 660 amino acids (including both ends); approximately 660 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, approximately 700 amino acids, or approximately 680 amino acids (including both ends); approximately 680 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, approximately 740 amino acids, approximately 720 amino acids, or approximately 700 amino acids (including both ends); approximately 700 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately It is separated by 760 amino acids, approximately 740 amino acids, or approximately 720 amino acids (including both ends); approximately 720 amino acids to approximately 800 amino acids, approximately 780 amino acids, approximately 760 amino acids, or approximately 740 amino acids (including both ends); approximately 740 amino acids to approximately 800 amino acids, approximately 780 amino acids, or approximately 760 amino acids (including both ends); approximately 760 amino acids to approximately 800 amino acids, or approximately 780 amino acids (including both ends); or approximately 780 amino acids to approximately 800 amino acids (including both ends).
[0091] In some embodiments, one or more amino acids interposed between the transmembrane domain and the hormone receptor ligand-binding domain may be or may comprise a linker peptide. In some embodiments, the linker peptide may comprise one or more of the following amino acid sequences: GSGSGSGSGS (SEQ ID NO: 20), GSGSGSGS (SEQ ID NO: 21), RSGSGSGS (SEQ ID NO: 22), or GSGSGSGS (SEQ ID NO: 23). In some embodiments, the linker peptide may be encoded by one or more of the following nucleic acid sequences: GGATCCGGCAGCGGATCTGGCAGTGGAAGC (SEQ ID NO: 24), GGATCTGGCTCTGGAAGCGGCAGC (SEQ ID NO: 25), AGATCCGGATCTGGAAGTGGCTCC (SEQ ID NO: 26), or GGAAGTGGATCTGGGAGCGGCTCT (SEQ ID NO: 27). In some embodiments, the linker peptide may comprise one or more copies (e.g., two, three, or four) of any one of SEQ ID NOs from 20 to 23, for example, in tandem.
[0092] In some embodiments, one or more amino acids interposed between the transmembrane domain and the hormone receptor ligand-binding domain may be an intracellular sequence in contact with the transmembrane domain in the endogenous polypeptide from which the transmembrane domain (e.g., any of the transmembrane domains described herein) originates, or may include an intracellular sequence. In some embodiments, one or more amino acids interposed between the transmembrane domain and the hormone receptor ligand-binding domain may be one or more additional domains (e.g., any of the exemplary additional domains described herein or known in the art), or may include one or more additional domains. In some embodiments, the single-chain chimeric polypeptide may be a single-chain chimeric antigen receptor (e.g., any of the single-chain chimeric antigen receptors described herein). In some embodiments, the chimeric polypeptide may further include one or more additional domains. Non-limiting examples of additional domains that may be included in a single-chain chimeric polypeptide include extracellular ligand-binding domains (e.g., antigen-binding domains, e.g., any of the antigen-binding domains described herein), ITIMs (e.g., any of the ITIMs known in the art), ITAMs (e.g., any of the ITAMs described herein or known in the art), dimerization domains (e.g., any of the dimerization domains known in the art that can dimerize with another dimerization domain present in another polypeptide expressed in mammalian cells (e.g., a recombinant polypeptide), e.g., any of the dimerization domains known in the art), and peptide tags (e.g., poly-His tags).
[0093] Single-chain chimeric polypeptide - extracellular hormone receptor LBD This specification provides single-chain chimeric polypeptides comprising an extracellular hormone receptor ligand-binding domain (e.g., any of the hormone receptor ligand-binding domains described herein or known in the art) and a transmembrane domain (e.g., any of the transmembrane domains described herein or known in the art), wherein the transmembrane domain and the extracellular hormone receptor ligand-binding domain are in direct contact with each other or separated by 1 to about 800 amino acids (e.g., or any of the sub-ranges of this range described herein), and neither the transmembrane domain nor the hormone receptor ligand-binding domain is present in a single endogenous single-chain polypeptide in mammals (e.g., humans).
[0094] In some examples of single-chain chimeric polypeptides, the transmembrane domain is in direct contact with the hormone receptor ligand-binding domain (i.e., there are no intervening amino acids between the transmembrane domain and the extracellular hormone receptor ligand-binding domain). In some examples of single-chain chimeric polypeptides, the transmembrane domain and the extracellular hormone receptor ligand-binding domain are separated by 1 to approximately 800 amino acids (e.g., any subrange of this range as described herein).
[0095] In some embodiments, one or more amino acids interposed between the transmembrane domain and the extracellular hormone receptor ligand-binding domain may be or may comprise a linker peptide. In some embodiments, the linker peptide may comprise one or more of the following amino acid sequences: GSGSGSGSGS (SEQ ID NO: 20), GSGSGSGS (SEQ ID NO: 21), RSGSGSGS (SEQ ID NO: 22), or GSGSGSGS (SEQ ID NO: 23). In some embodiments, the linker peptide may be encoded by one or more of the following nucleic acid sequences: GGATCCGGCAGCGGATCTGGCAGTGGAAGC (SEQ ID NO: 24), GGATCTGGCTCTGGAAGCGGCAGC (SEQ ID NO: 25), AGATCCGGATCTGGAAGTGGCTCC (SEQ ID NO: 26), or GGAAGTGGATCTGGGAGCGGCTCT (SEQ ID NO: 27). In some embodiments, the linker peptide may comprise one or more copies (e.g., two, three, or four) of any one of SEQ ID NOs from 20 to 23, for example, in tandem. In some embodiments, the linker peptide may be one or more of SEQ ID NOs: 45, 47, 49, 58, 60, 62, and 106, or may contain one or more of these sequences. In some embodiments, the linker peptide may be GS, or may contain GS.
[0096] In some embodiments, one or more amino acids interposed between the transmembrane domain and the extracellular hormone receptor ligand-binding domain may be a sequence in contact with the transmembrane domain in the endogenous polypeptide from which the transmembrane domain (e.g., any of the transmembrane domains described herein) originates, or may include such sequence. In some embodiments, one or more amino acids interposed between the transmembrane domain and the extracellular hormone receptor ligand-binding domain may be one or more additional domains (e.g., any of the exemplary additional domains described herein or known in the art), or may include such additional domains. In some embodiments, the single-chain chimeric polypeptide may be a single-chain chimeric antigen receptor (e.g., any of the single-chain chimeric antigen receptors described herein). In some embodiments, the chimeric polypeptide may further include one or more (e.g., two, three, four, or five) additional domains. Non-limiting examples of additional domains that may be included in a single-chain chimeric polypeptide include extracellular ligand-binding domains (e.g., antigen-binding domains, e.g., any of the antigen-binding domains described herein), ITIMs (e.g., any of the ITIMs known in the art), ITAMs (e.g., any of the ITAMs described herein or known in the art), and dimerization domains (e.g., those present in other polypeptides expressed in mammalian cells (e.g., recombinant polypeptides)). Examples include a dimerizable domain that can be dimerized with another dimerizable domain (for example, any dimerizable domain known in the art), and one or more peptide tags (for example, poly-His tags).
[0097] In some embodiments, the single-chain chimeric polypeptide comprises an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, and a transmembrane domain, extending from the N-terminus to the C-terminus. In some embodiments, the single-chain chimeric polypeptide comprises an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, and a transmembrane domain, extending from the C-terminus to the N-terminus. In some embodiments, the single-chain chimeric polypeptide comprises an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, and a transmembrane domain, extending from the N-terminus to the C-terminus. In some embodiments, the single-chain chimeric polypeptide comprises an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, and a transmembrane domain, extending from the C-terminus to the N-terminus.
[0098] Single-chain chimeric antigen receptor Single-chain chimeric antigen receptor - intracellular hormone receptor LBD Furthermore, this specification provides a single-chain chimeric antigen receptor comprising an extracellular antigen-binding domain (e.g., any antigen-binding domain described herein or known in the art), a transmembrane domain (e.g., any transmembrane domain described herein or known in the art), a hormone receptor ligand-binding domain (e.g., any hormone receptor ligand-binding domain described herein or known in the art), a costimulatory domain (e.g., any costimulatory domain described herein or known in the art), and an immunoreceptor-activated tyrosine motif (ITAM), wherein the transmembrane domain and the hormone ligand-binding domain are in direct contact with each other or separated by 1 to about 800 amino acids (e.g., any sub-range of this range described herein), and neither the transmembrane domain nor the hormone receptor ligand-binding domain is present in the same (single) endogenous single-chain polypeptide in mammals. The single-chain chimeric antigen receptors described herein can bind to any of the exemplary antigens described herein or any other antigen known in the art. In some embodiments, the single-chain chimeric antigen receptor specifically binds to a single antigen (e.g., any of the exemplary antigens described herein). In some embodiments, the single-chain chimeric antigen receptor specifically binds to two different antigens (e.g., any combination of the exemplary antigens described herein).
[0099] In some embodiments of these single-chain chimeric antigen receptors, the transmembrane domain is in contact with the hormone receptor ligand-binding domain. In some embodiments of these single-chain chimeric antigen receptors, the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to about 800 amino acids (e.g., or any subrange of this range as described herein). In some embodiments, the amino acids between the transmembrane domain and the hormone receptor ligand-binding domain do not contain any domains. In other embodiments, the amino acids between the transmembrane domain and the hormone receptor ligand-binding domain contain one or more intervening domains (e.g., one or more costimulatory domains and / or one or more ITAMs). In some embodiments, the amino acids between the transmembrane domain and the hormone receptor ligand-binding domain contain a sequence derived from the same endogenous transmembrane protein from which the transmembrane domain originates. In some embodiments, the amino acids between the transmembrane domain and the hormone receptor ligand-binding domain contain a linker sequence.
[0100] Some embodiments of these single-chain chimeric antigen receptors may include one or more (e.g., two, three, four, or five) costimulatory domains (e.g., any combination of any exemplary costimulatory domains described herein or known in the art). Some embodiments of these single-chain chimeric antigen receptors include one or both of the 4-1BB costimulatory domain and the CD28 costimulatory domain.
[0101] Some embodiments of these single-chain chimeric antigen receptors may include one or more (e.g., two, three, four, or five) ITAMs (e.g., any of the ITAMs described herein or known in the art). In some embodiments of these single-chain chimeric antigen receptors, the ITAM includes a cytoplasmic signaling sequence derived from CD3ζ (e.g., human CD3ζ).
[0102] In some embodiments of any of these single-chain chimeric antigen receptors, any two adjacent domains are approximately 1 to 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, and approximately 170 amino acids. Amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 15 amino acids, approximately 10 amino acids, approximately 8 amino acids, approximately 6 Amino acids, approximately 4 amino acids, or approximately 3 amino acids (including both ends); approximately 2 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids 0 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 15 amino acids, approximately 10 amino acids, approximately 8 amino acids, approximately 6 amino acids, or approximately 4 amino acids (including both ends);Approximately 3 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 15 amino acids, Approximately 10 amino acids, approximately 8 amino acids, approximately 6 amino acids, or approximately 5 amino acids (including both ends); approximately 4 to 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 3; 5 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 15 amino acids, approximately 10 amino acids, approximately 8 amino acids, or approximately 6 amino acids (including both ends); approximately 5 to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids Approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 15 amino acids, approximately 10 amino acids, approximately 8 amino acids, or approximately 7 amino acids (including both ends); approximately 6 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 16 0 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 15 amino acids, approximately 10 amino acids, or approximately 8 amino acids (including both ends);Approximately 8 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids Approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, approximately 15 amino acids, or approximately 10 amino acids (both ends Includes); approximately 10 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 15 0 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 30 amino acids, approximately 25 amino acids, approximately 20 amino acids, or approximately 15 amino acids (including both ends);Approximately 15 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35; Amino acids, approximately 30 amino acids, approximately 25 amino acids, or approximately 20 amino acids (including both ends); approximately 20 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 19 0 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, approximately 3 0 amino acids, or approximately 25 amino acids (including both ends); approximately 25 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, Approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, approximately 35 amino acids, or approximately 30 amino acids (including both ends);Approximately 30 to 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids, or approximately 35 amino acids (including both ends); Approximately 35 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, approximately 45 amino acids, approximately 40 amino acids (including both ends); approximately 40 amino acids to approximately; 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 13 0 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, approximately 55 amino acids, approximately 50 amino acids, or approximately 45 amino acids (including both ends); approximately 45 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids Approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids Mino acids, approximately 60 amino acids, approximately 55 amino acids, or approximately 50 amino acids (including both ends); approximately 50 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, Approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, approximately 60 amino acids, or approximately 55 amino acids (including both ends); approximately 55 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, approximately 65 amino acids, or approximately 60 amino acids (including both ends);Approximately 60 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, Approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, approximately 70 amino acids, or approximately 65 amino acids (including both ends); approximately 65 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids Acid, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, approximately 75 amino acids, or approximately 70 amino acids (including both ends); approximately 70 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 Amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, or approximately 75 amino acids (including both ends);Approximately 75 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids; Acid, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, approximately 80 amino acids, or approximately 75 amino acids (including both ends); approximately 75 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids Approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, approximately 90 amino acids, approximately 85 amino acids, or approximately 80 amino acids (including both ends); approximately 80 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids Approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, approximately 110 amino acids, approximately 100 amino acids, approximately 95 amino acids, or approximately 90 amino acids (including both ends); approximately 100 amino acids to approximately 500 amino acids, approximately 480 amino acids Mino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, approximately 120 amino acids, or approximately 110 amino acids (including both ends);Approximately 110 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, or approximately 120 amino acids ( Including both ends); approximately 120 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, approximately 130 amino acids, or approximately 1 20 amino acids (including both ends); approximately 120 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, approximately 140 amino acids, or approximately 130 Amino acids (including both ends); approximately 130 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, approximately 150 amino acids, or approximately 140 amino acids (including both ends);Approximately 140 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, approximately 160 amino acids, or approximately 150 amino acids (including both ends); approximately 150; Amino acids ~ approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 amino acids, approximately 170 amino acids, or approximately 160 amino acids (including both ends); approximately 160 amino acids ~ approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, approximately 180 Amino acids, or approximately 170 amino acids (including both ends); approximately 170 to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, approximately 190 amino acids, or approximately 180 amino acids (including both ends); approximately 180 to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, approximately 200 amino acids, or approximately 19 0 amino acids (including both ends); approximately 190 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, approximately 220 amino acids, or approximately 200 amino acids (including both ends); approximately 200 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, approximately 240 amino acids, or approximately 220 amino acids (including both ends); approximately 220 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, approximately 260 amino acids, or approximately 240 amino acids (including both ends); approximately 240 amino acids Acid ~ approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, approximately 280 amino acids, or approximately 260 amino acids (including both ends); approximately 260 amino acids ~ approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, approximately 300 amino acids, or approximately 280 amino acids (including both ends); approximately 280 to 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, approximately 320 amino acids, or approximately 300 amino acids (including both ends); approximately 300 to 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, approximately 340 amino acids, or approximately 320 amino acids (including both ends);Approximately 320 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, approximately 360 amino acids, or approximately 340 amino acids (including both ends); approximately 340 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, approximately 380 amino acids, or approximately 360 amino acids (including both ends); approximately 360 amino acids to approximately 500; It is separated by amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, approximately 400 amino acids, or approximately 380 amino acids (including both ends); approximately 380 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, approximately 420 amino acids, or approximately 400 amino acids (including both ends); approximately 400 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, approximately 440 amino acids, or approximately 420 amino acids (including both ends); approximately 420 amino acids to approximately 500 amino acids, approximately 480 amino acids, approximately 460 amino acids, or approximately 440 amino acids (including both ends); approximately 440 amino acids to approximately 500 amino acids, approximately 480 amino acids, or approximately 460 amino acids (including both ends); approximately 460 amino acids to approximately 500 amino acids or approximately 480 amino acids (including both ends); or approximately 480 amino acids to approximately 500 amino acids (including both ends).
[0103] In some embodiments, one or more amino acids between the extracellular antigen-binding domain and the transmembrane domain are sequences derived from the same endogenous single-chain polypeptide from which the transmembrane domain originates (e.g., the CD8α hinge region, e.g., SEQ ID NO: 112). In some embodiments, sequences including SEQ ID NO: 42, SEQ ID NO: 55, or SEQ ID NO: 112 are located between the extracellular antigen-binding domain and the transmembrane domain. In some embodiments, one or more amino acids between the extracellular antigen-binding domain and the transmembrane domain are, without limitation, hinge region sequences of an antibody such as a human antibody (e.g., IgG1, IgG2, IgG3, or IgG4), or include hinge region sequences. In some embodiments, one or more amino acids between the extracellular antigen-binding domain and the transmembrane domain are, or include linker sequences (e.g., non-natural linker sequences, e.g., GS, or any other linker sequences described herein).
[0104] In some embodiments of the single-chain chimeric antigen receptor, the domain following the hormone receptor ligand-binding domain is a co-stimulatory domain, followed by an ITAM. In some of these embodiments, one or more amino acids between the hormone receptor ligand-binding domain and the co-stimulatory domain are a sequence derived from, or include, the same endogenous single-chain polypeptide from which the co-stimulatory domain or the ITAM originates. In some of these embodiments, one or more amino acids between the hormone receptor ligand-binding domain and the co-stimulatory domain are a linker sequence (e.g., a non-natural linker sequence), or include a linker sequence. In some embodiments, one or more amino acids between the co-stimulatory domain and the ITAM are a sequence derived from, or include, the same endogenous single-chain polypeptide from which the co-stimulatory domain or the ITAM originates.
[0105] In some embodiments of the single-chain chimeric antigen receptor, the domain following the hormone receptor ligand-binding domain is a co-stimulatory domain, followed by the ITAM. In some embodiments of the single-chain chimeric antigen receptor, the domain following the ligand-binding domain is the ITAM, followed by the co-stimulatory domain. In some of these embodiments, one or more amino acids between the hormone receptor ligand-binding domain and the ITAM are a sequence derived from the same endogenous single-chain polypeptide from which the co-stimulatory domain or the ITAM is derived, or include such a sequence. In some of these embodiments, one or more amino acids between the hormone receptor ligand-binding domain and the ITAM are a linker sequence (e.g., a non-natural linker sequence), or include such a linker sequence. In some embodiments, one or more amino acids between the ITAM and the co-stimulatory domain are a sequence derived from the same endogenous single-chain polypeptide from which the ITAM or the co-stimulatory domain is derived, or include such a sequence.
[0106] In some embodiments, when two or more costimulatory domains are included in a single-chain chimeric antigen receptor, the two or more costimulatory domains may be placed between the hormone receptor ligand-binding domain and one or more ITAMs. In some embodiments of the single-chain chimeric antigen receptors described herein, the costimulatory domains and ITAMs are the primary amino acid distribution of the single-chain chimeric antigen receptor. They may alternate in the column.
[0107] Some embodiments of any single-chain chimeric antigen receptor described herein may further include a dimerization domain and / or a peptide tag.
[0108] In some cases, a single-chain chimeric antigen receptor may contain at least 80% (e.g., at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, at least 99%, or 100%) identical sequences to SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, or SEQ ID NO: 52.
[0109] Single-chain chimeric antigen receptor-extracellular hormone receptor LBD Furthermore, this specification provides a single-chain chimeric antigen receptor comprising an extracellular antigen-binding domain (e.g., any antigen-binding domain described herein or known in the art), an extracellular hormone receptor ligand-binding domain (e.g., any hormone receptor ligand-binding domain described herein or known in the art), a transmembrane domain (e.g., any transmembrane domain described herein or known in the art), a costimulatory domain (e.g., any costimulatory domain described herein or known in the art), and an immunoreceptor-activated tyrosine motif (ITAM), wherein the transmembrane domain and the extracellular hormone ligand-binding domain are in direct contact with each other or separated by 1 to about 800 amino acids (e.g., any sub-range of this range described herein), and the transmembrane domain and the extracellular hormone receptor ligand-binding domain are not present in the same endogenous single-chain polypeptide in mammals. The single-chain chimeric antigen receptor described herein can bind to any of the exemplary antigens described herein or any other antigen known in the art. In some embodiments, the single-chain chimeric antigen receptor specifically binds to a single antigen (e.g., any of the exemplary antigens described herein). In some embodiments, the single-chain chimeric antigen receptor specifically binds to two different antigens (e.g., any combination of the exemplary antigens described herein).
[0110] In some embodiments of these single-chain chimeric antigen receptors, the transmembrane domain is in contact with the extracellular hormone receptor ligand-binding domain. In some embodiments of these single-chain chimeric antigen receptors, the transmembrane domain and the extracellular hormone receptor ligand-binding domain are separated by 1 to about 800 amino acids (e.g., or any subrange of this range as described herein). In some embodiments, the amino acids between the transmembrane domain and the extracellular hormone receptor ligand-binding domain do not contain any domains. In other embodiments, the amino acids between the transmembrane domain and the extracellular hormone receptor ligand-binding domain contain one or more intervening domains (e.g., an antigen-binding domain and / or additional antigen-binding domains). In some embodiments, the amino acids between the transmembrane domain and the extracellular hormone receptor ligand-binding domain contain a sequence derived from the same endogenous transmembrane protein from which the transmembrane domain originates. In some embodiments, the amino acids between the transmembrane domain and the extracellular hormone receptor ligand-binding domain contain a linker sequence.
[0111] Some embodiments of these single-chain chimeric antigen receptors may include one or more (e.g., two, three, four, or five) costimulatory domains (e.g., any combination of any exemplary costimulatory domains described herein or known in the art). Some embodiments of these single-chain chimeric antigen receptors include one or both of the 4-1BB costimulatory domain and the CD28 costimulatory domain.
[0112] Some embodiments of these single-chain chimeric antigen receptors include one or more (e.g., two, three, The ITAM may include four or five ITAMs (e.g., any of the ITAMs described herein or known in the art). In some embodiments of these single-chain chimeric antigen receptors, the ITAM includes a cytoplasmic signaling sequence derived from CD3ζ (e.g., human CD3ζ).
[0113] In some embodiments of any of these single-chain chimeric antigen receptors, any two adjacent domains may be separated by 1 to about 500 amino acids (e.g., or any subrange of this range as described herein).
[0114] In some embodiments, one or more amino acids between the extracellular hormone receptor ligand-binding domain or extracellular antigen-binding domain and the transmembrane domain are sequences derived from the same endogenous single-chain polypeptide from which the transmembrane domain originates (e.g., a hinge sequence derived from human CD8α, e.g., SEQ ID NO: 112). In some embodiments, sequences including SEQ ID NO: 42, SEQ ID NO: 55, or SEQ ID NO: 112 are positioned between the extracellular hormone receptor ligand-binding domain or extracellular antigen-binding domain and the transmembrane domain. In some embodiments, one or more amino acids between the extracellular antigen-binding domain or extracellular hormone receptor ligand-binding domain and the transmembrane domain are, without limitation, hinge region sequences of an antibody such as a human antibody (e.g., IgG1, IgG2, IgG3, or IgG4), or include hinge region sequences. In some embodiments, one or more amino acids between the extracellular antigen-binding domain or extracellular hormone receptor ligand-binding domain (e.g., any hormone receptor ligand-binding domain described herein or known in the art) and the transmembrane domain are linker sequences (e.g., linker sequences of non-natural origin), or include linker sequences. In some embodiments, one or more amino acids between the extracellular antigen-binding domain and the extracellular hormone receptor ligand-binding domain are a linker sequence (e.g., a linker sequence of non-natural origin, e.g., GS, or any other linker sequence described herein) or include a linker sequence.
[0115] In some embodiments of the single-chain chimeric antigen receptor, the transmembrane domain is followed by a co-stimulatory domain, which is then followed by an ITAM. In some embodiments of the single-chain chimeric antigen receptor, the transmembrane domain is followed by an ITAM, which is then followed by a co-stimulatory domain. In some of these embodiments, one or more amino acids between the transmembrane domain and the co-stimulatory domain or ITAM are sequences derived from the same endogenous single-chain polypeptide from which the co-stimulatory domain or ITAM is derived, or include such sequences. In some of these embodiments, one or more amino acids between the transmembrane domain and the co-stimulatory domain or ITAM are linker sequences (e.g., non-natural linker sequences), or include such linker sequences. In some embodiments, one or more amino acids between the co-stimulatory domain and ITAM are linker sequences (e.g., non-natural linker sequences), or include such linker sequences. In some embodiments, one or more amino acids between the co-stimulatory domain and the ITAM are a sequence derived from the same endogenous single-chain polypeptide from which the co-stimulatory domain or the ITAM originates, or include such a sequence.
[0116] In some embodiments, if two or more costimulatory domains are included in the single-chain chimeric antigen receptor, the two or more costimulatory domains may be placed between one or more ITAMs. In some embodiments, if two or more ITAMs are included in the single-chain chimeric antigen receptor, the two or more ITAMs may be placed between one or more costimulatory molecules. In some embodiments of the single-chain chimeric antigen receptor described herein, the costimulatory domains and ITAMs may be alternating in the primary amino acid sequence of the single-chain chimeric antigen receptor.
[0117] Some embodiments of any single-chain chimeric antigen receptor described herein may further include a dimerization domain and / or a peptide tag.
[0118] In some embodiments, the single-chain chimeric antigen receptor comprises, from the N-terminus to the C-terminus, an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, a transmembrane domain, an intracellular costimulatory domain, and an ITAM. In some embodiments, the single-chain chimeric antigen receptor comprises, from the C-terminus to the N-terminus, an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, a transmembrane domain, an intracellular costimulatory domain, and an ITAM. In some embodiments, the single-chain chimeric antigen receptor comprises, from the N-terminus to the C-terminus, an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, a transmembrane domain, an intracellular costimulatory domain, and an ITAM. In some embodiments, the single-chain chimeric polypeptide comprises, from the C-terminus to the N-terminus, an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, a transmembrane domain, an intracellular costimulatory domain, and an ITAM.
[0119] In some cases, a single-chain chimeric antigen receptor may contain at least 80% (e.g., at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, at least 99%, or 100%) identical sequences to SEQ ID NO: 98.
[0120] Multi-chain chimeric antigen receptor Multi-chain chimeric antigen receptor - intracellular hormone receptor LBD Furthermore, this specification provides multi-chain chimeric antigen receptors comprising at least one first polypeptide including an extracellular antigen-binding domain (e.g., any of the antigen-binding domains described herein or known in the art), a transmembrane domain (e.g., any of the transmembrane domains described herein or known in the art), and a hormone receptor ligand-binding domain (e.g., any of the hormone receptor ligand-binding domains described herein or known in the art), wherein the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other or separated by 1 to about 800 amino acids (e.g., any of the subranges of this range described herein), and neither the transmembrane domain nor the hormone receptor ligand-binding domain resides in the same (single) endogenous single-chain polypeptide. The antigen specifically bound by any of the antigen-binding domains of these multi-chain chimeric antigen receptors may be any of the antigens described herein or known in the art. In some embodiments, the multi-chain chimeric antigen receptor specifically binds to only a single antigen (e.g., any of the exemplary antigens described herein). In some embodiments, the multi-chain chimeric antigen receptor specifically binds to two different antigens (for example, any combination of any of the exemplary antigens described herein).
[0121] In some embodiments of the multi-chain chimeric antigen receptor, the extracellular antigen-binding domain and the transmembrane domain are in contact with each other in at least one first polypeptide. In some embodiments of the multi-chain chimeric antigen receptor, 1 to about 500 amino acids (e.g., any subrange of this range as described herein) are located between the extracellular antigen-binding domain and the transmembrane domain in at least one first polypeptide. In some embodiments, one or more amino acids between the extracellular antigen-binding domain and the transmembrane domain in at least one first polypeptide are sequences derived from the same endogenous single-chain polypeptide from which the transmembrane domain originates. In some embodiments, one or more amino acids between the extracellular antigen-binding domain and the transmembrane domain of at least one first polypeptide are a hinge region sequence of a human antibody (e.g., IgG1, IgG2, IgG3, or IgG4), or include a hinge region sequence. In some embodiments, one or more amino acids between the extracellular antigen-binding domain and the transmembrane domain in at least one first polypeptide are a linker sequence (e.g., a non-natural linker sequence), or include a linker sequence.
[0122] In some embodiments of these multi-chain chimeric antigen receptors, in at least one first polypeptide, the transmembrane domain is in contact with the hormone receptor ligand-binding domain. In some embodiments of these multi-chain chimeric antigen receptors, in at least one first polypeptide, the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to about 800 amino acids (e.g., or any subrange of this range as described herein). In some embodiments, in at least one first polypeptide, the amino acids between the transmembrane domain and the hormone receptor ligand-binding domain do not contain a domain. In other embodiments, in at least one first polypeptide, the amino acids between the transmembrane domain and the hormone receptor ligand-binding domain include one or more intervening domains (e.g., one or more costimulatory domains (e.g., any of the costimulatory domains described herein) and / or one or more ITAMs (e.g., any of the ITAMs described herein)). In some embodiments, in at least one first polypeptide, the amino acids between the transmembrane domain and the hormone receptor ligand-binding domain include a sequence derived from the same endogenous transmembrane protein from which the transmembrane domain originates. In some embodiments, in at least one first polypeptide, the amino acids between the transmembrane domain and the hormone receptor ligand-binding domain include a linker sequence (e.g., a non-natural linker sequence).
[0123] In some embodiments of these multi-chain chimeric antigen receptors, at least one first polypeptide may further comprise one or more (e.g., two or three) dimerization domains (e.g., any dimerization domain known in the art), costimulatory domains (e.g., any of the costimulatory domains described herein), and / or peptide tags (e.g., any peptide tags known in the art).
[0124] Some embodiments of these multi-chain chimeric antigen receptors further include a second polypeptide which may comprise a transmembrane domain (e.g., any of the transmembrane domains described herein), a dimerization domain (e.g., a dimerization domain that can interact with at least one dimerization domain in the first polypeptide in mammalian cells), one or more costimulatory domains (e.g., any of the costimulatory domains described herein), and one or more ITAMs (e.g., any of the ITAMs described herein) (e.g., two, three, or four). As will be readily apparent to those skilled in the art, in the second polypeptide, a pair or each pair of adjacent domains may be in contact with each other or separated by one to about 800 amino acids (e.g., any of the subranges of this range described herein). The one or more amino acids between a pair of adjacent domains in the second polypeptide may be sequences derived from an endogenous single-chain polypeptide from which the transmembrane domain, costimulatory domain, or ITAM present in the second polypeptide originates.
[0125] Multi-chain chimeric antigen receptor-extracellular hormone receptor LBD Furthermore, this specification provides a multi-chain chimeric antigen receptor comprising at least one first polypeptide including an extracellular antigen-binding domain (e.g., any of the antigen-binding domains described herein or known in the art), an extracellular hormone receptor ligand-binding domain (e.g., any of the hormone receptor ligand-binding domains described herein or known in the art), and a transmembrane domain (e.g., any of the transmembrane domains described herein or known in the art), wherein the transmembrane domain and the extracellular hormone receptor ligand-binding domain are in direct contact with each other or separated by 1 to about 800 amino acids (e.g., any of the sub-ranges of this range described herein), and neither the transmembrane domain nor the hormone receptor ligand-binding domain is present in a single endogenous single-chain polypeptide. These multi-chain chimeric antigen receptors are specifically bound by the antigen-binding domain of any of the antigen-binding domains. The antigen may be any of the antigens described herein or known in the art. In some embodiments, the multi-chain chimeric antigen receptor specifically binds to only one antigen (e.g., any of the exemplary antigens described herein). In some embodiments, the multi-chain chimeric antigen receptor specifically binds to two different antigens (e.g., any combination of any of the exemplary antigens described herein).
[0126] In some embodiments of the multi-chain chimeric antigen receptor, in at least one first polypeptide, the extracellular hormone receptor ligand-binding domain and the transmembrane domain are in contact with each other. In some embodiments of the multi-chain chimeric antigen receptor, in at least one first polypeptide, 1 to about 700 amino acids (e.g., any of the subranges of this range described herein) are located between the extracellular hormone receptor ligand-binding domain and the transmembrane domain. In some embodiments, in at least one first polypeptide, one or more amino acids between the extracellular hormone receptor ligand-binding domain and the transmembrane domain are sequences derived from the same endogenous single-chain polypeptide from which the transmembrane domain is derived. In some embodiments, one or more amino acids between the extracellular hormone receptor ligand-binding domain and the transmembrane domain of at least one first polypeptide are or include a hinge region sequence of a human antibody (e.g., IgG1, IgG2, IgG3, or IgG4). In some embodiments, in at least one first polypeptide, one or more amino acids between the extracellular hormone receptor ligand-binding domain and the transmembrane domain are a linker sequence (e.g., a non-natural linker sequence) or include a linker sequence.
[0127] In some embodiments of these multi-chain chimeric antigen receptors, the transmembrane domain is in contact with an extracellular hormone receptor ligand-binding domain in at least one first polypeptide. In some embodiments of these multi-chain chimeric antigen receptors, in at least one first polypeptide, the transmembrane domain and the extracellular hormone receptor ligand-binding domain are separated by 1 to about 800 amino acids (e.g., or any of the sub-ranges of this range described herein). In some embodiments, in at least one first polypeptide, the amino acids between the transmembrane domain and the extracellular hormone receptor ligand-binding domain do not constitute a domain.
[0128] In some embodiments, in at least one first polypeptide, the amino acids between the transmembrane domain and the extracellular hormone receptor ligand-binding domain include one or more intervening domains (e.g., antigen-binding domains). In some embodiments, in at least one first polypeptide, the amino acids between the transmembrane domain and the antigen-binding domain include a sequence derived from the same endogenous transmembrane protein from which the transmembrane domain originates. In some embodiments, in at least one first polypeptide, the amino acids between the transmembrane domain and the antigen-binding domain include a linker sequence (e.g., a non-natural linker sequence). In some embodiments, one or more amino acids between the antigen-binding domain and the transmembrane domain of at least one first polypeptide are a hinge region sequence of a human antibody (e.g., IgG1, IgG2, IgG3, or IgG4), or include a hinge region sequence. In some embodiments, in at least one first polypeptide, one or more amino acids between the antigen-binding domain and the extracellular hormone receptor ligand-binding domain are a linker sequence (e.g., a non-natural linker sequence), or include a linker sequence.
[0129] In some embodiments, at least one first polypeptide comprises, from the N-terminus to the C-terminus, an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, and a transmembrane domain. It comprises an extracellular antigen-binding domain, an extracellular hormone receptor ligand-binding domain, and a transmembrane domain, extending from the C-terminus to the N-terminus. In some embodiments, at least one first polypeptide comprises an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, and a transmembrane domain, extending from the N-terminus to the C-terminus. In some embodiments, at least one first polypeptide comprises an extracellular hormone receptor ligand-binding domain, an extracellular antigen-binding domain, and a transmembrane domain, extending from the C-terminus to the N-terminus.
[0130] In some embodiments of these multi-chain chimeric antigen receptors, at least one first polypeptide may further comprise one or more (e.g., two or three) dimerization domains (e.g., any dimerization domain known in the art), costimulatory domains (e.g., any of the costimulatory domains described herein), and / or peptide tags (e.g., any peptide tags known in the art).
[0131] Some embodiments of these multi-chain chimeric antigen receptors further include a second polypeptide which may comprise one or more (e.g., two, three, or four, in any order or combination) transmembrane domains (e.g., any of the transmembrane domains described herein), dimerization domains (e.g., dimerization domains that can interact with at least one dimerization domain in the first polypeptide in mammalian cells), one or more costimulatory domains (e.g., any of the costimulatory domains described herein), and one or more ITAMs (e.g., any of the ITAMs described herein). As will be readily apparent to those skilled in the art, in the second polypeptide, a pair or each pair of adjacent domains may be in contact with each other or separated by one to about 800 amino acids (e.g., any of the subranges of this range described herein). The one or more amino acids between a pair of adjacent domains in the second polypeptide may be sequences derived from an endogenous single-chain polypeptide from which the transmembrane domains, costimulatory domains, or ITAMs present in the second polypeptide originate. In the second polypeptide, one or more amino acids between a pair of adjacent domains may be a linker sequence (e.g., a linker sequence of non-natural origin) or may contain a linker sequence.
[0132] As can be fully understood in the art, two or more polypeptides present in a multi-chain chimeric antigen receptor can associate via a pair of domains that interact with each other (by dimerizing domains). In some embodiments, the interaction between dimerizing domains may be induced by the addition of a small molecule. In some embodiments, two or more polypeptides present in a multimeric chimeric antigen receptor may associate by non-covalent interactions (e.g., association between dimerizing domains). In some embodiments, the two or more polypeptides present in a multimeric chimeric antigen receptor may associate by covalent interactions (e.g., by disulfide bonds, ester bonds, amide bonds, thioester bonds, or a combination thereof).
[0133] transmembrane domain In some embodiments, the single-chain chimeric polypeptide, single-chain chimeric antigen receptor, or multi-chain chimeric antigen receptor is the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28 (also known as Tp44), CD3ε, CD3δ, CD3γ, CD33, CD37 (also known as GP52-40 or TSPAN26), CD64 (also known as FCGR1A), CD80 (also known as B7, B7-1, B7.1, BB1, CD28LG, CD28LG1, and LAB7), CD45 (PTPRC, B220, CD45R, GP180, L-CA, LCA, LY5, T200, and protein tyrosine phosphatase, also known as receptor type C), CD4, CD5 (also known as LEU1 and T1), CD8α (also known as Leu2, MAL, and p32). CD9 (also known as BTCC-1, DRAP-27, MIC3, MRP-1, TSPAN-29, and TSPAN29), CD16 (also known as FCGR3 and FCG3), CD22 (also known as SIGLEC-2 and SIGLEC2), CD86 (also known as B7-2, B7.2, B70, CD28LG2, and LAB72), CD134 (TNFRSF4, ACT35, RP5-902P8.3, IMD16, OX40, TXGP1L, and tumor CD137 (also known as necrosis factor receptor superfamily member 4), CD27 (also known as S152, S152.LPFS2, T14, TNFRSF7, and Tp55), CD152 (also known as CTLA4, ALPS5, CELIAC3, CTLA-4, GRD4, GSE, IDDM12, and cytotoxic T lymphocyte-associated protein 4) PD1 (also known as PDCD1, CD279, PD-1, SLEB2, h...
Claims
1. A single-chain chimeric polypeptide, wherein the single-chain chimeric polypeptide is Transmembrane domain and The hormone receptor ligand binding domain, Includes, The transmembrane domain and the hormone receptor ligand-binding domain are either in direct contact with each other or separated by 1 to 500 amino acids. Both the transmembrane domain and the hormone receptor ligand-binding domain are not present in the same endogenous single-chain polypeptide in mammals. Single-chain chimeric polypeptide.
2. The single-chain chimeric polypeptide according to claim 1, wherein the transmembrane domain is a transmembrane domain derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154.
3. The single-chain chimeric polypeptide according to claim 1, wherein the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor, a progesterone receptor, or an androgen receptor.
4. The single-chain chimeric polypeptide according to claim 3, wherein the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor.
5. The single-chain chimeric polypeptide according to any one of claims 1 to 4, wherein the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other.
6. The single-chain chimeric polypeptide according to any one of claims 1 to 4, wherein the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 500 amino acids.
7. The single-chain chimeric polypeptide according to claim 6, wherein the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 250 amino acids.
8. The single-chain chimeric polypeptide according to claim 7, wherein the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 50 amino acids.
9. A nucleic acid comprising a nucleotide sequence encoding a single-chain chimeric polypeptide according to any one of claims 1 to 8.
10. A vector comprising the nucleic acid described in claim 9.
11. A mammalian cell containing the vector according to claim 10.
12. A method for inducing membrane localization of single-chain chimeric polypeptides in mammalian cells, Contacting a mammalian cell expressing a single-chain chimeric polypeptide according to any one of claims 1 to 8 with a hormone or hormone analogue in an amount sufficient to induce the localization of the single-chain chimeric polypeptide to the extracellular region of the plasma membrane of the cell, Methods that include...
13. A method for reversibly altering the membrane localization of single-chain chimeric polypeptides in mammalian cells, (a) Contacting a mammalian cell expressing a single-chain chimeric polypeptide according to any one of claims 1 to 8 with a hormone or hormone analogue in an amount sufficient to induce the localization of the single-chain chimeric polypeptide to the extracellular region of the plasma membrane of the cell, (b) By contacting the mammalian cells with the hormone or hormone analog in reduced quantities, a reduction in the level of the single-chain chimeric polypeptide on the extracellular side of the plasma membrane of the mammalian cells, Methods that include...
14. (c) Contacting the mammalian cells with an increased amount of the hormone or a hormone analog to cause an increase in the level of the single-chain chimeric polypeptide on the extracellular surface of the plasma membrane of the cells compared to the level in step (b). The method according to claim 13, further comprising:
15. The method according to any one of claims 12 to 14, further comprising introducing a nucleic acid encoding the single-chain chimeric polypeptide into a mammalian cell to produce a mammalian cell expressing the single-chain chimeric polypeptide.
16. The method according to any one of claims 12 to 15, wherein the mammalian cell is a T cell.
17. The T cell is CD8 + T cells, CD4 + The method according to claim 16, selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
18. The method according to any one of claims 12 to 17, wherein the mammalian cells are mammalian cells previously obtained from a subject.
19. The method according to claim 18, wherein the subject has been identified or diagnosed with cancer.
20. The method according to claim 18 or 19, further comprising obtaining the mammalian cells from the subject.
21. The method according to any one of claims 12 to 20, wherein the contact step is performed in vitro.
22. The method according to any one of claims 12 to 20, wherein the contact step is performed in a mammal.
23. A single-chain chimeric antigen receptor, wherein the single-chain chimeric antigen receptor is Extracellular antigen-binding domain, Transmembrane domain and The hormone receptor ligand binding domain, Co-stimulatory domain and Immune receptor activating tyrosine motif (ITAM), Includes, The transmembrane domain and the hormone receptor ligand-binding domain are either in direct contact with each other or separated by 1 to 500 amino acids. Both the transmembrane domain and the hormone receptor ligand-binding domain are mammalian In the same endogenous single-chain polypeptide, Single-chain chimeric antigen receptor.
24. The extracellular antigen-binding domain is scFv, (scFv) 2 , V H H domain, and V NAR A single-chain chimeric antigen receptor according to claim 23, selected from the group consisting of domains.
25. The single-chain chimeric antigen receptor according to claim 24, wherein the extracellular antigen-binding domain is scFv.
26. The single-chain chimeric antigen receptor according to any one of claims 23 to 25, wherein the extracellular antigen-binding domain specifically binds to a single antigen.
27. The single-chain chimeric antigen receptor according to claim 26, wherein the single antigen is a tumor antigen.
28. The single-chain chimeric antigen receptor according to claim 27, wherein the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16.
29. The single-chain chimeric antigen receptor according to claim 28, wherein the tumor antigen is CD19.
30. The single-chain chimeric antigen receptor according to claim 23, wherein the extracellular antigen-binding domain specifically binds to two different antigens.
31. The single-chain chimeric antigen receptor according to any one of claims 23 to 30, wherein the transmembrane domain is a transmembrane domain derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154.
32. The single-chain chimeric antigen receptor according to any one of claims 23 to 31, wherein the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor, a progesterone receptor, or an androgen receptor.
33. The single-chain chimeric antigen receptor according to claim 32, wherein the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor.
34. The single-chain chimeric antigen receptor according to any one of claims 23 to 33, wherein the aforementioned co-stimulatory domain is a cytoplasmic co-stimulatory domain derived from CD27, CD28, 4-1BB, OX40, CD30, CD40L, CD40, PD-1, PD-L1, ICOS, LFA-1, CD2, CD7, CD160, LIGHT, BTLA, TIM3, CD244, CD80, LAG3, NKG2C, and B7-H3.
35. The single-chain chimeric antigen receptor according to claim 34, wherein the costimulatory domain is 4-1BB or CD28.
36. The single-chain chimeric antigen receptor according to any one of claims 23 to 35, wherein the ITAM comprises a cytoplasmic signaling sequence derived from CD3ζ.
37. The single-chain chimeric antigen receptor according to any one of claims 23 to 36, wherein the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other.
38. The single-chain chimeric antigen receptor according to any one of claims 23 to 36, wherein the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 500 amino acids.
39. The single-chain chimeric antigen receptor according to claim 38, wherein the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 250 amino acids.
40. The single-chain chimeric antigen receptor according to claim 39, wherein the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 50 amino acids.
41. A nucleic acid comprising a nucleotide sequence encoding a single-chain chimeric antigen receptor according to any one of claims 23 to 40.
42. A vector comprising the nucleic acid described in claim 41.
43. A mammalian cell comprising the vector according to claim 42.
44. A method for inducing membrane localization of single-chain chimeric antigen receptors in mammalian cells, Contacting mammalian cells expressing a single-chain chimeric antigen receptor according to any one of claims 23 to 40 with a hormone or hormone analogue sufficient to induce the localization of the single-chain chimeric antigen-binding receptor to the extracellular space of the plasma membrane of the cells, Methods that include...
45. A method for altering the membrane localization of single-chain chimeric antigen receptors in mammalian cells, (a) Contacting mammalian cells expressing a single-chain chimeric antigen receptor according to any one of claims 23 to 40 with a hormone or hormone analogue in an amount sufficient to induce the localization of the single-chain chimeric antigen-binding receptor to the extracellular side of the plasma membrane of the cell, (b) A method comprising contacting the mammalian cells with an amount of the hormone or a hormone analogue that causes a decrease in the level of the single-chain chimeric antigen receptor on the extracellular side of the plasma membrane of the cells.
46. (c) The method of claim 45, further comprising contacting the mammalian cells with the hormone or a hormone analogue in an amount that causes an increase in the level of single-chain chimeric antigen receptors on the extracellular surface of the plasma membrane of the cells, compared to the level of (b).
47. The method according to any one of claims 44 to 46, further comprising introducing a nucleic acid encoding the single-chain chimeric antigen receptor into mammalian cells to produce mammalian cells expressing the single-chain chimeric antigen receptor.
48. The method according to claim 47, wherein the mammalian cell is a T cell.
49. The T cell is CD8 + T cells, CD4 + The method according to claim 48, wherein the cells are selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
50. The method according to any one of claims 44 to 49, wherein the mammalian cells are mammalian cells previously obtained from a subject.
51. The method according to claim 50, wherein the subject has been identified or diagnosed with cancer.
52. The method according to claim 50 or 51, further comprising obtaining the mammalian cells from the subject.
53. The method according to any one of claims 44 to 52, wherein the contact step is performed in vitro.
54. The method according to any one of claims 44 to 52, wherein the contact step is performed on a mammal.
55. The method according to claim 54, wherein the mammal has cancer.
56. The method according to claim 55, wherein the contact step results in the treatment of cancer in the mammal.
57. A multi-chain chimeric antigen receptor, wherein the multi-chain chimeric antigen receptor is Extracellular antigen-binding domain, Transmembrane domain and The hormone receptor ligand binding domain, It comprises at least one first polypeptide including, The transmembrane domain and the hormone receptor ligand-binding domain are either in direct contact with each other or separated by 1 to 500 amino acids. Both the transmembrane domain and the hormone receptor ligand-binding domain are not present in the same endogenous single-chain polypeptide in mammals. Multi-chain chimeric antigen receptor.
58. wherein the extracellular antigen-binding domain is selected from the group consisting of scFv, (scFv) 2 2 , VH H H domain, and VL NAR NAR domain, the multi-chain chimeric antigen receptor according to claim 57.
59. The multi-chain chimeric antigen receptor according to claim 58, wherein the extracellular antigen-binding domain is scFv.
60. The multi-chain chimeric antigen receptor according to any one of claims 57 to 59, wherein the extracellular antigen-binding domain specifically binds to a single antigen.
61. The multi-chain chimeric antigen receptor according to claim 60, wherein the single antigen is a tumor antigen.
62. The multi-chain chimeric antigen receptor according to claim 61, wherein the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16.
63. The multi-chain chimeric antigen receptor according to claim 62, wherein the tumor antigen is CD19.
64. The multi-chain chimeric antigen receptor according to claim 57, wherein the extracellular antigen-binding domain specifically binds to two different antigens.
65. The aforementioned transmembrane domains are the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, and C. A multi-chain chimeric antigen receptor according to any one of claims 57 to 64, wherein the transmembrane domain is derived from D134, CD137, or CD154.
66. The multi-chain chimeric antigen receptor according to any one of claims 57 to 65, wherein the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor, a progesterone receptor, or an androgen receptor.
67. The multi-chain chimeric antigen receptor according to claim 66, wherein the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor.
68. The multi-chain chimeric antigen receptor according to any one of claims 57 to 67, wherein the transmembrane domain and the hormone receptor ligand-binding domain are in direct contact with each other.
69. The multi-chain chimeric antigen receptor according to any one of claims 57 to 67, wherein the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 500 amino acids.
70. The multi-chain chimeric antigen receptor according to claim 69, wherein the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 250 amino acids.
71. The multi-chain chimeric antigen receptor according to claim 70, wherein the transmembrane domain and the hormone receptor ligand-binding domain are separated by 1 to 50 amino acids.
72. The multi-chain chimeric antigen receptor according to any one of claims 57 to 71, wherein the at least one polypeptide further comprises a costimulatory domain.
73. The multi-chain chimeric antigen receptor according to claim 72, wherein the aforementioned co-stimulatory domain is a cytoplasmic co-stimulatory domain derived from CD27, CD28, 4-1BB, OX40, CD30, CD40L, CD40, PD-1, PD-L1, ICOS, LFA-1, CD2, CD7, CD160, LIGHT, BTLA, TIM3, CD244, CD80, LAG3, NKG2C, and B7-H3.
74. The multi-chain chimeric antigen receptor according to claim 33, wherein the costimulatory domain is 4-1BB or CD28.
75. A method for inducing membrane localization of multi-chain chimeric antigen receptors in mammalian cells, Contacting mammalian cells expressing a multi-chain chimeric antigen receptor according to any one of claims 57 to 74 with a hormone or hormone analogue sufficient to induce the localization of the multi-chain chimeric antigen-binding receptor to the extracellular space of the plasma membrane of the cells, Methods that include...
76. A method for altering the membrane localization of multi-chain chimeric antigen receptors in mammalian cells, (a) Contacting mammalian cells expressing a multi-chain chimeric antigen receptor according to any one of claims 57 to 74 with a hormone or hormone analogue in an amount sufficient to induce the localization of the multi-chain chimeric antigen-binding receptor to the extracellular side of the plasma membrane of the cell, (b) Contacting the mammalian cells with an amount of the hormone or hormone analogue that causes a decrease in the level of the multi-chain chimeric antigen-binding receptors on the extracellular side of the plasma membrane of the cells, Methods that include...
77. (c) The method of claim 76, further comprising contacting the mammalian cells with an amount of the hormone or a hormone analogue that causes an increase in the level of the multi-chain chimeric antigen-binding receptors extracellularly on the plasma membrane of the cells.
78. The method according to any one of claims 75 to 77, further comprising introducing a nucleic acid encoding the single-chain chimeric antigen receptor into the mammalian cells to produce mammalian cells expressing the single-chain chimeric antigen receptor.
79. The method according to claim 78, wherein the mammalian cell is a T cell.
80. The T cell is CD8 + T cells, CD4 + The method according to claim 79, comprising a selection from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
81. The method according to any one of claims 75 to 80, wherein the mammalian cells are mammalian cells previously obtained from a subject.
82. The method according to claim 81, wherein the subject has been identified or diagnosed with cancer.
83. The method according to claim 81 or 82, further comprising obtaining the mammalian cells from the subject.
84. The method according to any one of claims 75 to 83, wherein the contact step is performed in vitro.
85. The method according to any one of claims 75 to 83, wherein the contact step is performed on a mammal.
86. The method according to claim 85, wherein the mammal has cancer.
87. The method according to claim 86, wherein the contact step results in the treatment of cancer in the mammal.
88. A method for treating cancer in a subject, (a) Administering mammalian cells expressing a single-chain chimeric antigen receptor according to any one of claims 23 to 40 or a multi-chain chimeric antigen receptor according to any one of claims 57 to 74 to the subject, Furthermore, the antigen-binding domain specifically binds to the antigen expressed by cancer in the subject; (b) administering to the subject a sufficient amount of hormone or hormone to induce the localization of the single-chain or multi-chain chimeric antigen receptor to the extracellular space of the plasma membrane of the cell, (c) After (b), identify in the subject the presence or severity of one or more symptoms associated with toxicity, the level of one or more cytokines associated with a cytokine storm, or both. (d) Comparing the presence or severity of one or more symptoms associated with the identified toxicity, the level of one or more cytokines associated with the identified cytokine storm, or both, to a control(s), (e) After (e), the presence or severity of one or more symptoms associated with the toxicity, the level of one or more cytokines associated with the cytokine storm, or both, is reduced in the subject by the single or multiple extracellular chains of the plasma membrane of the cells. Administering to the subject an amount of the hormone or a hormone analog sufficient to reduce the level of the chain's chimeric antigen receptor, Methods that include...
89. The method according to claim 88, wherein the amount of the hormone or hormone analog administered to the subject in step (e) is reduced by at least 25% compared to the amount of the hormone or hormone analog administered to the subject in step (b).
90. The method according to claim 89, wherein the amount of the hormone or hormone analog administered to the subject in step (e) is reduced by at least 50% compared to the amount of the hormone or hormone analog administered to the subject in step (b).
91. The method according to claim 90, wherein the amount of the hormone or hormone analog administered to the subject in step (e) is reduced by at least 75% compared to the level of the hormone or hormone analog administered to the subject in step (b).
92. The method according to claim 91, wherein the amount of the hormone or hormone analog administered to the subject in step (e) is reduced by 100% compared to the level of the hormone or hormone analog administered to the subject in step (b).
93. The method according to claim 88, wherein one or more symptoms associated with the toxicity are selected from the group consisting of high fever, swelling, chills, hypotension, tachycardia, weakness, headache, rash, sore throat, difficulty breathing, redness, extreme fatigue, nausea, and cerebral edema.
94. The method according to claim 88, wherein one or more cytokines associated with the cytokine storm are selected from the group consisting of tumor necrosis factor alpha, IFNγ, IL-10, IL-1β, IL-2, IL-6, IL-8, and IL-10, granulocyte-macrophage colony-stimulating factor (GM-CSF), and IL-5.
95. A single-chain chimeric polypeptide, wherein the single-chain chimeric polypeptide is Extracellular hormone receptor ligand binding domain, Transmembrane domain and Includes, The hormone receptor ligand-binding domain and the transcellular domain are either in direct contact with each other or separated by 1 to 700 amino acids. Both the transmembrane domain and the extracellular hormone receptor ligand-binding domain are not present in a single endogenous single-chain polypeptide in mammals. Single-chain chimeric polypeptide.
96. The single-chain chimeric polypeptide according to claim 95, wherein the transmembrane domain is a transmembrane domain derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154.
97. The single-chain chimeric polypeptide according to claim 95, wherein the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor, a progesterone receptor, or an androgen receptor.
98. The extracellular hormone receptor ligand-binding domain is derived from the estrogen receptor. A single-chain chimeric polypeptide according to claim 97, wherein the bond-binding domain is a single-chain chimeric polypeptide.
99. The single-chain chimeric polypeptide according to claim 98, wherein the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from a human estrogen receptor.
100. The single-chain chimeric polypeptide according to claim 99, wherein the ligand-binding domain of the human estrogen receptor has a wild-type sequence, except that it includes one or both of the amino acid substitutions at position 521 and amino acid substitutions at position 537, which are numbered with respect to the full-length wild-type sequence of the human hormone receptor.
101. The single-chain chimeric polypeptide according to any one of claims 95 to 100, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are in direct contact with each other.
102. The single-chain chimeric polypeptide according to any one of claims 95 to 100, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 700 amino acids.
103. The single-chain chimeric polypeptide according to claim 102, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 500 amino acids.
104. The single-chain chimeric polypeptide according to claim 103, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 250 amino acids.
105. The single-chain chimeric polypeptide according to claim 104, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 100 amino acids.
106. The single-chain chimeric polypeptide according to claim 105, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 50 amino acids.
107. The single-chain chimeric polypeptide according to claim 106, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 25 amino acids.
108. The single-chain chimeric polypeptide according to any one of claims 95 to 100, wherein the single-chain chimeric polypeptide comprises, from the N-terminus to the C-terminus, the extracellular antigen-binding domain, the extracellular hormone receptor ligand-binding domain, and the transmembrane domain.
109. The single-chain chimeric polypeptide according to any one of claims 95 to 100, wherein the single-chain chimeric polypeptide comprises, from the C-terminus to the N-terminus, the extracellular antigen-binding domain, the extracellular hormone receptor ligand-binding domain, and the transmembrane domain.
110. The single-chain chimeric polypeptide according to any one of claims 95 to 100, wherein the single-chain chimeric polypeptide comprises, from the N-terminus to the C-terminus, the extracellular hormone receptor ligand-binding domain, the extracellular antigen-binding domain, and the transmembrane domain.
111. The single-chain chimeric polypeptide according to any one of claims 95 to 100, wherein the single-chain chimeric polypeptide comprises, from the C-terminus to the N-terminus, the extracellular hormone receptor ligand-binding domain, the extracellular antigen-binding domain, and the transmembrane domain.
112. A nucleic acid comprising a nucleotide sequence encoding a single-chain chimeric polypeptide according to any one of claims 95 to 111.
113. A vector comprising the nucleic acid described in claim 112.
114. A mammalian cell comprising the vector according to claim 113.
115. A mammalian cell according to claim 114, which is a T cell.
116. The T cell is CD8 + T cells, CD4 + A mammalian cell according to claim 115, selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
117. A method for inducing plasma membrane localization of single-chain chimeric polypeptides in mammalian cells, (a) Contacting a mammalian cell expressing a single-chain chimeric polypeptide according to any one of claims 95 to 111 with a hormone or hormone analogue in an amount sufficient to induce the localization of the single-chain chimeric polypeptide to the extracellular side of the plasma membrane of the cell. Methods that include...
118. A method for reversibly altering the plasma membrane localization of single-chain chimeric polypeptides in mammalian cells, (a) Contacting a mammalian cell expressing a single-chain chimeric polypeptide according to any one of claims 95 to 111 with a hormone or hormone analogue in an amount sufficient to induce the localization of the single-chain chimeric polypeptide to the extracellular side of the plasma membrane of the cell, (b) By contacting the mammalian cells with the hormone or hormone analog in reduced quantities, a reduction in the level of the single-chain chimeric polypeptide on the extracellular side of the plasma membrane of the mammalian cells, Methods that include...
119. (c) The method of claim 118, further comprising contacting the mammalian cells with an increased amount of the hormone or a hormone analog to produce an increase in the level of the single-chain chimeric polypeptide extracellularly on the plasma membrane of the cells compared to the level of step (b).
120. The method according to any one of claims 117 to 119, further comprising, before step (a), introducing a nucleic acid encoding the single-chain chimeric polypeptide into mammalian cells to produce mammalian cells expressing the single-chain chimeric polypeptide.
121. The method according to any one of claims 117 to 120, wherein the mammalian cell is a T cell.
122. The T cell is CD8 + T cells, CD4 + The method according to claim 121, selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
123. The method according to any one of claims 117 to 122, wherein the mammalian cells are mammalian cells previously obtained from a subject.
124. The method according to claim 123, wherein the subject has been identified or diagnosed with cancer.
125. The method according to claim 123 or 124, further comprising obtaining the mammalian cells from the subject.
126. The method according to any one of claims 117 to 125, wherein the contact step(s) are performed in vitro.
127. The method according to any one of claims 117 to 125, wherein the contact step (which may be multiple) is performed in a mammal.
128. A single-chain chimeric antigen receptor, wherein the single-chain chimeric antigen receptor is Extracellular antigen-binding domain, Extracellular hormone receptor ligand binding domain, Transmembrane domain and Intracellular co-stimulatory domain, Intracellular immune receptor-activating tyrosine motifs (ITAMs) and Includes, The transmembrane domain and the extracellular hormone receptor ligand-binding domain are either in direct contact with each other or separated by 1 to 700 amino acids. Both the transmembrane domain and the extracellular hormone receptor ligand-binding domain are not present in a single endogenous single-chain polypeptide in mammals. Single-chain chimeric antigen receptor.
129. The extracellular antigen-binding domain is scFv, (scFv) 2 , V H H domain, and V NAR A single-chain chimeric antigen receptor according to claim 128, selected from the group consisting of domains.
130. The single-chain chimeric antigen receptor according to claim 129, wherein the extracellular antigen-binding domain is scFv.
131. The single-chain chimeric antigen receptor according to any one of claims 128 to 130, wherein the extracellular antigen-binding domain specifically binds to a single antigen.
132. The single-chain chimeric antigen receptor according to claim 131, wherein the single antigen is a tumor antigen.
133. The single-chain chimeric antigen receptor according to claim 132, wherein the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16.
134. The single-chain chimeric antigen receptor according to claim 133, wherein the tumor antigen is CD19.
135. The single-chain chimeric antigen receptor according to claim 128, wherein the extracellular antigen-binding domain specifically binds to two different antigens.
136. The single-chain chimeric antigen receptor according to claim 135, wherein at least one of the two different antigens is a tumor antigen.
137. The single-chain chimeric antigen receptor according to claim 136, wherein the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16.
138. The single-chain chimeric antigen receptor according to claim 137, wherein the tumor antigen is CD19.
139. The single-chain chimeric antigen receptor according to any one of claims 128 to 138, wherein the transmembrane domain is a transmembrane domain derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154.
140. The single-chain chimeric antigen receptor according to any one of claims 128 to 139, wherein the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor, a progesterone receptor, or an androgen receptor.
141. The single-chain chimeric antigen receptor according to claim 140, wherein the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor.
142. The single-chain chimeric antigen receptor according to claim 141, wherein the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from a human estrogen receptor.
143. The single-chain chimeric antigen receptor according to claim 142, wherein the ligand-binding domain of the human estrogen receptor has a wild-type sequence, except that it includes one or both of the amino acid substitutions at position 521 and position 537, which are numbered with respect to the full-length wild-type sequence of the human hormone receptor.
144. The single-chain chimeric antigen receptor according to any one of claims 128 to 143, wherein the intracellular costimulatory domain is a cytoplasmic costimulatory domain derived from CD27, CD28, 4-1BB, OX40, CD30, CD40L, CD40, PD-1, PD-L1, ICOS, LFA-1, CD2, CD7, CD160, LIGHT, BTLA, TIM3, CD244, CD80, LAG3, NKG2C, and B7-H3.
145. The single-chain chimeric antigen receptor according to claim 144, wherein the intracellular costimulatory domain is the cytoplasmic costimulatory domain derived from 4-1BB or CD28.
146. The single-chain chimeric antigen receptor according to any one of claims 128 to 145, wherein the intracellular ITAM comprises a cytoplasmic signaling sequence derived from CD3ζ.
147. The single-chain chimeric antigen receptor according to any one of claims 128 to 146, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are in direct contact with each other.
148. The single-chain chimeric antigen receptor according to any one of claims 128 to 146, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 700 amino acids.
149. The single-chain chimeric antigen receptor according to claim 148, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 500 amino acids.
150. The single-chain chimeric antigen receptor according to claim 149, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 250 amino acids.
151. The single-chain chimeric antigen receptor according to claim 150, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 100 amino acids.
152. The single-chain chimeric antigen receptor according to claim 151, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 50 amino acids.
153. The single-chain chimeric antigen receptor according to claim 152, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 25 amino acids.
154. The single-chain chimeric antigen receptor according to any one of claims 128 to 146, wherein the single-chain chimeric antigen receptor comprises, from the N-terminus to the C-terminus, the extracellular antigen-binding domain, the extracellular hormone receptor ligand-binding domain, the transmembrane domain, the intracellular costimulatory domain, and the ITAM.
155. The single-chain chimeric antigen receptor according to any one of claims 128 to 146, wherein the single-chain chimeric antigen receptor comprises, from the C-terminus to the N-terminus, the extracellular antigen-binding domain, the extracellular hormone receptor ligand-binding domain, the transmembrane domain, the intracellular costimulatory domain, and the ITAM.
156. The single-chain chimeric antigen receptor according to any one of claims 128 to 146, wherein the single-chain chimeric antigen receptor comprises, from the N-terminus to the C-terminus, the extracellular hormone receptor ligand-binding domain, the extracellular antigen-binding domain, the transmembrane domain, the intracellular costimulatory domain, and the ITAM.
157. The single-chain chimeric antigen receptor according to any one of claims 128 to 146, wherein the single-chain chimeric polypeptide comprises, from the C-terminus to the N-terminus, the extracellular hormone receptor ligand-binding domain, the extracellular antigen-binding domain, the transmembrane domain, the intracellular costimulatory domain, and the ITAM.
158. A nucleic acid comprising a nucleotide sequence encoding a single-chain chimeric antigen receptor according to any one of claims 128 to 157.
159. A vector comprising the nucleic acid described in claim 158.
160. A mammalian cell comprising the vector according to claim 159.
161. The mammalian cell according to claim 160, wherein the mammalian cell is a T cell.
162. The T cell is CD8 + T cells, CD4 + A mammalian cell according to claim 161, selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
163. A method for inducing plasma membrane localization of single-chain chimeric antigen receptors in mammalian cells, (a) Contacting a mammalian cell expressing a single-chain chimeric antigen receptor according to any one of claims 128 to 157 with a hormone or hormone analogue sufficient to induce the localization of the single-chain chimeric antigen-binding receptor to the extracellular side of the plasma membrane of the cell, Methods that include...
164. A method for altering the plasma membrane localization of single-chain chimeric antigen receptors in mammalian cells, (a) Contacting mammalian cells expressing a single-chain chimeric antigen receptor according to any one of claims 128 to 157 with a hormone or hormone analogue sufficient to induce localization of the single-chain chimeric antigen-binding receptor to the extracellular side of the plasma membrane of the cell, (b) Contacting the mammalian cells with an amount of the hormone or a hormone analog that causes a decrease in the level of the single-chain chimeric antigen receptor on the extracellular side of the plasma membrane of the cells, Methods that include...
165. (c) The method of claim 164, further comprising contacting the mammalian cells with the hormone or a hormone analogue in an amount that causes an increase in the level of the single-chain chimeric antigen receptor on the extracellular surface of the plasma membrane of the cells, compared to the level in (b).
166. The method according to any one of claims 163 to 165, further comprising, before step (a), introducing a nucleic acid encoding the single-chain chimeric antigen receptor into mammalian cells to produce mammalian cells expressing the single-chain chimeric antigen receptor.
167. The method according to claim 166, wherein the mammalian cell is a T cell.
168. The T cell is CD8 + T cells, CD4 + The method according to claim 167, comprising a selection from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
169. The method according to any one of claims 163 to 168, wherein the mammalian cells are mammalian cells previously obtained from a subject.
170. The method according to claim 169, wherein the subject has been identified or diagnosed with cancer.
171. The method according to claim 169 or 170, further comprising obtaining the mammalian cells from the subject.
172. The method according to any one of claims 163 to 171, wherein the contact step(s) (which may be multiple) is performed in vitro.
173. The method according to any one of claims 163 to 171, wherein the contact step (which may be multiple) is performed in a mammal.
174. The method according to claim 173, wherein the mammal has cancer.
175. The method according to claim 174, wherein the contact step results in the treatment of cancer in the mammal.
176. A multi-chain chimeric antigen receptor, wherein the multi-chain chimeric antigen receptor is Extracellular antigen-binding domain, Extracellular hormone receptor ligand binding domain, Transmembrane domain and It comprises at least one first polypeptide including, The transmembrane domain and the extracellular hormone receptor ligand-binding domain are either in direct contact with each other or separated by 1 to 700 amino acids. Both the transmembrane domain and the extracellular hormone receptor ligand-binding domain are not present in a single endogenous single-chain polypeptide in mammals. Multi-chain chimeric antigen receptor.
177. The extracellular antigen-binding domain is scFv, (scFv) 2 , V H H domain, and V NAR A multi-chain chimeric antigen receptor according to claim 176, selected from the group consisting of domains.
178. The multi-chain chimeric antigen receptor according to claim 177, wherein the extracellular antigen-binding domain is scFv.
179. The multi-chain chimeric antigen receptor according to any one of claims 176 to 178, wherein the extracellular antigen-binding domain specifically binds to a single antigen.
180. The multi-chain chimeric antigen receptor according to claim 179, wherein the single antigen is a tumor antigen.
181. The multi-chain chimeric antigen receptor according to claim 180, wherein the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16.
182. The multi-chain chimeric antigen receptor according to claim 181, wherein the tumor antigen is CD19.
183. The multi-chain chimeric antigen receptor according to claim 179, wherein the extracellular antigen-binding domain specifically binds to two different antigens.
184. The multi-chain chimeric antigen receptor according to claim 183, wherein at least one of the two different antigens is a tumor antigen.
185. The multi-chain chimeric antigen receptor according to claim 184, wherein the tumor antigen is selected from the group consisting of CD19, WT-1, CD22, L1-CAM, ROR-1, CD30, CD125, AFP, CEA, ETA, MAGE, and MUC16.
186. The multi-chain chimeric antigen receptor according to claim 185, wherein the tumor antigen is CD19.
187. The multi-chain chimeric antigen receptor according to any one of claims 176 to 186, wherein the transmembrane domain is a transmembrane domain derived from the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD3ε, CD3δ, CD3γ, CD33, CD37, CD64, CD80, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD86, CD134, CD137, or CD154.
188. The multi-chain chimeric antigen receptor according to any one of claims 176 to 187, wherein the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor, a progesterone receptor, or an androgen receptor.
189. The multi-chain chimeric antigen receptor according to claim 188, wherein the hormone receptor ligand-binding domain is a ligand-binding domain derived from an estrogen receptor.
190. The multi-chain chimeric antigen receptor according to claim 189, wherein the extracellular hormone receptor ligand-binding domain is a ligand-binding domain derived from a human estrogen receptor.
191. The multi-chain chimeric antigen receptor according to claim 190, wherein the ligand-binding domain of the human estrogen receptor has a wild-type sequence, except that it includes one or both of the amino acid substitutions at position 521 and position 537, which are numbered with respect to the full-length wild-type sequence of the human hormone receptor.
192. The multi-chain chimeric antigen receptor according to any one of claims 176 to 191, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are in direct contact with each other.
193. The multi-chain chimeric antigen receptor according to any one of claims 176 to 191, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 700 amino acids.
194. The multi-chain chimeric antigen receptor according to claim 193, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 500 amino acids.
195. The multi-chain chimeric antigen receptor according to claim 194, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 250 amino acids.
196. The multi-chain chimeric antigen receptor according to claim 195, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 100 amino acids.
197. The multi-chain chimeric antigen receptor according to claim 196, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 50 amino acids.
198. The multi-chain chimeric antigen receptor according to claim 197, wherein the extracellular hormone receptor ligand-binding domain and the transmembrane domain are separated by 1 to 25 amino acids.
199. The multi-chain chimeric antigen receptor according to any one of claims 176 to 198, wherein the at least one polypeptide further comprises an intracellular costimulatory domain.
200. The multi-chain chimeric antigen receptor according to claim 199, wherein the intracellular costimulatory domain is the cytoplasmic costimulatory domain derived from CD27, CD28, 4-1BB, OX40, CD30, CD40L, CD40, PD-1, PD-L1, ICOS, LFA-1, CD2, CD7, CD160, LIGHT, BTLA, TIM3, CD244, CD80, LAG3, NKG2C, and B7-H3.
201. The multi-chain chimeric antigen receptor according to claim 200, wherein the intracellular costimulatory domain is a cytoplasmic costimulatory domain derived from 4-1BB or CD28.
202. The multi-chain chimeric antigen receptor according to any one of claims 176 to 191, wherein the at least one first polypeptide comprises, from the N-terminus to the C-terminus, the extracellular antigen-binding domain, the extracellular hormone receptor ligand-binding domain, and the transmembrane domain.
203. The multi-chain chimeric antigen receptor according to any one of claims 176 to 191, wherein the at least one first polypeptide comprises, from the C-terminus to the N-terminus, the extracellular antigen-binding domain, the extracellular hormone receptor ligand-binding domain, and the transmembrane domain.
204. The multi-chain chimeric antigen receptor according to any one of claims 176 to 191, wherein the at least one first polypeptide comprises, from the N-terminus to the C-terminus, the extracellular hormone receptor ligand-binding domain, the extracellular antigen-binding domain, and the transmembrane domain.
205. The at least one first polypeptide extends from the C-terminus to the N-terminus of the cell A multi-chain chimeric antigen receptor according to any one of claims 176 to 191, comprising an exohormonal receptor ligand-binding domain, the extracellular antigen-binding domain, and the transmembrane domain.
206. A nucleic acid encoding a multi-strand chimeric receptor according to any one of claims 176 to 205.
207. A pair of nucleic acids that together encode a multi-stranded chimeric receptor according to any one of claims 176 to 205.
208. A mammalian cell containing the nucleic acid described in claim 206.
209. A mammalian cell comprising a set of nucleic acids as described in claim 207.
210. The mammalian cell according to claim 208 or 209, wherein the mammalian cell is a T cell.
211. The T cell is CD8 + T cells, CD4 + A mammalian cell according to claim 210, selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
212. A method for inducing plasma membrane localization of multi-chain chimeric antigen receptors in mammalian cells, (a) Contacting mammalian cells expressing a multi-chain chimeric antigen receptor according to any one of claims 176 to 205 with a hormone or hormone analogue sufficient to induce localization of the multi-chain chimeric antigen-binding receptor to the extracellular side of the plasma membrane of the cell, Methods that include...
213. A method for altering the plasma membrane localization of multi-chain chimeric antigen receptors in mammalian cells, (a) Contacting mammalian cells expressing a multi-chain chimeric antigen receptor according to any one of claims 176 to 205 with a hormone or hormone analogue sufficient to induce localization of the multi-chain chimeric antigen-binding receptor to the extracellular side of the plasma membrane of the cell, (b) Contacting the mammalian cells with an amount of the hormone or hormone analogue that causes a decrease in the level of the multi-chain chimeric antigen-binding receptors on the extracellular side of the plasma membrane of the cells, Methods that include...
214. (c) The method of claim 213, further comprising contacting the mammalian cells with an amount of the hormone or a hormone analogue that causes an increase in the level of the multi-chain chimeric antigen-binding receptors extracellularly on the plasma membrane of the cells.
215. The method according to any one of claims 212 to 214, further comprising, before step (a), introducing a nucleic acid encoding the multi-chain chimeric antigen receptor or a set of nucleic acids that together encode the multi-chain chimeric antigen receptor into mammalian cells to produce mammalian cells that express the multi-chain chimeric antigen receptor.
216. The method according to claim 215, wherein the mammalian cell is a T cell.
217. The T cell is CD8 + T cells, CD4 + The method according to claim 216, selected from the group consisting of T cells, memory T cells, Treg cells, and natural killer T cells.
218. The method according to any one of claims 212 to 217, wherein the mammalian cells are mammalian cells previously obtained from a subject.
219. The method according to claim 218, wherein the subject has been identified or diagnosed with cancer.
220. The method according to claim 218 or 219, further comprising obtaining the mammalian cells from the subject.
221. The method according to any one of claims 212 to 220, wherein the contact step is performed in vitro.
222. The method according to any one of claims 212 to 220, wherein the contact step is performed in a mammal.
223. The method according to claim 222, wherein the mammal has cancer.
224. The method according to claim 223, wherein the contact step results in the treatment of cancer in the mammal.
225. A method for treating cancer in a subject, (a) Administering mammalian cells expressing a single-chain chimeric antigen receptor according to any one of claims 128 to 157 or a multi-chain chimeric antigen receptor according to any one of claims 176 to 205 to the subject, Furthermore, the antigen-binding domain specifically binds to the antigen expressed by cancer in the subject; (b) administering to the subject a sufficient amount of hormone or hormone to induce the localization of the single-chain or multi-chain chimeric antigen receptor to the extracellular space of the plasma membrane of the cell, (c) After (b), identify in the subject the presence or severity of one or more symptoms associated with toxicity, or the level of one or more cytokines associated with a cytokine storm, or both. (d) Comparing the presence or severity of one or more symptoms associated with the identified toxicity, or the level of one or more cytokines associated with the identified cytokine storm, or both, to a control(s), (e) After (e), administer to the subject an amount of the hormone or hormone analogue sufficient to reduce the level of the single-chain or multi-chain chimeric antigen receptors on the extracellular side of the plasma membrane of the cells, such that the presence or severity of one or more symptoms associated with toxicity, or the level of one or more cytokines associated with the cytokine storm, or both, Methods that include...
226. The method according to claim 225, wherein the amount of the hormone or hormone analog administered to the subject in step (e) is reduced by at least 25% compared to the amount of the hormone or hormone analog administered to the subject in step (b).
227. The method according to claim 226, wherein the amount of the hormone or hormone analog administered to the subject in step (e) is reduced by at least 50% compared to the amount of the hormone or hormone analog administered to the subject in step (b).
228. The method according to claim 227, wherein the amount of the hormone or hormone analog administered to the subject in step (e) is reduced by at least 75% compared to the level of the hormone or hormone analog administered to the subject in step (b).
229. The method according to claim 228, wherein the amount of the hormone or hormone analog administered to the subject in step (e) is reduced by 100% compared to the level of the hormone or hormone analog administered to the subject in step (b).
230. The method according to claim 225, wherein one or more symptoms associated with the toxicity are selected from the group consisting of high fever, swelling, chills, hypotension, tachycardia, weakness, headache, rash, sore throat, difficulty breathing, redness, extreme fatigue, nausea, and cerebral edema.
231. The method according to claim 225, wherein one or more cytokines associated with the cytokine storm are selected from the group consisting of tumor necrosis factor alpha, IFNγ, IL-10, IL-1β, IL-2, IL-6, IL-8, and IL-10, granulocyte-macrophage colony-stimulating factor (GM-CSF), and IL-5.