Pharmaceutical composition and method for treating cancer

Abstract

The present invention aims to provide a pharmaceutical composition suitable for cancer treatment that targets molecules involved in the Hippo pathway other than TEAD as therapeutic targets. [Solution] A pharmaceutical composition comprising a nucleic acid that expresses a Lats kinase variant in cells as an active ingredient, wherein the variant is a Lats kinase variant that has a nuclear localization signal and is constitutively activated; and a method for treating cancer in animals other than humans, wherein an effective amount of the pharmaceutical composition described above is administered to the animal to be treated.

Description

Technical Field

[0001] The present invention relates to a pharmaceutical composition suitable for cancer treatment, targeting molecules involved in the Hippo pathway as therapeutic targets, and a method for treating cancer using the pharmaceutical composition.

Background Art

[0002] Cancer is a disease that affects one in two Japanese nationals and causes one death in four to six people. In Japan too, cancer genome medicine started in 2019 is making it possible to perform personalized medicine that analyzes gene abnormalities, predicts signal pathways that are abnormally activated, and selects molecular target drugs. However, there are many cases where sufficient understanding of gene abnormalities and signal pathway abnormalities and the development of molecular target drugs have not advanced.

[0003] The Hippo pathway and its downstream cancer genes YAP / TAZ are important signal pathways for normal cell growth and organ formation. The Hippo pathway is mainly composed of serine / threonine kinases (e.g., MST1 / 2, LATS1 / 2) and respective adapter proteins (e.g., SAV1, MOB1). In the activated state of the Hippo pathway, LATS1 / 2 highly phosphorylates YAP / TAZ, promotes binding to 14-3-3, localizes in the cytoplasm, and causes ubiquitin-proteasome degradation (YAP / TAZ inactivation). On the other hand, when inactivation of the Hippo pathway occurs due to various extracellular signals such as GPCR, receptor tyrosine kinase (RTK), and adhesion to the extracellular matrix, YAP / TAZ is dephosphorylated, translocates into the nucleus, binds to transcription factors TEAD1-4, acts as a co-transcription factor, and promotes transcription of proliferation-related genes.

[0004] In cancer, various genetic abnormalities are known to activate YAP / TAZ. For example, mutations and deletions in the FAT1 gene, amplification of the YAP1 gene, mutations and deletions in the NF2 gene, and E6 and E7 proteins due to HPV infection have been reported to be involved. The applicant has also revealed that EGFR phosphorylates MOB1 and activates YAP / TAZ (Non-Patent Literature 1), that overexpression of AXL confers resistance to EGFR inhibitors by reactivating YAP / TAZ (Non-Patent Literature 2), that RBM39 promotes the transcriptional activity of activated YAP / TAZ and confers resistance to anticancer drugs (Non-Patent Literature 3), and that activated YAP / TAZ promotes the transcription of PD-L2 and leads to immune evasion (Non-Patent Literature 4). Thus, in cancers with these genetic abnormalities, YAP / TAZ activation occurs, and YAP / TAZ can be a therapeutic target for anticancer treatment. However, therapeutic drugs targeting the Hippo pathway and YAP / TAZ are not yet in clinical use.

[0005] In recent years, attention has been focused on the binding of YAP / TAZ and TEAD. Following reports that palmitoylation of TEAD is important for binding to YAP / TAZ, the development of "TEAD inhibitors," which inhibit the binding of the two by fitting into the YAP / TAZ binding pocket of TEAD, began worldwide. Several TEAD inhibitors have already started clinical trials, with Phase I or Phase II clinical trials underway. At present, among the TEAD inhibitors, BGI-9004 from BridGene Biosciences, BPI-460372 from Betta Pharmaceuticals, ODM-212 from Orion Corporation, SW-682 from SpringWorks Therapeutics, and VT3989 from Vivace Therapeutics are among the most promising drugs currently undergoing clinical trials.

[0006] There are four variants of TEAD, from TEAD1 to TEAD4, and the expression level and dependence on proliferation of each variant differ depending on the type of cancer. For example, TEAD1 is reported to be important in pancreatic cancer, cervical cancer, and breast cancer (Non-Patent Documents 5-7), TEAD2 in pancreatic cancer, cerebral glioma, and breast cancer (Non-Patent Documents 8-10), and TEAD4 in colorectal cancer and liver cancer (Non-Patent Documents 11-12). On the other hand, many TEAD inhibitors have different drug affinities depending on the TEAD variant. For example, Vivace Therapeutics is developing a TEAD1 selective inhibitor, and Genentech is developing a TEAD2 / 4 selective inhibitor (Non-Patent Document 13). [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Ando T et al, Communications Biology, 2021, vol.4, Article No.1237. [Non-Patent Document 2] Okamoto K et al, Oncogene, 2023, vol.42, p.2869-2877. [Non-Patent Document 3] Ando T et al, Oncogenesis, 2024, vol.13, Article No.25. [Non-Patent Document 4] Ando T et al, Research Square, [online], May 2, 2020, Patent Society of Japan, [searched on November 6, 2020], Internet<URL:https: / / doi.org / 10.21203 / rs.3.rs-4330731 / v1> [Non-Patent Document 5] Landin Malt A et al, PLoS One, 2012, vol.7(9), Article No.e45498 [Non-Patent Document 6] Knight JF et al, British Journal of Cancer, 2008, vol.99, p. 1849-1858.

Non-licensed Document 7

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

Non-licensed Document 15

[0008] As mentioned above, the expression levels and dependence on proliferation of TEAD variants differ depending on the type of cancer, and TEAD inhibitors have different drug affinities for each TEAD variant. Therefore, when considering TEAD as a therapeutic target, it is necessary to consider which TEAD variant should be targeted in each type of cancer, and to develop inhibitors with high affinity for the target TEAD variant. Thus, developing drugs that target TEAD is fraught with difficulties.

[0009] The primary objective of this invention is to provide a pharmaceutical composition suitable for cancer treatment that targets molecules involved in the Hippo pathway other than TEAD as therapeutic targets. [Means for solving the problem]

[0010] The inventors of this invention have discovered that by expressing Lats kinase (LATS), a kinase that can directly phosphorylate YAP / TAZ even under physiological conditions, in the nucleus, it is possible to inactivate YAP / TAZ in the nucleus, and thereby suppress the proliferation of cancer cells, thus completing the present invention.

[0011] In other words, the present invention includes the following embodiments. [1] Using nucleic acids that express Lats kinase variants in cells as the active ingredient, A pharmaceutical composition in which the mutant is a Lats kinase mutant that has a nuclear localization signal and is constitutively activated. [2] The pharmaceutical composition according to [1], wherein the Lats kinase is one or more selected from the group consisting of human LATS1, human LATS2, and homologs thereof. [3] The pharmaceutical composition according to [2] above, wherein the amino acids corresponding to threonine at position 1079 and serine at position 909 of human LATS1 are substituted with aspartic acid or glutamic acid. [4] The pharmaceutical composition according to any one of [1] to [3] above, wherein the variant has a nuclear localization signal at the N-terminus or C-terminus. [5] The variant is a protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or a protein consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1, which is localized in the nucleus and constantly exhibits Lats kinase activity The pharmaceutical composition according to [1] above. [6] The pharmaceutical composition according to any one of [1] to [4] above, wherein the nucleic acid is mRNA. [7] The pharmaceutical composition according to any one of [1] to [6] above, wherein the cell is a cancer cell showing YAP / TAZ activation. [8] The pharmaceutical composition according to any one of [1] to [7] above, wherein the nucleic acid is encapsulated in a lipid nanoparticle. [9] The pharmaceutical composition according to any one of [1] to [7] above, which is used for the treatment of cancer.

[10] A method for treating cancer in an animal other than human, comprising administering an effective amount of the pharmaceutical composition according to any one of [1] to [6] above to the animal to be treated.

[11] The method for treating cancer according to

[10] above, wherein the cancer is a cancer showing YAP / TAZ activation.

Advantages of the Invention

[0012] The pharmaceutical composition according to this embodiment contains, as an active ingredient, a nucleic acid for expressing a kinase capable of directly phosphorylating YAP / TAZ in the nucleus. Therefore, the pharmaceutical composition according to this embodiment and the treatment method according to this embodiment using the same are useful for treating various types of cancers showing YAP / TAZ activation.

Brief Description of the Drawings

[0013] [Figure 1] This is an alignment diagram of the amino acids corresponding to T1079 and S909 of hLATS1 in the LATS homolog, and the amino acid sequences in their vicinity. [Figure 2] The images in Example 1 show immunofluorescence staining using an anti-FLAG antibody and nuclear staining with DAPI of HEK293A cells transfected with FLAG-hCALN or FLAG-cahLATS1. [Figure 3] This figure shows the results of Western blotting using anti-LATS1 antibody, anti-pYAP(S127) antibody, anti-YAP antibody, and β-actin antibody on HEK293A cells 24 hours after transfection with luciferase, cahLATS1, or hCALN mRNA in Example 1. [Figure 4] This figure shows the results of measuring the mRNA expression level of CTGF in HEK293A cells 24 hours after transfection with luciferase, cahLATS1, or hCALN mRNA in Example 1. [Figure 5] In Example 2, cells were cultured in culture media with a final concentration of IK-930, a TEAD inhibitor, of 1, 10, 25, or 100 μg / mL. The results of measuring the viability of cells after 72 hours using a cell viability measurement kit (Figure 5(A)) or the Crystal Violet staining method (Figure 5(B)) are shown in this figure. [Figure 6] This figure shows the results of measuring the viability of WSU-HN6 cells after transfection with luciferase, cahLATS1, or hCALN mRNA in Example 2, using a cell viability measurement kit (Figure 6(A)) or the Crystal Violet staining method (Figure 6(B)). [Figure 7] This figure shows the results of measuring the viability of cells 24 hours after transfection with luciferase or hCALN mRNA in CAL27 cells, HN12 cells, SCC47 cells, MDA-MB-231 cells, NCI-H226 cells, and PC9 cells in Example 2, using the Crystal Violet staining method. [Figure 8] This figure shows the time course of tumor volume in two groups of tumor-bearing model mice: a control group administered with Luciferase mRNA and a CALN-administered group administered with CALN mRNA (N=3 in each group). [Modes for carrying out the invention]

[0014] In this embodiment, "nucleic acid" means a molecule in which nucleotides are linked by a phosphate diester bond. This nucleotide includes not only naturally occurring nucleotides such as DNA and RNA, but also artificial nucleotides that have been modified from naturally occurring nucleotides and can be linked to them by a phosphate diester bond. Artificial nucleotides include those in which the side chains of natural nucleotides are modified with functional groups such as amino groups, those in which the hydroxyl group at the 2' position of the ribose skeleton is replaced with a methoxy group, fluoro group, methoxyethyl group, etc., phosphorothioate nucleotides (in which the oxygen atom of the phosphate group is replaced with a sulfur atom), morpholino nucleotides (in which ribose or deoxyribose is replaced with a morpholin ring), BNA (Bridged Nucleic Acid), HNA (Hexitol Nucleic Acid), LNA (Locked Nucleic Acid), PNA (Peptide Nucleic Acid), TNA (Threose Nucleic Acid), GNA (Glycerol Nucleic Acid), and CeNA (Cyclohexenyl Nucleic Acid). Furthermore, "nucleic acids" include molecules in which only one or more natural nucleotides are linked by phosphate diester bonds, such as DNA and RNA; molecules in which one or more natural nucleotides and one or more artificial nucleotides are linked by phosphate diester bonds; and molecules in which only one or more artificial nucleotides are linked by phosphate diester bonds.

[0015] The pharmaceutical composition according to this embodiment contains a nucleic acid that expresses a variant of LATS in cells as an active ingredient. The variant is a LATS variant that has a nuclear localization signal (NLS) and is constitutively activated. Hereafter, the "LATS variant that has an NLS and is constitutively activated" may be referred to as "constitutively activated Lats with NLS" and may be abbreviated as "CALN".

[0016] YAP / TAZ are primarily degraded in the cytoplasm via ubiquitin-proteasomal degradation. Therefore, YAP / TAZ that have already migrated into the nucleus are less susceptible to degradation and remain active within the nucleus. Wild-type LATS are localized in the cytoplasm, making it difficult for them to use YAP / TAZ in the cell nucleus as a substrate. In contrast, CALN expressed by the nucleic acid, which is the active ingredient of the pharmaceutical composition according to this embodiment, migrates into the nucleus via NLS, and can phosphorylate and inactivate YAP / TAZ in the nucleus. Phosphorylated YAP / TAZ are then excreted into the cytoplasm and subsequently degraded via ubiquitin-proteasomal degradation. In other words, the pharmaceutical composition according to this embodiment targets YAP / TAZ in the nucleus and contributes to its inactivation.

[0017] TEAD cannot function adequately as a transcription factor on its own; binding to the co-transcription factors YAP / TAZ is essential for transcription. Therefore, regardless of which TEAD variant the target cancer cell's proliferation depends on, inactivating YAP / TAZ, which is located upstream of TEAD, can reduce the transcriptional activity of proliferation-related genes and suppress proliferation. For this reason, the pharmaceutical composition according to this embodiment can be expected to have a therapeutic effect equivalent to or greater than that of a TEAD inhibitor, and its therapeutic effect is exerted regardless of the type of TEAD variant on which the target cancer cell depends. In other words, the pharmaceutical composition according to this embodiment can exert a therapeutic effect against various cancers in which functions such as proliferation, drug resistance, and immune evasion are promoted by YAP / TAZ activation, without being limited by the type of TEAD variant on which the target cancer cell depends.

[0018] The CALN expressed by the nucleic acid that is the active ingredient of the pharmaceutical composition according to this embodiment is not particularly limited as long as it is a protein that has NLS and constitutively exhibits LATS activity. Here, "LATS activity" means "serine / threonine kinase activity with YAP / TAZ as a substrate." The CALN expressed by the nucleic acid that is the active ingredient of the pharmaceutical composition according to this embodiment can be obtained, for example, by adding NLS to LATS (constitutively activated Lats: caLATS) that is in a constitutively activated state.

[0019] Activation of wild-type LATS requires phosphorylation by MST1 / 2 or the MAP4K family, and some enzymes require subsequent autophosphorylation. caLATS can be obtained, for example, by mutating the hydrophobic amino acid residues (serine (S) or threonine (T)) that are phosphorylated by MST1 / 2 or the MAP4K family and the hydrophobic amino acid residues (serine (S) or threonine (T)) that are autophosphorylated in wild-type LATS with phosphorylation-mimicking amino acids aspartic acid (D) or glutamic acid (E). The hydrophobic amino acid residues that are phosphorylated by MST1 / 2 or the MAP4K family are located in the hydrophobic motif of LATS, while the hydrophobic amino acid residues that are autophosphorylated are located in the activation loop.

[0020] Examples of wild-type LATS include human LATS1 (NCBI accession number: NP_004681) (hLATS1), human LATS2 (NCBI accession number: NP_055387.2) (hLATS2), and their homologs. For example, hLATS1 is activated by phosphorylation of threonine at position 1079 (T1079) by MST1 / 2 and the MAP4K family, followed by autophosphorylation of serine at position 909 (S909) (Non-patent Literature 14). hLATS2 is activated by phosphorylation of threonine at position 1041 (T1041) by MST1 / 2 and the MAP4K family, followed by autophosphorylation of serine at position 872 (S872). Therefore, mutants of hLATS1 in which T1079 and S909 are replaced with aspartic acid (hLATS1(S909D,T1079D)) (the region from amino acid 1 to 2267 of SEQ ID NO: 1), mutants of hLATS1 in which T1079 and S909 are replaced with glutamic acid (hLATS1(S909E,T1079E)), mutants of hLATS2 in which T1041 and S872 are replaced with aspartic acid (hLATS2(T1041D,S872D)), and mutants of hLATS2 in which T1041 and S872 are replaced with glutamic acid (hLATS2(T1041E,S872E)) are used as caLATS. LATS are kinases that are widely conserved in various organisms, and the phosphorylation sites used for activation regulation are also widely conserved. The amino acid sequence information of LATS homologs for each species, as well as the base sequence information of the genes encoding them, can be searched in databases such as those of the NCBI (National Center for Biotechnology Information). For example, the hLATS1 / hLATS2 homolog (hereinafter sometimes referred to as "LATS homolog").Examples include mouse LATS (NCBI accession number: NP_034820), rat LATS (NCBI accession number: XP_032750895.1), chicken LATS (NCBI accession number: XP_046770532.1), zebrafish LATS (NCBI accession number: NP_001018346.1), African clawed frog LATS (NCBI accession number: NP_001087838.1), anchiaridina rubra LATS (NCBI accession number: KAK7083036.1), nematode LATS (NCBI accession number: KRZ62009.1), and Corticium candelara rubra. Examples include *Candelabramum candelabrum* LATS (NCBI accession number: XP_062510301.1) and *Schistosoma bovis* LATS (NCBI accession number: RTG82691.1).

[0021] Figure 1 shows the alignment diagram of the amino acids corresponding to T1079 and S909 of hLATS1 in the LATS homologs, and the amino acid sequences of their vicinity. Mutants in which the amino acids corresponding to T1079 and S909 of hLATS1 in each LATS homolog shown in Figure 1 are replaced with aspartic acid or glutamic acid are used as caLATS, similar to hLATS1(S909D,T1079D). Hereafter, the "amino acids corresponding to T1079 and S909 of hLATS1 in the LATS homologs" may be referred to as "homeostatic essential amino acids." The homeostatic essential amino acid residues in hLATS2 are T1041 and S872.

[0022] Here, the "amino acid corresponding to T1079 of hLATS1" in a given LATS refers to the amino acid residue at the position corresponding to T1079 of hLATS1 when the amino acid sequences of that LATS and hLATS1 are aligned to achieve the highest homology. Similarly, the "amino acid corresponding to S909 of hLATS1" in a given LATS refers to the amino acid residue at the position corresponding to S909 of hLATS1 when the amino acid sequences of that LATS and hLATS1 are aligned to achieve the highest homology.

[0023] Generally, proteins with some kind of physiological activity can have one or more amino acids mutated without impairing their physiological activity. Here, "mutating amino acids in a protein" means deleting, substituting, or adding one or more amino acids in the amino acid sequence of a protein. Proteins in which one or more amino acids other than the homeostatic essential amino acids and that do not contribute to LATS activity in hLATS1 (S909D, T1079D) have been mutated can also be used as caLATS.

[0024] Numerous studies have been published on the domain structure of hLATS1 and its influence on the activity of each subprotein. For example, in the amino acid sequence of hLATS1, the 100-141 amino acid region is the UBA domain that binds to ubiquitin, and the 705-1010 amino acid region is the serine / threonine kinase domain. In addition, the PPxY motifs in the 373-376 and 556-559 amino acid regions are necessary for binding to YAP (Non-Patent Literature 15), and the LCD1 domain in the 13-167 amino acid region is important for maintaining the proper structure and function of LATS1 (Non-Patent Literature 16). Furthermore, three-dimensional structural data of hLATS1 (Uni Prot accession number: O95835) and three-dimensional structural data of hLATS1 (Uni Prot accession number: Q9NRM7) have also been reported. Based on these known facts, a person skilled in the art can predict the amino acid residues in hLATS1 and hLATS2 that can be mutated without impairing their caLATS activity.

[0025] For example, a protein having caLATS activity, consisting of an amino acid sequence in which one or more amino acids in regions other than the UBA domain, serine / threonine kinase domain, two PPxY motifs, and LCD1 domain of hLATS1 (S909D, T1079D) are mutated, can be used as caLATS. In addition to mutants in which the constitutively essential amino acids are substituted with aspartic acid or glutamic acid, a protein having caLATS activity, consisting of an amino acid sequence in which one or more amino acids (excluding constitutively essential amino acids) in regions other than the UBA domain, serine / threonine kinase domain, PPxY motifs, and LCD1 domain of the mutant are mutated, can be used as caLATS.

[0026] A mutant protein is obtained by introducing a mutation into wild-type LATS in which a homeostatic essential amino acid is replaced with aspartic acid or glutamic acid. Furthermore, one or more amino acids that do not contribute to LATS activity are mutated in this mutant protein, and it is preferable that the sequence identity with the amino acid sequence of wild-type LATS is 90% or more and less than 100%, more preferably 95% or more and less than 100%, even more preferably 98% or more and less than 100%, and even more preferably 99% or more and less than 100%. The sequence identity with the amino acid sequence of the mutated protein may be 70% or more and less than 100%, 80% or more and less than 100%, or 85% or more and less than 100%.

[0027] The sequence identity (homology) of amino acid sequences is determined by juxtaposing the two amino acid sequences, inserting gaps in the areas corresponding to insertions and deletions so that the corresponding amino acids match most frequently, and then determining the proportion of matching amino acids in the resulting alignment relative to the entire amino acid sequence excluding the gaps. The sequence identity of amino acid sequences can be determined using various homology search software known in the art. In this invention, the value of sequence identity of amino acid sequences is obtained by calculation based on the alignment obtained by the known homology search software BLASTP.

[0028] NLS may be attached to any part of caLATS as long as it does not impair the constitutive LATS activity of caLATS. Furthermore, NLS may be attached alone, or via a suitable linker peptide. For example, NLS may be attached to the N-terminus, the C-terminus, or inserted into the middle of caLATS. From the viewpoint of minimizing the impact on LATS activity and allowing the NLS function to be fully exercised, the CALN expressed by the nucleic acid, which is the active ingredient of the pharmaceutical composition according to this embodiment, is preferably a protein in which NLS is directly or via a suitable peptide linker to the N-terminus or C-terminus of caLATS, and more preferably a protein in which NLS is directly or via a suitable peptide linker to the C-terminus of caLATS.

[0029] NLS is a peptide composed of a region having one or more consecutive amino acid sequences of 2 to 6 positively charged amino acid residues, and is a signal peptide that is exposed on the protein surface and contributes to nuclear translocation. Examples of positively charged amino acid residues include lysine (K) and arginine (R). The NLS of CALN used in this embodiment can be any peptide capable of localizing CALN in the nucleus, and its amino acid sequence is not particularly limited. For example, known NLSs such as the NLS of SV40 large T antigen (PKKKRKV: SEQ ID NO: 3), c-Myc (PAAKRVKLD: SEQ ID NO: 4), and nucleoplasmin (KRPAATKKAGQAKKKK: SEQ ID NO: 5) or their modifications can be used. Furthermore, the NLS of CALN expressed by the nucleic acid, which is the active ingredient of the pharmaceutical composition according to this embodiment, may be one, two or more, and preferably one to three.

[0030] The CALN expressed by the nucleic acid, which is the active ingredient of the pharmaceutical composition according to this embodiment, is preferably a protein whose LATS activity-exhibiting region is derived from one or more proteins selected from the group consisting of hLATS1, hLATS2, and their homologs, more preferably a protein having a LATS activity-exhibiting region derived from hLATS1 or hLATS2 or a region in which further mutations have been introduced therein, even more preferably a protein in which NLS is attached to hLATS1 (S909D, T1079D), hLATS2 (S872D, T1041D), or caLATS in which further mutations have been introduced therein, and even more preferably a protein in which NLS is attached to the N-terminus or C-terminus of hLATS1 (S909D, T1079D), hLATS2 (S872D, T1041D), or caLATS in which further mutations have been introduced therein. The CALN expressed by the nucleic acid, which is the active ingredient of the pharmaceutical composition according to this embodiment, is preferably a protein in which NLS is attached to the N-terminus or C-terminus of hLATS1 (S909D, T1079D) or hLATS2 (S872D, T1041D), and more preferably a protein in which NLS is attached to the N-terminus or C-terminus of hLATS1 (S909D, T1079D).

[0031] The amino acid sequence of CALN (hCALN), obtained by adding the NLS sequence of SEQ ID NO: 3 to the C-terminus of hLATS1 (S909D, T1079D), is represented by SEQ ID NO: 1. As the CALN expressed by the nucleic acid, which is the active ingredient of the pharmaceutical composition according to this embodiment, hCALN, a protein obtained by substituting the NLS sequence of hCALN with another NLS such as SEQ ID NO: 4 or 5, can be used.

[0032] The following proteins are preferred as the CALN expressed by the nucleic acid, which is the active ingredient of the pharmaceutical composition according to this embodiment. (a) A protein consisting of the amino acid sequence represented by Sequence ID No. 1. (b) A protein having an amino acid sequence having 90% or more but less than 100% sequence identity with the amino acid sequence represented by Sequence ID No. 1, preferably 95% or more but less than 100%, more preferably 98% or more but less than 100%, and even more preferably 99% or more but less than 100%, which is localized in the nucleus and constitutively exhibits Lats kinase activity.

[0033] The protein in (b) above is preferably a protein having an amino acid sequence that has 90% or more but less than 100% sequence identity with the amino acid sequence represented by Sequence ID No. 1, wherein the amino acids corresponding to the amino acid region of positions 100 to 141 (UBA domain), the amino acid region of positions 705 to 1010 (serine / threonine kinase domain), the amino acid region of positions 373 to 376 (PPxY motif), the amino acid region of positions 556 to 559 (PPxY motif), the amino acid region of positions 13 to 167 (LCD1 domain), and the amino acid at position 1079 (D) in the amino acid sequence represented by Sequence ID No. 1 are the same as those in the amino acid sequence represented by Sequence ID No. 1.

[0034] The nucleic acid that is the active ingredient of the pharmaceutical composition according to this embodiment is not particularly limited as long as it is a nucleic acid that can express CALN in the nucleus of a cell into which the nucleic acid has been introduced. The nucleic acid may be DNA, RNA, or a chimeric nucleic acid containing DNA and RNA. It may also be a nucleic acid consisting only of natural nucleotides, a nucleic acid containing modified nucleotides, or a nucleic acid containing artificial nucleic acids. Examples of such modifications include methylation, methoxylation, pseudouridineization, deamination, and thiolation. Examples of artificial nucleic acids include BNA (Bridged Nucleic Acid), alkynyl nucleic acid, acyclic glycol nucleic acid (GNA), peptide nucleic acid (PNA), acyclic threoninol nucleic acid (aTNA), and serinol nucleic acid (SNA). Furthermore, the nucleic acid may be a chain nucleic acid or a cyclic nucleic acid.

[0035] Examples of such nucleic acids include CALN mRNA. The mRNA has a region (CDS) consisting of a base sequence encoding CALN, and any nucleic acid that functions as mRNA for the translation system within the introduced cell may be one consisting solely of natural ribonucleotides, or it may be a ribonucleotide with some or all of its bases modified. Furthermore, for stability reasons, the CALN mRNA is preferably cap-modified at its 5' end. CALN mRNA can be synthesized, for example, using an in vitro transcription (IVT) reaction.

[0036] A plasmid for CALN mRNA synthesis typically contains, in order from the 5' end, a promoter, a transcription start sequence, a 5'-UTR, the hCALN CDS, a 3'-UTR, and a Poly(A) sequence. The promoter and transcription start sequence are not particularly limited and can be any sequence capable of in vitro transcription. The nucleotide sequences of the 5'-UTR and 3'-UTR are also not particularly limited and can be any sequence capable of performing their respective functions in the cells in which CALN is intended to be expressed.

[0037] The nucleic acid used as the active ingredient in the pharmaceutical composition according to this embodiment may be, for example, an expression vector into which a CDS of CALN has been inserted. The expression vector may be a DNA vector or an RNA vector. These expression vectors can be synthesized, for example, by inserting a CDS of CALN into an expression vector used for expressing an exogenous gene using genetic engineering technology. As the expression vector, various commonly used expression vectors can be appropriately selected and used.

[0038] The pharmaceutical composition according to this embodiment may contain a pharmaceutically acceptable carrier along with a nucleic acid for expressing the active ingredient CALN. For example, the pharmaceutical composition according to this embodiment can be manufactured by appropriately mixing the nucleic acid, which is the active ingredient, with a pharmaceutically acceptable carrier.

[0039] A pharmaceutically acceptable carrier is an additive that does not cause harmful physiological reactions in the recipient and does not cause harmful interactions with other components such as the active ingredient. Examples of such additives include diluents, excipients, binders, stabilizers, isotonic agents, buffers, solubilizers, suspending agents, preservatives, freeze-drying protectants, freeze-protecting agents, lyophilization protectants, bacteriostatic agents, and adjuvants. These additives can be appropriately selected from those used in the formulation of pharmaceuticals.

[0040] The pharmaceutical composition according to this embodiment can be formulated by conventional methods into dosage forms suitable for various administration methods. Examples of such dosage forms include liquids, suspensions, injections, sprays, tablets, powders, granules, capsules, chewable tablets, syrups, etc. The route of administration when administering the pharmaceutical composition according to this embodiment to animals is not particularly limited and includes intravenous administration, enteral administration, intramuscular administration, subcutaneous administration, transdermal administration, nasal administration, transpulmonary administration, oral administration, etc.

[0041] The pharmaceutical composition according to this embodiment may also use lipid nanoparticles as a carrier. Lipid nanoparticles are widely used as DDS carriers for nucleic acid drugs such as mRNA. The nucleic acid is introduced into the target cells while encapsulated within the lipid nanoparticles.

[0042] Lipid nanoparticles are known from the following literature (e.g., Ugur Sahin et al., COVID-19 vaccine BNT162b1 elicits human antibody and TH1 T cell responses, Nature, 2020 Oct, 586(7830), 594-599.; KS Corbett et al., Evaluation of the mRNA-1273 Vaccine against SARS-CoV-2 in Nonhuman Primates, N. Engl. J. Med., 2020, 383. 1544-55.; Yan Zong et al., Lipid Nanoparticle (LNP) Enables mRNA Delivery for Cancer Therapy, Adv. Mater., 2023, 35:2303261-2303261; Xuexiang Han et al., An ionizable lipid toolbox for RNA delivery, Nat. Commun., 2021, 12, You may use the materials described in 7233; Patent No. 6946384; Japanese Unexamined Patent Publication No. 2024-071384; Patent No. 6666391; Japanese Unexamined Patent Publication No. 2024-052664; Japanese Patent Publication No. 2023-526178; Japanese Unexamined Patent Publication No. 2024-027144, etc.

[0043] Lipids that constitute lipid nanoparticles include ionizable cationic lipids, non-cationic lipids, sterols, and polyalkylene glycol-modified lipids. Here, ionizable cationic lipids are lipids that are close to electrically neutral at physiological pH (for example, around pH 7) and become cationic in acidic environments.

[0044] The ionizable cationic lipids are not particularly limited and include, for example, DLin-MC3-DMA(MC3), SM-102, ALC-0315, 306Oi10, cKK-E12, C12-200, 5A2-SC8, TT3, FTT5, ZA3-Ep10, OF-Deg-Lin, AA3-DLin, OC2-K3-E10, 4N4T(MIC1 and MIC2), IC8, unsaturated trialkylated lipid 10, YK009, 93-O17S, LNP-A10, 306-N16B, OF-02, A18-Iso5-2DC18, 98N12-5, 9AIP9, 7C1, G0-C14, L319, 304O13, 306-O12B, A9, and potentially Lipid Examples include 2,2(8,8)4CCH3, CL1, LP01, ATX-100, LP-01, Lipid 5, SGL0806, DLin-DMA, DLin-KC2-DMA, DLin-MC3-DMA, L319, DOTMA, DOTAP, etc. Ionizable cationic lipids can be used individually or in combination of two or more.

[0045] Among ionizable cationic lipids, preferred specific examples are, but are not limited to, the lipid represented by the following formula (Ia) (SGL0806).

[0046] [ka]

[0047] Noncationic lipids are not particularly limited and include, for example, neutral phospholipids derived from biological membranes such as phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, and dipalmitoylphosphatidylcholine. Noncationic lipids can be used individually or in combination of two or more.

[0048] Sterols are not particularly limited and include, for example, cholesterol, dihydrocholesterol, lanosterol, β-sitosterol, campesterol, stigmasterol, brassicasterol, ergocasterol, fucosterol, and 3β-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol). Sterols can be used individually or in combination of two or more.

[0049] Polyalkylene glycol-modified lipids are not particularly limited, and for example, lipids modified with polyethylene glycol (PEG), polypropylene glycol, polytetramethylene glycol, polyhexamethylene glycol, etc. can be used. Examples of polyalkylene glycol-modified lipids include PEG2000-DMG (PEG2000-dimyristylglycerol), PEG2000-DPG (PEG2000-dipalmitoylglycerol), PEG2000-DSG (PEG2000-distearoylglycerol), PEG5000-DMG (PEG5000-dimyristylglycerol), PEG5000-DPG (PEG5000-dipalmitoylglycerol), and PEG5000-DSG (PEG5000-distearoylglycerol). Examples include polyalkylene glycol-modified lipids (PGI), PEG-cDMA (N-[(methoxypoly(ethylene glycol)2000)carbamyl]-1,2-dimyristyloxypropyl-3-amine), PEG-C-DOMG (R-3-[(ω-methoxy-poly(ethylene glycol)2000)carbamoyl]-1,2-dimyristyloxypropyl-3-amine), PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, and PEG-ceramide (Cer). Polyalkylene glycol-modified lipids can be used individually or in combination of two or more types.

[0050] The ionizable cationic lipids, non-cationic lipids, sterols, and polyalkylene glycol-modified lipids can be produced by known methods. Some are also commercially available, and any of these can be used.

[0051] The types and composition of lipids constituting the lipid nanoparticles used in this embodiment are not particularly limited. By adjusting the types and composition of the constituent lipids of the lipid nanoparticles, the efficiency of introducing nucleic acids, which are the active ingredients of the pharmaceutical composition according to this embodiment, into target cells can be adjusted. Examples of lipid nanoparticles used in this embodiment include those containing, in terms of molar ratio of ionizable cationic lipids, 20-60% of ionizable cationic lipids, 5-25% of non-cationic lipids, 25-55% of sterols, and 0.5-15% of PEG-modified lipids in the total lipids of the lipid nanoparticles. Although not limited, the content of ionizable cationic lipids in the total lipids of the lipid nanoparticles may be 30-50% or 40-45%, non-cationic lipids may be 7.5-20% or 10-15%, sterols may be 30-50% or 40-45%, and PEG-modified lipids may be 1-10% or 1.5-5%.

[0052] Lipid nanoparticles can be formed by the aggregation and organization of the aforementioned lipids. Here, "organization" refers to the aggregation of constituent lipid molecules via non-covalent bonds such as hydrophobic bonds. Organized aggregates include bilayers, liposomes, multi-vesicles, string-like aggregates, disk-like aggregates, lamellar aggregates, rod-like aggregates, and mixtures thereof, formed by hydrophobic bonds between the hydrophobic parts of constituent molecules. By incorporating nucleic acids during the organization process, lipid nanoparticles containing nucleic acids can be obtained.

[0053] The lipid nanoparticles used in this embodiment may further contain molecules other than constituent lipids, such as surfactants (e.g., CHAPS, sodium cholate, octyl glucoside, ND-gluco-N-methylalkaneamides, etc.), glycolipids, peptide lipids, proteins, etc., as long as they do not impair the anticancer effect of the nucleic acid, which is the active ingredient.

[0054] Known methods such as alcohol dilution, hydration, and emulsification can be used to encapsulate nucleic acids such as mRNA in lipid nanoparticles. Alternatively, commercially available kits for producing nucleic acid-encapsulated lipid nanoparticles, such as the mRNA transfection reagent "in vivo-jetRNA®" (Polyplus) and the "LipidLaunch Uptake Kit" (Cayman Chemical), can also be used.

[0055] The animal to which the pharmaceutical composition according to this embodiment is administered is not particularly limited and may be a human or a non-human animal, but it is preferably a mammal. Examples of non-human mammals include cattle, pigs, horses, sheep, goats, monkeys, dogs, cats, rabbits, mice, rats, hamsters, guinea pigs, and the like.

[0056] The pharmaceutical composition according to this embodiment contains a nucleic acid that expresses CALN in cells as an active ingredient, and is therefore suitable as a pharmaceutical composition for the treatment or prevention of diseases caused by YAP / TAZ activation. In particular, it is effective for the treatment and prevention of recurrence of cancers that show YAP / TAZ activation due to any of the gene abnormalities. Since YAP / TAZ contributes not only to the proliferation of cancer cells but also to immune evasion and the acquisition of drug resistance, the pharmaceutical composition according to this embodiment is expected to have an inhibitory effect on the proliferation of cancer cells, as well as to inhibit immune evasion and the acquisition of drug resistance.

[0057] The target of treatment is an animal that has developed cancer, and the cancer in the animal can be treated by administering an effective amount of the pharmaceutical composition according to this embodiment to the target animal. The effective amount is not particularly limited as long as it is a therapeutically effective amount for cancer, that is, an amount sufficient to obtain an anticancer effect, and is determined appropriately considering the type of cancer, malignancy (stage of progression), route of administration, form of administration (dosage form), number of administrations per day, interval between administrations, species of organism, sex, age, weight, presence or absence of other diseases, etc. For example, the daily dose of the pharmaceutical composition according to this embodiment for an adult can be, for example, about 0.01 mg to 10 g of nucleic acid as the active ingredient. Generally, the above dose can be administered once or several times per day, but it may also be administered every few days.

[0058] The pharmaceutical composition according to this embodiment exhibits broad therapeutic effects against various types of cancer, and therefore the target cancers are not particularly limited. The target diseases for the pharmaceutical composition according to this embodiment are preferably cancers exhibiting YAP / TAZ activation, and particularly preferably cancers exhibiting YAP / TAZ activation due to genetic abnormalities. Examples of cancers exhibiting YAP / TAZ activation due to genetic abnormalities include head and neck squamous cell carcinoma (HNSCC) (EGFR gene amplification, FAT1 deletion / mutation, YAP1 gene amplification, HPV positive), lung adenocarcinoma (EGFR gene mutation), malignant mesothelioma (NF2 gene deletion), meningioma (NF2 gene deletion), epithelioid hemangioendothelioma (YAP or TAZ fusion gene), uveal melanoma (Gαq and Gα11 gene mutation), and other cancers accompanied by these genetic abnormalities. [Examples]

[0059] The present invention will now be described in more detail with reference to examples, but the present invention is not limited to the following examples.

[0060] [Example 1] The effect of CALN mRNA on YAP / TAZ inactivation was investigated.

[0061] <caln> In this example, as CALN, a protein (hCALN) was used in which an NLS was added to the C-terminus of caLATS (cahLATS1) that was constitutively activated by substituting the 1079th threonine and 909th serine of human LATS1 with asparagine. The full-length amino acid sequence (SEQ ID NO: 1) of hCALN and the nucleotide sequence (SEQ ID NO: 2) encoding the same are shown in Tables 1 and 2. In the tables, the black-and-white inverted characters indicate the mutation sites (S909D, T1079D). Also, the underlined part indicates the NLS.

[0062] [Table 1]

[0063] [Table 2]

[0064] <Intracellular localization of hCALN and cahLATS1> An expression vector (manufactured by Sigma-Aldrich) for expressing a fusion protein with a FLAG tag added to the N-terminus was incorporated with the full-length CDS of hCALN (SEQ ID NO: 2) or the full-length CDS of cahLATS1 (the nucleotide sequence lacking the underlined region in the nucleotide sequence of SEQ ID NO: 2) to prepare an expression vector for FLAG-hCALN (hCALN with a FLAG added to the N-terminus) and an expression vector for FLAG-cahLATS1 (cahLATS1 with a FLAG added to the N-terminus).

[0065] These expression vectors were each transfected into HEK293A cells, which are a cell line derived from human fetal kidneys, and immunofluorescence staining was performed with an antibody against the FLAG tag (manufactured by Cell Signaling Technology). The stained images of each cell are shown in Figure 2. In the figure, DAPI is the stained image by a nuclear stain. As shown in Figure 2, FLAG-cahLATS1 was localized in the cytoplasm, while hCALN to which NLS was added was localized in the nucleus.

[0066] <Preparation of hCALN mRNA> The preparation of mRNA for intracellular expression of hCALN was carried out in two steps: preparation of a cloning vector consisting of double-stranded DNA for synthesizing the target mRNA and synthesis of Cap-modified mRNA using the cloning vector as a template. The preparation of the mRNA was carried out based on the recommended protocol using the "Takara IVTpro mRNA synthesis system" (manufactured by Takara).

[0067] The kit contains a linearized vector having a T7 promoter, a transcription start sequence (AGG), a 5'-UTR (AGGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC: SEQ ID NO: 6), a 3'-UTR (TGAGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC: SEQ ID NO: 7), and a Poly(A) sequence (105 bases). By performing In-Fusion cloning using the vector and the CDS fragment for In-Fusion of hCALN, a cloning vector having a T7 promoter, a transcription start sequence, a 5'-UTR, the CDS of hCALN, a 3'-UTR, and a Poly(A) sequence was obtained from the 5' side.

[0068] The CDS fragment for In-Fusion of hCALN was prepared by performing PCR using a forward primer having a 15-base sequence for In-Fusion (AGAGAACCCGCCACC: SEQ ID NO: 8) at the 5' end and a reverse primer having a 15-base sequence for In-Fusion (CGAGGCTCCAGCTCA: SEQ ID NO: 9) at the 5' end with a nucleic acid containing the full length of the CDS of hCALN (SEQ ID NO: 2) as a template.

[0069] The cloning vector incorporating the CDS of hCALN was digested and linearized with Hind III at the 3' side of the Poly(A) sequence. Using the obtained linearized fragment as a template, Cap-modified mRNA of hCALN (SEQ ID NO: 10) was synthesized by an IVT reaction. For the IVT reaction, "CleanCap Reagent AG" (manufactured by TriLink) was used.

[0070] <Preparation of cahLATS1 mRNA> The preparation of mRNA for intracellular expression of cahLATS1 was performed in the same manner as the preparation of hCALN mRNA, except that the CDS of cahLATS1 (the nucleotide sequence with the underlined region in the nucleotide sequence of SEQ ID NO: 2 deleted) was used.

[0071] <Preparation of luciferase mRNA> The preparation of mRNA for intracellular expression of luciferase was performed in the same manner as the preparation of hCALN mRNA, except that the CDS of luciferase was used. Luciferase mRNA was used as a control mRNA in subsequent experiments.

[0072] <Evaluation of the effects on phosphorylation of YAP and expression level of CTGF> HEK293A cells were transfected with 2.5 μg / mL of luciferase, cahLATS1, or hCALN mRNA using "lipofectamine messengerMAX" (manufactured by Thermo Fisher Science), and the cells were harvested 24 hours later.

[0073] The collected cells were solubilized and subjected to Western blotting. Anti-LATS1 antibody (Cell Signaling Technology), anti-pYAP(S127) antibody (Cell Signaling Technology), anti-YAP antibody (Cell Signaling Technology), and β-actin antibody (Sigma-Aldrich) were used for Western blotting. The results of the Western blotting are shown in Figure 3. As shown in Figure 3, cells expressing hCALN showed significantly enhanced YAP phosphorylation compared to control cells expressing luciferase. A slight enhancement of YAP phosphorylation was also observed in cells expressing cahLATS1, but it was not as pronounced as in cells expressing hCALN. These results confirm that CALN localized in the nucleus significantly enhances YAP phosphorylation, and it is predicted that CALN contributes to YAP inactivation.

[0074] Similarly, HEK293A cells were transfected with luciferase, cahLATS1, or hCALN mRNA, and CTGF expression levels were examined after 24 hours. CTGF is a representative transcriptional target gene of YAP / TAZ. CTGF mRNA expression levels were determined by qPCR using primers for CTGF, and the relative expression level was calculated relative to the expression level of control cells expressing luciferase. The measurement results are shown in Figure 4. As shown in Figure 4, both cells expressing hCALN and cells expressing cahLATS1 showed reduced CTGF expression levels compared to control cells expressing luciferase. The reduction in CTGF expression was significantly greater in cells expressing hCALN than in cells expressing cahLATS1. These results confirm that CALN inactivates YAP and reduces the expression levels of YAP's transcriptional target genes.

[0075] [Example 2] Compounds that exhibit a growth inhibitory effect on cell lines of various cancer types with gene abnormalities leading to YAP / TAZ activation are expected to be new cancer therapeutic agents that can actually be applied to patients with various cancer types having gene abnormalities leading to YAP / TAZ activation. Therefore, the growth inhibitory effect of CALN mRNA on various cancer cells was examined and its anticancer effect was evaluated.

[0076] <Verification of the effect of IK-930 on the growth of WSU-HN6 cells> Using WSU-HN6 cells, which show YAP / TAZ activation due to EGFR gene amplification in human head and neck squamous cell carcinoma (HNSCC) cells, the effect of IK-930 (CAS number: 2563892-44-20), one of the TEAD inhibitors, was verified. WSU-HN6 cells were cultured for 72 hours in a culture medium with a final concentration of IK-930 of 1, 10, 25, or 100 μg / mL. The amount of surviving cells after culture was measured using the cell viability measurement kit "CellTiter-Blue (registered trademark) CellViability Assay" (manufactured by Promega), and the survival rate (%) of each cell was measured with the measurement value without IK-930 addition (0 μg / mL) set as 100%. The measurement results are shown in Fig. 5(A).

[0077] Similarly, WSU-HN6 cells were cultured for 72 hours in a culture medium with a final concentration of IK-930 of 0, 2.5, or 25 μg / mL, and the cells after culture were stained with Crystal Violet. The staining image of the cells throughout the culture container was analyzed by image analysis, and the staining intensity value was measured. The relative staining intensity with respect to the staining intensity value without IK-930 addition (0 μg / mL) was taken as the survival rate (%) of each cell. The results are shown in Fig. 5(B).

[0078] As shown in Figs. 5(A) and (B), the cell growth of WSU-HN6 cells was inhibited in a concentration-dependent manner by IK-930. In particular, by increasing the concentration of IK-930 up to 10, 25, 100 μg / mL, the growth was inhibited by approximately 10 - 20%.

[0079] <Measurement of the effect of hCALN mRNA on the growth of WSU-HN6 cells> WSU-HN6 cells were transfected with 1.0 μg / mL of luciferase, cahLATS1, or hCALN mRNA using "lipofectamine messengerMAX" (Thermo Fisher Science), and cell viability after 72 hours was measured in the same manner as described above. The results measured using the cell viability measurement kit are shown in Figure 6(A), and the results measured using Crystal Violet staining are shown in Figure 6(B).

[0080] As shown in Figures 6(A) and (B), even at a low concentration of 1.0 μg / mL, WSU-HN6 cells introduced with hCALN mRNA had their cell viability reduced to 10-20%, indicating that the proliferation of WSU-HN6 cells was significantly inhibited by the introduction of hCALN mRNA. WSU-HN6 cells introduced with cahLATS1 mRNA also showed a reduction in cell viability to about 30%. These results suggest that hCALN mRNA has approximately 100 times the therapeutic effect of IK-930.

[0081] <Measurement of the effects on the proliferation of various cancer cells> The cancer cells used included CAL27 cells, which exhibit heterozygous copy deletion of the FAT1 gene; HN12 cells, which exhibit YAP1 gene amplification; SCC47 cells, which exhibit human papillomavirus (HPV) infection; MDA-MB-231 cells, derived from breast cancer and exhibiting homozygous deletion of the NF2 gene; NCI-H226 cells, derived from malignant mesothelioma and exhibiting homozygous deletion of the NF2 gene; and PC9 cells, derived from lung adenocarcinoma and exhibiting exon 19 deletion of the EGFR gene (E746-A750 deletion). All of these cancer cells are thought to exhibit YAP / TAZ activation.

[0082] Except for using these cancer cells instead of WSU-HN6 cells, the cells were transfected with luciferase or hCALN mRNA in the same manner as described above, and the cell viability after 72 hours was measured. The results measured using the cell viability measurement kit are shown in Table 3, and the results measured using Crystal Violet staining are shown in Figure 7.

[0083] [Table 3]

[0084] As shown in Table 3 and Figure 7, a low concentration of 1.0 μg / mL of hCALN mRNA showed a significant inhibitory effect on cell proliferation in all of the following cell types: CAL27, HN12, SCC47, MDA-MB-231, NCI-H226, and PC9. These results suggest that CALN mRNA is an excellent anticancer agent applicable to various cancer types with diverse genetic abnormalities, and that it may exhibit a higher inhibitory effect on cell proliferation than existing TEAD inhibitors.

[0085] [Example 3] We administered hCALN mRNA to a tumor-bearing model and investigated its effects on the tumor.

[0086] First, we created a tumor-bearing mouse model by subcutaneously inoculating SCID mice with 1 million WSU-HN6 cells. Following WSU-HN6 cell inoculation, a mixture of 5 μg of control mRNA (Luciferase mRNA) or CALN mRNA and in vivo-jetRNA (Sartorius Polyplus) was administered into the tumors on days 0, 4, and 6. The tumor-bearing model mice were then grown until day 13 after WSU-HN6 cell inoculation, and the size of the tumor tissue was measured over time. The size of the tumor tissue was measured from its longest and shortest diameters based on the following formula.

[0087] [tumor volume (mm²] 3 )] = [Short diameter of tumor tissue (mm)] 2 ×[Longest diameter of tumor tissue (mm)] / 2

[0088] Figure 8 shows the tumor volume measurements for the control group (Luciferase mRNA administration group) and the CALN administration group (CALN mRNA administration group) (N=3 in each group). Tumor tissue growth was clearly suppressed in the CALN mRNA administration group compared to the control group. These results clearly indicate that CALN mRNA has a high antitumor effect.< / caln>

Claims

1. The active ingredient is a nucleic acid that expresses a variant of Lats kinase in cells. A pharmaceutical composition in which the mutant is a Lats kinase mutant that has a nuclear localization signal and is constitutively activated.

2. The pharmaceutical composition according to claim 1, wherein the Lats kinase is one or more selected from the group consisting of human LATS1, human LATS2, and their homologs.

3. The pharmaceutical composition according to claim 2, wherein the mutant is in which the amino acids corresponding to the 1079th threonine and 909th serine of human LATS1 are substituted with aspartic acid or glutamic acid.

4. The pharmaceutical composition according to claim 1, wherein the mutant has a nuclear localization signal at its N-terminus or C-terminus.

5. The aforementioned mutant is A protein consisting of the amino acid sequence represented by Sequence ID No. 1, or This protein consists of an amino acid sequence that has more than 90% sequence identity with the amino acid sequence represented by Sequence ID No. 1, is localized in the nucleus, and constitutively exhibits Lats kinase activity. The pharmaceutical composition according to claim 1.

6. The pharmaceutical composition according to claim 1, wherein the nucleic acid is mRNA.

7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the cells are cancer cells exhibiting YAP / TAZ activation.

8. The pharmaceutical composition according to any one of claims 1 to 6, wherein the nucleic acid is encapsulated in lipid nanoparticles.

9. A pharmaceutical composition according to any one of claims 1 to 6, used for the treatment of cancer.

10. A method for treating cancer in animals other than humans, A method for treating cancer, comprising administering an effective amount of the pharmaceutical composition described in any one of claims 1 to 6 to an animal to be treated.

11. The method for treating cancer according to claim 10, wherein the cancer is a cancer that exhibits YAP / TAZ activation.

Images