Cell-permeable peptides

Peptides with cationic and hydrophobic domains enhance cell permeability and therapeutic delivery to muscle tissues, addressing the limitations of current CPPs by increasing efficacy and reducing toxicity for genetic disease treatment.

JP2026099886APending Publication Date: 2026-06-18OXFORD UNIVERSITY INNOVATION LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026060847
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2018-08-09
Filing Date
2026-04-02
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

Current cell-permeable peptides (CPPs) used for delivering therapeutic molecules, such as antisense oligonucleotides, face challenges in achieving effective delivery to muscle tissues like skeletal and cardiac muscles without increasing toxicity, particularly for treating genetic diseases like Duchenne muscular dystrophy (DMD).

Method used

Development of peptides with specific structures comprising one or more cationic domains and two hydrophobic domains at the N- and C-termini, which enhance cell permeability and therapeutic molecule delivery, allowing for lower dose administration and reduced toxicity.

Benefits of technology

The peptides demonstrate increased exon skipping and functional dystrophin protein production in various muscle groups at lower doses, improving therapeutic efficacy while minimizing toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026099886000007
    Figure 2026099886000007
  • Figure 2026099886000008
    Figure 2026099886000008
  • Figure 2026099886000001
    Figure 2026099886000001
Patent Text Reader

Abstract

The present invention provides a complex comprising a cell-permeable peptide and a therapeutic molecule bound to the cell-permeable peptide. [Solution] The cell-permeable peptide has a total length of 40 amino acid residues or less and comprises a first hydrophobic domain located at the C-terminus and a second hydrophobic domain located at the N-terminus of the peptide. The complex comprises a therapeutic molecule bound to the cell-permeable peptide and is used as a therapeutic drug.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to peptides, particularly cell-penetrating peptides, and complexes of such cell-penetrating peptides with therapeutic molecules. The present invention further relates to the use of such peptides or complexes in therapy or as a drug, particularly in the treatment of genetic diseases, especially muscle diseases such as Duchenne muscular dystrophy.

Background Art

[0002] Nucleic acid medicines are genomic medicines that have the potential to change human healthcare. Academic research has shown that such therapies have applications across a wide range of disease areas, including neuromuscular diseases. The application of antisense oligonucleotide methods to regulate pre-mRNA splicing in the neuromuscular disease Duchenne muscular dystrophy (DMD) has placed this single-gene disorder at the forefront of advances in precision medicine.

[0003] However, the therapeutic development of these promising future antisense medicines is hampered by insufficient cell permeability and poor distribution characteristics, and the challenge is further emphasized by the large volume and dispersed nature of the muscle tissue substrate in DMD.

[0004] DMD occurs in 1 in 3,500 newborn males. This severe X-linked recessive disease is caused by mutations in the DMD gene that encodes the dystrophin protein. The disease is characterized by progressive muscle degeneration, leading to respiratory failure and cardiac complications, and ultimately premature death. Many of the mutations that underlie DMD are genomic frameshift deletions that result in premature truncation in the open reading frame, leading to the absence of the dystrophin protein.

[0005] Exon skipping therapy utilizes splice-switching antisense oligonucleotides (SSOs) to target specific regions of DMD copies, inducing the elimination of individual exons, leading to the repair of the abnormal reading frame and resulting in the production of a partially functional dystrophin protein, albeit with internal defects. Despite the undeniable potential of antisense oligonucleotide exon skipping therapy for DMD, the successful application of this approach is currently limited by relatively inadequate targeting of skeletal muscle, along with inappropriate targeting of single-stranded oligonucleotides to other affected tissues, such as the heart.

[0006] In September 2016, the Food and Drug Administration (FAD) granted accelerated approval for eteplirsen (a single-stranded oligonucleotide for modulating exon 51 splicing). This marked the first approved splicing-modulating oligonucleotide in the United States, but the level of dystrophin repair was disappointing, at approximately 1% of normal dystrophin levels. Comparisons with Becker muscular dystrophy (an allele disorder) and experiments in mdx mice indicate that at least ~15% of wild-type allogeneic myocyte membrane dystrophin expression is required to protect muscles from exercise-induced injury.

[0007] Therefore, there is a strong and urgent need to improve the delivery of antisense oligonucleotides in order to provide more effective treatments for destructive genetic diseases, such as DMD.

[0008] The use of viruses as delivery vehicles has been proposed, however, is limited due to the immunotoxicity of the viral coat protein. Instead, a wide range of nonviral delivery vectors have been developed, among which peptides have shown the best potential due to their small size, targeting specificity, and ability to deliver large biocargoes via capillary transport. Several peptides have been reported for their ability to penetrate cells, either alone or in combination with biocargoes.

[0009] For several years, cell-permeable peptides (CPPs) have been conjugated with SSOs (particularly charge-neutral phosphorodiamidate morpholino oligomers (PMOs) and peptide nucleic acids (PNAs)) to increase cellular delivery by effectively transporting SSOs across the cell membrane and reaching their pre-mRNA target sites in the cell nucleus. PMO therapeutics conjugated with certain arginine-rich CPPs (known as peptide-PMOs or P-PMOs) have been shown to enrich dystrophin production in skeletal muscle in an mdx mouse model of DMD, subsequently enabling systemic administration.

[0010] In particular, PNA / PMO internal transfer peptides (Pips) have been developed, which are arginine-rich CPPs consisting of two arginine-rich sequences separated by a short, hydrophobic central sequence. These "Pip" peptides are designed to improve plasma stability while, on the one hand, maintaining high levels of exon skipping by initially arriving at PNA. Furthermore, further derivatives of these peptides have been designed as PMOs complexes, which have been shown in mice to lead, importantly, to systemic skeletal muscle dystrophin production, including cardiac dystrophin, followed by systemic delivery. Despite the efficacy of these peptides, their therapeutic application has been hindered by the need for high doses and, therefore, the associated toxicity.

[0011] Other cell-permeable peptides containing a single arginine-rich domain, e.g., R6Gly, have also been produced. These CPPs have been used to generate peptide complexes with reduced toxicity, although in this case, the complexes showed lower potency compared to the Pip peptide.

[0012] Therefore, it has not yet been proven that currently available CPPs are suitable for human treatment of diseases such as DMD. [Overview of the Initiative] [Problems that the invention aims to solve]

[0013] In the field of cell-permeable peptide technology, there is a challenge to improve efficacy without increasing toxicity. The inventors have identified, synthesized, and tested numerous improved CPPs having specific structures according to the present invention that address at least this challenge.

[0014] These peptides maintain favorable efficacy levels in skeletal muscle when tested in vitro and in vivo with cargo therapeutic molecules. Furthermore, the peptides of the present invention exhibit improved efficacy levels in skeletal muscle when tested in vitro and in vivo with cargo therapeutic molecules. Simultaneously, when used in the form of a complex, these peptides allow the therapeutic cargo molecules to permeate cells, acting effectively at remarkably lower doses than conventionally available cell-permeable peptides. The improved efficacy at low doses means that the peptides of the present invention do not need to be administered at toxic high levels. Therefore, the peptides of the present invention offer improved suitability for use in therapeutic complexes for human treatment compared to conventionally available peptides. [Means for solving the problem]

[0015] According to a first aspect of the present invention, a peptide is provided which has a total length of 40 or fewer amino acid residues, comprising one or more cationic domains and two or more hydrophobic domains (each containing at least three amino acid residues), wherein one of the hydrophobic domains is located at the C-terminus of the peptide and the other hydrophobic domain is located at the N-terminus of the peptide.

[0016] According to a second aspect of the present invention, a complex is provided comprising the peptide of the first aspect, covalently bonded to a therapeutic molecule.

[0017] According to a third aspect of the present invention, there is provided a complex comprising the peptide of the first aspect covalently bound to an imaging molecule.

[0018] According to a fourth aspect of the present invention, there is provided a pharmaceutical composition comprising the complex of the second aspect.

[0019] According to a fifth aspect of the present invention, there is provided a complex according to the second aspect for use as a medicament.

[0020] In one specific example of the fifth aspect, there is provided a pharmaceutical composition according to the fourth aspect for use as a medicament.

[0021] According to a sixth aspect of the present invention, there is provided a method of treating a disease in a patient, the method comprising administering to the patient a complex according to the second aspect in a therapeutically effective amount.

[0022] In one specific example of the sixth aspect, there is provided a method of treating a disease in a patient, the method comprising administering to the patient a pharmaceutical composition according to the fourth aspect in a therapeutically effective amount.

[0023] According to a seventh aspect of the present invention, there is provided an isolated nucleic acid encoding the peptide of the first aspect or the complex of the second aspect or the complex of the third aspect.

[0024] According to an eighth aspect of the present invention, there is provided an expression vector comprising the nucleic acid sequence of the seventh aspect.

[0025] According to a ninth aspect of the present invention, there is provided a host cell comprising the expression vector of the eighth aspect. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] [Figure 1]Graph showing the in vitro exon 23 skipping efficiency of some peptides of the DPEP2 series conjugated to antisense therapeutic molecules at 0.25 μM, 0.5 μM, and 1 μM in H2K-mdx cells, measured by densitometry analysis of nested RT-PCR (error bar: standard deviation n ≧ 3). [Figure 2] (A) Graph showing the in vivo efficiency of some peptides of the DPEP2 series conjugated to antisense therapeutic molecules in the tibialis anterior muscle, (B) diaphragm, and (C) myocardium, compared to currently available peptides conjugated to the same therapeutic molecule. mdx mice were administered a single intravenous dose of 10 mg / kg, and the restoration of dystrophin protein was evaluated by Western blot, and exon skipping was evaluated by qRTPCR (error bar: standard deviation n = 3).

Mode for Carrying Out the Invention

[0027] The inventors have generated a series of peptides suitable for use as cell-penetrating peptides for delivering therapeutic molecules to cells.

[0028] Surprisingly, the inventors have found a group of peptides having at least one cationic domain and at least two hydrophobic domains of limited length located at the N and C termini of the peptide, which provide increased cell permeability to molecules compared to currently available cell-penetrating peptides, and have reached the present invention. This effect is observed when delivered to cells as a complex with an antisense oligonucleotide therapeutic or when administered in vivo.

[0029] From the perspective of the disease DMD, the increased cell permeability by the peptides of the present invention conjugated to a suitable therapeutic molecule is shown by the exclusion of a special exon in the transcript. The orientation of the antisense oligonucleotide to a suitable sequence results in the forced skipping of the exon, the correction of the open reading frame, and the restoration of an internally deleted but still partially functional isoform of dystrophin.

[0030] When used as a conjugate with an antisense oligonucleotide therapeutic designed to target the dystrophin gene, the peptide of the present invention exhibits high levels of exon exclusion and dystrophin protein repair.

[0031] In vivo, the results described herein show increased exon skipping and functional dystrophin expression when using the peptide conjugate of the present invention, compared to the exon skipping results of the same antisense oligonucleotide therapeutic combined with currently available cell-permeable peptides. This represents a significant improvement in the permeability of such peptide carriers to muscle cells affected by neuromuscular diseases.

[0032] While not wishing to be bound by any theory, the inventors believe that the presence of terminal hydrophobic domains has the effect of boosting the delivery properties of peptides in order to deliver therapeutic cargo to cells. This is advantageous because increased cell permeability means increased delivery of therapeutic molecules and enhanced therapeutic effects. Furthermore, these benefits are delivered at lower doses, thereby reducing the potential toxicity of cell-permeable peptides.

[0033] It was completely unexpected that such peptide structures would enhance the ability of arginine-rich cell-permeable peptides to transport therapeutic molecular cargo, such as oligonucleotides, into muscles.

[0034] As demonstrated here, the increased transport of such molecules unexpectedly led to a significant increase in exon skipping and the production of functional dystrophin protein in various different muscle groups, therapeutic molecules such as antisense oligonucleotides.

[0035] To avoid any ambiguity and to clarify how this specification should be interpreted, the terms used in accordance with the present invention are now further defined.

[0036] The present invention encompasses various combinations of the embodiments and features described, except where such combinations are clearly unacceptable or clearly to be avoided.

[0037] The section headings used herein are for organizational purposes only and should not be interpreted as limiting the subject matter described herein.

[0038] In all contexts, "X" represents various forms of unnatural amino acids and aminohexanoic acid.

[0039] In all contexts, "B" represents the naturally occurring, but non-genetically encoded, amino acid residue β-alanine.

[0040] In all contexts, "Ac" represents the acetylation of the relevant peptide.

[0041] In all contexts, "Hyp" refers to the relevant genetically encoded amino acid, hydroxyproline.

[0042] Any other capital letter anywhere represents the corresponding genetically encoded amino acid residue according to the accepted amino acid code.

[0043] Cationic domain The present invention relates to a short, cell-permeable peptide having a special structure containing at least one cationic domain.

[0044] In this context, "cationicity" refers to amino acids and amino acid domains that have a positive charge overall at physiological pH.

[0045] Preferably, the peptide comprises four or fewer cationic domains, three or fewer cationic domains, and two or fewer cationic domains.

[0046] Preferably, each cationic domain in the peptide is the same or different. Preferably, each cationic domain in the peptide is different.

[0047] Preferably, the peptide comprises one cationic domain.

[0048] Preferably, each cationic domain has a length of 5 to 20 amino acid residues, and preferably 9 to 14 amino acid residues.

[0049] Preferably, each cationic domain has a length of 9, 10, 11, 12, 13, or 14 amino acid residues.

[0050] Preferably, each cationic domain is of similar length, and preferably, each cationic domain is of the same length.

[0051] Preferably, each cationic domain comprises a cationic amino acid and may also contain polar and / or nonpolar amino acids.

[0052] Nonpolar amino acids are selected from alanine, β-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, and phenylalanine. Preferably, nonpolar amino acids do not have a negative charge.

[0053] The polar amino acids are selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine. Preferably, the selected polar amino acids do not have a negative charge.

[0054] The cationic amino acid is selected from arginine, histidine, and lysine. Preferably, the cationic amino acid has a positive charge at physiological pH.

[0055] Preferably, each cationic domain does not contain an anionic or negatively charged amino acid residue.

[0056] Preferably, each cationic domain comprises arginine, aminohexanoic acid, histidine, β-alanine, hydroxyproline, and / or serine residues.

[0057] Preferably, each cationic domain comprises an arginine, aminohexanoic acid, and / or a β-alanine residue.

[0058] Preferably, each cationic domain contains at least 40%, at least 45%, or at least 50% cationic amino acids.

[0059] Preferably, each cationic domain consists of a majority of cationic amino acids. Preferably, each cationic domain contains at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and at least 95% cationic amino acids.

[0060] Preferably, each cationic domain has an isoelectric point (Ip) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, and at least 12.0.

[0061] Preferably, each cationic domain has an isoelectric point (Ip) of at least 10.0.

[0062] Preferably, each cationic domain has an isoelectric point (Ip) of 11.0 to 13.0.

[0063] In one specific example, each cationic domain has an isoelectric point (Ip) of 12.3 to 12.7 degrees Celsius.

[0064] Preferably, the isoelectric point of the cationic domain is determined at physiological pH by various suitable methods available in the art, preferably by using IPC (www.isoelectric.org) (a web-based algorithm developed by Lukasz Kozlowski; Biol Direct. 2016; 11: 55. DOI: 10.1186 / s13062-016-0159-9).

[0065] Preferably, each cationic domain contains at least four cationic amino acids, preferably four to eight cationic amino acids.

[0066] Preferably, each cationic domain is arginine-rich.

[0067] "Arginine-rich" means that at least 40% of the cationic domain is formed by the aforementioned residues.

[0068] Preferably, each cationic domain consists mostly of arginine residues.

[0069] Preferably, the cationic domain may contain at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, or at least 70% of arginine residues.

[0070] Preferably, the cationic domain contains a total of 4 to 8 arginine residues.

[0071] Preferably, all of the cationic amino acids in a given cationic domain may be arginine.

[0072] Preferably, each cationic domain contains one or more β-alanine residues. Preferably, each cationic domain may contain a total of 3 to 7 β-alanine residues, and preferably, a total of 4 to 6 β-alanine residues.

[0073] Preferably, each cationic domain contains one or more aminohexanoic acid residues.

[0074] Preferably, each cationic domain may contain a total of 1 to 4 β-aminohexanoic acid residues, or preferably 1 to 3 aminohexanoic acid residues.

[0075] Preferably, various amino acid residues, such as 4-aminohexanoic acid, 5-aminohexanoic acid, or 6-aminohexanoic acid residues, are used. Preferably, 6-aminohexanoic acid is used.

[0076] Preferably, the cationic domain may comprise one or more histidine, hydroxyproline, or serine residues.

[0077] In one specific example, the peptide comprises one arginine-rich cationic domain.

[0078] Preferably, each cationic domain comprises three or fewer adjacent arginine residues and two or fewer adjacent arginine residues.

[0079] Preferably, each cationic domain may contain residues of arginine, aminohexanoic acid, and / or β-alanine. Preferably, each cationic domain is predominantly composed of residues of arginine, aminohexanoic acid, and / or β-alanine. Preferably, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the amino acid residues in each cationic domain are residues of arginine, aminohexanoic acid, and / or β-alanine. Preferably, each cationic domain consists of residues of arginine, aminohexanoic acid, and / or β-alanine.

[0080] Preferably, the peptide comprises one cationic domain, which forms the core of the peptide. Preferably, the cationic domain is located in the center of the peptide. Therefore, preferably, the cationic domain is known as the cationic core domain.

[0081] In one specific example, the peptide comprises one arginine-rich cationic domain.

[0082] Preferably, each cationic domain comprises an amino acid residue selected from the following: R, X, B, RR, BB, XX, RX, XR, RB, BR, BX, XB, RBR, RBB, BBR, BRR, BRB, RBX, RXB, RBX, XRB,

[0083] Preferably, each cationic domain comprises one of the following sequences: RBRXRBRXB (SEQ ID NO: 1), RBRXRBRXBRXRB (SEQ ID NO: 2), RBRXRBRXBR (SEQ ID NO: 3), RBRRXRBRXBRXRB (SEQ ID NO: 4), RBRXRBRBRXRB (SEQ ID NO: 5), RBRXRBRBRBRB (SEQ ID NO: 6), RBRBRBRBRBRB (SEQ ID NO: 7), RBRXRBRBRXR (SEQ ID NO: 8), RBRRBRBRBRRB (SEQ ID NO: 9), RRRBRBRBRXBRXRB (SEQ ID NO: 10), RBRRBRBRBBRXRB (SEQ ID NO: 11), RBRRBRBRBBRBRB (SEQ ID NO: 12), or any combination thereof.

[0084] Preferably, each cationic domain consists of one of the following sequences: RBRXRBRXB (SEQ ID NO: 1), RBRXRBRXBRXRB (SEQ ID NO: 2), RBRXRBRXBR (SEQ ID NO: 3), RBRRXRBRXBRXRB (SEQ ID NO: 4), RBRXRBRBRXRB (SEQ ID NO: 5), RBRXRBRBRBRB (SEQ ID NO: 6), RBRBRBRBRBRB (SEQ ID NO: 7), RBRXRBRBRXR (SEQ ID NO: 8), RBRRBRBRBRRB (SEQ ID NO: 9), RRRBRBRBRXBRXRB (SEQ ID NO: 10), RBRRBRBRBBRXRB (SEQ ID NO: 11), RBRRBRBRBBRBRB (SEQ ID NO: 12), or any combination thereof.

[0085] Preferably, each cationic domain consists of one of the following sequences: RBRRXRBRXBRXRB (Sequence ID 4), RBRRBRBRBRRB (Sequence ID 9), RBRRBRBRBBRXRB (Sequence ID 11).

[0086] Preferably, the cationic domains in the peptidase are the same or different. Preferably, the cationic domains in the peptide are different.

[0087] Hydrophobic domain The present invention relates to a short, cell-permeable peptide having a special structure in which at least two hydrophobic domains of a specific length are present, the hydrophobic domains being located at each end of the peptide.

[0088] Here, "hydrophobic" refers to an amino acid or amino acid domain that has the ability to repel water and / or is incompatible with water.

[0089] Preferably, the peptide comprises four or fewer hydrophobic domains and three or fewer hydrophobic domains.

[0090] Preferably, the peptide comprises two hydrophobic domains.

[0091] As defined above, each peptide comprises two or more hydrophobic domains, each having a length of at least three amino acid residues.

[0092] Preferably, each hydrophobic domain has a length of 3 to 6 amino acids. Preferably, each hydrophobic domain has a length of 5 amino acids.

[0093] Preferably, each hydrophobic domain may contain nonpolar, polar, and hydrophobic amino acid residues.

[0094] Hydrophobic amino acid residues are selected from alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.

[0095] Nonpolar amino acid residues are selected from alanine, β-alanine, valine, leucine, isoleucine, phenylalanine, methionine, tryptophan, proline, glycine, and cysteine.

[0096] Polar amino acid residues are selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine.

[0097] Preferably, the hydrophobic domain does not contain hydrophilic amino acid residues.

[0098] Preferably, each hydrophobic domain consists mostly of hydrophobic amino acid residues. Preferably, each hydrophobic domain contains at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% hydrophobic amino acid residues.

[0099] Preferably, each hydrophobic domain has a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, and at least 0.45.

[0100] Preferably, each hydrophobic domain has a hydrophobicity of 0.4 to 1.4.

[0101] In one specific example, each hydrophobic domain has a hydrophobicity of 0.45 to 0.48.

[0102] Preferably, hydrophobicity is measured according to White and Wimley: WC Wimley and SH White, "Experimentally measured hydrophobicity scale for membrane boundary proteins," Nature Struct Biol, 3:842 (1996).

[0103] Preferably, each hydrophobic domain contains at least three, and at least four, hydrophobic amino acid residues.

[0104] Preferably, each hydrophobic domain comprises residues of phenylalanine, leucine, isoleucine, tyrosine, and glutamine.

[0105] Preferably, the peptide comprises two hydrophobic domains. Preferably, the hydrophobic domains are located at the N-terminus and C-terminus of the peptide, preferably at either end of the peptide. Preferably, the N-terminus and C-terminus of the peptide are free of further amino acids or domains, except for other groups, such as terminal modifications, linkers, and / or therapeutic molecules. To avoid doubt, other such groups may be present in addition to the “peptide” described herein and claimed. Thus preferably, each hydrophobic domain forms the end of the peptide. Preferably, this does not preclude the presence of further linker groups, as described herein.

[0106] Preferably, the hydrophobic domain is adjacent to the core domain. Preferably, the hydrophobic domain is considered an arm domain. Preferably, the core domain may contain one or more cationic domains and one or more further hydrophobic domains. Preferably, the core domain contains one cationic domain.

[0107] In one specific example, the peptide comprises a core domain and two hydrophobic arm domains adjacent to it, and the core domain comprises one cationic domain.

[0108] In one specific example, the peptide consists of a core domain and two hydrophobic arm domains adjacent to it, and the core domain contains one cationic domain.

[0109] Preferably, the hydrophobic domain or each hydrophobic domain comprises one of the following sequences: YQFLI (sequence number 13), FQILY (sequence number 14), ILFQY (sequence number 15), or any combination thereof.

[0110] Preferably, the hydrophobic domain, or each hydrophobic domain, consists of one of the following sequences: YQFLI (sequence number 13), FQILY (sequence number 14), ILFQY (sequence number 15), or any combination thereof.

[0111] Preferably, the hydrophobic domain or each hydrophobic domain consists of the sequence YQFLI (SEQ ID NO: 13).

[0112] Preferably, each hydrophobic domain in the peptide has the same sequence or different sequences.

[0113] peptide This invention relates to a short, cell-permeable peptide used for transporting therapeutic cargo molecules in the treatment of medical conditions.

[0114] A peptide has adjacent single molecules. Preferably, a peptide contains several domains linearly between the N-terminus and the C-terminus. Preferably, the domains are selected from the cationic domains and hydrophobic domains described above. Preferably, a peptide consists of cationic domains and hydrophobic domains, and the domains are as defined above.

[0115] Each domain shares common sequence characteristics as described in the appropriate chapter above, but the exact sequence of each domain is subject to deformation and modification. Thus, a certain range of sequences is possible for each domain. Each possible combination of domain sequences produces a certain range of peptide structures, each of which forms the one of the present invention. The characteristics of the peptide structure are described below.

[0116] Preferably, the cationic domain separates each hydrophobic domain. Preferably, each cationic domain is adjacent to a hydrophobic domain on one of its sides.

[0117] Preferably, the hydrophobic domains are not adjacent to other hydrophobic domains.

[0118] In one specific example, the peptide has the following sequence, comprising two hydrophobic domains and one adjacent cationic domain: [Hydrophobic domain]-[Cationic domain]-[Hydrophobic domain]

[0119] Therefore, preferably, the cationic domain is known as the core domain, and each of the hydrophobic domains is known as an arm domain. Preferably, the hydrophobic arm domain is adjacent to a cationic domain on one of its sides.

[0120] In one specific example, the peptide consists of one cationic domain and two hydrophobic domains.

[0121] In one specific example, a peptide consists of a cationic core domain with two hydrophobic domains adjacent to each other.

[0122] In one specific example, the peptide consists of two hydrophobic arm domains, each containing a sequence selected from YQFLI (SEQ ID NO: 13), FQILY (SEQ ID NO: 14), and ILFQY (SEQ ID NO: 15), and adjacent to one cationic core domain containing a sequence selected from RBRXRBRXB (SEQ ID NO: 1), RBRXRBRXBRXRB (SEQ ID NO: 2), RBRXRBRXBR (SEQ ID NO: 3), RBRRXRBRXBRXRB (SEQ ID NO: 4), RBRXRBRBRXRB (SEQ ID NO: 5), RBRXRBRBRBRB (SEQ ID NO: 6), RBRBRBRBRBRB (SEQ ID NO: 7), RBRXRBRBRXR (SEQ ID NO: 8), RBRRBRBRBRRB (SEQ ID NO: 9), RBRRRBRBRXBRXRB (SEQ ID NO: 10), RBRRBRBRBBRXRB (SEQ ID NO: 11), and RBRRBRBRBBRBRB (SEQ ID NO: 12).

[0123] In one specific example, the peptide consists of two hydrophobic arm domains, each containing the sequence YQFLI (SEQ ID NO: 13), and one cationic core domain containing a sequence selected from RBRRXRBRXBRXRB (SEQ ID NO: 4), RBRRBRBRBRRB (SEQ ID NO: 9), and RBRRBRBRBBRXRB (SEQ ID NO: 11), adjacent to each other.

[0124] In any of these specific examples, further groups, such as linkers, terminal modifications, and / or therapeutic molecules, may be present.

[0125] Preferably, the peptide is N-terminally modified.

[0126] Preferably, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated. Preferably, the peptide is N-acetylated.

[0127] The N-terminus of the peptide may or may not be modified.

[0128] In one specific example, the peptide is N-acetylated.

[0129] Preferably, the peptide is C-terminally modified.

[0130] Preferably, the peptide comprises a C-terminal modification selected from carboxy-, thio-, aminooxy-, hydrazino-, thioester-, azide, strained alkyne, strained alkene, aldehyde-, thio, or haloacetyl- groups.

[0131] Advantageously, C-terminal modification provides a means of binding the peptide to a therapeutic molecule.

[0132] Therefore, the C-terminal modification may or may not include a linker.

[0133] Preferably, the C-terminal modification consists of a linker, or does not consist of a linker. Suitable linkers are described here or elsewhere.

[0134] Preferably, the peptide contains a C-terminal carboxyl group.

[0135] Preferably, the C-terminal carboxyl group is provided by a glycine or β-alanine residue.

[0136] In one specific example, the C-terminal carboxyl group is provided by a β-alanine residue.

[0137] Preferably, the C-terminal β-alanine residue is a linker.

[0138] Preferably, each hydrophobic domain may further include an N-terminal modification. Preferably, the C-terminal hydrophobic domain includes a C-terminal modification. Preferably, the N-terminal hydrophobic domain includes an N-terminal modification. Preferably, the C-terminal hydrophobic domain includes a linker group, and preferably, the C-terminal hydrophobic domain includes a C-terminal β-alanine. Preferably, the N-terminal hydrophobic domain is N-acetylated.

[0139] The peptides of the present invention are defined as having a total length of 40 or fewer amino acid residues. Therefore, the peptides are considered oligopeptides. Preferably, the peptides have a total length of 10 to 35 amino acid residues, more preferably 12 to 33 amino acid residues, 15 to 30 amino acid residues, 17 to 27 amino acid residues, or 20 to 25 amino acid residues.

[0140] Preferably, the peptide has a total length of at least 16, at least 17, at least 18, at least 19, or at least 20 amino acid residues.

[0141] Preferably, the peptide can permeate cells. Therefore, the peptide is considered a cell-permeable peptide.

[0142] Preferably, the peptide is for adhesion to therapeutic molecules. Preferably, the peptide is for transporting therapeutic molecules to target cells. Preferably, the peptide is for delivering therapeutic molecules to target cells. Therefore, the peptide is considered a carrier peptide.

[0143] Preferably, the peptide can penetrate cells and tissues, preferably the nucleus of cells. Preferably, it can penetrate muscle tissue.

[0144] Preferably, the peptide is selected from the following sequences: YQFLIRBRXRBRXBYQFLI (Sequence ID 16) YQFLIRBRXRBRXBRXRBYQFLI (Sequence ID 17) YQFLIRBRXRBRXBRYQFLI (Sequence ID 18) YQFLIRBRRXRBRXBRXRBYQFLI (Sequence ID 19) YQFLIRBRXRBRBRXRBYQFLI (Sequence ID 20) YQFLIRBRXRBRBRBRBYQFLI (Sequence ID 21) YQFLIRBRBRBRBRBRBYQFLI (Sequence ID 22) YQFLIRBRXRBRBRXRYQFLI (Sequence ID 23) YQFLIRBRRBRBRBRRBYQFLI (Sequence ID 24) YQFLIRBRRBRBRXBRXRBYQFLI (Sequence ID 25) YQFLIRBRRBRBRBBRXRBYQFLI (Sequence ID 26) YQFLIRBRRBRBRBBRBRBYQFLI (Sequence ID 27) FQILYRBRRBRBRBBRBRBFQILY (Sequence ID 28) YQFLIRBRRXRBRXBRXRBFQILY (Sequence ID 29)

[0145] Preferably, the peptide consists of one of the following sequences: YQFLIRBRRXRBRXBRXRBYQFLI (Sequence ID 19) YQFLIRBRRBRBRBRRBYQFLI (Sequence ID 24) YQFLIRBRRBRBRBBRXRBYQFLI (Sequence ID 26)

[0146] 1. In a specific example, the peptide has the following sequence: YQFLIRBRRXRBRXBRXRBYQFLI (Sequence ID 19) It consists of.

[0147] complex The peptide of the present invention is covalently bonded to a therapeutic molecule to provide a complex.

[0148] Therapeutic molecules are various molecules used to treat diseases. Therapeutic molecules are selected from nucleic acids, peptide nucleic acids, antisense oligonucleotides (e.g., PNA, PMO), short interfering RNA, microRNA, mRNA, gRNA (e.g., in the use of CRISPR / Cas9 technology), antagonist RNA, peptides, cyclic peptides, proteins, drugs, pharmaceuticals, or nanoparticles.

[0149] In one specific example, the therapeutic molecule is an antisense oligonucleotide.

[0150] Preferably, the antisense oligonucleotide consists of a phosphorodiamidate morpholino oligonucleotide (PMO).

[0151] Alternatively, the oligonucleotide is a modified PMO, or other electrically neutral oligonucleotides, such as peptide nucleic acids (PNAs), chemically modified PNAs (e.g., γ-PNA (Bahal, Nat.Comm. 2016)), oligonucleotide phosphoramidates (where the uncrosslinked oxygen of the phosphate is substituted with an amine or alkylamine, e.g., as described in International Publication No. 2016 / 028178), or other partially or completely electrically neutralized oligonucleotides.

[0152] Therapeutic antisense oligonucleotide sequences are selected from available ones; for example, antisense oligonucleotides for exon skipping in DMD are described at https: / / research-repository.uwa.edu.au / en / publications / antisense-oligonucleotide-induced-exon-skipping-across-the-human-, and therapeutic antisense oligonucleotides complementary to ISSN1 or IN7 sequences for the treatment of SMA are described in Zhou, HGT, 2013; Hammond et al., 2016; and Osman et al., HMG, 2014.

[0153] Preferably, the antisense oligonucleotide sequence is intended to induce exon skipping for use in the treatment of DMD.

[0154] Preferably, the antisense oligonucleotide sequence is for inducing exon skipping in the dystrophin gene for use in the treatment of DMD. Preferably, the antisense oligonucleotide sequence can induce exon skipping of one or more exons.

[0155] In one specific example, the antisense oligonucleotide sequence is intended to induce exon skipping of a single exon of the dystrophin gene for use in the treatment of DMD. Preferably, the single exon is selected from various exons associated with DMD, and is a specific exon in the dystrophin gene, for example, exons 45, 51, or 53.

[0156] PMO oligonucleotides of any of these sequences are available for purchase (for example, from Gene Tools Inc., USA).

[0157] In one specific example, the therapeutic molecule of the complex is an oligonucleotide complementary to the pre-mamma of the gene target.

[0158] Preferably, an oligonucleotide complementary to the pre-mRNA of the gene target causes a steric blocking phenomenon that denatures the pre-mRNA, leading to denatured mRNA and, consequently, a protein with a denatured sequence. Preferably, the gene target is the dystrophin gene.

[0159] Preferably, the stereoblocking phenomenon is exon inclusion or exon skipping.1 In a specific example, the stereoblocking phenomenon is exon skipping, preferably exon skipping of a single exon of the dystrophin gene.

[0160] Optionally, to improve water solubility, lysine residues may be added to one or both ends of the therapeutic molecule (e.g., PMO or PNA) before attachment to the peptide.

[0161] Preferably, the therapeutic molecule has a molecular weight of 5,000 Da or less, 3,000 Da or less, or 1,000 Da or less.

[0162] Preferably, the peptide is covalently bonded to the therapeutic molecule at its C-terminus. Preferably, the peptide is covalently bonded to the therapeutic molecule via a linker, if necessary. The linker acts as a spacer to detach the peptide sequence from the therapeutic molecule. In one specific example, the complex comprises a linker.

[0163] The linker is selected from various suitable arrangements.

[0164] Preferably, the linker is part of a peptide or therapeutic molecule. Preferably, the linker is located between the peptide and the therapeutic molecule.

[0165] In one specific example, the complex is covalently bonded to the therapeutic molecule via a linker. In one specific example, the complex comprises the following structure: [Peptide]-[Linker]-[Therapeutic Molecule]

[0166] In one specific example, the complex consists of the following sequence of terms: [Peptide]-[Linker]-[Therapeutic Molecule]

[0167] In the complex according to the present invention, any of the peptides shown herein is used. In one specific example, the complex comprises a peptide selected from one of the following sequences: YQFLIRBRRXRBRXBRXRBYQFLI (SEQ ID NO: 19), YQFLIRBRRBRBRBRRBYQFLI (SEQ ID NO: 24), and YQFLIRBRRBRBRBBRXRBYQFLI (SEQ ID NO: 26).

[0168] Preferably, in either case, the peptide may further include N-terminal modifications as described above.

[0169] Suitable linkers include, for example, disulfides, thioethers, or C-terminal cysteine ​​residues that allow the formation of thio-maleimide bonds, and C-terminal aldehydes that form oximes (click reaction or formation of morpholine bonds with basic amino acids on the peptide or carboxylic acid moieties on the peptide covalently bonded to an amino group on the peptide, for the formation of carboxamide bonds).

[0170] Preferably, the linker is 1 to 5 amino acids long. Preferably, the linker is any type of linker known in the art.

[0171] Preferably, the linker is one of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, and XB.

[0172] Preferably, the linker may be a polymer, such as PEG.

[0173] In one specific example, the linker is β-alanine.

[0174] In one specific example, the peptide is bound to the therapeutic molecule via a carboxamide bond.

[0175] The linker of the complex can form part of the therapeutic molecule to which the peptide binds. Alternatively, the therapeutic molecule may be directly attached to the C-terminus of the peptide. Preferably, in such specific examples, a linker is not required.

[0176] Alternatively, peptides are chemically bonded to therapeutic molecules. These chemical bonds may be, for example, via disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, sulfate, phosphoramidate, thiophosphate, boranophosphate, iminophosphate, or thiol-maleimide bonds.

[0177] Optionally, a cysteine ​​molecule may be added to the N-terminus of the therapeutic molecule to enable the formation of a disulfide bond to the peptide, or the N-terminus may undergo bromoacetylation for thioether bonding to the peptide.

[0178] The peptides of the present invention are equally covalently bonded to imaging molecules in order to form a complex.

[0179] Preferably, the imaging molecule is a variety of molecules that enable visualization of the complex. Preferably, the imaging molecule can indicate the location of the complex, preferably in vitro or in vivo. Preferably, a method is provided for monitoring the location of a complex comprising an imaging molecule, the method comprising administering the target complex and image processing the target to indicate the location of the complex.

[0180] Examples of imaging molecules include detection molecules, comparison molecules, or enhancement molecules. Suitable imaging molecules are selected from radionuclides; fluorophores; nanoparticles (e.g., nanoshells); nanocargoes; chromogens (e.g., enzymes); radioisotopes, dyes, radiopaque materials, fluorescent compounds, and combinations thereof.

[0181] Preferably, imaging molecules are visualized using imaging technologies (these are cell imaging technologies or medical imaging technologies). Suitable cell imaging technologies include, for example, cell image analysis, fluorescence microscopy, phase-contrast microscopy, SEM, and TEM. Suitable medical imaging technologies include, for example, X-ray, fluorescence fluoroscopy, MRI, scintigraphy, SPECT, PET, CT, CAT, and FNRI.

[0182] In some cases, imaging molecules are considered diagnostic molecules. Preferably, the diagnostic molecule enables the diagnosis of a disease using a complex. Preferably, the diagnosis of a disease is achieved by measuring the location of the complex using the imaging molecule. Preferably, a method for diagnosing a disease is provided, comprising administering an effective amount of a complex comprising the imaging molecule to a target and monitoring the location of the complex.

[0183] Preferably, further details such as the binding of a complex comprising imaging molecules are the same as those described above for a complex comprising therapeutic molecules.

[0184] Preferably, the peptide of the present invention is covalently bonded to therapeutic molecules and imaging molecules to provide a complex.

[0185] Preferably, the complex can penetrate cells and tissues, preferably the nucleus of cells.

[0186] Pharmaceutical composition The complex of the present invention is compounded into a pharmaceutical composition.

[0187] Preferably, the pharmaceutical composition comprises the complex of the present invention.

[0188] Preferably, the pharmaceutical composition may further include pharmaceutically acceptable diluents, adjuvants, or carriers.

[0189] Suitable pharmaceutically acceptable diluents, adjuvants, and carriers are known in the art.

[0190] As used herein, the expression “pharmaceutically acceptable” means a ligand, substance, formulation, and / or dosage form that, within the bounds of reasonable medical common sense, provides a reasonable benefit-to-risk ratio without excessive toxicity, inflammation, allergic reactions, or other problems or complications.

[0191] As used herein, the expression “pharmaceutically acceptable carrier” means a pharmaceutically acceptable substance or vehicle, such as a liquid or solid filler, diluent, additive, solvent, or encapsulating material, that is involved in transporting or carrying the complex from one organ or part of the body to another organ or part of the body. Each cell-permeable peptide must be “safe” in the sense that it is compatible with the other components of the composition, such as peptides and therapeutic molecules, and must not be harmful to humans. Lyophilized compositions (to be restored and administered) are also within the scope of the compositions of this invention.

[0192] Pharmaceutically acceptable carriers include, for example, excipients, vehicles, diluents, and combinations thereof. For example, when compositions are administered orally, they are formulated as tablets, capsules, granules, powders, or syrups; for parenteral administration, they are formulated as injections, infusions, or suppositories. These compositions are prepared by common means, and, as needed, the active compound (i.e., the complex) is mixed with various common excipients, such as excipients, binders, disintegrants, lubricants, flavorings, solubilizers, suspension aids, emulsifiers, coatings, or combinations thereof.

[0193] The pharmaceutical compositions described herein should be understood to further include modifications of additional known therapeutic agents, drugs, and compounds into prodrugs, etc., to alleviate, mediate, and treat the diseases, ailments, and conditions individually described herein in pharmaceutical use. Preferably, the pharmaceutical compositions are for use as pharmaceuticals, preferably in the same manner as described herein for the complexes. All the features described herein with respect to the treatment using the complexes apply to the pharmaceutical compositions.

[0194] Accordingly, another aspect of the present invention provides a pharmaceutical composition according to a fourth aspect for use as a pharmacopoeia. Further aspects provide a method for treating a patient in a diseased state, the method comprising administering an effective amount of the pharmaceutical composition according to the fourth aspect to the patient.

[0195] medical use A complex comprising the peptide of the present invention can be used as a drug for the treatment of diseases.

[0196] A drug is in the form of a pharmaceutical composition, as defined above.

[0197] A method for treating a patient or subject requiring treatment of a diseased condition is also provided, the method comprising the step of administering a therapeutically effective amount of the complex to the patient or subject.

[0198] Preferably, medical treatment requires the delivery of therapeutic molecules to cells, preferably to the nucleus of the cells.

[0199] Diseases to be treated include various diseases in which therapeutic molecules lead to improved therapeutic effects through improved passage of molecules through cells and / or nuclear membranes.

[0200] Preferably, the complex is intended for use in the treatment of neuromuscular disorders.

[0201] A complex comprising the peptide of the present invention is suitable for the treatment of hereditary neuromuscular disorders. A complex comprising the peptide of the present invention is suitable for the treatment of hereditary neuromuscular disorders. In a preferred example, a second embodiment of the complex for use in the treatment of hereditary neuromuscular disorders is provided. Preferably, the complex is used for the treatment of hereditary disorders. Preferably, the complex is used for the treatment of hereditary neuromuscular disorders. Preferably, the complex is used for the treatment of hereditary X-linked neuromuscular disorders. Preferably, the complex is used for the treatment of hereditary X-linked neuromuscular disorders.

[0202] Preferably, the complex is used to treat diseases caused by splicing defects. In such specific examples, the therapeutic molecule may comprise oligonucleotides that can prevent or correct splicing defects and / or increase correctly spliced ​​mRNA molecules.

[0203] Preferably, the complex is for use in the treatment of any of the following diseases: Duchenne muscular dystrophy (DMD), Bucher muscular dystrophy (BMD), Menkes disease, β-thalassemia, dementia, Parkinson's disease, spinal muscular atrophy (SMA), myotonic dystrophy (DM), Huntington's disease, Hutchinson-Gilford progeria syndrome, ataxia vasodilator, or cancer.

[0204] In one specific example, the complex is intended for use in the treatment of DMD.

[0205] In one specific example, a second embodiment of the complex for use in the treatment of DMD is provided.

[0206] Preferably, in such specific examples, the therapeutic molecule of the complex can act to increase the expression of dystrophin protein. Preferably, in such specific examples, the therapeutic molecule of the complex can act to increase the expression of functional dystrophin protein.

[0207] Preferably, the complex increases dystrophin expression by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%. Preferably, the complex increases dystrophin expression up to 50%.

[0208] Preferably, the complex restores dystrophin expression to 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%. Preferably, the complex restores dystrophin expression to 50%.

[0209] Preferably, the complex restores the function of the dystrophin protein by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%. Preferably, the complex increases the function of the dystrophin protein by up to 50%.

[0210] Preferably, the therapeutic molecule of the complex can act to do so by causing splicing of one or more exons during the transcription of dystrophin.

[0211] Preferably, the complex causes splicing of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, and 85% of one or more exons of the dystrophin gene. Preferably, the complex causes splicing of up to 50% of one or more exons of the dystrophin gene.

[0212] Preferably, the patient or subject receiving treatment is various animals or humans. Preferably, the patient or subject receiving treatment is a non-human mammal. The patient or subject receiving treatment is male or female. In this specific example, the subject is male.

[0213] Preferably, the patients or subjects receiving treatment are of various ages. Preferably, the patients or subjects receiving treatment are 0-40 years old, preferably 0-30 years old, preferably 0-25 years old, and preferably 0-20 years old.

[0214] Preferably, the complex is to be administered systemically to the subject by, for example, an intramedullary route, intracavitary route, intraventricular route, enteral route, parenteral route, intravenous route, intraarterial route, intramuscular route, intratumoral route, subcutaneous route, oral route, or nasal route.

[0215] In one specific example, the complex is intended to be administered intravenously to the subject. In another specific example, the complex is intended to be administered intravenously to the subject by injection.

[0216] Preferably, the complex is intended to be administered to the subject in a "therapeutically effective dose," meaning a dose sufficient to provide a benefit to the individual. The actual dose administered, as well as the rate and time course of administration, will depend on the nature and severity of the disease being treated. Dosage determination is the responsibility of the general practitioner or physician. Examples of techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th edition, 2000, published by Lippincott, Williams & Wilkins.

[0217] Examples of dosages are 0.01-50 mg / kg, 0.05-40 mg / kg, 0.1-30 mg / kg, 0.5-18 mg / kg, 1-16 mg / kg, 2-15 mg / kg, 5-10 mg / kg, 10-20 mg / kg, 12-18 mg / kg, and 13-17 mg / kg.

[0218] Advantageously, the dose of the complex of the present invention is about the same as or lower than the dose required to observe any effect from the therapeutic molecule alone, and lower than that of currently available cell-permeable peptides.

[0219] nucleic acids and hosts The peptides of the present invention are produced by various standard protein synthesis methods, such as chemical synthesis, semi-chemical synthesis, and the use of expression systems.

[0220] Accordingly, the present invention also relates to a nucleotide sequence comprising or consisting of DNA encoding a peptide, an expression system, for example, a vector comprising the sequence having sequences necessary for expression and control of expression, and a host cell and a host organism transformed by the expression system.

[0221] Therefore, nucleic acids encoding peptides according to the present invention are also provided.

[0222] Preferably, nucleic acids are provided in an isolated or purified form.

[0223] An expression vector comprising nucleic acid encoding the peptide according to the present invention is also provided.

[0224] Preferably, the vector is a plasmid.

[0225] Preferably, the vector includes a regulatory sequence, such as a promoter, that is capable of binding to the nucleic acid encoding the peptide according to the present invention. Preferably, the expression vector can express the peptide when introduced into suitable cells, such as mammalian, bacterial, or fungal cells.

[0226] Host cells comprising the expression vector of the present invention are also provided.

[0227] The expression vector is selected depending on the host cell into which the nucleic acid of the present invention is inserted. Such transformation of host cells includes common techniques, such as those taught by Sambrook et al. (Sambrook, J., Russell, D. (2001), Molecular Cloning: A Practical Manual, Cold Spring Harbor Laboratory Press, NY, USA). The selection of a suitable vector is within the scope of the skills of those skilled in the art. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.

[0228] The generated peptides are isolated and purified from the host by various suitable methods, such as precipitation or chromatographic separation, for example, affinity chromatography.

[0229] Suitable vectors, hosts, and genetic engineering techniques are well known in this field.

[0230] In this specification, the term “operatably bound” includes a situation in which a selected nucleotide sequence and a control nucleotide sequence are covalently bound so that the expression of a nucleic acid encoding sequence can be performed under the control of the control sequence, and the control sequence can thus produce transcription of a nucleotide encoding sequence that forms part or all of the selected nucleotide sequence. If necessary, the achieved transcription is then translated into the desired protein.

[0231] Next, specific examples of the present invention will be described with reference to the accompanying drawings and tables.

[0232] Throughout the detailed description and claims of this specification, the terms “contains” and “includes” and their variations mean “contains, but not limited to,” and they are not intended to exclude (or do not exclude) other moieties, additives, ingredients, integers, or processes. Throughout the detailed description and claims of this specification, the singular includes the plural unless the content otherwise requires. In particular, where the indefinite article is used, the specification should be understood to consider the plural together with the singular unless the content otherwise requires.

[0233] Features, integers, properties, compounds, chemical moieties, or groups described in conjunction with special aspects, specific examples, or embodiments of the invention should be understood to be applicable to other aspects, specific examples, or embodiments described herein, unless otherwise incompatible. All features and / or steps of the various methods described herein (including the claims, abstract, and drawings) can be combined in any combination, except in any combination in which at least some of such features and / or steps are mutually exclusive.

[0234] The present invention is not limited to the details of any of the various prior examples. The present invention extends to any novel one or any novel combination of any of the features disclosed in this specification (including the claims, abstract, and drawings), or any novel one or any novel combination of any of the steps of any of the disclosed methods. The reader's attention is directed to all papers and documents filed concurrently with or prior to this specification and published together with this specification for public inspection, the contents of all such papers and documents are incorporated herein by reference.

[0235] [Examples] 1. Materials and Methods 1.1 Synthesis and Preparation of P-PMO 9-Fluorenylmethoxycarbonyl (Fmoc) protected L-amino acids, benzotriazole-1-yloxytris-pyrrolidinophosphonium (PyBOP), 2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Fmoc-β-Ala-OH-filled Wang resin (0.19 or 0.46 mMol / g) were obtained from Merck (Hohenbrunn, Germany). HPLC-grade acetonitrile, methanol, and synthetic grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Haysham, England). PMO was purchased from Gene Tools Inc. (Philomas, USA). Chicken embryo extract and horse serum were obtained from Sera Laboratories International Ltd (West Sussex, UK). Interferon was obtained from Roche Applied Science (Pentzberg, Germany). All reagents were obtained from Sigma-Aldrich (St. Louis, Missouri, USA) unless otherwise specified. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. A stock solution of 10 mg / ml α-cyano-4-hydroxycinnamic acid or sinapic acid in 50% aqueous acetonitrile was used as the matrix. Error bars: Standard deviation is ±0.1%.

[0236] 1.2 Synthesis of P-PMO peptides for screening in H2k mdx cells a) Preparation of a library of peptide variants Peptides were prepared using an Intavis Parallel peptide synthesizer on a 10 μmol scale, or using a CEM Liberty Blue (trademark) peptide synthesizer (Buckingham, UK) on a 100 μmol scale, by applying standard Fmoc chemistry and following the manufacturer's recommendations, using Fmoc-β-Ala-OH-filled Wang resin (0.19 or 0.46 mMol / g, Merck Millipore). In the case of using the Intavis Parallel peptide synthesizer, a double coupling step was used with a PyBOP / NMM coupling mixture, followed by acetic anhydride coupling after each step. For synthesis using the CEM Liberty Blue peptide synthesizer, single reference coupling was performed for all amino acids except arginine, followed by double coupling. Coupling was performed once at 75°C for 5 minutes with 60 W microwave power, except for the arginine residue, and then twice for each residue. Each deprotection reaction was carried out twice at 75°C with a microwave power of 35W, the first time for 30 seconds, and the second time for 3 minutes. Upon completion of the synthesis, the resin was washed with DMF (3 × 50 ml), and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminus acetylation, the peptide resin was washed with DMF (3 × 20 ml) and DCM (3 × 20 ml). The peptide was split from the solid support by treatment with a splitting cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%; 3-10 ml) at room temperature for 3 hours. After the release of the peptide, excess TFA was removed by sparging with nitrogen. The crude peptide was precipitated by adding cold diethyl ether (15-40 ml depending on the scale of the synthesis) and centrifuged at 3200 rpm for 5 minutes. The crude peptide pellet was washed three times with cold diethyl ether (3 × 15 ml) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC scale-up module and a 440-LC fraction collector.The peptide was purified by semi-preparative HPLC on an RP-C18 column (10 × 250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O at a flow rate of 15 ml / min. Detection was performed at 220 nm and 260 nm. The fractions containing the desired peptide were combined and lyophilized to obtain the peptide as a white solid (see Table 2 for yields).

[0237] Table 1. Peptides synthesized in each example, having an N-terminal acetylation and a C-terminal β-alanine linker (where X is 6-aminohexanoic acid). [Table 1]

[0238] Table 2 Yield of peptides synthesized for the complex [Table 2]

[0239] b) Synthesis of PMO-peptide complex libraries The 25-mer PMO antisense sequence for mouse dystotrophin exon-23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 30)) was used. The peptide was ligated to the 3'-terminus of the PMO via its C-terminal carboxyl group. This was performed in NMP in the presence of 2.5 equivalents of DIPEA, using 2.5 and 2 equivalents of PyBOP and HOAt, respectively, with a 2.5-fold excess of peptide compared to the PMO dissolved in DMSO. In some examples, 2 equivalents of HBTU were used instead of PyBOP to activate the C-terminal carboxyl group of the peptide. Generally, a peptide (2500 nmol) solution in N-methylpyrrolidone (NMP, 80 μl) was prepared by adding PyBOP (19.2 μl of 0.3 M NMP solution), HOAt (16.7 μl of 0.3 M NMP solution), DIPEA (1.0 μl), and PMO (100 μl of 10 mM DMSO solution). The mixture was left at 40°C for 2.5 hours, and the reaction was quenched by adding 0.1% TFA aqueous solution (300 μl). This solution was purified by ion exchange chromatography using a reverse Gilson HPLC system. The PMO-peptide complex was purified on an ion exchange column (Resource S 4 ml, GE Healthcare) using a linear gradient of sodium sulfate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. The complex was eluted from the column using sodium chloride solution (1 M) at a flow rate of 4 l / min. Fractions containing the desired compound were combined and lyophilized to obtain the peptide-PMO derivative as a white solid. Excess salt was removed from the peptide-PMO complex by filtration of the collected fraction after ion exchange using an Amicon® ultra-15 3K stretched filter. The complex was lyophilized and analyzed by MALDI-TOF. The complex was dissolved in sterilized water and filtered through a 0.22 μm cellulose acetate membrane before use. The concentration of peptide-PMO was measured by molar extinction at 265 nm in a 0.1 N HCl solution (see Table 3 for yield).

[0240] Table 3. Yield of P-PMO complex for cell culture (Yield is based on the dry mass of lyophilized and purified P-PMO. The purity of P-PMO is confirmed by normal-phase HPLC at 220 nm and 260 nm to be greater than 95%). [Table 3]

[0241] 1.3 Cell culture Mouse H2k myoblasts were cultured in gelatin (0.01%) coated flasks at 33°C under 10% CO2 in Dulbecco's Eagle modified medium (DMEM; PAA laboratories) supplemented with 20% heat-inactivated fetal bovine serum (FBS Gold; PAA laboratories), 2% chicken embryo extract (Seralab), 1% penicillin-streptomycin-neomycin antibiotic mixture (PSN; Gibco), and 3 pg / μl γ-interferon (Roche). The cells were then transferred to gelatin (0.01%) coated 24-well plates at a density of 2 × 10⁶ 5 Cells were dispersed at a concentration of 10% CO2 at 33°C for 2 days. To induce differentiation into myotubes, the cells were further grown in DMEM supplemented with 5% horse serum (Sigma) and 1% PSN at 37°C for 2 days under 5% CO2.

[0242] 1.4 Gene transfer in cells Cells were incubated with the peptide-PMO prepared as described above in serum-free Opti-MEM, with 350 μl added to each well as a primary and secondary sample, and incubated at 37°C for 4 hours. The gene transduction medium was then replaced with DMEM supplemented with 5% horse serum and 1% PSN, and the cells were incubated at 37°C for a further 20 hours. The cells were washed with PBS, and 0.5 ml of TRI RNA (Sigma) isolate was added to each well. The cells were frozen at -80°C for 1 hour. 1.5 RNA collection and nested RT-PCR analysis Total intracellular RNA was extracted using TRI reagent, along with additional precipitation with ethanol. Purified RNA was quantified using Nanodrop® ND-1000 (Thermo Scientific). RNA (400 ng) was used as a template for RT-PCR using the OneStep RT-PCR Kit (Roche, Indianapolis, USA). See Table 5 for primer sequences. The cycle conditions for initial reverse transcription were 30 cycles per cycle: 30 minutes at 50°C and 7 minutes at 94°C, followed by 20 seconds at 94°C, 40 seconds at 55°C, and 80 seconds at 68°C. 1 μl of the RT-PCR product was used as a template for the second PCR step. Amplification was performed using SuperTAQ 0.5U for 25 cycles at 30 seconds at 94°C, 1 minute at 55°C, and 1 minute at 72°C. The product was separated by electrophoresis using a 1.5% agarose gel. Images of agarose gel taken with Molecular Imager ChemiDoc (trademark) XRS + Images were obtained using an imaging system (BioRad, UK) and analyzed using Image Lab (V4.1). Microsoft Excel was used to analyze and blot the exon skipping assay data, expressing the percentage of exon-23 skipping from the last three independent experiments.

[0243] 1.6 Synthesis of test PMO-peptide complexes in H2k mdx mice a) Synthesis of peptide variants Peptides were synthesized on a 100 μmol scale using a CEM Liberty Blue (trademark) microwave peptide synthesizer (Buckingham, UK) and Fmoc chemistry, following the manufacturer's recommendations. The side-chain protecting group used was unstable to trifluoroacetic acid treatment, so the peptides were synthesized using a 5-fold excess of Fmoc-protected amino acids (0.25 mM) activated with PyBOP (5-fold excess) in the presence of DIPEA. Piperidine (20% (v / v) DMF solution) was used to remove the N-Fmoc protecting group. After removing the arginine residue, coupling was performed once at 78°C for 5 minutes at 60 W microwave power, and then twice for each remaining residue. Each deprotection reaction was performed twice at 75°C at 35 W microwave power, one time for 30 seconds and the other time for 3 minutes. Upon completion of synthesis, the resin was washed with DMF (3 × 50 ml), and the N-terminus of the solid-phase-bound peptide was acetylated with acetic anhydride at room temperature in the presence of DIPEA. After N-terminus acetylation, the peptide resin was washed with DMF (3 × 20 ml) and DCM (3 × 20 ml). The peptide was split from the solid support by treatment with a splitting cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%; 10 ml) at room temperature for 3 hours. Excess TFA was removed by sparging with nitrogen. The split peptide was precipitated by adding ice-cold diethyl ether and centrifuged at 3000 rpm for 5 minutes. Crude peptide pellets were washed three times with cold diethyl ether (3 × 40 ml) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC scale-up module and a 440-LC fraction collector. The peptides were further purified by semi-preparative HPLC on an RP-C18 column (10 × 250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O at a flow rate of 15 ml / min. Detection was performed at 220 nm and 260 nm (see Table 4 for yields).

[0244] Table 4: Yield of peptides synthesized on a larger scale for complexation [Table 4]

[0245] b) Synthesis of PMO-peptide complexes The 25-mer PMO antisense sequence for mouse dystotrophin exon-23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 30)) was used. The peptide was ligated to the 3'-terminus of the PMO via its C-terminal carboxyl group. This was performed in NMP in the presence of 2.5 equivalents of DIPEA, using 2.5 and 2 equivalents of PyBOP and HOAt, respectively, with a 2.5-fold excess of peptide compared to the PMO dissolved in DMSO. In some examples, HBTU (2 equivalents) was used instead of PyBOP to activate the C-terminal carboxyl group of the peptide. Generally, a peptide (10 μmol) solution in N-methylpyrrolidone (NMP, 100 μl) was mixed with HBTU (76.6 μl of 0.3 M NMP solution), HOAt (66.7 μl of 0.3 M NMP solution), DIPEA (4.0 μl), and PMO (400 μl of 10 mM DMSO solution). The mixture was left at 40°C for 2 hours, and the reaction was quenched by adding 0.1% TFA aqueous solution (1 ml). The reaction mixture was purified using a cation exchange chromatography column (Resource S 6 ml column, GE Healthcare) with 25 mM sodium sulfate buffer (pH 7.0) containing 25% acetonitrile. The complex was eluted from the column with sodium chloride solution (1 M) at a flow rate of 6 ml / min. Excess salt was removed from the peptide-PMO complex using an Amicon® ultra-15 3K centrifuge filter by filtration of the fraction collected after ion exchange. The complex was freeze-dried and analyzed by MALDI-TOF. Before use, the complex was dissolved in sterilized water and filtered through a 0.22 μm cellulose acetate membrane. The peptide-PMO concentration was measured by molar extinction of the complex at 265 nm in a 0.1 N HCl solution. The overall yield was 29–46% based on PMO (Table 5).

[0246] Table 5. Yield of P-PMO complex synthesized on a large scale for in vivo analysis (Yields are based on the dry mass of lyophilized and purified P-PMO. The purity of P-PMO is greater than 95%, as confirmed by normal-phase HPLC at 220 nm and 260 nm.) [Table 5]

[0247] 1.7 In vivo assay of dystrophin repair by P-PMO The experiment was conducted at the Oxford University Biochemistry Unit under a Home Office Project License, following facility reviews. Mice were housed in a minimal disease facility. Environmentally, temperature was controlled, and a 12-hour light-dark cycle was maintained. All animals were given free access to commercially available rodent feed and water. The experiment was conducted in female mdx mice aged 10-12 weeks. The mdx mice were restrained before a single tail vein injection of P-PMO 10 mg / kg. One week after the injection, the animals were sacrificed, and the TA, heart, and diaphragm muscle were removed, flash-frozen in dry ice-cooled isopentane, and stored at -80°C.

[0248] 1.8 Western blot analysis To assess the duration of dystrophin repair after single administration, 1 / 3 of muscle (for TA and diaphragm) or 90 transverse frozen sections 7 μm thick (for heart) were dissolved in 300 μl of buffer (50 mM Tris (pH 8), 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 10% SDS, and protease / phosphatase inhibitors), followed by centrifugation at 13000 rpm (Heraeus, #3325B) for 10 minutes. The supernatant was collected and heated at 100°C for 3 minutes. Protein was quantified by BCA, and 40 μg of protein / sample was degraded in NuPAGE 3-8% Tris-Acetate gel as previously described (19). The proteins were transferred to a PVDF membrane with a pore size of 0.45 μm at 30 V for 1 hour, followed by 100 V for 1 hour, and then detected with monoclonal anti-dystrophin antibody (1:200, NCL-DYS1, Novocastra) and anti-vinculin antibody (loading control, 1:100000, hVIN-1, Sigma) as previously described (37). A second antibody (IRDye 800CW sheep anti-mouse) was used at a dilution of 1:20000 (LiCOR). The level of dystrophin repair in P-PMO-treated mdx mice was expressed as a relative percentage to C57BL / 10 wild-type control mice (assumed to be 100%). Therefore, standard curves were created, including five consecutive C57BL / 10 protein dilutions, in parallel with the P-PMO-treated mice. The dilution series were as follows: 75%, 40%, 15%, 5%, or 0% of the 40 μg total protein loaded in each lane came from C57BL / 10 protein lysates, and the remainder came from untreated mdx protein lysates. These references were quantified and used in Western blotting in parallel with the treated mdx samples. Dystrophin intensity was quantified for all standards and treated samples using the Fluorescence Odyssey imaging system and normalized for all samples by calculating the percentage of vinculin fluorescence intensity. The standard normalized values ​​were blotted against known dystrophin concentrations to obtain the best-fitting formula, which was then used to interpolate the normalized values ​​for each sample of P-PMO-treated mdx mice.

[0249] 1.9 RT-qPCR Analysis of In Vivo DMD Exon 23 Skipping The exclusion of exon 23 from mouse DMD transcription was quantified in skeletal muscle and cardiomyocyte tissue treated with peptide-PMO. Briefly, RNA was extracted from homogenized tissue using a Trizol extraction method, and cDNA was synthesized using random primers. Primers / probes were synthesized by Integrated DNA Technologies and designed to specifically amplify the transcription-deficient exon 23 using either a probe extending to exons 23-24 representing the unskipped product (mDMD23-24, see Table 6), or a probe extending to the boundary between exons 22 and 24 (mDMD22-24). The level of each transcription was measured by calibration to a standard curve prepared using known transcription levels, and the skipping rate was obtained as [skipped] / [skipped + unskipped].

[0250] Table 6: Primer and probe sequences for the quantification of exon 23 skipping by nested RT-PCR or quantitative RT-PCR. [Table 6]

[0251] 2.Results The results presented here demonstrate a clear dose-response effect on the intracellular exon skipping activity of the peptide-PMO complex prepared here (Figure 1). This also highlights that all peptides in the DPEP2 series, i.e., all peptides of the present invention, possess sufficient cell penetration ability and are considered suitable for therapeutic use. The results presented here further highlight the in vivo activity of the peptide-PMO complexes of the present invention in mouse models of the relevant diseases (Figure 2). Overall, the results suggest that the activity of the peptide complexes of the present invention is maximal in the tibialis anterior muscle, followed by the diaphragm and cardiac muscle. These results demonstrate that the DPEPs of the present invention have good in vivo exon skipping activity and provide increased in vivo expression of dystrophin. Furthermore, when used in the same complex, the DPEPs of the present invention are comparable to conventional cell-permeable peptides, such as "PIP" peptides and R6Gly, at least in skeletal muscle. It is noteworthy that all of the peptide complexes of the present invention exhibit higher activity than known R6Gly comparators when used in the same complex. Therefore, the DPEP2 peptide of the present invention provides a promising cell-permeable peptide for improving the efficacy of therapeutic complexes for the treatment of human neuromuscular diseases.

Claims

1. A peptide having a total length of 40 or fewer amino acid residues, comprising one or more cationic domains; and two or more hydrophobic domains, each containing at least three amino acid residues, wherein one of the hydrophobic domains is located at the C-terminus of the peptide and the other hydrophobic domain is located at the N-terminus of the peptide.

2. The peptide according to claim 1, wherein one of the hydrophobic domains forms the C-terminus of the peptide, and the other hydrophobic domain forms the N-terminus of the peptide.

3. The peptide according to claim 1 or 2, wherein each hydrophobic domain has a length of 3 to 6 amino acids, and preferably each hydrophobic domain has a length of 5 amino acids.

4. The peptide according to any one of claims 1 to 3, wherein each hydrophobic domain comprises a number of hydrophobic amino acid residues, and preferably each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or 100% hydrophobic amino acids.

5. Each hydrophobic domain comprises residues of phenylalanine, leucine, isoleucine, tyrosine, and glutamine, and preferably each hydrophobic domain comprises residues of phenylalanine, leucine, isoleucine, tyrosine, and / or glutamine, as described in any one of claims 1 to 4.

6. The peptide according to any one of claims 1 to 5, comprising two hydrophobic domains.

7. The peptide according to any one of claims 1 to 6, wherein the hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO: 13), FQILY (SEQ ID NO: 14), ILFQY (SEQ ID NO: 15), or various combinations thereof, and preferably the hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO: 13), FQILY (SEQ ID NO: 14), ILFQY (SEQ ID NO: 15), or various combinations thereof.

8. The peptide according to any one of claims 1 to 7, wherein the cationic domain or each cationic domain has a length of 5 to 20 amino acid residues, preferably 9 to 14 amino acid residues.

9. The peptide according to any one of claims 1 to 8, wherein each cationic domain comprises at least 40%, at least 45%, or at least 50% cationic amino acids.

10. The peptide according to any one of claims 1 to 9, wherein the cationic domain or each cationic domain comprises a number of cationic amino acids, and preferably the cationic domain or each cationic domain comprises at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of cationic amino acids.

11. The peptide according to any one of claims 1 to 10, wherein the cationic domain or each cationic domain comprises residues of arginine, β-alanine, and / or aminohexanoic acid, and preferably, the cationic domain or each cationic domain comprises residues of arginine, β-alanine, and / or aminohexanoic acid.

12. The peptide according to any one of claims 1 to 11, wherein the cationic domain or each cationic domain is arginine-rich, and preferably the cationic domain or each cationic domain contains at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, or at least 70% of arginine residues.

13. The peptide according to any one of claims 1 to 12, comprising one cationic domain.

14. The cationic domain or each cationic domain comprises the following sequence RBRXRBRXB (SEQ ID NO: 1), RBRXRBRXBRXRB (SEQ ID NO: 2), RBRXRBRXBR (SEQ ID NO: 3), RBRRXRBRXBRXRB (SEQ ID NO: 4), RBRXRBRBRXRB (SEQ ID NO: 5), RBRXRBRBRBRB (SEQ ID NO: 6), RBRBRBRBRBRB (SEQ ID NO: 7), RBRXRBRBRXR (SEQ ID NO: 8), RRRBRBRBRRB (SEQ ID NO: 9), RRRBRBRBRXBRXRB (SEQ ID NO: 10), RRRBRBRBBRXRB (SEQ ID NO: 11), RRRBRBRBBRBRB (SEQ ID NO: 12), or one of various combinations thereof, preferably a cationic domain The main or each cationic domain is one of the following sequences: RBRXRBRXB (SEQ ID NO: 1), RBRXRBRXBRXRB (SEQ ID NO: 2), RBRXRBRXBR (SEQ ID NO: 3), RBRRXRBRXBRXRB (SEQ ID NO: 4), RBRXRBRBRXRB (SEQ ID NO: 5), RBRXRBRBRBRB (SEQ ID NO: 6), RBRBRBRBRBRB (SEQ ID NO: 7), RBRXRBRBRXR (SEQ ID NO: 8), RRRBRBRBRRB (SEQ ID NO: 9), RRRBRBRBRXBRXRB (SEQ ID NO: 10), RRRBRBRBBRXRB (SEQ ID NO: 11), RRRBRBRBBRBRB (SEQ ID NO: 12), or any combination thereof, according to any one of claims 1 to 13.

15. The peptide according to any one of claims 1 to 14, comprising a hydrophobic arm domain adjacent to a core domain, and preferably comprising one cationic domain.

16. The peptide according to any one of claims 1 to 15, comprising one cationic domain and two hydrophobic domains, preferably having two hydrophobic arm domains adjacent to one cationic core domain.

17. The peptide according to any one of claims 1 to 16, comprising two hydrophobic arm domains, each containing a sequence selected from YQFLI (SEQ ID NO: 13), FQILY (SEQ ID NO: 14), and ILFQY (SEQ ID NO: 15), and one cationic core domain containing a sequence selected from RBRXRBRXB (SEQ ID NO: 1), RBRXRBRXBRXRB (SEQ ID NO: 2), RBRXRBRXBR (SEQ ID NO: 3), RBRRXRBRXBRXRB (SEQ ID NO: 4), RBRXRBRBRXRB (SEQ ID NO: 5), RBRXRBRBRBRB (SEQ ID NO: 6), RBRBRBRBRBRB (SEQ ID NO: 7), RBRXRBRBRXR (SEQ ID NO: 8), RBRRBRBRBRRB (SEQ ID NO: 9), RRRBRBRBRXBRXRB (SEQ ID NO: 10), RBRRBRBRBBRXRB (SEQ ID NO: 11), and RBRRBRBRBBRBRB (SEQ ID NO: 12), adjacent to two hydrophobic arm domains, each containing a sequence selected from YQFLI (SEQ ID NO: 13), FQILY (SEQ ID NO: 14), and ILFQY (SEQ ID NO: 15), respectively.

18. The peptide according to any one of claims 1 to 17, comprising one of the following sequences: YQFLIRBRRXRBRXBRXRBYQFLI (SEQ ID NO: 19), YQFLIRBRRBRBRBRRBYQFLI (SEQ ID NO: 24), and YQFLIRBRRBRBRBBRXRBYQFLI (SEQ ID NO: 26).

19. A complex comprising a peptide according to any one of claims 1 to 18, covalently bonded to a therapeutic molecule.

20. Furthermore, the complex according to claim 19, comprising a linker, preferably the linker, which binds the complex to a therapeutic molecule.

21. The composite according to claim 19 or 20, wherein the linker is selected from G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, and XB.

22. The complex according to any one of claims 19 to 21, wherein the therapeutic molecule is selected from nucleic acids, peptide nucleic acids, antisense oligonucleotides (e.g., PNA, PMO), short interfering RNA, microRNA, peptides, cyclic peptides, proteins, drugs, and preferably the therapeutic molecule is an antisense oligonucleotide.

23. A complex according to any one of claims 19 to 22 for use as a pharmaceutical agent.

24. A complex for use according to claim 23 in the treatment of neuromuscular or musculoskeletal disorders, preferably genetic disorders of the neuromuscular or musculoskeletal system, preferably hereditary genetic disorders of the neuromuscular or musculoskeletal system, preferably hereditary X-linked genetic disorders of the neuromuscular or musculoskeletal system.

25. A complex for use according to claim 23 or 24 in the treatment of DMD.