Antibodies against misfolded superoxide dismutase-1 (SOD1) and ubiquitin ligase fusion proteins

Abstract

Antibodies or binding fragments thereof, fusion proteins, or pharmaceutical compositions directed against misfolded SOD1 epitopes, or nucleic acids, fusion proteins, or pharmaceutical compositions encoding the antibodies or binding fragments thereof, are described. Also provided are methods for using and producing such antibodies or binding fragments thereof, fusion proteins, nucleic acids, or pharmaceutical compositions, and methods of using them to treat disorders in human subjects in need thereof.

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This disclosure claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 446,485, filed February 17, 2023, which is incorporated herein by reference in its entirety.

[0002] (Incorporating sequence listing) The computer-readable form of the sequence listing "P58515PC01_ST26" (272,118 bytes) was created on February 19, 2024, and is incorporated herein by reference.

[0003] FIELD OF THE INVENTION The present disclosure relates to antibodies against misfolded superoxide dismutase-1 (SOD1) and ubiquitin ligase fusion proteins thereof for treating conditions, diseases, and disorders mediated by misfolded SOD1, including amyotrophic lateral sclerosis, Alzheimer's disease, and Parkinson's disease. [Background technology]

[0004] Proteins can fold into complex, tightly packed structures. Folding is not only important for biological activity, but proteins that do not fold properly or cannot remain folded can cause disease (reviewed in 48). Misfolding can, in some cases, lead to protein aggregation, which can then result in discrete deposits extracellularly (e.g., plaques) or intracellularly (e.g., inclusion bodies in the cytosol or nucleus).

[0005] Neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease / Lewy body dementia (PD / LBD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), and prion diseases are characterized by neuronal deposition of misfolded, aggregated proteins (reviewed in 49). These diseases pose significant challenges to our aging population and healthcare system.

[0006] Sporadic AD, ALS, and PD / LBD are all associated with the neuronal accumulation of pathological multimers of misfolded polypeptides, potentially fibrils, protofilaments, and amorphous aggregates, including the amyloid-beta (Abeta) fragment of amyloid precursor protein (APP) in AD, superoxide dismutase-1 (SOD1) in ALS, AD, and PD, and alpha-synuclein in PD and LBD. Additionally, familial amyloidotic polyneuropathy (FAP) results from the aggregation of transthyretin to form amyloid deposits. Similar to prion diseases, mutations in the genes encoding these polypeptides are associated with autosomal dominant familial forms of ALS, AD, and PD.

[0007] Oxidative stress is involved in ALS, PD, and AD. Reactive oxygen species and reactive nitrogen species (ROS and RNS, respectively) generated in these environments may contribute to cellular injury, including abnormal oxidation of proteins or lipids. The accumulation of cytoskeletal debris and selective neuronal cell death that occurs in these diseases may also be due to oxidative stress and accumulated insoluble proteins. SOD1 is known to play an antioxidant role, and alterations in its activity may contribute to neurodegenerative disease states. SOD1 is a major target of oxidative damage in the brains of AD and PD. Total SOD1 levels are increased in both AD and PD, and SOD1 forms proteinaceous aggregates associated with amyloid senile plaques and neurofibrillary tangles in AD brains. It has been suggested that AD, PD, and ALS may share common pathogenic mechanisms (Choi et al., 2005).

[0008] ALS is a fatal neuromuscular disease characterized by selective loss of motor neurons, leading to muscle atrophy. It is the most common motor neuron disease in adults and the third most common neurodegenerative disease after Alzheimer's disease and Parkinson's disease. The number of people who develop ALS annually worldwide is estimated at 1.9 per 100,000 people per year, while the number of people with ALS at any given time is estimated at approximately 4.5 per 100,000 people. ALS often begins with muscle spasms and weakness in the limbs or slurred speech; eventually, the disease affects muscle control needed for movement, speaking, eating, and breathing. The average survival time from onset to death is 2 to 4 years, with approximately 10% surviving longer than 10 years. Death is usually due to respiratory failure.

[0009] Familial (hereditary) ALS typically accounts for 10% of all ALS cases, although estimates range from 5% to 20%. Approximately 20% of familial ALS cases are associated with mutations in the gene encoding superoxide dismutase 1 (SOD1), an intracellular free radical defense enzyme (see Table 1 and Mathis, S., et al. (2019), incorporated herein by reference). Intracellular aggregation of misfolded SOD1, which inhibits protein degradation, has been observed in familial ALS and in more common non-familial (sporadic) ALS, suggesting that SOD1 aggregation may underlie all forms of ALS.

[0010] Misfolded SOD1 is exported from cells by both secretory and constitutive mechanisms. Extracellular misfolded SOD1 is highly toxic to motor neurons through activation of killing pathways by local immune cells and may also be involved in cell-to-cell spread of disease throughout the nervous system through a prion-like template misfolding process. The implication that extracellular misfolded SOD1 plays a role in the pathogenesis of ALS provides an opportunity for antibody therapy of neurodegenerative diseases, as this compartment is accessible for antibody neutralization. Nevertheless, treatment of human subjects with antibodies targeting available extracellular epitopes on ubiquitous proteins can result in adverse autoimmune effects, such as those seen with Abeta in Alzheimer's disease. There remains a need in the art for compositions and methods for the treatment of misfolded SOD1-associated diseases, such as ALS, AD, and PD. Summary of the Invention

[0011] Disclosed herein are isolated antibodies or binding fragments thereof, fusion proteins, or nucleic acids that target misfolded SOD1, as well as pharmaceutical compositions comprising same, and methods for making and using same.

[0012] Thus, in one aspect, there is provided herein an isolated antibody or binding fragment thereof that binds to a misfolded superoxide dismutase 1 (SOD1) epitope having the amino acid sequence set forth in SEQ ID NO: 144, wherein the antibody or binding fragment thereof is (i) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; (ii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12; (iii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; (iv) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13; (v) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13; (vi) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58; (vii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28; or (viii) An isolated antibody or binding fragment thereof is provided, comprising: a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31; and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

[0013] In some embodiments, the antibody or binding fragment thereof comprises: (i) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 65, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; or (ii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 68, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; or (iii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; or (iv) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; or (v) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 78, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; or (vi) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; or (vii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86; or (viii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 91.

[0014] In some embodiments, the percentage of identity is outside the CDRs described herein and the antibody or antigen-binding fragment thereof maintains specificity in binding to mutant SOD1.

[0015] In some embodiments, the binding fragment is a Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimer, minibody, diabody, or bispecific antibody binding fragment. In some embodiments, the binding fragment is an scFv. In some embodiments, the antibody or binding fragment thereof comprises one or more amino acids selected from the group consisting of D-amino acids, modified amino acids, amino acid analogs, or combinations thereof. In some embodiments, the modified amino acids comprise a modification selected from the group consisting of methylation, amidation, acetylation, and / or substitution with other chemical groups. In some embodiments, the antibody or binding fragment thereof is modified by pegylation, acetylation, glycosylation, biotinylation, or prenylation.

[0016] In another aspect, a fusion protein is provided comprising an antibody or binding fragment thereof described herein and an E3 ligase or an active fragment thereof, in some embodiments, the E3 ligase is CHIP, UBE4A, NEDD4L, UBR5, RNF4, UBOX5, BTrCP, or Parkin, or an active fragment thereof.

[0017] Also provided in a further aspect is a nucleic acid encoding an antibody or binding fragment thereof described herein, or a fusion protein described herein.

[0018] In another aspect, a vector comprising the nucleic acid described herein is also provided.

[0019] In another aspect, there is also provided a composition, optionally a pharmaceutical composition, comprising an antibody or binding fragment thereof described herein, a fusion protein described herein, a nucleic acid described herein, or a vector described herein, and optionally at least one carrier, such as a pharmaceutical carrier.

[0020] In another aspect, provided herein is a method for treating a medical condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject in need thereof, comprising administering to the subject an antibody or binding fragment thereof described herein, a fusion protein described herein, a nucleic acid described herein, a vector described herein, or a pharmaceutical composition described herein. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is Parkinson's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the misfolded form of SOD1 comprises an SOD1 monomer, a dimer comprising a misfolded SOD1 monomer, an aggregate comprising an SOD1 monomer and / or a dimer, or a toxic trimer. In some embodiments, the SOD1 monomer comprises a mutant SOD1 monomer. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, where X is a truncating mutation.

[0021] Also provided in another aspect is a fusion protein that specifically binds to a mutant SOD1, comprising: a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3; a first linker; a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223.

[0022] In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 68; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; The fusion protein comprises an active E3 ligase fragment comprising a region, a second linker, and an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein is formulated for viral delivery to a subject. In some embodiments, the fusion protein is expressed and delivered by an aa AAV vector.

[0023] In another aspect, methods are provided for treating a neurodegenerative condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject in need thereof, the method comprising administering a fusion protein described herein to the subject. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the SOD1 comprises mutant SOD1. In some embodiments, the mutant SOD1 comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, where X is a truncating mutation. In some embodiments, the mutant SOD1 comprises G93A.

[0024] These and other objects and features of the present disclosure will become more fully apparent when the following detailed description of the disclosure is read in conjunction with the accompanying drawings. [Brief explanation of the drawings]

[0025] Embodiments of the present disclosure will be described with reference to the drawings. [Figure 1A] 1 shows the results of an epitope mapping experiment using hybridoma clone 3H1. [Figure 1B] 1 shows the results of an epitope mapping experiment using hybridoma clone 8D1. [Figure 2] The epitope locations of the anti-SOD1 antibodies are shown. [Figure 3A] 1 shows the design of a misfold-specific ubiquitin ligase (mUbL) fusion protein. [Figure 3B] 1 is a graph showing gene expression data from human post-mortem ventral horns in control and ALS donors. [Figure 4A]10 is an image showing HEK293 cells transfected with mUbL and SOD1-A4V-GFP and stained for DAPI and mUbL. [Figure 4B] 1 shows an immunoblot showing mUbL expression in mUbL-transfected HEK293 cells, and a graph showing signal intensity representing protein expression levels. [Figure 4C] 1 is an immunoblot showing that mUbL does not degrade endogenous SOD1. [Figure 4D] We show that mUbL2 interacts with misfolded SOD1. [Figure 5A] FIG. 11 is a graph of results showing that all mUbLs were able to reduce the amount of SOD1-A4V-GFP in HEK293, Neuro2A, and SHSY5Y cells. [Figure 5B] 1 is a graph of results showing that mUbL2 was consistently effective in reducing fluorescence in HEK293, Neuro2A, and SHSY5Y cells. [Figure 5C-1] Figure 5C shows that mUbL2 was most effective at reducing the number of insoluble fluorescent aggregates present in transfected HEK293, Neuro2A, and SHSY5Y cells by maintaining SOD1 at levels that allowed it to diffuse through saponin-induced pores in the cell membrane. Figure 5D shows that mUbL reduces the number of insoluble SOD1G93A-EGFP aggregates in HEK293 cells. [Figure 5C-2] Figure 5C shows that mUbL2 was most effective at reducing the number of insoluble fluorescent aggregates present in transfected HEK293, Neuro2A, and SHSY5Y cells by maintaining SOD1 at levels that allowed it to diffuse through saponin-induced pores in the cell membrane. Figure 5D shows that mUbL reduces the number of insoluble SOD1G93A-EGFP aggregates in HEK293 cells. [Figure 6A] 1 is a graph of results showing that mUbL can reduce levels of misfolded SOD1 across a range of SOD1 mutations. [Figure 6B] 1 is a graph of results showing that when the proteasome is inhibited by treatment with MG132, the action of mUbL is prevented. [Figure 6C] 1 is a graph of results showing the effectiveness of mUbL in reducing the intensity of SOD1A4V-EGFP fluorescence when normalized to mUbL expression. [Figure 7A] Figure 1 shows the design of the E3 ligase panel, where the binding domain was removed and the scFv from mUbL2 was fused to a truncated ligase. [Figure 7B] Figure 1 shows that the ligases in the mUbL panel have varying efficacies in reducing the intensity of SOD1G93A-EGFP fluorescence when expression of mUbL is controlled. [Figure 8A] 1 is a graph of results showing that E3 ligase was able to reduce the total fluorescence of SOD1-A4V and G93A in HEK293 cells, and was also able to reduce SOD1-A4V in SHSY5Y cells. [Figure 8B] FIG. 10 is a graph of results showing that E3 ligase was effective in reducing the number of insoluble fluorescent aggregates in transfected cells after saponin treatment. [Figure 8C] 1 is a graph of results showing that E3 ligase was effective in reducing the level of soluble fluorescence in the medium after saponin treatment. [Figure 9A] 1 shows the expression of mUbL in neurons in brain tissue. [Figure 9B] WT / mUbL mice show expression of mUbL in the brain and spinal cord but not in the liver. [Figure 10] We show that the mUbL transgene was effective in attenuating and delaying weight loss during the early symptomatic phase of ALS in male SOD1G93A mice, but not in female SOD1G93A mice. [Figure 11] 1 shows that the mUbL transgene was effective in delaying disease progression in SOD1G93A mice. [Figure 12]We show that the mUbL transgene effectively attenuated the clinical phenotype at the end stage of the disease. [Figure 13] Figure 1 shows the phenotype affecting mUbL of SOD1G93A at the endpoint. Survival was analyzed using the log-rank test. DETAILED DESCRIPTION OF THE INVENTION

[0026] I. Definition In understanding the scope of the present disclosure, the term "comprises" and its derivatives, as used herein, are intended to be open-ended terms that specify the presence of stated features, elements, components, groups, integers, and / or steps, but do not exclude the presence of other, unstated features, elements, components, groups, integers, and / or steps. The above also applies to words of similar meaning, such as "including," "having," and their derivatives. As used herein, terms of degree, such as "substantially," "about," and "approximately," refer to a reasonable amount of deviation from the modified term such that the end result does not significantly change. When this deviation does not negate the meaning of the modifying word, these terms of degree should be interpreted as including a deviation of at least ±5% of the modified term.

[0027] Where a term is provided in the singular, the inventors also contemplate aspects of the present disclosure described in terms of the plural of that term. As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the content clearly dictates otherwise; for example, "an antibody" includes the plural of antibodies. Thus, for example, reference to a "method" includes one or more methods, and / or steps of the type described herein and / or that will become apparent to those skilled in the art upon reading this disclosure.

[0028] The terms "administer," "administering," or "administered" refer to the act of giving a drug or therapeutic treatment to a physiological system (e.g., a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs).

[0029] As used herein, the term "affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule and its binding partner. Unless otherwise specified, as used herein, "binding affinity" refers to the intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair. The affinity of a molecule X for its partner Y is generally determined by the equilibrium dissociation constant (K D Affinity can be measured by common methods known in the art.

[0030] The term "amino acid" refers to naturally occurring amino acids, as well as non-naturally occurring or non-standard amino acids such as amino acid analogs, synthetic amino acids, and amino acid mimetics. These amino acids may be in the L- or D- (isomer) configuration, or may include dextrorotatory forms of both. Amino acids incorporated into antibodies are referred to as "residues." Amino acids may be referred to herein by either their commonly known three-letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

[0031] As used herein, the term "antibody" is intended to include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, and humanized antibodies. Antibodies may be derived from recombinant sources and / or produced in transgenic animals. As used herein, the term "antibody binding fragment" or "antibody fragment" refers to any antibody fragment, including Fv (a molecule comprising a VL and a VH), single-chain variable fragment (scFv; a molecule comprising a VL and a VH connected by a peptide linker), Fab, Fab', F(ab')2, dsFv, ds-scFv, single domain antibody (sdAB; V H H, V H , VL The term "antibody" is intended to include, but is not limited to, molecules comprising a single variable domain with three or fewer CDRs, such as IgNAR antigen-binding variable domains (VNARs), and multivalent presentations thereof. Also included are dimers, minibodies, diabodies, and multimers thereof, bispecific and multispecific antibody fragments, and domain antibodies. Antibodies can be fragmented using conventional techniques. For example, F(ab')2 fragments can be generated by treating an antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges and produce Fab' fragments. Papain digestion can lead to the formation of Fab fragments. Fab, Fab', and F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments, and other fragments can also be synthesized by recombinant techniques.

[0032] In the present disclosure, an scFv antibody that binds to misfolded SOD1 is recombinantly produced based on the heavy chain variable region (VH) and light chain variable region (VL) sequences of a rabbit monoclonal antibody raised against the SOD1 peptide NEESTKTGN (SEQ ID NO: 142), which are located in an electrostatic loop that is normally unavailable in the fully folded SOD1 structure; this alpha-helical sequence becomes linear when SOD1 is misfolded. Generation of rabbit monoclonal antibodies can be carried out using techniques known in the art and as described herein.

[0033] An scFv is a fusion of the variable regions of an immunoglobulin heavy chain (VH) and light chain (VL) connected by a short linker peptide, e.g., 10 to about 25 amino acids. The linker is typically glycine-rich for flexibility and serine- or threonine-rich for solubility, and can connect the N-terminus of the VH to the C-terminus of the VL, or vice versa. scFvs have been used to facilitate phage display, where it is very convenient to express the antigen-binding domain as a single peptide. Alternatively, scFvs can be produced directly from subcloned heavy and light chains derived from hybridomas. scFvs are versatile and can be used in countless applications, including, for example, flow cytometry, immunohistochemistry, as the antigen-binding domain of a chimeric antigen receptor, and therapeutic uses. In some embodiments, the antibodies or binding fragments thereof described herein comprise a heavy chain comprising a heavy chain variable region and a light chain comprising a light chain variable region, the heavy and light chains being connected by a linker. In some embodiments, the linker is a peptide linker. In some embodiments, the linker comprises GSGSG (SEQ ID NO: 222) or GGGGSGGGSGGGGS (SEQ ID NO: 221).

[0034] Antibodies against misfolded SOD1 may be prepared using techniques known in the art, such as those described by Kohler and Milstein, Nature 256,495 (1975) and Kuroiwa et al. (2002), and in U.S. Patent Nos. RE32,011, 4,902,614, 4,543,439, 4,411,993, and 9,133,272, and PCT Application Nos. 2010 / 004438 and 2014 / 031694 (incorporated herein by reference). (Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Plenum Press, Kennett, McKearn, and Bechtol (eds.), 1980; Monoclonal Antibodies: Methods and Protocols, Humana Press, Albitar (ed.), 2007, and Antibodies: A Laboratory Manual, 2 nd Edition, Greenfield (ed), Cold Spring Harbor Laboratory Press, 2014 (also incorporated herein by reference). Within the context of this disclosure, antibodies are understood to include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, antibody fragments (e.g., Fab and F(ab')2), and recombinantly produced binding partners.

[0035] To produce polyclonal antibodies in a host, such as a rabbit or goat, the host is immunized with an immunogen or immunogen fragment, optionally bound to a carrier, generally with an adjuvant, and antibodies against the immunogen are recovered from the serum. Furthermore, polyclonal antibodies can be absorbed to be monospecific; that is, serum can be absorbed against the relevant immunogen, so that no cross-reactive antibodies remain in the serum, making it monospecific. To produce monoclonal antibodies, antibody-producing cells (lymphocytes) can be harvested from the immunized animal and fused with myeloma cells by standard somatic cell fusion procedures to immortalize these cells and generate hybridoma cells. Such techniques are well known in the art (e.g., the hybridoma technique first developed by Kohler and Milstein (1975), as well as other techniques, such as the human B-cell hybridoma technique (Kozbor, D, and Roder, J, 1983), the EBV hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985), and screening of combinatorial antibody libraries (Huse, W et al., 1989). Hybridoma cells can be screened immunochemically for the production of antibodies specifically reactive with the protein or a binding fragment thereof, and monoclonal antibodies can be isolated.

[0036] Chimeric antibodies, e.g., antibody molecules that combine a non-human animal variable region with a human constant region, are also contemplated within the scope of this disclosure. Chimeric antibody molecules can, for example, contain variable regions or domains from antibodies of a mouse, rat, rabbit, or other species with a human constant region. Conventional methods can be used to generate chimeric antibodies containing immunoglobulin variable regions that recognize a target (Antibodies: A Laboratory Manual, 2002). nd Edition, Greenfield (ed), Cold Spring Harbor Laboratory Press, 2014).

[0037] Monoclonal or chimeric antibodies that specifically react with a target as described herein can be further humanized by producing human constant region chimeras in which portions of the variable regions, particularly the conserved framework regions of the antigen-binding domain, are of human origin, and only the hypervariable regions are of non-human origin. Such immunoglobulin molecules can be produced by techniques known in the art (e.g., Teng et al., 1983; Kozbor, D., and Roder, J., 1983; Olsson and Kaplan; 1982; PCT Publication WO 92 / 06193; Antibodies: A Laboratory Manual, 2002). nd Edition, Greenfield (ed), Cold Spring Harbor Laboratory Press, 2014, each of which is incorporated herein by reference.) Humanized antibodies can also be produced commercially.

[0038] Rabbit antibodies are suitable for humanization. Rabbit antibodies have limited framework variability due to the preferential use of a single VH germline segment (80-90% of VDJ genes) combined with multiple homologous VJ genes. The fact that rabbit variable domain frameworks are highly homologous to each other makes them more suitable for common human acceptor frameworks (Borras et al., 2010). Humanized antibodies can be generated by grafting CDRs onto a human antibody acceptor framework. Rabbit variable regions or domains can be humanized by grafting antigen-binding loops into a human framework (i.e., human framework FW1.4). Affinity and stability can be optimized by replacing highly conserved residues in rabbit variable domains (i.e., human framework FW1.4gen) involved in CDR conformation (Borras et al., 2010 and U.S. Patent No. 8,293,235, each of which is incorporated herein by reference).

[0039] The rabbit monoclonal antibodies also contain stable human Ig germline frameworks (i.e., IGHV3-66 * 01, IGHJ4 * 01, IGKV1-27 * 01, and IGKJ4 * 01) can also be humanized by grafting combined CDRs (Kabat, IMGT, and Paratome). The combined CDR grafting strategy involves antigen contact residues as well as supporting residues (Zhang and Ho, 2017, incorporated herein by reference).

[0040] Humanization can also be achieved by grafting only specificity-determining residues (SDRs) onto a human antibody framework, thereby reducing the number of non-human residues while retaining residues important for antigen-antibody interactions, thereby reducing immunogenicity (Kashmiri et al., 2005, incorporated herein by reference). Similarly, selectivity-determining residues contained in rabbit CDR regions can be transferred onto homologous acceptor human antibody variable heavy and light chain sequences (U.S. Patent Application Publication No. 20090104187, incorporated herein by reference).

[0041] An alternative CDR grafting technique involves the use of human framework sequences from human germline genes based on CDR similarity. Antibody humanization is achieved based on the similarity of CDR sequences rather than the similarity of frameworks. Human antibodies with similarly structured CDRs support the CDRs of other species while retaining affinity. This is achieved by comparing the homology between residues, and residues in human CDRs that are not already identical to those in rabbits are converted to rabbit sequences (U.S. Patent No. 6,881,557, incorporated herein by reference).

[0042] Humanized rabbit monoclonal antibodies can be generated using mutational lineage-guided (MLG) humanization. The heavy and light chain variable region sequences are aligned with comparable human germline VH and VK sequences. Rabbit residues in the framework regions involved in CDR contacts are unchanged. Structurally related and exchangeable residues, as well as non-critical structural residues, are humanized. Solvent-facing residues are also replaced with human germline residues. Selective substitution of non-human residues in both frameworks and within the CDRs generates humanized antibodies guided by biological and sequence information (Yu et al., 2010; WO 2005016950; U.S. Pat. No. 7,462,697, each of which is incorporated herein by reference).

[0043] Antibodies can also be humanized by resurfacing, which replaces available surface residues in the variable regions. Substitution of these exposed residues reduces immunogenicity in humans (U.S. Patent Application Publication No. 20040086979, each of which is incorporated herein by reference). Similarly, rabbit monoclonal antibodies can be humanized by changing amino acids within the framework regions of the variable regions or domains to generate sequences similar to those of the analogous human antibody framework regions (WO2005016950, incorporated by reference).

[0044] Alternatively, a phage display approach can be used to generate chimeric rabbit / human antibodies containing rabbit variable regions or domains and human constant domains, thus already being partially humanized. The rabbit variable regions or domains can then be humanized. Humanization can be achieved using CDR grafting with framework fine-tuning via phage display. Rabbit CDR sequences can be grafted onto an appropriate human framework. Framework fine-tuning can alter residues in the human framework involved in antigen binding (Rader et al., 2000; U.S. Patent No. 6,346,269, each of which is incorporated herein by reference). Chimeric rabbit / human Fabs can also be converted to chimeric rabbit / human IgG1s (Steinberger et al., 2000; U.S. Patent Application Publication No. 20030049251, each of which is incorporated herein by reference).

[0045] For the production of recombinant antibodies (generally, Huston et al., 1991; Johnson and Bird, 1991; Mernaugh and Mernaugh, 1995), messenger RNA from antibody-producing B lymphocytes of animals or hybridomas is reverse transcribed to obtain complementary DNA (cDNA). The antibody cDNA, which can be full-length or partial length, is amplified and cloned into a phage or plasmid. The cDNA can be partial length heavy and light chain cDNAs separated or connected by a linker. The antibody or its binding fragment is expressed using a suitable expression system to obtain the recombinant antibody. Antibody cDNA can also be obtained by screening an appropriate expression library.

[0046] As used herein, the term "signal peptide" or "signal sequence" refers to a short amino acid sequence at the beginning (N-terminus) of a newly synthesized polypeptide, such as an antibody heavy or light chain, or a fusion protein containing the variable regions of these chains. This sequence, typically spanning 15-30 amino acids, targets nascent antibody molecules to the endoplasmic reticulum (ER) or other relevant organelles, setting the stage for their secretion, membrane integration, or specific compartmentalization. Upon reaching the target site, the signal peptide is cleaved, processing the antibody into its mature form, ready to fold and achieve its functional configuration. If the signal peptide is not at the N-terminus, it may lose its functionality as a signal peptide and will not provide a cleavage site for processing. Internal signal peptides may be or function as linkers. The antibodies and fusion proteins described herein may or may not have a signal peptide, whether N-terminal or internal.

[0047] As used herein, the terms "E3 ligase" or "E3 ubiquitin ligase" refer to proteins in the ubiquitin proteasome pathway that recruit ubiquitin-loaded E2 ubiquitin-conjugating enzymes, recognize protein substrates, and either assist in or directly catalyze the transfer of ubiquitin from the E2 to the protein substrate. E3 ligases interact with both the target protein and the E2 enzyme, conferring substrate specificity to the E2. E3 ligases typically polyubiquitinate their substrates with Lys48-linked chains of ubiquitin, targeting them for destruction by the proteasome, although many other types of linkages are possible, altering protein activity, interaction, or localization. Ubiquitination by E3 ligases regulates diverse areas, such as cell cycle control, cellular trafficking, DNA repair, and signal transduction. The human genome encodes over 600 putative E3 ligases, including CHIP (UniProtKB ID: Q9UNE7), UBE4A (UniProtKB ID: Q14139), NEDD4L (UniProtKB ID: Q96PU5), UBR5 (UniProtKB ID: O95071), RNF4 (UniProtKB ID: P78317), UBOX5 (UniProtKB ID: O94941), Parkin (UniProtKB ID: O60260), and BTrCP (UniProtKB ID: Q9Y297), which are selected herein as representatives of different families of E3 ligases. E3 ligases or active fragments thereof can be fused to the misfolded SOD1-specific antibodies or binding fragments thereof described herein to generate fusion proteins called misfolding-specific ubiquitin ligase (mUbL or MisfoldUbL) fusion proteins. The binding domain of an E3 ligase confers its substrate specificity to the E3. This specificity can be altered if the binding domain is removed or replaced. Truncated forms of E3 ligase that lack the binding domain are useful for targeting misfolded SOD1 when fused to an antibody or binding fragment thereof disclosed herein. Active fragments of E3 ligase retain the catalytic function of the E3 ligase and are useful for targeting misfolded SOD1 when fused to an antibody or binding fragment thereof disclosed herein.Molecular biology techniques for creating such fusion proteins are known to those skilled in the art.

[0048] As used herein, the term "effective amount" refers to an amount of a therapy (e.g., a prophylactic or therapeutic agent) sufficient to effect beneficial or desired results, including clinical results. An effective amount can be administered in one or more administrations.

[0049] As used herein, the term "isolated" refers to a material that has been removed from its original environment (e.g., the natural environment if it occurs in nature). For example, a naturally occurring antibody present in a living animal is not isolated, but the same antibody separated from some or all of the coexisting materials in the natural system is isolated.

[0050] As used herein, the term specific binding includes both low affinity specific binding and high affinity specific binding. Specific binding can be, for example, a low affinity misfolded SOD1 antibody or binding fragment thereof, or a high affinity misfolded SOD1 antibody or binding fragment thereof, or a high affinity misfolded SOD1 antibody or binding fragment thereof, or a high affinity misfolded SOD1 antibody or binding fragment thereof, or a high affinity misfolded SOD1 antibody or binding fragment thereof, or a low ... -4 M ~ about 10 -7 K D Specific binding can also be demonstrated by a high affinity misfolded SOD1 antibody or binding fragment thereof, or fusion protein, for example, a misfolded SOD1 antibody or binding fragment thereof, or a fusion protein having a binding affinity of at least about 10 for misfolded SOD1. -7 M, at least about 10 -8 M, at least about 10 -9 M, at least about 10 -10 M, or at least about 10 -11 M or 10 -12 K over M D The misfolded SOD1 antibody or binding fragment thereof, or fusion protein can be, for example, about 2×10 for misfolded SOD1. -5 M~10 -7 K of M D , e.g., about 10 as measured by SPR-6 ~10 -7 M, or about 10 -8 M~10 -10 M, or approximately 10 as measured by flow cytometry -9 M~5×10 -7 K of M D Low and high affinity misfolded SOD1 antibodies or binding fragments thereof, or fusion proteins that selectively bind to misfolded SOD1, can be useful in the methods described herein.

[0051] The term "pharmaceutically acceptable carrier" refers to any such carrier known to those skilled in the art to be suitable for a particular mode of administration. For example, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., that can be used as a vehicle for a pharmaceutically acceptable substance. In addition, the active material can be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action or have another action.

[0052] As used herein, the term "pharmaceutically acceptable salts" refers to salts that are known to be non-toxic and are commonly used in pharmaceutical literature. Typical inorganic acids used to form such salts include hydrochloric acid, hydrobromic acid, hydroiodic acid, nitric acid, sulfuric acid, phosphoric acid, hypophosphoric acid, and the like. Salts derived from organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, and hydroxyalkandioic acids, aromatic acids, aliphatic and aromatic sulfonic acids, and the like may also be used. Such pharmaceutically acceptable salts include acetate, phenylacetate, trifluoroacetate, acrylate, ascorbate, benzoate, chlorobenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, methylbenzoate, o-acetoxybenzoate, naphthalene-2-benzoate, bromide, isobutyrate, phenylbutyrate, beta-hydroxybutyrate, chloride, cinnamate, citrate, formate, fumarate, glycolate, heptanoate, lactate, maleate, hydroxymaleate, malonate, mesylate, nitrate, cinnamate, hydroxybenzoate ... Examples of the salt include oxalate, phthalate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, propionate, phenyl propionate, salicylate, succinate, sulfate, bisulfate, pyrosulfate, sulfite, hydrogen sulfite, sulfonate, benzenesulfonate, p-bromophenylsulfonate, chlorobenzenesulfonate, ethanesulfonate, 2-hydroxyethanesulfonate, methanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, p-toluenesulfonate, xylenesulfonate, and tartrate.

[0053] As used herein, the terms "treat," "treatment," and "treating" refer to the prevention, reduction, or amelioration of the progression, severity, and / or duration of at least one symptom and / or condition of any condition or disease. The term "treatment" or "treating" refers to any administration of a compound disclosed herein and includes (i) inhibiting a disease or disease state in an individual experiencing or exhibiting a symptom or condition of the disease (e.g., halting further development of the symptom and / or condition), or (ii) ameliorating a disease in an individual experiencing or exhibiting a symptom or condition of the disease (e.g., reversing the symptom and / or condition). The term "control" includes preventing, treating, eradicating, ameliorating, or otherwise reducing the severity of a symptom of a disease or a disease state.

[0054] The terms "reducing," "reduce," or "reduction" herein in the context of a disease or condition refer to a lessening of the causes, symptoms, or effects of the disease or condition. Thus, in the disclosed methods, "reducing" can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the amount of reperfusion injury, or any value or range therebetween.

[0055] As used herein, the term "subject" or "patient," or equivalent terms, includes all members of the animal kingdom, particularly mammals, including humans. A subject or patient is preferably a human.

[0056] The recitation herein of numerical ranges by endpoints includes all numbers and fractions subsumed within that range (e.g., 1 to 5 includes, for example, 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It should also be understood that all numbers and fractions thereof are presumed to be modified by the term "about."

[0057] II. Misfolded SOD1 Antibodies or Binding Fragments Thereof, Fusion Proteins, or Nucleic Acids and Compositions Misfolded SOD1-specific antibodies or binding fragments thereof, or fusion proteins have utility for treating medical conditions, diseases, or disorders mediated by misfolded forms of SOD1 in subjects in need of treatment.

[0058] A. Misfolded SOD1-binding antibody Disclosed herein are antibodies or binding fragments thereof that bind to misfolded SOD1. Variants and modified embodiments of these antibodies that can be used in these methods are also provided.

[0059] The present disclosure provides the misfolded SOD1 epitope ESTKTGN (SEQ ID NO: 144), which is the core epitope recognized by misfolded SOD1 antibodies. In one embodiment, the antibody or binding fragment thereof binds to the epitope ESTKTGN (SEQ ID NO: 144).

[0060] In one embodiment, the antibody binding fragment is an Fv, scFv, Fab, Fab', F(ab')2, dsFv, ds-scFv, sdAB, dimer, minibody, diabody, or multimer thereof. In one embodiment, the antibody binding fragment is an scFv.

[0061] In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 contains one or more modifications to increase protease resistance, serum stability, and / or bioavailability. In some embodiments, the modifications are selected from pegylation, acetylation, glycosylation, biotinylation, prenylation, or substitution of the antibody or binding fragment thereof with D-amino acids and / or unnatural amino acids. The antibody or binding fragment thereof can contain one or more non-canonical disulfide bonds, for example, at IMGT (ImMunoGeneTics) positions 54 and 78, to increase stability, protease resistance, serum stability, and / or bioavailability. Thus, in some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 contains one or more non-canonical disulfide bonds to increase stability, protease resistance, serum stability, and / or bioavailability. In some embodiments, the one or more non-canonical disulfide bonds are at IMGT positions 54 and 78.

[0062] As is understood in the art, the amino acid positions or boundaries delineating the CDR regions of an antibody can vary depending on the context and the different definitions known in the art. Some positions within a variable region can be considered hybrid CDRs, in that the position can be within a CDR region under one set of criteria, but is considered outside the CDR region under another set of criteria. In some embodiments, the CDRs in the variable light and variable heavy chains can be delineated using the IMGT, Kabat, Chothia, AbM, Contact, or Paratome schemes, or another scheme known in the art. The "Kabat" approach to defining CDRs uses sequence variability (Kabat et al. (1991); incorporated herein by reference). The "Chothia" approach uses the positions of structural loops (Chothia and Lesk, (1987), Chothia et al. (1992); incorporated herein by reference). The IMGT numbering system is an adaptation of the Chothia numbering scheme (Lefranc et al., (1999); see also http: / / imgt.cines.fr; incorporated herein by reference). CDRs defined by "AbM" are a compromise between Kabat and Chothia and are delineated using the Oxford Molecular AbM antibody modeling software (see Martin et al. (1989); see also www.bioinf-org.uk / abs; incorporated herein by reference). The antibody numbering scheme developed by the Chemical Computing Group (CCG) combines several antibody numbering schemes and provides a broader definition of CDR boundaries based on the CDR definitions of Martin and coworkers (Maier et al. (2014); incorporated herein by reference). "Contact" CDR delineations are based on analysis of known antibody-antigen crystal structures (see, e.g., MacCallum et al. (1996)).The "Paratome" approach involves computational programs based on a set of consensus regions derived from the structural alignment of a non-redundant set of known antibody-antigen complexes (Kunik et al. (2012); see also www.ofranlab.org / paratome / ; incorporated herein by reference). The "Aho" or Honegger scheme number the variable domains of the immunoglobulin superfamily in a uniform manner. This system is based on the structural alignment of 3D structures of immunoglobulin variable regions that encompass the observed length variations. This allows the definition of structurally conserved Cα positions, and therefore the appropriate framework region and CDR lengths are predicted (see Honegger, A. and Pluckthun A. (2001); incorporated herein by reference). The CDRs described herein include those based on the CCG, Paratome, Kabat, Chothia, or Aho definitions (see Table 7), and it should be understood that CDRs based on other methods are encompassed herein. In some embodiments, the CDRs described herein are based on IMGT, CCG, Paratome, Kabat, Chothia, or Aho.

[0063] In an exemplary embodiment of the present disclosure, an isolated antibody or binding fragment thereof binds to a misfolded superoxide dismutase 1 (SOD1) epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof is (i) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; (ii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12; (iii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; (iv) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13; (v) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13; (vi) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58; (vii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28; or (viii) A heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

[0064] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0065] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0066] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0067] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13.

[0068] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13.

[0069] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58.

[0070] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28.

[0071] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

[0072] In some embodiments, the CDRs described herein are mutated at one or two positions. In some embodiments, the CDRs containing one or two mutated positions retain specific binding activity for a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144.

[0073] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises: (i) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 65, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; or (ii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 68, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; or (iii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; or (iv) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; or (v) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 78, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; or (vi) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; or (vii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86; or (viii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 91.

[0074] In some embodiments, an isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 65, and a light chain comprising a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70.

[0075] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 68, and a light chain comprising a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70.

[0076] In some embodiments, an isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, and a light chain comprising a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76.

[0077] In some embodiments, an isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, and a light chain comprising a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76.

[0078] In some embodiments, an isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 78, and a light chain comprising a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82.

[0079] In some embodiments, an isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80, and a light chain comprising a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82.

[0080] In some embodiments, an isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, and a light chain comprising a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86.

[0081] In some embodiments, an isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88, and a light chain comprising a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 91.

[0082] In some embodiments, the percentage of identity is outside of the CDRs described herein.

[0083] In some embodiments, the antibody binding fragment is a Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimer, minibody, diabody, or bispecific antibody binding fragment. In some embodiments, the antibody binding fragment is an scFv.

[0084] Also provided is an isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising: (i) a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 109, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 114; (ii) a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 112, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 114; (iii) a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 116, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 120; (iv) a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 118, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 120; (v) a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 122, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 126; (vi) a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 124, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 126; (vii) a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 128, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 130; or (viii) a heavy chain comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 132, and a light chain comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 135.

[0085] In some embodiments, the isolated antibody binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody comprises a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 109, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 114.

[0086] In some embodiments, the isolated antibody binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody comprises a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 112, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 114.

[0087] In some embodiments, the isolated antibody binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody comprises a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 116, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 120.

[0088] In some embodiments, the isolated antibody binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody comprises a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 118, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 120.

[0089] In some embodiments, the isolated antibody binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody comprises a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 122, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 126.

[0090] In some embodiments, the isolated antibody binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody comprises a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 124, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 126.

[0091] In some embodiments, the isolated antibody binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody comprises a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 128, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 130.

[0092] In some embodiments, the isolated antibody binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody comprises a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 132, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 135.

[0093] In some embodiments, the isolated antibody binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody comprises a heavy chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 93, and a light chain comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 95.

[0094] In some embodiments, the percentage of identity is outside of the CDRs described herein.

[0095] B. Modified Antibodies and Antibody Analogs In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 contains one or more L-amino acids, D-amino acids, and / or non-standard amino acids. In various embodiments, the antibody or binding fragment thereof may contain amino acids, including the carboxy- and / or amino-terminal amino acids in the antibody, or may be modified by pegylation, methylation, amidation, acetylation, prenylation, and / or substitution with other chemical groups that can alter the circulating half-life of the antibody or binding fragment thereof without adversely affecting its activity. Examples of non-conventional or unnatural amino acids include, but are not limited to, citrulline, ornithine, norleucine, norvaline, 4-(E)-butenyl-4(R)-methyl-N-methylthreonine (MeBmt), N-methyl-leucine (MeLeu), aminoisobutyric acid, statin, and N-methyl-alanine (MeAla). The amino acids may participate in disulfide bonds. In some embodiments, the amino acids have the general structure H2N--C(H)(R)--COOH. In some embodiments, the amino acid is a naturally occurring amino acid. In some embodiments, the amino acid is a synthetic or unnatural amino acid (e.g., an α,α-disubstituted amino acid, an N-alkyl amino acid), in some embodiments, the amino acid is a D-amino acid, and in some embodiments, the amino acid is an L-amino acid. In some embodiments, the modified amino acid comprises a modification selected from the group consisting of methylation, amidation, acetylation, and / or substitution with other chemical groups. In some embodiments, the antibody or binding fragment thereof is modified by pegylation, acetylation, glycosylation, biotinylation, or prenylation.

[0096] The antibodies or binding fragments thereof described herein can be fused to an Fc domain and can be multimerized, for example, to generate bispecific / biparatopic molecules. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 is fused to an Fc domain. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 is multimeric. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 is fused to an Fc domain and is multimeric.

[0097] The antibodies and binding fragments thereof are useful for diagnostic purposes, including in vivo imaging to identify endogenous sites of misfolded SOD1, and for testing samples to detect SOD1. The antibodies and binding fragments thereof are also useful for therapeutic purposes, for treating diseases involving misfolded SOD1. In some embodiments, the antibodies or binding fragments thereof described herein are for treating or diagnosing a medical condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject.

[0098] For either purpose, the antibody or binding fragment can be conjugated to a suitable agent to form a conjugate. The active sequence of the antibody or its binding fragment is not significantly affected by the appropriate agent. For diagnostic purposes, a suitable agent is a detectable label, including radioisotopes or fluorescent markers for whole-body imaging, and radioisotopes, enzymes, peptides, fluorescent labels, etc. for sample testing. In these diagnostic approaches, the agent can function as a label either directly, by itself, or indirectly, as an agent that binds to the desired label, such as a labeled secondary antibody that binds to the agent. For diagnostic purposes, the detectable label can be any of a variety of types used in the field of in vitro diagnostics, including particulate labels, e.g., biotin / streptavidin, metal sols, e.g., colloidal gold, radioisotopes, e.g., I presented with peptide chelators of the N2S2, N3S, or N4 type. 125or Tc 99 Suitable enzyme labels include horseradish peroxidase, alkaline phosphatase, and the like. For example, labels may be used with adamantyl methoxy phosphoryloxy phenyl dioxetane (AMPPD), disodium 3-(4-(methoxyspiro{1,2-dioxetane-3,2'-(5'-chloro)tricyclo{3.3.1.1}, 4-(4- ... The antibody may be the enzyme alkaline phosphatase, which is detected by measuring the presence or formation of chemiluminescence following conversion of a 1,2 dioxetane substrate, such as (3,7}decan}-4-yl)phenyl phosphate (CSPD), and CDP and CDP-star® or other luminescent substrates known to those skilled in the art, e.g., chelates of suitable lanthanides, such as terbium(III) and europium(III). The means of detection is determined by the label selected. The appearance of the label or its reaction product can be achieved visually, if the label is particulate or colored and accumulates at an appropriate level, or using instruments such as a spectrophotometer, luminometer, or fluorometer, all according to standard practice. In some embodiments, the antibody or binding fragment thereof further comprises a suitable agent as described herein. In some embodiments, the antibody or binding fragment thereof further comprises a detectable label as described herein.

[0099] The imaging agent may be included in the composition or in an additional composition. Suitable imaging agents include commercially available agents used in positron emission tomography (PET), computer assisted tomography (CAT), single photon emission computed tomography, X-ray, fluoroscopy, and magnetic resonance imaging (MRI).

[0100] Imaging agents useful in conjunction with antibodies or binding fragments thereof to screen for endogenous sites of misfolded SOD1 include metals, radioisotopes, and radiopaque substances (e.g., gallium, technetium, indium, strontium, iodine, barium, bromine, and phosphorus-containing compounds), radiolucent substances, contrast agents, dyes (e.g., fluorescent dyes and chromophores), and enzymes that catalyze colorimetric or fluorescent reactions. Generally, such agents can be attached or captured using various techniques as described above and can be present in any orientation. See, for example, U.S. Patent Nos. 6,391,280, 7,875,454, 8,102,945, 10,086,073, and 10,449,261, which are expressly incorporated herein by reference.

[0101] Contrast agents according to the present disclosure are useful in imaging procedures such as X-ray contrast agents, optical imaging probes, spin labels, or radioactive units. Examples of materials suitable for use as contrast agents in MRI include currently available gadolinium chelates such as diethylene triamine pentaacetic acid (DTPA) and gadopentetate dimeglumine, as well as iron, magnesium, manganese, copper, and chromium. Examples of materials useful for CAT and X-ray imaging include iodine-based materials, such as ionic monomers typified by diatrizoate and iothalamate, nonionic monomers such as iopamidol, isohexol, and ioversol, nonionic dimers such as iotrol and iodixanol, and ionic dimers such as ioxagult.

[0102] Medications for use with PET scans include N 13 and fluorodeoxyglucose (FDG).

[0103] In some embodiments, the detectable label is a peptide label comprising three or more amino acid residues at the C-terminus, the N-terminus, or both the C-terminus and the N-terminus. In some embodiments, the antibody or binding fragment thereof comprises one or more peptide labels. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 further comprises one or more peptide labels comprising 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 30 amino acid residues at the N-terminus. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 further comprises one or more peptide tags comprising 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 30 amino acid residues at the C-terminus. In some embodiments, the antibody or binding fragment thereof that binds to misfolded SOD1 further comprises one or more peptide tags comprising 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 30 amino acid residues at both the C-terminus and the N-terminus.

[0104] C. Misfolded specific ubiquitin ligase fusion protein The present disclosure also provides a fusion protein comprising an antibody or binding fragment thereof that binds to misfolded SOD1 and an E3 ligase or an active fragment thereof. In some embodiments, the fusion protein comprises an antibody or binding fragment thereof described herein and an E3 ligase or an active fragment thereof. The sequences of the E3 ligases, truncated forms thereof, or active fragments thereof described herein have at least 85% identity and can retain ubiquitin ligase activity.

[0105] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof is (i) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; (ii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12; (iii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; (iv) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13; (v) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13; (vi) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58; (vii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28; or (viii) A heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

[0106] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0107] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0108] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0109] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13.

[0110] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13.

[0111] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58.

[0112] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28.

[0113] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

[0114] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 97, SEQ ID NO: 99, and SEQ ID NO: 101, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 103, SEQ ID NO: 105, and SEQ ID NO: 107.

[0115] In some embodiments, the CDRs described herein are mutated at one or two positions. In some embodiments, the CDRs containing one or two mutated positions retain specific binding activity for a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144.

[0116] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof is (i) a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 65, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; (ii) a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 68, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; (iii) a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; (iv) a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; (v) a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 78, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; (vi) a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; (vii) a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86; or (viii) a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 91.

[0117] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 65, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70.

[0118] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 68, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70.

[0119] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76.

[0120] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76.

[0121] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 78, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82.

[0122] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82.

[0123] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86.

[0124] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain having a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88, and a light chain having a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 91.

[0125] In some embodiments, the fusion protein comprises a heavy chain variable region, a first linker, a light chain variable region, a second linker, and an active E3 ligase fragment. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, a first linker, a light chain variable region comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70, a second linker, and an active E3 ligase fragment. and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186 to 193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 68; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186 to 193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186 to 193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186 to 193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 78; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186 to 193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186 to 193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186 to 193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 91; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186 to 193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 65; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; a region, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 68; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; a region, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; a region, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74; a first linker; an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, or an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a truncated E3 ligase comprising a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 78, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82, and a second linker. a region, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; a region, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86; a region, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 91; a region, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:65; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO:187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:68, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO:187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 187.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:78; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 187.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 91; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:65; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO:188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:68; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises an active E3 ligase fragment comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 76; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:78; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:88; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:91; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:65; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:189.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:68, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO:189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 189.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:78; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 189.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 91; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:65; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:68; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:190.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74; a first linker; a light chain variable region comprising an amino acid sequence having 5% or 100% identity to the amino acid sequence of SEQ ID NO: 190; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:78; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 190.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:88; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:91; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:65; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:68; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:78; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:88; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:91; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:65; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:68; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:192.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 192. In embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:78; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO:192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 192.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:88; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:91; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:65; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO:193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:68; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO:193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 74, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:78; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, a first linker, a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:88; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:91; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3; a first linker; a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs:186-193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs:186-193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16; a first linker; a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs:186-193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs:186-193, or at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. The truncated E3 ligase includes an amino acid sequence having 8%, 99%, 99.5%, 99.5%, or 100% identity. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16; a first linker; a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs:186-193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55; a first linker; a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs:186-193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25; a first linker; a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs:186-193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31; a first linker; a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:32, SEQ ID NO:33, and SEQ ID NO:34; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs:186-193, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:32, SEQ ID NO:33, and SEQ ID NO:34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:223. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:187.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:187. In some embodiments, the fusion protein comprises an amino acid sequence of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9. a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13; a first linker; a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13; a second linker; and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:187.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:32, SEQ ID NO:33, and SEQ ID NO:34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:187. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:188. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:32, SEQ ID NO:33, and SEQ ID NO:34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:188.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 189.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:189.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, a first linker, and a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:32, SEQ ID NO:33, and SEQ ID NO:34. a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequence of SEQ ID NO: 189, a second linker, and an active E3 ligase fragment comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 190.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:190.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:32, SEQ ID NO:33, and SEQ ID NO:34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:190. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:32, SEQ ID NO:33, and SEQ ID NO:34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:191. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:192.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13, a second linker, and at least 85%, 90% of the amino acid sequence of SEQ ID NO:192. In some embodiments, the fusion protein comprises an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:192.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:32, SEQ ID NO:33, and SEQ ID NO:34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:192. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 193.In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:193. In some embodiments, the fusion protein comprises a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:32, SEQ ID NO:33, and SEQ ID NO:34, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the antibodies or antigen-binding fragments thereof, or fusion proteins described herein further comprise a methionine or a signal peptide at the N-terminus. In some embodiments, the polypeptide comprising at least 85% identity to the amino acid sequence of SEQ ID NO: 65, 68, 72, 74, 78, 80, 84, 88, 162, 164, 166, 168, 170, 172, 174, or 176 further comprises a methionine or signal peptide at the N-terminus.In some embodiments, the signal peptide is not at the N-terminus; for example, the signal peptide may be present in a fusion protein and may not function as a cleavage site. In other embodiments, the antibody or antigen-binding fragment thereof, or the fusion protein lacks any signal peptide. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO: 224. In some embodiments, a polypeptide comprising at least 85% identity to the amino acid sequence of SEQ ID NO: 82, 86, 91, 166, 168, 170, 172, 174, or 176 further comprises an N-terminal methionine or signal peptide. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO: 225. In some embodiments, a polypeptide comprising at least 85% identity to the amino acid sequence of SEQ ID NO: 70, 162, or 164 further comprises an N-terminal methionine or signal peptide. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO: 226. In some embodiments, any antibody, antigen-binding fragment, fusion protein, or polypeptide described herein may or may not have a signal peptide and / or methionine at the N-terminus. In some embodiments, any amino acid sequence in Tables 5, 6, or 12 may or may not have a signal peptide and / or methionine at the N-terminus. In some embodiments, any antibody, antigen-binding fragment, fusion protein, or polypeptide described herein may or may not have a signal peptide, optionally SEQ ID NO: 224, 225, or 226. In some embodiments, a polypeptide comprising at least 85% identity to the amino acid sequence of SEQ ID NO: 166, 168, 170, 172, 174, or 176 may have a deletion of the amino acid sequence comprising SEQ ID NO: 225. In some embodiments, a polypeptide comprising at least 85% identity to the amino acid sequence of SEQ ID NO: 162 or 164 may have a deletion of the amino acid sequence comprising SEQ ID NO: 226. In some embodiments, a signal peptide can be used as a linker. In some embodiments, the first linker comprises the amino acid sequence GSGSG (SEQ ID NO:222) or SEQ ID NO:221.In some embodiments, the second linker comprises the amino acid sequence GSGSG (SEQ ID NO: 222) or SEQ ID NO: 221. In some embodiments, the fusion protein comprises a polypeptide having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 162, 164, 166, 168, 170, 172, 174, and 176. In some embodiments, the fusion protein comprises a polypeptide having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 162, 164, 166, 168, 170, 172, 174, and 176, and further comprises a 6-His tag or a FLAG tag at the 5' or 3' end. In some embodiments, the fusion protein comprises a polypeptide having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 162, 164, 166, 168, 170, 172, 174, and 176, and further comprises a 6-His tag at the 3' end. The sequences described herein can have the addition and / or deletion of tags, such as a 6-His tag or a FLAG tag, and nucleic acids encoding same.

[0126] E3 ligases useful as part of a fusion protein can be members of the U-BOX, HECT, F-BOX, RBR, or RING E3 ligase families. In some embodiments, the E3 ligase is a member of the U-BOX, HECT, F-BOX, RBR, or RING family of E3 ligases, or an active fragment thereof. In some embodiments, a member of the U-BOX family of ligases is CHIP, UBE4A, or UBOX5 (RNF37), or an active fragment thereof. In some embodiments, a member of the HECT family of ligases is NEDD4L or UBR5, or an active fragment thereof. In some embodiments, a member of the F-BOX family of ligases is BTrCP or an active fragment thereof. In some embodiments, a member of the RBR family is Parkin or an active fragment thereof. In some embodiments, a member of the RING family is RNF4 or an active fragment thereof. In some embodiments, the E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 145, 147, 149, 151, 153, 155, 157, and 159. In some embodiments, the E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to amino acids 128-303 of SEQ ID NO: 145. In some embodiments, the E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 873-1066 of SEQ ID NO: 147. In some embodiments, the E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 2-340 of SEQ ID NO: 149.In some embodiments, the E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 616-975 of SEQ ID NO: 151. In some embodiments, the E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 2455-2799 of SEQ ID NO: 153. In some embodiments, the E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to amino acids 1-261 of SEQ ID NO: 155. In some embodiments, the E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to amino acids 220-465 of SEQ ID NO: 157. In some embodiments, the E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to amino acids 76-190 of SEQ ID NO: 159, any one of SEQ ID NOs: 145, 147, 149, 151, 153, 155, 157, and 159. In some embodiments, the active fragment of E3 ligase comprises a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186-193, or an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223.In some embodiments, an active fragment of an E3 ligase comprises a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186-193, or an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 223. In some embodiments, an active fragment of an E3 ligase comprises an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 186-193. In some embodiments, an active fragment of an E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 186. In some embodiments, an active E3 ligase comprises a truncated E3 ligase comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 223. In some embodiments, an active fragment of an E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 187. In some embodiments, an active fragment of an E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 188. In some embodiments, an active fragment of an E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 189. In some embodiments, an active fragment of an E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 190.In some embodiments, an active fragment of an E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 191. In some embodiments, an active fragment of an E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 192. In some embodiments, an active fragment of an E3 ligase comprises an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 193. In some embodiments, the percentage of identity is outside the CDRs described herein.

[0127] D. Nucleic acid Nucleic acids encoding the antibodies or binding fragments thereof, or fusion proteins described herein are also provided. Nucleic acid sequences encoding antibodies or binding fragments thereof, or fusion proteins can be expressed in a variety of host cells that secrete expression products, including E. coli, other bacterial hosts, yeast, and various higher eukaryotic cells, such as COS, CHO, and HeLa cell lines, as well as myeloma cell lines. The recombinant protein gene is operably linked to expression control sequences appropriate for each host. For E. coli, this includes a promoter such as the T7, trp, or lambda promoter, a ribosome binding site, and preferably a transcription termination signal. For eukaryotic cells, the control sequences include a promoter and may include an enhancer derived from immunoglobulin genes, SV40, cytomegalovirus, etc., and a polyadenylation sequence, and may include splice donor and acceptor sequences.

[0128] The vectors of the present disclosure can be introduced into selected host cells by well-known methods, such as calcium chloride transformation for E. coli and calcium phosphate treatment or electroporation for mammalian cells. Cells transformed with the vector can be selected by resistance to antibiotics conferred by genes contained on the vector, such as the amp, gpt, neo, and hyg genes. Additionally, nucleic acids can be introduced into mammalian cells by viral vectors.

[0129] Once expressed and secreted, the antibody or binding fragment thereof, or fusion protein can be purified according to standard procedures in the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis, and the like (see Scopes, RK Protein Purification: Principles and Practice. Springer Science & Business Media, 2013; Burgess, Richard R., and Murray P. Deutscher, eds. Guide to Protein Purification. Academic Press, 2009). Substantially pure compositions of at least about 90-95% homogeneity can be obtained, and even 98-99% or more homogeneity for pharmaceutical uses. Once purified, partially or to homogeneity as desired, the antibody or binding fragment thereof, or fusion protein can be used therapeutically.

[0130] Thus, there is provided an isolated antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof is (i) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 66 or 67, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 71; (ii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 69, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 71; (iii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 73, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 77; (iv) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 75, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 77; (v) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 79, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 83; (vi) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 81, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 83; (vii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 85, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 87; or (viii) Also provided is an isolated antibody or binding fragment thereof, comprising: a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 89 or 90; and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 92.

[0131] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 66 or 67, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 71.

[0132] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 69, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 71.

[0133] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 73, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 77.

[0134] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 75, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 77.

[0135] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 79, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 83.

[0136] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 81, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 83.

[0137] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 85, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 87.

[0138] In some embodiments, the isolated antibody or binding fragment thereof binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, and the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 89 or 90, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 92.

[0139] In some embodiments, the percentage of identity is outside of the CDRs described herein.

[0140] Also provided is an isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, the antibody comprising: (i) a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 110 or 111, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 115; (ii) a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 113, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 115; (iii) a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 117, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 121; (iv) a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 119, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 121; (v) a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 123, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 127; (vi) a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 125, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 127; (vii) a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 129, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 131; or (viii) a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 133 or 134, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 136.

[0141] In some embodiments, the isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 110 or 111, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 115.

[0142] In some embodiments, the isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 113, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 115.

[0143] In some embodiments, the isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 117, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 121.

[0144] In some embodiments, the isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 119, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 121.

[0145] In some embodiments, the isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 123, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 127.

[0146] In some embodiments, the isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 125, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 127.

[0147] In some embodiments, the isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 129, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 131.

[0148] In some embodiments, the isolated antibody that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144 comprises a heavy chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 133 or 134, and a light chain encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 136.

[0149] Also provided is a fusion protein comprising an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof is (i) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 66 or 67, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 71; (ii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 69, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 71; (iii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 73, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 77; (iv) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 75, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 77; (v) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 79, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 83; (vi) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 81, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 83; (vii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 85, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 87; or (viii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 89 or 90, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 92.

[0150] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 66 or 67, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 71.

[0151] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 69, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 71.

[0152] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 73, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 77.

[0153] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 75, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 77.

[0154] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142 or 144, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 79, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 83.

[0155] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 81, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 83.

[0156] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 85, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 87.

[0157] In some embodiments, the fusion protein comprises an E3 ligase or an active fragment thereof and an antibody or binding fragment thereof that binds to a misfolded SOD1 epitope having the amino acid sequence set forth in SEQ ID NO: 142, wherein the antibody or binding fragment thereof comprises a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 89 or 90, and a light chain comprising a light chain variable region, wherein the light chain variable region is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 92.

[0158] In some embodiments, the active fragment of an E3 ligase comprises an amino acid sequence encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of any one of SEQ ID NOs: 146, 148, 150, 152, 154, 156, 158, and 160. In some embodiments, the fusion protein comprises an amino acid sequence encoded by a nucleic acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the nucleic acid sequence of any one of SEQ ID NOs: 161, 163, 165, 167, 169, 171, 173, 175, and 179-185.

[0159] In some embodiments, the percentage of identity is outside of the CDRs described herein.

[0160] In some embodiments, the antibodies or antigen-binding fragments thereof, or fusion proteins described herein comprise a sequence set forth in Table 4 with the N-terminal methionine deleted. In some embodiments, the antibodies or antigen-binding fragments thereof, or fusion proteins described herein comprise a sequence set forth in Table 4 with the first 15, 16, 17, 18, 29, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids deleted and optionally replaced with methionine. In some embodiments, the sequence set forth in Table 4 further comprises a signal peptide at the N-terminus. In some embodiments, the antibodies or antigen-binding fragments thereof, or fusion proteins described herein comprise a sequence set forth in Table 5 with the first 15, 16, 17, 18, 29, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids deleted. In some embodiments, the antibodies or antigen-binding fragments thereof, or fusion proteins described herein comprise a sequence shown in Table 5 with the first 15, 16, 17, 18, 29, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids deleted and optionally replaced by methionine.

[0161] In some embodiments, the polypeptides disclosed herein are encoded by nucleic acids.

[0162] In some embodiments, vectors are also provided that contain a nucleic acid encoding an antibody or a binding fragment thereof, or an E3 ligase or an active fragment thereof, and a fusion protein comprising an antibody or a binding fragment thereof described herein. To express the antibody or a fragment thereof, or the fusion protein, the nucleic acid is operably linked to transcriptional and translational control sequences. Useful vectors include plasmids, retroviruses, cosmids, and the like. The vector and expression control sequences are selected to be compatible with the expression host cell used. The nucleic acid encoding the heavy chain or its variable region and the nucleic acid encoding the light chain or its variable region can be inserted into separate vectors. In some embodiments, the nucleic acid encoding the heavy chain or its variable region and the nucleic acid encoding the light chain or its variable region are inserted into the same vector. The nucleic acids are inserted into the vector by standard methods known in the art, such as ligation of complementary restriction sites on the antibody gene fragment and the vector, or blunt-end ligation if no restriction sites are present.

[0163] III. Pharmaceutical Preparations and Medicaments In another aspect, the antibodies or binding fragments thereof, fusion proteins or nucleic acids, and variants and modifications thereof described herein are provided as pharmaceutical compositions for therapeutic use. In one embodiment, the pharmaceutical formulation comprises an isolated antibody or binding fragment thereof, or fusion protein described herein.

[0164] Representative delivery regimens include oral, parenteral (including subcutaneous, intramuscular, and intravenous injection), rectal, buccal (including sublingual), transdermal, inhalation, ocular, and intranasal. In one embodiment, delivery of the compound involves subcutaneous injection of a controlled release injectable formulation. In some embodiments, the compounds described herein are useful for subcutaneous, intranasal, and inhalation administration.

[0165] The selection of the exact dose and composition and the most appropriate delivery regimen will be influenced by, among other factors, the pharmacological properties of the selected antibody or binding fragment thereof, fusion protein, or nucleic acid, the nature and severity of the condition being treated, and the physical condition and mental acuity of the recipient. In addition, the route of administration results in differences in the amount of substance absorbed. Bioavailability for administration of compounds via different routes varies significantly, ranging from less than 1% to nearly 100%. Typically, bioavailability from routes other than intravenous, intraperitoneal, or subcutaneous injection is 50% or less.

[0166] The pharmaceutical compositions or formulations of the present disclosure can be formulated with physiologically acceptable carriers or excipients to prepare pharmaceutical compositions. The carriers and compositions can be sterilized. The formulation should be suitable for the mode of administration, for example, intravenous or subcutaneous administration. Methods for formulating compositions are known in the art (see, for example, Remington's Pharmaceuticals Sciences, 17th Edition, Mack Publishing Co., (Alfonso R. Gennaro, editor) (1989), incorporated herein by reference).

[0167] Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions (e.g., NaCl), saline, buffered saline, alcohol, glycerol, ethanol, gum arabic, vegetable oils, benzyl alcohol, polyethylene glycol, gelatin, carbohydrates (such as lactose, amylose, or starch), sugars (mannitol, sucrose, or others), dextrose, magnesium stearate, talc, silicic acid, viscous paraffin, flavor oils, fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidone, and the like, and combinations thereof. Pharmaceutical preparations can, if desired, be mixed with auxiliary substances (e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring agents, and / or aromatic substances) that do not deleteriously react with the active compounds or interfere with their activity. In one embodiment, a water-soluble carrier suitable for intravenous administration is used. Pharmaceutically acceptable salts retain the desired biological activity of the parent antibody or binding fragment thereof without toxic side effects.

[0168] If desired, the composition or medicament can also contain a small amount of wetting or emulsifying agent, or pH buffering agent.The composition can be in the form of a liquid solution, suspension, emulsion, sustained-release formulation, or powder.The composition can also be formulated as a suppository with conventional binders and carriers such as triglycerides.

[0169] The composition or medicament can be formulated according to conventional procedures as a pharmaceutical composition adapted for administration to humans. For example, in one embodiment, a composition for intravenous administration is typically a solution in sterile isotonic aqueous buffer. If necessary, the composition may also include a solubilizing agent and a local anesthetic to ease pain at the injection site. Generally, the ingredients are supplied separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachet indicating the quantity of active ingredient. When the composition is administered by infusion, it can be dispensed using an infusion bottle containing sterile pharmaceutical-grade water, saline, or dextrose / water. When the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.

[0170] In some embodiments, the pharmaceutical composition comprises a liquid carrier such as, but not limited to, water, saline, phosphate-buffered saline, Ringer's solution, dextrose solution, serum-containing solutions, Hank's solution, other aqueous physiologically balanced solutions, oils, esters, and glycols.

[0171] The antibodies or binding fragments thereof, fusion proteins, or nucleic acids described herein can be formulated as neutral or salt forms. As noted above, pharmaceutically acceptable salts include salts formed with free amino groups (e.g., salts derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc.) and salts formed with free carboxyl groups (e.g., salts derived from sodium, potassium, ammonium, calcium, ferric hydroxide, isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, etc.).

[0172] Pharmaceutical formulations of the present disclosure contain an antibody or binding fragment thereof as a binder, which may be mixed with an excipient, diluted with an excipient, or enclosed within a carrier, which may be in the form of a capsule, sachet, paper, or other container, according to well-known methods and pharmaceutical compositions. The compositions may be administered by any route suitable for administering an antibody or binding fragment thereof, fusion protein, or nucleic acid, including parenteral, intravenous, subcutaneous, or intramuscular administration. Typically, the antibody or binding fragment thereof, fusion protein, or nucleic acid is dissolved or suspended in a sterile injectable solution at a concentration sufficient to provide the required dose in 0.5 to 2 ml or less. Pharmaceutical compositions of the present disclosure suitable for parenteral administration contain one or more compounds of the present disclosure in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, or sterile powders that can be reconstituted into a sterile injectable solution or dispersion immediately before use, which may contain antioxidants, buffers, solutes that render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents.

[0173] Injectable depot forms are made by forming microencapsulated matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer and the properties of the particular polymer used, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues. The injectable materials can be sterilized, for example, by filtration through a bacterial-retaining filter.

[0174] The pharmaceutical compositions may be presented in unit-dose or multi-dose hermetically sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets of the kind described above.

[0175] IV. Treatment Methods and Uses Therapeutic methods and uses are contemplated for diseases and conditions mediated by misfolded SOD1, such as amyotrophic lateral sclerosis (ALS), Alzheimer's disease or Parkinson's disease, or frontotemporal dementia. Misfolded SOD1 targets represent opportunities where antibodies or binding fragments thereof, fusion proteins, or nucleic acids such as those described herein can be used to treat or prevent diseases and conditions mediated by misfolded SOD1.

[0176] Thus, in one embodiment, there is provided a method of treating a medical condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject in need thereof, the method comprising administering to the subject an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is Parkinson's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the misfolded form of SOD1 comprises an SOD1 monomer, a dimer comprising an SOD1 monomer, an aggregate comprising an SOD1 monomer and / or a dimer, or a toxic trimer. In some embodiments, the SOD1 monomer comprises a mutant SOD1 monomer. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, where X is a truncation mutation. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from Table 1.

[0177] [Table 1]

[0178] Also provided is the use of an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein to treat a medical condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject in need thereof. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is Parkinson's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the misfolded form of SOD1 comprises an SOD1 monomer, a dimer comprising an SOD1 monomer, an aggregate comprising an SOD1 monomer and / or a dimer, or a toxic trimer. In some embodiments, the SOD1 monomer comprises a mutant SOD1 monomer. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, where X is a truncation mutation. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from Table 1.

[0179] Further provided is a use of an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein for the manufacture of a medicament for treating a medical condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject in need thereof. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is Parkinson's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, misfolded forms of SOD1 include SOD1 monomers, dimers comprising SOD1 monomers, aggregates comprising SOD1 monomers and / or dimers, and toxic trimers. In some embodiments, the SOD1 monomer comprises a mutant SOD1 monomer. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, where X is a truncation mutation. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from Table 1.

[0180] Further provided is an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition described herein for use in treating or preventing a disease in a subject. In some embodiments, the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder. In some embodiments, the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, or frontotemporal dementia. In some embodiments, the ALS is sporadic ALS. In some embodiments, the ALS is familial ALS. In some embodiments, the neurodegenerative condition, disease, or disorder is Alzheimer's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is Parkinson's disease. In some embodiments, the neurodegenerative condition, disease, or disorder is frontotemporal dementia. In some embodiments, the misfolded forms of SOD1 include SOD1 monomers, dimers comprising SOD1 monomers, aggregates comprising SOD1 monomers and / or dimers, and toxic trimers. In some embodiments, the SOD1 monomer comprises a mutant SOD1 monomer. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, where X is a truncation mutation. In some embodiments, the mutant SOD1 monomer comprises one or more mutations selected from Table 1.

[0181] In some embodiments, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition may be administered in combination with one or more additional therapeutic agents. Co-administration includes simultaneous administration in separate compositions (also called concurrent administration), administration at different times in separate compositions, or administration in a composition in which both agents are present. In some embodiments, the additional therapeutic agent is an ALS therapeutic agent. In some embodiments, the ALS therapeutic agent is tofersen (Qalsody), AMX0035 (RELYVRIO), edaravone (Radicava™), riluzole (Rilutek), thickened riluzole (Tiglutik), riluzole oral film (Exservan™), or Nuedexta®. In some embodiments, the ALS therapeutic agent is an antisense oligonucleotide. In some embodiments, the ALS therapeutic agent is tofersen.

[0182] V. Route of Administration The antibodies or binding fragments thereof, fusion proteins, or pharmaceutical compositions described herein that bind to misfolded SOD1 can be administered by any suitable route. In some embodiments, the antibodies or binding fragments thereof, fusion proteins, nucleic acids, or pharmaceutical compositions are administered parenterally. In some embodiments, parenteral administration is selected from intravenous, intradermal, inhalation, transdermal (topical), intraocular, intramuscular, subcutaneous, intramuscular, and / or transmucosal administration. In some embodiments, the antibodies or binding fragments thereof, fusion proteins, nucleic acids, or pharmaceutical compositions described herein are administered subcutaneously. As used herein, the term "subcutaneous tissue" is defined as the layer of loose, irregular connective tissue immediately below the skin. For example, subcutaneous administration can be performed by injecting the composition into areas including, but not limited to, the thigh, abdomen, buttocks, or scapular region. In some embodiments, the antibodies or binding fragments thereof, fusion proteins, nucleic acids, or pharmaceutical compositions described herein are administered intravenously. In other embodiments, the antibodies or binding fragments thereof, fusion proteins, or pharmaceutical compositions described herein that bind to misfolded SOD1 are administered by direct administration to the target tissue or nervous system (e.g., direct injection into the brain, intracerebroventricularly, or intrathecally). Alternatively, the antibodies or binding fragments thereof, fusion proteins, or pharmaceutical compositions described herein that bind to misfolded SOD1 (or compositions or medicaments containing the misfolded SOD1 antibodies or binding fragments thereof, fusion proteins, or nucleic acids described herein) can be administered by inhalation, parenterally, intradermally, transdermally, or transmucosally (e.g., orally or nasally). If desired, two or more routes can be used in parallel.

[0183] In some embodiments, the antibody or binding fragment thereof, fusion protein, or pharmaceutical composition that binds to misfolded SOD1 described herein is administered orally. In some embodiments, the present disclosure provides a solid dosage form of the antibody or fragment thereof, fusion protein, or pharmaceutical composition that binds to misfolded SOD1 described herein for oral administration, comprising: (a) the antibody or binding fragment thereof, fusion protein, or pharmaceutical composition that binds to misfolded SOD1, (b) at least one pharmaceutically acceptable pH-lowering agent, (c) at least one absorption enhancer effective to promote the bioavailability of the antibody or binding fragment thereof, fusion protein, or pharmaceutical composition that binds to misfolded SOD1, and (d) a protective vehicle. In some embodiments, the solid dosage form is a capsule or a tablet.

[0184] The present disclosure also contemplates additional methods for administering an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition across the blood-brain barrier, such as those aimed at transiently increasing the permeability of the blood-brain barrier, as described in U.S. Pat. No. 7,012,061, entitled "Method for increasing the permeability of the blood-brain barrier," which is incorporated herein by reference.

[0185] Those skilled in the art will recognize a variety of suitable methods for administering the compounds of the invention directly to the brain or across the blood-brain barrier, and will be able to modify these methods to safely administer the products of the invention.

[0186] VI. Dosage and Formulations An effective amount of an antibody or binding fragment thereof, fusion protein, or pharmaceutical composition that binds to misfolded SOD1, or a nucleic acid encoding the antibody or binding fragment thereof, fusion protein, or pharmaceutical composition, is used in the treatment. The dosage of the antibody or fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition used in accordance with the present disclosure will vary depending on the antibody or binding fragment thereof, fusion protein, or pharmaceutical composition and the condition being treated.

[0187] The dosage form is optionally a liquid dosage form. The term "liquid dosage form" refers to a non-solid dosage form suitable for, but not limited to, parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraventricular, intrathecal, intraorbital, ocular, intracapsular, intrathecal, intracisternal, intraperitoneal, intranasal, aerosol, or oral administration. Solutions of the compounds of the present invention can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO, and mixtures thereof, with or without alcohol, and in oils. Under ordinary conditions of storage and use, these preparations contain preservatives to prevent microbial growth. Those skilled in the art will know how to prepare suitable formulations. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington's Pharmaceutical Sciences (2003-20th edition) and The United States Pharmacopeia: The National Formulary, published in 1999 (USP 24 NF19). The formulation optionally contains excipients, including, but not limited to, buffers, antioxidants, stabilizers, carriers, diluents, and pH adjusters.

[0188] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists.

[0189] Those skilled in the art will recognize that the dosage form and formulation selected will depend on the characteristics of the composition, for example, a composition containing an antibody may require a different formulation than a composition containing a nucleic acid, and will select an appropriate formulation and dosage form for the composition.

[0190] Additional factors that affect the effective dose of the formulation include the route of administration, the target site, the physiological condition of the subject, the subject species, whether the treatment is prophylactic or therapeutic, and whether other drugs are administered.

[0191] Anti-SOD1 antibodies, such as scFv or scFv-containing fusion proteins, can be administered via intravenous infusion. The therapeutic concentration of SOD1 scFv or scFv-E3 ligase fusion proteins can be 1 to 10 micrograms per milliliter (µg / mL) locally in the CNS. With an intact blood-brain barrier (BBB), only 1 / 100 to 1 / 1000 of antibodies, such as IgG, penetrate the CNS. Therefore, the concentration of therapeutic antibodies in the peripheral circulation required to reach this concentration in the CNS is approximately 100 µg / mL to a maximum of 10 mg / mL, which is close to the pre-therapeutic level of antibodies in human plasma. Given that a human blood volume is approximately 5 liters, a 50-gram dose is the upper limit, which would be similar to the dose of pooled polyclonal intravenous immunoglobulin (IVIG) used to treat many disorders. Considering that degradation of human antibodies, e.g., IgG, takes 3 to 4 weeks, dosing once every 3 weeks should constitute an effective regimen. However, dosing of scFv or scFv-E3 ligase fusion proteins may be higher or lower than the above calculations, depending on the specifics of the condition. For example, mild disruption of the BBB has been noted in ALS, likely in areas where neuroinflammation is greatest, e.g., areas where disease is most evident, such as anterior horn motor neurons and cortical motor neurons, as well as certain fiber tracts served by cortical motor neurons. Therefore, selective BBB disruption in areas of greatest disease may allow for therapeutic efficacy with lower circulating concentrations of anti-misfolded SOD1 antibodies.

[0192] The antibodies or fusion proteins described herein can be used for direct infusion into the CNS via the intraventricular route or the intrathecal route. An example of a medical device used for this purpose is manufactured by MedTronic. Because the CSF recirculates several times per day, continuous infusion is required rather than a 3-4 week dosing regimen. A final concentration of 1-10 micrograms / mL is achieved by injecting approximately 5 mg per day in 500 mL of CSF per day.

[0193] Various embodiments may include different dosing regimens. In some embodiments, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition that binds to misfolded SOD1 is administered by continuous infusion. In some embodiments, the continuous infusion is intravenous. In other embodiments, the continuous infusion is subcutaneous. Alternatively or additionally, in some embodiments, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition that binds to misfolded SOD1 is administered bimonthly, monthly, twice monthly, once every three weeks, once every two weeks, weekly, twice weekly, three times weekly, daily, twice daily, or another clinically desirable dosing schedule. The dosing regimen for a single subject need not be at regular intervals but can vary over time depending on the needs of the subject.

[0194] In one embodiment, the topical dosage is administered at least once daily until a therapeutic result is achieved. The dosage can be administered twice daily, although more or less frequent dosing may be preferred. Once a therapeutic result is achieved, the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition can be tapered or discontinued. Occasionally, side effects warrant discontinuing therapy. An effective amount of the antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition of interest is used in treatment. The dosage should be sufficient to ameliorate the symptoms or signs of the disease being treated without causing unacceptable toxicity to the patient.

[0195] The antibodies or binding fragments thereof, or fusion proteins described herein can be delivered by any method known to those of skill in the art, for example, by using a recombinant viral vector. In some embodiments, the antibodies or binding fragments thereof, or fusion proteins described herein are delivered by a recombinant viral vector. In some embodiments, the viral vector is an adenoviral vector, an adeno-associated virus (AAV) vector, a herpes simplex virus (HSV) vector, a lentiviral vector, a retroviral vector, an SV-40 type viral vector, or a vaccinia viral vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector is an AAV9 vector. In some embodiments, the AAV vector has an engineered capsid that efficiently transduces the central and / or peripheral nervous system. In some embodiments, the AAV is AAV-PHP.eB.

[0196] The recombinant viral vector can include regulatory sequences that allow expression of the encoded antibody or binding fragment thereof, or fusion protein, such as a promoter, an enhancer, an internal ribosome entry site (IRES), and / or a sequence encoding a protein transduction domain (PTD). In some embodiments, the viral vector includes a promoter region operably linked to the coding sequence to cause or improve expression of the antibody or binding fragment thereof, or fusion protein. In some embodiments, the promoter is ubiquitous, tissue-specific, strong, weak, regulated, or chimeric to allow efficient and suitable production of the antibody or binding fragment thereof, or fusion protein. In some embodiments, the promoter is a cellular, viral, fungal, plant, or synthetic promoter. In some embodiments, the promoter used is functional in neuronal and muscle cells. In some embodiments, the promoter is functional in motor neurons and glial cells. In some embodiments, the promoter is functional in neurons, glia, and skeletal muscle cells, e.g., the promoter is a neuron-specific promoter, a glia-specific promoter, or a skeletal muscle-specific promoter, e.g., with non-substantial activation of operably linked sequences in other cell types. In some embodiments, the promoter is an RNA polymerase III-dependent promoter or an RNA polymerase II-dependent promoter. In some embodiments, the regulated promoter is a Tet on / off element-containing promoter, a rapamycin-inducible promoter, or a metallothionein promoter. In some embodiments, the motor neuron-specific promoter is a calcitonin gene-related peptide (CGRP) promoter, a choline acetyltransferase (ChAT) promoter, or a homeobox 9 (HB9) promoter.In some embodiments, the neuron-specific promoter is a neuron-specific enolase (NSE) promoter, a synapsin promoter, or a neuron-specific silencer element (NRSE) promoter. In some embodiments, the glial cell-specific promoter is a glial fibrillary acidic protein (GFAP) promoter. In some embodiments, the promoter is a CMV promoter, an RSV promoter, an SV40 promoter, or a chicken beta actin (CBA) promoter. In some embodiments, the promoter is a phosphoglycerate kinase (PGK) promoter or an elongation factor 1 alpha (EF1alpha) promoter. In some embodiments, the promoter is a prion promoter. In some embodiments, the promoter is a CAG promoter.

[0197] Recombinant viral vectors for delivering and expressing mUBL can be delivered in pharmaceutically acceptable doses by direct stereotactic brain injection, spinal injection, intravascular delivery, or intramuscular delivery. In some embodiments, recombinant viral vectors encoding mUBL are administered by stereotactic brain injection or spinal injection. In some embodiments, recombinant viral vectors encoding mUBL are administered intravascularly or intramuscularly.

[0198] VII. Kit In some embodiments, the present disclosure further provides a kit or other article of manufacture comprising an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition that binds to misfolded SOD1 described herein, and instructions for its reconstitution (if lyophilized) and / or use. The kit or other article of manufacture may include a container, syringe, vial, and any other item, device, or apparatus useful for administration (e.g., subcutaneously, by inhalation). Suitable containers include, for example, bottles, vials, syringes (e.g., pre-filled syringes), ampoules, cartridges, reservoirs, or lyo-jects. The container may be formed from a variety of materials, such as glass or plastic. In some embodiments, the container is a pre-filled syringe. Suitable pre-filled syringes include, but are not limited to, borosilicate glass syringes with a baked-on silicone coating, borosilicate glass syringes with thermally sprayed silicone, or plastic resin syringes without silicone.

[0199] Typically, the container may hold the formulation and a label on or associated with the container that may indicate instructions for reconstitution and / or use. For example, the label may indicate that the formulation is to be reconstituted to a concentration described above. The label may further indicate that the formulation is useful or intended for subcutaneous administration, for example. In some embodiments, the container may contain a single dose of a stable formulation containing an antibody or binding fragment thereof, fusion protein, nucleic acid, or pharmaceutical composition that binds to misfolded SOD1. In various embodiments, a single dose of the stable formulation is present in a volume of less than about 15 ml, about 10 ml, about 5.0 ml, about 4.0 ml, about 3.5 ml, about 3.0 ml, about 2.5 ml, about 2.0 ml, about 1.5 ml, about 1.0 ml, or about 0.5 ml. Alternatively, the container holding the formulation may be a multi-use vial, allowing for repeated administration of the formulation (e.g., 2 to 6 administrations). The kit or other article of manufacture may further comprise a second container comprising a suitable diluent (eg, BWFI, saline, buffered saline). Upon mixing the diluent and formulation, the final polypeptide or nucleic acid concentration in the reconstituted formulation can be at least about 0.2 μg / ml (e.g., at least about 0.5 μg / ml, at least about 1 μg / ml, at least about 2 μg / ml, at least about 5 μg / ml, at least about 10 μg / ml, at least about 20 μg / ml, at least about 25 μg / ml, at least about 50 μg / ml, at least about 75 μg / ml, at least about 0.1 mg / ml, at least about 0.2 mg / ml, at least about 0.5 mg / ml, at least about 1 mg / ml, at least about 2 mg / ml, at least about 2.5 mg / ml, at least about 5 mg / ml, at least about 10 mg / ml, at least about 20 mg / ml, at least about 30 mg / ml, at least about 40 mg / ml, at least about 50 mg / ml, at least about 75 mg / ml, at least about 100 mg / ml). The kit or other article of manufacture may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. In some embodiments, the kit or other article of manufacture may include instructions for self-administration.

[0200] The following non-limiting examples are illustrative of the present disclosure. [Example]

[0201] Example 1. Epitope mapping of murine antibodies 3H1 and 8D1 A peptide target of misfolded aggregated SOD1 was synthesized and characterized to provide an immunogen for the development of a mouse monoclonal antibody for biochemical characterization of epitope exposure. The peptide DLGKGGNEESTKTG (SEQ ID NO: 137) was synthesized and conjugated to KLH (keyhole limpet hemocyanin). Because the sequence DLGKGGNEESTKTG (SEQ ID NO: 137) has no endogenous cysteines, it was conjugated to KLH using the sulfo-MBS method (Pierce Reagents and Methods) for thiol group conjugation.

[0202] The SOD1 epitope DLGKGGNEESTKTG (SEQ ID NO: 137) is further analyzed to determine subportions (e.g., distinct epitopes) that are immunogenic. Immunogenicity analysis of SOD1, including antigenicity plots, is used to identify distinct epitopes. Isolated peptides corresponding to these distinct epitopes can be synthesized, and an immunogen comprising isolated peptides corresponding to one or more of these distinct epitopes can be used to generate antibodies.

[0203] Epitope mapping experiments using isolated peptides were performed to clarify the binding targets of the mouse anti-misfolded SOD1 antibodies 3H1 and 8D1. The isolated peptides used included DLGKGGNEESTKTG (SEQ ID NO: 137), GKGGNEESTKTGN (SEQ ID NO: 138), GGNEESTKTGNAG (SEQ ID NO: 139), NEESTKTGNAGSR (SEQ ID NO: 140), ESTKTGNAGSRLA (SEQ ID NO: 141), TKTGNAGSRLACG (SEQ ID NO: 194), and NAGSRLAZGVIGI (SEQ ID NO: 195). Figure 1 shows the results of the epitope mapping experiment. Experiments showed that 3H1 and 8D1 can bind to at least the isolated peptides GKGGNEESTKTGN (SEQ ID NO: 138), GGNEESTKTGNAG (SEQ ID NO: 139), NEESTKTGNAGSR (SEQ ID NO: 140), and ESTKTGNAGSRLA (SEQ ID NO: 141), indicating a minimal epitope for ESTKTGN (SEQ ID NO: 144). This epitope ESTKTGN (SEQ ID NO: 144) resides in an electrostatic loop in the DLGKGGNEESTKTG (SEQ ID NO: 137) portion of the SOD1 protein.

[0204] Example 2.3H1 Sequence The mouse 3H1 antibody was isolated and fully sequenced. RT-PCR was performed using 5' RACE and gene-specific reverse primers amplifying the appropriate mouse immunoglobulin heavy chain (IgG2a) and light chain (kappa) variable region sequences. Specific bands were excised and cloned into the pCR-Blunt II-TOPO vector for sequencing, and the constructs were transformed into E. coli. At least eight colonies for each chain were picked and PCR screened for the presence of the amplified region before sequencing; additional colonies were picked as needed (see Table 2). Selected PCR-positive clones were sequenced. DNA sequences were analyzed by BLAST and SnapGene to confirm homology to the mouse antibody sequence.

[0205] [Table 2]

[0206] DNA and Amino Acid Sequence Analysis: The determined DNA sequences for the 3H1 heavy and kappa chains are shown in Table 4 below. The consensus DNA sequence and translated protein sequence for 3H1 are shown in Table 3. The ATG start codon and corresponding methionine amino acid are in italics, and the complementarity determining regions (CDRs) are in bold according to the IMGT / LIGM-DB. 3H1 produces mRNA containing sequences encoding IgG2a heavy and kappa chains. Consensus sequences for both the heavy and light chain variable regions have been determined (see Table 3 for the consensus sequence and Table 4 for the raw sequence).

[0207] [Table 3]

[0208] The murine 3H1 antibody has consensus heavy chain CDR sequences; GSTFSNYW (SEQ ID NO: 97), which corresponds to the nucleic acid sequence GGATCCACTTTCAGTAACTACTGG (SEQ ID NO: 98); VAEIRLKSNT (SEQ ID NO: 99), which corresponds to the nucleic acid sequence GTTGCTGAAATTAGATTGAAATCTAATACT (SEQ ID NO: 100); and TGNAMDF (SEQ ID NO: 101), which corresponds to the nucleic acid sequence ACCGGCAATGCTATGGACTTC (SEQ ID NO: 102).

[0209] The murine 3H1 antibody has the consensus light chain CDR sequences; QSLVYSNGNTY (SEQ ID NO: 103), which corresponds to the nucleic acid sequence CAGAGCCTTGTATATAGTAATGGAAACACCTAT (SEQ ID NO: 104); KVS (SEQ ID NO: 105) corresponding to the nucleic acid sequence AAAGTTTCC (SEQ ID NO: 106); and SQSTHVPPWT (SEQ ID NO: 107), which corresponds to the nucleic acid sequence TCTCAAAGTACACATGTTCCTCCGTGGACG (SEQ ID NO: 108).

[0210] [Table 4]

[0211] Example 3A. Rabbit anti-misfolded SOD1 antibody Additionally, anti-misfolded SOD1 antibodies were raised in rabbits using the isolated peptide NEESTKTGN (SEQ ID NO: 142). Their amino acid and corresponding nucleic acid sequences are listed in Table 5. The mature variable regions are underlined and are shown separately in Table 6. The CDRs of these antibodies are shown in Table 7.

[0212] [Table 5-1]

[0213] [Table 5-2]

[0214] [Table 5-3]

[0215] [Table 6]

[0216] [Table 7-1]

[0217] [Table 7-2]

[0218] Example 3B. Hybridoma production of rabbit anti-misfolded SOD1 antibodies Three-month-old New Zealand rabbits are immunized with 100 μg of soluble synthetic peptide NEESTKTGN (SEQ ID NO: 142) or ESTKTGN (SEQ ID NO: 144) administered with Freund's adjuvant using a protocol of five subcutaneous injections and two test bleeds per rabbit. Titers are monitored periodically throughout the immunization period. Positively immunoreactive rabbits are identified by ELISA and Western blot analysis and selected for rabbit monoclonal preparation. To generate rabbit hybridomas, splenocytes from the immunized rabbits are isolated and fused with a rabbit hybridoma fusion partner. Hybridoma clones secreting misfolding-specific SOD1 antibodies are selected by ELISA screening of hybridoma supernatants.

[0219] Clonal cell lines expressing rabbit IgG against misfolding-specific antigens are further screened by Western blot analysis and immunohistochemistry using a panel of cell lines expressing either wild-type SOD1 with or without amplification, or misfolded SOD1 with a linearized alpha-helical sequence from the electrostatic loop.

[0220] Example 3C: Generation of a humanized rabbit anti-misfolded SOD1 antibody by CDR grafting Rabbit monoclonal anti-misfolded SOD1 antibodies are produced as in Example 3B. The antibody structure and / or sequence are analyzed to determine the combined Kabat, IMGT, and Paratome complementarity-determining regions (CDRs; Zhang et al., 2017). The identified CDRs from the rabbit monoclonal anti-misfolded SOD1 antibodies are then humanized via grafting onto a suitable stable human Ig germline framework to produce an equivalent humanized scFv for each rabbit monoclonal antibody. Genes encoding the DNA sequences of the CDR-grafted scFvs are synthesized by overlap extension PCR. The DNA constructs are then transformed into E. coli using an expression plasmid. After 3 hours of induction, E. coli cells are harvested, inclusion bodies are isolated, and the humanized scFv proteins are purified and then renatured by rapid dilution into refolding buffer.

[0221] The humanized scFvs are then characterized and compared to the original rabbit monoclonal anti-misfolded SOD1 antibody via ELISA screening. The humanized scFvs are further screened by Western blot analysis and immunohistochemistry using a panel of cell lines expressing either wild-type SOD1 with or without amplification, or misfolded SOD1 with a linearized alpha-helical sequence from the electrostatic loop.

[0222] Example 4A. Binding analysis of rabbit anti-SOD1 antibodies Supernatants from hybridoma cell cultures producing rabbit monoclonal antibodies were analyzed for antibody activity by indirect ELISA on plates coated with 1 μg / well of peptide or protein antigen. Table 8A summarizes the results of the binding assay. As shown in the experiment, the two A-7-85 antibodies (7-85 H3-2 / L1-2 and 7-85 H3-2 / L2-2) exhibit two-fold higher specificity than 3H1. Sequence analysis in Example 3A indicates that 7-85 H3-2 / L1-2 and 7-85 H3-2 / L2-2 have identical sequences. The binding of anti-SOD1 antibodies was also characterized by ratio analysis. By the peak agg / dim OD ratio method, all analyzed A-7 antibodies are more specific than 3H1. EC 50 Although most A-7 antibodies are less specific than 3H1 by the ratio of the method, the EC of dimeric SOD1 is not obtained because a complete curve is not obtained. 50 Values ​​were extrapolated (except for A-7-63).

[0223] [Table 8]

[0224] Example 4B. Generation of scFv B lymphocytes generated by immunizing rabbits with the antigen NEESTKTGN were isolated and immortalized with myeloma cells. Hybridoma cell lines secreting monoclonal antibodies were then selected using limiting dilution cloning. Rabbit antibodies were isolated and sequenced. RT-PCR was performed using 5' RACE and gene-specific reverse primers amplifying the appropriate rabbit immunoglobulin heavy and light chain variable region sequences. Specific bands were excised and cloned into the pCR-Blunt II-TOPO vector for sequencing, and the constructs were transformed into E. coli. Colonies for each chain were picked and PCR screened for the presence of the amplified region before sequencing; additional colonies were picked as needed. Selected PCR-positive clones were sequenced. DNA sequences were analyzed by BLAST and SnapGene to confirm homology to the rabbit antibody sequences. Once the sequences were confirmed, the heavy and light chain variable sequences were cloned into the expression vector pcDNA3-R4-uAb to generate anti-SOD1 scFvs (e.g., A-7-35a, 35, 58a, 58b, 63a, 63b, 85, and 93).

[0225] Example 5A. Targeting misfolded SOD1 for proteasomal degradation via SOD1-scFv-E3 ligase fusion protein Methods and Materials Plasmid The expression vector pcDNA3-R4-uAb, containing a single-chain variable fragment of beta-galactosidase fused to the truncated E3 ligase CHIP (the carboxy terminus of Hsc70-interacting protein), was obtained from Addgene (Addgene plasmid 101800, deposited by Matthew De Lisa (Portnoff et al., 2014)). The mUbLs used in this study were generated by replacing the beta-galactosidase scFv with the anti-SOD1 scFv described in Example 4B. Table 8B shows which mUbL numbers correspond to which fusion proteins containing which specific scFvs (see Table 12 for sequences).

[0226] [Table 9]

[0227] C-terminally EGFP-tagged SOD1 variant SOD1 on pEGFP-N1 backbone WT , SOD1 A4V , SOD1 G93A , SOD1 G85R , SOD1 D90A , SOD1 G127X , SOD1 V148G , SOD1 H46R , SOD1 G37R , SOD1 C6G , SOD1 E100G Vectors for expression of have been previously described (Turner et al., 2005, Farrawell et al., 2019).

[0228] Cell culture and transfection Human embryonic kidney (HEK293), Neuro2a (N2a), and neuroblastoma SHSY5Y cells were maintained in Dulbecco's modified Eagle's medium / Ham's nutrient mixture F12 (DMEM / F12 supplemented with 10% fetal bovine serum (FBS, Bovogen Biologicals, Australia)). Cells were maintained at 37°C in a humidified incubator containing 5% atmospheric CO2. For confocal microscopy, cells were grown in 96-well optical-bottom plates (Thermoscientific, Australia). For cell lysate experiments, cells were grown in 6-well plates. Cells were plated at approximately 25% confluency 24 h before transfection with TransIT-X2 transfection reagent (Mirus Bio, USA). Transfections were performed according to the manufacturer's instructions using 0.1 μg of DNA per well for 96-well plates, 0.5 μg of DNA per well for 24-well plates, and 2.5 μg of DNA per well for 6-well plates. For co-transfections, the amount of DNA was divided equally between the constructs.

[0229] Immunofluorescence HEK293 cells were seeded on 96-well optical-bottom plates (Thermofisher, USA) or glass coverslips and co-transfected with GFP-tagged SOD1A4V and different mUbLs. After 48 h, cells were fixed with 4% paraformaldehyde (PFA) (Merck Millipore, USA) in phosphate-buffered saline (PBS) for 20 min at room temperature. Cells were permeabilized in 0.11% Triton X-100 (TX-100) in PBS for 10 min before being blocked with 5% FBS, 1% bovine serum albumin (BSA), and 0.3% TX-100 in PBS for 1 h at room temperature. Cells were incubated overnight at 4°C with a mouse primary antibody against the histidine tag (Ab18184, Abcam, UK; 1:1000 dilution), followed by incubation for 1 hour at room temperature with an Alexa Fluor 647-conjugated goat anti-mouse IgG secondary antibody (ab150115, Abcam, UK; 1:1000 dilution). All antibodies were diluted in blocking buffer, and cells were washed with PBS between each incubation step.

[0230] Measurement of ubiquitin-proteasome system function To determine the mechanism of action of mUbL, HEK293 cells were co-transfected with SOD1-A4V-EGFP and mUbL and treated with 10 μM of the proteasome inhibitor MG132 overnight (approximately 18 h).

[0231] Fluorescence measurements Fluorescence of SOD1-expressing cells was monitored over 48 hours on an Incucyte automated fluorescence microscope (Essen BioScience, USA) as described by McAlary et al. (2016). Images were acquired every 2 hours and analyzed using a treatment definition trained to select GFP-positive cells. The number of GFP-positive cells was normalized to the number of GFP-positive cells in the control mUbL wells. To measure insoluble GFP aggregates, cells 48 hours after transfection were treated with 0.03% saponin (Sigma, Germany) in PBS. After a 10-minute incubation at room temperature, GFP signals were analyzed using a treatment definition trained to select GFP-positive cells. To measure soluble fluorescence after saponin treatment, 100 μl of medium was transferred to a fresh 96-well plate, and GFP soluble fluorescence was measured using a POLARstar Omega plate reader (BMG, Germany). The setup included a 2x2 matrix well scan readout from the bottom optics with excitation at 485 nm and emission at 520 nm.

[0232] High-throughput fluorescence measurements A Thunder automated microscope (Leica, Germany) was used for plate-based image acquisition. HEK293 cells co-expressing SOD1 mutant EGFP-tagged constructs and mUbL were co-transfected into 96-well optical-bottom plates. Each well was imaged in a 9 × 9 tile scan. Image overlap was not used to avoid overlapping cell numbers in later analysis steps.

[0233] Image analysis All images generated by automated microscopy underwent preprocessing quality control to exclude out-of-focus images, which were manually assessed by a user and excluded from the dataset. After quality control, images were processed with CellProfiler to segment cells within 30-130 pixel units and measure intensity, granularity, size / shape, intensity distribution, and texture.

[0234] Cell lysis HEK293 cells grown in 6-well plates and transfected with mUbL were harvested 48 hours post-transfection with trypsin-EDTA (Gibco). Cells were washed with PBS and then resuspended in RIPA buffer (50 mM Tris-HCl pH 7.4, 1% (w / v) sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1% TX-100, 0.1% SDS, 10 mM NEM, 1 mM sodium orthovanadate, Halt™ protease inhibitor cocktail (Thermo Scientific)). Protein concentration was determined by DC assay.

[0235] Protein analysis Cell lysates with a total protein concentration of 30 μg were mixed with 4x reducing SDS-PAGE sample buffer [200 mM Tris-HCl pH 6.8, 8% SDS (w / v), 40% glycerol (v / v), 50 mM EDTA, 0.08% bromophenol blue (w / v), 4% β-mercaptoethanol (v / v)] and heated at 70°C for 10 min before loading onto a 4-20% Criterion™ TGX Stain-Free™ gel (BioRad, Australia). The gel was electrophoresed at 100 V for 5 min, then at 150 V for 1 h. After electrophoresis, total protein on the gel was quantified using a Criterion Stain Free™ Imager (BioRad, Australia) before transfer for immunoblotting. Proteins separated by SDS-PAGE were transferred onto methanol-activated Amersham™ Hybond™ 0.2 μm PVDF membranes (GE Healthcare, USA) using 1x transfer buffer (25 mM Tris-based, 20% methanol (v / v), 192 mM glycine) at 100 V for 1 h at 4°C. After transfer, the membranes were imaged on a stain-free imager to confirm transfer and measure total protein. The membranes were blocked in 5% skim milk powder in Tris-buffered saline containing 0.2% (v / v) Tween-20 (TBST) for 1 h at room temperature and then probed with primary antibodies overnight at 4°C. The following day, the membranes were washed three times with TBST for 30 min each and then incubated with secondary antibodies for 1 h at room temperature. The membranes were visualized using a chemiluminescent substrate (Thermo Scientific) on an Amersham Imager 6600RGB. Analysis and quantification were performed using ImageJ (version 1.53c). If necessary, the membranes were then stripped with sodium azide for 2 hours at room temperature.The following primary antibodies were used for immunoblotting: mouse anti-FLAG (F1804 and F3165, Sigma, Germany; 1:2500), rabbit anti-SOD1 (Ab13498, Abcam, UK; 1:5000), rabbit anti-GFP (ab290, Abcam, UK; 1:10000), rabbit anti-GAPDH (G8795, Sigma, Germany; 1:50000), and mouse anti-GAPDH (G9545, Sigma, Germany; 1:50000). Secondary antibodies conjugated to HRP, goat anti-mouse IgG (P044701-2, Dako Agilent; 1:5000) or goat anti-rabbit-HRP (P044801-2, Dako Agilent; 1:5000), were used as needed.

[0236] Co-immunoprecipitation Dynabead co-immunoprecipitation kits (Thermofisher, USA) were used to detect SOD1 binding by mUbL, according to the manufacturer's instructions. Briefly, HEK293 cells were grown in 6-well plates and co-transfected with 250 ng each of mUbL and SOD1 A4V-GFP. Forty-eight hours after transfection, cells were lysed in extraction IP buffer. The cell lysate was mixed with 1.5 mg of magnetic Dynabeads coupled to an anti-His tag antibody (ab18184, Abcam) for 30 minutes at 4°C. After washing, bound proteins were eluted and boiled in 4x Laemelli sample buffer for analysis by immunoblotting.

[0237] Results and Discussion Figure 3 shows the design of misfolded-specific ubiquitin ligase (mUbL) fusion proteins. The heavy and light chain variable fragments of eight different scFv clones (labeled mUbL 1–8; see Table 9) specific for misfolded SOD1 were fused to a truncated E3 ligase via a flexible glycine-serine linker (Figure 3A). See Table 6 for the amino acid and nucleic acid sequences of the heavy and light chain variable fragments present in each clone. The constructs contain Flag and His tags for detection. Initially, the E3 ligase carboxy-terminus of Hsc70 interacting protein (CHIP) was selected for mUbL construction due to its high expression level and location in both human and mouse cell lines (see Table 10A). mUbL was designed to specifically bind to misfolded forms of SOD1, thus bringing E3 ubiquitin ligases into proximity with misfolded SOD1, leading to ubiquitination and proteasomal degradation of the misfolded SOD1. A construct containing an scFv against β-galactosidase fused to truncated CHIP was used as a control. Figure 3B shows gene expression data from human postmortem ventral horn tissue. E3 ligases have been shown to be part of a broad cohort of proteins that show differential expression in ventral horn spinal cord tissue from ALS donors compared to control samples (D'Erchia et al., 2017).

[0238] [Table 10]

[0239] [Table 11]

[0240] The data in Table 10A is sourced from proteinatlas.org. The mRNA expression data are given NX or normalized expression scores by combining data from three transcriptome datasets: the human protein atlas (HPA), the Genotype-Tissue Expression portal (GTEx), and CAGE data generated by the Fantom5 consortium.

[0241] Figure 4 shows that mUbL is expressed in the nucleus and cytoplasm of HEK293 cells and interacts with misfolded SOD1-A4V. HEK293 cells transfected with mUbL and SOD1-A4V-GFP were fixed, permeabilized, and stained for the mUbL C-terminal His tag using an anti-His antibody 48 h posttransfection (Figure 4A; scale bar 10 μM). HEK293 cells were transfected with mUbL and lysed in RIPA buffer 48 h posttransfection. Immunoblotting using an anti-FLAG antibody showed that mUbL was present in the soluble fraction (Figure 4B; control: beta-galactosidase scFv, "UT": not transfected). Significance was determined using one-way ANOVA with Dunnett's multiple comparison test, comparing HEK293 cells transfected with mUbL and the control; no differences were detected between mUbLs or between mUbL and the control. Figure 4C shows a Western blot demonstrating that mUbL does not degrade endogenous SOD1. Error bars represent the mean SD of two separate experiments, and the en...

Claims

1. 1. An isolated antibody or binding fragment thereof that binds to a misfolded superoxide dismutase 1 (SOD1) epitope having the amino acid sequence set forth in SEQ ID NO: 144, wherein the antibody or binding fragment thereof is (i) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6; (ii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12; (iii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; (iv) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:13; (v) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 13; (vi) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 55, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58; (vii) a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28; or (viii) An isolated antibody or binding fragment thereof, comprising: a heavy chain comprising a heavy chain variable region, wherein the heavy chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31; and a light chain comprising a light chain variable region, wherein the light chain variable region comprises CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO:

34.

2. (i) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 65, and the light chain comprises a light chain variable region comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 70; or (ii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 68, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 70; or (iii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 72, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 76; or (iv) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 74, and the light chain comprises a light chain variable region comprising an amino acid sequence at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identical to the amino acid sequence of SEQ ID NO: 76; or (v) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 78, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; or (vi) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 80, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 82; or (vii) the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 84, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 86; or (viii) The antibody or binding fragment thereof of claim 1, wherein the heavy chain comprises a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 88, and the light chain comprises a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:

91.

3. 3. The antibody or binding fragment thereof of claim 1 or 2, wherein the binding fragment is a Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimer, minibody, diabody, or bispecific antibody binding fragment.

4. The antibody or binding fragment thereof according to any one of claims 1 to 3, wherein the binding fragment is an scFv.

5. The antibody or binding fragment thereof of any one of claims 1 to 4, wherein the antibody or binding fragment thereof comprises one or more amino acids selected from the group consisting of D-amino acids, modified amino acids, amino acid analogs, or combinations thereof.

6. The antibody or binding fragment thereof of claim 5, wherein the modified amino acid comprises a modification selected from the group consisting of methylation, amidation, acetylation, and / or substitution with other chemical groups.

7. The antibody or binding fragment thereof according to any one of claims 1 to 6, wherein the antibody or binding fragment thereof is modified by pegylation, acetylation, glycosylation, biotinylation, or prenylation.

8. A fusion protein comprising the antibody or binding fragment thereof according to any one of claims 1 to 7 and E3 ligase or an active fragment thereof.

9. 9. The fusion protein of claim 8, wherein the E3 ligase is CHIP, UBE4A, NEDD4L, UBR5, RNF4, UBOX5, BTrCP, or Parkin, or an active fragment thereof.

10. 10. The fusion protein of claim 8 or 9, comprising a heavy chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, a first linker, a light chain variable region comprising CDR1, CDR2, and CDR3 having the amino acid sequences of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, a second linker, and an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:186, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:

223.

11. a heavy chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:68; a first linker; a light chain variable region comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:70; a second linker; and 11. The fusion protein of claim 10, comprising an active E3 ligase fragment comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO: 6, or a truncated E3 ligase comprising an amino acid sequence having at least 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.5%, or 100% identity to the amino acid sequence of SEQ ID NO:

223.

12. 12. The fusion protein of claim 10 or 11 formulated for viral delivery to a subject.

13. The fusion protein of claim 12, wherein the fusion protein is expressed and delivered by AAV.

14. A nucleic acid encoding the antibody or binding fragment thereof of any one of claims 1 to 7, or the fusion protein of any one of claims 8 to 13.

15. A vector comprising the nucleic acid of claim 14.

16. A pharmaceutical composition comprising the antibody or antibody thereof according to any one of claims 1 to 7, the fusion protein according to any one of claims 8 to 13, the nucleic acid according to claim 14, or the vector according to claim 15, and at least one pharmaceutical carrier.

17. 19. A method for treating a medical condition, disease, or disorder mediated by a misfolded form of SOD1 in a subject in need thereof, comprising administering to the subject an antibody or binding fragment thereof described in any one of claims 1 to 7, a fusion protein described in any one of claims 8 to 13, a nucleic acid described in claim 14, a vector described in claim 15, or a pharmaceutical composition described in claim 16.

18. 18. The method of claim 17, wherein the medical condition, disease, or disorder is a neurodegenerative condition, disease, or disorder.

19. 19. The method of claim 18, wherein the neurodegenerative condition, disease, or disorder is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, or frontotemporal dementia.

20. 20. The method of claim 19, wherein the ALS is sporadic ALS.

21. 20. The method of claim 19, wherein the ALS is familial ALS.

22. 20. The method of claim 19, wherein the neurodegenerative condition, disease, or disorder is Alzheimer's disease.

23. 20. The method of claim 19, wherein the neurodegenerative condition, disease, or disorder is Parkinson's disease.

24. 20. The method of claim 19, wherein the neurodegenerative condition, disease, or disorder is frontotemporal dementia.

25. 25. The method of any one of claims 17 to 24, wherein the misfolded form of SOD1 comprises an SOD1 monomer, a dimer comprising a mutant SOD1 monomer, or an aggregate comprising SOD1 monomers and / or dimers, or a toxic trimer.

26. 26. The method of claim 25, wherein the SOD1 monomer comprises a mutant SOD1 monomer.

27. 27. The method of claim 26, wherein the mutant SOD1 monomer comprises one or more mutations selected from the group consisting of A4V, G93A, G85R, D90A, G127X, V148G, H46R, G37R, C6G, and E100G, wherein X is a truncation mutation.

28. 27. The method of claim 26, wherein the mutant SOD1 comprises G93A.

Images