Use of isocitrate lyase and its L-amino acid in the production of L-amino acids

Genetic modification using the isocitrate lyase gene aceA and its variants enhances L-amino acid production in microorganisms, addressing productivity and conversion rate issues in microbial fermentation.

JP2026512836APending Publication Date: 2026-04-21NINGXIA EPPEN BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
NINGXIA EPPEN BIOTECH CO LTD
Filing Date
2024-03-27
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Current methods for producing L-amino acids through microbial fermentation face challenges in achieving high fermentation productivity and efficient sugar-to-acid conversion rates, leading to high production costs and limited scalability.

Method used

The use of isocitrate lyase gene aceA and its variants, such as aceA Q371*, is employed to genetically modify microorganisms by controlling the activity and expression of the aceA protein, either through knockout, downregulation, or fusion with tags, to enhance L-amino acid production.

Benefits of technology

This approach significantly increases the production of L-amino acids like L-alanine, L-valine, L-arginine, and L-threonine by optimizing metabolic pathways, thereby reducing production costs and improving fermentation efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026512836000001
    Figure 2026512836000001
  • Figure 2026512836000002
    Figure 2026512836000002
  • Figure 2026512836000003
    Figure 2026512836000003
Patent Text Reader

Abstract

This invention provides for the use of isocitrate lyase and its L-amino acid in the production of L-amino acids. Specifically, it provides for the use of a protein having the amino acid sequence shown in SEQ ID No. 2, or a substance that controls the activity and / or content of said protein, in the construction of genetically modified strains that produce L-amino acids. A high-productivity L-amino acid strain, an aceA gene mutant modified strain with a point mutation (CT) introduced at position 1111 of the aceA gene coding region of wild-type E. coli W3110, and a modified strain with the aceA gene knocked out were constructed. Experiments revealed that the aceA gene and its mutant aceA Q371* The gene is involved in L-amino acid biosynthesis, and it has been shown that knocking out or weakening the aceA gene is advantageous for L-amino acid accumulation. By constructing genetically modified strains that produce L-amino acids using the aceA gene and its mutants, it is possible to promote increased L-amino acid production.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to the Chinese patent application filed with the Chinese National Patent Office on March 29, 2023, application number 202310316337.2, with the title of the invention "Effect of isocitrate lyase gene aceA on L-amino acid synthesis," and all contents of said patent application are incorporated into this application by reference.

[0002] This application belongs to the field of biotechnology and relates to isocitrate lyase and its use in the production of L-amino acids, and more specifically, to the effect of the isocitrate lyase gene aceA on the synthesis of amino acids such as L-alanine, L-valine, L-arginine, L-tryptophan, and L-threonine. [Background technology]

[0003] L-amino acids are used in animal feed, pharmaceuticals, and cosmetics. Production of L-amino acids by microbial fermentation is currently the most widely used method, and the fermentation productivity of amino acid-producing microorganisms is a crucial factor in determining whether fermentation can achieve large-scale industrial applications. Currently, there is a shortage of highly fermentable strains, so a small number of amino acids cannot be produced by fermentation. Even for amino acid-producing strains that have been successfully produced by fermentation, further improvements are needed in acid production and sugar-to-acid conversion rates to reduce production costs.

[0004] To improve the yield and quality of amino acids, high-quality production strains are essential. With the development of recombinant DNA technology and the acquisition of related microbial genome information, genetic engineering breeding techniques based on the principles of metabolic engineering are gradually becoming mainstream. By intentionally altering the metabolic pathways and networks of microorganisms and artificially modifying the metabolic control mechanisms of strains, it is crucial to direct the metabolic flow within the microorganism in the desired direction, accumulate excess amino acids, significantly increase amino acid production, reduce costs, and accelerate the industrial production of L-amino acids.

[0005] Isocitrate lyase aceA is an important enzyme in the glyoxylate cycle of oilseed crops. Currently, no research has been conducted on the function of aceA in the production of L-amino acids. SUMMARY OF THE INVENTION

[0006] The technical problem to be solved by the present application is how to improve the production amount of L-amino acids by genetic modification in microorganisms. The technical problem to be solved is not limited to the described technical subject, and those skilled in the art can also clearly understand other technical subjects not described in this specification from the following description.

[0007] To solve the above technical problem, the present application provides the use of substances that control the activity and / or content of proteins or proteins. The use may include any one of the following: A1) Use in the construction of genetically modified strains for producing L-amino acids, A2) Use in the production of L-amino acids, A3) Use in controlling the production amount of L-amino acids by microorganisms. The protein is named aceA protein and may include any one of the following: B1) A protein having the amino acid sequence shown in SEQ ID No. 2, B2) A protein having 90% or more identity with the protein described in B1) and having the same function, in which amino acid residues are substituted and / or deleted and / or added in the amino acid sequence shown in SEQ ID No. 2, B3) A fusion protein having the same function, with a tag linked to the N-terminus and / or C-terminus of B1) or B2).

[0008] The linkage in B3) is achieved via a peptide bond.

[0009] Tags include, but are not limited to, GST (glutathione S-transferase) tagged proteins, His-tag proteins, MBP (maltose-binding protein) tagged proteins, Flag-tagged proteins, SUMO-tagged proteins, HA-tagged proteins, Myc-tagged proteins, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag-tagged proteins.

[0010] Those skilled in the art can easily mutate the nucleotide sequence encoding the aceA protein of the present invention using known methods such as directed evolution and point mutation. Any artificially modified nucleotide having 75% or more identity with the nucleotide sequence of the isolated aceA protein of the present invention is derived from the nucleotide sequence of the present invention and is equivalent to the sequence of the present invention, as long as it encodes the aceA protein and has the function of the aceA protein.

[0011] A 75% or higher degree of identity may also be 80%, 85%, 90%, or 95% or higher.

[0012] In this specification, identity refers to the identity of an amino acid sequence or nucleotide sequence. Amino acid sequence identity can be measured using online identity search sites, such as the BLAST page on the NCBI homepage. For example, using the advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and then searching for and calculating amino acid sequence identity, the identity value (%) can be obtained.

[0013] In this specification, identity of 80% or more may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. Identity of 85% or more may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. Identity of 90% or more may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. A 95% or higher level of identity may be at least 95%, 96%, 97%, 98%, or 99%.

[0014] In this specification, a substance that controls the activity and / or content of a protein may be a substance that controls the expression of the gene encoding the aceA protein.

[0015] In the above, a substance that controls gene expression may be a substance that performs at least one of the following six types of control: 1) control at the transcriptional level of the gene, 2) control of the gene after transcription (including control of modification, splicing, and / or processing of the gene transcript), 3) control of the gene's RNA transport (including control of the transport of the gene's mRNA from the cell nucleus to the cytoplasm), 4) control of the gene's translation, 5) control of the gene's mRNA degradation, and 6) control of the gene after translation (including control of the activity of proteins translated from the gene, e.g., control of protein precursor processing, protein transport, protein degradation, and / or protein folding).

[0016] The substance that controls gene expression may specifically be any of the biomaterials described herein.

[0017] Furthermore, the substance controlling gene expression may be a substance (including nucleic acid molecules or vectors) that inhibits, reduces, or downregulates the expression of the gene encoding the aceA protein. The substance that inhibits, reduces, or downregulates the expression of the gene encoding the aceA protein may be a reagent that knocks out the gene (aceA gene), for example, a reagent that knocks out the gene via CRISPR-Cas9, or a reagent that knocks out the gene via homologous recombination. The reagent that inhibits or reduces gene expression may include polynucleotides that target the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0018] This application further provides the use of nucleic acid molecules encoding the aceA protein, including any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids. D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

[0019] In the above use, the nucleic acid molecule may include any one of the following: F1) DNA molecule whose coding sequence is SEQ ID No. 1, F2) A DNA molecule whose nucleotide sequence is SEQ ID No. 1.

[0020] This application further provides the use of nucleic acid molecules that inhibit or reduce the expression of a gene encoding the aceA protein, including any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids. D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

[0021] In the above use, the nucleic acid molecule may include any one of the following: H1) sgRNA1 whose target sequence is SEQ ID No. 11, H2) sgRNA2 whose target sequence is SEQ ID No. 12.

[0022] This application further provides the use of an expression cassette comprising any of the above nucleic acid molecules, comprising any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids. D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

[0023] This application further provides the use of recombinant vectors comprising any of the above nucleic acid molecules, comprising any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids. D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

[0024] This application further provides the use of recombinant microorganisms comprising any of the above nucleic acid molecules, including any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids. D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

[0025] This application further provides the use of recombinant host cells comprising any of the above nucleic acid molecules, including any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids. D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

[0026] Furthermore, expression cassettes, recombinant vectors, recombinant microorganisms, and recombinant host cells can express any of the above nucleic acid molecules.

[0027] The DNA molecule shown in SEQ ID No. 1 (also called the aceA gene) encodes the aceA protein, which has the amino acid sequence shown in SEQ ID No. 2.

[0028] The nucleic acid molecule may further include nucleic acid molecules obtained by modifying the codon bias based on the nucleotide sequence shown in SEQ ID No. 1.

[0029] The nucleic acid molecules that inhibit or reduce the expression of the gene encoding the aceA protein described herein may also be nucleic acid molecules that reduce the expression level of the aceA gene.

[0030] The nucleic acid molecules that inhibit or reduce the expression of the gene encoding the aceA protein may be sgRNA, microRNA, siRNA, shRNA, and / or antisense oligonucleotides.

[0031] Furthermore, sgRNA, microRNA, siRNA, shRNA, and / or antisense oligonucleotides are used to inhibit the expression of the aceA gene.

[0032] sgRNA1 can be used to induce gene mutations, specifically mutations in the aceA gene. sgRNA2 can be used for gene knockout, specifically to knock out the aceA gene.

[0033] As is well known to those skilled in the art, gene editing techniques can be used to inhibit the expression of the aceA gene, and gene knockdown techniques can be used to inactivate or silence the aceA gene at the post-transcriptional or translational level. Gene knockdown techniques include, but are not limited to, RNA interference, Morpholino interference, antisense nucleic acids, ribozymes, or dominant-negative mutations. It is also well known to those skilled in the art that the aceA gene can be silenced by inhibiting its expression using shRNA or siRNA expressed by viruses (such as lentiviruses or adeno-associated viruses).

[0034] Controlling the production of L-amino acids by microorganisms as described herein may involve increasing (upregulation) or decreasing (downregulation) the amount of L-amino acids accumulated in the microorganisms (promoting or inhibiting L-amino acid biosynthesis).

[0035] The vectors described herein mean vectors that can introduce, amplify, and express foreign DNA or a target gene in host cells. The vectors may be cloning vectors or expression vectors, and include, but are not limited to, plasmids, phages (such as λ phages and M13 filamentous phages), cosmids, Ti plasmids, and viral vectors (such as retroviruses (including lentiviruses), adenoviruses, and adeno-associated viruses). In one or more embodiments of the present invention, the vectors are pET28(a), pGRB vectors, and / or pREDCas9 plasmids.

[0036] The microorganisms described herein may be bacteria, fungi, actinomycetes, protozoa, algae, or viruses. Examples of bacteria include, but are not limited to, genera such as Escherichia sp., Erwinia sp., Agrobacterium sp., Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., and Bacillus sp. For example, the bacteria may be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniagenes, Corynebacterium crenatum, or Pantoea. The fungi may also be yeasts, and examples of yeasts include, but are not limited to, genera such as Saccharomyces (e.g., budding yeast, Saccharomyces cerevisiae), Kluyveromyces (e.g., Kluyveromyces lactis), Pichia (e.g., Pichia pastoris), Schizosaccharomyces (e.g., Schizosaccharomyces pombe), and Hansenula (e.g., Hansenula polymorpha). Other examples of fungi include, but are not limited to, genera such as Fusarium sp., Rhizoctonia sp., Verticillium sp., Penicillium sp., Aspergillus sp., and Cephalosporium sp.Actinomycetes include, but are not limited to, genera such as Streptomyces sp., Nocardia sp., Micromonospora sp., Streptosporangium sp., Actinoplanes sp., and Thermoactinomyces sp. Algae include, but are not limited to, genera such as Fucus sp., Achnanthes sp., Amphiprora sp., Amphora sp., Ankistrodesmus sp., Asteromonas sp., and Boekelovia sp. The virus may be, but is not limited to, rotavirus, herpesvirus, influenza virus, or adenovirus. In one or more embodiments of the present application, the microorganism is Escherichia coli DH5α, Escherichia coli W3110, and / or Escherichia coli CGMCC26289.

[0037] The host cells (also called receptor cells) described herein may be plant cells or animal cells. The host cells include not only specific receptor cells but also their offspring, which, due to natural, accidental, or intentional mutations and / or modifications, may not necessarily be completely identical to the original parent cells, but are still included in the scope of host cells. Suitable host cells are known in the art. Here, plant cells may be, but are not limited to, those of plants such as Arabidopsis thaliana, Nicotiana tabacum, Zea mays, Oryza sativa, and Triticum aestivum. Animal cells may include, but are not limited to, mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), African green monkey kidney cells (Vero cells), baby hamster kidney cells (BHK cells), mouse mammary cancer cells (C127 cells), human fetal kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells, or NK cells), avian cells (e.g., chicken or duck cells), amphibian cells (e.g., African clawed frog (Xenopus laevis) cells or giant salamander (Andrias davidianus) cells), fish cells (e.g., grass carp, carp, rainbow trout, or catfish cells), insect cells (e.g., Sf21 cells or Sf-9 cells), etc.

[0038] The recombinant vectors described herein refer to recombinant DNA molecules constructed by ligating an exogenous target gene or nucleic acid molecule to a vector in vitro.

[0039] The recombinant microorganisms (or recombinant host cells) described herein mean recombinant microorganisms (or recombinant host cells whose function has been altered) whose function has been changed by manipulating or modifying the genes of the target microorganism (or target host cell). Examples include recombinant microorganisms (or recombinant host cells) obtained by introducing an exogenous target gene or recombinant vector into the target microorganism (or target host cell), or recombinant microorganisms (or recombinant host cells) obtained by directly editing the endogenous genes of the target microorganism (or target host cell). Recombinant microorganisms (or recombinant host cells) include not only specific recombinant microorganisms (or recombinant host cells) but also their offspring, and it can be understood that the offspring are included in the scope of recombinant microorganisms (or recombinant host cells) even if they are not necessarily completely identical to the original parent cells due to natural, accidental, or intentional mutations and / or modifications.

[0040] The above recombinant microorganisms can be used to produce a variety of products, including, but not limited to, alanine, lysine, glutamic acid, valine, glycine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, and citrulline.

[0041] The recombinant vector described herein may be pET28(a)-aceA. Recombinant vector pET28(a)-aceA is a recombinant expression vector obtained by cloning the wild-type aceA gene and its promoter into the expression vector pET28(a). Recombinant vector pET28(a)-aceA contains the aceA gene and its promoter shown in SEQ ID No. 3.

[0042] The recombinant microorganism described herein may be DH5α / pET28(a)-aceA. The recombinant strain DH5α / pET28(a)-aceA is a recombinant strain obtained by introducing the recombinant vector pET28(a)-aceA into Escherichia coli DH5α. The recombinant strain DH5α / pET28(a)-aceA contains the aceA gene and its promoter shown in SEQ ID No. 3.

[0043] This invention further provides a method for increasing the production of L-amino acids by microorganisms. This method may include reducing the content and / or activity of aceA protein in the target microorganism to obtain a microorganism that produces more L-amino acids than the target microorganism.

[0044] The target microorganism may also be a microorganism containing a gene that codes for the aceA protein.

[0045] In the above method, reducing the content and / or activity of aceA protein in the target microorganism may include reducing the expression level and / or activity of the gene encoding aceA protein in the target microorganism.

[0046] In the above method, reducing the expression level and / or activity of the gene encoding the aceA protein in the target microorganism may be done by reducing or inactivating the activity of the gene encoding the aceA protein in the genome of the target microorganism using gene mutation technology, gene knockout technology, gene editing technology, or gene weakening technology.

[0047] In the above method, reducing or inactivating the activity of the gene encoding the aceA protein in the genome of the target microorganism using gene editing technology is performed using a CRISPR / Cas9 system, the CRISPR / Cas9 system includes a vector that expresses an sgRNA targeting the protein-coding gene, and the sgRNA may include any one of the following: G1) sgRNA1 for gene mutations, target sequence is SEQ ID No. 11. G2) sgRNA2 for gene knockout, target sequence is SEQ ID No. 12.

[0048] In the above method, the gene mutation described in G1) may be a mutation in which a DNA molecule having the nucleotide sequence shown in SEQ ID No. 1 in the target microorganism is changed to a DNA molecule shown in SEQ ID No. 5.

[0049] Specifically, the cytosine (C) at position 1111 of SEQ ID No. 1 is mutated to thymine (T) to obtain SEQ ID No. 5.

[0050] Furthermore, sgRNA1 is used to introduce a point mutation into the aceA gene coding region (SEQ ID No. 1). The point mutation changes the cytosine (C) at position 1111 of the aceA gene nucleotide sequence (SEQ ID No. 1) to thymine (T), resulting in the DNA molecule shown in SEQ ID No. 5 (mutant aceA gene, mutant aceA Q371* The goal is to obtain genes (and naming them).

[0051] The DNA molecule shown in SEQ ID No. 5 is a mutant protein (aceA) having the amino acid sequence shown in SEQ ID No. 6. Q371* It codes for a protein. In the mutant protein's amino acid sequence (SEQ ID No. 6), the stop codon at position 371 has been mutated from glutamine (Q).

[0052] All microorganisms obtained by any of the methods described herein, or any recombinant microorganisms described herein, are all within the scope of protection of this application.

[0053] The use of microorganisms obtained by any of the methods described herein, or any recombinant microorganisms described herein, in the fermentation production of L-amino acids is also within the scope of protection of this application.

[0054] The present invention further provides recombinant microorganisms in which the aceA protein is weakly expressed or not expressed at all.

[0055] Furthermore, weak expression or non-expression is achieved by reducing the expression level and / or activity of the gene encoding the aceA protein in the target microorganism.

[0056] Furthermore, reducing the expression level and / or activity of the gene encoding the aceA protein in the target microorganism involves reducing or inactivating the activity of the gene encoding the aceA protein in the genome of the target microorganism using gene mutation techniques, gene knockout techniques, gene editing techniques, or gene weakening techniques.

[0057] Furthermore, gene editing may be performed using a CRISPR / Cas9 system, which includes a vector expressing an sgRNA targeting a protein-coding gene, and the sgRNA includes one of the following: G1) sgRNA1 for gene mutations, target sequence is SEQ ID No. 11. G2) sgRNA2 for gene knockout, target sequence is SEQ ID No. 12.

[0058] Furthermore, the gene mutation described in G1) may involve mutating a DNA molecule having the nucleotide sequence shown in SEQ ID No. 1 in the target microorganism to the DNA molecule shown in SEQ ID No. 5.

[0059] The present invention further provides recombinant microorganisms containing nucleic acid molecules that inhibit or reduce the expression of genes encoding the aceA protein.

[0060] Furthermore, the nucleic acid molecule may contain one of the following: H1) sgRNA1 whose target sequence is SEQ ID No. 11, H2) sgRNA2 whose target sequence is SEQ ID No. 12.

[0061] This application further provides a protein named aceA Q371* This protein may include any one of the following: M1) A protein having the amino acid sequence shown in SEQ ID No. 6 M2) A protein having 80% or more identity with the protein described in M1) and having the same function, in which amino acid residues are substituted and / or deleted and / or added in the amino acid sequence shown in SEQ ID No. 6 M3) A fusion protein having the same function, with a tag linked to the N-terminus and / or C-terminus of M1) or M2)

[0062] The linkage in M3) is achieved via a peptide bond

[0063] This invention further provides a nucleic acid molecule encoding the aceA Q371* protein

[0064] This invention further provides an expression cassette containing a nucleic acid molecule encoding the aceA Q371* protein

[0065] This invention further provides a recombinant vector containing a nucleic acid molecule encoding the aceA Q371* protein

[0066] This invention further provides a recombinant microorganism containing a nucleic acid molecule encoding the aceA Q371* protein

[0067] This invention further provides a recombinant host cell containing a nucleic acid molecule encoding the aceA Q371* protein

[0068] Furthermore, the nucleic acid molecule may include the DNA molecule shown in SEQ ID No. 5

[0069] This application provides the aceA Q371* protein or aceAQ371* This further provides one of the following uses of a protein-coding nucleic acid molecule: N1) Use in the construction of genetically modified strains that produce L-amino acids. N2) Use in the production of L-amino acids, N3) Use in controlling the production of L-amino acids by microorganisms.

[0070] DNA molecule shown in SEQ ID No. 5 (aceA Q371* Because the thymine (T) at position 1111 in the gene (also known as the gene) is mutated from cytosine (C), translation is terminated prematurely, ultimately resulting in the mutant protein aceA, which has the amino acid sequence shown in SEQ ID No. 6. Q371* This can be obtained.

[0071] The L-amino acids described herein include L-alanine, L-valine, L-arginine, L-tryptophan, and / or L-threonine.

[0072] Isocitrate lyase (ICL) is an enzyme that breaks down isocitrate into glyoxylate and succinate in the glyoxylate cycle, and these products are synthesized into malate by malate synthase. This invention provides the use of the E. coli isocitrate lyase gene aceA in increasing the production of L-amino acids by microorganisms. In this invention, first, a random mutant plasmid was constructed using an aceA gene fragment containing random point mutations obtained by error-prone PCR amplification, and then E. coli W3110 was transformed to obtain aceA gene mutant W3110 strains with different mutations. After fermentation culture of the obtained mutant strains, the concentration (content) of L-alanine was analyzed using HPLC, and YPAla-aceA mutant strain 2, which showed superior L-alanine production ability compared to the wild-type W3110 strain and other mutant strains, was screened. Sequencing of the aceA gene in YPAla-aceA mutant strain 2 revealed that the cytosine (C) at position 1111 in the aceA gene's nucleotide sequence (SEQ ID No. 1) was mutated to thymine (T), and the glutamine (Q) at position 371 in the amino acid sequence of the encoded protein (SEQ ID No. 2) was mutated to a stop codon (the mutated gene is aceA). Q371* It was revealed that the gene (which was named aceA) and aceA Q371* To further investigate the influence of genes on L-amino acid production by production strains, this invention constructs two modified strains: 1) a modified aceA gene mutant strain in which a point mutation (CT) is introduced at position 1111 of the aceA gene coding region of a high-productivity L-amino acid strain and wild-type E. coli W3110; and 2) a modified strain in which the aceA gene is knocked out of a high-productivity L-amino acid strain and wild-type E. coli W3110. Fermentation experiments were conducted on the constructed modified strains, and the results showed that the aceA gene and its mutant aceA Q371* The gene is involved in L-amino acid biosynthesis, and it has been shown that knocking out or weakening the aceA gene, i.e., inhibiting or reducing the expression of the aceA gene, is advantageous for the accumulation of L-amino acids. (aceA gene and its variants) Q371*By constructing genetically modified strains that produce L-amino acids using genes (or similar), it is possible to promote an increase in L-amino acid production.

[0073] Deposit Information 1. Bacterial species name: Escherichia coli Latin name: Escherichia coli Classification name: Escherichia coli Strain number: YP007-1 Depository name: Center for Ordinary Microorganisms, China Microbial Species Preservation and Storage Administration Abbreviation for depositary institution: CGMCC Address: No. 3, No. 1, Beichen West Road, Beichen West Road, Chaoyang District, Beijing Deposit date: December 26, 2022 Deposit Center Registration Number: CGMCC No.26289 2. Bacterial species name: Escherichia coli Latin name: Escherichia coli Classification name: Escherichia coli Strain number: YP045 Depository name: Center for Ordinary Microorganisms, China Microbial Species Preservation and Storage Administration Abbreviation for depositary institution: CGMCC Address: No. 3, No. 1, Beichen West Road, Beichen West Road, Chaoyang District, Beijing Deposit date: June 15, 2021 Deposit Center Registration Number: CGMCC No.22721 3. Bacterial species name: Escherichia coli Latin name: Escherichia coli Classification name: Escherichia coli Strain number: YP004-8 Depository name: Center for Ordinary Microorganisms, China Microbial Species Preservation and Storage Administration Abbreviation for depositary institution: CGMCC Address: No. 3, No. 1, Beichen West Road, Beichen West Road, Chaoyang District, Beijing Deposit date: July 25, 2022 Deposit Center Registration Number: CGMCC No.25402 4. Bacterial species name: Escherichia coli Latin name: Escherichia coli Classification name: Escherichia coli Strain number: YP006D Depository name: Center for Ordinary Microorganisms, China Microbial Species Preservation and Storage Administration Abbreviation for depositary institution: CGMCC Address: No. 3, No. 1, Beichen West Road, Beichen West Road, Chaoyang District, Beijing Deposit date: July 25, 2022 Deposit Center Registration Number: CGMCC No.25403 5. Bacterial species name: Escherichia coli Latin name: Escherichia coli Classification name: Escherichia coli Strain number: YP0158 Depository name: Center for Ordinary Microorganisms, China Microbial Species Preservation and Storage Administration Abbreviation for depositary institution: CGMCC Address: No. 3, No. 1, Beichen West Road, Beichen West Road, Chaoyang District, Beijing Deposit date: July 25, 2022 Deposit Center Registration Number: CGMCC No.25404 [Modes for carrying out the invention]

[0074] The present invention will be described in detail below with reference to specific embodiments, but the examples shown are for illustrative purposes only and do not limit the scope of the present invention. The examples provided below can be used by those skilled in the art as a guide for further improvements, but do not limit the present invention in any way.

[0075] The experimental methods in the following examples are, unless otherwise specified, conventional methods and are carried out in accordance with the techniques or conditions described in the literature in this art, or in accordance with the product instructions. The materials, reagents, etc., used in the following examples are, unless otherwise specified, commercially available.

[0076] The Escherichia coli W3110 used in the following examples is a strain from the American Type Culture Collection (ATCC) with deposit number ATCC27325.

[0077] The pGRB cloning vector and pREDCas9 plasmid used in the following examples are products of Addgene.

[0078] In the following examples, the L-alanine-producing bacterium CGMCC26289 is Escherichia coli YP007-1 CGMCC No. 26289, and is abbreviated as CGMCC26289.

[0079] In the following examples, the L-valine-producing bacterium CGMCC22721 is Escherichia coli YP045 CGMCC No. 22721, and is abbreviated as CGMCC22721.

[0080] In the following examples, the L-arginine-producing bacterium CGMCC25402 is Escherichia coli YP004-8 CGMCC No. 25402, and is abbreviated as CGMCC25402.

[0081] In the following examples, the L-tryptophan-producing bacterium CGMCC25403 is Escherichia coli YP006D CGMCC No. 25403, and is abbreviated as CGMCC25403.

[0082] In the following examples, the L-threonine-producing bacterium CGMCC25404 is Escherichia coli YP0158 CGMCC No. 25404, and is abbreviated as CGMCC25404.

[0083] Example 1: Construction of a mutant strain containing the isocitrate lyase gene aceA 1. Construction of a mutant plasmid containing the isocitrate lyase gene aceA To facilitate the research, the wild-type aceA gene (nucleotide sequence SEQ ID No. 1) and its promoter were first cloned into the expression vector pET28(a). Using the Escherichia coli W3110 genome sequence published by NCBI as a template, PCR amplification was performed using primers PaceA-PF and PaceA-PR to obtain the wild-type aceA promoter, and PCR amplification was performed using primers aceA-PF and aceA-PR to obtain the wild-type aceA gene. After recovery, the expression vector pET28(a) (purchased from TaKaRa, containing kanamycin resistance), which was recovered by enzymatic cleavage with EcoRI / HindIII, was ligated with NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligated product was transformed into E. coli DH5α competent cells, spread on 2-YT agar medium containing kanamycin (50 mg / L), and cultured at 37°C to obtain pET28(a) transformants DH5α / pET28(a)-aceA (nucleotide sequences of the aceA gene and its promoter are SEQ ID No. 3), which contain the aceA gene and its promoter. The single clones obtained by culture were PCR identified using primers T7 / T7t and rTaq, and those containing a PCR-amplified 1889 bp fragment (sequence is SEQ ID No. 4) were designated as pET28(a)-positive transformants DH5α / pET28(a)-aceA, which contain the aceA gene and its promoter.

[0084] The extracted plasmid was named pET28(a)-aceA. Plasmid pET28(a)-aceA (also referred to herein as recombinant vector pET28(a)-aceA) is a recombinant expression vector obtained by cloning the wild-type aceA gene and its promoter into the expression vector pET28(a). Recombinant vector pET28(a)-aceA contains the aceA gene and its promoter shown in SEQ ID No. 3.

[0085] Recombinant strain DH5α / pET28(a)-aceA is a recombinant strain obtained by introducing the recombinant vector pET28(a)-aceA into Escherichia coli DH5α. Recombinant strain DH5α / pET28(a)-aceA contains the aceA gene and its promoter shown in SEQ ID No. 3.

[0086] To obtain a mutant encoding the isocitrate lyase gene aceA, a random mutagenesis kit (Agilent Technologies, USA) was used to construct an aceA mutant gene plasmid (aceA random mutant plasmid). Specifically, plasmid pET28(a)-aceA was used as a template, and PCR amplification was performed using primers PaceA-PF and aceA-PR to obtain a 1602 bp aceA gene fragment containing random point mutations, which was named DNA fragment 1 (the sequence is SEQ ID No. 3, but it has random point mutations in the aceA coding region).

[0087] PCR amplification system: 5×HiFi with Mg 2+ 10 μL of buffer, 1.5 μL of dNTP mixture (10 mM), 1.6 μL each of primers (10 pM), 0.5 μL of KAPA HiFi HotStart (1 U / μL), and ddH2O were added to make a total volume of 50 μL.

[0088] PCR amplification program: Pre-denaturation at 95°C for 5 minutes, (denaturation at 98°C for 20 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 60 seconds, 30 cycles), over-extension at 72°C for 5 minutes.

[0089] The recovered DNA fragment 1 was enzymatically cleaved with EcoRI / HindIII and ligated with the expression vector pET28(a) (purchased from TaKaRa, containing kanamycin resistance) using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligated product was transformed into DH5α-competent cells and cultured on 2-YT agar medium containing kanamycin (50 mg / L) at 37°C. The single clones obtained from the culture were PCR identified using primers T7 / T7t and rTaq. Those containing a PCR-amplified 1889 bp fragment (sequence ID No. 4, but with a random point mutation in the aceA coding region) were designated as pET28(a)-positive transformants containing a random aceA mutation. The extracted plasmid is an aceA random mutation plasmid.

[0090] PCR amplification system: 12.5 μL of 2× Premix r Taq, 1 μL each of primers (10 pM), and ddH2O were added to make a total volume of 25 μL.

[0091] PCR amplification program: Pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 90 seconds (30 cycles), and over-extension at 72°C for 10 minutes.

[0092] The primer was designed as follows (synthesized by Shanghai Invitrogen): PaceA-PF:5'- TAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCC TCTTCTGTGATAGTCGATCG-3' (The underlined nucleotide sequence is the pET28(a) homology arm sequence) (SEQ ID No. 13) PaceA-PR:5'-CTCCATAGTTATGTGGTGGTCGTGCAGCTCCTCGTCATG-3'(SEQ ID No.14), aceA-PF:5'-CCATGACGAGGAGCTGCACGACCACCACATAACTATGGAG-3'(SEQ ID No.15), aceA-PR:5'- CGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTGCTTAGAACTGCGATTCTTCAGTG-3' (The underlined nucleotide sequence is the pET28(a) homology arm sequence) (SEQ ID No. 16) T7:5'-TAATACGACTCACTATAGGG-3'(SEQ ID No.17), T7t:5'-GCTAGTTATT GCTCAGCGG-3' (SEQ ID No.18).

[0093] 2. Construction of a mutant strain possessing the isocitrate lyase gene aceA. To identify the L-alanine production of the mutant vector constructed in Procedure 1, specifically, the aceA random mutant plasmid constructed in Procedure 1 was used to transform an alanine-producing E. coli CGMCC26289 strain (transformation and identification were the same as in Procedure 1). The positive transformants were then subcultured for 3 passages on 2-YT agar medium containing kanamycin (50 mg / L), and then inoculated into a 500 mL Erlenmeyer flask containing 30 mL of nutrient-rich medium. Fermentation was carried out at 37°C for 24 hours with shaking. 600 When the value reached 0.2, a final concentration of 0.1 mM IPTG was added to induce overexpression of isocitrate lyase.

[0094] After fermentation culture, the concentration of L-amino acids was analyzed by high-performance liquid chromatography (HPLC) and is shown in Table 1. Strains with superior L-alanine production ability were selected as YPAla-aceA mutants.

[0095] Nutrient-rich medium: The solvent is water, and the solutes and their concentrations are: glucose 30 g / L, (NH4)2SO4 2 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.05 g / L, MnSO4·H2O 0.05 g / L, FM902 yeast powder 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, betaine 0.5 g / L, citric acid 2 g / L, VH 20 mg / L, VB1 1.5 mg / L, VB3 1.5 mg / L, VB 12 The concentration was 1.5 g / L, and the pH was adjusted to 7.0 with sodium hydroxide.

[0096] TIFF2026512836000001.tif40170

[0097] As shown in Table 1, the E. coli YPAla-aceA mutant strains of this invention have the ability to produce L-alanine, and among them, YPAla-aceA mutant strain 2 has superior L-alanine production ability and is almost identical to the production strain CGMCC26289.

[0098] Plasmid was extracted from YPAla-aceA mutant strain 2 and the aceA gene was sequenced. The results showed that the cytosine (C) at position 1111 in the aceA mutant's nucleotide sequence was mutated to thymine (T), and the glutamine (Q) at position 371 in the amino acid sequence of the mutant protein aceA was mutated to a stop codon. This plasmid is pET28(a)-aceA. Q371* (The sequence is shown in SEQ ID No. 3, and it was confirmed that position 1408 is mutated to (T)). Here, the DNA sequence shown in SEQ ID No. 1 is the wild-type aceA gene, the amino acid sequence of the encoded protein is SEQ ID No. 2 (this protein will be referred to as the wild-type aceA protein), and the DNA sequence shown in SEQ ID No. 5 is the mutant aceA. Q371* It is a gene, and the variant is aceA. Q371* In the gene sequence (SEQ ID No. 5), the thymine (T) at position 1111 has mutated from cytosine (C), and the amino acid sequence of the encoded protein is SEQ ID No. 6 (this mutant protein is called mutant aceA). Q371* It is a protein, and the mutant protein aceA Q371* The stop codon at position 371 in the amino acid sequence (SEQ ID No. 6) is mutated from glutamine (Q).

[0099] Example 2: Construction of a mutant strain containing the isocitrate lyase gene aceA Based on the genome sequence of Escherichia coli W3110 published by NCBI, point mutations were induced in the aceA gene of both the L-amino acid high-producing strain and wild-type E. coli W3110 using CRISPR / Cas9 gene editing technology, resulting in the development of the aceA gene and mutant aceA in the high-producing strain. Q371* We further studied the effects of genes on the production of amino acids such as L-alanine, L-valine, L-arginine, L-tryptophan, and L-threonine.

[0100] A point mutation is introduced into the aceA gene coding region (SEQ ID No. 1), which changes the cytosine (C) at position 1111 of the aceA gene nucleotide sequence (SEQ ID No. 1) to thymine (T), resulting in the DNA molecule shown in SEQ ID No. 5 (mutant aceA gene, mutant aceA Q371* The goal is to obtain genes.

[0101] Correspondingly, the DNA molecule shown in SEQ ID No. 5 is a mutant protein (aceA) whose amino acid sequence is SEQ ID No. 6. Q371* It codes for a protein. In the mutant protein's amino acid sequence (SEQ ID No. 6), the stop codon at position 371 has been mutated from glutamine (Q).

[0102] 1. Construction of sgRNA Based on the genome sequence of Escherichia coli W3110 published by NCBI, sgRNA (sgRNA1) target sequences were designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting appropriate sgRNA target sequences, terminal sequences of a linearized pGRB cloning vector were added to the 5' and 3' ends of the target sequences, and complete sgRNA plasmids were formed by recombination.

[0103] The sgRNA1 target sequence is 5'-AGCGGCGGACGCTAACCTGGCGG-3' (SEQ ID No. 11). sgRNA1 mutates the base C at position 1111 of the aceA gene to the base T, thereby creating a mutant gene (aceA Q371* (gene) and mutant protein (aceA Q371* Used to obtain protein.

[0104] To amplify DNA fragments containing the sgRNA1 target sequence, no template is required; only PCR annealing is necessary. The system and program are as follows: PCR reaction system: 10 μL of sgRNA-1F, 10 μL of sgRNA-1R. PCR reaction program: Denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute. After annealing, the target fragment (DNA fragment containing the sgRNA1 target sequence) was recovered using a DNA purification kit, its DNA concentration was measured, and the concentration was diluted to 100 ng / μL.

[0105] To prevent self-ligation of pGRB plasmids, the pGRB plasmids were enzymatically cleaved with SpeI and dephosphorylated. Enzymatic cleavage system: 5 μL of 10× Buffer, 2.5 μL of SpeI, 3000-5000 ng of pGRB plasmid DNA, and ddH2O were added to make a total volume of 50 μL. After enzymatic cleavage at 37°C for 3 hours, the plasmids were separated and recovered by agarose gel electrophoresis and dephosphorylated. Dephosphorylation system: 5 μL of 10× Buffer, 1000-2000 ng of linearized pGRB plasmid DNA, 2.5 μL of CIAP, and ddH2O were added to make a total volume of 50 μL. After treatment at 37°C for 1 hour, the linearized pGRB plasmids were recovered using a DNA purification kit. Recombination of the linearized pGRB plasmid with a DNA fragment containing the sgRNA1 target sequence was performed using the Gibson Assembly Kit (New England). Recombination system: 2.5 μL of NEB assembly enzyme, 2 μL of linearized pGRB plasmid, and 0.5 μL of DNA fragment containing the sgRNA1 target sequence. After assembly at 50°C for 30 minutes, the product was transformed into DH5α-competent cells, the plasmid was extracted, and sequencing was performed using the sequencing primers sgRNA-PF / sgRNA-PR. The constructed plasmid was named pGRB-sgRNA-1.

[0106] The primers used in this experiment were designed as follows (synthesized by Shanghai Invitrogen), with the underlined bases being homologous arm sequences of the pGRB cloning vector and the bolded bases being sgRNA1 target sequences. sgRNA-1F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT AGCGGCGGACGCTAACCTGGCGG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG -3' (SEQ ID No. 19), sgRNA-1R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC CCGCCAGGTTAGCGTCCGCCGCT ACTAGTATTATACCTAGGACTGAGCTAGCTGTCA -3' (SEQ ID No. 20), sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3' (SEQ ID No.21), sgRNA-PR:5'-ATGAGAAAGCGCCACGCT-3' (SEQ ID No.22).

[0107] 2. Genetic variant aceA Q371* DNA amplification Using W3110 genomic DNA as a template, PCR amplification was performed using primers P1 / P2, P3 / P4, and KAPA HiFi HotStart, respectively, yielding two aceA molecules with mutant bases of 641 bp and 628 bp. Q371* DNA fragment (aceA Q371* Up and aceA Q371* Down) was obtained. After the PCR reaction was complete, aceA was obtained by agarose gel electrophoresis using a column DNA gel recovery kit. Q371* Up and aceA Q371* Down was recovered from both DNA fragments. Using the two recovered DNAs as templates, overlap PCR amplification was performed using primers P1 / P4, and a point mutation was incorporated into the homology arm DNA fragment Up-aceA. Q371* -Down(SEQ ID No.7)1241bp was obtained.

[0108] PCR amplification system: 5×HiFi with Mg 2+ 10 μL of buffer, 1.5 μL of dNTP mixture (10 mM), 1.6 μL each of primers (10 pM), 0.5 μL of KAPA HiFi HotStart (1 U / μL), and ddH2O were added to make a total volume of 50 μL.

[0109] PCR amplification program: Pre-denaturation at 95°C for 5 minutes, (denaturation at 98°C for 20 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 60 seconds, 30 cycles), over-extension at 72°C for 5 minutes.

[0110] The primers were designed as follows (synthesized by Shanghai Invitrogen), with lowercase bold bases indicating mutation sites. P1:5'-TTGGCGGTGTCCTGAATGCC-3' (SEQ ID No.23), P2:5'-CATACCCTCGCCCTaGGCATAGGCGTTTGCCAGGTC-3' (SEQ ID No.24), P3:5'-AAACGCCTATGCCtAGGGCGAGGGTATGAAGCAC-3' (SEQ ID No.25), P4:5'-GTAAAAAATGCCGCGTCCGTAC-3' (SEQ ID No.26).

[0111] 3. Preparation and transformation of competent cells The pREDCas9 plasmid (containing the spectinomycin resistance gene) was used to transform competent cells of L-alanine-producing strain CGMCC26289, L-valine-producing strain CGMCC22721, L-arginine-producing strain CGMCC25402, L-tryptophan-producing strain CGMCC25403, L-threonine-producing strain CGMCC25404, and wild-type E. coli W3110, respectively. These cells were then spread on 2-YT agar medium containing spectinomycin (100 mg / L) and cultured at 32°C. Spectinomycin (100 mg / L) resistant single colonies were selected and identified by PCR using primers pRedCas9-PF / pRedCas9-PR and r Taq. The resulting colonies containing 943 bp (SEQ ID No. 8) were identified as the L-alanine-producing strain CGMCC26289-Cas9, L-valine-producing strain CGMCC22721-Cas9, L-arginine-producing strain CGMCC25402-Cas9, L-tryptophan-producing strain CGMCC25403-Cas9, L-threonine-producing strain CGMCC25404-Cas9, and wild-type E. coli W3110-Cas9, all containing the pREDCas9 plasmid.

[0112] Competent cells were prepared for the following strains: L-alanine-producing strain CGMCC26289-Cas9, L-valine-producing strain CGMCC22721-Cas9, L-arginine-producing strain CGMCC25402-Cas9, L-tryptophan-producing strain CGMCC25403-Cas9, L-threonine-producing strain CGMCC25404-Cas9, and wild-type E. coli W3110-Cas9. 600 When the value reached 0.1, IPTG at a final concentration of 0.1 mM was added to induce homologous recombination via λ-Red. 600When the value reaches 0.6, collect the bacterial cells and prepare competent cells, then add the pGRB-sgRNA-1 plasmid and the point mutation recombinant DNA fragment Up-aceA Q371* -Down cells were transformed and cultured on 2-YT agar medium containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) at 32°C. Transformants were identified by PCR using primers P5 / P6 and r Taq. The resulting 280 bp (SEQ ID No. 9) PCR product was denatured at 95°C for 10 minutes, placed on ice for 5 minutes, and then subjected to SSCP (Single-Strand Conformation Polymorphis) electrophoresis (Up-aceA). Q371* -Down-amplified PCR fragments were used as the positive control, W3110-amplified PCR fragments as the negative control, and water as the blank control. Because the fragment structures and electrophoretic positions are different, the electrophoretic position of the PCR fragments does not match the position of the negative control fragment. However, strains whose electrophoretic position matches that of the positive control fragment were considered to be strains in which allele substitution was successful.

[0113] The primer was designed as follows (synthesized by Shanghai Invitrogen): P5:5'-GGCAGAAAAACCTCGACGAC-3' (SEQ ID No.27), P6:5'-CCCTGAATAATAGTCGTCAC-3'(SEQ ID No.28), pRedCas9-PF:5'-GCAGTGGCGGTTTTCATG-3' (SEQ ID No.29), pRedCas9-PR:5'-CCTTGGTGATCTCGCCTTTC-3' (SEQ ID No. 30).

[0114] PCR amplification system: 12.5 μL of 2× Premix r Taq, 1 μL each of primers (10 pM), and ddH2O were added to make a total volume of 25 μL.

[0115] PCR amplification program: Pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 90 seconds (30 cycles), and over-extension at 72°C for 10 minutes.

[0116] Preparation of PAGE for SSCP electrophoresis and electrophoresis conditions: 8 mL of 40% acrylamide, 4 mL of glycerin, 2 mL of 10×TBE, 40 μL of TEMED, 600 μL of 10% APS, and 26 mL of ddH2O. Place the electrophoresis tank on ice and perform electrophoresis with 1×TBE buffer at a voltage of 120 V for 10 hours.

[0117] Transformants that successfully exhibited point mutations were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and 0.2% arabinose to remove the pGRB-sgRNA-1 plasmid. Colonies that grew with spectinomycin (100 mg / L) but not with ampicillin (100 mg / L) were selected, transferred to 2-YT medium, and cultured at 42°C to remove the pREDCas9 plasmid. Colonies that did not grow with spectinomycin (100 mg / L) but grew with antibiotic-free 2-YT medium were selected, and PCR amplification was performed again using primers P5 / P6 to determine the sequence of the point mutation. The sequencing results were compared with the W3110 genome sequence, and those in which base C at position 1111 of the aceA gene was mutated to base T were identified as the genomutated aceA type. Q371* It was confirmed to be a positive transformant. Genetic variant: aceA Q371* The L-alanine-producing strain is YPAla-aceA001, and the genetically variant aceA. Q371* The L-valine-producing strain is YPV-aceA001, and the genetically mutant aceA Q371* The L-arginine-producing strain is YPR-aceA001, and the genetically mutant aceA Q371* The L-tryptophan-producing strain is YPTrp-aceA001, and the genetically variant aceA Q371* The L-threonine-producing strain is YPThr-aceA001, and the genetically mutant aceA Q371* The E. coli strain W3110 was named W3110-aceA001.

[0118] Example 3: Construction of a modified strain lacking the isocitrate lyase gene aceA in the genome. Based on the genome sequence of Escherichia coli W3110 published by NCBI, we further investigated the effects of the E. coli aceA gene on the synthesis of amino acids such as L-alanine, L-valine, L-arginine, L-tryptophan, and L-threonine by knocking out the aceA gene in L-alanine-producing strain CGMCC26289, L-valine-producing strain CGMCC22721, L-arginine-producing strain CGMCC25402, L-tryptophan-producing strain CGMCC25403, L-threonine-producing strain CGMCC25404 (sequencing confirmed that the wild-type aceA gene is retained on the chromosomes of these amino acid-producing strains), and wild-type E. coli W3110, using CRISPR / Cas9 gene editing technology.

[0119] 1. Construction of sgRNA Based on the genome sequence of Escherichia coli W3110 published by NCBI, sgRNA target sequences (sgRNA2) were designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting appropriate sgRNA target sequences, homologous arm sequences of a linearized pGRB cloning vector were added to the 5' and 3' ends of the target sequences, and complete sgRNA plasmids were formed by recombination.

[0120] The sgRNA2 target sequence is 5'-CCTGGCGGCCAGCATGTATCCGG-3' (SEQ ID No. 12). sgRNA2 is used to knock out the aceA gene.

[0121] To amplify DNA fragments containing the sgRNA2 target sequence, no template is required; only PCR annealing is necessary. The system and program are as follows: PCR reaction system: 10 μL of sgRNA-3F, 10 μL of sgRNA-3R. PCR reaction program: Denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute. After annealing, the target fragment (DNA fragment containing the sgRNA2 target sequence) was recovered using a DNA purification kit, its DNA concentration was measured, and the concentration was diluted to 100 ng / μL.

[0122] To prevent self-ligation of pGRB plasmids, the pGRB plasmids were enzymatically cleaved with SpeI and dephosphorylated. Enzymatic cleavage system: 5 μL of 10× Buffer, 2.5 μL of SpeI, 3000-5000 ng of pGRB plasmid DNA, and ddH2O were added to make a total volume of 50 μL. After enzymatic cleavage at 37°C for 3 hours, the plasmids were separated and recovered by agarose gel electrophoresis and dephosphorylated. Dephosphorylation system: 5 μL of 10× Buffer, 1000-2000 ng of linearized pGRB plasmid DNA, 2.5 μL of CIAP, and ddH2O were added to make a total volume of 50 μL. After treatment at 37°C for 1 hour, the linearized pGRB plasmids were recovered using a DNA purification kit. Recombination of the linearized pGRB plasmid with a DNA fragment containing the sgRNA2 target sequence was performed using the Gibson Assembly Kit (New England). Recombination system: 2.5 μL of NEB assembly enzyme, 2 μL of linearized pGRB plasmid, and 0.5 μL of DNA fragment containing the sgRNA2 target sequence. After assembly at 50°C for 30 minutes, the product was transformed into DH5α-competent cells, the plasmid was extracted, and sequencing was performed using the sequencing primers sgRNA-PF / sgRNA-PR. The constructed plasmid was named pGRB-sgRNA-2.

[0123] The primers used in this experiment were designed as follows (synthesized by Shanghai Invitrogen), with the underlined bases being homologous arm sequences of the pGRB cloning vector and the bases in red being sgRNA2 target sequences. sgRNA-2F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTCCTGGCGGCCAGCATGTATCCGG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG -3' (SEQ ID No. 31), sgRNA-2R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC CCGGATACATGCTGGCCGCCAGG ACTAGTATTATACCTAGGACTGAGCTAGCTGTCA -3' (SEQ ID No. 32), sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3' (SEQ ID No.21), sgRNA-PR:5'-ATGAGAAAGCGCCACGCT-3' (SEQ ID No.22).

[0124] 2. PCR amplification of DNA recombinant fragments deleted from the genome. Based on the genome sequence of Escherichia coli W3110 published by NCBI, two pairs of primers were designed and synthesized to amplify upstream and downstream homologous arm sequences. The aceA gene was then knocked out by CRISPR / Cas9 gene editing in L-alanine-producing strain CGMCC26289, L-valine-producing strain CGMCC22721, L-arginine-producing strain CGMCC25402, L-tryptophan-producing strain CGMCC25403, L-threonine-producing strain CGMCC25404, and wild-type E. coli W3110.

[0125] The primer was designed as follows (synthesized by Shanghai Invitrogen): P7:5'-GATGAAGAGCACAATAACCAGG-3'(SEQ ID No.33), P8:5'-CAGTCAGCAACGGTTGTTGTTGCGTGCAGATGCTCCATAGTTATG-3'(SEQ ID No.34), P9:5'-CATAACTATGGAGCATCTGCACGCAACAACAACCGTTGCTGACTG-3' (SEQ ID No.35), 10:5'-CGCATCAGTAGAGATTCCCAGC-3'(SEQ ID No.36).

[0126] Using W3110 genomic DNA as a template, PCR amplification was performed using primers P7 / P8, P9 / P10, and KAPA HiFi HotStart to obtain upstream homology arm fragments of 643 bp and 668 bp, respectively. After the PCR reaction was complete, each fragment was recovered by agarose gel electrophoresis using a column-type DNA gel recovery kit. The recovered DNA was subjected to overlap PCR amplification using primers P7 / P10 to obtain a recombinant DNA fragment ΔaceA-Up-Down (SEQ ID No. 10), 1266 bp, in which the aceA gene was deleted from the genome.

[0127] PCR amplification system: 5×HiFi with Mg 2+ 10 μL of buffer, 1.5 μL of dNTP mixture (10 mM), 1.6 μL each of primers (10 pM), 0.5 μL of KAPA HiFi HotStart (1 U / μL), and ddH2O were added to make a total volume of 50 μL.

[0128] PCR amplification program: Pre-denaturation at 95°C for 5 minutes, (denaturation at 98°C for 20 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 60 seconds, 30 cycles), over-extension at 72°C for 5 minutes.

[0129] 3. Preparation and transformation of competent cells Competent cells were prepared for the following strains: L-alanine-producing strain CGMCC26289-Cas9, L-valine-producing strain CGMCC22721-Cas9, L-arginine-producing strain CGMCC25402-Cas9, L-tryptophan-producing strain CGMCC25403-Cas9, L-threonine-producing strain CGMCC25404-Cas9, and wild-type E. coli W3110-Cas9. 600 When the value reached 0.1, IPTG at a final concentration of 0.1 mM was added to induce homologous recombination via λ-Red. 600When the ratio reached 0.6, bacterial cells were collected and competent cells were prepared. These cells were transformed with the pGRB-sgRNA-2 plasmid and the recombinant DNA fragment ΔaceA-Up-Dwon, which lacked aceA from the genome, respectively. The cells were then spread on 2-YT agar medium containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and cultured at 32°C. Single colonies obtained from the culture were identified by PCR using primers P7 / P10 and r Taq. Cells containing a PCR-amplified 1266 bp (SEQ ID No. 10) fragment were considered positive transformants, and those containing a PCR-amplified 2571 bp fragment were considered the original strain.

[0130] Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and 0.2% arabinose to remove the pGRB-sgRNA-2 plasmid. Colonies that grew with spectinomycin (100 mg / L) but not with ampicillin (100 mg / L) were selected, transferred to 2-YT medium, and cultured at 42°C to remove the pREDCas9 plasmid. Colonies that did not grow with spectinomycin (100 mg / L) but grew with antibiotic-free 2-YT medium were selected, and re-identified by PCR using primers P7 / P10 and r Taq. Transformants containing PCR-amplified 1266 bp (SEQ ID No. 10) were identified as positive transformants.

[0131] A positive transformant lacking the aceA gene from the genome of the L-alanine-producing strain CGMCC26289 was named YPAla-aceA002, a positive transformant lacking the aceA gene from the genome of the L-valine-producing strain CGMCC22721 was named YPV-aceA002, and a positive transformant lacking the aceA gene from the genome of the L-arginine-producing strain CGMCC25402 was named YPR-aceA002. A positive transformant lacking the aceA gene from the genome of the L-tryptophan-producing strain CGMCC25403 was named YPTrp-aceA002, a positive transformant lacking the aceA gene from the genome of the L-threonine-producing strain CGMCC25404 was named YPThr-aceA002, and a positive transformant lacking the aceA gene from the genome of wild-type Escherichia coli W3110 was named W3110-aceA002.

[0132] PCR amplification system: 12.5 μL of 2× Premix r Taq, 1 μL each of primers (10 pM), and ddH2O were added to make a total volume of 25 μL.

[0133] PCR amplification program: Pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 90 seconds (30 cycles), and over-extension at 72°C for 10 minutes.

[0134] Example 4: Fermentation Experiment 1. L-alanine fermentation experiment Escherichia coli strain W3110, L-alanine-producing strain CGMCC26289, and aceA-modified strains YPAla-aceA001, W3110-aceA001, YPAla-aceA002, and W3110-aceA002 were inoculated into 5L fermentation tanks of type BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.), and fermentation experiments were conducted using L-alanine fermentation medium and culture conditions, repeating three times for each strain. After fermentation was complete, the L-alanine content was measured by high-performance liquid chromatography (HPLC), and the average value from the three repetitions is shown in Table 2.

[0135] L-alanine fermentation medium: The solvent was water, and the solutes and their concentrations were glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·7H2O 0.01 g / L, FM902 yeast powder 1.5 g / L, corn steep liquor 5 g / L, and molasses 17 g / L. Ammonia was added to adjust the pH to 7.0.

[0136] L-alanine fermentation culture conditions: Calibration DO100%: Temperature 37℃, airflow 5L / min, rotation speed 800rpm, tank pressure 0Mpa, calibration after 5 min. Inoculation amount: 10% Initial conditions: pH 7.0, culture temperature 37°C, tank pressure 0 MPa, airflow 0.5 L / min, rotation speed 400 rpm Overall control: 1. If dissolved oxygen is less than 30%, increase the rotation speed in the following order: 500 rpm → 600 rpm → airflow 1 L / min → 700 rpm → 800 rpm; 2. After 8 hours of fermentation, increase the tank pressure to 0.01 MPa, and after 12 hours of fermentation, increase the tank pressure to 0.02 MPa → 0.03 MPa → 0.04 MPa → 0.05 MPa. Residual sugar control: Before F12h, residual sugar is controlled to 0.1-0.5%, and after F12h, it is controlled to 0.1-0.3% according to DO requirements. Formula ingredients: 25% aqueous ammonia, 55% concentrated sugar, 10% GPE-type defoaming agent Fermentation cycle: Approximately 30 hours. During the control process, the airflow is increased or decreased based on a dissolved oxygen level of 20% to 30%.

[0137] TIFF2026512836000002.tif74170

[0138] The fermentation results described above indicate that, in both the L-alanine-high-producing strain CGMCC26289 and the wild-type E. coli W3110, replacing the glutamine at position 371 in the amino acid sequence of the aceA gene with a stop codon, or completely knocking out the aceA gene, is conducive to increasing L-alanine production.

[0139] 2. L-valine fermentation experiment Escherichia coli strain W3110, L-valine-producing strain CGMCC22721, and aceA-modified strains YPV-aceA001, W3110-aceA001, YPV-aceA002, and W3110-aceA002 were inoculated into 5L fermentation tanks of type BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.), and fermentation experiments were conducted using L-valine fermentation medium and culture conditions, repeating three times for each strain. After fermentation was complete, the L-valine content was measured by high-performance liquid chromatography (HPLC), and the average value from the three repetitions is shown in Table 3.

[0140] L-valine fermentation medium: The solvent is water, and the solutes and their concentrations are: yeast extract powder 4g / L, corn steep liquor powder 2g / L, peptone 4g / L, methionine 2g / L, KH2PO4·3H2O 7g / L, MgSO4·7H2O 2g / L, CoCl2 20mg / L, (NH4)2SO4 3g / L, citric acid 2g / L, FeSO4·7H2O 50mg / L, MnSO4·7H2O 30mg / L, VH 20mg / L, VB1 1.5mg / L, VB3 1.5mg / L, VB 12 The concentration is 1.5 g / L, with 0.3 mL / L of antifoaming agent and 3 g / L of (NH4)2SO4, and the pH is 7.0.

[0141] L-valine fermentation culture conditions: Dissolved oxygen Electrode calibration method: Zero point calibration with saturated sodium sulfite solution, span point calibration in air L-valine fermentation consists of two stages: aerobic fermentation and oxygen-restricted fermentation. Cells are cultured under aerobic conditions, and in the initial stage, dissolved oxygen is controlled to approximately 25% by adjusting the airflow, rotation speed, and sugar supply rate. 600 When the value reaches 50-60, the rotation speed is reduced to 400 rpm and the airflow to 2 L / min, and the process transitions from aerobic fermentation to oxygen-restricted fermentation. Calibration DO100%: Temperature 33℃, airflow 1L / min, rotation speed 400rpm, tank pressure 0.01Mpa, calibration after 5 min. Inoculation amount: 3.5% Fermentation cycle: Approximately 18-20 hours

[0142] TIFF2026512836000003.tif74170

[0143] The above fermentation results indicate that, in both the L-valine high-producing strain CGMCC22721 and the wild-type E. coli W3110, substituting the glutamine at position 371 in the amino acid sequence of the aceA gene with a stop codon, or completely knocking out the aceA gene, is advantageous for increasing L-valine production.

[0144] III. L-arginine fermentation experiment Escherichia coli strain W3110, L-arginine-producing strain CGMCC25402, and aceA-modified strains YPR-aceA001, W3110-aceA001, YPR-aceA002, and W3110-aceA002 were inoculated into 5L fermentation tanks of type BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.), and fermentation experiments were conducted using L-arginine fermentation medium and culture conditions, repeating three times for each strain. After fermentation was complete, the L-arginine content was measured by high-performance liquid chromatography (HPLC), and the average value from the three repetitions is shown in Table 4.

[0145] L-arginine fermentation medium: The solvent is water, and the solutes and their concentrations are: glucose 8 g / L, FM902 yeast powder 3 g / L, K2HPO4·3H2O 6 g / L, MgSO4·7H2O 1 g / L, FeSO4·7H2O 0.05 g / L, betaine 0.5 g / L, VB 12 The concentration is 0.005 g / L, with 0.3 mL / L of antifoaming agent and 3 g / L of ammonium sulfate, and the pH is 7.2.

[0146] L-arginine fermentation culture conditions: Calibration DO100%: Temperature 35℃, pH 7.2, rotation speed 100rpm, airflow 6L / min, tank pressure 0.00Mpa Inoculation amount: 10% Initial conditions: Temperature 35°C, pH 7.2, Tank pressure 0.01 MPa, Airflow 1.5 L / min, Rotation speed 350 rpm Overall control: When DO is controlled to 20%-30% and dissolved oxygen is below 25%, the rotation speed increases from 300rpm → 400rpm → 2.0L / min → 500rpm → 0.02Mpa → 600rpm → 3.0L / min → 0.03Mpa → 700rpm → 3.5L / min → 0.04Mpa → 800rpm → 900rpm → 4.0L / min → 0.05Mpa → 1000rpm. Residual sugar control: Controlling residual sugar to 0.05% to 0.1% throughout the entire process. Formula ingredients: 25% ammonia water, 80% concentrated sugar, 10% GPE-type defoaming agent Fermentation cycle: Approximately 50 hours. During the control process, the airflow is increased or decreased based on a dissolved oxygen level of 20% to 30%.

[0147] TIFF2026512836000004.tif74170

[0148] The fermentation results described above indicate that, in both the L-arginine-high-producing strain CGMCC25402 and the wild-type E. coli W3110, replacing the glutamine at position 371 in the amino acid sequence of the aceA gene with a stop codon, or completely knocking out the aceA gene, is advantageous for increasing L-arginine production.

[0149] IV. L-tryptophan fermentation experiment Escherichia coli strain W3110, L-tryptophan-producing strain CGMCC25403, and aceA-modified strains YPTrp-aceA001, W3110-aceA001, YPTrp-aceA002, and W3110-aceA002 were inoculated into 5L fermentation tanks of type BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.), and fermentation experiments were conducted using L-tryptophan fermentation medium and culture conditions, repeating three times for each strain. After fermentation was complete, the L-tryptophan content was measured by high-performance liquid chromatography (HPLC), and the average value from the three repetitions is shown in Table 5.

[0150] L-tryptophan fermentation medium: The solvent was water, and the solutes and their concentrations were glucose 7 g / L, FM902 yeast powder 1 g / L, (NH4)2SO4 1.2 g / L, citric acid 1.2 g / L, MgSO4·7H2O 1.5 g / L, K2HPO4·3H2O 5.5 g / L, and antifoaming agent 0.2 mL / L. Ammonia was added to adjust the pH to 7.0.

[0151] L-tryptophan alanine fermentation culture conditions: Calibration DO100%: Temperature 35℃, Rotation speed 800rpm, Air volume 5L / min, Tank pressure 0.00Mpa Inoculation amount: 10% Initial conditions: Temperature 35°C, pH 7.0, airflow 1.0 L / min, rotation speed 350 rpm Overall control: If dissolved oxygen is below 20% before the basal sugar is depleted, the engine speed increases in the order of 400 rpm → 450 rpm; once the basal sugar is depleted, sugar is replenished to control the dissolved oxygen level to 15%~30%; the pH is 7.0 before F24h and 6.7 after F24h. Residual sugar control: Before F12h, residual sugar is controlled to 0.1%~0.5%, and after F12h, it is controlled to 0.1%~0.3% according to DO requirements. Formula ingredients: 25% aqueous ammonia, 55% concentrated sugar, 10% GPE-type defoaming agent Fermentation cycle: Approximately 34 hours. During the control process, the airflow is increased or decreased based on a dissolved oxygen level of 15% to 30%.

[0152] TIFF2026512836000005.tif80170

[0153] The above fermentation results indicate that, in both the L-tryptophan high-producing strain CGMCC25403 and the wild-type E. coli W3110, substituting the glutamine at position 371 in the amino acid sequence of the aceA gene with a stop codon, or completely knocking out the aceA gene, is advantageous for increasing L-tryptophan production.

[0154] 5. L-threonine fermentation experiment Escherichia coli strain W3110, L-threonine-producing strain CGMCC25404, and aceA-modified strains YPThr-aceA001, W3110-aceA001, YPThr-aceA002, and W3110-aceA002 were inoculated into 5L fermentation tanks of type BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.), and fermentation experiments were conducted using L-threonine fermentation medium and culture conditions, repeating three times for each strain. After fermentation was complete, the L-threonine content was measured by high-performance liquid chromatography (HPLC), and the average value from the three repetitions is shown in Table 6.

[0155] L-threonine fermentation medium: The solvent was water, and the solutes and their concentrations were glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·H2O 0.01 g / L, FM902 yeast powder 1.5 g / L, corn steep liquor 5 g / L, and molasses 17 g / L. Ammonia was added to adjust the pH to 7.0.

[0156] L-threonine fermentation culture conditions: Calibration DO100%: Temperature 37℃, airflow 5L / min, rotation speed 800rpm, tank pressure 0Mpa, calibration after 5 min. Inoculation amount: 10% Initial conditions: pH 7.0, culture temperature 37°C, tank pressure 0 MPa, airflow 0.5 L / min, rotation speed 400 rpm Overall control: 1. If dissolved oxygen is less than 30%, increase the rotation speed in the following order: 500 rpm → 600 rpm → airflow 1 L / min → 700 rpm → 800 rpm; 2. After 8 hours of fermentation, increase the tank pressure to 0.01 MPa, and after 12 hours of fermentation, increase the tank pressure to 0.02 MPa → 0.03 MPa → 0.04 MPa → 0.05 MPa. Residual sugar control: Before F12h, residual sugar is controlled to 0.1-0.5%, and after F12h, it is controlled to 0.1-0.3% according to DO requirements. Formula ingredients: 25% aqueous ammonia, 55% concentrated sugar, 10% GPE-type defoaming agent Fermentation cycle: Approximately 30 hours. During the control process, the airflow is increased or decreased based on a dissolved oxygen level of 20% to 30%.

[0157] TIFF2026512836000006.tif74170

[0158] The above fermentation results indicate that, in both the L-threonine-high-producing strain CGMCC25404 and the wild-type E. coli W3110, substituting the glutamine at position 371 in the amino acid sequence of the aceA gene with a stop codon, or completely knocking out the aceA gene, is advantageous for increasing L-threonine production.

[0159] The present invention has been described in detail above. Those skilled in the art will be able to implement the present invention over a wider range of parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without performing unnecessary experiments. While the present invention has shown specific embodiments, it should be understood that further improvements can be made to the present invention. In short, based on the principles of the present invention, this application is intended to include any modifications, uses, or improvements to the present invention, including those that deviate from the scope disclosed herein and are made using prior art known in the art. Some basic features may be applied within the scope of the appended claims below.

[0160] Some of the sequences used in this specification are as follows: SEQ ID No.1: Wild-type aceA gene ORF(CDS) nucleotide sequence (1305 bp) 1 ATGAAAACCC GTACACAACA AATTGAAGAA TTACAGAAAG AGTGGACTCA ACCGCGTTGG 61 GAAGGCATTA CTCGCCCATA CAGTGCGGAA GATGTGGTGA AATTACGCGG TTCAGTCAAT 121 CCTGAATGCA CGCTGGCGCA ACTGGGCGCA GCGAAAATGT GGCGTCTGCT GCACGGTGAG 181 TCGAAAAAAG GCTACATCAA CAGCCTCGGC GCACTGACTG GCGGTCAGGC GCTGCAACAG 241 GCGAAAGCGG GTATTGAAGC AGTCTATCTG TCGGGATGGC AGGTAGCGGC GGACGCTAAC 301 CTGGCGGCCA GCATGTATCC GGATCAGTCG CTCTATCCGG CAAACTCGGT GCCAGCTGTG 361 GTGGAGCGGA TCAACAACAC CTTCCGTCGT GCCGATCAGA TCCAATGGTC CGCGGGCATT 421 GAGCCGGGCG ATCCGCGCTA TGTCGATTAC TTCCTGCCGA TCGTTGCCGA TGCGGAAGCC 481 GGTTTTGGCG GTGTCCTGAA TGCCTTTGAA CTGATGAAAG CGATGATTGA AGCCGGTGCA 541 GCGGCAGTTC ACTTCGAAGA TCAGCTGGCG TCAGTGAAGA AATGCGGTCA CATGGGCGGC 601 AAAGTTTTAG TGCCAACTCA GGAAGCTATT CAGAAACTGG TCGCGGCGCG TCTGGCAGCT 661 GACGTGACGG GCGTTCCAAC CCTGCTGGTT GCCCGTACCG ATGCTGATGC GGCGGATCTG 721 ATCACCTCCG ATTGCGACCC GTATGACAGC GAATTTATTA CCGGCGAGCG TACCAGTGAA 781 GGCTTCTTCC GTACTCATGC GGGCATTGAG CAAGCGATCA GCCGTGGCCT GGCGTATGCG 841 CCATATGCTG ACCTGGTCTG GTGTGAAACC TCCACGCCGG ATCTGGAACT GGCGCGTCGC 901 TTTGCACAAG CTATCCACGC GAAATATCCG GGCAAACTGC TGGCTTATAA CTGCTCGCCG 961 TCGTTCAACT GGCAGAAAA CCTCGACGAC AAAACTATTG CCAGCTTCCA GCAGCAGCTG 1021 TCGGATATGG GCTACAAGTT CCAGTTCATC ACCCTGGCAG GTATCCACAG CATGTGGTTC 1081 AACATGTTTG ACCTGGCAAA CGCCTATGCC CAGGGCGAGG GTATGAAGCA CTACGTTGAG 1141 AAAGTGCAGC AGCCGGAATT TGCCGCCGCG AAAGATGGCT ATACCTTCGT ATCTCACCAG 1201 CAGGAAGTGG GTACAGGTTA CTTCGATAAA GTGACGACTA TTATTCAGGG CGGCACGTCT 1261 TCAGTCACCG CGCTGACCGG CTCCACTGAA GAATCGCAGT TCTAA SEQ ID No.2: Protein complex of aceA fragment(434aa) . MKTRTQQIEE LQKEWTQPRW EGITRPYSAE DVVKLRGSVN PECTLAQLGA AKMWRLLHGE61 SKKGYINSLG ALTGGQALQQ AKAGIEAVYL SGWQVAADAN LAASMYPDQS LYPANSVPAV1 VERINNTFRR ADQWSAGI EPGDPRYVDY FLPIVADAEA GFGGVLNAFE LMKAMIEAGA181 AAVHFEDQLA SVKKCGHMGG KVLVPTQEAI QKLVAARLAA DVTGVPTLLV ARTDADAADL2 ITSDCDPYDS EFITGERTSE GFFRTHAGIE QAISRGLAYA PYADLVWCET STPDLELARR301 FAQAIHAKYP GKLLAYNCSP SFNWQKNLDD KTIASFQQQL SDMGYKFQFI TLAGIHSMWF361 NMFDLANAYA QGEGMKHYVE KVQQPEFAAA KDGYTFVSHQ QEVGTGYFDK VTTIIQGGTS421 SVTALTGSTE ESQF* SEQ ID No.5:chain aceA Q371* Composite ORF(CDS) Catalytic Fragment(1305bp) 1 ATGAAAACCC GTACACAACA ATGAAAGA TTACAGAAAG AGTGGACTCA ACCGCGTTGG 61 GAAGGCATTA CTCGCCCATA CAGTGCGGAA GATGTGGTGA AATTACGCGG TTCAGTCAAT 121 CCTGAATGCA CGCTGGCGCA ACTGGGCGCA GCGAAAATGT GGCGTCTGCT GCACGGTGAG 181 TCGAAAAAAG GCTACATCAA CAGCCTCGGC GCACTGACTG GCGGTCAGGC GCTGCAACAG 241 GCGAAAGCGG GTATTGAAGC AGTCTATCTG TCGGGATGGC AGGTAGCGGC GGACGCTAAC 301 CTGGCGGCCA GCATGTATCC GGATCAGTCG CTCTATCCGG CAAACTCGGT GCCAGCTGTG 361 GTGGAGCGGA TCAACAACAC CTTCCGTCGT GCCGATCAGA TCCAATGGTC CGCGGGCATT 421 GAGCCGGGCG ATCCGCGCTA TGTCGATTAC TTCCTGCCGA TCGTTGCCGA TGCGGAAGCC 481 GGTTTTGGCG GTGTCCTGAA TGCCTTTGAA CTGATGAAAG CGATGATTGA AGCCGGTGCA 541 GCGGCAGTTC ACTTCGAAGA TCAGCTGGCG TCAGTGAAGA AATGCGGTCA CATGGGCGGC 601 AAAGTTTTAG TGCCAACTCA GGAAGCTATT CAGAAACTGG TCGCGGCGCG TCTGGCAGCT 661 GACGTGACGG GCGTTCCAAC CCTGCTGGTT GCCCGTACCG ATGCTGATGC GGCGGATCTG 721 ATCACCTCCG ATTGCGACCC GTATGACAGC GAATTTATTA CCGGCGAGCG TACCAGTGAA 781 GGCTTCTTCC GTACTCATGC GGGCATTGAG CAAGCGATCA GCCGTGGCCT GGCGTATGCG 841 CCATATGCTG ACCTGGTCTG GTGTGAAACC TCCACGCCGG ATCTGGAACT GGCGCGTCGC 901 TTTGCACAAG CTATCCACGC GAAATATCCG GGCAAACTGC TGGCTTATAA CTGCTCGCCG 961 TCGTTCAACT GGCAGAAAAA CCTCGACGAC AAAACTATTG CCAGCTTCCA GCAGCAGCTG 1021 TCGGATATGG GCTACAAGTT CCAGTTCATC ACCCTGGCAG GTATCCACAG CATGTGGTTC 1081 AACATGTTTG ACCTGGCAAA CGCCTATGCC TAGGGCGAGG GTATGAAGCA CTACGTTGAG 1141 AAAGTGCAGC AGCCGGAATT TGCCGCCGCG AAAGATGGCT ATACCTTCGT ATCTCACCAG 1201 CAGGAAGTGG GTACAGGTTA CTTCGATAAA GTGACGACTA TTATTCAGGG CGGCACGTCT 1261 TCAGTCACCG CGCTGACCGG CTCCACTGAA GAATCGCAGT TCTAA SEQ ID No. 6: Mutant protein aceA Q371* The amino acid sequence (370aa) MKTRTQQIEE LQKEWTQPRW EGITRPYSAE DVVKLRGSVN PECTLAQLGA AKMWRLLHGE61 SKKGYINSLG ALTGGQALQQ AKAGIEAVYL SGWQVAADAN LAASMYPDQS LYPANSVPAV121 VERINNTFRR ADQIQWSAGI EPGDPRYVDY FLPIVADAEA GFGGVLNAFE LMKAMIEAGA181 AAVHFEDQLA SVKKCGHMGG KVLVPTQEAI QKLVAARLAA DVTGVPTLLV ARTDADAADL241 ITSDCDPYDS EFITGERTSE GFFRTHAGIE QAISRGLAYA PYADLVWCET STPDLELARR301 FAQAIHAKYP GKLLAYNCSP SFNWQKNLDD KTIASFQQQL SDMGYKFQFI TLAGIHSMWF361 NMFDLANAYA [Industrial applicability]

[0161] This invention provides the use of the Escherichia coli isocitrate lyase gene aceA in increasing the production of L-amino acids by microorganisms. Experiments have shown that the aceA gene and its mutant aceA Q371* The gene is involved in L-amino acid biosynthesis, and it has been shown that knocking out or weakening the aceA gene, i.e., inhibiting or reducing the expression of the aceA gene, is advantageous for the accumulation of L-amino acids. (aceA gene and its mutants)Q371* By constructing genetically modified strains that produce L-amino acids using genes (or other similar methods), it is possible to significantly increase L-amino acid production and reduce costs, making this extremely important for accelerating the industrial production of L-amino acids.

Claims

1. The use of a protein or a substance that controls the activity and / or content of said protein, The aforementioned use includes any one of the following: A1) Use in the construction of genetically modified strains that produce L-amino acids, A2) Use in the production of L-amino acids, A3) Use in controlling the production of L-amino acids by microorganisms, The aforementioned protein comprises one of the following: B1) A protein having the amino acid sequence shown in SEQ ID No. 2, B2) A protein having 90% or more identity with the protein described in B1) and having the same function, in which amino acid residues are substituted and / or deleted and / or added in the amino acid sequence shown in SEQ ID No.

2. A fusion protein having the same function as B3) B1) or B2), with a tag attached to the N-terminus and / or C-terminus. use.

2. Use of a nucleic acid molecule encoding the protein according to claim 1, comprising any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids, D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

3. The nucleic acid molecule comprises any one of the following uses according to claim 2: F1) A DNA molecule whose code sequence is SEQ ID No. 1, F2) A DNA molecule whose nucleotide sequence is SEQ ID No.

1.

4. Use of a nucleic acid molecule that inhibits or reduces the expression of a gene encoding the protein described in claim 1, comprising any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids, D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

5. The nucleic acid molecule comprises any one of the following uses according to claim 4: H1) sgRNA1 whose target sequence is SEQ ID No. 11, H2) sgRNA2 whose target sequence is SEQ ID No.

12.

6. Use of an expression cassette comprising the nucleic acid molecule according to claim 2 and / or claim 4, comprising any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids, D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

7. Use of a recombinant vector comprising the nucleic acid molecule according to claim 2 and / or claim 4, comprising any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids, D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

8. Use of a recombinant microorganism comprising the nucleic acid molecule described in claim 2 and / or claim 4, comprising any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids, D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

9. Use of recombinant host cells comprising the nucleic acid molecule according to claim 2 and / or claim 4, comprising any one of the following: D1) Use in the construction of genetically modified strains that produce L-amino acids, D2) Use in the production of L-amino acids, D3) Use in controlling the production of L-amino acids by microorganisms.

10. A method for increasing the production of L-amino acids by microorganisms, comprising reducing the content and / or activity of the protein described in claim 1 in the target microorganism to obtain a microorganism that produces a higher amount of L-amino acids than the target microorganism.

11. The method according to claim 10, wherein reducing the content and / or activity of the protein described in claim 1 in the target microorganism is achieved by reducing the expression level and / or activity of the gene encoding the protein in the target microorganism.

12. The method according to claim 11, wherein reducing the expression level and / or activity of the gene encoding the protein in the target microorganism is achieved by reducing or inactivating the activity of the gene encoding the protein described in claim 1 in the genome of the target microorganism using gene mutation technology, gene knockout technology, gene editing technology or gene weakening technology.

13. The method according to claim 12, wherein the activity of a gene encoding the protein described in claim 1 in the genome of a target microorganism is reduced or inactivated using gene editing technology, the method is performed using a CRISPR / Cas9 system, the CRISPR / Cas9 system comprises a vector expressing an sgRNA targeting the gene encoding the protein, the sgRNA comprising any one of the following: G1) sgRNA1 for gene mutations, the target sequence is SEQ ID No.

11. G2) sgRNA2 for gene knockout, with target sequence SEQ ID No.

12.

14. The method according to claim 13, wherein the gene mutation described in G1) is to mutate a DNA molecule having the nucleotide sequence shown in SEQ ID No. 1 in the target microorganism to a DNA molecule shown in SEQ ID No.

5.

15. A recombinant microorganism characterized in that the protein described in claim 1 is weakly expressed or not expressed at all.

16. The recombinant microorganism according to claim 15, wherein weak expression or non-expression is achieved by reducing the expression level and / or activity of the gene encoding the protein in the target microorganism.

17. Reducing the expression level and / or activity of the gene encoding the protein in the target microorganism is achieved by reducing or inactivating the activity of the gene encoding the protein described in claim 1 in the genome of the target microorganism using gene mutation technology, gene knockout technology, gene editing technology or gene weakening technology, according to the recombinant microorganism of claim 16.

18. The gene editing is performed using a CRISPR / Cas9 system, the CRISPR / Cas9 system includes a vector that expresses an sgRNA targeting the gene encoding the protein, and the sgRNA includes any one of the following, according to claim 17: G1) sgRNA1 for gene mutations, the target sequence is SEQ ID No.

11. G2) sgRNA2 for gene knockout, with target sequence SEQ ID No.

12.

19. The recombinant microorganism according to claim 18, wherein the gene mutation described in G1) is to mutate a DNA molecule having the nucleotide sequence shown in SEQ ID No. 1 in the target microorganism to a DNA molecule shown in SEQ ID No.

5.

20. A recombinant microorganism characterized by comprising a nucleic acid molecule that inhibits or reduces the expression of a gene encoding the protein described in claim 1.

21. The nucleic acid molecule comprises one of the following recombinant microorganisms according to claim 20: H1) sgRNA1 whose target sequence is SEQ ID No. 11, H2) sgRNA2 whose target sequence is SEQ ID No.

12.

22. Proteins containing one of the following: M1) A protein having the amino acid sequence shown in SEQ ID No. 6, M2) A protein having 80% or more identity and the same function as the protein described in M1), in which amino acid residues are substituted and / or deleted and / or added in the amino acid sequence shown in SEQ ID No.

6. A fusion protein having the same function as M3), M1), or M2), with a tag attached to the N-terminus and / or C-terminus.

23. A nucleic acid molecule encoding a protein according to claim 22.

24. An expression cassette comprising a nucleic acid molecule encoding the protein described in claim 22.

25. A recombinant vector comprising a nucleic acid molecule encoding the protein described in claim 22.

26. A recombinant microorganism comprising a nucleic acid molecule encoding the protein described in claim 22.

27. Recombinant host cells comprising a nucleic acid molecule encoding the protein described in claim 22.

28. A nucleic acid molecule according to any one of claims 23 to 27, comprising the DNA molecule shown in SEQ ID No.

5.

29. Use of the protein according to claim 22 or the nucleic acid molecule according to any one of claims 23 to 28, one of the following: N1) Use in the construction of genetically modified strains that produce L-amino acids, N2) Use in the production of L-amino acids, N3) Use in controlling the production of L-amino acids by microorganisms.

30. The use according to any one of claims 1 to 9, 29, or the method according to any one of claims 10 to 14, wherein the L-amino acid comprises L-alanine, L-valine, L-arginine, L-tryptophan and / or L-threonine.