Method for freeze-drying lipid nanoparticles

Polymer-coated lipid nanoparticles (PCLNPs) stabilize siRNA during freeze-drying and reconstitution, addressing the inefficiencies of current treatments by maintaining encapsulation efficiency and stability, enabling direct administration for intestinal diseases.

JP2026513911APending Publication Date: 2026-05-01TAKEDA PHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
TAKEDA PHARMA CO LTD
Filing Date
2024-04-05
Publication Date
2026-05-01

Smart Images

  • Figure 2026513911000011
    Figure 2026513911000011
  • Figure 2026513911000012
    Figure 2026513911000012
  • Figure 2026513911000013
    Figure 2026513911000013
Patent Text Reader

Abstract

This disclosure features novel lipid nanoparticle formulations and their use. The lipid nanoparticles ("LNPs") comprise an encapsulated therapeutic agent and an aqueous solution containing a salt and an anionic polymer, which dissolves the salt and anionic polymer in the aqueous solution, thereby forming polymer-coated lipid nanoparticles ("PCLNPs"). The lipid nanoparticles of this disclosure are useful in lyophilization or freeze-drying processes, reducing nanoparticle aggregation and maintaining potency after reconstitution.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Related Applications This application claims priority to U.S. Provisional Application No. 63 / 457,770, filed Apr. 6, 2023, the entire contents of which are hereby expressly incorporated by reference herein.

Background Art

[0002] Intestinal diseases (e.g., Crohn's disease, irritable bowel syndrome, ulcerative colitis, and gastrointestinal cancer) affect millions of people worldwide. Current treatments mainly focus on treating symptoms and are often expensive and ineffective in the long term. data-format="fixed">

[0003] [[ / data-format]]data-format="fixed"> [[ / data-format]]data-format="fixed"> [[ / data-format]]

[0004] Lyophilization or freeze-drying of LNPs has been investigated as a potential method to protect siRNA during traverse of the GI tube to enable interaction of siRNA with intestinal epithelial cells and effective silencing of genes that produce harmful proteins. See, for example, R. Ball et al., “Achieving long-term stability of lipid nanoparticles: examining the effect of pH, temperature, and lyophilization,” Int. J. Nanomedicine, 12:305 (2017). The researchers found that the use of lyophilization protectants (e.g., sucrose or trehalose) during the lyophilization process was necessary to improve LNP stability, gene silencing ability, siRNA capture, particle size, and monodispersity. The conclusion was that when freezing of LNPs is required, the addition of 20% (w / v) sucrose or trehalose is necessary to prevent aggregation and loss of potency of nanoparticles. An alternative to the use of sugar was the use of 30% ethanol in the liquid used to reconstitute the lyophilized particles. That approach is impractical because the reconstituted particles need to be dialysis before they can be administered to patients. [Overview of the project]

[0005] Accordingly, in one embodiment, the present invention provides a composition comprising at least one lipid nanoparticle ("LNP") encapsulating a therapeutic agent, and an aqueous solution containing a salt and an anionic polymer, wherein the salt and anionic polymer are dissolved in the aqueous solution.

[0006] In one embodiment, an anionic polymer is bound to the surface of lipid nanoparticles, thereby forming polymer-coated lipid nanoparticles ("PCLNPs"). Preferably, the binding of the polymer to the LNPs occurs due to the negative properties of the anionic polymer and the positive properties of the lipid nanoparticles (LNPs).

[0007] In one embodiment, the polymer coating covers at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% of the surface of the lipid nanoparticles. In some embodiments, the polymer extends beyond the surface of the lipid nanoparticles.

[0008] In one embodiment, the anionic polymer is a methacrylic acid polymer. Eudragit® is a trademark for various polymethacrylate copolymers. It includes anionic, cationic, and neutral copolymers based on copolymers derived from esters of acrylic acid and methacrylic acid. Preferably, the amount of ionic polymer based on the amount of LNP on a w / w basis is about 1 to about 100, more preferably about 1 to about 12, and even more preferably about 1.18 to about 11.75. On a volume basis, the amount of ionic polymer is about 50 μL to about 500 μL per 1 mL of LNP, more preferably about 50 μL to about 150 μL per 1 mL of LNP.

[0009] In one embodiment, the PCLNP has a negative zeta potential. In one embodiment, the zeta potential is approximately -0.1mV to approximately -50mV, approximately -1.0mV to approximately -45mV, approximately -2.0mV to approximately -30mV, approximately -10mV to approximately -20mV, or approximately -5.0mV to approximately -10mV. In one embodiment, the zeta potential is at least -0.1mV, at least -0.5mV, at least -1.0mV, at least -2.0mV, at least -5.0mV, at least -10mV, at least -15mV, at least -20mV, at least -25mV, at least -30mV, at least -35mV, at least -40mV, at least -45mV, or at least -50mV. In one embodiment, the zeta potential is -0.1mV, -0.5mV, -1.0mV, -2.0mV, -5.0mV, -10mV, -15mV, -20mV, -25mV, -30mV, -35mV, -40mV, -45mV, or -50mV.

[0010] The polymer-coated lipid nanoparticles in the aqueous composition according to the present invention preferably have a negative zeta potential. Preferably, the zeta potential is in the range of about -0.1 mV to about -50 mV. A preferred range is -10 mV to -50 mV. In non-freeze-dried compositions, the zeta potential is determined by measuring the potential between the surface of the solid being tested and its liquid medium. Freeze-dried PCLNPs need to be reconstituted before measuring the zeta potential. Preferably, the zeta potential is measured both before and after freeze-drying.

[0011] The difference in zeta potential is evaluated by the following formula: 100 × (Zeta potential before freeze-drying / Zeta potential after freeze-drying and reconstruction) = difference (%)

[0012] In one embodiment, the polydispersity index (PDI) of PCLNP in the composition is less than 1.0, less than 0.9, less than 0.8, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.2, or less than 0.1. In one embodiment, the PDI is less than 0.2.

[0013] In one embodiment, the difference in size of PCLNP before and after freeze-drying is less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5%.

[0014] The particle size of PCLNPs is evaluated before and after lyophilization. For evaluation after lyophilization, the particles need to be reconstituted. The size difference is evaluated using the following formula: 100 × (Size before freeze-drying (nm) / Size after freeze-drying and reconstruction) = difference (%)

[0015] In one embodiment, the difference in PDI of PCLNP before and after freeze-drying is less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5%.

[0016] Freeze-dried materials need to be reconstituted before measurement. PDI is defined as the standard deviation of the particle size distribution divided by the mean particle size. PDI is used to estimate the average uniformity of a particle solution. A higher PDI value indicates a wider size distribution within the particle sample. 100 × (PDI before freeze-drying / PDI after freeze-drying and reconstitution) = difference (%)

[0017] In one embodiment, the nucleic acid molecule is DNA or RNA. In one embodiment, the nucleic acid molecule is RNA. In one embodiment, the RNA is mRNA, microRNA (miRNA), or short interfering RNA (siRNA). Preferably, the RNA segment encapsulated in the LNP produces a pharmacological effect on the patient, and the composition of the substance can be used as a pharmaceutical composition suitable for administration to the patient to alleviate certain diseases or disease symptoms.

[0018] In one embodiment, nucleic acid molecules are approximately 10 nucleotides (nt) to 20 kilobases (kb), approximately 500 nt to approximately 20 kb, approximately 1 kb to approximately 20 kb, approximately 2 kb to approximately 20 kb, approximately 3 kb to approximately 20 kb, approximately 4 kb to approximately 20 kb, approximately 5 kb to approximately 20 kb, approximately 6 kb to approximately 20 kb, approximately 7 kb to approximately 20 kb, approximately 8 kb to approximately 20 kb, approximately 9 kb to approximately 20 kb, approximately 10 kb to approximately 20 kb, approximately 15 kb to approximately 20 kb, approximately 10 nt to approximately 15 kb, approximately 500 nt to approximately 15 kb, and approximately 1 kb to approximately 15kb, about 2kb to about 15kb, about 3kb to about 15kb, about 4kb to about 15kb, about 5kb to about 15kb, about 6kb to about 15kb, about 7kb to about 15kb, about 8kb to about 15kb, about 9kb to about 15kb, about 10kb to about 15k b, approx. 10nt~10kb, approx. 500nt~approx. 10kb, approx. 1kb~approx. 10kb, approx. 2kb~approx. 10kb, approx. 3kb~approx. 10kb, approx. 8kb to about 10kb, about 9kb to about 10kb, about 10nt to 8kb, about 500nt to about 8kb, about 1kb to about 8kb, about 2kb to about 8kb, about 3kb to about 8kb, about 4kb to about 8kb, about 5kb to about 8kb, about 6kb to about 8kb, Approximately 7kb to approximately 8kb, approximately 10nt to 6kb, approximately 500nt to approximately 6kb, approximately 1kb to approximately 6kb, approximately 2kb to approximately 6kb, approximately 3kb to approximately 6kb, approximately 4kb to approximately 6kb, approximately 5kb to approximately 6kb, approximately 10nt to 5kb, approximately 500nt to approximately 5kb, The nucleotides are approximately 1kb to 5kb, 2kb to 5kb, 3kb to 5kb, 4kb to 5kb, 10nt to 4kb, 500nt to 4kb, 1kb to 4kb, 2kb to 4kb, 3kb to 4kb, 10nt to 3kb, 500nt to 3kb, 1kb to 3kb, 2kb to 3kb, 10nt to 2kb, 500nt to 2kb, 1kb to 2kb, 10nt to 1kb, 500nt to 1kb, or approximately 10nt to 500nt. Preferably, the nucleic acid is RNA (e.g., siRNA). Preferably, the siRNA is approximately 20nt to 25nt.

[0019] In some embodiments, the term "N / P ratio" refers to the ratio of positively charged lipids, lipidoids, or polymer amine (N = nitrogen) groups to positively charged nucleic acid phosphate (P) groups. In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is DNA. In some embodiments, the N / P ratio is about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, about 5 to about 35, about 5 to about 30, about 5 to about 25, about 5 to about 20, about 5 to about 15, about 5 to about 10, about 10 to about 35, about 10 to about 30, about 10 to about 25, about 10 to about 20, about 10 to about 15, about 15 to about 35, about 15 to about 30, about 15 to about 25, about 15 to about 20, about 20 to about 35, about 20 to about 30, about 20 to about 25, about 25 to about 35, about 25 to about 30, or about 30 to about 35. Preferably, the nucleic acid is RNA, and the N / P ratio is about 5 to about 30. In some embodiments, the nucleic acid is DNA, and the N / P ratio is approximately 15 to approximately 20.

[0020] In one embodiment, the lipid nanoparticles include at least one lipid selected from the group consisting of cationic lipids, anionic lipids, neutral lipids, amphoteric lipids, ionic lipids, helper lipids, cholesterol, PEG lipids, phospholipids, and combinations thereof. In one embodiment, the lipid nanoparticles include ionic lipids and cationic lipids.

[0021] In one embodiment, the combination of ionic lipids and cationic lipids constitutes more than 20%, more than 30%, more than 40%, more than 50%, or more than 60% of the total lipids in the lipid nanoparticles.

[0022] In one embodiment, the ionic lipid is a primary aminolipid, a secondary aminolipid, a tertiary aminolipid, or a polyhydric lipid. In one embodiment, the polyhydric lipid is selected from the group consisting of N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarboxamide)ethyl]-3,4-di[oleyloxy]benzamide (MVL5), 2,3-dioleyloxy-N-[2-(sperminecarboxamide)ethyl]-N,N-dimethyl-1-propaneaminium HCl salt (DOSPA), and N4-cholesteryl-spermine HCl salt (GL67). In one embodiment, the cationic lipid is a quaternary aminolipid. In one embodiment, the cationic lipid is 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA). In one embodiment, the cationic lipid is 3β-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol), DOTAP:DOPE(1:1 w / w), DOTAP:DOPE(1:1, w / w)+0.1 wt.% NBD-DOPE, 1-Oleoyl-2-[6-[(7-Nitro-2-1,3-Benzoxadiazole-4-yl)amino]hexanoyl]-3-trimethylammoniumpropane (chloride salt) (fluorescent DOTAP), N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propane-1-aminium bromide (DORI), O,O'-Ditetradecanoyl-N-(α-trimethylammonioacetyl)diethanolamine chloride (DC-6-14), 1,2-Dilauroyl-sn-glycero-3-ethylphosphocholine (chloride) (12:0 EPC), 1,2-Dimiristoyl-sn-glycero-3-ethylphosphocholine (chloride) (14:0 EPC), 1,2-Dipalmitoyl-sn-glycero-3-ethylphosphocholine (chloride) (16:0 EPC), 1,2-Distearoyl-sn-glycero-3-ethylphosphocholine (chloride) (18:0 EPC), 1,2-Dioleoyl-sn-glycero-3-ethylphosphocholine (chloride) (18:1 EPC), 1-Palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (chloride) (16:0-18:0 EPC), 1,2-Dimyristoyl-sn-glycero-3-ethylphosphocholine (Tf salt) (14:1 EPC), Dimethyldioctadecylammonium (bromide salt) (18:0 DDAB), 1,2-Dimyristoyl-3-trimethylammonium-propane (chloride salt) (14:0 The following are selected from the group consisting of TAP, 1,2-dipalmitoyl-3-trimethylammonium-propane (chloride salt) (16:0 TAP), 1,2-stearoyl-3-trimethylammonium-propane (chloride salt) (18:0 TAP), 1,2-dioleoyl-3-trimethylammonium-propane (chloride salt) (18:1 TAP (DOTAP)), 1,2-dioleoyl-3-trimethylammonium-propane (methyl sulfate) (18:1 TAP (DOTAP, MS salt)), and 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (chloride salt) (DOTMA).

[0023] The LNP composition is preferably prepared by microfluidic mixing. Other preferred components of the composition may include C12-200 (cationic lipid), DOTMA (polar lipid), cholesterol, DSPC (distearoyl phosphatidylcholine, zwitterionic phospholipid), and / or DMG-PEG(2k) (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000, synthetic polar lipid). In a preferred combination, when the amount of lipid is 2 mg / ml, all of these components are included at a molar ratio of about 30:20:38.5:10:1.5, respectively.

[0024] In one embodiment, the net charge of the lipid nanoparticles is negative at pH 7. In one embodiment, the net charge of the lipid nanoparticles is positive at pH 7. In one embodiment, the net charge of the lipid nanoparticles is neutral at pH 7.

[0025] In one embodiment, the aqueous solution containing salt is selected from the group consisting of HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), PBS (phosphate buffered saline), TRIS (tris(hydroxymethyl)aminomethane), MES (2-(N-morpholino)ethanesulfonic acid), and citrate buffer. In one embodiment, the aqueous solution containing salt is HEPES. In one embodiment, the aqueous solution containing salt is PBS.

[0026] In one embodiment, the pH of the aqueous solution containing salt is from about 7.0 to about 8.0. In one embodiment, the pH of the aqueous solution containing salt is about 7.6. Preferably, the buffering properties of the salt are such that an anionic polymer dissolves in the composition. Depending on the particular polymer used, dissolution can occur at a pH of about 5 to about 12, preferably about 6 to about 9, most preferably about 6.5 to about 8. Salts that provide buffering action within such pH ranges are known in the art.

[0027] In one embodiment, the composition further comprises a sugar. In one embodiment, the sugar is a disaccharide. In one embodiment, the sugar is selected from the group consisting of lactose, sucrose, trehalose, and combinations thereof. In one embodiment, the amount of sugar in the solution before freeze-drying is about 0% to about 40%, about 1% to about 40%, about 1% to about 35%, about 1% to about 30%, about 1% to about 25%, about 1% to about 20%, about 1% to about 15%, about 1% to about 10%, about 1% to about 5%, about 5% to about 40%, about 5% to about 35%, about 5% to about 30%, about 5% to about 25%, about 5% to about 20%, about 5% to about 15%, about 5% to about 10%, about 10% to about 40%, about 10% to about 35%, about 10% The amounts are approximately 30%, approximately 10% to approximately 25%, approximately 10% to approximately 20%, approximately 10% to approximately 15%, approximately 15% to approximately 40%, approximately 15% to approximately 35%, approximately 15% to approximately 30%, approximately 15% to approximately 25%, approximately 15% to approximately 20%, approximately 20% to approximately 40%, approximately 20% to approximately 35%, approximately 20% to approximately 30%, approximately 20% to approximately 25%, approximately 25% to approximately 40%, approximately 25% to approximately 35%, approximately 25% to approximately 30%, approximately 30% to approximately 40%, approximately 30% to approximately 35%, or approximately 35% to approximately 40%. In one embodiment, the amount of sugar in the solution before freeze-drying is at least 5%, at least 10%, at least 20%, or at least 30%. In one embodiment, the amount of sugar in the solution before freeze-drying is approximately 5%.

[0028] In one embodiment, the composition further comprises a sugar. In one embodiment, the sugar is a disaccharide. In one embodiment, the sugar is selected from the group consisting of lactose, sucrose, trehalose, and combinations thereof. In one embodiment, the amount of sugar is from about 0% to about 40%, from about 1% to about 40%, from about 1% to about 35%, from about 1% to about 30%, from about 1% to about 25%, from about 1% to about 20%, from about 1% to about 15%, from about 1% to about 10%, from about 1% to about 5%, from about 5% to about 40%, from about 5% to about 35%, from about 5% to about 30%, from about 5% to about 25%, from about 5% to about 20%, from about 5% to about 15%, from about 5% to about 10%, from about 10% to about 40%, from about 10% to about 35%, from about 10% to about 30%, from about 10% to about 25%, from about 10% to about 20%, from about 10% to about 15%, from about 15% to about 40%, from about 15% to about 35%, from about 15% to about 30%, from about 15% to about 25%, from about 15% to about 20%, from about 20% to about 40%, from about 20% to about 35%, from about 20% to about 30%, from about 20% to about 25%, from about 25% to about 40%, from about 25% to about 35%, from about 25% to about 30%, from about 30% to about 40%, from about 30% to about 35%, or from about 35% to about 40% in the lyophilized formulation. In one embodiment, the amount of sugar in the lyophilized formulation is at least 5%, at least 10%, at least 20%, or at least 30%. In one embodiment, the amount of sugar in the lyophilized formulation is about 5%.

[0029] In one embodiment, the composition further comprises a sugar. In one embodiment, the sugar is a disaccharide. In one embodiment, the sugar is selected from the group consisting of lactose, sucrose, trehalose, and combinations thereof. In one embodiment, the amount of sugar in the reconstituted solution is approximately 0% to approximately 40%, approximately 1% to approximately 40%, approximately 1% to approximately 35%, approximately 1% to approximately 30%, approximately 1% to approximately 25%, approximately 1% to approximately 20%, approximately 1% to approximately 15%, approximately 1% to approximately 10%, approximately 1% to approximately 5%, approximately 5% to approximately 40%, approximately 5% to approximately 35%, approximately 5% to approximately 30%, approximately 5% to approximately 25%, approximately 5% to approximately 20%, approximately 5% to approximately 15%, approximately 5% to approximately 10%, approximately 10% to approximately 40%, approximately 10% to approximately 35%, approximately 10% to approximately The amounts are 30%, approximately 10% to 25%, approximately 10% to 20%, approximately 10% to 15%, approximately 15% to 40%, approximately 15% to 35%, approximately 15% to 30%, approximately 15% to 25%, approximately 15% to 20%, approximately 20% to 40%, approximately 20% to 35%, approximately 20% to 30%, approximately 20% to 25%, approximately 25% to 40%, approximately 25% to 35%, approximately 25% to 30%, approximately 30% to 40%, approximately 30% to 35%, or approximately 35% to 40%. In one embodiment, the amount of sugar is at least 5%, at least 10%, at least 20%, or at least 30% in the reconstituted solution. In one embodiment, the amount of sugar is approximately 5% in the reconstituted solution.

[0030] In one embodiment, the nucleic acid molecule is a short-chain interfering RNA, the anionic polymer is a methacrylic acid polymer, and the lipid nanoparticles include at least one lipid selected from the group consisting of cationic lipids, polar lipids, amphoteric lipids, or combinations thereof.

[0031] In one embodiment, the nucleic acid molecule is a short-chain interfering RNA, the anionic polymer is a methacrylic acid polymer, and the lipid nanoparticles contain at least one cationic lipid.

[0032] In another aspect, the present invention provides a pharmaceutical composition comprising a composition disclosed herein and a pharmaceutically acceptable carrier.

[0033] In one embodiment, the composition is lyophilized. Preferably, the composition is lyophilized to provide a lyophilized mixture of lipid nanoparticles that encapsulate a therapeutic agent(s) containing a nucleotide sequence (e.g., microRNA or short RNA segment), the nanoparticles being coated with an ionic polymer (e.g., Eudragit®) together with a salt that acts as a buffer in an aqueous solution to provide a desired pH range. Preferably, the lipids are selected from cationic lipids, polar lipids, amphoteric lipids, or mixtures thereof.

[0034] In another aspect, the present invention provides a method for storing the lyophilized compositions disclosed herein, the method comprising storing the lyophilized product at a temperature of about 2°C to about 8°C. In another aspect, the present invention provides a method for storing the lyophilized compositions disclosed herein, the method comprising storing the lyophilized product at a temperature of about -20°C.

[0035] In another aspect, the present invention provides a method for reconstituting a lyophilized composition disclosed herein, the method comprising adding a liquid medium to the lyophilized composition.

[0036] In one embodiment, the liquid medium is an aqueous medium.

[0037] The present invention also provides a novel method of freeze-drying in which an ionic polymer (e.g., Eudragit®, preferably Eudragit® S100) is mixed with other components before freeze-drying, instead of using known cryoprotectants (e.g., sucrose or trehalose). The addition of the ionic polymer helps to stabilize the freeze-dried product against aggregation after the reconstruction of LNPs.

[0038] The present invention provides an improved method for lyophilizing a lipid nanoparticle composition, comprising mixing the lipid nanoparticle composition with an ionic polymer before freezing the composition, and subsequently removing water using a conventional lyophilizing device. A lyophilized composition containing a preferred amount of ionic polymer can be reconstituted with water, preferably deionized water, after reconstitution without adversely affecting stability, as indicated by the absence of particle aggregation or loss of RNA segment efficacy. Alternatively, the lyophilized LNP composition can be encapsulated or administered by other means to patients requiring treatment provided by the RNA segment.

[0039] A preferred lyophilized composition contains an effective amount of an ionic polymer (preferably Eudragit® S100) to stabilize the lyophilized composition against aggregation or decomposition during reconstitution. The lyophilized composition may be used for direct treatment of a patient or may be reconstituted before treatment, for example, with deionized water. The presence of the ionic polymer stabilizes the LNP composition against aggregation or decomposition during reconstitution, eliminating the need for complex prior procedures for reconstitution (e.g., reconstitution with ethanol followed by dialysis) before patient treatment.

[0040] In another embodiment, the present invention provides a method for producing a pharmaceutical composition, the method comprising: a) producing lipid nanoparticles from at least one lipid and at least one nucleic acid molecule; and b) mixing an aqueous solution containing a salt and an anionic polymer with the lipid nanoparticles produced in step a) and a pharmaceutically acceptable carrier.

[0041] In one embodiment, the method further includes freeze-drying the mixture obtained in step b).

[0042] In one embodiment, the anionic polymer is a methacrylic acid polymer.

[0043] In another embodiment, the present invention provides a method for stabilizing lipid nanoparticles for freeze-drying, the method comprising: a) generating lipid nanoparticles from at least one lipid and at least one nucleic acid molecule; b) mixing an aqueous solution containing a salt and an anionic polymer with the lipid nanoparticles generated in step a); and c) freeze-drying the resulting mixture to thereby stabilize the freeze-dried lipid nanoparticles.

[0044] In one embodiment, the anionic polymer is dissolved in a buffer.

[0045] In another embodiment, the present invention provides a method for producing a stable pharmaceutical composition, the method comprising: a) dissolving an anionic polymer in an aqueous solution containing a salt; and b) mixing the dissolved anionic polymer with lipid nanoparticles containing at least one nucleic acid.

[0046] In one embodiment, the method further includes freeze-drying the mixture obtained in step b).

[0047] In one embodiment, step b) further includes sugar. In one embodiment, the amount of sugar is about 5%.

[0048] In one embodiment, the nucleic acid molecule is DNA or RNA. In one embodiment, RNA is mRNA, microRNA (miRNA), or short interfering RNA (siRNA).

[0049] In one embodiment, the lipid nanoparticles include ionic lipids and / or cationic lipids. In one embodiment, the combination of ionic and cationic lipids constitutes more than 20%, more than 30%, more than 40%, more than 50%, or more than 60% of the total lipids in the lipid nanoparticles. In one embodiment, the ionic lipid is a primary aminolipid, a secondary aminolipid, a tertiary aminolipid, or a polyhydric lipid. In one embodiment, the cationic lipid is a quaternary aminolipid. In one embodiment, the cationic lipid is 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA).

[0050] In one embodiment, the aqueous solution containing the salt is a buffer selected from the group consisting of HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), PBS (phosphate-buffered saline), TRIS (tris(hydroxymethyl)aminomethane), MES (2-(N-morpholino)ethanesulfonic acid), and citrate buffer. In one embodiment, the pH of the aqueous solution containing the salt is about 7.0 to about 8.0.

[0051] The present invention provides an improved method for treating patients suffering from various gastrointestinal diseases by treating the patient with polymer-coated lipid nanoparticles that encapsulate nucleotides selected to treat the patient's disease or condition.

[0052] In another embodiment, the present invention provides a method for treating a disease or disorder of interest, the method comprising administering a composition disclosed herein, a pharmaceutical composition disclosed herein, or a lyophilized composition disclosed herein to a subject in need thereof.

[0053] In one embodiment, the disease or disorder is a disease or disorder of the gastrointestinal tract. In one embodiment, the disease or disorder is Crohn's disease, irritable bowel syndrome, ulcerative colitis, or gastrointestinal cancer.

[0054] Preferred therapeutic agents include nucleotides, which may be RNA or DNA. Particularly preferred therapeutic agents include short interfering RNA segments that can reduce or eliminate the production of harmful proteins in the gastrointestinal system. The RNA fragment contained in the LNP will be determined by the treatment desired for the patient under consideration. For example, siRNAs designed to silence genes that produce irritant proteins for various disease conditions are known. Other lipids and formulations embodying the teachings of this application may be manufactured by those skilled in the art.

[0055] In one embodiment, the lyophilized composition or pharmaceutical composition is administered orally as a lyophilized mixture. In one embodiment, the lyophilized composition or pharmaceutical composition is encapsulated in a capsule. In one embodiment, the capsule further comprises a pharmaceutically acceptable carrier, diluent, excipient, solvent, or emulsifier.

[0056] In one embodiment, the lyophilized composition or pharmaceutical composition is administered intravenously as a lyophilized mixture.

[0057] In another aspect, the present invention provides a method for treating a disease or disorder in a subject, the method comprising administering to a subject one of the compositions disclosed herein, the pharmaceutical compositions disclosed herein, or the lyophilized compositions disclosed herein, reconstituted in a liquid medium.

[0058] In one embodiment, the reconstituted lyophilized composition is administered orally. In one embodiment, the reconstituted lyophilized composition is administered intravenously. In one embodiment, the reconstituted lyophilized composition is administered subcutaneously or intramuscularly. [Brief explanation of the drawing]

[0059] [Figure 1A] Samples before and after freeze-drying are shown. [Figure 1B] The 5% sucrose sample after freeze-drying showed a P / LNP ratio of 1.18. [Figure 1C]The size histograms before and after freeze-drying are shown. Size is analyzed after dilution 100-fold with deionized water (DIW). Each sample is analyzed three times. Error bars represent the standard deviation. [Figure 1D] The size histograms before and after freeze-drying are shown. Sizes were analyzed after dilution 100-fold using DIW. Each sample was analyzed three times. Error bars represent the standard deviation. [Figure 2] The size distribution of formulations B, C, D, E1, E4, F, and G before and after lyophilization is shown. Size was analyzed after 100-fold dilution with DIW. Each sample was analyzed three times. Error bars represent the standard deviation. [Figure 3A-1] Size distribution of LNP-S100 preparations (containing 40% sucrose and sucrose-free) dialyzed against 50 mM HEPES during lyophilization. Size was analyzed after 100-fold dilution by DIW. Each sample was analyzed three times. Error bars represent the standard deviation. [Figure 3A-2] (Continued) Size distribution of LNP-S100 preparations (containing 40% sucrose and sucrose-free) dialyzed against 50 mM HEPES during freeze-drying. After dilution 100-fold by DIW, size was analyzed. Each sample was analyzed three times. Error bars represent the standard deviation. [Figure 3B] Size distribution of LNP-S100 formulations (with different sucrose content) dialyzed against 50 mM HEPES during lyophilization. Size was analyzed after 100-fold dilution by DIW. Each sample was analyzed three times. Error bars represent the standard deviation. [Figure 4] This shows the size distribution of LNP-S100 formulations (with different sucrose content) dialyzed against 1×PBS during lyophilization. Size was analyzed after 100-fold dilution with DIW. Each sample was analyzed three times. Error bars represent the standard deviation. [Figure 5A] RAW264.7 cells treated with reconstituted lyophilized LNP (A, B, C, D, E1, E4, F, G) were compared with non-lyophilized LNP dialyzed in 50 mM HEPES. Five wells were analyzed for each sample. Standard deviation is shown as error bars. [Figure 5B] RAW264.7 cells treated with reconstituted lyophilized LNP compared to non-lyophilized LNP dialyzed in 1×PBS. Five wells were analyzed per sample. Standard deviation is shown as error bars. [Figure 6A] HeLa cells treated with reconstituted lyophilized LNP compared to non-lyophilized LNP dialyzed with 50 mM HEPES. Five wells were analyzed per sample. Standard deviation is shown as error bars. [Figure 6B] HeLa cells treated with reconstituted lyophilized LNP compared to non-lyophilized LNP dialyzed in 1×PBS. Five wells were analyzed per sample. Standard deviation is shown as error bars. [Figure 7A] Comparison of LNPs and PCLNPs before and after freeze-drying, regarding their physicochemical properties. [Figure 7B] Comparison of LNP and PCLNP before and after freeze-drying regarding their effectiveness. [Figure 8A] The retention effectiveness of LNPs and PCLNPs after exposure to biocompatible media. The stability, encapsulation efficiency, and mean factor changes of LNPs in fasted irritated gastric juice (FaSSGF) and fasted irritated intestinal juice (FaSSIF), tested for size and ZP, are shown at 37°C for 1 hour. [Figure 8B] The retention effectiveness of LNPs and PCLNPs after exposure to biomedical media. The physicochemical properties and in vitro effectiveness of freeze-dried PCLNPs incubated with FaSSGF and FaSSIF are shown. [Figure 8C] Retention effectiveness of LNPs and PCLNPs after exposure to biocompatible media. This shows the retention of effectiveness of LNPs and PCLNPs after incubation with mucin followed by freeze-drying. [Figure 9] In vivo efficacy of knocking down endogenous HPRT with freeze-dried LNPs containing siHPRT. [Figure 10] In vivo efficacy of mRNA expression using freeze-dried LNPs containing FLuc mRNA. [Figure 11]Quantitative data of siRNA (siTNF) in a DSS-induced colitis model after 5 days of siRNA LNP administration in a 12-day DSS model. [Modes for carrying out the invention]

[0060] definition As used herein, the terms “comprising” or “comprises” are used in reference to compositions, methods, and their respective components, which may include elements essential to the method or composition, but which may also include unspecified elements, whether essential or not.

[0061] As used herein, the term “essentially derived from” refers to elements necessary for a given embodiment. The term acknowledges the presence of elements that do not substantially affect the basic novel or functional characteristics of that embodiment.

[0062] The term "consisting of" refers to the compositions, methods, and their respective components described herein, excluding any elements not described in the description of the embodiments.

[0063] Where used herein and in the appended claims, the singular forms “a,” “an,” and “the” include multiple references unless otherwise explicitly stated in the context. Thus, for example, a reference to “method” includes one or more methods and / or steps, such as the types described herein and / or those that become apparent to those skilled in the art when reading this disclosure. Similarly, the word “or” is intended to include “and” unless otherwise explicitly stated in the context. Methods and materials similar to or equivalent to those described herein may be used in carrying out or testing the disclosure, but preferred methods and materials are described below. The abbreviation “eg” is derived from the Latin “exempli gratia” and is used herein to indicate a non-limiting example. Thus, the abbreviation “eg” is synonymous with the term “for example.”

[0064] Unless otherwise stated in the operational examples or elsewhere, all numerical values ​​representing the amounts of components or reaction conditions used herein should be understood to be modified in all cases with the term “approximately.” The term “approximately” as used in relation to percentages may mean ±1%. The present invention is further described in detail by the following examples, but the scope of the invention is not limited thereto.

[0065] The terms “purify,” “refined,” and “clean” mean to make something substantially pure or clear from unwanted components, contamination, mixtures, or impurities.

[0066] The terms “significant” or “remarkably” are used synonymously with the term “substantially.” The term “substantially” refers to a qualitative state that indicates the whole or nearly whole degree or extent of a particular feature or characteristic. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, go to completion and / or progress toward completion, or achieve or avoid absolute results. Therefore, the term “substantially” is used herein to compensate for the potential lack of completeness inherent in many biological and chemical phenomena.

[0067] The term "stable" refers to a compound that is strong enough to overcome isolation from a reaction mixture to a useful degree of purity, and preferably can be formulated into an effective therapeutic agent. The terms "stabilize" and "stable" mean to make stable or to become stable.

[0068] Polymer-coated lipid nanoparticles The present invention provides a novel composition of a substance comprising at least one lipid nanoparticle encapsulating an active ingredient, and an aqueous solution containing a salt and an anionic polymer. Preferably, the salt and anionic polymer are dissolved in the aqueous solution. In some embodiments, the composition comprises at least one lipid nanoparticle encapsulating an active ingredient, and an aqueous solution containing a salt and a polymer, wherein the salt and polymer are dissolved in the aqueous solution. In some embodiments, the polymer is a cationic polymer or an anionic polymer.

[0069] As used herein, “polymer-coated lipid nanoparticles” or “PCLNP” refers to at least one polymer that electrostatically bonds to the surface of lipid nanoparticles to form a coating around the LNPs. As used herein, “electrostatically bonded,” or its grammatical derivative, means that they are bonded based on an attractive force with opposite charges. For example, the polymer preferably has an opposite charge to the lipid nanoparticles, for example, the polymer contains a negative charge and the lipid nanoparticles contain a positive charge. In some embodiments, the polymer contains a positive charge and the lipid nanoparticles contain a negative charge.

[0070] In some embodiments, the polymer coating covers at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% of the surface of the lipid nanoparticles. In some embodiments, the polymer coating covers about 5% to about 100%, about 5% to about 95%, about 5% to about 90%, about 5% to about 80%, about 5% to about 70%, about 5% to about 60%, about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, about 5% to about 10%, about 10% to about 100%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, and about 1 0%~approx. 70%, approx. 10%~approx. 60%, approx. 10%~approx. 50%, approx. 10%~approx. 40%, approx. 10%~approx. 30%, approx. 10%~approx. 20%, approx. 20%~approx. 100%, approx. 20%~approx. 95%, approx. 20%~approx. 90%, approx. 20%~approx. 80%, approx. 20%~approx. 70%, approx. 20%~approx. 60%, approx. 20%~approx. 50%, approx. 20%~approx. 40%, approx. 20%~approx. 30%, approx. 30%~approx. 100%, approx. 30%~approx. 95%, approx. 30% %~approx. 90%, approx. 30%~approx. 80%, approx. 30%~approx. 70%, approx. 30%~approx. 60%, approx. 30%~approx. 50%, approx. 30%~approx. 40%, approx. 40%~approx. 100%, approx. 40%~approx. 95%, approx. 40%~approx. 90%, approx. 40%~approx. 80%, approx. 40%~approx. 70%, approx. 40%~approx. 60%, approx. 40%~approx. 50%, approx. 50%~approx. 100%, approx. 50%~approx. 95%, approx. 50%~approx. 90%, approx. 50%~approx. 80%, approx. 50% It covers approximately 70%, 50% to 60%, 60% to 100%, 60% to 95%, 60% to 90%, 60% to 80%, 60% to 70%, 70% to 100%, 70% to 95%, 70% to 90%, 70% to 80%, 80% to 100%, 80% to 95%, 80% to 90%, 90% to 100%, 90% to 95%, and 95% to 100%.

[0071] In some embodiments, the polymer is an anionic polymer. In some embodiments, the anionic polymer is a methacrylic acid polymer (e.g., Eudragit® S100 (an anionic copolymer derived from methacrylic acid and methyl methacrylate (1:2)), S12, 5, and L100). In some embodiments, the methacrylic acid polymer is Eudragit® S100. In some embodiments, the anionic polymer is Eudragit® L-55. In some embodiments, the polymer is poly(beta-amino ester) (PBAE). In some embodiments, the anionic polymer is poly(methyl methacrylate) (PMMA). In some embodiments, the anionic polymer is an acrylate, methacrylate, cyanoacrylate, or nitroacrylate. In some embodiments, the anionic polymer is poly(alkyl cyanoacrylate) (PACA) or poly(butyl cyanoacrylate) (PBCA). In some embodiments, the anionic polymer is hyaluronic acid.

[0072] In some embodiments, the polymer is a cationic polymer. In some embodiments, the cationic polymer is chitosan. In some embodiments, the cationic polymer is polyethyleneimine (PEI). In some embodiments, the cationic polymer is poly(L-lysine). In some embodiments, the cationic polymer is poly(acrylic acid) (PAA). In some embodiments, the cationic polymer is gelatin, cationic cellulose, cationic dextran, poly-L-ornithine (PLO), poly-L-arginine (PLR), or polyamidoamine (PAMAM).

[0073] As used herein, the expression “N / P ratio” refers to the ratio of positively charged lipids, lipidoids, or polymer amine (N = nitrogen) groups to positively charged nucleic acid phosphate (P) groups, and is perhaps one of the most important physicochemical properties of polymer-based gene delivery vehicles. In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is DNA. In some embodiments, the N / P ratio is about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, about 5 to about 35, about 5 to about 30, about 5 to about 25, about 5 to about 20, about 5 to about 15, about 5 to about 10, about 10 to about 35, about 10 to about 30, about 10 to about 25, about 10 to about 20, about 10 to about 15, about 15 to about 35, about 15 to about 30, about 15 to about 25, about 15 to about 20, about 20 to about 35, about 20 to about 30, about 20 to about 25, about 25 to about 35, about 25 to about 30, or about 30 to about 35. Preferably, the nucleic acid is RNA, and the N / P ratio is about 5 to about 30. In some embodiments, the nucleic acid is DNA, and the N / P ratio is approximately 15 to approximately 20.

[0074] As used herein, the terms “salt-containing aqueous solution” and “buffer” are used interchangeably. In some embodiments, the salt-containing aqueous solution is a buffer selected from the group consisting of HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), PBS (phosphate-buffered saline), TRIS (tris(hydroxymethyl)aminomethane), MES (2-(N-morpholino)ethanesulfonic acid), and citrate buffer. In one embodiment, the aqueous solution is HEPES. In another embodiment, the aqueous solution is PBS.

[0075] In some embodiments, the pH of the aqueous solution containing the salt is about 7.0 to about 8.0. In some embodiments, the pH is about 7.6.

[0076] In some embodiments, the PCLNP composition further comprises a sugar. In some embodiments, the sugar is a disaccharide. In some embodiments, the sugar is selected from the group consisting of lactose, sucrose, trehalose, and combinations thereof.

[0077] In some embodiments, the amount of sugar in the PCLNP composition is about 0% to about 40%. In one embodiment, the amount of sugar is about 0.1% to about 40%, about 1% to about 40%, about 1% to about 35%, about 1% to about 30%, about 1% to about 25%, about 1% to about 20%, about 1% to about 15%, about 1% to about 10%, about 1% to about 5%, about 5% to about 40%, about 5% to about 35%, about 5% to about 30%, about 5% to about 25%, about 5% to about 20%, about 5% to about 15%, about 5% to about 10%, about 10% to about 40%, about 10% to about 35%, and about 10% to about 30%. , approximately 10% to approximately 25%, approximately 10% to approximately 20%, approximately 10% to approximately 15%, approximately 15% to approximately 40%, approximately 15% to approximately 35%, approximately 15% to approximately 30%, approximately 15% to approximately 25%, approximately 15% to approximately 20%, approximately 20% to approximately 40%, approximately 20% to approximately 35%, approximately 20% to approximately 30%, approximately 20% to approximately 25%, approximately 25% to approximately 40%, approximately 25% to approximately 35%, approximately 25% to approximately 30%, approximately 30% to approximately 40%, approximately 30% to approximately 35%, or approximately 35% to approximately 40%. In one embodiment, the amount of sugar is at least 5%, at least 10%, at least 20%, or at least 30%. In one embodiment, the amount of sugar is preferably about 5%.

[0078] As used herein, the term “zeta potential” refers to the electrostatic potential of a molecule or particle (e.g., LNP) measured at the hydrodynamic sliding surface outside the surface of the molecule or particle. It is typically measured by electrophoretic mobility. Particles are likely to encounter other particles with the same charge sign, in relation to surface potential and electrostatic repulsion. In some embodiments, the zeta potential of lipid nanoparticles can be measured with or without polymer coating.

[0079] In some embodiments, the composition comprises PCLNPs coated with an anionic polymer. In some embodiments, the zeta potential is negative.

[0080] In some applications, the zeta potential is approximately -0.1mV to -50mV, approximately -0.5mV to -50mV, approximately -1.0mV to -50mV, approximately -2.0mV to -50mV, approximately -5.0mV to -50mV, approximately -10mV to -50mV, approximately -15mV to -50mV, approximately -20mV to -50mV, approximately -25mV to -50mV, approximately -30mV to -50mV, approximately -35mV to -50mV, approximately -40mV to -50mV, approximately -45mV to -50mV, approximately -0.1mV to -45mV, approximately -0.5mV to -45mV, approximately -1.0mV to -45mV mV, approximately -2.0mV to approximately -45mV, approximately -5.0mV to approximately -45mV, approximately -10mV to approximately -45mV, approximately -15mV to approximately -45mV, approximately -20mV~Approx.-45mV, Approx.-25mV~Approx.-45mV, Approx.-30mV~Approx.-45mV, Approx.-35mV~Approx.-45mV, Approx.-40mV~ -45mV, -0.1mV~-40mV, -0.5mV~-40mV, -1.0mV~-40mV, -2.0mV~- 40mV, approximately -5.0mV to approximately -40mV, approximately -10mV to approximately -40mV, approximately -15mV to approximately -40mV, approximately -20mV to approximately -40mV, approximately -25mV~Approx.-40mV, Approx.-30mV~Approx.-40mV, Approx.-35mV~Approx.-40mV, Approx.-0.1mV~Approx.-35mV, Approx.-0.5m V ~ approx. -35mV, approx. -1.0mV ~ approx. -35mV, approx. -2.0mV ~ approx. -35mV, approx. -5.0mV ~ approx. -35mV, approx. -10mV ~ approx. -35mV, approximately -15mV to approximately -35mV, approximately -20mV to approximately -35mV, approximately -25mV to approximately -35mV, approximately -30mV to approximately -35mV, -0.1mV to -30mV, -0.5mV to -30mV, -1.0mV to -30mV, -2.0mV to -30mV, -5 .0mV~Approx.-30mV, Approx.-10mV~Approx.-30mV, Approx.-15mV~Approx.-30mV, Approx.-20mV~Approx.-30mV, Approx.-25mV~Approx. -30mV, approximately -0.1mV to approximately -25mV, approximately -0.5mV to approximately -25mV, approximately -1.0mV to approximately -25mV, approximately -2.0mV to approximately -2 5mV, approximately -5.0mV to approximately -25mV, approximately -10mV to approximately -25mV, approximately -15mV to approximately -25mV, approximately -20mV to approximately -25mV, approximately -0.1mV to approx. -20mV, approx. -0.5mV to approx. -20mV, approx. -1.0mV to approx. -20mV, approx. -2.0mV to approx. -20mV, approx. -5.0mV to approx. -20mV, approx. -10mV to approx. -20mV, approx. -15mV to approx. -20mV, approx. -0.1mV to approx. -15mV, approx. -0.5mV to approx. -15mV, approx. -1.0mV to approx. -15mV, approx. -2.0mV ~Approx.-15mV, Approx.-5.0mV~Approx.-15mV, Approx.-10mV~Approx.-15mV, Approx.-0.1mV~Approx.-10mV, Approx.-0.5mV~Approx.-10mV, Approx.-1.0mV~Approx.-10mV, Approx.-2.0mV~Approx. The ranges are -10mV, approximately -5.0mV to approximately -10mV, approximately -0.1mV to approximately -5.0mV, approximately -0.5mV to approximately -5.0mV, approximately -1.0mV to approximately -5.0mV, approximately -2.0mV to approximately -5.0mV, approximately -0.1mV to approximately -2.0mV, approximately -0.5mV to approximately -2.0mV, approximately -1.0mV to approximately -2.0mV, approximately -0.1mV to approximately -1.0mV, approximately -0.5mV to approximately -1.0mV, or approximately -0.1mV to approximately -0.5mV. In some embodiments, the zeta potential is at least -0.1mV, at least -0.5mV, at least -1.0mV, at least -2.0mV, at least -5.0mV, at least -10mV, at least -15mV, at least -20mV, at least -25mV, at least -30mV, at least -35mV, at least -40mV, at least -45mV, or at least -50mV. In some embodiments, the zeta potential is up to -0.1mV, up to -0.5mV, up to -1.0mV, up to -2.0mV, up to -5.0mV, up to -10mV, up to -15mV, up to -20mV, up to -25mV, up to -30mV, up to -35mV, up to -40mV, up to -45mV, or up to -50mV.

[0081] In some embodiments, the composition comprises PCLNPs coated with a cationic polymer. In some embodiments, the zeta potential is positive.

[0082] In some embodiments, the zeta potential is approximately +0.1mV to +50mV, approximately +0.5mV to +50mV, approximately +1.0mV to +50mV, approximately +2.0mV to +50mV, approximately +5.0mV to +50mV, approximately +10mV to +50mV, approximately +15mV to +50mV, approximately +20mV to +50mV, approximately +25mV to +50mV, approximately +30mV to +50mV, approximately +35mV to +50mV, approximately +40mV to +50mV, approximately +45mV to +50mV, approximately +0.1mV to +45mV, approximately +0.5mV to +45mV, and approximately +1.0mV to +45mV. mV, approximately +2.0mV to approximately +45mV, approximately +5.0mV to approximately +45mV, approximately +10mV to approximately +45mV, approximately +15mV to approximately +45mV, approximately +20mV~Approx.+45mV, Approx.+25mV~Approx.+45mV, Approx.+30mV~Approx.+45mV, Approx.+35mV~Approx.+45mV, Approx.+40mV~ Approx. +45mV, Approx. +0.1mV ~ Approx. +40mV, Approx. +0.5mV ~ Approx. +40mV, Approx. +1.0mV ~ Approx. +40mV, Approx. +2.0mV ~ Approx. + 40mV, approximately +5.0mV to approximately +40mV, approximately +10mV to approximately +40mV, approximately +15mV to approximately +40mV, approximately +20mV to approximately +40mV, approximately +25mV to approx. +40mV, approx. +30mV to approx. +40mV, approx. +35mV to approx. +40mV, approx. +0.1mV to approx. +35mV, approx. +0.5m V ~ approx. +35mV, approx. +1.0mV ~ approx. +35mV, approx. +2.0mV ~ approx. +35mV, approx. +5.0mV ~ approx. +35mV, approx. +10mV ~ approx. +35mV, approximately +15mV to approximately +35mV, approximately +20mV to approximately +35mV, approximately +25mV to approximately +35mV, approximately +30mV to approximately +35mV, Approximately +0.1mV to approximately +30mV, approximately +0.5mV to approximately +30mV, approximately +1.0mV to approximately +30mV, approximately +2.0mV to approximately +30mV, approximately +5 .0mV~Approx.+30mV, Approx.+10mV~Approx.+30mV, Approx.+15mV~Approx.+30mV, Approx.+20mV~Approx.+30mV, Approx.+25mV~Approx. +30mV, approximately +0.1mV to approximately +25mV, approximately +0.5mV to approximately +25mV, approximately +1.0mV to approximately +25mV, approximately +2.0mV to approximately +2 5mV, approximately +5.0mV to approximately +25mV, approximately +10mV to approximately +25mV, approximately +15mV to approximately +25mV, approximately +20mV to approximately +25mV, approximately +0.1mV to approx. +20mV, approx. +0.5mV to approx. +20mV, approx. +1.0mV to approx. +20mV, approx. +2.0mV to approx. +20mV, approx. +5.0mV to approx. +20mV, approx. +10mV to approx. +20mV, approx. +15mV to approx. +20mV, approx. +0.1mV to approx. +15mV, approx. +0.5mV to approx. +15mV, approx. ~+15mV, +5.0mV~+15mV, +10mV~+15mV, +0.1mV~+10mV, +0.5mV~+10mV, +1.0mV~+10mV, +2.0mV~Approx. The ranges are +10mV, approximately +5.0mV to approximately +10mV, approximately +0.1mV to approximately +5.0mV, approximately +0.5mV to approximately +5.0mV, approximately +1.0mV to approximately +5.0mV, approximately +2.0mV to approximately +5.0mV, approximately +0.1mV to approximately +2.0mV, approximately +0.5mV to approximately +2.0mV, approximately +1.0mV to approximately +2.0mV, approximately +0.1mV to approximately +1.0mV, approximately +0.5mV to approximately +1.0mV, or approximately +0.1mV to approximately +0.5mV. In some embodiments, the zeta potential is at least +0.1mV, at least +0.5mV, at least +1.0mV, at least +2.0mV, at least +5.0mV, at least +10mV, at least +15mV, at least +20mV, at least +25mV, at least +30mV, at least +35mV, at least +40mV, at least +45mV, or at least +50mV. In some embodiments, the zeta potential is max +0.1mV, max +0.5mV, max +1.0mV, max +2.0mV, max +5.0mV, max +10mV, max +15mV, max +20mV, max +25mV, max +30mV, max +35mV, max +40mV, max +45mV, or max +50mV.

[0083] In some embodiments, the zeta potential of PCLNPs is measured before and after freeze-drying. Measurement after freeze-drying requires the PCLNPs to be reconstituted. In some embodiments, the difference in zeta potential of PCLNPs before and after freeze-drying is calculated using the following formula: 100 × (Zeta potential before freeze-drying / Zeta potential after freeze-drying) = difference (%).

[0084] In some embodiments, the difference in zeta potential of PCLNP before and after freeze-drying is less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, and less than 5%. In some embodiments, the difference in zeta potential of PCLNP before and after freeze-drying is approximately 1% to 30%, 5% to 30%, 10% to 30%, 15% to 30%, 20% to 30%, 25% to 30%, 1% to 25%, 5% to 25%, 10% to 25%, 15% to 25%, 20% to 25%, 1% to 20%, 5% to 20%, 10% to 20%, 15% to 20%, 1% to 15%, 5% to 15%, 10% to 15%, 1% to 10%, 5% to 10%, or 1% to 5%.

[0085] As used herein, the term “polydispersion index (PDI)” refers to the standard deviation (σ) of the particle size distribution divided by the mean particle size. PDI is used to estimate the mean uniformity of a particle solution. For example, a small value (e.g., less than 0.3) indicates a narrow particle size distribution. For example, a larger PDI value indicates a larger size distribution in a particle sample.

[0086] In some embodiments, the polydispersity index of PCLNP in the composition is less than 1.0, less than 0.9, less than 0.8, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.2, and less than 0.1. In some embodiments, the polyvariance index of PCLNPs in the composition is approximately 0.1 to 1.0, approximately 0.1 to 0.9, approximately 0.1 to 0.8, approximately 0.1 to 0.7, approximately 0.1 to 0.6, approximately 0.1 to 0.5, approximately 0.1 to 0.4, approximately 0.1 to 0.3, approximately 0.1 to 0.2, approximately 0.2 to 1.0, approximately 0.2 to 0.9, approximately 0.2 to 0.8, approximately 0.2 to 0.7, approximately 0.2 to 0.6, approximately 0.2 to 0.5, approximately 0.2 to 0.4, approximately 0.2 to 0.3, approximately 0.3 to 1.0, approximately 0.3 to 0.9, approximately 0.3 to 0.8, approximately 0.3 to 0.7, and approximately 0. The ranges are approximately 3 to 0.6, approximately 0.3 to 0.5, approximately 0.3 to 0.4, approximately 0.4 to 1.0, approximately 0.4 to 0.9, approximately 0.4 to 0.8, approximately 0.4 to 0.7, approximately 0.4 to 0.6, approximately 0.4 to 0.5, approximately 0.5 to 1.0, approximately 0.5 to 0.9, approximately 0.5 to 0.8, approximately 0.5 to 0.7, approximately 0.5 to 0.6, approximately 0.6 to 1.0, approximately 0.6 to 0.9, approximately 0.6 to 0.8, approximately 0.6 to 0.7, approximately 0.7 to 1.0, approximately 0.7 to 0.9, approximately 0.7 to 0.8, approximately 0.8 to 1.0, approximately 0.8 to 0.9, or approximately 0.9 to 1.0.

[0087] In some embodiments, the polydispersity index of PCLNPs is measured before and after freeze-drying. Measurement after freeze-drying requires the PCLNPs to be reconstituted. In some embodiments, the difference in the polydispersity index of PCLNPs before and after freeze-drying is calculated by the following formula: 100 × (PDI before freeze-drying / PDI after freeze-drying) = Difference (%).

[0088] In some embodiments, the difference in polydispersity index of PCLNP before and after freeze-drying is less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, and less than 5%. In some embodiments, the difference in polydispersity index of PCLNP before and after freeze-drying is approximately 1% to 30%, 5% to 30%, 10% to 30%, 15% to 30%, 20% to 30%, 25% to 30%, 1% to 25%, 5% to 25%, 10% to 25%, 15% to 25%, 20% to 25%, 1% to 20%, 5% to 20%, 10% to 20%, 15% to 20%, 1% to 15%, 5% to 15%, 10% to 15%, 1% to 10%, 5% to 10%, or 1% to 5%.

[0089] In some embodiments, the size of PCLNPs is measured before and after freeze-drying. Measurement after freeze-drying requires the PCLNPs to be reconstituted. In some embodiments, the difference in size of PCLNPs before and after freeze-drying is calculated using the following formula: 100 × (Size before freeze-drying / Size after freeze-drying) = Difference (%).

[0090] In some embodiments, the size difference of PCLNPs before and after freeze-drying is less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, and less than 5%. In some embodiments, the size difference of PCLNPs before and after freeze-drying is approximately 1% to 30%, 5% to 30%, 10% to 30%, 15% to 30%, 20% to 30%, 25% to 30%, 1% to 25%, 5% to 25%, 10% to 25%, 15% to 25%, 20% to 25%, 1% to 20%, 5% to 20%, 10% to 20%, 15% to 20%, 1% to 15%, 5% to 15%, 10% to 15%, 1% to 10%, 5% to 10%, or 1% to 5%.

[0091] Lipid nanoparticles As used herein, the terms “lipid nanoparticles” or “LNPs” refer to structures comprising a lipophilic core surrounded by a hydrophilic phase enclosing the core. Ionic interactions arising from the different lipophilic and hydrophilic components of the nanoparticles produce independently observable physical properties, with an average size of less than 1 μm, i.e., an average size ranging from 1 to 1000 nm.

[0092] "Average size" is understood as the average diameter of a population of nanoparticles, including the lipophilic and hydrophilic phases. The average size of these systems can be measured by standard methods known to those skilled in the art, which are described, for example, in the experimental section below.

[0093] Anionic lipids refer to lipids that can be negatively charged. Exemplary anionic lipids include, for example, one or more phosphate groups that have a negative charge at physiological pH. In some embodiments, anionic lipids do not include a serine moiety and include, for example, phosphatidylserine lipids.

[0094] As used herein, the term “ionic lipid” refers to a lipid having at least one protonable or deprotonable group, which is positively charged at a pH below physiological pH (e.g., pH 7.4) and neutral at a second pH (preferably above physiological pH). It will be understood by those skilled in the art that the addition or removal of protons as a function of pH is an equilibrium process, and that references to charged or neutral lipids refer to the properties of major species, and that not all lipids need to exist in charged or neutral forms. Generally, ionic lipids have a pKa of protonable group in the range of about 4 to about 7. Ionic lipids are also referred to herein as cationic lipids.

[0095] As used herein, the term “noncationic lipid” refers to any amphiphilic lipid as well as any other neutral or anionic lipid. Therefore, noncationic lipids may be neutral, uncharged lipids, amphoteric lipids, or anionic lipids.

[0096] As used herein, the term “conjugated lipid” refers to a lipid molecule conjugated with a non-lipid molecule (e.g., PEG (e.g., PEG lipids), polyoxazolines, polyamides, or polymers (e.g., cationic polymers)).

[0097] The term "neutral lipid," also known as "helper lipid," refers to any of the various lipid species that exist in either an uncharged or neutral amphoteric form at a selected pH. Such lipids at physiological pH include, but are not limited to, phosphatidylcholine (e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC)), phosphatidylethanolamine (e.g., 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE)), sphingomyelin (SM), ceramides, steroids (e.g., sterols), and their derivatives. Neutral lipids may be synthetic or naturally derived.

[0098] In some embodiments, the lipid nanoparticles include at least one lipid selected from the group consisting of cationic lipids, anionic lipids, neutral lipids, amphoteric lipids, ionic lipids, helper lipids, cholesterol, PEG lipids, phospholipids, and combinations thereof.

[0099] In some embodiments, the lipid nanoparticles include ionic lipids and cationic lipids. In some embodiments, the combination of ionic and cationic lipids constitutes more than 20%, more than 30%, more than 40%, more than 50%, or more than 60% of the total lipids in the lipid nanoparticles. In some embodiments, the combination of ionic and cationic lipids constitutes more than 20% to 70%, more than 20% to 60%, more than 20% to 50%, more than 20% to 40%, more than 20% to 30%, more than 30% to 70%, more than 30% to 60%, more than 30% to 50%, more than 30% to 40%, more than 40% to 70%, more than 40% to 60%, more than 40% to 50%, more than 50% to 70%, more than 50% to 60%, or more than 60% to 70%. In some embodiments, the combination of ionic and cationic lipids constitutes at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% of the total lipids in the lipid nanoparticles.

[0100] In some embodiments, the ionic lipids are primary aminolipids, secondary aminolipids, tertiary aminolipids, or polyhydric lipids. In some embodiments, the ionic lipids constitute more than about 5%, more than about 10%, more than about 20%, more than about 30%, more than about 40%, or more than about 50% of the total lipids in the lipid nanoparticles. In some embodiments, ionic lipids constitute approximately 5% to 50%, 5% to 45%, 5% to 40%, 5% to 35%, 5% to 30%, 5% to 25%, 5% to 20%, 5% to 15%, 5% to 10%, 10% to 50%, 10% to 45%, 10% to 40%, 10% to 35%, 10% to 30%, 10% to 25%, 10% to 20%, 10% to 15%, 15% to 50%, 15% to 45%, 15% to 40%, 15% to 35%, and 15% to 50% of the total lipids in the lipid nanoparticles. The percentages are approximately 30%, 15% to 25%, 15% to 20%, 20% to 50%, 20% to 45%, 20% to 40%, 20% to 35%, 20% to 30%, 20% to 25%, 25% to 50%, 25% to 45%, 25% to 40%, 25% to 35%, 25% to 30%, 30% to 50%, 30% to 45%, 30% to 40%, 30% to 35%, 35% to 50%, 35% to 45%, 35% to 40%, 40% to 50%, 40% to 45%, or 45% to 50%. In some embodiments, the ionic lipids constitute at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, or at least 50% of the total lipids in the lipid nanoparticles.

[0101] In some embodiments, the cationic lipid is a quaternary aminolipid. In some embodiments, the cationic lipid constitutes more than 5%, more than 10%, more than 20%, more than 30%, more than 40%, or more than 50% of the total lipids in the lipid nanoparticles. In some embodiments, cationic lipids constitute approximately 5% to 50%, 5% to 45%, 5% to 40%, 5% to 35%, 5% to 30%, 5% to 25%, 5% to 20%, 5% to 15%, 5% to 10%, 10% to 50%, 10% to 45%, 10% to 40%, 10% to 35%, 10% to 30%, 10% to 25%, 10% to 20%, 10% to 15%, 15% to 50%, 15% to 45%, 15% to 40%, 15% to 35%, and 15% to 20% of the total lipids in the lipid nanoparticles. The percentages are approximately 30%, 15% to 25%, 15% to 20%, 20% to 50%, 20% to 45%, 20% to 40%, 20% to 35%, 20% to 30%, 20% to 25%, 25% to 50%, 25% to 45%, 25% to 40%, 25% to 35%, 25% to 30%, 30% to 50%, 30% to 45%, 30% to 40%, 30% to 35%, 35% to 50%, 35% to 45%, 35% to 40%, 40% to 50%, 40% to 45%, or 45% to 50%. In some embodiments, the cationic lipids constitute at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, or at least 50% of the total lipids in the lipid nanoparticles.

[0102] In some embodiments, the ionic lipid is C12-200. In some embodiments, the cationic lipid is 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA). In some embodiments, the ionic lipid is C12-200 and the cationic lipid is 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA). In some embodiments, C12-200 accounts for about 30% of the total lipids in the lipid nanoparticles, and DOTMA accounts for about 20% of the total lipids in the lipid nanoparticles.

[0103] In some embodiments, the cationic lipid is 3β-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol), DOTAP:DOPE(1:1 w / w), DOTAP:DOPE(1:1, w / w)+0.1 wt.% NBD-DOPE, 1-Oleoyl-2-[6-[(7-Nitro-2-1,3-Benzoxadiazole-4-yl)amino]hexanoyl]-3-trimethylammoniumpropane (chloride salt) (fluorescent DOTAP), N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propane-1-aminium bromide (DORI), O,O'-Ditetradecanoyl-N-(α-trimethylammonioacetyl)diethanolamine chloride (DC-6-14), 1,2-Dilauroyl-sn-glycero-3-ethylphosphocholine (chloride) (12:0 EPC), 1,2-Dimiristoyl-sn-glycero-3-ethylphosphocholine (chloride) (14:0 EPC), 1,2-Dipalmitoyl-sn-glycero-3-ethylphosphocholine (chloride) (16:0 EPC), 1,2-Distearoyl-sn-glycero-3-ethylphosphocholine (chloride) (18:0 EPC), 1,2-Dioleoyl-sn-glycero-3-ethylphosphocholine (chloride) (18:1 EPC), 1-Palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (chloride) (16:0-18:0 EPC), 1,2-Dimyristoyl-sn-glycero-3-ethylphosphocholine (Tf salt) (14:1 EPC), Dimethyldioctadecylammonium (bromide salt) (18:0 DDAB), 1,2-Dimyristoyl-3-trimethylammonium-propane (chloride salt) (14:0 Selected from the group consisting of (TAP), 1,2-dipalmitoyl-3-trimethylammonium-propane (chloride salt) (16:0 TAP), 1,2-stearoyl-3-trimethylammonium-propane (chloride salt) (18:0 TAP), 1,2-dioleoyl-3-trimethylammonium-propane (chloride salt) (18:1 TAP (DOTAP)), 1,2-dioleoyl-3-trimethylammonium-propane (methyl sulfate) (18:1 TAP (DOTAP, MS salt)), or 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (chloride salt) (DOTMA).

[0104] In some embodiments, the net charge of the LNP is positive at pH 7. In some embodiments, the net charge of the LNP is negative at pH 7. In some embodiments, the net charge of the LNP is neutral at pH 7.

[0105] Treatment drugs As used herein, the terms “therapeutic” or “preventive” refer to any agent that, when administered to a subject, has therapeutic, diagnostic, and / or preventive effects, and / or induces a desired biological and / or pharmacological effect. Therapeutic agents are also called “active drugs,” “activating agents,” or “active ingredients.” Such substances include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

[0106] As used herein, the term “nucleic acid” refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in either single-stranded or double-stranded form, and includes DNA, RNA, and hybrids thereof. DNA may take the form of antisense molecules, plasmid DNA, cDNA, PCR products, or vectors. RNA may take the form of small hairpin RNA (shRNA), messenger RNA (mRNA), antisense RNA, miRNA, micRNA, multivalent RNA, dicer substrate RNA, or viral RNA (vRNA), and combinations thereof. Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or bindings, which are synthetic, natural, and unnatural, and which have similar binding properties to the reference nucleic acid. Examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidates, methylphosphonates, chiral methylphosphonates, 2'-O-methylribonucleotides, and peptide nucleic acids (PNAs). Unless otherwise specified, the term encompasses nucleic acids containing known analogs of natural nucleotides having similar binding properties to the reference nucleic acid. Unless otherwise indicated, a given nucleic acid sequence implicitly includes not only the explicitly indicated sequence but also its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologues, single nucleotide polymorphisms, and complementary sequences. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with a mixed base and / or deoxyinosine residue (Batzer et al., Nucleic Acid Res., 19:5081 (1991), Ohtsuka et al., J. Biol. Chem., 260:2605-2608 (1985), Rossolini et al., Mol. Cell. Probes, 8:91-98 (1994)). A "nucleotide" contains the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together via phosphate groups."Bases" include purines and pyrimidines, which further include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, as well as synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications that introduce new reactive groups (e.g., amines, alcohols, thiols, carboxylates, and alkyl halides).

[0107] In one embodiment, nucleic acid molecules are approximately 10 nucleotides (nt) to 20 kilobases (kb), approximately 500 nt to approximately 20 kb, approximately 1 kb to approximately 20 kb, approximately 2 kb to approximately 20 kb, approximately 3 kb to approximately 20 kb, approximately 4 kb to approximately 20 kb, approximately 5 kb to approximately 20 kb, approximately 6 kb to approximately 20 kb, approximately 7 kb to approximately 20 kb, approximately 8 kb to approximately 20 kb, approximately 9 kb to approximately 20 kb, approximately 10 kb to approximately 20 kb, approximately 15 kb to approximately 20 kb, approximately 10 nt to approximately 15 kb, approximately 500 nt to approximately 15 kb, and approximately 1 kb to approximately 15kb, about 2kb to about 15kb, about 3kb to about 15kb, about 4kb to about 15kb, about 5kb to about 15kb, about 6kb to about 15kb, about 7kb to about 15kb, about 8kb to about 15kb, about 9kb to about 15kb, about 10kb to about 15k b, approx. 10nt~10kb, approx. 500nt~approx. 10kb, approx. 1kb~approx. 10kb, approx. 2kb~approx. 10kb, approx. 3kb~approx. 10kb, approx. 8kb to about 10kb, about 9kb to about 10kb, about 10nt to 8kb, about 500nt to about 8kb, about 1kb to about 8kb, about 2kb to about 8kb, about 3kb to about 8kb, about 4kb to about 8kb, about 5kb to about 8kb, about 6kb to about 8kb, Approximately 7kb to approximately 8kb, approximately 10nt to 6kb, approximately 500nt to approximately 6kb, approximately 1kb to approximately 6kb, approximately 2kb to approximately 6kb, approximately 3kb to approximately 6kb, approximately 4kb to approximately 6kb, approximately 5kb to approximately 6kb, approximately 10nt to 5kb, approximately 500nt to approximately 5kb, The nucleotides are approximately 1kb to 5kb, 2kb to 5kb, 3kb to 5kb, 4kb to 5kb, 10nt to 4kb, 500nt to 4kb, 1kb to 4kb, 2kb to 4kb, 3kb to 4kb, 10nt to 3kb, 500nt to 3kb, 1kb to 3kb, 2kb to 3kb, 10nt to 2kb, 500nt to 2kb, 1kb to 2kb, 10nt to 1kb, 500nt to 1kb, or approximately 10nt to 500nt. Preferably, the nucleic acid is RNA (e.g., siRNA). Preferably, the siRNA is approximately 20nt to 25nt. Preferably, the nucleic acid is DNA (e.g., a viral vector) and is about 3kb to about 20kb in length.

[0108] Nucleotide analogs may be any molecule obtained by modifying ribonucleotides, deoxyribonucleotides, RNA, or DNA to improve nuclease resistance, stabilize them, increase their affinity to complementary nucleic acids, enhance cell permeability, or make them visible, compared to RNA or DNA. Nucleotide analogs may be native or non-native molecules, examples of which include sugar-modified nucleotide analogs and phosphate-diester-modified nucleotide analogs.

[0109] A sugar-modified nucleotide analog may be any one obtained by adding or substituting a substance having any chemical structure for some or all of the chemical structure of the sugar of a nucleotide. Specific examples include nucleotide analogs substituted with 2'-O-methylribose, nucleotide analogs substituted with 2'-O-propylribose, nucleotide analogs substituted with 2'-methoxyethoxyribose, nucleotide analogs substituted with 2'-O-methoxyethylribose, nucleotide analogs substituted with 2'-O-[2-(guanidinium)ethyl]ribose, nucleotide analogs substituted with 2'-O-fluororibose, bridged artificial nucleic acids (BNAs) having two cyclic structures by introducing a cross-linking structure to the sugar portion, more specifically, locked artificial nucleic acids (LNAs) in which the oxygen atom at the 2' position and the carbon atom at the 4' position are cross-linked via methylene, and ethylene-bridged artificial nucleic acids (ENAs).

[0110] Phosphodiester-modified nucleotide analogs may be any analogs obtained by adding or substituting any chemical substance with part or all of the chemical structure of the phosphodiester bond of a nucleotide. Specific examples include nucleotide analogs substituted with phosphorothioate bonds and nucleotide analogs substituted with N3'-P5' phosphoramide bonds.

[0111] Nucleic acid derivatives may be any molecule obtained by adding another chemical substance to nucleic acid to improve nuclease resistance, stabilize it, increase its affinity to complementary nucleic acids, enhance cell permeability, or make it visible, compared to nucleic acids. Specific examples include derivatives with added 5'-polyamines, cholesterol, steroids, bile acids, vitamins, Cy5, Cy3, 6-FAM, and biotin.

[0112] The nucleic acids of the present invention are not limited to specific nucleic acids, and may include, for example, nucleic acids intended to improve diseases, symptoms, disorders, or illnesses, or to alleviate or prevent the onset of diseases, symptoms, disorders, or illnesses (sometimes referred to herein as "treatment of diseases, etc."), or nucleic acids for controlling the expression of a desired protein useful for research, even though the protein does not contribute to the treatment of diseases, etc.

[0113] Specific examples of nucleic acids in the present invention include siRNA, shRNA, miRNA, miRNA mimics, antisense nucleic acids, ribozymes, mRNA, decoy nucleic acids, aptamers, plasmid DNA, cosmid DNA, and BAC DNA. The nucleic acid is preferably RNA (e.g., siRNA and mRNA) or an analog or derivative obtained by artificially modifying RNA.

[0114] In this invention, "siRNA" refers to a double-stranded RNA or its analogues consisting of 10 to 30 nucleotides, preferably 15 to 25 nucleotides, and containing a complementary sequence. siRNA contains, preferably 1 to 3 nucleotides, more preferably 2 nucleotides, overhanging nucleotides at its 3' end. The complementary sequence portion may contain perfectly complementary or non-complementary nucleotides, but is preferably perfectly complementary.

[0115] The siRNAs in this invention are not limited to specific siRNAs; for example, siRNAs for knockdown of gene expression against disease-related genes may be used. Disease-related genes refer to any genes or polynucleotides that produce transcripts or translation products at abnormal levels or in abnormal forms in cells derived from patient tissue compared to tissues or cells derived from disease-free controls. The siRNAs in this invention may be used to control the expression of desired proteins useful for research.

[0116] In this invention, "mRNA" refers to RNA containing a nucleotide sequence that can be translated into a protein. The mRNA in this invention is not limited to a specific mRNA, but may be any mRNA capable of expressing a desired protein in a cell. Preferably, the mRNA is useful for pharmaceutical applications (e.g., disease treatment applications) and / or research applications, and an example of such mRNA is mRNA for expressing a marker protein (e.g., luciferase) in a cell.

[0117] The term "gene" refers to a nucleic acid (e.g., DNA or RNA) sequence that contains a coding sequence of partial or full length necessary for the production of a polypeptide or precursor polypeptide.

[0118] As used herein, “gene product” refers to a gene product (e.g., an RNA transcript or polypeptide).

[0119] The term "RNA" means a molecule containing at least one ribonucleotide residue. "Ribonucleotide" means a nucleotide having a hydroxyl group at the 2' position of the β-D-ribofuranose moiety. The term includes double-stranded RNA, single-stranded RNA, isolated RNA (e.g., partially purified RNA), essentially pure RNA, synthetic RNA, recombinant RNA, and modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Such alterations may include, for example, the addition of non-nucleotide substances to the terminal(s) or internal (e.g., to one or more nucleotides of RNA) of interfering RNA. Nucleotides in RNA molecules in this disclosure may also include non-standard nucleotides (e.g., non-natural nucleotides or chemically synthesized nucleotides or deoxynucleotides). These modified RNAs may be called analogs of naturally occurring RNA. As used herein, the terms “ribonucleic acid” and “RNA” refer to molecules containing at least one ribonucleotide residue (e.g., siRNA, antisense RNA, single-stranded RNA, microRNA, mRNA, non-coding RNA, and polyvalent RNA).

[0120] In some embodiments, RNA is self-replicating RNA. In some embodiments, RNA is mRNA. In some embodiments, RNA is siRNA. In some embodiments, nucleic acid is approximately 1,000 to 13,000 nucleotides long.

[0121] The lipid nanoparticles of this disclosure also typically have total lipid:RNA ratios (mass / mass ratio) of approximately 1:1 to 100:1, 1:1 to 50:1, 2:1 to 45:1, 3:1 to 40:1, 5:1 to 38:1, or 6:1 to 40:1, or 7:1 to 35:1, or 8:1 to 30:1, or 10:1 to 25:1, or 8:1 to 12:1, or 13:1 to 17:1, or 18:1 to 24:1, or 20:1 to 30:1.

[0122] In some embodiments, the lipid nanoparticles contain RNA that is completely encapsulated within the lipid portion of the formulation, with approximately 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 30% to 95%, 40% to 95%, 50% to 95%, 60% to 95%, 70% to 95%, 80% to 95%, 85% to 95%, 90% to 95%, and 30% to 9 0%, approximately 40% to approximately 90%, approximately 50% to approximately 90%, approximately 60% to approximately 90%, approximately 70% to approximately 90%, approximately 80% to approximately 90%, or at least approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 91%, approximately 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, or approximately 99% (or any percentage or range thereof) have RNA enclosed within them.

[0123] The encapsulated siRNA is calculated using the following formula: [(Total siRNA - Free siRNA) / (Total siRNA)] × 100%.

[0124] The term "expression" of a nucleic acid sequence refers to one or more of the following events: (1) generation of an RNA template from a DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing), (3) translation of the RNA into a polypeptide or protein, and (4) post-translational modification of the polypeptide or protein.

[0125] Diseases and Disabilities The diseases are not limited to specific diseases, and examples of diseases include those listed below. The contents within each parentheses () are examples of the corresponding disease-related genes, unless a specific disease example is listed. Another example of nucleic acids in this invention is a nucleic acid that controls the expression level of any of those disease-related genes (or proteins encoded by disease-related genes).

[0126] (1) Hematological disorders [anemia (CDAN1, CDA1, RPS19, DBA, PKLR, PK1, NT5C3, UMPH1, PSN1, RHAG, RH50A, NRAMP2, SPTB, ALAS2, ANH1, ASB, ABCB7, ABC7, ASAT), naked lymphocytic syndrome (TAPBP, TPSN, TAP2, ABCB3, PSF2, RING11, MHC2TA, C2TA, RFX5), hemorrhagic disorders (TBXA2R, P2R X1, P2X1), factor H and factor H-like 1 deficiency (HF1, CFH, HUS), factor V and factor VIII deficiency (MCFD2), factor VII deficiency (F7), factor X deficiency (F10), factor XI deficiency (F11), factor XII deficiency (F12, HAF), factor XIIIA deficiency (F13A1, F13A), factor XIIIB deficiency (F13B), Fanconi anemia (FANCA, FACA, FA1, FA, FAA, FAAP95, FAAP90, F1134064, FANCB, FANCC, FACC, BRCA2, FANCD1, FANCD2, FANCD, FACD, FAD, FACE, FACE, FANCF, XRCC9 , FANCG, BRIP1, BACH1, FANCJ, PHF9, FANCL, FANCM, KIAA1596), hemophagocytic lymphohistopathy (PRF1, HPLH2, UNC13D, MUNC13-4, HPLH3) , HLH3, FHL3), hemophilia A (F8, F8C, HEMA), hemophilia B (F9, HEMB), bleeding disorders (PI, ATT, F5), leukopenia (ITGB2, CD18, LCAMB, LAD, EIF2B1, EIF2BA, EIF2B2, EIF2B3, EIF2B5, LVWM, CACH, CLE, EIF2B4), sickle cell anemia (HBB), thalassemia (HBA2, HBB, HBD, LCRB, HBA1), etc.],

[0127] (2) Inflammatory / immune diseases [[AIDS (KIR3DL1, NKAT3, NKB1, AMB11, KIR3DS1, IFNG, CXCL12, SDF1), Autoimmune Lymphoproliferative Syndrome (TNFRSF6, APT1, FAS, CD95, ALPS1A), Combined Immunodeficiency (IL2RG, SCIDX1, SCIDX, IMD4), HIV Infection (CCL5, SCYA5, D17S135E, TCP228, IL10, CSIF, CMKBR 2, CCR2, DMKBR5, CCCKR5, CCR5), immunodeficiency (CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4, TNFSF5, CD40 LG, HIGM1, IGM, FOXP3, IPEX, AIID, XPID, PIDX, TNFRSF14B, TACI), inflammation (IL10, IL-1, IL-13, IL-17, IL-23, CTLA4), severe complex Immunodeficiency disorders (JAK3, JAKL, DCLRE1C, ATREMIS, SCIDA, RAG1, RAG2, ADA, PTPRC, CD45, LCA, IL7R, CD3D, T3D, IL2RG, SCIDX1, SCIDX, IMD4), rheumatoid arthritis, psoriasis, inflammatory bowel disease (e.g., Crohn's disease, ulcerative colitis), Sjögren's syndrome, Behçet's disease, multiple sclerosis, systemic lupus erythematosus, lupus nephritis, discoid lupus erythematosus Castleman's disease, ankylosing spondylitis, polymyositis, dermatomyositis, polyarteritis nodosa, mixed connective tissue disease, scleroderma, lupus profundus, chronic thyroiditis, Graves' disease, autoimmune gastritis, type I and type II diabetes, autoimmune lysis. Blood anemia, autoimmune neutropenia, thrombocytopenia, atopic dermatitis, chronic active hepatitis, myasthenia gravis, graft-versus-host disease, Addison's disease, abnormal immune response, arthritis, dermatitis, radiation dermatitis, primary biliary cirrhosis, etc.],

[0128] (3) Metabolic / Hepatic / Kidney Diseases [Amyloid Neuropathy (TTR, PALB), Amyloidosis (APOA1, APP, AAA, CVAP, AD1, GSN, FGA, LYZ, TTR, PALB), Non-Alcoholic Steatohepatitis, and Hepatic Fibrosis (COL1A1), Cirrhosis (KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988), Cystic Fibrosis (CFTR, ABCC7, CF, MRP7), Glycogen Storage Disease (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM), Hepatocellular Adenoma (TC)] [F1, HFN1A, MODY3), liver failure (SCOD1, SCO1), hepatic lipase deficiency (LIPC), hepatoblastoma (CTNNB1, PDFGRL, PDGRL, PRLTS, AXIN1, AXIN, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5), medullary polycystic kidney disease (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2), phenylketonuria (PAH, PKU1, QDPR, DHPR, PTS), polycystic kidney disease and liver disease (FCYT, PKHD1, APRKD, PDK1, PDK2, PDK4, PDKTS, PRKCSH, G19P1, PCLD, SEC63, etc.]

[0129] (4) Neurological disorders [ALS (SOD1, ALS2, STEX, FUS, TARDBP, VEGF), Alzheimer's disease (APP, AAA, CVAP, AD1, APOE, AD2, PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE, DCP1, ACE1, MPO, PACIP1, PAXIP1L, PTIP, A2M, BLMH, BMH, PSEN1, AD3), Autism (BZRAP1, MDGA2, GLO1, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4, KIAA1260, AUTSX2), Fragile X syndrome (F [MR2, FXR1, FXR2, mGLUR5), Huntington's disease (HD, IT15, PRNP, PRIP, JPH3, JP3, HDL2, TBP, SCA17), Parkinson's disease (NR4A2, NURR1, NOT, TINUR, SNCAIP, TBP, SCA17, SNCA, NACP, PARK1, PARK4, DJ1, DBH, NDUFV2), Rett syndrome (MECP2, RTT, PPMX, MRX16, MRX79, CDKL5, STK9), schizophrenia (GSK3, 5-HTT, COMT, DRD, SLC6A3, DAOA, DTNBP1), secretase-related disorder (APH-1), etc.]

[0130] (5) Eye diseases [Age-related macular degeneration (Abcr, Cc12, cp, Timp3, Cathepsin D, Vldlr, Ccr2), Cataracts (CRYAA, CRYA1, CRYBB2, CRYB2, PITX3, BFSP2, CP49, CP47, PAX6, AN2, MGDA, CRYBA1, CRYB1, CRYGC, CRYG3, CCL, LIM2, MP19, CRYGD, CRYG4, BSFP2, CP49] , CP47, HSF4, CTM, MW, AQPO, CRYAB, CRYA2, CTPP2, CRYBB1, CRYGD, CRYG4, CRYA1, GJA8, CX50, CAE1, GJA3, CX4 6, CZP3, CAE3, CCM1, CAM, KRIT1), corneal opacity (APOA1, TGFB1, CSD2, CDGG1, CSD, BIGH3, CDG2, TASTD2, TROP2, M1S1, V SX1, RINX, PPCD, PPD, KTCN, COL8A2, FECD, PPCD2, PIP5K3, CFD), congenital hereditary flat cornea (KERA, CNA2), glaucoma (MYOC, TIGR, GLC1A, JOAG, GPOA, OPTN, GLC1E, FIP2, HYPL, NRP, CYP1B1, GLC3A, OPA1, NTG, NPG, CYP1B1, GLC3A), Leber Congenital Kurouchi Disorders (CRB1, RP12, CRX, CORD2, CRD, RPGRIP1, LCA6, CORDS, RPE65, RP20, AIPL1, LCA4, GUCY2D, GUC2D, LCA1, CORD6, RDH12, LCA3), macular dystrophy (ELOVL4, ADMD, STGD2, STGD3, RDS, RP7, PRPH2, PRPH, AVMD, AOFMD, VMD2, etc.), and

[0131] (6) Neoplastic diseases [malignant tumors, neovascular glaucoma, infantile hemangioma, multiple myeloma, chronic sarcoma, metastatic melanoma, Kaposi's sarcoma, vascular proliferation, cachexia, metastasis of breast cancer, etc., cancer (e.g., colorectal cancer (e.g., familial colorectal cancer, hereditary nonpolyposis colorectal cancer, gastrointestinal stromal tumors), lung cancer (e.g., non-small cell lung cancer, small cell lung cancer, malignant mesothelioma), mesothelioma, pancreatic cancer (e.g., pancreatic ductal carcinoma), gastric cancer (e.g., papillary adenocarcinoma, mucinous adenocarcinoma, adenosquamous cell carcinoma), breast cancer (e.g., invasive (e.g., ductal carcinoma in situ, ductal carcinoma in non-invasive, inflammatory breast cancer), ovarian cancer (e.g., epithelial ovarian cancer, extragonadal germ cell tumor, ovarian germ cell tumor, low-grade ovarian tumor), prostate cancer (e.g., hormone-dependent prostate cancer, hormone-independent prostate cancer), liver cancer (e.g., primary liver cancer, extrahepatic cholangiocarcinoma), thyroid cancer (e.g., medullary thyroid carcinoma), kidney cancer (e.g., renal cell carcinoma, transitional cell carcinoma of the renal pelvis and ureter), uterine cancer, brain tumor (e.g., pineal astrocytoma, pilocytic astrocytoma, etc.) Diffuse astrocytoma, anaplastic astrocytoma, melanoma, sarcoma, bladder cancer, hematological cancers (e.g., multiple myeloma), pituitary adenoma, glioma, acoustic neuroma, retinal sarcoma, pharyngeal cancer, laryngeal cancer, tongue cancer, thymoma, esophageal cancer, duodenal cancer, colon cancer, rectal cancer, hepatocellular carcinoma, pancreatic endocrine tumor, bile duct cancer, gallbladder cancer, penile cancer, ureteral cancer, testicular tumor, vulvar cancer, cervical cancer, endometrial cancer, uterine sarcoma, gestational trophoblastic disease, vaginal cancer, skin cancer, mycosis fungoides, basal cell tumor, soft tissue sarcoma, malignant lymphoma, rhodochrosites [Kidney disease, myelodysplastic syndrome, adult T-cell leukemia, chronic myeloproliferative disorders, pancreatic endocrine tumors, fibrous histiocytoma, leiomyosarcoma, rhabdomyosarcoma, cancer of unknown primary origin], leukemia (e.g., acute leukemia (e.g., acute lymphoblastic leukemia, acute myeloid leukemia), chronic leukemia (e.g., chronic lymphocytic leukemia, chronic myeloid leukemia), myelodysplastic syndrome), uterine sarcoma (e.g., mixed mesodermal tumor, uterine leiomyosarcoma, endometrial stromal tumor), myelofibrosis, etc.].

[0132] Pharmaceutical composition The compositions of the present invention as pharmaceuticals can be produced by using the methods disclosed herein together with pharmaceutically acceptable carriers. Examples of drug dosage forms include orally administered formulations (e.g., capsules, tablets, or liquids) containing conventional adjuvants (e.g., buffers and / or stabilizers). Examples of drug dosage forms include parenterally administered formulations (e.g., liquids such as injections) containing conventional adjuvants (e.g., buffers and / or stabilizers). Examples of drug dosage forms include topically administered formulations (e.g., ointments, creams, liquids, and plasters) containing conventional pharmaceutical carriers.

[0133] As used herein, the expression “pharmaceutically acceptable” means a compound, material, composition, and / or dosage form that is suitable for use in contact with human and animal tissues without causing excessive toxicity, irritation, allergic response, or other problems or complications, within the bounds of sound medical judgment, commensurate with a reasonable benefit-to-risk ratio.

[0134] As used herein, the expression “pharmaceutically acceptable excipients” refers to any component other than the compounds described herein (e.g., a vehicle capable of suspending or dissolving the active compound) that is substantially non-toxic and non-inflammatory in the patient. Excipients may include, for example, anti-adhesion agents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (pigments), emollients, emulsifiers, fillers (diluents), film-forming agents or coatings, flavorings, fragrances, flow accelerators (flow enhancers), lubricants, preservatives, printing inks, adsorbents, suspending agents or dispersants, sweeteners, and hydration water. Exemplary excipients include, but are not limited to, butylated hydroxytoluene (BHT), calcium carbonate, dicalcium phosphate, calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pre-gelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0135] The compositions of the present invention can be used to introduce active ingredients into various types of cells, tissues, or organs. Examples of cells to which the compositions of the present invention may be applied include: mesenchymal stem cells, neural stem cells, skin stem cells, spleen cells, nerve cells, glial cells, pancreatic B cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fibrous cells, muscle cells (e.g., skeletal muscle cells, cardiomyocytes, myoblasts, muscle satellite cells, smooth muscle cells), adipocytes, blood cells (e.g., macrophages, T cells, B cells, natural killer cells, mast cells, leukocytes, neutrophils, basophils, eosinophils, monocytes, megakaryocytes, hematopoietic stem cells), synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary gland cells, hepatocytes or stromal cells, oocytes, spermatophores, or progenitor cells capable of differentiating into these cells, stem cells (e.g., including induced pluripotent stem cells (iPS cells), embryonic stem cells (ES cells)), primordial germ cells, oocytes, and fertilized eggs. Examples of tissues or organs to which the composition of the present invention may be applied include all tissues or organs in which the above-mentioned cells exist (e.g., the brain, parts of the brain (e.g., olfactory bulb, amygdala, basal ganglia, hippocampus, thalamus, hypothalamus, subthalamic nucleus, cerebral cortex, medulla oblongata, cerebellum, occipital lobe, frontal lobe, temporal lobe, putamen, caudate nucleus, corpus callosum, substantia nigra)), spinal cord, pituitary gland, stomach, pancreas, kidney, liver, gonads, thyroid gland, gallbladder, bone marrow, adrenal gland, skin, lungs, digestive tract (e.g., large intestine, small intestine), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate gland, placenta, uterus, bone, joints, and muscles (e.g., skeletal muscle, smooth muscle, cardiac muscle)).

[0136] The compositions of the present invention are particularly efficient at introducing nucleic acids into target cells.

[0137] The compounds, lipid particles, and compositions of the present invention are stable, have low toxicity, and can be used safely. When the compositions of the present invention are used in vivo, or when the compositions are used as drugs, the compositions are appropriately administered to a subject (e.g., human or non-human mammal (preferably human)) so that an effective amount of nucleic acid can be delivered to target cells.

[0138] When the composition of the present invention is used in vivo, or when the composition is used as a drug, the composition can be administered orally or parenterally (e.g., topically, rectally, or intravenously) in a safe manner in the form of pharmaceutical formulations (e.g., tablets (e.g., sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets), powders, granules, capsules (e.g., soft capsules, microcapsules), liquids, lozenges, syrups, emulsions, suspensions, injections (e.g., subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), topical formulations (e.g., nasal formulations, transdermal formulations, ointments), suppositories (e.g., rectal suppositories, vaginal suppositories), pellets, nasal formulations, pulmonary formulations (inhalants), and infusions). Each formulation may be a controlled-release formulation (e.g., immediate-release formulation and sustained-release formulation (e.g., sustained-release microcapsules)).

[0139] An "effective dose" or "therapeutic effective dose" of an activator or therapeutic agent (e.g., therapeutic nucleic acid) is an amount sufficient to produce the desired effect (e.g., an increase or inhibition of the expression of a target sequence compared to the normal expression level detected in the absence of the nucleic acid). An increase in the expression of a target sequence is achieved when some measurable level of expression product is detected that is not present in the absence of the nucleic acid. If an expression product is present at any level before contact with the nucleic acid, an increase in expression is achieved when the multiple increase in the value achieved with the nucleic acid (e.g., siRNA) relative to the control is approximately 1.05, 1.1, 1.2, 1.3, 1.4, 1.5, 1.75, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, 750, 1000, 5000, or 10000 or greater. Inhibition of the expression of a target gene or target sequence is achieved when the values ​​obtained with nucleic acid (e.g., antisense oligonucleotide) relative to a control are approximately 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%. Suitable assays for measuring the expression of a target gene or target sequence include, for example, protein or RNA level testing using methods known to those skilled in the art (e.g., dot blotting, Northern blotting, in situ hybridization, ELISA, immunoprecipitation, enzyme function, fluorescence or luminescence of a suitable reporter protein, and phenotypic assays known to those skilled in the art).

[0140] Method for generating PCLNP The compositions of the present invention provide a method for producing the pharmaceutical compositions disclosed herein (e.g., polymer-coated lipid nanoparticles). In some embodiments, the lipid nanoparticles are produced from at least one lipid and at least one nucleic acid molecule and mixed with an anionic polymer dissolved in an aqueous solution containing a salt, thereby forming PCLNPs. In some embodiments, the PCLNPs are further mixed with a pharmaceutically acceptable carrier. In some embodiments, the mixture of PCLNPs and the pharmaceutically acceptable carrier is freeze-dried. In some embodiments, the anionic polymer is a methacrylic acid polymer.

[0141] In another embodiment, the disclosure provides a method for stabilizing lipid nanoparticles for freeze-drying, wherein the lipid nanoparticles are mixed with an anionic polymer, which is generated from at least one lipid and at least one nucleic acid molecule and dissolved in an aqueous solution containing a salt, thereby forming PCLNPs. In some embodiments, the PCLNPs are freeze-dried, thereby stabilizing them.

[0142] In another embodiment, the disclosure provides a method for producing a stable pharmaceutical composition, in which an anionic polymer is dissolved in an aqueous solution containing a salt and mixed with lipid nanoparticles containing at least one nucleic acid. In some embodiments, the PCLNPs are freeze-dried to stabilize them.

[0143] In some embodiments, the anionic polymer is a methacrylic acid polymer. In some embodiments, the anionic polymer is dissolved in an aqueous solution containing a salt before being mixed with the LNP. In some embodiments, the aqueous solution containing the salt is selected from the group consisting of HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), PBS (phosphate-buffered saline), TRIS (tris(hydroxymethyl)aminomethane), MES (2-(N-morpholino)ethanesulfonic acid), and citrate buffer. In one embodiment, the aqueous solution is HEPES. In one embodiment, the aqueous solution is PBS. In some embodiments, the pH of the aqueous solution containing the salt is about 7.0 to about 8.0. In some embodiments, the pH is about 7.6.

[0144] In some embodiments, the nucleic acid molecule is DNA or RNA. In some embodiments, RNA is mRNA, microRNA (miRNA), or short interfering RNA (siRNA).

[0145] In some embodiments, the lipid nanoparticles include at least one lipid selected from the group consisting of cationic lipids, anionic lipids, neutral lipids, amphoteric lipids, ionic lipids, helper lipids, cholesterol, PEG lipids, phospholipids, and combinations thereof.

[0146] In some embodiments, the lipid nanoparticles include ionic lipids and cationic lipids. In some embodiments, the molecular ratio of the combination of ionic lipids and cationic lipids in the lipid nanoparticles is greater than 20%, greater than 30%, greater than 40%, greater than 50%, or greater than 60% of the total lipids in the lipid nanoparticles.

[0147] In some embodiments, the ionic lipids are primary aminolipids, secondary aminolipids, tertiary aminolipids, or polyhydric lipids. In some embodiments, the ionic lipids constitute more than about 5%, more than about 10%, more than about 20%, more than about 30%, more than about 40%, or more than about 50% of the total lipids in the lipid nanoparticles.

[0148] In some embodiments, the cationic lipid is a quaternary aminolipid. In some embodiments, the cationic lipid constitutes more than 5%, more than 10%, more than 20%, more than 30%, more than 40%, or more than 50% of the total lipids in the lipid nanoparticles.

[0149] In some embodiments, the ionic lipid is C12-200. In some embodiments, the cationic lipid is 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA). In some embodiments, the ionic lipid is C12-200 and the cationic lipid is 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA). In some embodiments, C12-200 accounts for about 30% of the total lipids in the lipid nanoparticles, and DOTMA accounts for about 20% of the total lipids in the lipid nanoparticles.

[0150] In another aspect, the Disclosure provides a method for storing the lyophilized compositions or pharmaceutical compositions disclosed herein by storing the lyophilized product at a temperature of about 2°C to about 8°C or about -20°C.

[0151] In another embodiment, the Disclosure provides a method herein for reconstituting a lyophilized composition disclosed herein by adding a liquid medium to the lyophilized composition. In some embodiments, the zeta potential, size, and PDI of the reconstituted PCLNPs are measured by comparing them with the zeta potential, size, and PDI of the PCLNPs before and after lyophilization.

[0152] In some embodiments, the zeta potential of PCLNPs is measured before and after reconstruction. In some embodiments, the difference in the zeta potential of PCLNPs before and after reconstruction is calculated by the following formula: 100 × (Zeta potential before reconstruction / Zeta potential after reconstruction) = difference (%).

[0153] In some embodiments, the difference in the zeta potential of PCLNP before and after PCLNP reconstruction is less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, and less than 5%. In some embodiments, the difference in the zeta potential of PCLNPs before and after PCLNP reconstruction is approximately 1% to 30%, 5% to 30%, 10% to 30%, 15% to 30%, 20% to 30%, 25% to 30%, 1% to 25%, 5% to 25%, 10% to 25%, 15% to 25%, 20% to 25%, 1% to 20%, 5% to 20%, 10% to 20%, 15% to 20%, 1% to 15%, 5% to 15%, 10% to 15%, 1% to 10%, 5% to 10%, or 1% to 5%.

[0154] In some embodiments, the zeta potential of PCLNPs is measured before lyophilization and after reconstitution. In some embodiments, the difference in the zeta potential of PCLNPs before lyophilization and after reconstitution is calculated by the following formula: 100 × (Zeta potential before freeze-drying / Zeta potential after reconstruction) = difference (%).

[0155] In some embodiments, the difference in zeta potential between PCLNP before lyophilization and reconstitution of PCLNP is less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, and less than 5%. In some embodiments, the difference in zeta potential of PCLNP before freeze-drying and after reconstitution of PCLNP is approximately 1% to 30%, 5% to 30%, 10% to 30%, 15% to 30%, 20% to 30%, 25% to 30%, 1% to 25%, 5% to 25%, 10% to 25%, 15% to 25%, 20% to 25%, 1% to 20%, 5% to 20%, 10% to 20%, 15% to 20%, 1% to 15%, 5% to 15%, 10% to 15%, 1% to 10%, 5% to 10%, or 1% to 5%.

[0156] In some embodiments, the polyvariance index of PCLNP is measured before and after reconstruction. In some embodiments, the difference in PDI of PCLNP before and after reconstruction is calculated by the following formula: 100 × (PDI before reconstruction / PDI after reconstruction) = difference (%).

[0157] In some embodiments, the difference in the polyvariance index of PCLNP before and after reconstruction of PCLNP is less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, and less than 5%. In some embodiments, the difference in polyvariance index of PCLNP before and after reconstruction of PCLNP is approximately 1% to 30%, 5% to 30%, 10% to 30%, 15% to 30%, 20% to 30%, 25% to 30%, 1% to 25%, 5% to 25%, 10% to 25%, 15% to 25%, 20% to 25%, 1% to 20%, 5% to 20%, 10% to 20%, 15% to 20%, 1% to 15%, 5% to 15%, 10% to 15%, 1% to 10%, 5% to 10%, or 1% to 5%.

[0158] In some embodiments, the polydispersity index of PCLNPs is measured before lyophilization and after reconstitution. In some embodiments, the difference in PDI of PCLNPs before lyophilization and after reconstitution is calculated by the following formula: 100 × (PDI before freeze-drying / PDI after reconstitution) = difference (%).

[0159] In some embodiments, the difference in polydispersity index between PCLNP before lyophilization and PCLNP after reconstruction is less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, and less than 5%. In some embodiments, the difference in polydispersity index of PCLNP before freeze-drying and after reconstitution of PCLNP is approximately 1% to 30%, 5% to 30%, 10% to 30%, 15% to 30%, 20% to 30%, 25% to 30%, 1% to 25%, 5% to 25%, 10% to 25%, 15% to 25%, 20% to 25%, 1% to 20%, 5% to 20%, 10% to 20%, 15% to 20%, 1% to 15%, 5% to 15%, 10% to 15%, 1% to 10%, 5% to 10%, or 1% to 5%.

[0160] In some embodiments, the size of the PCLNP is measured before and after reconstruction. In some embodiments, the difference in the size of the PCLNP before and after reconstruction is calculated by the following formula: 100 × (Size before reconstruction / Size after reconstruction) = difference (%).

[0161] In some embodiments, the difference in size of PCLNPs before and after reconstruction is less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, and less than 5%. In some embodiments, the difference in size of PCLNPs before and after PCLNP reconstruction is approximately 1% to 30%, 5% to 30%, 10% to 30%, 15% to 30%, 20% to 30%, 25% to 30%, 1% to 25%, 5% to 25%, 10% to 25%, 15% to 25%, 20% to 25%, 1% to 20%, 5% to 20%, 10% to 20%, 15% to 20%, 1% to 15%, 5% to 15%, 10% to 15%, 1% to 10%, 5% to 10%, or 1% to 5%.

[0162] In some embodiments, the size of PCLNPs is measured before lyophilization and after reconstitution. In some embodiments, the difference in size between PCLNPs before lyophilization and after reconstitution is calculated by the following formula: 100 × (Size before freeze-drying / Size after reconstruction) = difference (%).

[0163] In some embodiments, the difference in size between PCLNPs before lyophilization and after reconstruction is less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, and less than 5%. In some embodiments, the size difference of PCLNPs before freeze-drying and after reconstitution is approximately 1% to 30%, 5% to 30%, 10% to 30%, 15% to 30%, 20% to 30%, 25% to 30%, 1% to 25%, 5% to 25%, 10% to 25%, 15% to 25%, 20% to 25%, 1% to 20%, 5% to 20%, 10% to 20%, 15% to 20%, 1% to 15%, 5% to 15%, 10% to 15%, 1% to 10%, 5% to 10%, or 1% to 5%.

[0164] Treatment method The present invention provides a method for treating a subject by administering the compositions disclosed herein. The lyophilized compositions disclosed herein can be administered orally, intravenously, subcutaneously, intramuscularly, intraperitoneally, topically, and by injection.

[0165] The term “patient” refers to any person who may want treatment, may need treatment, needs treatment, is receiving treatment, is scheduled to receive treatment, or is receiving care from a professional trained for a particular disease or condition.

[0166] The term "subject" refers to any organism to which the composition according to this disclosure may be administered, for example, for experimental, diagnostic, preventive, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals (e.g., mice, rats, rabbits, non-human primates, and humans)).

[0167] The term “treatment” refers to the partial or complete alleviation, improvement, enhancement, reduction, delay of onset, inhibition of progression, reduction of severity, and / or reduction of incidence of one or more symptoms or characteristics of a particular infection, disease, disorder, and / or condition. For example, “treatment” of cancer may refer to inhibiting the survival, growth, and / or spread of the tumor. Treatment may be administered to subjects who show no signs of the disease, disorder, and / or condition, and / or subjects who show only early signs of the disease, disorder, and / or condition, with the aim of reducing the risk of developing a condition associated with the disease, disorder, and / or condition. [Examples]

[0168] Further embodiments of the present disclosure are described in more detail in the following embodiments, but are not intended to limit the scope of the claims.

[0169] Example 1: Evaluating the effect of adding S100 to the formulation to maintain activity after freeze-drying. Preparation of LNPs (lipid nanoparticles) LNP was prepared using microfluidic mixing, and the lipid concentration was maintained at 2 mg / mL. Lipids C12-200 or MC3 or SM-102, DOTMA, Chol (cholesterol), (DSPC) (distearoylphosphatidylcholine, an amphoteric phospholipid), and DMG-PEG(2k) (1,2-dimiristoyl-rac-glycero-3-methoxypolyethylene glycol-2000, a synthetic polar lipid) were added in a ratio of 30 (ionizable / cationic):20 (DOTMA):38.5 (Chol):10 (DSPC):1.5 (DMG-PEG(2k)) mol%, with an N / P (nitrogen / phosphate) ratio equal to 20. siGAPDH (siRNA against glyceraldehyde-3-phosphate dehydrogenase) or siHPRT (siRNA against hypoxanthine-guanine phosphoribosyltransferase) were the payloads used in in vitro and in vivo studies, respectively. The total flow rate (TFR) was set to 12 mL / min. The flow rate ratio (FRR) was set to 3:1 (aqueous phase:organic phase). During LNP preparation by microfluidic mixing, the sample was added to a 20 kDa MWCO (molecular weight cutoff) dialysis cassette and dialyzed overnight with 100 times the volume of 1 × PBS or 50 mM HEPES.

[0170] Typically, samples were diluted 100-fold with 1×PBS and 100-10-fold with 0.1×PBS, and tested for size and zeta potential, respectively, using dynamic light scattering (DLS). Inclusion was evaluated using the Ribogreen assay according to the manufacturer's protocol. Lipid concentration per LNP was calculated based on siRNA concentration.

[0171] In some cases, LNPs were concentrated using ultracentrifugation with a 30 kDa MWCO membrane centrifuged at 2000 G until the desired siRNA concentration was obtained. In some cases, the dialyzed samples were buffered with 50 mM HEPES before lyophilization.

[0172] Added S100 By working backward from the N / P ratio, the lipid concentration for each LNP is calculated based on the siRNA concentration.

[0173] To avoid ionic interactions, a 50 mg / mL S100 solution was prepared in 50 mM HEPES buffer, and the pH was adjusted until S100 was completely dissolved (typically pH = 7.8). The final pH was recorded.

[0174] The obtained S100 solution was added to LNP based on the weight ratio of S100 to lipids. The sample was shaken by high-speed pipetting or vortex mixing.

[0175] After dilution with deionized water (DIW) 100-fold and 10- to 50-fold with DIW, each S100-LNP formulation was evaluated for size / PDI (polydispersion index) and charge.

[0176] Freeze drying Solutions of 10%, 20%, and 40% sucrose were prepared in 50 mM HEPES buffer.

[0177] Equal amounts of each sucrose solution were added to each solution so that the effective concentration of sucrose in the solution was half that of the stock solution.

[0178] After the sucrose addition step, the size was analyzed by diluting 100-fold with DIW, and the zeta potential (ZP) was analyzed by diluting 10- to 50-fold with DIW.

[0179] The samples were frozen overnight at -80°C and then freeze-dried in a bench freeze-dryer for up to two days.

[0180] The sample was reconstituted by adding the same amount of DIW as the amount of LNP used, or to the desired concentration required for administration. After reconstitution, the sample was analyzed for size / PDI and charge after 100-fold dilution with DIW and after 10- to 50-fold dilution with DIW, respectively.

[0181] The total siRNA was determined based on the initially added LNP solution. The encapsulated siRNA was calculated using the following formula: [(Total siRNA - Free siRNA) / (Total siRNA)] × 100%.

[0182] in vitro cell transfection RAW264.7 cells were plated overnight at 10,000 cells / well in 96-well opaque cell culture plates. At the time of transfection, the medium was changed to OMEM. Samples were diluted with OMEM and added to the wells. Cells were transfected for 5 hours, after which the cells were washed with 1×PBS and replaced with fresh medium. After 48 hours, the medium was removed, the wells were washed with 1×PBS and lysed, and analyzed according to the manufacturer's protocol using the KDAlert® kit for GAPDH knockdown and the Pierce BCA kit for total protein assay.

[0183] Research on biomedical media FaSSGF and FaSSIF were prepared according to the manufacturer's protocol. 2% and 5% mucin were prepared in 1×PBS. In these experiments, the formulations were concentrated to mimic the dose administered to animals (2 mg / kg siRNA LNP). The formulations were diluted with different volumes of FaSSIF and FaSSGF and incubated at 37°C with orbital shaking at 280 rpm for 1 hour. Dilutions were performed as instructed. In the mucin experiments, equal volumes of LNP and mucin were incubated at 37°C with orbital shaking at 280 rpm for 1 hour.

[0184] result LNP preparation and the effect of dialysis buffer LNPs were prepared and analyzed for size / PDI (polydispersion index), charge, and encapsulation efficiency (EE), as shown in Table 1. All formulations dialyzed with 1×PBS or 50 mM HEPES exhibited similar physicochemical properties. [Table 1]

[0185] The charge of the S100-LNP is affected by the LNP buffer. The change in charge is a function of the LNP buffer used. For example, when the charge of LNP was titrated using an older formulation prepared in 1×PBS, S100 appeared to show a negative charge even at a low S100 / LNP of 0.03 (w / w) (Table 2). When LNP was dialyzed against 1×PBS and titrated against increasing weights of S100 (50 mg / mL, in 50 mM HEPES), size was measured at a 100-fold dilution of DIW and ZP at a 50-fold dilution of DIW. However, when LNP prepared in 50 mM HEPES was used instead, the observed change in charge was slower, with lower positive values ​​observed at lower S100, indicating that the charge was gradually neutralized (Table 3). [Table 2] [Table 3]

[0186] Characteristics of S100 solution To reduce the differences in salt species within the system, S100 was dissolved in 1×PBS, 0.1×PBS, and 50 mM HEPES to a final concentration of 50 mg / mL. Previously, S100 was dissolved using pH-adjusted water, but the system collapsed upon addition to LNP. Initially, S100 appeared to dissolve easily in 50 mM HEPES solution, but after overnight stirring, it also dissolved in PBS solution. The zwitterionic properties of HEPES are advantageous, ensuring that they do not interfere with the electrostatic interaction between the polymer and LNP. (Table 4) [Table 4]

[0187] Effect of S100 in freeze-drying: 1×PBS LNP + 50mM HEPES S100 LNPs dialyzed against PBS exhibit negative zeta potentials at lower P / LNP concentrations, as previously observed. PDIs for B–D are less than 0.2. See Table 5 and Figure 2. [Table 5]

[0188] A preliminary study showing that S100 modulates the freeze-drying effect of LNPs. In the trials, we used LNPs from an old batch containing 1×PBS. These LNPs were buffer-exchanged with 50 mM HEPES and used in the experiments. The samples were analyzed before lyophilization, prior to the addition of 40% sucrose. After lyophilization, the samples were reconstituted using the same amount of DIW (0.5 mL in this case) as the LNPs originally used. Size and charge data are shown in Table 6 and Figure 1. [Table 6]

[0189] Systematic addition of S100 to LNP As shown in Table 7, the following samples corresponding to lyophilized LNPs were prepared both with and without sucrose and S100. The effective sucrose concentration is 20% in the solution before lyophilization. For A and E4, 200 μL and 209.8 μL of 50 mM HEPES were added instead of a 40% sucrose solution. [Table 7]

[0190] Size data is shown in Table 8. As shown, the size does not change upon the addition of sucrose. During lyophilization, the formulations were reconstituted with 200 μL of DIW. Formulation A, which contained no polymer or cryoprotectant, completely disintegrated, and visible particles were present. Upon the addition of polymer (P), as described above, the formulation required at least P / LNP = 1.18 to suppress aggregation after reconstitution (Table 6). Interestingly, it was observed that E4, which contained only S100 and no cryoprotectant (sucrose), was able to inhibit the increase in size after lyophilization. The change in size can be further visualized in Figure 3A. [Table 8]

[0191] The effect of sucrose on freeze-drying Lyophilization is an excellent solution for improving the stability of LNPs, and it can have various applications, particularly for oral delivery, by enabling encapsulation, high concentration, and matrix formation into gels that allow for sustained release, to name a few. To concentrate, the amount of diluent to be added is much smaller than the amount before lyophilization, and a high solid content makes dissolution difficult, resulting in high viscosity, which would affect administration. The physicochemical effects of sucrose levels were evaluated by adding different concentrations of sucrose to LNP+S100 at 1.18(w / w)P / LNP, as shown in Table 7 and visualized in Figure 3B. Interestingly, the amount of sucrose in the formulation did not have a statistically significant effect on the size characteristics after lyophilization. In fact, as with E4, the sample appears to be adequately protected despite the absence of sucrose. [Table 9]

[0192] Similar findings were observed for LNPs dialyzed with 1×PBS, as shown in Table 10 and Figure 4. [Table 10]

[0193] in vitro cell transfection To test whether lyophilized LNPs still function, the formulation was introduced into RAW264.7 cells and its effect on functionality was evaluated. RAW264.7 cells were used because they are a difficult cell line to transfect.

[0194] Measuring free siRNA using the Ribogreen assay in formulations containing S100 is difficult (the negative charge interacts with the fluorescent dye). Therefore, it was decided to select siRNA corresponding to the LNP content at the start of the lyophilization process. LNP dialyzed against 50 mM HEPES contained a total of 5698 nM of siGAPDH, with 97.5% encapsulated.

[0195] As can be seen in Figure 5A, compared to LNP, formulation E functioned both before and after lyophilization. Formulation A, which contained no S100 polymer and disintegrated during reconstitution, showed no functionality, similar to the untreated formulation. Another study was conducted on LNPs that were dialyzed in 1×PBS, lyophilized with S100, and tested in RAW264.7 cells (Figure 5B). A similar trend was observed, and as shown in Figure 5B, LNPs lyophilized with S100 were functional compared to LNPs lyophilized without polymer.

[0196] As shown in Figures 6A and 6B, a similar trend was observed in HeLa cells despite most formulations being reconstituted one day earlier.

[0197] As is evident from Figures 6A and 6B, the weight ratios of ionic polymer to LNP (1.18, 3.33, 11.75, and 33.3) were effective in substantially silencing the GAPDH gene, indicating a significant reduction in GAPDH production from untreated cells. When dialyzed against 50 mM HEPES, samples with sucrose concentrations of 0%, 10%, 20%, and 40% and an ionic polymer to LNP weight ratio of 1.18 were effective in reducing GAPDH production by approximately 40% or more. When dialyzed against 1×PBS, samples with an ionic polymer to LNP weight ratio of 3.33 and sucrose concentrations of 0%, 10%, 20%, and 40% were effective in reducing GAPDH production.

[0198] Example 2 Physicochemical properties and effectiveness Using MC3 and SM-102, siHPRT LNPs were prepared, and knockdown of these variants, comparing LNPs and PCLNPs, was tested in vitro in RAW264.7 cells. The data showed that the formulations retained their potency after lyophilization, demonstrating the universality of the technique. Physicochemical data before and after polymer addition and lyophilization, as well as a comparison of the efficacy of LNPs and PCLNPs, are shown in Figures 7A and 7B, respectively.

[0199] Furthermore, to test the efficacy of LNPs and PCLNPs after exposure to bio-related media associated with the GI tube (e.g., fasting gastric juice and intestinal juice, and mucin), the inventors observed the retention of efficacy as shown in Figures 8A, B, and C. Figure 8A shows the stability of LNPs under volume-diluted mouse GI conditions at 1:1 to 1:5 dilutions in fasting-stimulated gastric juice (FaSSGF) and fasting-stimulated intestinal juice (FaSSIF) at 37°C for 1 hour. (a) Representative physicochemical data show a bimodal distribution in FaSSIF (1:5 dilution) by bile micelles and a higher positive charge in gastric media (1:3 dilution) due to ionization of positive charge. (b) Inclusion data shows good stability even after incubation at 37°C for 1 hour. (d)(c) Expression of GAPDH mRNA in RAW264.7 cells after incubation at 37°C for 1 hour in FaSSGF and (d)FaSSIF. Figure 8B shows the physicochemical properties and in vitro efficacy data when lyophilized PCLNP was incubated with FaSSGF and FaSSIF and transfection on cells was evaluated. In Figure 8C, the inventors observed the retention of efficacy of LNP and PCLNP after incubation with mucin followed by lyophilization.

[0200] Example 3 In vivo oral delivery (siRNA) LNPs were tested for their in vivo efficacy in knocking down endogenous HPRTs. LNP formulations containing siHPRT were prepared in the same manner as in Example 1, except that S100 was not added and lyophilization was not performed. C12-200 and DOTMA were used as ionic and cationic lipids, respectively.

[0201] After fasting overnight, SKH1 female mice were administered 2 mg / kg of siHPRT-encapsulated LNP. A diet was introduced 6 hours after administration. The animals were necropsied at 24 and 48 hours. At 24 and 48 hours, all GI organs were removed, and mRNA levels were quantified by RT-qPCR using GAPDH as the endogenous gene.

[0202] No HPRT knockdown was observed at 24 hours, but the 48-hour samples showed a favorable trend toward gene knockdown, with statistically significant knockdown observed in the ileum (Figure 9).

[0203] Example 4 In vivo oral delivery (mRNA) LNPs were tested to assess the in vivo efficacy of mRNA expression. LNP formulations containing FLuc mRNA were prepared similarly to Example 3, except that FLuc mRNA was used instead of siHPRT. Food was introduced 1 hour after administration, rather than 6 hours later. A dose equivalent to FLuc mRNA encapsulated in the LNP (2 mg / kg) was administered orally. Control mice were orally administered PBS. IVIS data showed luminescence of LNPs in the gastrointestinal tract compared to control animals. Luminescence was observed only in the LNP group during organ isolation and subsequent IVIS (Figure 10).

[0204] Example 5 In vivo oral delivery (siRNA) LNPs were tested in vivo in a mouse model of acute DSS colitis. LNP formulations containing siRNA against TNF-α (siTNF) were prepared in the same manner as in Example 3, except that siTNF was used instead of siHPRT. As siTNF, siTNF(CG) (Chemegenes, sense strand: GCUCUUCUGUCUACUGAACUU, antisense strand: AAGUUCAGUAGACAGAAGAGCGU) was used.

[0205] B6 / J mice were administered 2% DSS in their drinking water for 12 days. LNP was administered to the treatment group for the first 5 days of DSS treatment. A total of 10 mg / kg of siRNA was administered over the 5-day treatment period. PBS was administered to the untreated control group instead of LNP. siRNA in the colon was detected by evaluating the DSS-only and DSS+siTNF(CG)LNP groups on days 6, 8, and 12. Tissue siRNA was quantified using Stemloop qPCR. Figure 11 shows that siRNA was present in the colon on days 6 and 8, and baseline levels were observed on day 12. The siRNA content on days 6 and 8 shows a decrease in siRNA content over time.

Claims

1. A composition comprising at least one lipid nanoparticle containing a therapeutic agent, and an aqueous solution containing a salt and an anionic polymer, wherein the salt and the anionic polymer are dissolved in the aqueous solution.

2. The composition according to claim 1, wherein the anionic polymer is bonded to the surface of the lipid nanoparticles, thereby forming polymer-coated lipid nanoparticles ("PCLNP").

3. The composition according to claim 2, wherein the polymer coating covers at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% of the surface of the lipid nanoparticles.

4. The composition according to any one of claims 1 to 3, wherein the anionic polymer is a methacrylic acid polymer.

5. The composition according to claim 2, wherein the PCLNP has a negative zeta potential.

6. The composition according to claim 5, wherein the zeta potential is approximately -0.1 mV to approximately -50 mV, approximately -1.0 mV to approximately -45 mV, approximately -2.0 mV to approximately -30 mV, approximately -10 mV to approximately -20 mV, or approximately -5.0 mV to approximately -10 mV.

7. The composition according to claim 5, wherein the zeta potential is at least -0.1 mV, at least -0.5 mV, at least -1.0 mV, at least -2.0 mV, at least -5.0 mV, at least -10 mV, at least -15 mV, at least -20 mV, at least -25 mV, at least -30 mV, at least -35 mV, at least -40 mV, at least -45 mV, or at least -50 mV.

8. The composition according to claim 5, wherein the zeta potential is a maximum of -0.1 mV, a maximum of -0.5 mV, a maximum of -1.0 mV, a maximum of -2.0 mV, a maximum of -5.0 mV, a maximum of -10 mV, a maximum of -15 mV, a maximum of -20 mV, a maximum of -25 mV, a maximum of -30 mV, a maximum of -35 mV, a maximum of -40 mV, a maximum of -45 mV, or a maximum of -50 mV.

9. The composition according to any one of claims 5 to 8, wherein the zeta potential is approximately -10 mV to approximately -50 mV.

10. The composition according to any one of claims 1 to 9, wherein the polyvariance index (PDI) of the PCLNP in the composition is less than 1.0, less than 0.9, less than 0.8, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.2, or less than 0.

1.

11. The composition according to any one of claims 1 to 10, wherein the PDI is less than 0.

2.

12. The composition according to any one of claims 1 to 11, wherein the difference in size of the PCLNP before and after freeze-drying is less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5%.

13. The composition according to any one of claims 1 to 12, wherein the difference in PDI of the PCLNP before and after freeze-drying is less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5%.

14. The composition according to any one of claims 1 to 13, wherein the nucleic acid molecule is DNA or RNA.

15. The composition according to claim 14, wherein the nucleic acid molecule is RNA.

16. The composition according to claim 14 or 15, wherein the RNA is mRNA, microRNA (miRNA), or short interfering RNA (siRNA).

17. The composition according to any one of claims 1 to 16, wherein the nucleic acid molecule is approximately 10 nucleotides (nt) to 20 kilobases (kb).

18. The composition according to any one of claims 1 to 17, wherein the lipid nanoparticles include at least one lipid selected from the group consisting of cationic lipids, anionic lipids, neutral lipids, amphoteric lipids, ionic lipids, helper lipids, cholesterol, PEG lipids, phospholipids, and combinations thereof.

19. The composition according to claim 18, wherein the lipid nanoparticles include ionic lipids and cationic lipids.

20. The composition according to claim 18 or 19, wherein the combination of the ionic lipid and the cationic lipid constitutes more than 20%, more than 30%, more than 40%, more than 50%, or more than 60% of the total lipids in the lipid nanoparticles.

21. The composition according to any one of claims 18 to 20, wherein the ionic lipid is a primary amino lipid, a secondary amino lipid, a tertiary amino lipid, or a polyhydric lipid.

22. The composition according to any one of claims 18 to 21, wherein the cationic lipid is a quaternary aminolipid.

23. The composition according to any one of claims 18 to 21, wherein the cationic lipid is 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA) or 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP).

24. The composition according to any one of claims 1 to 23, wherein the net charge of the lipid nanoparticles is negative at pH 7.

25. The composition according to any one of claims 1 to 23, wherein the net charge of the lipid nanoparticles is positive at pH 7.

26. The composition according to any one of claims 1 to 23, wherein the net charge of the lipid nanoparticles is neutral at pH 7.

27. The composition according to any one of the prior claims, wherein the aqueous solution containing the salt is selected from the group consisting of HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), PBS (phosphate-buffered saline), TRIS (tris(hydroxymethyl)aminomethane), MES (2-(N-morpholino)ethanesulfonic acid), and citrate buffer.

28. The composition according to claim 27, wherein the aqueous solution containing the salt is HEPES.

29. The composition according to claim 27, wherein the aqueous solution containing the salt is PBS.

30. The composition according to any one of claims 27 to 29, wherein the pH of the aqueous solution containing the salt is about 7.0 to about 8.

0.

31. The composition according to claim 30, wherein the pH of the aqueous solution containing the salt is approximately 7.

6.

32. The composition according to any one of the prior claims, wherein the composition further comprises a sugar.

33. The composition according to claim 32, wherein the sugar is a disaccharide.

34. The composition according to claim 32 or 33, wherein the sugar is selected from the group consisting of lactose, sucrose, trehalose, and combinations thereof.

35. The composition according to any one of claims 32 to 34, wherein the amount of sugar is approximately 0% to approximately 40%.

36. The composition according to any one of claims 32 to 35, wherein the amount of the sugar is at least 5%, at least 10%, at least 20%, or at least 30%.

37. The composition according to any one of claims 32 to 36, wherein the amount of the aforementioned sugar is about 5%.

38. The composition according to any one of the prior claims, wherein the nucleic acid molecule is a short interfering RNA, the anionic polymer is a methacrylic acid polymer, and the lipid nanoparticles comprise at least one lipid selected from the group consisting of cationic lipids, polar lipids, amphoteric lipids, or combinations thereof.

39. The composition according to any one of the prior claims, wherein the nucleic acid molecule is a short interfering RNA, the anionic polymer is a methacrylic acid polymer, and the lipid nanoparticles comprise at least one cationic lipid.

40. A pharmaceutical composition comprising the composition according to any one of claims 1 to 39 and a pharmaceutically acceptable carrier.

41. The composition according to any one of claims 1 to 39, or the pharmaceutical composition according to claim 38, wherein the composition is freeze-dried.

42. A method for storing a freeze-dried composition according to claim 41, comprising storing the freeze-dried product at a temperature of about 2°C to about 8°C.

43. A method for storing the freeze-dried composition according to claim 41, comprising storing the freeze-dried product at a temperature of about -20°C.

44. A method for reconstituting the freeze-dried composition according to claim 41, comprising adding a liquid medium to the freeze-dried composition.

45. The method according to claim 44, wherein the liquid medium is an aqueous medium.

46. A method for producing a pharmaceutical composition, a) To generate lipid nanoparticles from at least one lipid and at least one nucleic acid molecule, and b) The method comprising mixing an aqueous solution containing a salt and an anionic polymer with the lipid nanoparticles and a pharmaceutically acceptable carrier produced in step a).

47. Furthermore, the method according to claim 46, comprising c) freeze-drying the mixture obtained in step b).

48. The method according to claim 46 or 47, wherein the anionic polymer is a methacrylic acid polymer.

49. A method for stabilizing lipid nanoparticles for freeze-drying, wherein the method is a) To generate lipid nanoparticles from the at least one lipid and the at least one nucleic acid molecule, b) Mixing an aqueous solution containing the salt and anionic polymer with the lipid nanoparticles produced in step a), and c) Freeze-dry the resulting mixture. The method comprising stabilizing the freeze-dried lipid nanoparticles thereby.

50. The method according to any one of claims 45 to 49, wherein the anionic polymer is dissolved in a buffer.

51. A method for producing a stable pharmaceutical composition, wherein the method is a) Dissolving an anionic polymer in an aqueous solution containing salt, and b) The method comprising mixing the dissolved anionic polymer with lipid nanoparticles containing at least one nucleic acid.

52. The method according to claim 51, further comprising c) freeze-drying the mixture obtained in step b).

53. The method according to any one of claims 46 to 52, wherein step b) further comprises sugar.

54. The method according to claim 53, wherein the amount of the sugar is approximately 5%.

55. The method according to claim 51 or 52, wherein the nucleic acid molecule is DNA or RNA.

56. The method according to claim 55, wherein the RNA is mRNA, microRNA (miRNA), or short interfering RNA (siRNA).

57. The method according to any one of claims 46 to 56, wherein the lipid nanoparticles include ionic lipids and / or cationic lipids.

58. The method according to claim 57, wherein the combination of the ionic lipid and the cationic lipid constitutes more than 20%, more than 30%, more than 40%, more than 50%, or more than 60% of the total lipids in the lipid nanoparticles.

59. The method according to claim 57 or 58, wherein the ionic lipid is a primary amino lipid, a secondary amino lipid, a tertiary amino lipid, or a polyhydric lipid.

60. The method according to any one of claims 57 to 59, wherein the cationic lipid is a quaternary aminolipid.

61. The method according to any one of claims 57 to 60, wherein the cationic lipid is 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA) or 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP).

62. The method according to any one of claims 46 to 61, wherein the aqueous solution containing the salt is a buffer selected from the group consisting of HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), PBS (phosphate-buffered saline), TRIS (tris(hydroxymethyl)aminomethane), MES (2-(N-morpholino)ethanesulfonic acid), and citrate buffer.

63. The method according to any one of claims 46 to 62, wherein the pH of the aqueous solution containing the salt is about 7.0 to about 8.

0.

64. A method for treating a target disease or disorder, the method comprising administering the composition according to any one of claims 1 to 39, the pharmaceutical composition according to claim 40, or the lyophilized composition according to claim 41 to a target requiring the same.

65. The method according to claim 64, wherein the disease or disorder is a disease or disorder of the gastrointestinal tract.

66. The method according to claim 65, wherein the disease or disorder is Crohn's disease, irritable bowel syndrome, ulcerative colitis, or gastrointestinal cancer.

67. The method according to claim 64, wherein the freeze-dried composition or the pharmaceutical composition is administered orally as a freeze-dried mixture.

68. The method according to claim 64, wherein the freeze-dried composition or the pharmaceutical composition is administered intravenously as a freeze-dried mixture.

69. A method for treating a target disease or disorder, comprising administering to the target a composition according to any one of claims 1 to 39, a pharmaceutical composition according to claim 40, or a lyophilized composition according to claim 41 reconstituted in a liquid medium.

70. The method according to claim 69, wherein the reconstituted freeze-dried composition is administered orally.

71. The method according to claim 69, wherein the reconstituted lyophilized composition is administered intravenously.

72. The method according to claim 69, wherein the reconstituted freeze-dried composition is administered subcutaneously or intramuscularly.