Applications of anti-CD3 antibodies for the selective removal of activated T cells

Monovalent anti-CD3 antibodies selectively target and eliminate activated T cells, addressing the limitations of existing antibodies by reducing inflammatory responses and effectively treating autoimmune and transplant-related diseases.

JP2026516525APending Publication Date: 2026-05-25SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-05-20
Publication Date
2026-05-25

AI Technical Summary

Technical Problem

Existing T-cell elimination antibodies, such as anti-CD3 antibodies in the complete IgG form, pose risks of inducing cytokine release syndrome and excessive inflammatory responses, while current strategies fail to selectively target activated T cells, leading to autoimmune diseases, graft-versus-host diseases, and organ transplant rejection.

Method used

Development of monovalent anti-CD3 antibodies or their antigen-binding fragments, specifically targeting the heavy and light chain variable regions, which selectively remove activated T cells without affecting inactive T cells, thereby minimizing inflammatory responses.

Benefits of technology

The monovalent anti-CD3 antibodies effectively suppress autoimmune diseases, graft-versus-host diseases, and organ transplant rejection by selectively eliminating activated T cells, reducing inflammatory responses and minimizing side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026516525000001_ABST
    Figure 2026516525000001_ABST
Patent Text Reader

Abstract

This invention relates to the selective removal of activated T cells using a monovalent antibody or its antigen-binding fragment, which includes heavy chain variable regions and light chain variable regions of an antibody that specifically binds to CD3. In one embodiment of the present invention, the monovalent anti-CD3 antibody or its antigen-binding fragment is useful as a T cell removal agent or T cell immunosuppressant because it can selectively remove only activated T cells without affecting non-activated T cells. In particular, this invention is useful for the prevention or treatment of T cell-mediated autoimmune diseases, graft-versus-host diseases, or organ transplant rejection, as well as for the prevention of graft-versus-host disease (GVHD) side effects in allogeneic CAR-T cell therapy.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the selective removal of activated T cells using a monovalent antibody or its antigen-binding fragment, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3. The monovalent anti-CD3 antibody or its antigen-binding fragment according to the present invention can be effectively used as a T cell removal agent and a T cell immunosuppressant. [Background technology]

[0002] T cells play a central role in antigen-specific immune responses, mediating immune responses specific to pathogen antigens when pathogens invade the body, thereby protecting the body from infection. However, if T cell responses are excessively induced, they can induce excessive inflammatory responses in the body, potentially leading to inflammatory diseases. Typical examples include excessive T cell responses to self-antigens, which can induce autoimmune diseases, and T cell responses to grafts during organ transplantation, which can lead to transplantation rejection and subsequent organ transplant failure. Furthermore, in anti-tumor allogeneic T cell therapy, where T cells from another person are administered to a patient for tumor treatment, these donor T cells can attack the patient's normal tissues, inducing inflammation and potentially causing graft-versus-host disease (GVHD).

[0003] Consequently, attempts have been made to suppress T-cell-mediated inflammatory responses by developing T-cell-specific antibodies to eliminate T cells. For example, T-cell elimination antibodies such as anti-CD3 antibodies, anti-Thymocyte globulin (ATG), and anti-CD52 antibodies have been attempted, and of these, ATG and anti-CD52 antibodies are currently commercially available and in use. However, these antibodies are known to increase the risk of infection by inducing a general decrease in T cells, and in particular, T-cell elimination antibodies in the complete IgG form are known to have problems such as the risk of inducing a strong inflammatory response such as cytokine release syndrome by inducing excessive T-cell activation before T-cell elimination.

[0004] Therefore, rather than a strategy to eliminate T cells in general, it is necessary to develop a strategy that minimizes the risk of cytokine release syndrome by temporarily removing only activated T cells (effector T cells) that immediately induce inflammation, while leaving a sufficient T cell reservoir to respond to infection.

[0005] As a result of producing anti-CD3 antibodies in various forms, the inventors confirmed that monovalent antibodies, particularly single-chain variable fragment (scFv) anti-CD3 antibodies, have relatively little effect on inactive T cells and can selectively remove only activated T cells, thus completing the present invention. [Overview of the project] [Problems that the invention aims to solve]

[0006] The present invention aims to provide a pharmaceutical composition for preventing or treating T cell-mediated autoimmune diseases, graft-versus-host diseases, or organ transplant rejection reactions, comprising a monovalent antibody or an antigen-binding fragment thereof, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

[0007] Furthermore, the present invention aims to provide a pharmaceutical composition for T cell immunosuppression or activated T cell removal, comprising a monovalent antibody or an antigen-binding fragment thereof, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

[0008] The present invention aims to provide a method for suppressing T-cell immunity, comprising the step of administering a monovalent antibody or its antigen-binding fragment, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

[0009] The present invention aims to provide a method for removing TCR (T cell receptor)-positive CAR-T cells, comprising the steps of (a) downregulating the expression of T cell receptors (TCRs) in T cells, (b) introducing chimeric antigen receptors (CARs) into T cells, and (c) treating the cells obtained in steps (a) and (b) with a monovalent antibody containing a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3, or an antigen-binding fragment thereof, wherein steps (a) and (b) are performed regardless of the order.

[0010] The present invention aims to provide a monovalent antibody or its antigen-binding fragment, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

[0011] The present invention aims to provide a polynucleotide encoding the monovalent antibody or its antigen-binding fragment, an expression vector containing the same, and cells comprising the polynucleotide or the expression vector containing the same. [Means for solving the problem]

[0012] One aspect of the present invention provides a pharmaceutical composition for preventing or treating T cell-mediated autoimmune diseases, graft-versus-host diseases, or organ transplant rejection, comprising a monovalent antibody or an antigen-binding fragment thereof, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

[0013] In this specification, the term "antibody" includes not only the complete antibody form but also the antigen-binding fragment of the antibody molecule, as an antibody that specifically binds to a particular antigen. A complete antibody has a structure comprising two full-length light chains and two full-length heavy chains, each light chain linked to a heavy chain by a disulfide bond. The heavy chain constant region has gamma (γ), mu (μ), alpha (α), delta (δ), and epsilon (ε) types, and has subclasses gamma 1 (γ1), gamma 2 (γ2), gamma 3 (γ3), gamma 4 (γ4), alpha 1 (α1), and alpha 2 (α2). The light chain constant region has kappa (κ) and lambda (λ) types.

[0014] In this specification, the term "antigen binding fragment" refers to a fragment that possesses antigen-binding function, and includes Fab, F(ab'), Fv, scFv, or single-domain antibody (sdAB). Among antibody fragments, Fab (fragment antigen binding) has a structure that has variable regions of the light chain and heavy chain, a constant region of the light chain, and the first constant region (CH1) of the heavy chain, and has one antigen-binding site. Fab' differs from Fab in that it has a hinge region containing one or more cysteine ​​residues at the C-terminus of the heavy chain CH1 domain. Fv is the smallest antibody fragment having only heavy chain variable regions and light chain variable regions. Recombination techniques for producing Fv fragments are disclosed in PCT international publication patent applications WO 88 / 10649, WO 88 / 106630, WO 88 / 07085, WO 88 / 07086 and WO 88 / 09344.

[0015] In this specification, the term "heavy chain" refers to the entire full-length heavy chain and its fragments, including the variable region domain VH and the three constant region domains CH1, CH2, and CH3 of an antibody, which contain an amino acid sequence having a sufficiently variable region sequence to confer specificity to an antigen. In this specification, the term "light chain" refers to the entire full-length light chain and its fragments, including the variable region domain VL and the constant region domain CL of an antibody, which contain an amino acid sequence having a sufficiently variable region sequence to confer specificity to an antigen.

[0016] In this specification, the term "CDR (complementarity determining region)" refers to the amino acid sequence of the hypervariable region of the immunoglobulin heavy and light chains. The heavy chain (HCDR1, HCDR2, and HCDR3) and the light chain (LCDR1, LCDR2, and LCDR3) each contain three CDRs. The CDRs provide key contact residues when the antibody binds to an antigen or epitope.

[0017] The antibody that specifically binds to CD3 is an antibody that binds to CD3 molecules on the surface of T cells, and the antibody may be a monoclonal antibody, a polyclonal antibody, or a recombinant antibody. The antibody may also be a full-length antibody or an antibody fragment. In this case, the antibody fragment may include a portion of an anti-CD3 antibody that has the ability to bind to CD3. The antibody fragment may be Fab, Fab', Fv, scFv, or a single-domain antibody (sdAB).

[0018] In the present invention, the antibody or antigen fragment binding that specifically binds to CD3 may be a monovalent antibody. Specifically, the monovalent antibody may be a Fab, Fab', Fv, scFv, or single-domain antibody (sdAB).

[0019] Specifically, the scFv fragment of the antibody may be formed by binding the light chain variable region, linker, and heavy chain variable region of the fragment that specifically binds to CD3 in the order from the N-terminus to the C-terminus, or by binding the heavy chain variable region, linker, and light chain variable region of the fragment that specifically binds to CD3 in that order. Furthermore, the Fab fragment of the antibody may be formed by binding a molecule containing the light chain variable region and light chain constant region of the antibody that specifically binds to CD3 to a molecule containing the heavy chain variable region and heavy chain constant region of the antibody that specifically binds to CD3.

[0020] The monovalent antibody or its binding fragment that specifically binds to CD3 may include one complementarity determining region (CDR) of the heavy chain variable region and / or light chain variable region selected from the known anti-CD3 antibodies OKT3, UCHT1, teplizumab, otelixizumab, visilizumab, and foralumab, specifically CDR1, CDR2, or CDR3. The known anti-CD3s are merely illustrative and not limited thereto, and the antibody or its binding fragment may include combinations of CDR1, CDR2, or CDR3 of each of the known anti-CD3 antibodies.

[0021] The monovalent antibody or its binding fragment that specifically binds to CD3 can include a light chain variable region containing light chain CDR1 (LCDR1), light chain CDR2 (LCDR2), and light chain CDR3 (LCDR3) respectively represented by the amino acid sequences of SEQ ID NOs: 23 to 25, or a heavy chain variable region containing heavy chain CDR1 (HCDR1), heavy chain CDR2 (HCDR2), and heavy chain CDR3 (HCDR3) respectively represented by the amino acid sequences of SEQ ID NOs: 26 to 28. Further, this can include a light chain variable region containing the amino acid sequence of SEQ ID NO: 29 and / or a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 30. In one embodiment of the present invention, it can be one containing a linker between the light chain variable region containing the amino acid sequence of SEQ ID NO: 29 and the heavy chain variable region containing the amino acid sequence of SEQ ID NO: 30. The linker can have the amino acid sequence of SEQ ID NO: 1 ((G4S)3 linker), but the type of linker is not limited thereto.

[0022] The monovalent antibody or its binding fragment that specifically binds to CD3 can include a light chain variable region containing LCDR1, LCDR2, and LCDR3 respectively represented by the amino acid sequences of SEQ ID NOs: 32 to 34, or a heavy chain variable region containing HCDR1, HCDR2, and HCDR3 respectively represented by the amino acid sequences of SEQ ID NOs: 35 to 37. Further, this can include a light chain variable region containing the amino acid sequence of SEQ ID NO: 38 and / or a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 39.

[0023] In one embodiment of the present invention, the monovalent anti-CD3 antibody or its binding fragment can be an scFv fragment containing the amino acid sequences of SEQ ID NOs: 13, 22, 31, and 40, or a Fab fragment containing the amino acid sequences of SEQ ID NOs: 41 and 42. Further, the anti-CD3 antibody or its binding fragment can include the amino acid sequences of SEQ ID NOs: 13, 22, 31, 40, 41, and 42, a part thereof, or an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more identity thereto.

[0024] The monovalent anti-CD3 antibody or its binding fragment may further contain an immunoglobulin kappa sequence. The immunoglobulin kappa sequence can have the amino acid sequence of SEQ ID NO: 2, and can include the amino acid sequence of SEQ ID NO: 2, a part thereof, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% or more identity with these. In addition, the monovalent anti-CD3 antibody or its binding fragment may further contain a tag sequence. The tag can have the amino acid sequence of SEQ ID NO: 3 or 4, but is not limited thereto.

[0025] In this application, even if it is described as "including the gene sequence / amino acid sequence of a specific SEQ ID NO." or "having the gene sequence / amino acid sequence of a specific SEQ ID NO.", if it has the same or corresponding function as that composed of the gene sequence / amino acid sequence of the SEQ ID NO., it is obvious that those having a gene sequence / amino acid sequence in which some sequences are deleted, modified, substituted or added can also be used in this application. Also, in this application, gene sequences and base sequences can be used interchangeably.

[0026] For example, if it has the same or corresponding function as the monovalent anti-CD3 antibody or its binding fragment, it is obvious that those with a meaningless sequence added inside or at the end of the sequence of the SEQ ID NO., or those with a part of the sequence inside or at the end of the sequence of the SEQ ID NO. deleted also belong to the scope of this application.

[0027] Homology and identity mean the degree related to two given base sequences and can be expressed as a percentage. The terms homology and identity can often be used interchangeably.

[0028] Whether any two sequences are homologous or identical can be determined using a known computer algorithm such as the "FASTA" program with default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as executed in the EMBOSS package's Needleman program (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), can be used to determine the results (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF, et al, J MOLEC BIOL 215: 403 (1990); Guide to Huge Computers, Martin J. Bishop, ED., Academic Press, San Diego, 1994). (Including CARILLO ETA / . SIAM J Applied Math 48: 1073). For example, sequence homology or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information Databases.

[0029] The antibody or its binding fragment that specifically binds to CD3 may include a part of a bispecific antibody. Specifically, it may include a site in which one of the two different antigen-binding sites of the bispecific antibody can recognize and bind to CD3. Specifically, antibodies that specifically bind to CD3 include teclistamab, tebentafusp, blinatumomab, catumaxomab, TNB-486, AMG562, duvortuxizumab, AMG910, pasotuxizumab, HPN424, AMG 160, JNJ-63898081, CC-1, and AMG. 509, HPN536, odronextamab, epcoritamab, glofitamab, mosunetuzumab, JNJ-75348780, vixtimotamab, AMG 330, REGN4018, AMG199, MGD007, EGFR BAT, AMG596, M701, solitomab, MT110, AMG110, AMG 211, MEDI-565, cibisatamab, tidutamab, talquetamab, RG6194, GBR The CD3-binding antibody selected from 1302, M802, Runimotamab, GEN1044, GEN1047, PF-07062119, AMG 757, BI 764532, HPN328, Hu3F8-BsAb, GEM3PSCA, IMC-C103C, IMC-F106C, JNJ-70218902, AMG 424, Elranatamab, ABBV-383, AMG 420, CC-93269, Linvoseltamab, Alnuctamab, Cevostamab, and AMG 427 may target CD3 in its heavy chain variable region and / or light chain variable region.The types of bispecific antibodies mentioned above are merely examples of bispecific antibodies that include at least one site capable of binding to CD3, and are not limited to these.

[0030] The monovalent antibody or its antigen-binding fragment, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3 according to the present invention, can induce the death of activated T cells and suppress alloreactive immune responses.

[0031] Alloreactive immune responses can be divided into two types: graft-versus-host reaction, in which donor T cells attack the recipient's normal tissue when donor T cells are administered to the recipient, and graft rejection, in which recipient T cells attack the donor's organs or cells when donor organs or cells are transplanted to the recipient. Since both reactions are T cell attacks that occur when donor or recipient T cells are activated, the monovalent antibody or its antigen-binding fragment containing heavy chain variable regions and light chain variable regions of the antibody that specifically binds to CD3 according to the present invention can selectively kill activated T cells and suppress these alloreactive immune responses.

[0032] The aforementioned T cell-mediated immune diseases may include T cell-mediated autoimmune diseases, graft-versus-host diseases, or organ transplant rejection. In this specification, the term "autoimmune disease" means a disease resulting from an autoimmune reaction, which is an incompatible and excessive reaction to autoantigens. The aforementioned autoimmune diseases include rheumatoid arthritis, multiple sclerosis, systemic lupus erythematosus, type 1 diabetes, Crohn's disease, scleroderma, Sjögren's syndrome, psoriasis, inflammatory bowel disease, ulcerative colitis, ankylosing spondylitis, interstitial lung disease, uveitis, optic neuritis, peripheral neuropathies, sarcoidosis, antiphospholipid syndrome, and inflammatory myopathy. This group may include, but is not limited to, myopathies, Behcet's disease, alopecia totalis / universalis, pemphigus vulgaris, myasthenia gravis, Graves' disease, Hashimoto's thyroiditis, Guillain-Barré syndrome, celiac disease, and pernicious anemia.More specifically, T-cell-mediated autoimmune diseases may include, but are not limited to, a group of conditions including rheumatoid arthritis, systemic lupus erythematous, Crohn's disease, multiple sclerosis, lupus nephritis, psoriasis (pSS), primary focal and segmental glomerular sclerosis, and immune thrombocytopenia.

[0033] In this specification, the term "graft-versus-host disease (GVHD)" refers to a disease in which, when allogeneic hematopoietic stem cell transplantation is performed on patients with hematological malignancies, donor T cells in the peripheral blood or bone marrow injected along with the transplanted stem cells recognize the recipient's normal tissue as a target for attack, triggering an immune response. In addition to direct cytolytic attack, donor T cells are known to promote the secretion of pro-inflammatory and fibrous cytokines or the production of autoantibodies, resulting in an excessive immune response throughout the body. This concept of graft-versus-host disease includes not only allogeneic hematopoietic stem cell transplantation but also graft-versus-host disease caused by TCR-positive CAR-T cells during allogeneic CAR-T cell therapy, as illustrated in the examples presented in this invention.

[0034] In this specification, the term "organ transplant rejection" refers to a disease in which the transplanted organ becomes necrotic when alloreactive T cells in the recipient, which recognize the organ donor's transplantation graft as a target, are activated and attack the organ donor's transplantation graft.

[0035] In this invention, we have confirmed that monovalent anti-CD3 antibodies can eliminate activated T cells not only in vitro but also in vivo, suggesting the potential for monovalent anti-CD3 antibodies to be developed as therapeutic agents for T cell-mediated inflammatory autoimmune diseases caused by activated T cells. This can be easily predicted from the example of existing T cell elimination or suppression antibodies that have been marketed for autoimmune diseases such as multiple sclerosis (e.g., alemtuzumab (anti-CD52 antibody), daclizumab (anti-CD25 antibody)).

[0036] Furthermore, since anti-CD3 antibodies (teplizumab) have recently begun to be marketed with FDA approval in the United States for the treatment of autoimmune diabetes (type 1 diabetes), the monovalent anti-CD3 antibody according to the present invention can be developed as an autoimmune suppressant for T cell removal and inactivation. However, anti-CD3 antibodies in the form of bivalent complete IgG antibodies (complete IgG), such as teplizumab, are structurally different from the monovalent anti-CD3 antibody of the present invention, and monovalent anti-CD3 antibodies exhibit significantly greater T cell killing ability compared to bivalent complete IgG antibodies; therefore, monovalent anti-CD3 antibodies are functionally distinct from bivalent complete IgG antibodies.

[0037] While it is extremely difficult to demonstrate the ability of anti-CD3 antibodies to suppress autoimmune diseases in experimental animal models, the ability to suppress human T cell-mediated inflammatory diseases can be determined by their ability to suppress xenograft-versus-host disease induced when human T cells are administered to immunodeficient mice. In this invention, we evaluated the severity of xenograft-versus-host disease induced by human T cells in an immunodeficient mouse model and confirmed that when treated with a monovalent anti-CD3 antibody, weight loss, clinical symptoms, and mortality due to graft-versus-host disease were significantly reduced in the antibody-treated group (Figure 19). Therefore, since monovalent anti-CD3 antibodies can greatly suppress inflammatory diseases induced by T cells, they have a very high potential for development as a therapeutic agent for autoimmune diseases, which are similar T cell-mediated inflammatory diseases. Additionally, as a disease similar to the graft-versus-host disease in the aforementioned model, it may also be usable for the treatment of allogeneic GVHD, which occurs after allogeneic hematopoietic stem cell transplantation for the treatment of hematological malignancies.

[0038] Furthermore, monovalent anti-CD3 antibodies or their antigen-binding fragments can be used as therapeutic agents to suppress organ rejection reactions mediated by recipient T cells after organ transplantation. In this invention, immunodeficient NSG mice were transplanted with skin from the allogenic strain C57BL6 mice, and activated human T cells were administered to induce immune rejection reactions in which the engraftment of the transplanted skin was inhibited by the T cells. In this case, transplant rejection reactions in which most of the transplanted skin tissue was lost were observed in the group administered only human T cells, but it was confirmed that the skin engraftment rate was significantly improved in the group administered both with and without monovalent anti-CD3 antibodies (Figure 20). Therefore, monovalent anti-CD3 antibodies may be useful as an immunorejection inhibitor during organ transplantation.

[0039] Therefore, the monovalent anti-CD3 antibody or its antigen-binding fragment according to the present invention can be used as a therapeutic agent for T cell-mediated inflammatory diseases such as autoimmune diseases, graft-versus-host diseases, and organ transplant rejection.

[0040] The pharmaceutical composition may further contain an immunosuppressant or be used in combination with an immunosuppressant. The combination may mean administering the monovalent anti-CD3 antibody or its antigen-binding fragment and the immunosuppressant simultaneously, sequentially or individually, and in any order.

[0041] Another aspect of the present invention provides a pharmaceutical composition for T cell immunosuppression or activated T cell removal, comprising a monovalent antibody or an antigen-binding fragment thereof, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

[0042] In the aforementioned pharmaceutical composition, the "antibody," "antigen-binding fragment," or "antibody or antigen-binding fragment that specifically binds to CD3" is as described above.

[0043] A monovalent antibody or antigen-binding fragment that specifically binds to CD3 may induce the death of activated T cells. This death includes apoptosis of T cells. In one embodiment of the present invention, unlike the complete IgG form of the same antibody, the monovalent antibody or antigen-binding fragment may induce T cell death only in response to the monovalent antibody or antigen-binding fragment. Furthermore, the monovalent antibody or antigen-binding fragment that specifically binds to CD3 may not exhibit the activity to induce death in unactivated T cells, specifically naive T cells. Specifically, the monovalent antibody or antigen-binding fragment that specifically binds to CD3 may induce apoptosis by upregulating the dephosphorylation of NFATc2 in activated T cells. That is, it may induce death via the calcium-NFAT pathway during TCR / CD3 signaling in T cells. In other words, the monovalent antibody or antigen-binding fragment may be used for T cell immunosuppression or activated T cell removal.

[0044] A further aspect of the present invention provides a method for suppressing T cell immunity, comprising the step of administering a monovalent antibody or an antigen-binding fragment thereof, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

[0045] Furthermore, the present invention provides a method for removing TCR-positive CAR-T cells in the process of producing CAR-T cells for allogeneic CAR-T cell therapy, comprising the steps of (a) downregulating the expression of T cell receptors (TCRs) in T cells, (b) introducing chimeric antigen receptors (CARs) into T cells, and (c) treating the cells obtained in steps (a) and (b) with a monovalent antibody containing a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3, or an antigen-binding fragment thereof, wherein steps (a) and (b) are performed regardless of the order.

[0046] According to one embodiment of the present invention, a step of activating T cells may be further included before carrying out each of the above steps (a) or (b). This is because the activation state of the target T cells must precede the downregulation of TCR expression or the introduction of a chimeric receptor.

[0047] More specifically, steps (a) and (b) can be performed regardless of the chronological order. In particular, after the expression of the T cell receptor in the T cells in step (a) is downregulated, the introduction of the chimeric antigen receptor into the T cells in step (b) is possible, but after the introduction of the chimeric antigen receptor in step (b), the expression of the T cell receptor in the T cells in step (a) can be downregulated. That is, after steps (a) and (b) are performed regardless of the order, the present invention provides a method for processing a monovalent antibody or its antigen-binding fragment, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

[0048] According to one embodiment of the present invention, in allogeneic CAR-T cell therapy, when CAR is expressed in donor T cells to produce CAR-T cells and then injected into the recipient's body, a side effect occurs in which the T cell receptor (TCR) of the donor T cells recognizes the recipient's normal cells as antigens and attacks them, resulting in a type of graft-versus-host disease. To minimize such side effects, the production of CAR-T cells for allogeneic CAR-T cell therapy includes a process to remove the TCR of the donor T cells, specifically the process described in (a) above. However, despite experimental methods to downregulate TCR expression, residual TCR-positive CAR-T cells remain, which can cause an inflammatory response, i.e., graft-versus-host disease, in the recipient's body. Therefore, residual TCR-positive CAR-T cells can be removed through the process described in (c) above, which involves processing a monovalent antibody or its antigen-binding fragment containing the heavy chain variable region and light chain variable region of an antibody that specifically binds to CD3. More specifically, CAR-T cells can be produced from which residual TCR-positive CAR-T cells have been effectively removed through step (c) above.

[0049] The step of downregulating the expression of the TCR may be carried out by a CRISPR system, specifically by gene editing techniques including CRISPR / Cas9, TALEN, zinc finger nuclease, base-editing, and prime-editing, or by nucleic acids selected from the group consisting of antisense RNA, antagonist RNA, siRNA, shRNA, and miRNA.

[0050] In this specification, the term “disease” may mean a pathological condition, in particular cancer, infectious disease, inflammatory disease, degenerative disease, cell death-related disease, and graft rejection.

[0051] In this specification, the term “prevention” means the treatment of a disease or disease condition, or the treatment of a protective effect; the term “treatment” means or includes the alleviation, inhibition of progression, or prevention of a disease, disorder or condition, or one or more of its symptoms; and “active ingredient” or “pharmaceutically effective amount” may mean any amount of a composition used in the process of carrying out the invention provided herein that is sufficient to alleviate, inhibit the progression, or prevent a disease, disorder or condition, or one or more of its symptoms.

[0052] In this specification, the terms “administer,” “introduce,” and “transplant” are used interchangeably and may mean the placement of a particular composition into an organism by a method or route that results in at least partial localization of the composition to a desired site. A particular composition may be administered by any suitable route that delivers at least a portion of its cells or cellular components to a desired location within a living organism. The survival time of cells after administration to an organism may be as short as a few hours, for example, 24 hours to several days, or as long as several years.

[0053] The pharmaceutical composition according to the present invention may contain a pharmaceutically acceptable carrier. For oral administration, binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., can be used. For injectable preparations, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc., can be mixed and used. For topical administration, bases, excipients, lubricants, preservatives, etc., can be used. Formulations of the pharmaceutical composition of the present invention can be manufactured in various forms by mixing with the aforementioned pharmaceutically acceptable carriers. For example, for oral administration, they can be manufactured in the form of tablets, lozenges, capsules, elixirs, suspensions, syrups, wafers, etc., and for injectable preparations, they can be manufactured in single-dose ampoules or multi-dose forms. Furthermore, the anticancer composition may typically contain surfactants that facilitate movement across membranes. Such surfactants include those derived from steroids, cationic lipids such as N-[1-(2,3-dioleoyl)propyl-N,N,N-trimethylammonium chloride (DOTMA), or various compounds such as cholesterol hemisuccinate and phosphatidylglycerol.

[0054] The pharmaceutical composition of the present invention can be administered orally or parenterally, and can be administered by, for example, intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, intraperitoneal injection, intrasternal injection, intratumoral injection, local administration, intranasal administration, intracerebral administration, intracranial administration, intrapulmonary administration, and intrarectal administration, but is not limited thereto.

[0055] The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, patient's age, weight, sex, medical condition, diet, administration time, route of administration, excretion rate, and response sensitivity, and a skilled physician can usually easily determine and prescribe a dosage effective for the desired treatment or prevention. According to a preferred embodiment of the present invention, the daily dose of the pharmaceutical composition of the present invention is 0.0001-100 mg / kg. In this specification, the term "pharmaceutical effective dose" means an amount sufficient to prevent or treat the aforementioned disease.

[0056] Another aspect of the present invention provides a method for preventing or treating a disease (for example, a T cell-mediated autoimmune disease, graft-versus-host disease, or organ transplant rejection), comprising the step of administering a monovalent antibody or an antigen-binding fragment thereof, or a composition containing the same, to an individual in need.

[0057] Another aspect of the present invention provides an antibody or antigen-binding fragment thereof that includes a light chain variable region comprising LCDR1 of SEQ ID NO: 23, LCDR2 of SEQ ID NO: 24, and LCDR3 of SEQ ID NO: 25, and a heavy chain variable region comprising HCDR1 of SEQ ID NO: 26, HCDR2 of SEQ ID NO: 27, and HCDR3 of SEQ ID NO: 28, or a light chain variable region comprising LCDR1 of SEQ ID NO: 32, LCDR2 of SEQ ID NO: 33, and LCDR3 of SEQ ID NO: 34, and a heavy chain variable region comprising HCDR1 of SEQ ID NO: 35, HCDR2 of SEQ ID NO: 36, and HCDR3 of SEQ ID NO: 37.

[0058] In the above, "antibodies" and "antigen-binding fragments" are as described above.

[0059] The antibody or its antigen-binding fragment may be an antibody or its antigen-binding fragment that specifically binds to CD3.

[0060] The antibody or its antigen-binding fragment may include a light chain variable region containing the amino acid sequence of SEQ ID NO: 29 or 38 and / or a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 30 or 39.

[0061] Specifically, the antibody or its antigen-binding fragment may include a light chain variable region containing the amino acid sequence of SEQ ID NO: 29 and / or a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 30. Furthermore, the antibody or its antigen-binding fragment may also include a light chain variable region containing the amino acid sequence of SEQ ID NO: 38 and / or a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 39.

[0062] Another aspect of the present invention provides a polynucleotide encoding the antibody or its antigen-binding fragment.

[0063] The polynucleotide encoding the antibody of the present invention can be readily isolated and sequenced using conventional procedures. For example, oligonucleotide primers designed to specifically amplify the heavy and light chain coding regions from phage template DNA can be used. Once the polynucleotide is isolated, it can be placed in an expression vector, and the expression vector can then be introduced into a suitable host cell to produce the desired monoclonal antibody from the transformed host cell (i.e., transformant).

[0064] Another aspect of the present invention provides an expression vector containing the polynucleotide.

[0065] The expression vector may be an adenovirus vector, a retrovirus vector, a lentivirus vector, or an adeno-associated virus vector, and in one embodiment of the present invention, the expression vector may be a retrovirus vector. The expression vector can be prepared by a conventional technician so that the anti-CD3 monovalent antibody according to the present invention can be expressed and secreted. The expression vector may further include a signal sequence or a leader sequence. In one embodiment of the present invention, the leader sequence may include, but is not limited to, the sequence METDTLLLWVLLLWVPGSTGDV or MERHWIFLLLLSVTAGVHS. Additionally, the expression vector may further include a restriction enzyme cleavage site sequence. Specifically, the restriction enzyme cleavage site sequence may include, but is not limited to, the sequence AQAA, GQAGQ, or KL.

[0066] Furthermore, the present invention provides cells comprising the polynucleotide or an expression vector containing the same.

[0067] The cells may be transduced with a virus containing a polynucleotide capable of expressing an antibody or a conjugated fragment thereof that specifically binds to CD3 according to the present invention. The transduced cells can secrete an antibody or a conjugated fragment thereof that specifically binds to the CD3 of the cell.

[0068] The virus may contain in its genome a nucleic acid molecule encoding an antibody or a binding fragment thereof that specifically binds to CD3 according to the present invention. Therefore, cells into which the virus has been transduced may express an anti-CD3 antibody or a fragment thereof on their surface. The virus may be an adenovirus, retrovirus, lentivirus, or adeno-associated virus. In one embodiment of the present invention, the virus may be a retrovirus. The virus may be obtained by transforming cells with an expression vector containing a nucleic acid molecule encoding the viral envelope protein, as described above. The transformation may be carried out by conventional methods. During transformation, available envelope proteins may include VSV-G, Ecotropic envelope, Mokola, Rabies, MLV-Ampho, MLV-10A1, LCMV-WE, LCMV-Arm53b envelope, feline endogenous gamma retrovirus (FEV1) RD114 envelope and its variants, gibbon ape leukemia virus (GALV) envelope and its variants, MLV 4070A envelope, or gp120 / gp41 (Mol. Ther. Methods Clin. Dev., 2016(3):16017; J. Virol. Methods, 2004:122-131; Molecular Therapy-Methods & Clinical Development 2016(3):16017). [Effects of the Invention]

[0069] A monovalent anti-CD3 antibody or its antigen-binding fragment according to one aspect of the present invention can selectively remove only activated T cells without affecting inactive T cells, and can therefore be usefully used as a T cell removal agent or T cell immunosuppressant. For example, it can be used to prevent or treat T cell-mediated autoimmune diseases, graft-versus-host diseases, or organ transplant rejection. Furthermore, because it can completely remove residual donor CD3-positive T cells, which can be a problem in allogeneic CAR-T cell therapy, which has gained prominence as an anti-cancer T cell therapy, it can be effectively used to prevent or mitigate the side effects of graft-versus-host disease (GVHD) caused by allogeneic CAR-T cell administration. [Brief explanation of the drawing]

[0070] [Figure 1] This graph shows the cell death effects of anti-CD3 OKT3 IgG, Fab, and scFv antibodies on activated T cells. [Figure 2] This graph shows the apoptosis-inducing effects of anti-CD3 OKT3 IgG, Fab, and scFv antibodies on activated T cells. [Figure 3] This graph shows the cell death effects of anti-CD3 UCHT1 IgG, scFv antibodies, and anti-CD3 1-4-2, 1-4-7 scFv antibodies on activated T cells. [Figure 4] This graph shows the cell death effects of anti-CD3 OKT3 IgG, Fab, and scFv antibodies on inactivated T cells. [Figure 5] This image shows the analysis of the apoptosis induction mechanism of anti-CD3 scFv via Western blotting. [Figure 6] Images showing the apoptosis induction mechanism of anti-CD3 scFv analyzed via signal inhibitors and flow cytometry; Veh: Vehicle, CsA: Cyclosporin A, Dasa: Dasatinib. [Figure 7]This graph shows the analysis of residual TCR-positive cells after TCR removal by CRISPR / Cas9 for the production of allogeneic CAR-T cells. [Figure 8] This graph shows the analysis of residual TCR-positive cells after TCR removal by CRISPR / Cas9 and MACS for the production of allogeneic CAR-T cells. [Figure 9] This graph shows the analysis of residual TCR-positive cells after TCR removal using CRISPR / Cas9 and anti-CD3 OKT3 scFv for allogeneic CAR-T cell production. [Figure 10] This graph shows the analysis of allogeneic CAR-T cells produced using CRISPR / Cas9 and anti-CD3 OKT3 scFv (Ab:CD3 OKT3 scFv). [Figure 11] This graph shows the tumor-killing and cytokine-secreting capabilities of allogeneic CAR-T cells produced using CRISPR / Cas9 and anti-CD3 OKT3 scFv (Del Ab T cells: TCR removed + anti-CD3 OKT3 scFv T cells, Conv CAR-T: normal CAR-T cells, Del Ab CAR-T: CAR-T cells with removed TCR + anti-CD3 OKT3 scFv). [Figure 12] This image shows the anticancer effect of CAR-T cells with TCR removal and / or anti-CD3 OKT3 scFv (Conv CAR-T: Conventional CAR-T, Del CAR-T: CAR-T with TCR removal, Del Ab CAR-T: CAR-T with TCR removal + anti-CD3 OKT3 scFv). [Figure 13] This graph shows the preventive or ameliorative effects of graft-versus-host disease (GRAPH) side effects and mouse survival rates using TCR-depleted CAR-T cells and / or anti-CD3 OKT3 scFv cells; Conv CAR-T: Conventional CAR-T cells, Del CAR-T: TCR-depleted CAR-T cells, Del Ab CAR-T: TCR-depleted CAR-T cells + anti-CD3 OKT3 scFv cells. [Figure 14] This graph shows the decrease in total T cell count due to anti-CD3 OKT3 scFv treatment. [Figure 15]This graph shows the changes in the number of CD4 and CD8 T cell subsets after anti-CD3 OKT3 scFv treatment, analyzed via flow cytometry (EF / EM: effector T cells / effector memory T cells, N / SCM: naive / stem cell memory T cells, CM: central memory T cells). [Figure 16] This graph analyzes the changes in the distribution of CD4 and CD8 T subsets after anti-CD3 OKT3 scFv treatment (EF / EM: effector T cells / effector memory T cells, N / SCM: naive / stem cell memory T cells, CM: central memory T cells). [Figure 17-18] This shows the results of human T cell death after in vivo administration of a monovalent anti-CD3 antibody (UCHT1-scFv). [Figure 19] This report presents the results of evaluating weight loss, clinical symptoms of graft-versus-host disease, and mortality rates after inducing xenograft-versus-host disease with human T cells in an immunodeficient mouse model, followed by administration of a monovalent anti-CD3 antibody (UCHT1-scFv). [Figure 20] This shows the results of observing whether transplant rejection, in which skin tissue is shed by human T cells, occurs when a monovalent anti-CD3 antibody (UCHT1-scFv) is administered to an immunodeficient mouse model. [Modes for carrying out the invention]

[0071] The following are preferred embodiments to aid in understanding the present invention. However, these embodiments are provided only to facilitate understanding the present invention and do not limit the scope of the invention. The embodiments can be modified in various ways and are not limited to those disclosed below, but can be embodied in various forms.

[0072] Example 1. Production of activated T cells T cells receive activation and deactivation signals through signal transduction via the T cell receptor (TCR)-CD3 complex on their cell surface. The TCR is composed of alpha and beta chains, while the CD3 complex is composed of gamma, delta, epsilon, and zeta chains. Of these, antibodies against the CD3 epsilon subunit are the most well known. When anti-CD3 epsilon antibodies (hereinafter referred to as anti-CD3 antibodies) are added to T cells in a solid-phase coated form (for example, antibodies coated on a cell culture plate, commonly known as plate-bound antibodies), multiple antibodies simultaneously cross-link the TCR-CD3 complex, thereby transmitting the TCR signal into the cell. The TCR signal contains both activation and deactivation signals. When antibodies against CD28, the activation receptor on the T cell surface, are added to provide the CD28 signal, the activation signal becomes dominant, and the T cell is activated. This allowed us to stimulate normal human peripheral blood T cells in vitro with plate-attached anti-CD3 and anti-CD28 antibodies to produce activated T cells.

[0073] Specifically, peripheral blood mononuclear cells (PBMCs) containing a large number of T cells were isolated from normal human peripheral blood cells using the Ficoll centrifugation method, which utilizes the difference in intercellular density. The isolated PBMCs were cultured with anti-CD3 antibody (10 ug / ml, clone OKT3), anti-CD28 antibody (2 ug / ml, clone CD28.2), and recombinant hIL-2 (200 U / ml, Proleukin) in a plate-adhered form for 5 days to activate them. Since only T cells survive and proliferate during this period, the majority of surviving cells after 5 days are activated T cells. After washing the cells, they were cultured for an additional 3 days in a culture medium containing hIL-2 (200 U / ml) before being used as activated T cells.

[0074] Experimental Example 1. Selective removal ability of monovalent anti-CD3 antibody against activated T cells. 1. Selective removal ability of OKT3 against activated T cells The anti-human CD3 antibody, OKT3 IgG, was purchased as a commercially available antibody. To test the T-cell elimination ability of the monovalent soluble anti-CD3 antibody, existing, well-known anti-human CD3 antibodies, specifically OKT3 clones, were isolated and purified from human HEK293F cells in monovalent antibody forms (Fab and scFv).

[0075] Specifically, anti-human CD3 OKT3 Fab antibodies were prepared by cloning the VH-CH1 domain and VL-CL domain of each clone into expression vectors (pCEP4), transfecting HEK293F cells with the two plasmids, and then performing affinity purification (via kappa-select resin) on the antibodies secreted into the culture medium. Specifically, anti-human CD3 OKT3 scFv antibodies were prepared by cloning the scFv portion of each clone to pCEP4 in a state where it is linked to the Ck (kappa light chain constant domain) (scFv-Ck), transfecting HEK293F cells with this plasmid, and then performing affinity purification (via kappa-select resin) on the scFv-Ck antibodies secreted into the culture medium. Tables 1 and 2 below show the sequences of OKT3 scFv and OKT3 Fab, respectively, as well as the sequences used for their isolation and purification.

[0076] [Table 1]

[0077] [Table 2]

[0078] Each form of purified antibody was administered to human T cells activated for 8 days at the same molar concentration (12.5 pmol antibody / 5X10). 5The cells were treated with T cells ( / mL), and after 24 hours, T cell viability and the presence or absence of apoptosis were analyzed by flow cytometry.

[0079] Specifically, activated T cells were cultured for 24 hours with OKT3 antibodies of various forms (Fab and scFv), and then T cell viability was analyzed by 7AAD staining and flow cytometry. In this study, 7AAD, a fluorescent DNA-binding compound, cannot penetrate into the cell or bind to DNA when the cell is alive. However, as the cell membrane is destroyed during cell death, 7AAD enters the cell, binds to DNA, and the cell becomes fluorescent. Therefore, 7AAD-negative cells are classified as live cells, while 7AAD-positive cells are classified as dead or dying cells.

[0080] As shown in Figure 1, soluble OKT3 antibodies in full IgG form did not affect T cell viability, but monovalent antibodies, OKT3-Fab and OKT3-scFv, significantly reduced T cell viability (7AAD-negative cell ratio).

[0081] 1.2. Mechanism of activated T cell death - Apoptosis To confirm whether the death of activated T cells by the monovalent antibodies OKT3-Fab and OKT3-scFv was due to apoptosis, annexin V and 7AAD staining, markers of apoptotic cell death, were performed simultaneously, and the results are shown in Figure 1. In early apoptotic cells, the cell membrane is stained with annexin V, but the cell membrane has not yet been destroyed, and 7AAD is not stained, resulting in an annexin V(+) 7AAD(-) morphology. In late apoptotic cells, staining up to 7AAD occurs, resulting in an annexin V(+) 7AAD(+) morphology.

[0082] Furthermore, to further verify whether the activation of T cells by the monovalent antibody against OKT3 was apoptosis, we confirmed the activation of caspase 3, an enzyme that mediates apoptosis, via flow cytometry, and the results are shown in Figure 2.

[0083] As shown in Figure 1, after adding OKT3 antibodies of various forms to activated T cells, analysis over time revealed that in the groups treated with OKT3-Fab and OKT3-scFv antibodies, the proportion of early apoptotic cells increased sharply from 3 hours, and from 6 hours onward, late apoptotic cells appeared and their proportion increased sharply thereafter. However, in the group treated with the fully IgG form of OKT3 antibody, there was no change in the proportion of apoptotic cells.

[0084] As shown in Figure 2, in the groups treated with OKT3-Fab and OKT3-scFv antibodies, activated caspase 3 was detected 3 hours after treatment, indicating that active apoptosis occurred in these cells. However, activated caspase 3 was not detected in the group treated with OKT3 in its complete IgG form.

[0085] Based on these results, we confirmed that, unlike fully IgG-form OKT3, Fab or scFv-form OKT3 induces cell death via the apoptotic pathway of activated T cells.

[0086] 1.3. Selective removal ability of other monovalent anti-CD3 antibodies against activated T cells We investigated whether the T-cell apoptosis-inducing ability of soluble monovalent OKT3 antibody could be replicated with other monovalent anti-CD3 antibodies. For UCHT1 antibody, another anti-CD3 antibody, we purchased a commercially available IgG antibody and prepared it in scFv form using the same method as described in 1.1 above. We then conducted experiments to confirm whether it induced the death of activated T cells. Table 3 below shows the sequences of UCHT1 scFv and the sequences used to isolate and purify them.

[0087] [Table 3]

[0088] Furthermore, to confirm the versatility of the apoptosis-induced cell death of scFv-form anti-CD3 antibodies, novel anti-CD3 epsilon antibodies were screened. Specifically, human CD3 gamma / epsilon and delta / epsilon extracellular heterodimer proteins were mixed with an adjuvant and immunized 10 chickens four times at two-week intervals. Then, the chicken spleens, bone marrow, and bursa of Fabricius were collected, and total RNA isolation, cDNA synthesis, and variable light chain and heavy chain gene PCR were performed. A chicken immunoassay library was then constructed by cloning these antibodies into the phage display vector pComb3XSS. Subsequently, bio-panning was performed to screen for antibody clones that specifically bind to human CD3 protein. After separating and purifying the positive antibody clones in scFv form, two antibodies that bind to CD3(+) Jurkat cells (clones 1-4-2 and 1-4-7) were selected for final determination, and experiments were conducted to analyze whether they could induce activated T cell death using the same method as described in 1.1 above. The results for each are shown in Figure 3. Furthermore, Tables 4 and 5 below show the sequences of scFv 1-4-2 and 1-4-7, respectively, as well as the sequences used to isolate and purify them.

[0089] [Table 4]

[0090] [Table 5]

[0091] As shown in Figure 3, UCHT1 antibodies in full IgG form did not affect the survival rate of activated T cells, but UCHT1 antibodies in scFv form significantly reduced T cell survival. In addition, when scFv antibodies against two screening anti-CD3 antibody clones (1-4-2 and 1-4-7) were added to activated T cells, a significant decrease in T cell survival was confirmed.

[0092] 1.4. Selective removal ability of anti-CD3 inactivated T cells To confirm whether the apoptosis-inducing ability of the monovalent anti-CD3 antibody described above is also observed in unactivated T cells, scFv OKT3 antibody was added to normal human peripheral blood T cells for 24 hours, and then T cell death was confirmed using the same method as in Experimental Example 1.3. The results are shown in Figure 4.

[0093] As shown in Figure 4, in unactivated T cells, no apoptosis-induced cell death was observed with complete IgG, Fab, or scFv OKT3 antibodies.

[0094] Through these results, we confirmed that the T-cell killing ability of anti-CD3 antibodies is selective in Fab or scFv form, rather than in the complete IgG form, when targeting activated T cells. We confirmed that four distinct monovalent anti-CD3 antibodies induce apoptosis in activated T cells.

[0095] Experimental Example 2. Analysis of the apoptotic mechanism of monovalent anti-CD3 antibodies To confirm whether T cell apoptosis induced by monovalent anti-CD3 antibodies is due to the TCR / CD3 signaling system, we analyzed the TCR / CD3 signaling pathway.

[0096] T-cell TCR / CD3 signaling is known to involve the activation of higher-level signaling molecules such as ZAP70-LAT-PLCγ1, followed by the activation of three lower-level signaling pathways: the calcium-NFAT pathway, the PKCθ-NFκB pathway, and the Erk-AP1 pathway. Specifically, activation of the calcium-NFAT pathway can be confirmed by the rapid migration of NFAT molecules in Western blotting (NFAT is activated by dephosphorylation, and dephosphorylated NFAT is detected as a small band in SDS-PAGE), activation of the PKCθ-NFκB pathway by the degradation of IκB, an NFκB inhibitor, and activation of the Erk-AP1 pathway by the detection of phosphorylated Erk (p-Erk).

[0097] Accordingly, activated T cells were treated with each form of OKT3 antibody (OKT3-IgG, OKT3-Fab, OKT3-scFv) or PMA / ionomycin (positive control group) which activates all three of the aforementioned sub-signaling pathways. The presence or absence of activation of each pathway, NFATc2, IκB, P-ERK, and Total ERK, was confirmed by Western blotting, and the results are shown in Figure 5.

[0098] Furthermore, to verify whether activation of the TCR / CD3 signaling pathway and its subordinate NFAT pathway induced apoptosis by the OKT3 antibody, we confirmed T cell death by administering signaling inhibitors that affect the activation of higher-level TCR / CD3 signaling molecules. Specifically, activated T cells were treated with 10 μM cyclosporine A (calcineurin inhibitor, CsA) in 0.01% DMSO and 100 nM dasatinib (Lck inhibitor) in 0.01% DMSO, along with an anti-CD3 antibody. The negative control group (Vehicle) used 0.01% DMSO. The results are shown in Figure 6.

[0099] As shown in Figure 5, when comparing each group against a positive control group that induced activation of all three pathways, no significant activation was observed in any of the three pathways with OKT3-IgG, but NFAT activation was observed in cells treated with Fab and scFv. On the other hand, no activation of the NFκB and Erk-AP pathways was observed. Therefore, it was confirmed that the monovalent OKT3 antibody activates the NFAT pathway during TCR / CD3 signaling.

[0100] As shown in Figure 6, dasatinib (Dasa) significantly suppressed apoptosis induced by OKT3-scFv, while cyclosporine A (CsA) partially suppressed apoptosis. In other words, OKT3-scFv induced apoptosis through the TCR / CD3 signaling pathway, and the NFAT pathway in particular was confirmed to be involved.

[0101] Experimental Example 3. Ability of anti-CD3 scFv to remove residual TCR-positive CAR-T cells in allogeneic CAR-T cell therapy. 2.1 Incompleteness of TCR removal by CRISPR / Cas9 techniques and / or MACS Most antitumor CAR-T cell therapies maintain the form of autologous CAR-T cell therapy, in which T cells are collected from the patient's peripheral blood, the CAR gene is introduced, and then the cells are returned to the patient. In the case of autologous CAR-T cells, the process of collecting T cells from the patient and manufacturing CAR-T cells takes a considerable amount of time, and there is a risk of failure in CAR-T cell production due to the poor condition of the patient's T cells. For this reason, allogeneic CAR-T cell therapy is being attempted, in which CAR-T cells are manufactured in advance from peripheral blood T cells (allogeneic T cells) collected from healthy individuals, frozen, and immediately administered to patients who need them. However, in the case of allogeneic CAR-T cell therapy, there is a possibility of inducing graft-versus-host disease (GVHD), a side effect in which administered allogeneic CAR-T cells attack the patient's normal tissues and induce severe inflammation. Attempts have been made to prevent GVHD side effects by producing CAR-T cells from which the TCR / CD3 complex of T cells that induce graft-versus-host disease has been removed using CRISPR / CAS9 gene editing technology. However, the removal of the TCR / CD3 complex using the CRISPR / Cas9 technique has the problem that some residual TCR-positive CAR-T cells remain.

[0102] Since TCR and CD3 are always expressed together on the cell surface in a complex form, if either TCR or CD3 is not expressed, the other will not be expressed either. In other words, residual TCR-positive cells can be removed with an anti-CD3 antibody. Therefore, in the process of removing the TCR / CD3 complex by CRISPR / Cas9 for allogeneic CAR-T cell therapy, we attempted to remove residual TCR-positive cells with the monovalent anti-CD3 antibody of the present invention.

[0103] Specifically, as shown in Figure 7, after activating T cells on day 0 of the experiment, a gRNA / Cas9 protein complex (Ribonulceoprotein: RNP) targeting the TCR was constructed using a previously reported human TCR alpha chain-specific guide RNA (gRNA) sequence (GAGAATCAAAATCGGTGAAT) (Mol Ther. 2016 Mar;24(3):570-81). This complex was then transformed into T cells that had been activated for two days using electroporation. Subsequently, these T cells were cultured in a culture medium containing hIL-2 (200 U / ml) for several days, and the expression of the TCR and CD3 epsilon chain on the cell surface was confirmed by flow cytometry. On days 5, 8, 11, and 14 of the experiment, residual TCR-positive T cells were confirmed by flow cytometry, and the results are shown in Figure 7.

[0104] Furthermore, when MACS (magnet-associated cell sorting), an existing method, was performed to remove residual TCR-positive cells, residual TCR-positive cells were identified using the same method. Specifically, after removing the TCR of activated T cells using the CRISPR / Cas9 technique for 2 days, the T cells were treated with an anti-CD3 antibody labeled with a magnetic microbead 6 days later. Then, the T cells were passed through a magnetic column (LD column) to trap CD3-positive cells, i.e., TCR-positive cells, in the column. TCR-negative cells that flowed out after passing through the column were harvested and cultured for several days in a culture medium containing hIL-2 (200 U / ml). Residual TCR-positive T cells were identified by flow cytometry, and the results are shown in Figure 8.

[0105] As shown in Figure 7, approximately 7% of TCR-positive T cells were confirmed to remain on day 5 of culture, and this residual TCR-positive rate was maintained at a constant level even after two weeks of in vitro culture.

[0106] As shown in Figure 8, we confirmed that approximately 2% of TCR-positive T cells remain even when using the existing MACS (magnet-associated cell sorting) purification method.

[0107] Based on these results, we experimentally confirmed that complete removal of TCR-positive T cells using CRISPR / Cas9 techniques is extremely difficult with existing MACS methods.

[0108] 3.2. Ability of anti-CD3 scFv to remove residual TCR-positive T cells

[0109] After removing TCR-positive T cells using the CRISPR / Cas9 technique, we confirmed whether adding the OKT3-scFv antibody to the cell culture medium would also remove TCR-positive T cells.

[0110] First, as shown in Figure 9, T cells cultured on day 7, which had undergone T cell activation and anti-TCR gRNA / Cas9 complex introduction, were treated with OKT3-ScFv antibody. After an additional 3 days of culture, the presence or absence of residual TCR-positive T cells was checked. The results are shown in Figure 9.

[0111] As shown in Figure 9, most TCR-positive T cells were removed, which was more effective in removing residual TCR-positive T cells than the existing MACS purification method.

[0112] Next, we treated conventionally most widely used anti-CD19 CAR-T cells with the anti-CD3 scFv of the present invention and confirmed its ability to remove TCR-positive T cells.

[0113] Specifically, the anti-CD19 CAR cDNA was synthesized by commissioning DNA synthesis according to the existing publicly available sequence (U.S. Patent Publication US2013 / 0287748 A1) in a form in which the anti-CD19 scFv, CD8 hinge and transmembrane domain, 41BB intracellular domain, and CD3 zeta intracellular domain were ligated (Integrated DNA Technologies). After cloning the synthesized anti-CD19 CAR cDNA into a lentiviral vector, it was transformed into 293T cell line (ATCC) using Lipofectamin 3000 (Invitrogen) along with three types of packaging DNA (pMD.2G, pMDLg / pRRE, pRSV-rev). The culture supernatant containing the lentivirus secreted between 24 and 48 hours was harvested, filtered (0.45 μm filter) to remove residual cell particles, concentrated 100-fold using an ultra-high-speed centrifuge, and used as a lentiviral concentrate for CAR-T cell production.

[0114] T cells in peripheral blood mononuclear cells were activated for two days, and then the T cells were cultured with concentrated lentivirus for two days to transduce the CAR gene into the T cells, thereby producing anti-CD19 CAR-T cells. Subsequently, the cells were washed to remove any remaining virus from the culture medium, and the proliferation of CAR-T cells was induced by adding culture medium containing hIL-2 (200 U / ml) twice at three-day intervals. Seven days after the start of T cell culture, OKT3-scFv antibody (12.5 pmol / 1X10) was added. 5 The cells were added to the cell culture medium and cultured for an additional 3 days. On the 10th day from the start of culture, residual TCR-positive T cells were confirmed using a flow cytometer. The results are shown in Figure 10.

[0115] As shown in Figure 10, CAR-T cells from which TCRs were removed, produced through TCR removal and anti-CD19 CAR gene introduction, showed the presence of more than 10% TCR-positive T cells on day 7 of culture. However, after additional 3 days of culture in the presence of OKT3-ScFv, it was confirmed that the majority of residual TCR-positive CAR-T cells were removed.

[0116] Additionally, to confirm whether the tumor-killing ability and other functions of existing CAR-T cells are maintained when conventional, universal anti-CD19 CAR-T cells are treated with the anti-CD3 scFv of the present invention, we cultured them together with CD19-positive Raji cell lines, which are targets of CAR-T cells, and confirmed their cytokine secretion and tumor-killing abilities.

[0117] Specifically, Raji-Luc cells (3X10) are CD19-positive Raji cells that overexpress luciferase. 4 After culturing the cells with CAR T or T cells for 18 hours, the culture medium was treated with luciferin (6 mg / ml), and the luminescence of the surviving Raji-Luc cells was measured with a luminometer to determine the cell viability, from which the cell-killing ability was calculated (Figure 11). The specific formula is as follows.

[0118] <Mathematical formula 1> The survival rate (%) of Raji-Luc cells is calculated as follows: [(Luminescence of the experimental group) - (Background luminescence)] / [(Luminescence when only Raji-Luc cells are present) - (Background luminescence)] × 100.

[0119] Cell killing ability (% cytotoxicity) = 100-cell viability.

[0120] Furthermore, cytokine secretion capacity was measured by measuring INF-γ secreted during co-culture of antibody-treated CAR-T cells or T cells with CD19(+) tumor cells. Specifically, 1.5 x 10⁻¹⁰ 5 CD19-positive Raji cell line and 3X10 4 After 24 hours of co-culturing CAR-T cells, the culture medium was obtained and the amount of human INF-γ in the culture medium was measured according to the manufacturer's experimental method for the human IFN-γ ELISA kit (R&D) (Figure 11).

[0121] As shown in Figure 11, we confirmed that both the tumor-killing ability and cytokine secretion capacity of CAR-T cells were maintained to a similar degree to that of CAR-T cells that had not been treated with antibodies.

[0122] Based on these results, we confirmed the possibility that treating residual TCR-positive CAR-T cells, which are generated during the removal process of TCRs from allogeneic CAR-T cells, with a monovalent anti-CD3 antibody can more effectively remove these residual TCR-positive CAR-T cells, thereby mitigating or improving side effects such as graft-versus-host disease.

[0123] 2.3. Preventive effect of graft-versus-host disease (in vivo) associated with removal of residual TCR-positive CAR-T cells by anti-CD3 scFv. In vivo experiments were conducted to confirm whether graft-versus-host disease (GVHD) induced by residual TCR-positive CAR-T cells generated during the allogeneic CAR-T cell production process can be prevented by treatment with the monovalent anti-CD3 antibody (OKT3 scFv) of the present invention. Although it is difficult to directly realize graft-versus-host disease induced by allogeneic CAR-T cells in mice, administering human CAR-T cells to immunodeficient mice can simulate allogeneic GVHD, which is induced when donor allogeneic CAR-T cells attack the recipient's MHC, by inducing the TCR of human CAR-T cells to recognize MHC molecules of normal mouse cells and attack mouse tissue. This is called xenogeneic GVHD. In other words, if human CAR-T cells expressing TCRs are administered to immunodeficient mice inoculated with human tumors, the tumor-removing efficacy of CAR-T cells can be observed in vivo for the first month, but thereafter, xenograft-versus-host disease side effects, in which human CAR-T cells attack normal mouse tissue, can be observed.

[0124] Specifically, immunodeficient NSG mice were subjected to whole-body radiation of 2.5 Gy, followed by the development of 5 × 10⁶ CD19-positive Raji-Luc cell lines. 5The cells were injected intravenously. Three days after Raji cell injection, 5 × 10⁶ mice were given either anti-CD19 CAR-T cells produced from human T cells, anti-CD19 CAR-T cells with removed TCRs, or anti-CD19 CAR-T cells treated with OKT3-scFv antibody to remove residual TCR-positive cells. 6 The tumor cells were injected intravenously one by one. At one-week intervals after tumor cell injection, the bioluminescence of the tumors was measured using an in-vivo imaging system (IVIS). Each mouse was intraperitoneally injected with 2 mg of luciferin dissolved in 100 μl of saline, and an image of the tumor in the body was acquired via IVIS 10 minutes later, which is shown in Figure 12.

[0125] As shown in Figure 12, when tumor growth in mice was measured over time using bioluminescence imaging, all individuals in the group administered only tumor cells died within 2-3 weeks, while the group administered three types of CAR-T cells showed almost no tumor growth and all individuals survived up to 3 weeks, demonstrating excellent therapeutic efficacy and confirming that the antitumor efficacy of all CAR-T cells was well maintained. However, 10 weeks after tumor administration, among the three CAR-T cell administration groups, all mice in the anti-CD19 CAR-T cell group, in which existing anti-CD19 CAR-T cells and TCRs were removed but residual TCR-positive cells remained, died from graft-versus-host disease. Only the group of mice administered anti-CD19 CAR-T cells treated with OKT3-scFv antibody to remove residual TCR-positive cells survived without the side effects of graft-versus-host disease (Figure 13).

[0126] Additionally, the incidence of graft-versus-host disease in mice was compared between groups administered anti-CD19 CAR-T cells produced from various human T cells, anti-CD19 CAR-T cells with removed TCRs but with residual TCR-positive cells remaining, or anti-CD19 CAR-T cells treated with OKT3-scFv antibody to remove residual TCR-positive cells.

[0127] The severity of graft-versus-host disease (GVHD) was measured by body weight and the GVHD score. Both body weight and the GVHD score were measured twice a week. The GVHD score was calculated by assigning scores from 0 to 3 points to five clinical symptoms (skin, hair condition, posture, activity level, and inflammatory eye disease) and summing them up. Both were measured until 80 days after tumor administration, and the results are shown in Figure 13.

[0128] As shown in Figure 13, in the group administered with conventional CAR-T cells in which the TCR was not removed (Conv CAR-T), weight loss began two weeks after tumor administration, clinical findings of graft-versus-host disease were observed, and all individuals died from graft-versus-host disease at three weeks. In the group administered with CAR-T cells in which the TCR was removed but residual TCR-positive cells remained (Del CAR-T), weight loss and graft-versus-host disease severity were partially reduced compared to the Conv CAR-T group, but death from graft-versus-host disease still occurred at 8-9 weeks. This indicates that residual TCR-positive CAR-T cells induced severe graft-versus-host disease side effects. On the other hand, in the group administered with CAR-T cells treated with anti-CD3 scFv antibody to completely remove residual TCR-positive cells (Del Ab CAR-T), all individuals showed long-term survival without side effects, exhibiting antitumor efficacy without weight loss or graft-versus-host disease findings.

[0129] Based on these results, we confirmed that the efficient and complete removal of residual TCR-positive cells through monovalent anti-CD3 antibody treatment during the allogeneic CAR-T cell manufacturing process can significantly reduce graft-versus-host disease side effects of allogeneic CAR-T cells.

[0130] Experimental Example 4. Selective removal effect of activated T cells in peripheral blood by anti-CD3 antibody. Through the above experimental examples, we confirmed that the monovalent anti-CD3 antibody of the present invention can prevent or treat graft-versus-host disease side effects by removing residual TCR-positive cells during the allogeneic CAR-T cell production process.

[0131] Furthermore, the monovalent anti-CD3 antibody of the present invention may be used as a therapeutic agent when directly administered to patients suffering from inflammatory diseases caused by activated T cells, by directly removing activated T cell populations within the patient's body. Examples of such diseases include autoimmune diseases, graft-versus-host diseases, or organ transplant rejection. In other words, if the monovalent anti-CD3 antibody can selectively remove inflammation-mediated activated T cells when administered to patients with autoimmune diseases, graft-versus-host diseases, or organ transplant rejection, it can also be used as an immunosuppressant by suppressing the inflammatory response by T cells while minimizing the risk of infection by preserving naive T cells or memory T cells.

[0132] Therefore, we aimed to confirm whether activated T cells in human blood cells can be selectively removed by treating them with the anti-CD3 scFv antibody (OKT3-ScFv) of the present invention.

[0133] Specifically, T cell populations from peripheral blood mononuclear cells (PBMCs) collected from healthy individuals were classified into subset groups based on their activation history using CD45RA and CCR7 expression as markers. The CD45RA(+)CCR7(+) group consisted mostly of naive T cells that had never been activated, with a small number of quiescent stem cell memory T cells mixed in (N / SCM). The CD45RA(-)CCR7(+) group consisted of central memory T cells (CM) that had been activated but were in the quiescent phase. All of these cell populations are currently inactive and in the quiescent phase. On the other hand, the CCR7(-) cell population consisted of activated effector T cells or effector memory T cells that can be immediately activated (EF / EM). Therefore, the EF / EM cell population contains a large number of currently activated T cells.

[0134] Following this, normal human peripheral blood mononuclear cells and OKT3-scFv antibody were cultured for 3 days, and then the changes in the ratio and decrease in cell number of inactivated and activated T cells were analyzed by flow cytometry to analyze the T cell subsets (subpopulations) within the peripheral blood mononuclear cells. More specifically, cell counting beads (Thermo Scientific) were added during flow cytometry, and the number of cells passing through the flow cytometer per unit volume was measured to calculate the number of T cells and each subset. After staining with anti-CD3-PE, anti-CD4-APC-Cy7, anti-CD8-PE-Cy7, anti-CD45RA-FITC, anti-CCR7-APC, and 7-AAD, the 7-AAD-negative and CD3-positive cell populations were gated, and then the intracellular fraction of each subset in CD4-positive and CD8-positive cells was analyzed. The results are shown in Figures 14 to 16.

[0135] As shown in Figures 14 to 16, the total number of T cells decreased by approximately 30% after 3 days of OKT3-scFv antibody treatment (Figure 14). Of these, the ratio of EF / EM group (activated T cells) to N / SCM group and CM group (inactivated T cells) partially decreased in both CD4 and CD8 T cells (Figures 15 and 16). Furthermore, when the absolute number of cells in each subset group (subpopulation) was calculated, in CD4 T cells, antibody treatment resulted in a partial decrease in the number of cells in the N / SCM group and CM group (inactivated T cells), but the decrease in the number of cells in the EF / EM group (activated T cells) was far more pronounced. In CD8 T cells, there was no change in the number of cells in the N / SCM group and CM group (inactivated T cells) due to antibody treatment, while a clear decrease in the number of cells was observed in the EF / EM group (activated T cells). Furthermore, when calculated using the ratio of cell number reduction in the antibody-treated group compared to the untreated group, it was confirmed that the relative cell number reduction rate was significantly higher in the EF / EM group (activated T cells) for both CD4 and CD8 T cells (Figure 16).

[0136] Based on these results, we confirmed that monovalent anti-CD3 antibodies have a selective removal effect on activated T cells in peripheral blood and can be usefully used as a multi-purpose selective activated T cell removal agent and T cell immunosuppressant.

[0137] Experimental Example 5. In vivo removal of activated T cells by anti-CD3 antibody. To confirm whether the monovalent anti-CD3 antibody also has an activated T cell elimination effect when administered directly in vivo, human T cells activated in vitro were administered to immunodeficient mice. Then, the monovalent anti-CD3 antibody (UCHT1-scFv) was administered intravenously several times at two-day intervals, and the death of human T cells was tracked. In this process, human T cells artificially expressing the luciferase enzyme were used, allowing for the tracking of bioluminescence in human T cells using an in-vivo imaging system (IVIS).

[0138] Specifically, to produce luciferase-expressing human T cells, a highly sensitive luciferase (eff-Luc) cDNA obtained from pDONR222-eGFP (Addgene plasmid #364493) was cloned into a modified pCDH-EF1 vector (Addgene Plasmid #72266) so that it could be expressed together with GFP cDNA. The cloned lentiviral plasmid was transfected into a 293T cell line (ATCC) using lipofectamine 3000 (Invitrogen) along with three types of packaging DNA (pMD.2G, pMDLg / pRRE, pRSV-rev). After transfection, the culture supernatant containing the lentivirus secreted during 24 and 48 hours was harvested, residual cell particles were removed using a 0.45 μm filter, and the supernatant was concentrated 100-fold using an ultra-high-speed centrifuge before being used as a lentiviral concentrate for transduction.

[0139] Leukocytes obtained from healthy individuals via leukapheresis were added to a 24-well plate coated with anti-CD3 antibody (OKT3, 10 μg / ml, BioXcell) along with anti-CD28 antibody (CD28.2, 2 μg / ml, BD Biosciences), and then cultured for 48 hours to activate T cells. Subsequently, a lentivirus concentrate for luciferase expression was mixed with the T cell culture medium and cultured together. Two days after transduction using lentivirus, the cells were washed to remove any remaining virus from the culture medium, and culture was continued for two 3-day periods (3 days + 3 days) with the addition of culture medium containing human IL-2 (200 U / ml) (10-day protocol).

[0140] In the case of luciferase-expressing T cells, there is the advantage that the presence and degree of proliferation of T cells in vivo can be confirmed via IVIS. Therefore, 5 × 10⁶ luciferase-expressing human T cells were introduced into immunodeficient NSG mice. 6 Cells were injected intravenously. The distribution of luciferase-expressing T cells in the body was confirmed using an in vivo imaging system at one-week intervals after human T cell injection. Starting 14 days after T cell injection (when T cells were observed in all mice via IVIS), monovalent anti-CD3 antibody (UCHT1-scFv, low dose: 20 μg / ea, high dose: 100 μg / ea) diluted in 200 μl of PBS was injected intravenously every two days for a total of five times. From the time of monovalent anti-CD3 antibody administration, the distribution of T cells in the mouse body was confirmed every two days using IVIS. Each mouse was intraperitoneally injected with 2 mg of luciferin dissolved in 100 μl of saline. The size of tumor cells was measured via IVIS 10 minutes after intraperitoneal injection.

[0141] The experimental results are shown in Figures 17 and 18. These results demonstrate that in the group administered monovalent anti-CD3 antibody, in vivo T cells were significantly eliminated, and that the higher the amount of monovalent anti-CD3 antibody administered, the faster and more clearly the in vivo T cells decreased, confirming a dose-dependent effect.

[0142] Experimental Example 6. In vivo suppression of T cell-mediated diseases by anti-CD3 antibodies. When luciferase-expressing human T cells are injected into the aforementioned immunodeficient mice, the human T cells attack normal mouse tissue, inducing xenogeneic graft-versus-host disease (GVHD), which causes inflammation. Therefore, we investigated whether administering a monovalent anti-CD3 antibody could suppress xenogeneic graft-versus-host disease by eliminating human T cells.

[0143] The severity of graft-versus-host disease (GVHD) in mice was measured using two methods: body weight and the GVHD score. Body weight and the GVHD score were measured twice a week, and the GVHD score was assigned a score from 0 to 3 points according to five disease indicators (skin, hair condition, posture, activity level, and inflammatory eye disease), and then aggregated.

[0144] Figure 19 shows the results of evaluating weight loss, clinical symptoms of graft-versus-host disease, and mortality rate after administration of a monovalent anti-CD3 antibody (UCHT1-scFv) following induction of xenograft-versus-host disease by human T cells in an immunodeficient mouse model. From Figure 19, it was confirmed that weight loss, clinical symptoms, and mortality rate due to graft-versus-host disease were significantly reduced when treated with the monovalent anti-CD3 antibody. Therefore, since the monovalent anti-CD3 antibody can greatly suppress inflammatory diseases induced by T cells, it has very high potential for development as a therapeutic agent for autoimmune diseases, which are similar T cell-mediated inflammatory diseases. Furthermore, as a disease similar to the graft-versus-host disease in the above model, it may also be usable for the treatment of allogeneic graft-versus-host disease (allogeneic GVHD) that occurs after allogeneic hematopoietic stem cell transplantation for the treatment of hematological malignancies, caused by donor T cells.

[0145] To determine whether a monovalent anti-CD3 antibody could be used as a therapeutic agent to suppress organ rejection by recipient T cells after organ transplantation, an immune rejection reaction was induced by administering activated human T cells to an allogeneic mouse skin transplantation model in which the skin of C57BL6 mice, an allogenic strain, was transplanted onto immunodeficient NSG mice, and then it was tested whether a transplant rejection reaction that inhibits the engraftment of the transplanted skin would appear.

[0146] Specifically, tail skin (1×1×0.5 cm 3 ) derived from female C57BL / 6 mice was transplanted onto the tail of female immunodeficient NSG mice. In the case of the tail skin used for transplantation, it was stored in PBS solution for a maximum of 30 minutes until used for transplantation. NSG mice were anesthetized with Avertin (8 - 10 mg / 400 μl of PBS, intraperitoneal injection) during the entire surgical process and then the transplantation surgery was carried out. Three pieces of donor skin were transplanted to each tail of one NSG mouse. The site where the skin transplantation was completed was fixed with a glass tube and adhesive bandage for 3 days to protect the transplanted skin. The engraftment of the transplanted skin was visually confirmed and evaluated daily. The transplant rejection reaction was defined as when 75% of the surface of the transplanted skin was necrotic. 14 days after the tail skin transplantation, 2×10 6 cells of activated human T cells were injected intravenously. A monovalent anti-CD3 antibody (UCHT1-scFv, 100 μg / ea, intraperitoneal injection) diluted in 200 μl of PBS was injected once every 2 days for a total of 4 times as the primary injection starting from the day of T cell administration. After a 6-day rest, the secondary injection was carried out in the same manner as the primary injection for a total of 8 times of administering the monovalent anti-CD3 antibody. The graft engraftment was measured through the formula "[Number of transplanted skins remaining based on the observation date] / [Number of transplanted skins remaining on the day of T cell injection (14 days after skin transplantation)]×100".

[0147] Figure 20 shows the results of observing whether transplant rejection, in which skin tissue is shed by human T cells, occurs when a monovalent anti-CD3 antibody (UCHT1-scFv) is administered to an immunodeficient mouse model. As can be seen in Figure 20, transplant rejection, in which most of the transplanted skin tissue is shed, was observed in the group administered only human T cells, but in the group administered both the monovalent anti-CD3 antibody and human T cells, the survival rate of the transplanted skin was significantly improved. Therefore, the monovalent anti-CD3 antibody may be useful as an immunorejection inhibitor during organ transplantation.

[0148] The above description of the present invention is illustrative, and a person with ordinary skill in the art will understand that the invention can be easily modified into other specific forms without altering the technical idea or essential features of the invention. Therefore, the embodiments described above should be understood in all respects as illustrative and not limiting.

Claims

1. A pharmaceutical composition for preventing or treating T cell-mediated autoimmune diseases, graft-versus-host diseases (GVHD), or organ transplant rejection, comprising a monovalent antibody or an antigen-binding fragment thereof, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

2. The pharmaceutical composition according to claim 1, wherein the antigen-binding fragment is Fab, Fab', Fv, scFv, or a single-domain antibody (sdAB).

3. The pharmaceutical composition according to claim 1, wherein the antibody that specifically binds to CD3 is selected from any one of the following: OKT3, UCHT1, teplizumab, otelixizumab, bisilizumab, foralumab; an antibody comprising a light chain variable region including LCDR1 of SEQ ID NO: 23, LCDR2 of SEQ ID NO: 24, and LCDR3 of SEQ ID NO: 25, and a heavy chain variable region including HCDR1 of SEQ ID NO: 26, HCDR2 of SEQ ID NO: 27, and HCDR3 of SEQ ID NO: 28; and an antibody comprising a light chain variable region including LCDR1 of SEQ ID NO: 32, LCDR2 of SEQ ID NO: 33, and LCDR3 of SEQ ID NO: 34, and a heavy chain variable region including HCDR1 of SEQ ID NO: 35, HCDR2 of SEQ ID NO: 36, and HCDR3 of SEQ ID NO:

37.

4. Antibodies that specifically bind to CD3 include teclistamab, tebentafusp, blinatumomab, catumaxomab, TNB-486, AMG562, duvortuxizumab, AMG910, pasotuxizumab, HPN424, AMG160, JNJ-63898081, CC-1, and AMG 509, HPN536, odronectamab, epicolitamab, glofitamab, mosunetuzumab, JNJ-75348780, vixtimotamab, AMG 330, REGN4018, AMG199, MGD007, EGFR BAT, AMG596, M701, solitomab, MT110, AMG110, AMG 211, MEDI-565, cibisatamab, tidutamab, talquetamab, RG6194, GBR 1302, M802, Runimotamab, GEN1044, GEN1047, PF-07062119, AMG 757, BI 764532, HPN328, Hu3F8-BsAb, GEM3PSCA, IMC-C103C, IMC-F106C, JNJ-70218902, AMG 424, Elranatamab, ABBV-383, AMG The pharmaceutical composition according to claim 1, wherein the CD3-binding antibody is selected from 420, CC-93269, linvoseltamab, alnuctamab, cevostamab, and AMG 427, and the heavy chain variable region and light chain variable region target CD3.

5. The pharmaceutical composition according to claim 1, wherein the monovalent antibody or its antigen-binding fragment induces the death of activated T cells and / or suppresses alloreactive immune responses.

6. The aforementioned autoimmune diseases include rheumatoid arthritis, multiple sclerosis, systemic lupus erythematosus, type 1 diabetes, Crohn's disease, scleroderma, Sjögren's syndrome, psoriasis, inflammatory bowel disease, ulcerative colitis, and ankylosing spondylitis. Spongylitis, interstitial lung disease, uveitis, optic neuritis, peripheral neuropathy, sarcoidosis, antiphospholipid syndrome, inflammatory myopathy, Behcet's disease, alopecia totalis / universalis, pemphigus vulgaris The pharmaceutical composition according to claim 1, which is selected from the group including vulgaris, myasthenia gravis, Graves' disease, Hashimoto's thyroiditis, Guillain-Barré syndrome, celiac disease, and pernicious anemia.

7. The pharmaceutical composition according to claim 1, which is used in combination with an immunosuppressant.

8. A pharmaceutical composition for T cell immunosuppression or activated T cell removal, comprising a monovalent antibody or an antigen-binding fragment thereof, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

9. A method for suppressing T-cell immunity, comprising the step of administering a monovalent antibody or an antigen-binding fragment thereof, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.

10. (a) A step of downregulating the expression of T cell receptors (TCRs) in T cells, (b) The step of introducing a chimeric antigen receptor (CAR) into T cells, (c) The step of treating the cells obtained in steps (a) and (b) above with a monovalent antibody or an antigen-binding fragment thereof, which includes a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3. A method for removing TCR (T cell receptor) positive CAR-T cells, wherein steps (a) and (b) above are performed regardless of the order.

11. The method according to claim 10, wherein the step of downregulating TCR expression is carried out by gene editing techniques, siRNA, shRNA, or miRNA.

12. The method according to claim 11, wherein the gene editing technique is carried out by CRISPR (clustered regularly interspaced short palindromic repeats) / Cas 9, TALEN, zinc finger nuclease, base editing, or prime editing.

13. It includes a light chain variable region containing LCDR1 of SEQ ID NO: 23, LCDR2 of SEQ ID NO: 24, and LCDR3 of SEQ ID NO: 25, and a heavy chain variable region containing HCDR1 of SEQ ID NO: 26, HCDR2 of SEQ ID NO: 27, and HCDR3 of SEQ ID NO: 28, or An antibody or its antigen-binding fragment comprising a light chain variable region including LCDR1 of SEQ ID NO: 32, LCDR2 of SEQ ID NO: 33, and LCDR3 of SEQ ID NO: 34, and a heavy chain variable region including HCDR1 of SEQ ID NO: 35, HCDR2 of SEQ ID NO: 36, and HCDR3 of SEQ ID NO:

37.

14. The antibody or antigen-binding fragment according to claim 13, comprising a light chain variable region containing the amino acid sequence of SEQ ID NO: 29 or 38 and / or a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 30 or 39.

15. A polynucleotide encoding the antibody or antigen-binding fragment thereof according to claim 13.

16. An expression vector comprising the polynucleotide of claim 15.

17. A cell comprising the polynucleotide of claim 15 or an expression vector containing the same.