Novel GSPT1 decomposing agent and use of novel GSPT1 decomposing agent
Novel GSPT1 degrading agents with specific substituents on a phenylsulfonamide ring improve GSPT1 degradation persistence and pH stability, addressing the limitations of conventional drug development by enhancing anticancer efficacy against neuroendocrine cancers.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-04-12
- Publication Date
- 2026-05-26
AI Technical Summary
Conventional drug development strategies struggle to target nuclear transcription factors and scaffold proteins due to their lack of a docking pocket structure, limiting the development of effective drugs for diseases related to these proteins, with only about 15% of known disease-related proteins having FDA-approved drugs.
Development of novel GSPT1 degrading agents represented by formula I, which utilize specific substituents on a phenylsulfonamide ring bonded to pomalidomide to enhance GSPT1 degradation persistence, pH stability, and safety, leveraging the body's ubiquitin-proteasome system for targeted protein degradation.
The compounds exhibit high selectivity and sustained degradation activity for GSPT1, excellent pH stability, and low cytotoxicity, demonstrating excellent anticancer efficacy against cancers with a neuroendocrine phenotype, such as small cell lung cancer and neuroendocrine prostate cancer.
Smart Images

Figure 2026516556000001_ABST
Abstract
Description
Detailed description of the invention
[0001] [Technical field] [1] The present invention relates to novel GSPT1 degrading agents and the use of novel GSPT1 degrading agents. More specifically, the present invention relates to a compound represented by formula I, its stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts, a pharmaceutical composition comprising the same for treating disorders of uncontrolled cell proliferation, and a method for treating disorders of uncontrolled cell proliferation by administering the same to a mammal.
[0002] [Background technology] [2] Conventional drug development strategies involve directly modifying protein activity by binding drugs to specific active sites of disease-related proteins such as enzymes, receptors, signaling molecules, and membrane proteins. Therefore, nuclear transcription factors, scaffold proteins, and aggregates remain difficult targets for drug development because they do not possess a docking pocket structure. According to the Human Protein Atlas, only about 15% of the approximately 4,500 known disease-related proteins have FDA-approved drugs.
[0003] [3] In order to overcome these limitations of conventional drug development strategies, there has been a great deal of research into targeted protein degradation techniques for targets that are difficult to develop drugs for.
[0004] [4] Targeted proteolytic techniques attempt to treat a disease by using the body's own proteolytic systems to remove disease-related proteins. Intracellular proteolytic activity is carried out by lysosomes and proteasomes, with approximately 80% of cellular proteins being labeled with ubiquitin by the ubiquitin-proteasome system (UPS) and then degraded by the proteasome.
[0005] [5] Ubiquitin is a protein composed of 76 amino acids. E1 ubiquitin ligases, E2 ubiquitin ligases, and E3 ubiquitin ligases are involved in the process of ubiquitination, which labels ubiquitin for UPS-mediated proteolysis, and the labeled protein is degraded by the ATP-dependent protease complex, the 26S proteasome. E3 ubiquitin ligases bind to both the E2 ligase and the substrate protein and are responsible for recognizing the substrate protein to be labeled with ubiquitin.
[0006] [6] Drugs employing the TPD strategy can be classified into PROTACs (proteolytically induced chimeras) and molecular glues, depending on the structure of the compound. PROTACs are heterobifunctional compounds in which the ligand of an E3 ligase, a component of UPS, and the ligand of the target protein are linked via a linker. In contrast, molecular glues utilize the characteristics of small molecules to induce the formation of a specific protein complex that promotes the interaction between the target protein and the E3 ligase involved in proteolysis, thereby degrading the target protein. Molecular glues have a significantly lower molecular weight than PROTACs and therefore have the advantage of enabling the development of therapeutic agents with superior pharmacokinetic properties.
[0007] [7] Previous studies have shown that immunomodulatory imides (IMiDs), including thalidomide, lenalidomide, and pomalidomide, bind to cereblon (CRBN), the substrate receptor for CRL4 E3 ubiquitin ligase (Ito et al., Science 327:1345~1350 (2010)). As previously reported, when IMiD binds to CRBN, it creates a new surface that triggers neo-interactions between CRBN and Ikaros (IKZF1) and between CRBN and Aiolos (IKZF3), thereby enabling IMiD drugs to induce CRBN-dependent ubiquitination and subsequent proteolysis of Ikaros and Aiolos (Kronke et al., Science 343:301~305 (2014), Lu et al., Science 343:305~309 (2014)).
[0008] [8] On the other hand, International Publication No. 2022 / 066835 discloses an IMiD-based compound that selectively degrades GSPT1 compared to Ikaros and Aiolos. However, this document lacks research on characteristics essential for successful anticancer drug development, such as the GSPT1 degradation persistence, safety, and stability of the compound.
[0009] [Disclosure of the Invention] [Technical issues] [9] Accordingly, the inventors have conducted extensive characterization studies of IMiD-based compounds and have found that the presence of specific substituents at each position of the phenylsulfonamide ring bonded to the pomalidomide structure significantly improves the persistence of GSPT1 degradation and pH stability, as well as the anticancer efficacy and safety, and that excellent anticancer efficacy can be achieved against cancers exhibiting a neuroendocrine phenotype.
[0010] [Solutions to the problem]
[10] In one aspect of the present invention, the following formula I:
[11] [Formula I]
[12] [ka]
[0011] Compounds represented by
[13] , stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts thereof are provided, in formula I,
[14] R 1 These are halogens, C1-C6 alkyls, C1-C6 alkoxys, C1-C6 haloalkyls, or C1-C6 haloalkoxys.
[15] R 2 R 2a A C1-C6 alkyl group which may be substituted with
[16] R 2a is a hydroxyl, halogen, C1-C6 alkoxy, C1-C6 haloalkoxy, or -NR'R'',
[17] R' and R'' may each be hydrogen or a C1-C6 alkyl group, or R' and R'' may together with the nitrogen atom bonded to them to form a 3-8 membered heterocyclic ring which may contain one additional heteroatom selected from N, O, and S.
[18] R 3 It is either hydrogen or a halogen.
[0012]
[19] In another aspect of the present invention, a pharmaceutical composition for treating disorders of uncontrolled cell proliferation in mammals is provided, comprising a compound represented by formula I, a stereoisomer thereof, a hydrate, a solvate, or a pharmaceutically acceptable salt thereof.
[0013]
[20] In another aspect of the present invention, a method is provided for modulating cereblon activity or GSPT1 activity in at least one cell, comprising the step of contacting at least one cell in vitro with a compound represented by formula I, a stereoisomer thereof, a hydrate, a solvate, or a pharmaceutically acceptable salt thereof.
[0014]
[21] In another aspect of the present invention, a method is provided for treating a disorder of uncontrolled cell proliferation in a mammal, comprising the step of administering to a mammal a compound represented by formula I, a stereoisomer thereof, a hydrate, a solvate, or a pharmaceutically acceptable salt thereof.
[0015] [Advantageous effects of the invention]
[22] The compounds according to the present invention exhibit high selectivity and sustained degradation activity for GSPT1, excellent pH stability, and low cytotoxicity to normal cells, and therefore have excellent anticancer efficacy and a high therapeutic index. In addition, the compounds according to the present invention may exhibit excellent anticancer activity against cancers exhibiting a neuroendocrine phenotype, such as small cell lung cancer (SCLC), neuroendocrine pulmonary cancer (NEC), and neuroendocrine prostate cancer (NEPC). [Brief explanation of the drawing]
[0016] [Figure 1]This figure shows the results obtained by measuring the GSPT1 degradation activity of reference compound 1 and example compounds against various neosubstrates at different concentrations. [Figure 2] This figure shows the results obtained by observing the change in GSPT1 expression levels over time when treated with reference compound 1 and example compound (100 nM). [Figure 3] This figure shows the results obtained by measuring the real-time proliferation of cancer cells (NCI-H1155 cells) after treatment with reference compound 1 and example compounds. [Figure 4] This figure shows the results obtained by performing TMT-labeled proteomics analysis after treating the HL60 cell line with the example compound. [Figure 5] This figure shows the results obtained by observing GSPT1 expression levels and protein translation rates over time after treating NCI-H1155 cells with 1 μM compound 3. [Figure 6] This figure shows the results obtained by observing GSPT1 expression levels, N-MYC expression levels, and protein translation rates over time after treating NCI-H1155 cells with 1 μM of compound 3 (left), and the results obtained by measuring the expression levels of GSPT1, N-MYC, and ATF-4, as well as the activation level of caspase 3 (right). [Figure 7] This figure shows the results obtained by measuring the time-course GSPT1 expression levels, ATF-4 expression levels, and caspase-3 activation levels after treating HL60 cells with 0.3 μM compound 3. [Figure 8] This figure shows the results obtained by observing the GSPT1 expression level and protein translation rate over time after treating NCI-H2023 cells with 1 μM of reference compound 1 and compound 3. [Figure 9a] This figure shows the results obtained by measuring the cell viability of various small cell lung cancer (SCLC) cell lines and lung adenocarcinoma (LUAD) cell lines after treatment with compounds 3 and 4. [Figure 9b]This figure shows the results obtained by calculating the EC50 of compound 3 and compound 4 against cell lines of lung adenocarcinoma (LUAD), small cell lung cancer (SCLC), pulmonary neuroendocrine carcinoma (NEC), and neuroendocrine prostate cancer (NEPC). [Figure 10] This figure shows the therapeutic index (TI) of each compound, calculated based on the cell viability of reference compound 1, compound 3, and compound 4 measured in NCI-H1155 cells, HL60 cells, and HeKa cells. [Figure 11] This figure shows the changes in bioluminescence over time (Figure 11a) and body weight (Figure 11b) after administration of compound 3 in an HL-60-Luc AML animal model. [Figure 12] This figure shows the results obtained by observing the expression levels of GSPT1 and N-MYC 6 hours and 24 hours after administration of compound 4 in an animal model of NCI-H1155 lung cancer (Figure 12a), and the results obtained by measuring the change in tumor volume over time after administration of compound 4 (Figure 12b). [Figure 13] This figure shows the results obtained by measuring the changes in tumor volume over time (Figure 13a) and changes in body weight (Figure 13b) after administering compound 3 at various doses and administration cycles.
[0017] [Modes of the Invention]
[37] The present invention will be described in further detail thereafter.
[0018]
[38] Each description and embodiment disclosed herein may also apply to each of the other descriptions and embodiments. That is, any combination of the various elements disclosed herein falls within the scope of this application. In addition, the scope of this application should not be construed as being limited by the following detailed description.
[0019]
[39] In one aspect of the present invention, the following formula I:
[40] [Formula I]
[41] [ka] There is provided a compound represented by
[42] , its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt, wherein in formula I,
[43] R 1 is halogen, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, or C1-C6 haloalkoxy,
[44] R 2 is C1-C6 alkyl optionally substituted with R 2a and
[45] R 2a is hydroxy, halogen, C1-C6 alkoxy, C1-C6 haloalkoxy, or -NR’R”,
[46] R’ and R” are each hydrogen or C1-C6 alkyl, or R’ and R” together with the nitrogen atom to which they are attached may form a 3- to 8-member heterocyclic ring optionally containing one additional heteroatom selected from N, O, and S,
[47] R 3 is hydrogen or halogen.
[0020]
[48] In the above formula I, R 1 is halogen, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, or C1-C6 haloalkoxy. In one embodiment, R 1 is halogen, C1-C3 alkyl, C1-C3 alkoxy, C1-C3 haloalkyl, or C1-C3 haloalkoxy. In one embodiment, R 1 can be halogen, C1-C6 alkyl, C1-C6 haloalkyl, or C1-C6 haloalkoxy. In one embodiment, R 1 can be halogen, C1-C3 alkyl, C1-C3 haloalkyl, or C1-C3 haloalkoxy. In one embodiment, R 1 can be halogen or C1-C6 alkyl. In one embodiment, R 1 can be halogen or C1-C3 alkyl. In one embodiment, R 1 can be halogen (F, Cl, Br, or I). For example, R 1This includes, but is not limited to, F, Cl, Br, I, -OCH2F, -OCHF2, -OCF3, -CH2F, -CHF2, -CF3, or -CH3.
[0021]
[49] In the above equation I, R 2 is either C1-C6 alkyl or R 2a It is a C1-C6 alkyl group substituted with R. In one embodiment, R 2 This can be a C1-C6 alkyl group. In one embodiment, R 2 This can be a C1-C3 alkyl group. In one embodiment, R 2 R 2a It may be a C1-C6 alkyl group substituted with R. In one embodiment, R 2 R 2a It can be a C1-C3 alkyl group substituted with R. In this case, R 2a R can be a hydroxyl, halogen, C1-C6 alkoxy, or C1-C6 haloalkoxy. In one embodiment, R 2a R can be a hydroxyl, halogen, C1-C3 alkoxy, or C1-C3 haloalkoxy. In one embodiment, R 2a R may be a hydroxyl or C1-C6 haloalkoxy. In one embodiment, R 2a R can be a hydroxyl or C1-C3 haloalkoxy. For example, R 2 This includes, but is not limited to, -CH3, -CH2CH3, -CH2OCF3, -CH2OCHF2, -CH2OCH2F, -CH2OH, or -CH2CH2OH.
[0022]
[50] Or, R 2 R 2a It can be a C1-C6 alkyl substituted with R 2a This can be -NR'R". In one embodiment, R 2 R 2a It may be a C1-C3 alkyl group substituted with R' and R''. R' and R'' may each be hydrogen or a C1-C6 alkyl group. In one embodiment, R' and R'' may each be hydrogen or a C1-C3 alkyl group.
[0023]
[51] In addition, R' and R'' together with the nitrogen atom to which they are bonded may form a 3- to 8-membered heterocyclic ring which may include one additional heteroatom selected from N, O, and S. In one embodiment, R' and R'' together with the nitrogen atom to which they are bonded may form a morpholinyl ring, a thiomorpholinyl ring, a piperadinyl ring, or a piperidinyl ring.
[0024]
[52] For example, R 2 This includes, but is not limited to, -CH2-morpholinyl, -CH2-CH2-morpholinyl, -CH2-NH2, -CH2-NH(CH3), -CH2-N(CH3)2, -CH2CH2-NH2, -CH2-CH2NH(CH3), or -CH2-CH2-N(CH3)2.
[0025]
[53] In the above equation I, R 3 is hydrogen or halogen. In one embodiment, R 3 is hydrogen. In one embodiment, R 3 It is a halogen. For example, R 3 This can be F, Cl, Br, or I. For example, R 3 It can be F.
[0026]
[54] The inventors found that the compound disclosed in the prior art (International Publication No. 2022 / 066835) did not exhibit sustained GSPT1 degradation activity, and after a certain period, for example 48 hours after treatment, the GSPT1 expression level recovered, and the tumor cells whose proliferation had been suppressed began to grow again. Without intending to be bound by theory, the inventors found that the compound disclosed in the prior art was unstable at physiological pH (pH 7), and the inventors believe that this pH instability of the compound disclosed in the prior art is one of the reasons why its GSPT1 degradation activity and tumor inhibitory activity are transient.
[0027]
[55] Therefore, in order to obtain a compound having improved pH stability, sustained and selective degradation activity against GSPT1, and excellent tumor growth inhibitory activity, the inventors conducted extensive research on the properties of compounds in which phenylsulfonamide was bonded to a pomalidomide structure by modifying the structure. As a result, it was found that compounds having an alkyl group or an alkyl group substituted with a specific substituent at the meta position based on the position in which the sulfonamide group is bonded exhibit excellent pH stability, sustained and selective degradation activity against GSPT1, and excellent tumor growth inhibitory activity. In particular, the inventors found that compounds having a halogen, or an alkyl group or alkoxy group which may be substituted with a halogen, at the adjacent ortho position, and the adjacent para position which is unsubstituted or substituted with a halogen (preferably F), exhibit significantly improved properties in terms of pH stability, GSPT1 degradation activity, and tumor growth inhibitory activity.
[0028]
[56] In one embodiment, the compound represented by formula I of the present invention may have the following combinations of substituents.
[0029]
[57] R 1 These are halogens, C1-C6 alkyls, C1-C6 haloalkyls, or C1-C6 haloalkoxys.
[58] R 2 R 2a A C1-C6 alkyl group which may be substituted with
[59] R 2a These are hydroxyl or C1-C6 haloalkoxy compounds.
[60] R 3 It is either hydrogen or a halogen.
[0030]
[61] In one embodiment, the compound represented by formula I of the present invention may have the following combinations of substituents.
[0031]
[62] R 1 These are halogens or C1-C6 alkyl groups.
[63] R 2These are C1-C6 alkyl groups,
[0032]
[64] R 3 It is either hydrogen or a halogen.
[0033]
[65] For example, in equation I above, R 1 R can be a halogen or a C1-C3 alkyl, 2 It can be a C1-C3 alkyl, and R 3 R can be hydrogen or a halogen. For example, in formula I above, 1 R can be F, Cl, Br, I, -CH3, or -CH2CH3, 2 This can be -CH3 or -CH2CH3, and R 3 This can be hydrogen or F.
[0034]
[66] In one embodiment, the compound represented by formula I of the present invention may have the following combinations of substituents.
[0035]
[67] R 1 These are C1-C6 haloalkyl or C1-C6 haloalkoxy,
[68] R 2 These are C1-C6 alkyl groups,
[69] R 3 It is either hydrogen or a halogen.
[0036]
[70] For example, in equation I above, R 1 R can be a C1-C3 haloalkyl or C1-C3 haloalkoxy, 2 It can be a C1-C3 alkyl, and R 3 R can be hydrogen or a halogen. For example, in formula I above, 1 This can be -OCH2F, -OCHF2, -OCF3, -CH2F, -CHF2, or -CF3, R 2 This can be -CH3 or -CH2CH3, and R 3 This can be hydrogen or F.
[0037]
[71] In one embodiment, the compound represented by formula I of the present invention may have the following combinations of substituents.
[0038]
[72] R 1 It is a halogen,
[73] R 2 R 2a A C1-C6 alkyl group which may be substituted with
[74] R 2a These are hydroxyl or C1-C6 haloalkoxy compounds.
[75] R 3 It is hydrogen.
[0039]
[76] For example, in equation I above, R 1 It can be a halogen, R 2 R may be a C1-C3 alkyl which may be substituted with a hydroxyl group or a C1-C3 haloalkoxy group, 3 R can be hydrogen. For example, in equation I above, 1 is Cl, Br, or I, and R 2 This can be -CH2OCHF2, -CH2OCH2F, -CH2OH, or -CH2CH2OH.
[0040]
[77] In one embodiment, in the compound represented by formula I of the present invention, R 1 It can be a halogen, R 2 It can be a C1-C6 alkyl, and R 3 R can be hydrogen. For example, in equation I above, 1 is Cl, Br, or I, and R 2 R can be a C1-C3 alkyl such as methyl or ethyl, 3 It could be hydrogen.
[0041]
[78] In one embodiment, the compound represented by formula I of the present invention has the following combination of substituents.
[0042]
[79] R 1 It is a halogen,
[80] R 2is C1-C6 alkyl substituted with NR’R”,
[81] Each of R’ and R” is hydrogen, C1-C6 alkyl, or C1-C3 alkyl,
[82] R 3 is hydrogen.
[0043]
[83] For example, in the compound represented by formula I of the present invention, R 1 can be halogen (e.g., Cl), R 2 can be methylaminomethyl, and R 3 can be hydrogen.
[84] In one embodiment, the compound represented by formula I of the present invention may have the following combinations of substituents.
[0044]
[85] R 1 is halogen,
[86] R 2 is C1-C6 alkyl substituted with NR’R”,
[87] R’ and R” may together with the nitrogen atom to which they are attached form a 3- to 8-member heterocyclic ring optionally containing one additional heteroatom selected from N, O, and S,
[88] R 3 is hydrogen. <00�0458>
[89] In one embodiment, the compound represented by formula I of the present invention may have the following combinations of substituents.
[90] R 1 is halogen,
[91] R 2 is C1-C6 alkyl substituted with NR’R”,
[92] R’ and R” may together with the nitrogen atom to which they are attached form a morpholinyl ring, thiomorpholinyl ring, piperazinyl ring, or piperidinyl ring,
[93] R 3 is hydrogen.
[0046]
[94] For example, in the compound represented by formula I of the present invention, R 1can be a halogen (e.g., Cl), and R 2 can be morpholinylmethyl, and R 3 can be hydrogen.
[0047]
[95] R 1 , R 2 , and R 3 For the above combinations of R 1 , R 2 , and R 3 the specific examples previously described for each of them can also be applied.
[0048]
[96] The compound represented by formula I can be a compound represented by any one of the following formulas.
[97]
Chemical formula
[98]
Chemical formula
[0049]
[99] In one embodiment, the compound represented by formula I according to the present invention can be a compound having any one of the following structures.
[0100]
Chemical formula
[0050]
[0101] definition
[0102] All technical and scientific terms used in this document have the meanings generally understood by those skilled in the art, and unless otherwise specified, conventional measurement methods, manufacturing methods, and conventional components or substances are used based on conventional techniques such as pharmacology, pharmaceutical chemistry, mass spectrometry, NMR, HPLC, and biochemistry.
[0051]
[0103] The individual features and components of each embodiment described and explained herein can be combined with any other features and components of any other embodiment without departing from the scope or spirit of this disclosure.
[0052]
[0104] Unless otherwise specified, in this specification and the appended claims, “or” and “and” mean “and / or.” The terms “include” and “included” are non-restrictive and mean that a compound, composition, or method may include additional features or components in addition to the specific features or components listed.
[0053]
[0105] In this specification, a numerical range indicated by the term "~" refers to a range that includes the numerical values described before and after the term "~" as its lower and upper limits, respectively.
[0054]
[0106] As used in this book, the terms "optional" or "optionally" mean that the event or situation described thereafter may or may not occur, and that the description includes both the cases in which the event or situation occurs and the cases in which it does not occur. For example, the term "may be substituted" means both substitution by the specified substituent and non-substitution.
[0055]
[0107] compound
[0056]
[0108] As used in this book, unless otherwise specified, the term "alkyl" refers to saturated linear and branched carbon chains having 1 to 6 carbon atoms, 1 to 4 carbon atoms, or 1 to 3 carbon atoms, whether used alone or as part of a substituent. Non-exclusive examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, and tert-butyl.
[0057]
[0109] The term "alkoxy" refers to an -O-alkyl group. Non-exclusive examples of alkoxy groups include methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, sec-butoxy, iso-butoxy, and tert-butoxy.
[0058]
[0110] The term "heteroatom" means nitrogen, oxygen, or sulfur, such as N(O)(N + -O - It contains oxidized nitrogen such as ), oxidized sulfur such as S(O) and S(O)2, and basic quaternized nitrogen.
[0059]
[0111] The terms "heterocycloalkyl," "heterocyclic," or "heterocyclic" refer to saturated or partially unsaturated cyclic groups that contain one or more heteroatoms, with the remaining ring atoms being carbon. Heterocycloalkyl groups may, for example, contain one or two heteroatoms. Heterocycloalkyl groups may have 3 to 8 ring members, 5 to 7 ring members, or 5 or 6 ring members. Examples of heterocycloalkyl groups include, but are not limited to, morpholinyl, thiomorpholinyl, piperazinyl, piperidinyl, pyrrolidinyl, and azetidinyl.
[0060]
[0112] The term "oxo" refers to the (=O) group.
[0061]
[0113] As used in this book, the term "halogen" refers to atoms belonging to Group 17 of the periodic table. Halogen atoms include fluorine, chlorine, bromine, and iodine, and can be used synonymously with the term "halo," which refers to a monovalent functional group composed of halogens.
[0062]
[0114] In this book, the term "hydroxy" refers to the -OH functional group (hydroxyl group).
[0063]
[0115] In this book, the term "amino" refers to -NH2.
[0064]
[0116] As used in this book, the term "alkylamino" refers to a group in which one of the two hydrogen atoms in the amino group is replaced by an alkyl group. Examples of alkylamino groups include, but are not limited to, methylamino, ethylamino, and propylamino.
[0065]
[0117] As used in this book, the term "dialkylamino" refers to -N(alkyl)2. In this case, the two alkyl groups may be the same or different from each other. Examples of dialkylamino substituents include, but are not limited to, dimethylamino, diethylamino, ethylmethylamino, and dipropylamino.
[0066]
[0118] As used in this book, the term "haloalkyl" refers to an alkyl group substituted with one or more halogen atoms. The halogens may be the same (e.g., CHF2, -CF3) or different (e.g., CF2Cl). Where explicitly stated, a haloalkyl group may be substituted with one or more substituents other than halogens. Examples of haloalkyl groups may include, but are not limited to, fluoromethyl, dichloroethyl, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl groups.
[0067]
[0119] As used in this book, the term "haloalkoxy" refers to an alkoxy group substituted with one or more halogen atoms, where alkoxy is defined above. Non-exclusive examples of haloalkoxy groups may include fluoromethoxy, dichloroethoxy, trifluoromethoxy, and trichloromethoxy.
[0068]
[0120] As used in this book, the term "hydroxyalkyl" refers to an alkyl group substituted with one or more -OH groups, where alkyl is defined above.
[0069]
[0121] In this specification, [ka] The asterisk (*) or hyphen (-) is used to indicate the position where a substituent is bonded to the rest of the compound. For example, if a hyphen is shown at the end of a substituent, it means that the end is bonded to the rest of the compound. In addition, when two or more substituents are linked by a hyphen, it means that the substituent immediately preceding the hyphen is bonded to a substitutable atom of the substituent immediately following the hyphen.
[0070]
[0122] As used herein, the term “solvate” may refer to a compound of the present invention or a salt thereof containing a stoichiometric or non-stoichiometric amount of solvent bonded by non-covalent intermolecular forces. Preferred solvents for this purpose may be volatile solvents, non-toxic solvents, and / or solvents suitable for administration to humans. The solvent may be water, in which case the “solvate” is referred to as a “hydrate.” The compounds of the present invention may exist as hydrates, which can be obtained, for example, by crystallization from a solvent or aqueous solution. In this regard, one, two, three, or any number of solvent molecules or water molecules may combine with the compounds of this disclosure to form solvates and hydrates. Unless otherwise stated, this disclosure includes all such possible solvates.
[0071]
[0123] In addition, the compounds according to the present invention may exist in various crystalline polymorphs, and therefore, certain modifications can become metastable. Unless otherwise specified, the compounds of the present invention include all of these possible polymorphs.
[0072]
[0124] As used in this book, the term “stereoisomer” may refer to a compound or salt thereof of the present invention that has the same chemical formula or the same molecular formula but is optically or stereochemically different, and may more specifically be a diastereomer, enantiomer, or geometric isomer.
[0073]
[0125] In some embodiments, the compounds of the present invention contain one or more chiral centers and may exist in the form of a racemate, a single enantiomer, a mixture of enantiomers, a single diastereomer, a mixture of diastereomers, and so on. In one embodiment, due to the properties or rotational limitations of the chiral centers, the compounds of the present invention may exist in the form of enantiomers or diastereomers.
[0074]
[0126] If two or more chiral centers are present in the compounds of the present invention, multiple diastereomers and enantiomers of the chemical structures disclosed herein may exist. Pure isomers, separated isomers, partially pure isomers, or racemic mixtures are all intended to be within the scope of the present invention.
[0075]
[0127] The purification of isomers and the separation of isomeric mixtures can be achieved by standard techniques known in the art. For example, a diastereomer mixture can be separated into its respective diastereomers by chromatographic processes or crystallization, and a racemate can be separated into its respective enantiomers by chromatographic processes or chiral phase separation.
[0076]
[0128] The compounds of the present invention may be used in the form of pharmaceutically acceptable salts derived from acids or bases.
[0077]
[0129] The term "pharmaceutically acceptable salt" refers to a salt of a pharmaceutical active ingredient prepared with an acid or base that, when administered in a therapeutically effective dose, is tolerable by the biological system, tolerable by the subject, or tolerable by both the biological system and the subject. If the compound of the present invention contains a relatively acidic functional group, a base addition salt can be obtained by contacting the neutral form of the compound of the present invention with a sufficient amount of the desired base in either a pure solvent or a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include, but are not limited to, sodium salts, potassium salts, calcium salts, ammonium salts, organic amino salts, magnesium salts, lithium salts, strontium salts, or similar salts.
[0078]
[0130] If the compounds of this disclosure contain relatively basic functional groups, an acid addition salt can be obtained by contacting the neutral form of the compound of the present invention with a sufficient amount of the desired acid in either a pure solvent or a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, salts derived from inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, monocarbonate, phosphoric acid, monohydrogenic acid, dihydrogenic acid, sulfuric acid, monohydrosulfuric acid, hydroiodic acid, or phosphorous acid, and salts derived from relatively non-toxic organic acids such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-tolylsulfonic acid, citric acid, tartaric acid, or methanesulfonic acid. In addition, salts of amino acids such as alginic acid and salts of organic acids such as glucuronic acid or galacturonic acid are also included.
[0079]
[0131] Method for preparing compounds
[0080]
[0132] The compounds according to the present invention can be readily prepared from commercially available starting materials, from compounds known in the literature, or from intermediates readily prepared therefrom by standard synthetic methods and procedures in the relevant field.
[0081]
[0133] The methods described in this book can be monitored according to preferred methods known in the art. For example, product formation can be monitored by nuclear magnetic resonance spectroscopy (e.g., 1 H or 13 C) It can be monitored by spectroscopic means such as infrared spectroscopy, spectrophotometric methods (e.g., UV-visible light), and mass spectrometry, or by chromatography such as high-performance liquid chromatography (HPLC), gas chromatography (GC), gel permeation chromatography (GPC), or thin-layer chromatography (TLC).
[0082]
[0134] The following schematic reaction scheme roughly illustrates a typical method for preparing the compound represented by formula I. Those skilled in the art can easily prepare the compound represented by formula I by appropriately selecting suitable starting materials, reaction temperature, reaction conditions, catalyst, solvent, processing method, etc., based on the preparation methods disclosed in detail in the examples provided here. Hereafter, the designation of each substituent in formula I in the reaction scheme is the same as the designation of the substituent at the corresponding position in formula I, unless otherwise specified.
[0083]
[0135] In one embodiment, the compound represented by formula I according to the present invention is reacted as shown in the reaction scheme A below, R 1 , R 2 and R 3 It can be prepared by reacting a phenylsulfonyl chloride compound substituted with .
[0084]
[0136] [Reaction Scheme A]
[0137] [ka]
[0138] [ka]
[0085]
[0139] The substituent R of the compound represented by formula I 1 , R 2 , and R 3 R corresponding to 1 , R 2 , and R 3 The final target phenylsulfonyl chloride compound, substituted with , can be purchased as a commercially available compound, or it can be readily prepared based on techniques known in the field of medicinal chemistry and the examples provided in this book.
[0086]
[0140] In Step 1, the phenylsulfonyl chloride compound and dimethyl-4-aminobenzene-1,2-dicarboxylate are reacted in the presence of a suitable solvent such as pyridine at a suitable temperature (e.g., 20°C to 30°C, e.g., about 25°C) for a certain period of time (e.g., about 1 hour).
[0087]
[0141] In Step 2, the dicarboxylate compound obtained in Step 1 is hydrolyzed with LiOH in a suitable solvent (e.g., a mixed solution of THF, MeOH, and water) to obtain a phthalate compound. This reaction can be carried out at a suitable temperature (e.g., about 20°C to about 80°C, e.g., about 50°C) for a suitable period of time (e.g., about 8 hours to about 15 hours, e.g., about 12 hours).
[0088]
[0142] In step 3, the phthalate compound obtained in step 2 is reacted with 3-aminopiperidine-2,6-dione or a suitable salt thereof (e.g., HCl salt) in the presence of a suitable solvent and reagent such as acetic acid and sodium acetate to obtain the compound represented by formula I. This reaction can be carried out at a suitable temperature (e.g., 80°C to 120°C, e.g., 100°C) over a specific period of time (e.g., about 8 hours to about 15 hours, e.g., about 12 hours).
[0089]
[0143] Medical use, pharmaceutical composition, and method of administration
[0090]
[0144] In another aspect of the present invention, a pharmaceutical composition for treating disorders of uncontrolled cell proliferation is provided, comprising a compound represented by formula I, its stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts. The compound represented by formula I, its stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts are as described above.
[0091]
[0145] As used in this book, the terms “to treat” or “to treat” mean to suppress a disease, for example, to suppress a disease, condition or disorder in an object experiencing or exhibiting the symptoms or signs of a disease, condition or disorder, i.e., to prevent further progression of the symptoms and / or signs; or to improve a disease, for example, to improve a disease, condition or disorder in an object experiencing or exhibiting the symptoms or signs of a disease, condition or disorder, i.e., to improve the symptoms and / or signs, for example, to reduce the severity of the disease.
[0092]
[0146] In one embodiment, a disorder of uncontrolled cell proliferation is cancer.
[0093]
[0147] In one embodiment, the cancer may be a childhood cancer such as childhood acute leukemia or childhood medulloblastoma. In one embodiment, the cancer may be selected from brain cancer, lung cancer, blood cancer, bladder cancer, colon cancer, cervical cancer, endometrial cancer, ovarian cancer, squamous cell carcinoma, kidney cancer, peritoneal cancer, breast cancer, stomach cancer, colorectal cancer, prostate cancer, pancreatic cancer, genitourinary cancer, lymphatic cancer, laryngeal cancer, skin cancer, malignant melanoma, colorectal cancer, endometrial cancer, thyroid cancer, rhabdomyosarcoma, liver cancer, and combinations thereof. For example, the cancer may be lung cancer, prostate cancer, breast cancer, ovarian cancer, endometrial cancer, bladder cancer, or skin cancer.
[0094]
[0148] Lung cancer may be small cell lung cancer, non-small cell lung cancer, or neuroendocrine pulmonary cancer. Prostate cancer may be androgen receptor-positive prostate cancer (AR-positive prostate cancer; ARPC), castration-resistant prostate cancer (CRPC), double-negative prostate cancer (DNPC) (neither androgen receptors nor neuroendocrine markers are expressed), or neuroendocrine prostate cancer (NEPC). Brain cancer may be glioblastoma, medulloblastoma, glioma, or a combination thereof. Kidney cancer may be clear cell carcinoma of the kidney. Bladder cancer may be urothelial carcinoma of the bladder. Hematological cancers may be selected from chronic myeloid leukemia (CML), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), hairy cell leukemia, chronic myelomonocytic leukemia (CMML), juvenile myelomonocytic leukemia (JMML), large granular lymphocytic leukemia (LGL), acute lymphoblastic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T-cell lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, hairy cell lymphoma, Burkitt lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, and combinations thereof.
[0095]
[0149] In one embodiment, impaired uncontrolled cell proliferation may be associated with cereblon (CRBN) dysfunction.
[0096]
[0150] In this book, "Cereblon" and "CRBN" may be used synonymously and refer to the protein encoded by the human CRBN gene, located at 3p26.2 cytogenetically and between base pairs 3,148,489 and 3,179,716 on chromosome 3 (UCSC Genome Browser for Humans, December 2013 (GRCh38 / hg38) assembly). CRBN is the substrate recognition element of the DCX(DDB1-CUL4-X-box)E3 protein ligase complex, which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. The DCX(DDB1-CUL4-X-box)E3 protein ligase complex consists of at least CRBN, CUL4A, DDB1, and RBX1. The CRBN protein has two isoforms produced by alternative splicing. Isoform 1 has 442 amino acids and a molecular weight of 50,546 Da, while isoform 2 has 441 amino acids and a molecular weight of 50,475 Da.
[0097]
[0151] Disorders of uncontrolled cell proliferation may be associated with GSPT1 dysfunction. These disorders may be related to GSPT1 or caused by GSPT1. For example, a disorder of uncontrolled cell proliferation may be a GSPT1-related cancer.
[0098]
[0152] In this book, GSPT1 (G1 to S phase transition 1), also known as eRF3, is a translation termination factor that binds to eRF1 and mediates the recognition of stop codons and the release of newly synthesized proteins from ribosomes. GSPT1 plays a crucial role in maintaining high-fidelity protein synthesis (Cell. 2011 Oct 14; 147(2):396~408). Ubiquitination and degradation of GSPT1 are known to induce suppression of the expression levels of oncogenic proteins (translationally addicted oncoproteins, e.g., c-MYC, N-MYC, L-MYC, BCL-2, MCL-1, etc.) that are maintained at high expression levels in cancer cells in a translation-dependent manner (Mullard, Nat Rev Drug Discov. 2022, 21:865~867). In addition, GSPT1 degradation is known to activate a cell death mechanism called the "integrative stress response" (Surka et al., Blood 2021, 137(5):661~677). This response is mediated by ATF-4 and is known to ultimately lead to caspase-3 dependent cell death.
[0099]
[0153] The compound represented by Formula I according to the present invention may be useful in treating MYC-induced cancers, such as cancers induced by oncogenic proteins such as c-MYC, n-MYC, and l-MYC, whose expression levels are maintained at high levels in a protein translation-dependent manner. MYC-induced cancers include, but are not limited to, prostate cancer, breast cancer, liver cancer, and colorectal cancer. In one embodiment, the compound represented by Formula I according to the present invention may be useful in treating cancers exhibiting high n-Myc expression levels.
[0100]
[0154] In addition, the compound represented by Formula I according to the present invention may be useful in treating cancers sensitive to the integrated stress response, such as hematological cancers. Hematological cancers include, but are not limited to, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), and acute lymphocytic leukemia (ALL). For example, acute myeloid leukemia is a type of hematological cancer.
[0101]
[0155] The compound represented by Formula I according to the present invention is a molecular glue having a structure based on pomalidomide, one of the immunomodulatory imide drugs, which can bind to the CRBN protein and induce selective GSPT1 degradation. Compounds represented by Formula I, having specific combinations of substituents, may exhibit superior selectivity for GSPT1 in particular compared to various neosubstrates such as IKAROS, AIOLOS, and CK1α. The compound represented by Formula I according to the present invention has superior selectivity and degradation activity for GSPT1 compared to the compound disclosed in the prior art international publication No. 2022 / 066835. In particular, the compound disclosed in the aforementioned prior art exhibits only transient degradation activity for GSPT1, subsequently restoring GSPT1 expression levels and showing tumor cell regrowth, whereas the compound represented by Formula I according to the present invention exhibits sustained and stable GSPT1 degradation activity and excellent tumor cell proliferation inhibitory activity.
[0102]
[0156] Furthermore, the compound represented by Formula I according to the present invention has excellent inhibitory activity against tumor cell proliferation and significantly reduced cytotoxicity to normal cells, and therefore has a much larger therapeutic index than the compounds disclosed in the prior art.
[0103]
[0157] In one embodiment, the cancer is a cancer exhibiting a neuroendocrine phenotype. The inventors have found that the compound represented by formula I exhibits particularly excellent anticancer activity against cancers exhibiting a neuroendocrine phenotype, such as lung cancer or prostate cancer.
[0104]
[0158] Cancers exhibiting a neuroendocrine phenotype have been reported to share common morphological and marker-based histological features, such as a high nucleus-to-cytoplasmic ratio, high frequency of mitotic characteristics, and granular chromatin (Am.Soc.Clin.Oncol.Educ.Book.2015;35:92~103). In addition, cancers exhibiting a neuroendocrine phenotype have been reported to essentially possess loss-and / or inactivating mutations in TP53 and RB1 at the molecular level, and to express common neuroendocrine markers such as chromogranin A (CHGA) and synaptophysin (SYP) (Nat.Med.2016;22:298~305, Lancet Oncol.2015;16:e435~e446).
[0105]
[0159] In one embodiment, cancers exhibiting a neuroendocrine phenotype include, but are not limited to, neuroendocrine prostate cancer (NEPC), castration-resistant prostate cancer, and pulmonary neuroendocrine tumors.
[0106]
[0160] In one embodiment, the pharmaceutical composition may include conventional pharmaceutically acceptable carriers, excipients, or additives. These pharmaceutically acceptable carriers, excipients, or additives may include, but are not limited to, one or more pharmaceutically acceptable diluents, preservatives, antioxidants, solubilizers, emulsifiers, colorants, release agents, coating agents, sweeteners, flavoring agents, and fragrances, as well as adjuvants. The pharmaceutical compositions of this disclosure can be conveniently prepared as unit dosage forms and can be prepared by methods well known in the fields of pharmacy and pharmaceutical science.
[0107]
[0161] Pharmaceutical compositions can be prepared according to conventional methods and may be prepared as various oral formulations such as tablets, pills, powders, capsules, syrups, emulsions, and microemulsions, or as parenteral formulations such as intramuscular, intravenous, or subcutaneous formulations, or as formulations for topical application to the skin. A pharmaceutical composition may be a single composition or separate compositions. A pharmaceutical composition may contain, as an active ingredient of one embodiment, a compound, stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt.
[0108]
[0162] For ease of administration and uniformity of dosage, it may be particularly advantageous to formulate the aforementioned pharmaceutical compositions into unit dosage forms. As used herein, the term “unit dosage form” refers to physically separate units suitable as a unit administration form, each unit containing a predetermined amount of active ingredient calculated to produce the desired therapeutic effect in relation to the required pharmaceutical carrier. Typical examples of unit dosage forms include tablets (including divided or coated tablets), capsules, or pills for oral administration, single-dose vials for solutions or suspensions for injection, suppositories for rectal administration, powder packets, cachets, and separate batches thereof.
[0109]
[0163] When the pharmaceutical composition is prepared in the form of an oral formulation, examples of additives or carriers used may include cellulose, calcium silicate, corn starch, lactose, sucrose, dextrose, calcium phosphate, stearic acid, magnesium stearate, calcium stearate, gelatin, talc, surfactants, suspending agents, emulsifiers, diluents, and the like. When the pharmaceutical composition of the present invention is prepared in the form of an injectable formulation, the additives or carriers may include water, saline solution, aqueous glucose solution, similar aqueous sugar solution, alcohol, glycol, ether (e.g., polyethylene glycol 400), oil, fatty acid, fatty acid ester, glyceride, surfactant, suspending agent, emulsifier, and the like.
[0110]
[0164] In one embodiment, the pharmaceutical composition of the present invention can be prepared in liquid dosage form, which may contain preservatives, stabilizers, buffers, flavor enhancers, sweeteners, colorants, antioxidants, and complex-forming agents. For example, the complex-forming agent may include chelating agents such as ethylenediaminetetraacetic acid, nitrilotriacetic acid, diethylenetriaminepentaacetic acid, and their salts. Optionally, it may be necessary to stabilize the liquid dosage form with a physiologically acceptable base or buffer to a pH range of approximately 9 or less. Ideally, a dosage form stable at a neutral or slightly basic pH (pH 8 or less) should be prepared. In this regard, compounds of the present invention that have excellent stability at neutral pH may also be advantageous from the viewpoint of formulation stability. If necessary, it may be advantageous to use α-cyclodextrin, β-cyclodextrin, or γ-cyclodextrin, or derivatives thereof, particularly hydroxyalkyl-substituted cyclodextrins, such as 2-hydroxypropyl-β-cyclodextrin or sulfobutyl-β-cyclodextrin, to enhance the solubility and / or stability of the compounds of this disclosure in liquid dosage forms, parenteral injection forms, or intravenous injection forms. In addition, cosolvents such as alcohols can improve the solubility and / or stability of the compounds of this disclosure in pharmaceutical compositions.
[0111]
[0165] The dosage of the pharmaceutical composition is an effective amount for the treatment of the subject or patient and may be administered orally or parenterally as desired. When administered orally, the pharmaceutical composition may be administered in amounts of 0.01 to 1000 mg per kg of body weight per day, more specifically 0.1 to 300 mg, based on the active ingredient, in one dose or in several divided doses. When administered parenterally, the dosage may be administered in amounts of 0.01 to 100 mg per kg of body weight per day, more specifically 0.1 to 50 mg, based on the active ingredient, in one dose or in several divided doses. The dosage administered to a specific subject or patient should be determined considering several relevant factors, including the patient's weight, age, sex, and health status, diet, administration time, method of administration, and disease severity, and should be appropriately increased or decreased by a professional. The above dosages are not intended to limit the scope of the present invention. A physician or veterinarian with ordinary skill in the art can easily determine and prescribe the necessary effective amount of the pharmaceutical composition. For example, a physician or veterinarian may start the dose of the compound of the present invention used in a pharmaceutical composition at a level lower than necessary to achieve the desired therapeutic effect, and gradually increase it until the desired effect is achieved.
[0112]
[0166] In one embodiment, the scope of pharmaceutical compositions includes pharmaceutical compositions comprising, as an active ingredient, at least one of the compounds of the present disclosure in a therapeutically effective amount, either alone or in combination with a pharmaceutically acceptable carrier. The terms “therapeutably effective amount” or “effective amount” mean an amount sufficient to produce a beneficial or desired clinical outcome, for example, an amount sufficient to alleviate, improve, stabilize, reverse, slow the progression of a disease, or delay the progression of a disease.
[0113]
[0167] Depending on the method of administration, the pharmaceutical composition comprises 0.05 to 99% by weight, preferably 0.1 to 70% by weight, more preferably 0.1 to 50% by weight of an active ingredient and 1 to 99.95% by weight, preferably 30 to 99.9% by weight, more preferably 50 to 99.9% by weight of a pharmaceutically acceptable carrier (all percentages are based on the total weight of the composition).
[0114]
[0168] In one embodiment, the pharmaceutical composition may further comprise at least one agent known to treat cancer.
[0115]
[0169] At least one of the following drugs is contraindicated: uracil mustard, chlormetine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, pipobromane, triethylenemelamine, triethylenethiophosphoramine, busulfan, carmustine, lomustine, streptozocin, dacarbazine, temozolomide, thiotepa, altretamine, methotrexate, 5-fluorouracil, floxuridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fludaramine phosphate. Rabin, pentostatin, bortezomib, vinblastine, vincristine, vinorelbine, vindesine, bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin, dexamethasone, clofarabine, cladribine, pemetrexed, idarubicin, paclitaxel, docetaxel, ixabepyrone, mitramycin, topotecan, irinotecan, deoxycoformycin, mitomycin-C, L-asparaginase, interferon, Etoposide, Teniposide 17α-Ethinylestradiol, Diethylstilbestrol, Testosterone, Prednisone, Fluoxymesterone, Drostanolone Propionate, Testolactone, Megestrol Acetate, Tamoxifen, Methylprednisolone, Methyltestosterone, Prednisolone, Triamcinolone, Chlorotrianicene, Hydroxyprogesterone, Aminoglutethimide, Estramustine, Medroxyprogesterone Acetate, Leuprolide, F Lutamide, toremifene, goserelin, cisplatin, carboplatin, hydroxyurea, amsacrine, procarbazine, mitotane, mitoxantrone, levamizole, navelbine, anastrozole, letrozole, capecitabine, raloxifene, doroxifene, hexamethylmelamine, oxaliplatin, gefitinib, capecitabine, erlotinib, azacitidine, temozolomide, gemcitabine, vasostatin, and combinations thereof may be selected.
[0116]
[0170] In addition, at least one agent may be selected from DNA methyltransferase inhibitors, HDAC inhibitors, glucocorticoids, mTOR inhibitors, cytotoxic agents, or a combination thereof.
[0117]
[0171] DNA methyltransferase inhibitors may be 5-aza-2'-deoxycytidine, 5-azacitidine, zebralin, epigallocatechin-3-gallate, procaine, or a combination thereof.
[0118]
[0172] HDAC inhibitors may include vorinostat, entinostat, panobinostat, trichostatin A, mosetinostat, belinostat, dasinostat, gibinostat, tubastatin A, prasinostat, droxinostat, xinostat, romidepsin, valproic acid, AR-42 (OSU-HDAC42), tasedinarin, licorinostat, apicidine, or combinations thereof.
[0119]
[0173] Glucocorticoids may be dexamethasone, prednisolone, methylprednisolone, betamethasone, triamcinolone, fludrocortisone, beclomethasone, or combinations thereof.
[0120]
[0174] mTor inhibitors may be BEZ235, everolimus, sirolimus, temsirolimus, rapamycin, AZD8055, or a combination thereof.
[0175] Cytotoxic agents may be selected from alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, or chemotherapeutic agents selected from anthracyclines, cytarabine, purine analogs, sorafenib, gemtuzumab ozogamicin, rituximab, or combinations thereof.
[0121]
[0176] The alkylating agent may be selected from carboplatin, cisplatin, cyclophosphamide, chlorambucil, melphalan, carmustine, busulfan, lomustine, dacarbazine, oxaliplatin, ifosfamide, mechloretamine, temozolomide, thiotepa, bendamustine, and streptozocin.
[0122]
[0177] Antimetabolites may be selected from gemcitabine, 5-fluorouracil, capecitabine, hydroxyurea, mercaptopurine, pemetrexed, fludarabine, nelarabine, cladribine, clopharabine, cytarabine, decitabine, pralatrexate, phloxuridine, methotrexate, and thioguanine.
[0123]
[0178] Antitumor antibiotics may be selected from doxorubicin, mitoxantrone, bleomycin, daunorubicin, dactinomycin, epirubicin, idarubicin, plicamycin, mitomycin, pentostatin, and barrubicin.
[0124]
[0179] Mitotic inhibitors may be selected from irinotecan, topotecan, rubitecan, cabazitaxel, docetaxel, paclitaxel, etoposide, vincristine, ixabepirone, vinorelbine, vinblastine, and teniposide.
[0125]
[0180] At least one of the drugs may be a BCL2 inhibitor, an FLT3 inhibitor, an IDH1 / 2 inhibitor, a CDK (cyclin-dependent kinase) inhibitor, a transcription inhibitor, an HSP inhibitor, or a combination thereof.
[0126]
[0181] BCL2 (B-cell lymphoma 2) inhibitors may include venetoclax, navitoclax, ovatoclax mesylate, subtoclax, and risaftoclax.
[0127]
[0182] FLT3 (FMS-like tyrosine kinase 3) inhibitors may include midostaurin, quizartinib, gilteritinib, sorafenib, klenolanib, and pexidartinib.
[0128]
[0183] IDH (isocitrate dehydrogenase) 1 / 2 inhibitors may include ivosidenib, enasidenib, borasidenib, ortasidenib, AGI-6780, AGI-5198, GSK321, and others.
[0129]
[0184] CDK inhibitors may include CDK7 inhibitors, CDK9 inhibitors, CDK12 inhibitors, etc., such as samraciclib, arbocidicib, fadracilib, sericiclib, zoctiliclib, atubeciclib, enitocilib, boriclib, SY5609, XL201, Q-901, KRLS-017, GTAEXS-617, TGN-1062, THZ1, THZ2, SY-1365, YKL-5-124, ICEC09. This may include 42, LY3405105, LDC4297, BS-181, SNS-32, AT-7519, AZD-4573, KB-0742, AU-07, BTXA-51, GFH-009, JS-101, PRT-2527, QHRD-107, TP-1287, SYHX-1903, CTX-439, KIN-004, SY-12882, THZ-531, CT-7439, AU-003, AU-004, etc.
[0130]
[0185] Transcription inhibitors include any drug capable of inhibiting the transcription of oncogenic proteins. The compounds of the present invention may exhibit anticancer effects by inhibiting the RNA-to-protein translation process based on GSPT1 degradation activity. Therefore, when used in combination with transcription inhibitors that inhibit the DNA-to-RNA transcription process, enhanced anticancer effects may be observed. Such transcription inhibitors may include, for example, lurubinectedin, which is known to inhibit transcription by covalently binding to residues located in the minor groove of DNA.
[0131]
[0186] HSP (heat shock protein) inhibitors include HSP70 inhibitors, HSP90 inhibitors, etc., and may include, for example, pimitespiv, luminespiv, tanespimycin, albespimycin, ganetespiv, onarespiv, geldanamycin, locaglamide, etc.
[0132]
[0187] In one embodiment, at least one drug can be packaged together with a compound represented by formula I according to the present invention, its stereoisomer, its hydrate, its solvate, or a pharmaceutically acceptable salt thereof, to form a combination, and / or transport together.
[0133]
[0188] In one embodiment, at least one drug may be supplied in the form of a kit comprising a compound represented by Formula I according to the present invention, its stereoisomer, its hydrate, its solvate, or a pharmaceutically acceptable salt thereof. By using the kit, two or more components, which may be an active ingredient or non-active ingredient, a carrier, a diluent, etc., may be provided together with instructions for the preparation of an actual dosage form by the patient or the person administering the drug to the patient.
[0134]
[0189] In another embodiment, a method is provided for adjusting cereblon activity or GSPT1 activity in at least one cell, comprising the step of contacting at least one cell in vitro with a compound represented by formula I, its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt thereof. Of the terms or elements referred to in the description of this method, those terms or elements that are the same as those described above are as stated above.
[0135]
[0190] As used in this book, the term “bring to contact” means bringing a compound or pharmaceutical composition of the Disclosure close to a cell, target protein, or other biological entity so as to enable the compound or pharmaceutical composition of the Disclosure to directly affect the activity of the cell, target protein, or other biological entity, that is, to enable the compound or pharmaceutical composition of the Disclosure to bring close to a cell, target protein, or other biological entity.
[0136]
[0191] The compound represented by Formula I according to the present invention, or a pharmaceutical composition containing the same, has activity as a regulator of cereblon protein. In addition, the compound represented by Formula I according to the present invention, or a pharmaceutical composition containing the same, has activity as a regulator of GSPT1 expression and / or activity. In addition, the compound represented by Formula I according to the present invention, or a pharmaceutical composition containing the same, has activity as a cell proliferation inhibitor. Therefore, new compounds can be evaluated using the compound represented by Formula I according to the present invention. For example, a test compound can be evaluated by comparing analytical values obtained by performing biological analysis using a test compound and the compound of the present invention. Biological analysis includes, but is not limited to, cereblon binding analysis, GSPT1 degradation activity analysis, or cell proliferation tests.
[0137]
[0192] In another embodiment, a method is provided for treating a disorder of uncontrolled cell proliferation, comprising the step of administering a compound represented by formula I, its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt to a target.
[0138]
[0193] The terms or elements used in this description that are the same as those described above are as stated above. As used in this text, the term “subject” refers to a subject requiring treatment for a disease, and more specifically, mammals such as humans or non-human primates, mice, dogs, cats, horses, and cattle.
[0139]
[0194] In another embodiment, the medical use of the compound represented by formula I, its stereoisomers, hydrates, or solvates for the treatment of uncontrolled cell proliferation disorders such as cancer, or the use of the compound represented by formula I, its stereoisomers, hydrates, or solvates for the manufacture of agents for the treatment of uncontrolled cell proliferation disorders such as cancer. The terms or elements referred to in the description of use are as described above.
[0140]
[0195] Hereafter, the present invention will be described in detail by analogy. However, the following examples are merely illustrative and the scope of the present invention is not limited to them.
[0141]
[0196] [Example of preparation]
[0142]
[0197] Preparation Example 1: (3-bromo-2-chlorobenzyl)oxy)(tert-butyl)diphenylsilane (intermediate A1)
[0198] Step 1: (3-Bromo-2-chlorophenyl)methanol
[0199] [ka]
[0143]
[0200] At 0°C under an N2 atmosphere, 3-bromo-2-chlorobenzoic acid (5 g, 21.23 mmol) was dissolved in THF (50 mL), to which BH3·THF (1 M, 42.47 mL) was slowly added dropwise. The mixture was stirred at 25°C under an N2 atmosphere for 12 hours. The mixture was neutralized by slowly adding water (20 mL) and K2CO3 under 0°C under an N2 atmosphere. It was then extracted with RINKAN (50 mL x 3). The organic layer was washed with brine (100 mL x 3), dried over anhydrous Na2SO4, filtered, and then concentrated under reduced pressure to obtain (3-bromo-2-chlorophenyl)methanol (4.4 g, yield 94%) as a yellow solid. 1 H NMR (400 MHz, CDCl3) δ ppm 4.80 (2H, s), 7.16 (1H, t, J = 8.0 Hz), 7.47 (1H, dd, J = 7.6,0.8 Hz), 7.57 (1H, dd, J = 8.0, 1.2 Hz).
[0144]
[0201] Step 2: (3-bromo-2-chlorobenzyl)oxy)(tert-butyl)diphenylsilane
[0202] [ka]
[0145]
[0203] (3-bromo-2-chlorophenyl)methanol (4.4 g, 19.87 mmol) and imidazole (1.62 g, 23.84 mmol) were dissolved in DCM (20 mL), and tert-butyl-chloro-diphenylsilane (TBDPCl, 6.55 g, 23.84 mmol) was added at 0°C. The mixture was stirred at 25°C for 12 hours. The mixture was concentrated under reduced pressure, diluted with water (300 mL), and then extracted with ELISA (200 mL x 3). The organic layer was washed with brine (400 mL), dried over anhydrous Na2SO4, filtered, and then concentrated under reduced pressure to obtain the residue. The residue was purified by silica column chromatography (PE:ELISA = 100:0 to 100:1) to obtain intermediate A1 (8.8 g, yield 96%) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 1.13 (9H, s), 4.83 (2H, s), 7.22 (1H, t, J = 8.0 Hz), 7.37-7.46(6H, m), 7.52-7.58 (1H, m), 7.69 (4H, dd, J = 8.0, 1.6 Hz), 7.74 (1H, dd, J =7.6, 1.2 Hz).
[0146]
[0204] Preparation Example 2: 1-Bromo-2-(difluoromethoxy)-4-fluoro-3-methylbenzene (Intermediate A2)
[0205] [ka]
[0147]
[0206] A solution of KOH (5.47 g, 97.55 mmol) in water (20 mL) and ACN (20 mL) was added with 6-bromo-3-fluoro-2-methyl-phenol (1 g, 4.88 mmol) at 25 °C. Then, 1-[[bromo(difluoro)methyl]-ethoxy-phosphoryl]oxyethane (2.60 g, 9.75 mmol) was added at -78 °C. The mixture was stirred at -78 °C for 0.3 h and then at 25 °C for 1.7 h. The mixture was diluted with DCM (50 mL) and water (50 mL). Then, it was extracted with DCM (50 mL × 3). The organic layer was washed with brine (100 mL × 3), dried over anhydrous Na2SO4, filtered, and then concentrated under reduced pressure to obtain Intermediate A2 (1.2 g, yield 96%) as a yellow oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.30 (3H, d, J = 2.0 Hz), 6.22-6.76 (1H, m), 6.91 (1H, t, J =8.8 Hz), 7.43 (1H, dd, J = 8.8, 5.6 Hz).
[0148]
[0207] Preparation Example 3: 1-Bromo-2-(difluoromethoxy)-3-methylbenzene (Intermediate A3)
[0208]
Chemical formula
[0149]
[0209] A solution of KOH (24 g, 427.73 mmol) in water (15 mL) and ACN (15 mL) was added with 2-bromo-6-methylphenol (4 g, 21.39 mmol) at 25 °C. Then, 1-[[bromo(difluoro)methyl]-ethoxy-phosphoryl]oxyethane (11.42 g, 42.77 mmol) was added at -78 °C. The mixture was stirred at -78 °C for 0.3 h and then at 25 °C for 1.7 h. The mixture was diluted with water (100 mL). Then, it was extracted with DCM (50 mL × 3). The organic layer was washed with brine (50 mL), dried over anhydrous Na2SO4, filtered, and then concentrated under reduced pressure to obtain Intermediate A3 (4 g, yield 79%) as a yellow oil.1 1H NMR (400 MHz, CDCl3) δ ppm 2.38 (3H, s), 6.31 - 6.75 (1H, m), 7.00 - 7.08 (1H, m), 7.20 (1H, d, J = 7.6 Hz), 7.45 (1H, d, J = 8.0 Hz).
[0150]
[0210] Preparation Example 4: 1 - Bromo - 2 - (difluoromethoxy) - 3 - ethylbenzene (Intermediate A4)
[0211]
Chem.
[0151]
[0212] A solution of KOH (the 11.16 g, 198.95 mmol) in water (8 mL) and ACN (8 mL) was added with 2 - bromo - 6 - ethylphenol (2 g, 9.95 mmol) at 25 °C. Then, 1 - [bromo(difluoro)methyl] - ethoxy - phosphoryl]oxyethane (5.31 g, 19.90 mmol) was added at -78 °C. The mixture was stirred at -78 °C for 0.3 h and then at 25 °C for 0.5 h. The mixture was diluted with water (20 mL). Then, it was extracted with DCM (20 mL × 3). The organic layer was washed with brine (30 mL × 3), dried over anhydrous Na2SO4, filtered, and then concentrated under reduced pressure to obtain Intermediate A4 (1.6 g, yield 64%) as a yellow oil. 1 1H NMR (400 MHz, CDCl3) δ ppm 1.24 - 1.26 (3H, m), 2.75 - 2.82 (2H, m), 6.31 - 6.75 (1H, m), 7.03 - 7.12 (1H, m), 7.22 - 7.28 (1H, m), 7.43 - 7.48 (1H, m).
[0152]
[0213] Preparation Example 5: 1 - Bromo - 2 - chloro - 3 - ethyl - benzene (Intermediate A5)
[0214] Step 1: 1-Bromo-2-chloro-3-vinylbenzene
[0215]
Chem.
[0153]
[0216] A mixture of 1-bromo-2-chloro-3-iodobenzene (450 mg, 1.42 mmol), 4,4,5,5-tetramethyl-2-vinyl-1,3,2-dioxaborolane (225 mg, 1.46 mmol), Cs2CO3 (1.16 g, 3.54 mmol), and Pd(dppf)Cl2 (104 mg, 142.04 μmol) was mixed with water (1 mL) and dioxane (10 mL). The mixture was degassed, purged three times with N2, and then stirred under an N2 atmosphere at 70°C for 4 hours. The mixture was diluted with water (30 mL) and extracted with SiO2 (15 mL x 3). The organic layer was washed with brine (50 mL), dried over anhydrous Na2SO4, filtered, and then concentrated under reduced pressure to obtain the residue. The residue was purified by silica column chromatography (PE:siRNA = 100:0 to 99:1) to obtain 1-bromo-2-chloro-3-vinylbenzene (0.2 g, yield 65%) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 5.42 (1H, d, J = 11.2 Hz), 5.72 (1H, d, J = 17.2 Hz), 7.07-7.19(2H, m), 7.49-7.58 (2H, m).
[0154]
[0217] Step 2: 1-Bromo-2-chloro-3-ethylbenzene
[0218] [ka]
[0219] To a solution of 1-bromo-2-chloro-3-vinylbenzene (0.2 g, 919.58 μmol) dissolved in dimethyl sulfate (5 mL), Pt / C (773 mg, 183.95 μmol, 5% purity) and ZnBr2 (42 mg, 186.50 μmol) were added under an N2 atmosphere. The mixture was degassed, purged three times with H2 (15 psi), and then stirred under an H2 (15 psi) atmosphere at 25°C for 12 hours. The mixture was filtered and filtered under reduced pressure to obtain intermediate A5 (220 mg, crude product) as a yellow oily substance. 1 H NMR (400 MHz, CDCl3) δ ppm 1.24 (3H, t, J = 7.6 Hz), 2.76-2.87 (2H, m) 7.01-7.10 (1H, m),7.18 (1H, dd, J = 7.6, 1.2 Hz), 7.48 (1H, dd, J = 8.0, 1.6 Hz).
[0155]
[0220] Preparation Example 6: 1-Bromo-2-chloro-3-ethyl-4-fluorobenzene (Intermediate A6)
[0221] Step 1: 1-Bromo-2-chloro-4-fluoro-3-vinylbenzene
[0222] [ka]
[0156]
[0223] A solution of methyl(triphenyl)phosphonium bromide (3 g, 8.40 mmol) in DCM (20 mL) was added with DBU (1.42 g, 9.36 mmol). The reaction mixture was stirred at 50 °C for 30 minutes. Then, a solution of 3-bromo-2-chloro-6-fluoro-benzaldehyde (1 g, 4.21 mmol) in DCM (10 mL) was added to the reaction mixture. The mixture was stirred at 50 °C for 3 hours. The mixture was diluted with DCM (50 mL) and washed with HCl solution (0.1 M, 50 mL × 2). The organic layer was dried over anhydrous Na2SO4 and concentrated under reduced pressure to obtain a yellow residue. The residue was purified by silica column chromatography (PE:EtOAc = 99:1) to obtain 1-bromo-2-chloro-4-fluoro-3-vinyl-benzene (160 mg, yield 16%) as a white liquid. 1 H NMR (400 MHz, CDCl3) δ ppm 5.69 (1H, d, J = 12.0 Hz), 5.94 (1H, d, J = 18.0 Hz), 6.79 (1H,dd, J = 18.0, 12.0 Hz), 6.93 (1H, t, J = 9.6 Hz), 7.49 (1H, dd, J = 8.8, 5.2Hz).
[0157]
[0224] Step 2: 1-Bromo-2-chloro-3-ethyl-4-fluorobenzene
[0225]
Chemical formula
[0226] To a solution of 1-bromo-2-chloro-4-fluoro-3-vinylbenzene (510 mg, 2.17 mmol) in EtOAc (5 mL), ZnBr2 (102 mg, 453 μmol) and Pt / C (2.04 g, 971 μmol, purity 10%) were added under N2 atmosphere. The mixture was degassed, purged with H2 (15 psi) three times, and then stirred under H2 (15 psi) atmosphere at 25 °C for twelve hours. The mixture was filtered and concentrated under reduced pressure to obtain Intermediate A6 (500 mg, crude product) as a white oil. 1H NMR (400 MHz, CDCl3) δ ppm 1.19 (3H, t, J = 7.6 Hz), 2.87 (2H, d, J = 7.6, 2.4 Hz), 6.88(1H, t, J = 8.8 Hz), 7.45 (1H, dd, J = 8.8, 5.6 Hz).
[0158]
[0227] Preparation Example 7: 1-Bromo-4-fluoro-3-methyl-2-(trifluoromethoxy)benzene (Intermediate A7)
[0228] Step 1: 1-Bromo-2-[bromo(difluoro)methoxy]-4-fluoro-3-methylbenzene
[0229] [ka]
[0230] 6-bromo-3-fluoro-2-methylphenol (1 g, 4.88 mmol) was dissolved in DMF (10 mL) and NaH (595 mg, 14.88 mmol, 60% purity) was added under N2 atmosphere at 0°C. The mixture was stirred at 0°C for 10 minutes. Then, t-BuOK (606 mg, 5.40 mmol) and dibromo(difluoro)methane (18.96 mmol, 1.75 mL) were added. The reaction mixture was stirred under N2 atmosphere at 70°C for 12 hours and 50 minutes. The mixture was slowly poured into water (30 mL) and extracted with DCM (15 mL x 3). The organic layer was washed with brine (30 mL x 3), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica column chromatography (PE:SiO = 1:0 to 100:1) to obtain 1-bromo-2-[bromo(difluoro)methoxy]-4-fluoro-3-methylbenzene (690 mg, crude product) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.30 (3H, s), 6.95 (1H, t, J = 8.8 Hz), 7.46 (1H, dd, J = 8.8,5.6 Hz).
[0159]
[0231] Step 2: 1-Bromo-4-fluoro-3-methyl-2-(trifluoromethoxy)benzene
[0232] [ka]
[0233] 1-Bromo-2-[bromo(difluoro)methoxy]-4-fluoro-3-methylbenzene (690 mg, 2.07 mmol) was dissolved in DCM (8 mL), and AgBF4 (402 mg, 2.07 mmol) was added at -78 °C. The mixture was stirred at 25 °C for 12 hours. The mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica column chromatography (PE:siRNA = 1:0) to obtain intermediate A7 (300 mg, yield 53%) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.30 (3H, d, J = 1.6 Hz), 6.95 (1H, t, J = 8.8 Hz), 7.46 (1H,dd, J = 8.82, 6.0 Hz).
[0160]
[0234] Preparation Example 8: 1-iodo-3-methyl-2-(trifluoromethoxy)benzene (intermediate A8)
[0235] [ka]
[0236] To a solution of 1-methyl-2-(trifluoromethoxy)benzene (2.0 g, 11.35 mmol) and N,N,N',N'-tetramethylethylene-1,2-diamine (1.32 g, 11.36 mmol, 1.71 mL) dissolved in THF (10 mL), tert-butyllithium (1.3 M, 14.00 mL) was added at -78 °C under an N2 atmosphere, and the mixture was stirred for 30 minutes. I2 (3.44 g, 13.55 mmol, 2.73 mL) was added to the mixture, and the mixture was stirred at -78 °C for 2 hours. The mixture was quenched with saturated NH4Cl (30 mL) and extracted with DCM (3 × 20 mL). The organic layer was washed with brine (2 × 20 mL) and concentrated to obtain a yellow residue. The residue was purified by silica column chromatography (PE: Depositphotos = 100:0) and then purified twice by preparative HPLC (PE: Depositphotos = 1:0). However, since the two compounds could not be separated, they were further purified using preparative HPLC (column: Waters Xbridge C18 150×50mm×10mm, mobile phase: [water (NH4HCO3)-ACN], gradient: 64%→94%B over 10 minutes). The resulting compounds were extracted with PE (3×30mL), dried over anhydrous Na2SO4, and then concentrated under reduced pressure to obtain intermediate A8 (0.2g, 662.18μmol, yield 6%) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.30 (3H, s), 6.84 (1H, t, J=7.6 Hz), 7.14 (1H, d, J=7.6 Hz),7.63 (1H, d, J=7.6 Hz).
[0161]
[0237] Preparation Example 9: 2-bromo-3-ethyl-aniline (intermediate B1)
[0238] Step 1: 2-Bromo-1-nitro-3-vinylbenzene
[0239] [ka]
[0240] A solution of methyl(triphenyl)phosphonium bromide (5.3 g, 14.84 mmol) in DCM (50 mL) was added to a solution containing DBU (2.5 g, 16.42 mmol, 2.48 mL). The reaction mixture was stirred at 50°C for 30 minutes. Then, a solution of 2-bromo-3-nitro-benzaldehyde (1.7 g, 7.39 mmol) in DCM (30 mL) was added to the reaction mixture. The mixture was stirred at 50°C for 3 hours. The mixture was diluted with DCM (100 mL) and washed with HCl solution (0.1 M, 50 mL x 2). The organic layer was dried over anhydrous Na2SO4 and concentrated under reduced pressure to obtain a yellow residue. The residue was purified by silica column chromatography (PE:siRNA = 50:1 to 20:1) to obtain 2-bromo-1-nitro-3-vinylbenzene (0.8 g, 3.51 mmol, yield 47%) as a yellow solid. 1 H NMR (400 MHz, CDCl3) δ ppm 5.39-5.51 (1H, m), 5.65-5.76 (1H, m), 6.97-7.08 (1H, m),7.32-7.38 (1H, m), 7.47-7.54 (1H, m), 7.62-7.67 (1H, m).
[0162]
[0241] Step 2: 2-Bromo-3-ethyl-aniline
[0242] [ka]
[0243] To a solution of 2-bromo-1-nitro-3-vinylbenzene (0.1 g, 438.51 μmol) dissolved in toluene (10 mL), Pt / C (50 mg, 11.90 μmol, 5% purity) and ZnBr2 (20 mg, 88.81 μmol, 4.44 μL) were added under an N2 atmosphere. The mixture was degassed, purged several times with H2 (15 psi), and then stirred under an H2 (15 psi) atmosphere at 25°C for 16 hours. The mixture was filtered through Celite and washed with toluene (3 × 20 mL). The filtrate was washed with water (2 × 15 mL), the organic layer was dried over anhydrous Na2SO4, filtered, and concentrated to obtain intermediate B1 (0.16 g, 799.70 μmol, 91% yield) as a yellow oil. The final compound was used in the next reaction without further purification. 1 H NMR (400 MHz, CDCl3) δ ppm 1.24 (3H, t, J = 7.6 Hz), 2.75 (2H, q, J = 7.2 Hz), 4.1 (2H,s), 6.64-6.67 (2H, m), 7.06 (1H, t, J = 8.0 Hz).
[0163]
[0244] Preparation Example 10: 2-bromo-4-fluoro-5-methylaniline (intermediate B2)
[0245] [ka]
[0246] To a solution of tert-butylamine (2.37 g, 32.35 mmol, 3.40 mL) dissolved in DCM (40 mL), 20 mL of DCM containing Br2 (2.58 g, 16.14 mmol, 832.12 μL) was slowly added dropwise at -78°C. The mixture was stirred at -78°C for 1 hour. 20 mL of DCM containing 4-fluoro-3-methylaniline (2.0 g, 15.98 mmol, 205.76 μL) was added dropwise to the reaction mixture at -78°C, and the mixture was slowly heated to 25°C and stirred for 12 hours. The mixture was diluted with DCM (200 mL) and washed with saturated Na2SO3 (100 mL × 2) and brine (1 × 100 mL). The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain a yellow residue. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150×40mm×15um, mobile phase: [water (TFA)-ACN], B%: 35%→65%, 10 minutes) to obtain intermediate B2 (4.0 g, 9.80 mmol, yield 61%) as a purple solid. The ratio of 2-bromo-4-fluoro-3-methylaniline to 2-bromo-4-fluoro-5-methylaniline was approximately 1:2. 1 H NMR (400 MHz, CDCl3) δ ppm 2.33-2.36 (3H, m), 6.61-6.64 (1H, m), 6.86(1H, t, J = 8.8 Hz);LC / MS (ESI) m / z = 204.0 [M+2] + LC / MS t R = 0.75 minutes.
[0164]
[0247] Reaction scheme 1: Synthesis of 2-chloro-N-(2-(2,6-dioxopiperidine-3-yl)-1,3-dioxoisoindorin-5-yl)-3-(morpholinomethyl)benzenesulfonamide
[0248] [ka]
[0249] Step 1: tert-butyl((2-chloro-3-((4-methoxybenzyl)thio)benzyl)oxy)diphenylsilane
[0250] Intermediate A1 (8.8 g, 19.14 mmol) was dissolved in DMF (100 mL) and Xantphos (1.12 g, 1.93 mmol), Et3N (2.94 g, 29.05 mmol), and Pd2(dba)3 (1.76 g, 1.92 mmol) were added at 25 °C under an N2 atmosphere. The mixture was then stirred at 130 °C for 12 hours. The mixture was diluted with water (300 mL) and extracted with SiO2 (200 mL x 3). The organic layer was washed with brine (200 mL x 3), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica column chromatography (PE:SiO = 100:0 to 19:1) to obtain tert-butyl((2-chloro-3-((4-methoxybenzyl)thio)benzyl)oxy)diphenylsilane (8.2 g, yield 80%) as a white solid. 1 H NMR (400 MHz, CDCl3) δ ppm 1.12 (9H, s), 3.78 (3H, s), 4.09 (2H, s), 4.83 (2H, s), 6.83(2H, d, J = 8.4 Hz), 7.15-7.21 (1H, m), 7.22-7.30 (3H, m), 7.35-7.46 (6H, m),7.61 (1H, d, J = 7.2 Hz), 7.70 (4H, dd, J = 7.6, 1.2 Hz).
[0165]
[0251] Step 2: 3-(((tert-butyldiphenylsilyl)oxy)methyl)-2-chlorobenzenesulfonyl chloride (intermediate C1)
[0252] To a solution of tert-butyl((2-chloro-3-((4-methoxybenzyl)thio)benzyl)oxy)diphenylsilane (2 g, 3.75 mmol) dissolved in ACN (30 mL), AcOH (1.3 mL), and water (0.8 mL), 1,3-dichloro-5,5-dimethyl-imidazolidin-2,4-dione (1.47 g, 7.45 mmol) was added at 0°C. The mixture was stirred at 0°C for 5 minutes. The reaction mixture was neutralized to pH=7 with saturated NaHCO3. The mixture was concentrated under reduced pressure, diluted with water (200 mL), and then extracted with DCM (150 mL x 3). The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica column chromatography (PE:SiO = 100:0 to 19:1) to obtain intermediate C1 (1.7 g, 95% yield) as a yellow oily substance. 1 H NMR (400 MHz, CDCl3) δ ppm 1.15 (9H, s), 4.91 (2H, s), 7.42 (4H, d, J = 7.2 Hz), 7.45-7.49(2H, m), 7.57 (1H, t, J = 8.0 Hz), 7.69 (4H, dd, J = 8.0, 2.0 Hz), 8.10 (1H, d,J = 7.6 Hz), 8.17 (1H, d, J = 7.6 Hz).
[0166]
[0253] Step 3: Dimethyl 4-((3-(((tert-butyldimethylsilyl)oxo)methyl)-2-chlorophenyl)sulfinamide)phthalate
[0254] To a solution of dimethyl-4-aminobenzene-1,2-dicarboxylic acid (0.5 g, 2.39 mmol) dissolved in pyridine (20 mL), intermediate C1 (1.7 g, 3.55 mmol) was added. The mixture was stirred at 25°C for 1 hour. The mixture was concentrated under reduced pressure, diluted with water (200 mL), and then extracted with ELISA (300 mL x 3). The organic layer was washed with brine (300 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica column chromatography (PE=ELISA=10:1 to 4:1) to obtain dimethyl-4-((3-(((tert-butyldimethylsilyl)oxo)methyl)-2-chlorophenyl)sulfinamide)phthalate (1.2 g, yield 44%, purity 57%) as a white solid. LC / MS (ESI) m / z = 652.3 [M+H] + LC / MS t R =0.753 minutes.
[0167]
[0255] Step 4: Dimethyl 4-((2-chloro-3-(hydroxymethyl)phenyl)sulfonamide)phthalate (intermediate D1)
[0256] Dimethyl 4-((3-(((tert-butyldimethylsilyl)oxo)methyl)-2-chlorophenyl)sulfinamide)phthalate (1.2 g, 1.05 mmol) was dissolved in THF (10 mL), and TBAF (1 M, 4.19 mL) was added at 0°C. The mixture was stirred at 25°C for 12 hours. The mixture was filtered under reduced pressure, diluted with water (50 mL), and then extracted with ELISA (30 mL x 3). The organic layer was washed with HCl (1 M, 50 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150×40mm×15um, mobile phase: [water (TFA)-ACN], gradient: 30%→60%B over 10 minutes) to obtain intermediate D1 (0.35g, yield 81%) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 3.76 (6H, d, J = 14.0 Hz), 4.57 (2H, s), 7.27-7.34 (2H, m),7.58 (1H, s), 7.67 (1H, d, J = 9.2 Hz), 7.78-7.86 (1H, m), 8.04 (1H, dd, J =8.0, 2.0 Hz), 11.36 (1H, s); LC / MS (ESI) m / z = 382.1 [M - 32 + H] + .LC / MS t R = 0.533 minutes.
[0168]
[0257] Step 5: Dimethyl-4-[(2-chloro-3-formyl-phenyl)sulfonamide]benzene-1,2-dicarboxylic acid
[0258] MnO2 (1.47 g, 16.92 mmol) was added to a solution of intermediate D1 (0.35 g, 845.76 μmol). The mixture was stirred at 25°C for 72 hours. The mixture was filtered and concentrated under reduced pressure to obtain dimethyl-4-[(2-chloro-3-formyl-phenyl)sulfonamide]benzene-1,2-dicarboxylic acid (0.44 g, crude product) as a white solid. LC / MS (ESI) m / z = 434.1 [M+ Na] + LC / MS t R =0.558 minutes.
[0169]
[0259] Step 6: Dimethyl 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamide)phthalate
[0260] Dimethyl 4-[(2-chloro-3-formyl-phenyl)sulfonamide]benzene-1,2-dicarboxylic acid (100 mg, 242.83 μmol) was dissolved in MeOH (1 mL) and DCM (1 mL). Borane; 2-methylpyridine (50 mg, 467.46 μmol) and AcOH (1 mg, 24.28 μmol) were added to the solution. The mixture was stirred at 25°C for 12 hours. The mixture was concentrated under reduced pressure, and the residue was purified by preparative TLC (PE:HCl = 1:2) to obtain dimethyl 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamide)phthalate (70 mg, yield 58%, purity 97%) as a yellow solid. LC / MS (ESI) m / z = 483.2 [M+H] +LC / MS t R =0.479 minutes.
[0170]
[0261] Step 7: 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamide)phthalate
[0262] Dimethyl 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamide)phthalate (70 mg, 140.60 μmol) was dissolved in THF (1 mL), MeOH (1 mL), and H2O (1 mL). LiOH·H2O (27 mg, 643.47 μmol) was added to this solution. The mixture was stirred at 50°C for 12 hours. The reaction mixture was filtered and concentrated under reduced pressure to obtain 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamide)phthalic acid (80 mg, crude product) as a white solid. LC / MS (ESI) m / z = 455.1 [M+H] + LC / MS t R =0.417 minutes.
[0171]
[0263] Step 8: 2-Chloro-N-(2-(2,6-dioxopiperidine-3-yl)-1,3-dioxoisoindorin-5-yl)-3-(morpholinomethyl)benzenesulfonamide (Compound 1)
[0264] 3-aminopiperidine-2,6-dione (43 mg, 261.26 μmol, HCl salt) and 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamide)phthalic acid (80 mg, 175.87 μmol) were dissolved in AcOH (2 mL), and NaOAc (32 mg, 390.10 μmol) was added to the solution. The mixture was stirred at 100 °C for 12 hours. The mixture was filtered and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150 × 25 mm × 10 μm, mobile phase: [water (FA)-ACN], gradient: 6% → 36% B over 10 minutes) to obtain compound 1 (35.84 mg, yield 37%, purity 99.01%) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.88-2.06 (1H, m), 2.35 (4H, br s), 2.57-2.69 (2H, m),2.77-2.91 (1H, m), 3.49-3.62 (6H, m), 5.07 (1H, dd, J = LC / MS (ESI) m / z = 547.2 [M+H] + LC / MS t R = 1.528 minutes.
[0172]
[0265] Reaction scheme 2: 2-(difluoromethoxy)-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-4-fluoro-3-methylbenzenesulfonamide
[0266] [ka]
[0267] Step 1: 3-(difluoromethoxy)-1-fluoro-4-[(4-methoxyphenyl)methylsulfanyl]-2-methylbenzene
[0268] Intermediate A2 (400 mg, 1.57 mmol), (4-methoxyphenyl)methanethiol (242 mg, 1.57 mmol), Pd2(dba)3 (144 mg, 0.157 mmol), xantphos (182 mg, 0.314 mmol), and DIEA (608 mg, 4.71 mmol) were mixed with 1,4-dioxane (6 mL). The mixture was degassed, purged three times with N2, and then stirred at 90°C under an N2 atmosphere for 16 hours. The reaction mixture was poured into water (20 mL) and extracted with SiO2 (30 mL x 3). The organic layer was washed with brine (20 mL x 2), dried over anhydrous Na2SO4, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica column chromatography (0 → 10% siRNA / PE gradient) to obtain 3-(difluoromethoxy)-1-fluoro-4-[(4-methoxyphenyl)methylsulfanyl]-2-methylbenzene (350 mg, yield 68.0%) as a colorless oil. 1 H NMR (400 MHz, DMSO-d6) δppm 2.16 (d, J = 2.0 Hz, 3H), 3.74-3.71 (m, 3H), 4.14 (s, 2H), 6.72(s, 1H), 6.89-6.83 (m, 2H), 6.91 (s, 1H), 7.20-7.14 (m, 1H), 7.27-7.21 (m, 2H),7.36-7.33 (m, 1H), 7.37 (s, 1H).
[0173]
[0269] Step 2: 2-(difluoromethoxy)-4-fluoro-3-methylbenzenesulfonyl chloride (intermediate C2)
[0270] 3-(difluoromethoxy)-1-fluoro-4-[(4-methoxyphenyl)methylsulfanyl]-2-methylbenzene (200 mg, 0.001 mmol) was dissolved in AcOH (3 mL) and H2O (1 mL), to which NCS (325 mg, 2.44 mmol) was added. The mixture was stirred at 35°C for 1.5 hours. The reaction mixture was poured into water (20 mL) and extracted with ethyl acetate (20 mL x 3). The organic layer was washed with brine (10 mL x 2), dried over anhydrous Na2SO4, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica column chromatography (0 → 10% ethyl acetate / PE gradient) to obtain intermediate C2 (100 mg, yield 59.8%) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.39 (3H, s), 6.52-6.90 (1H, m), 7.20 (1H, t, J = 8.4 Hz), 7.98(1H, dd, J = 8.8, 5.6 Hz).
[0174]
[0271] Step 3: 2-(difluoromethoxy)-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxoisoindorin-5-yl]-4-fluoro-3-methylbenzenesulfonamide (compound 2)
[0272] Intermediate C2 (100 mg, 0.364 mmol) and 5-amino-2-(2,6-dioxo-3-piperidyl)isoindoline-1,3-dione (99.5 mg, 0.364 mmol) were dissolved in pyridine (2 mL), and DMAP (4.45 mg, 0.0364 mmol) was added to the solution. The mixture was stirred at 35°C for 1.5 hours. The reaction mixture was concentrated under reduced pressure and purified by preparative HPLC (Welch Xtimate C18 150 × 40 mm × 10 μm, mobile phase: [water (FA)-ACN], gradient: 24% → 64% B over 25 minutes). Most of the ACN was removed by concentration under reduced pressure, and then the residual solvent was removed using a freeze-dryer to obtain compound 2 (16.0 mg, yield 8.59%) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ 2.05-1.99 (m, 1H), 2.20 (s, 3H), 2.63-2.54 (m, 2H), 5.09 (dd, J =5.6, 12.8 Hz, 1H), 7.29-6.92 (m, 1H), 7.41 (t, J = 8.8 Hz, 1H), 7.52-7.47 (m,2H), 7.82 (d, J = 8.0 Hz, 1H), 7.92 (dd, J = 6.4, 8.8Hz, 1H), 11.10 (s, 1H),11.42 (s, 1H); LC / MS (ESI) m / z = 512.0 [M+H] + .
[0175]
[0273] Reaction scheme 3: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methylbenzenesulfonamide
[0274] [Method 1]
[0275] [ka]
[0176]
[0276] Step 1: 2-Chloro-3-methylbenzenesulfonyl chloride (intermediate C3)
[0277] To a solution of 2-chloro-3-methylaniline (5 g, 35.31 mmol) dissolved in water (50 mL), HCl (12 M, 36 mL) and NaNO2 (2.92 g, 42.29 mmol) were sequentially added at 0°C. The mixture was stirred at 0°C for 1 hour to obtain mixture 1. Meanwhile, SO2 (50 Psi) was injected into AcOH (35 mL) over 20 minutes at 0°C to obtain mixture 2. Mixture 2 was added to mixture 1 at 0°C. The reaction mixture was stirred at 0°C for 10 minutes, and CuCl2 (3.06 g, 22.77 mmol) was added. The mixture was diluted with water (200 mL) and extracted with ELISA (200 mL x 3). The organic layer was washed with saturated NaHCO3 (300 mL) and brine (300 mL) and dried over anhydrous Na2SO4. This was concentrated under reduced pressure and purified by silica column chromatography (PE:Â=50:0 to 40:1) to obtain intermediate C3 (6.0 g, yield 75%) as a yellow oily substance. 1 H NMR (400 MHz, CDCl3) δ ppm 2.53 (3H, s), 7.40 (1H, t, J = 7.6 Hz), 7.62 (1H, dd, J = 7.6,0.8 Hz), 8.03 (1H, dd, J = 8.0, 0.8 Hz).
[0177]
[0278] Step 2: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methylbenzenesulfonamide (compound 3)
[0279] Intermediate C3 (4.1 g, 18.21 mmol) and 5-amino-2-(2,6-dioxo-3-piperidyl)isoindoline-1,3-dione (4 g, 14.64 mmol) were mixed with pyridine (50 mL) and stirred at 25°C for 12 hours. The reaction mixture was concentrated under reduced pressure and diluted with water (200 mL), HCl (1 M, 100 mL), and DCM (300 mL). The mixture was filtered, and the solid was concentrated under reduced pressure to obtain the crude product. The crude product was added to water (18 mL) to obtain compound 3 (5.8 g, yield 84%, purity 98%) as a gray solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.92-2.09 (1H, m), 2.36 (3H, s), 2.40-2.49 (1H, m), 2.54-2.62(1H, m), 2.76-2.95 (1H, m), 5.08 (1H, dd, J = 13.2, 5.6 Hz), 7.44-7.55 (3H, m),7.63-7.72 (1H, m), 7.79-7.84 (1H, m), 8.05 (1H, dd, J = 8.0, 1.2 Hz), 11.09(1H, s), 11.61 (1H, s); LC / MS (ESI) m / z = 462.1 [M+H] + .
[0178]
[0280] [Method 2]
[0281] [ka]
[0282] Step 1: 4-[(2-chloro-3-methylphenyl)sulfonamino]benzene-1,2-dicarboxylic acid
[0283] Intermediate C3 (5.00 g, 22.23 mmol) was dissolved in pyridine (50 mL), and dimethyl 4-aminobenzene-1,2-dicarboxylic acid (3.1 g, 14.82 mmol) was added to the solution. The mixture was stirred at 25°C for 12 hours. The reaction mixture was concentrated under reduced pressure, diluted with water (300 mL), and extracted with siRNA (200 mL x 3). The organic layer was washed with brine (400 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica column chromatography (PE:siRNA = 100:1 to 2:1) to obtain 4-[(2-chloro-3-methylphenyl)sulfoneamino]benzene-1,2-dicarboxylic acid (5.3 g, yield 75%, purity 83%) as a yellow solid. LC / MS (ESI) m / z = 398.1[M + H] + .
[0179]
[0284] Step 2: 4-[(2-chloro-3-methylphenyl)sulfonamino]phthalic acid
[0285] 4-[(2-chloro-3-methylphenyl)sulfonamino]benzene-1,2-dicarboxylic acid (5.3 g, 11.06 mmol) was dissolved in THF (20 mL), MeOH (20 mL), and H2O (20 mL). LiOH·H2O (1.96 g, 46.59 mmol) was added to the solution. The mixture was stirred at 50°C for 12 hours. The reaction mixture was adjusted to pH 4-5 using 2 M HCl. The mixture was diluted with water (120 mL) and extracted with ELISA (100 mL). The organic layer was washed with brine (200 mL x 3), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain 4-[(2-chloro-3-methylphenyl)sulfonamino]phthalic acid (5.8 g, crude product) as a yellow solid. LC / MS (ESI) m / z = 369.0 [M + H] + .
[0180]
[0286] Step 3: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methylbenzenesulfonamide (compound 3)
[0287] 4-[(2-chloro-3-methylphenyl)sulfonamino]phthalic acid (5 g, 35.31 mmol) and 3-aminopiperidine-2,6-dione (3.31 g, 20.14 mmol, HCl) were dissolved in AcOH (100 mL), and NaOAc (1.57 g, 19.19 mmol) was added to the solution. The mixture was stirred at 100 °C for 12 hours. The mixture was filtered and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex luna C18 250 × 80 mm × 10 μm, mobile phase: [water (FA)-ACN], gradient: 35% → 65% B over 20 minutes) to obtain compound 3 (5320.28 mg, yield 72%, purity 99.18%) as a gray solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.95-2.04 (1H, m), 2.36 (3H, s), 2.40-2.48 (1H, m), 2.57 (1H,d, J= 18.4 Hz), 2.79-2.94 (1H, m), 5.07 (1H, dd, J=12.8, 5.2 Hz), 7.44-7.54(3H, m), 7.64-7.72 (1H, m), 7.78-7.86 (1H, m), 8.04 (1H, dd, J=8.0, 1.2 Hz),11.09 (1H, s), 11.61 (1H, s); LC / MS (ESI) m / z = 462.2 [M + H] + .
[0181]
[0288] [Method 3]
[0289] [ka]
[0290] Step 1: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methylbenzenesulfonamide
[0291] To a solution of 1-bromo-2-chloro-3-methylbenzene (5 g, 24.33 mmol) and (4-methoxyphenyl)methanethiol (3.94 g, 25.55 mmol) dissolved in DMF (100 mL), Xantphos (1.41 g, 2.43 mmol), TEA (3.64 g, 35.92 mmol), and Pd2(dba)3 (1.56 g, 1.70 mmol) were added at 25°C under nitrogen conditions. The reaction mixture was then stirred at 130°C for 15 hours. Water (300 mL) was poured into the reaction mixture and extracted with RINKAN (250 mL x 3). The combined organic layers were washed with brine (300 mL x 3), dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether / ethyl acetate = 100 / 0 to 100 / 1) to obtain 2-chloro-1-[(4-methoxyphenyl)methylsulfanyl]-3-methylbenzene (5 g, yield 74%) as a white solid. 1H NMR (400 MHz, CDCl3) δ ppm 2.39 (3H, s), 3.80 (3H, s), 4.11 (2H, s), 6.78-6.91 (2H, m),7.02-7.14 (3H, m), 7.29 (2H, d, J = 8.8 Hz).
[0182]
[0292] Step 2: 2-Chloro-3-methylbenzenesulfonyl chloride (intermediate C3)
[0293] 2-chloro-1-[(4-methoxyphenyl)methylsulfanyl]-3-methylbenzene (5 g, 17.93 mmol), acetic acid (5 mL), and water (3 mL) were dissolved in ACN (120 mL). To this solution, 1,3-dichloro-5,5-dimethyl-imidazolidin-2,4-dione (7.07 g, 35.88 mmol) was added at 0°C. The reaction mixture was stirred at 0°C for 5 minutes. The reaction mixture was then adjusted to pH 7 using an aqueous sodium bicarbonate solution. The reaction mixture was concentrated, then water (100 mL) was added, and it was extracted with ethyl acetate (200 mL x 3). The combined organic layer was washed with brine (300 mL), dried over Na₂SO₄, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether / ethyl acetate = 100 / 0 to 100 / 1) to obtain 2-chloro-3-methylbenzenesulfonyl chloride (3.2 g, yield 79%) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.53 (3H, s), 7.36-7.42 (1H, m), 7.62 (1H, dd, J = 7.6, 0.8Hz), 8.04 (1H, dd, J = 8.4, 1.2 Hz).
[0183]
[0294] Steps 3-5: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methylbenzenesulfonamide (compound 3)
[0295] Compound 3 was obtained by reacting 2-chloro-3-methylbenzenesulfonyl chloride in the same manner as in steps 1-3 of Method 2.
[0296] Reaction scheme 4: 2-bromo-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methylbenzenesulfonamide
[0297] [ka]
[0184]
[0298] Step 1: 2-Bromo-3-methylbenzenesulfonyl chloride
[0299] To a solution of 2-bromo-3-methylaniline (1 g, 5.37 mmol) dissolved in acetic acid (3 mL) and ACN (15 mL), water (3 mL) containing hydrochloric acid (12 M, 1.71 mL) was slowly added. After 10 minutes, a solution of NaNO2 (371 mg, 5.38 mmol) dissolved in water (2 mL) was slowly added at 0°C. The reaction mixture was stirred at 25°C for 2 hours to obtain Solution 1. In a separate flask, SO2 (50 Psi) was bubbling in acetic acid (15 mL) at 10°C for 20 minutes. Then, a solution of CuCl2 (723 mg, 5.38 mmol) dissolved in water (3 mL) was added to obtain Solution 2. Solution 1 was slowly added to Solution 2 at 0°C. The reaction mixture was stirred at 25°C for 6 hours. The reaction mixture was diluted with HCl (30 mL), poured into ice-cold sodium bicarbonate aqueous solution (100 mL), and then extracted with HCl (30 mL x 3). The combined organic layer was washed with sodium bicarbonate aqueous solution (100 mL x 5) and brine (100 mL), dried over Na₂SO₄, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO₂, petroleum ether:ethyl acetate = 100:0 to 20:1) to obtain 2-bromo-3-methylbenzenesulfonyl chloride (0.5 g, yield 35%) as a yellow solid. 1 H NMR (400 MHz, CDCl3) δ ppm 2.57 (3H, s), 7.37-7.49 (1H, m), 7.53-7.65 (1H, m), 8.06 (1 H,dd, J = 8.0, 0.8 Hz).
[0185]
[0300] Step 2: Dimethyl-4-[(2-bromo-3-methylphenyl)sulfonylamino]benzene-1,2-dicarboxylate (intermediate D2)
[0301] Dimethyl-4-aminobenzene-1,2-dicarboxylate (40 mg, 191.21 μmol) was added to a solution of 2-bromo-3-methylbenzenesulfonyl chloride (80 mg, 296.80 μmol) dissolved in pyridine (1 mL). The reaction mixture was then stirred at 25°C for 1 hour. The reaction mixture was concentrated, then water (10 mL) was added, and the reaction mixture was extracted with ELISA (20 mL x 3). The combined organic layer was washed with brine (30 mL), dried over Na₂SO₄, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by preparative TLC (SiO₂, petroleum ether:ethyl acetate = 2:1) to obtain intermediate D2 (80 mg, yield 92%, purity 97%) as a colorless oil. LC / MS (ESI) m / z = 442.2 [M + H] + .
[0186]
[0302] Step 3: 4-[(2-bromo-3-methylphenyl)sulfonylamino]phthalate
[0303] Intermediate D2 (80 mg, 175.45 μmol) was dissolved in THF (1 mL), MeOH (1 mL), and water (1 mL), to which LiOH·H2O (33 mg, 786.46 μmol) was added. The reaction mixture was then stirred at 50°C for 12 hours. The reaction mixture was then adjusted to pH 4-5 using hydrochloric acid (2 M). Water (20 mL) was added to the reaction mixture and extracted with HCl (30 mL x 3). The combined organic layers were washed with brine (30 mL x 3), dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain 4-[(2-bromo-3-methylphenyl)sulfonylamino]phthalic acid (60 mg, crude product) as a white solid. LC / MS (ESI) m / z = 396.2 [M - OH] + .
[0187]
[0304] Step 4: 2-Bromo-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methylbenzenesulfonamide (Compound 4)
[0305] 4-[(2-bromo-3-methylphenyl)sulfonylamino]phthalic acid (50 mg, 120.71 μmol) and 3-aminopiperidine-2,6-dione (26 mg, 157.97 μmol) were dissolved in acetic acid (1 mL), and NaOAc (11 mg, 134.10 μmol) was added to the solution. The reaction mixture was then stirred at 100 °C for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the crude product, which was purified by preparative HPLC (column: Phenomenex luna C18 150 × 25 mm × 10 μm, mobile phase: [water (FA)-ACN], B%: 30% → 60%, 10 minutes) to obtain compound 4 (38.94 mg, yield 63%, purity 98.71%) as a gray solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.94-2.07 (1H, m), 2.40 (3H, s), 2.45 (1H, s), 2.56 (1H, d, J =19.2 Hz), 2.79-2.93 (1H, m), 5.07 (1H, dd, J = 12.8, 5.2 Hz), 7.46-7.56 (3H,m), 7.65 (1H, d, J = 6.8 Hz), 7.81 (1H, d, J = 8.4 Hz), 8.05 (1H, d, J = 7.2Hz), 11.09 (1H, s), 11.61 (1H, s); LC / MS (ESI) m / z = 506.1 [M + H] + .
[0188]
[0306] Reaction scheme 5: N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-2-iodo-3-methylbenzenesulfonamide
[0307] [ka]
[0308] Step 1: Dimethyl-4-[(2-iodo-3-methylphenyl)sulfonylamino]benzene-1,2-dicarboxylate (intermediate D3)
[0309] Intermediate D2 (70 mg, 158.27 μmol), NaI (476 mg, 3.18 mmol), and CuI (35 mg, 183.78 μmol) were dissolved in 1,4-dioxane (5 mL). N,N'-dimethylethane-1,2-diamine (31 mg, 351.67 μmol) was added to this solution under nitrogen conditions. The reaction mixture was then stirred under nitrogen conditions at 120 °C for 24 hours. The reaction mixture was diluted with HCl (20 mL), adjusted to pH=5 by treatment with hydrochloric acid (1 M), and then extracted with HCl (20 mL x 3). The combined organic layer was washed with brine (40 mL), dried over Na₂SO₄, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO₂, petroleum ether:ethyl acetate = 4:1 to 3:1) to obtain intermediate D3 (50 mg, yield 65%) as a yellow solid. LC / MS (ESI) m / z = 490.0 [M + H] + .
[0189]
[0310] Step 2: 4-[(2-iodo-3-methylphenyl)sulfonylamino]phthalic acid
[0311] Intermediate D3 (50 mg, 102.19 μmol) was dissolved in THF (3 mL), MeOH (1 mL), and water (1 mL), to which LiOH·H2O (13 mg, 309.79 μmol) was added. The reaction mixture was then stirred at 50°C for 12 hours. The reaction mixture was then diluted with water (20 mL), and the pH was adjusted to 5 using hydrochloric acid (1 M). Extraction was performed with ELISA (15 mL x 3). The combined organic layer was washed with brine (20 mL), dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain 4-[(2-iodo-3-methylphenyl)sulfonylamino]phthalic acid (47 mg, crude product) as a yellow solid. LC / MS (ESI) m / z = 483.9 [M + Na] + .
[0190]
[0312] Step 3: N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-2-iodo-3-methylbenzenesulfonamide (compound 5)
[0313] 4-[(2-iodo-3-methylphenyl)sulfonylamino]phthalic acid (47 mg, 101.90 μmol) and 3-aminopiperidine-2,6-dione (25 mg, 151.89 μmol, hydrochloride) were dissolved in acetic acid (3 mL), to which NaOAc (11 mg, 134.10 μmol) was added. The reaction mixture was then stirred at 100 °C for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the crude product, which was purified by preparative HPLC (with formic acid added, column: Phenomenex luna C18 150 × 25 mm × 10 μm, mobile phase: [water (FA)-ACN], B%: 36% → 56%, 10 minutes) to obtain compound 5 (35.46 mg, yield 62%, purity 98.40%) as a green solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.92-2.05 (1H, m), 2.46 (3H, s), 2.53-2.62 (2H, m), 2.80-2.91(1H, m), 5.06 (1H, dd, J = 12.8, 5.6 Hz), 7.44 (2H, s), 7.48-7.54 (1H, m),7.55-7.61 (1H, m), 7.72-7.83 (1H, m), 7.98 (1H, d, J = 7.2 Hz), 11.09 (1H, s),11.47-11.72 (1H, m); LC / MS (ESI) m / z = 554.1 [M + H] + .
[0191]
[0314] Reaction scheme 6: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-(methylaminomethyl)benzenesulfonamide
[0315] [ka]
[0316] [ka]
[0317] Step 1: Dimethyl-4-[(2-chloro-3-formyl-phenyl)sulfonylamino]benzene-1,2-dicarboxylate
[0318] Intermediate D1 (150 mg, 362.47 μmol) was dissolved in DCM (8 mL), and MnO2 (252 mg, 2.90 mmol) was added to the solution. The reaction mixture was then stirred at 20°C for 40 hours. The reaction mixture was filtered, and the filtrate was concentrated to obtain dimethyl 4-[(2-chloro-3-formyl-phenyl)sulfonylamino]benzene-1,2-dicarboxylate (150 mg, crude product) as a yellow oily substance. LC / MS (ESI) m / z = 412.0 [M + H] + .
[0192]
[0319] Step 2: Dimethyl-4-[[2-chloro-3-(methylaminomethyl)phenyl]sulfonylamino]benzene-1,2-dicarboxylate (intermediate D4)
[0320] Dimethyl 4-[(2-chloro-3-formylphenyl)sulfonylamino]benzene-1,2-dicarboxylate (75 mg, 182.12 μmol) and methaneamine (25 mg, 370.27 μmol, hydrochloride) were dissolved in DCM (3 mL) and MeOH (3 mL), respectively. Et3N (36 mg, 355.77 μmol) was added to these solutions. Then acetic acid (33 mg, 549.54 μmol) was added. The reaction mixture was stirred at 20°C for 5 hours, and then borane; 2-methylpyridine (39 mg, 364.62 μmol) was added. The reaction mixture was then stirred at 20°C for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the crude product. The crude product was purified by preparative HPLC (with formic acid added, column: Phenomenex luna C18 150×25mm×10um, mobile phase: [water(FA)-ACN], B%: 8% → 38% B over 2 minutes) to obtain intermediate D4 (40 mg, yield 51%) as a grayish-white solid. LC / MS (ESI) m / z = 427.1 (M + H) + .
[0193]
[0321] Step 3: Dimethyl 4-[[3-[[tert-butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonylamino]benzene-1,2-dicarboxylate
[0322] Intermediate D4 (40 mg, 93.71 μmol) was dissolved in DCM (3 mL), to which Boc2O (40 mg, 183.28 μmol) and Et3N (30 mg, 296.47 μmol) were added, and the mixture was stirred at 20°C for 2 hours. The reaction mixture was poured into water (10 mL) and extracted with DCM (10 mL x 3). The combined organic layer was washed with brine (20 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain the crude product. The crude product was purified by preparative TLC (silica gel plate, petroleum ether:ethyl acetate = 1:1) to obtain dimethyl 4-[[3-[[tert-butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonylamino]benzene-1,2-dicarboxylate (45 mg, yield 91%) as a colorless oil. LC / MS (ESI) m / z = 549.1 [M + Na] + .
[0194]
[0323] Step 4: 4-[[3-[[tert-butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonylamino]phthalate
[0324] Dimethyl 4-[[3-[[tert-butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonylamino]benzene-1,2-dicarboxylate (45 mg, 85.39 μmol) was dissolved in THF (1 mL), MeOH (1 mL), and water (1 mL), to which LiOH·H2O (18 mg, 428.94 μmol) was added. The reaction mixture was stirred at 50°C for 12 hours. The reaction mixture was then concentrated under reduced pressure, diluted with water (10 mL), and the reaction mixture was adjusted to pH 5 using hydrochloric acid (1 M), and extracted with ELISA (10 mL × 3). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain 4-[[3-[[tert-butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonylamino]phthalic acid (43 mg, crude product) as a colorless oil. LC / MS (ESI) m / z = 521.1 [M + Na] + .
[0195]
[0325] Step 5: tert-butyl N-[[2-chloro-3-[[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindoline-5-yl]sulfamoyl]phenyl]methyl]-N-methyl-carbamate
[0326] 4-[[3-[[tert-butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonylamino]phthalic acid (43 mg, 86.18 μmol) was dissolved in ACN (2 mL), and CDI (28 mg, 172.68 μmol) was added to the solution and stirred at 20°C for 30 minutes. Then, 3-aminopiperidine-2,6-dione (18 mg, 109.36 μmol, hydrochloride) was added and stirred at 20°C for 12.5 hours. The reaction mixture was poured into water (20 mL) and extracted with ELISA (10 mL x 3). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain tert-butyl N-[[2-chloro-3-[[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]sulfamoyl]phenyl]methyl]-N-methyl-carbamate (51 mg, crude product) as a pale yellow oil. LC / MS (ESI) m / z = 613.2 [M + Na] + .
[0196]
[0327] Step 6: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindoline-5-yl]-3-(methylaminomethyl)benzenesulfonamide (Compound 6)
[0328] 51 mg, 86.29 μmol of tert-butyl N-[[2-chloro-3-[[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindoline-5-yl]sulfamoyl]phenyl]methyl]-N-methyl-carbamate was dissolved in 1.5 mL of DCM, to which hydrochloric acid / dioxane (4 M, 0.5 mL) was added. The reaction mixture was stirred at 20°C for 12 hours. The reaction mixture was concentrated under reduced pressure and then purified by preparative HPLC (hydrochloric acid added, column: YMC Triart C18 150 × 25 mm × 5 μm, mobile phase: [water (hydrochloric acid)-ACN], gradient: 13% → 43% B over 10 minutes) to obtain compound 6 (39.07 mg, yield 85%, purity 99.44%, hydrochloride salt) as a grayish-white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.92-2.06 (1H, m), 2.40-2.48 (2H, m), 2.58-2.62 (3H, m),2.76-2.93 (1H, m), 4.22-4.38 (2H, m), 5.08 (1H, dd, J = 12.8, 5.2 Hz),7.47-7.59 (2H, m), 7.70 (1H, t, J = 8.0 Hz), 7.83 (1H, d, J = 8.0 Hz), 7.97(1H, d, J = 7.2 Hz), 8.25 (1H, d, J = 6.8 Hz), 9.16-9.49 (2H, m), 11.12 (1H,s), 11.83 (1H, s); LC / MS (ESI) m / z = 491.0 [M + H] + .
[0197]
[0329] Reaction scheme 7: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-(trifluoromethoxymethyl)benzenesulfonamide
[0330] [ka]
[0331] Step 1: Dimethyl 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonylamino]benzene-1,2-dicarboxylate
[0332] AgOTf (373 mg, 1.45 mmol), 1-(chloromethyl)-4-fluoro-diazoniabicyclo[2.2.2]octanbis(tetrafluoroborate) (Selectfluor, 257 mg, 725.46 μmol), KF (112 mg, 1.93 mmol), and intermediate D1 (200 mg, 483.29 μmol) were dissolved in SiO (2.5 mL). To this solution, 2-fluoropyridine (141 mg, 1.45 mmol) and trimethyl(trifluoromethyl)silane (206 mg, 1.45 mmol) were added under nitrogen conditions. The reaction mixture was then stirred under nitrogen conditions at 20 °C for 12 hours. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. Purification by preparative TLC (silica gel plate, petroleum ether:ethyl acetate = 1:1) yielded dimethyl 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonylamino]benzene-1,2-dicarboxylate (15 mg, yield 6%, purity 97%) as a yellow oil. LC / MS (ESI) m / z = 482.0 [M + H] + .
[0198]
[0333] Step 2: 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonylamino]phthalic acid
[0334] Dimethyl 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonylamino]benzene-1,2-dicarboxylate (15 mg, 30.20 μmol) was dissolved in THF (1 mL), MeOH (1 mL), and water (1 mL). LiOH·H2O (7 mg, 166.81 μmol) was added to this solution. The reaction mixture was stirred at 50°C for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonylamino]phthalic acid (14 mg, crude product) as a white solid. LC / MS (ESI) m / z = 436.0 [M - OH + H] + .
[0199]
[0335] Step 3: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-(trifluoromethoxymethyl)benzenesulfonamide (Compound 7)
[0336] 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonylamino]phthalic acid (14 mg, 30.85 μmol) and 3-aminopiperidine-2,6-dione (8 mg, 48.61 μmol, hydrochloride) were dissolved in acetic acid (3 mL), and NaOAc (3 mg, 36.57 μmol) was added to the solution. The reaction mixture was then stirred at 100 °C for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the crude product, which was purified by preparative HPLC (with formic acid added, column: Phenomenex luna C18 150 × 25 mm × 10 μm, mobile phase: [water (FA)-ACN], gradient: 36% → 66% B over 10 minutes) to obtain compound 7 (3.09 mg, yield 18%, purity 98.88%) as a green solid. 1 H NMR (400 MHz, CDCl3) δ ppm 2.08-2.20 (1H, m), 2.72-2.83 (2H, m), 2.87-2.97 (1H, m), 4.94(1H, dd, J = 12.4, 5.6 Hz), 5.15 (2H, s), 7.46-7.50 (1H, m), 7.51-7.56 (2H, m),7.60 (1H, s), 7.76 (2H, d, J = 8.0 Hz), 7.90-8.04 (1H, m), 8.14-8.26 (1H, m);LC / MS (ESI) m / z = 546.0 [M+H] + .
[0200]
[0337] Reaction scheme 8: 2-(difluoromethoxy)-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methylbenzenesulfonamide
[0338] [ka]
[0339] Step 1: (2-(difluoromethoxy)-3-methylphenyl)(4-methoxybenzyl)sulfane
[0340] Intermediate A3 (4 g, 16.87 mmol), (4-methoxyphenyl)methanethiol (3.12 g, 20.25 mmol), Xantphos (1.46 g, 2.53 mmol), and TEA (3.42 g, 33.75 mmol) were dissolved in DMF (30 mL). Pd2(dba)3 (773 mg, 843.74 μmol) was added to the solution, and the reaction mixture was stirred at 130 °C for 12 hours. Water (180 mL) was poured into the reaction mixture and extracted with SiO2 (60 mL x 3). The combined organic layers were washed with brine (50 mL x 3), dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether:ethyl acetate = 1:0 to 10:1) to obtain (2-(difluoromethoxy)-3-methylphenyl)(4-methoxybenzyl)sulfane (4.1 g, yield 78%) as a yellow solid. 1 H NMR (400 MHz, CDCl3) δ ppm 2.34 (3H, s), 3.79 (3H, s), 4.08 (2H, s), 6.33-6.74 (1H, m),6.82 (2H, d, J = 8.4 Hz), 7.03-7.12 (2H, m), 7.16-7.23 (3H, m).
[0201]
[0341] Step 2: 2-(difluoromethoxy)-3-methylbenzenesulfonyl chloride (intermediate C4)
[0342] (2-(difluoromethoxy)-3-methylphenyl)(4-methoxybenzyl)sulfan (4 g, 12.89 mmol) was dissolved in ACN (30 mL), acetic acid (1.5 mL), and water (1.5 mL). To this solution, 1,3-dichloro-5,5-dimethyl-imidazolidin-2,4-dione (5.08 g, 25.78 mmol) was added, and the reaction mixture was stirred at 10°C for 30 minutes. Ice water (30 mL) was added to the reaction mixture, and it was quenched with aqueous sodium bicarbonate solution (20 mL), then extracted with DCM (40 mL x 2). The combined organic layers were dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether:ethyl acetate = 1:0 to 20:1) to obtain intermediate C4 (2 g, yield 60%) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.49 (3H, s), 6.49-6.90 (1H, m), 7.36-7.45 (1H, m), 7.64-7.71(1H, m), 7.94 (1H, dd, J = 8.0, 0.8 Hz).
[0202]
[0343] Step 3: Dimethyl 4-((2-(difluoromethoxy)-3-methylphenyl)sulfonamide)phthalate (intermediate D5)
[0344] The reaction mixture, consisting of intermediate C4 (1.96 g, 7.65 mmol) and dimethyl-4-aminobenzene-1,2-dicarboxylate (1.6 g, 7.65 mmol), was mixed with pyridine (15 mL) and stirred under nitrogen at 25 °C for 1 hour. The reaction mixture was concentrated and extracted with dimethyl phosphate (20 mL x 3). The combined organic layer was washed with water (30 mL x 2) and brine (30 mL). The mixture was then dried over Na₂SO₄, filtered, and concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO₂, petroleum ether:ethyl acetate = 20:1 to 3:1) to obtain intermediate D5 (3 g, 91% yield) as a yellow oily substance. 1H NMR (400 MHz, CDCl3) δ ppm 2.42 (3H, s), 3.88 (3H, s), 3.92 (3H, s), 6.50-6.91 (1H, m),7.19 (1H, s), 7.28-7.32 (2H, m), 7.37 (1H, d, J = LC / MS(ESI) m / z = 430.1 [M + H] + .
[0203]
[0345] Step 4: 4-[[2-(difluoromethoxy)-3-methylphenyl]sulfonylamino]phthalate
[0346] Intermediate D5 (3 g, 6.99 mmol) was dissolved in THF (10 mL), MeOH (10 mL), and water (10 mL), to which LiOH·H2O (879 mg, 20.96 mmol) was added at 25°C. The reaction mixture was stirred at 50°C for 12 hours. The reaction mixture was diluted with water (100 mL) and then extracted with ethyl acetate (50 mL x 2). The reaction mixture was adjusted to pH 4-5 by adding hydrochloric acid (2 M) to the aqueous layer and extracted with ethyl acetate (50 mL x 3). The combined organic layers were washed with brine (30 mL x 2), dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain 4-[[2-(difluoromethoxy)-3-methylphenyl]sulfonylamino]phthalic acid (2.7 g, yield 96%) as a brown solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 2.30 (3H, s), 6.80-7.21 (1H, m), 7.24 (1H, dd, J = 8.4, 2.4Hz), 7.32 (1H, s), 7.36-7.45 (1H, m), 7.57-7.69 (2H, m), 7.76 (1H, d, J = 6.8Hz), 10.93 (1H, s), 12.38-13.74 (2H, m); LC / MS (ESI) m / z = 424.1 [M + Na] + .
[0204]
[0347] Step 5: 2-(difluoromethoxy)-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindoline-5-yl]-3-methylbenzenesulfonamide (compound 8)
[0348] 4-[[2-(difluoromethoxy)-3-methylphenyl]sulfonylamino]phthalic acid (1.5 g, 3.74 mmol) and NaOAc (613 mg, 7.47 mmol) were dissolved in acetic acid (20 mL), to which 3-aminopiperidine-2,6-dione (720 mg, 4.37 mmol, hydrochloride) was added. The reaction mixture was then stirred at 100 °C for 12 hours. The reaction mixture was filtered and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by preparative HPLC (column: Phenomenex luna C18 150 × 40 mm × 15 μm, mobile phase: [water (FA)-ACN], gradient: 33% → 63% B over 15 minutes) to obtain compound 8 (1.26 g, yield 67%, purity 98.62%) as a pink solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.96-2.06 (1H, m), 2.30 (3H, s), 2.41-2.48 (1H, m), 2.59 (1H,d, J = 2.8 Hz), 2.79-2.93 (1H, m), 5.08 (1H, dd, J = 12.8, 5.2 Hz), 6.84-7.27(1H, m), 7.43 (1H, t, J = 8.0 Hz), 7.47-7.55 (2H, m), 7.65 (1H, d, J = 7.2 Hz),7.78-7.87 (2H, m), 11.10 (1H, s), 11.36 (1H, s); LC / MS (ESI) m / z = 494.2 [M + H] + .
[0205]
[0349] Reaction scheme 9: 2-Chloro-N-(2-(2,6-dioxopiperidine-3-yl)-1,3-dioxoisoindorin-5-yl)-3-(hydroxymethyl)benzenesulfonamide
[0350] [ka]
[0351] Step 1: 3-Bromo-2-chlorobenzenesulfonyl chloride
[0352] To a solution of 3-bromo-2-chloroaniline (2 g, 9.69 mmol) dissolved in water (20 mL), hydrochloric acid (12 M, 10.00 mL) and NaNO2 (804 mg, 11.65 mmol) were sequentially added while stirring. The reaction mixture was stirred at 0°C for 1 hour to obtain Solution 1. In a separate flask, SO2 (15 Psi) was bubbling in acetic acid (14 mL) at 0°C for 20 minutes to obtain Solution 2. Solution 2 was slowly added to Solution 1 at 0°C and stirred at the same temperature for 10 minutes. CuCl2 (848 mg, 6.31 mmol) was added, and the reaction mixture was stirred at 0°C for 1 hour. Water (80 mL) was poured into the reaction mixture and extracted with Depositphotos (50 mL x 3). The combined organic layers were washed with brine (50 mL x 3), dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether:ethyl acetate = 100:0 to 49:1) to obtain 3-bromo-2-chlorobenzenesulfonyl chloride (0.11 g, yield 4%) as a yellow oil. 1 H NMR (400 MHz, CDCl3) δ ppm 7.41 (1H, t, J = 8.0 Hz), 8.03 (1H, dd, J = 8.0, 1.6 Hz), 8.17(1H, dd, J = 8.0, 1.2 Hz).
[0206]
[0353] Step 2: Dimethyl-4-[(3-bromo-2-chlorophenyl)sulfonylamino]benzene-1,2-dicarboxylate (intermediate D6)
[0354] Dimethyl 4-aminobenzene-1,2-dicarboxylate (55 mg, 262.91 μmol) was added to a solution of 3-bromo-2-chlorobenzenesulfonyl chloride (110 mg, 379.36 μmol) in pyridine (2 mL). The reaction mixture was stirred at 25°C for 1 hour. The reaction mixture was concentrated, then water (20 mL) was added, and the reaction mixture was extracted with ELISA (30 mL x 3). The combined organic layer was washed with brine (10 mL), dried over Na₂SO₄, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO₂, petroleum ether:ethyl acetate = 10:1 to 4:1) to obtain intermediate D6 (60 mg, yield 46%, purity 93%) as a white solid. LC / MS (ESI) m / z = 431.9 [M - 32 + H] + .
[0207]
[0355] Step 3: 4-[(3-bromo-2-chlorophenyl)sulfonylamino]phthalic acid
[0356] Intermediate D6 (30 mg, 60.30 μmol) was dissolved in THF (1 mL), MeOH (1 mL), and water (1 mL). LiOH·H2O (11 mg, 266.38 μmol) was added to this solution. The reaction mixture was stirred at 50°C for 12 hours. The reaction mixture was adjusted to pH 4-5 by adding hydrochloric acid (2 M), then water (20 mL) was added, and the reaction mixture was extracted with HCl (10 mL x 3). The combined organic layer was washed with brine (20 mL x 3), dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain 4-[(3-bromo-2-chlorophenyl)sulfonylamino]phthalic acid (40 mg, crude product) as a yellow solid. LC / MS (ESI) m / z = 435.9 [M + H] + .
[0208]
[0357] Step 4: 3-Bromo-2-chloro-N-(2-(2,6-dioxopiperidine-3-yl)-1,3-dioxoisoindorin-5-yl)benzenesulfonamide
[0358] 4-[(3-bromo-2-chlorophenyl)sulfonylamide]phthalic acid (40 mg, 92.03 μmol) and 3-aminopiperidine-2,6-dione (20 mg, 121.51 μmol, hydrochloride) were dissolved in acetic acid (1 mL), to which NaOAc (10 mg, 121.91 μmol) was added. The reaction mixture was stirred at 100 °C for 12 hours. The reaction mixture was filtered and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by preparative HPLC (column: Phenomenex luna C18 150×25mm×10um, mobile phase: [water (FA)-ACN], gradient: 30%→50%B over 10 minutes) to obtain 3-bromo-2-chloro-N-(2-(2,6-dioxopiperidine-3-yl)-1,3-dioxoisoindorin-5-yl)benzenesulfonamide (8 mg, yield 17%) as a yellow solid. LC / MS (ESI) m / z = 528.0 [M + H] + .
[0209]
[0359] Step 5: 2-Chloro-N-(2-(2,6-dioxopiperidine-3-yl)-1,3-dioxoisoindorin-5-yl)-3-(hydroxymethyl)benzenesulfonamide (Compound 9)
[0360] To a solution of tributylstannylmethanol (8 mg, 24.92 μmol) and 3-bromo-2-chloro-N-(2-(2,6-dioxopiperidine-3-yl)-1,3-dioxoisoindorin-5-yl)benzenesulfonamide (8 mg, 15.19 μmol) dissolved in 1,4-dioxane (1 mL), palladium;triphenylphosphan (562 μg, 1.52 μmol) was added under nitrogen conditions at 25°C. The reaction mixture was stirred at 100°C for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the crude product. The crude product was purified by preparative HPLC (column: Phenomenex luna C18 150×25mm×10um, mobile phase: [water (TFA)-ACN], gradient: 28%→48%B over 7 minutes) to obtain compound 9 (5.42 mg, yield 73%, purity 97.68%) as a grayish-white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.93-2.07 (1H, m), 2.32-2.44 (1H, m), 2.55-2.69 (1H, m),2.76-2.93 (1H, m), 4.57 (2H, s), 5.07 (1H, dd, J = 12.8, 5.2 Hz), 5.42-5.65(1H, m), 7.45-7.54 (2H, m), 7.61 (1H, s), 7.82 (2H, t, J = 7.2 Hz), 8.10 (1H,d, J = 7.6 Hz), 11.10 (1H, s), 11.65 (1H, s); LC / MS (ESI) m / z = 478.2 (M + H) + .
[0361]
[0210]
[0362] Example 1: 2-(difluoromethoxy)-N-(2-(2,6-dioxopiperidine-3-yl)-1,3-dioxoisoindorin-5-yl)-3-ethylbenzenesulfonamide (compound 10)
[0363] [ka]
[0364] Compound 10 (53.78 mg, yield 51%, purity 98.89%) was obtained as a yellow solid by reacting intermediate A4 in the same manner as in steps 1-5 of reaction scheme 8. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.08-1.16 (3H, m), 1.97-2.05 (1H, m), 2.42-2.47 (1H, m),2.54-2.63 (1H, m), 2.65-2.75 (2H, m), 2.80-2.90 (1H, m), 5.03 (1H, dd, J =12.8, 5.6 Hz), 6.83-7.27 (1H, m), 7.42-7.54 (3H, m), 7.67-7.72 (1H, m),7.78-7.82 (2H, m), 11.10 (1H, s), 11.32 (1H, s); LC / MS (ESI) m / z = 508.2 [M +H] + .
[0211]
[0365] Example 2: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-ethyl-benzenesulfonamide (Compound 11)
[0366] [ka]
[0367] Compound 11 (7.8 mg, yield 65%, purity 98.96%) was obtained as a yellow solid by reacting intermediate A5 in the same manner as in steps 1-5 of reaction scheme 8. 1 H NMR (400 MHz, CD3OD) δ ppm 1.19 (3H, t, J = 7.6 Hz), 2.00-2.14 (1H, m), 2.62-2.86 (5H, m),5.07 (1H, dd, J = 12.8, 5.6 Hz), 7.38-7.46 (1H, m), 7.48-7.52 (1H, m), 7.56(1H, dd, J = 7.6, 2.0 Hz), 7.60 (1H, d, J = 1.6 Hz), 7.72 (1H, d, J = 8.4 Hz),8.09 (1H, dd, J = 8.0, 1.6 Hz); LC / MS (ESI) m / z = 476.1 [M + H] + .
[0368] Example 3: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-ethyl-4-fluorobenzenesulfonamide (Compound 12)
[0369] [ka]
[0370] Compound 12 (69.93 mg, 47% yield, 99.9% purity) was obtained as a white solid by reacting intermediate A6 in the same manner as in steps 1-5 of reaction scheme 8. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.07 (3H, t, J = 7.2 Hz), 1.95-2.05 (1H, m), 2.31-2.46 (1H, m),2.57-2.70 (1H, m), 2.71-2.80 (2H, m), 2.80-2.91 (1H, m), 5.07 (1H, dd, J =12.8, 5.6 Hz), 7.40-7.55 (3H, m), 7.75-7.87 (1H, m), 8.12 (1H, dd, J = 8.8, 5.6Hz), 11.09 (1H, s), 11.66 (1H, s); LC / MS (ESI) m / z = 494.2 [M + H] + .
[0212]
[0371] Example 4: N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-4-fluoro-3-methyl-2-(trifluoromethoxy)benzenesulfonamide (Compound 13)
[0372] [ka]
[0373] Compound 13 (13.58 mg, yield 26%, purity 98.87%) was obtained as a green solid by reacting intermediate A7 in the same manner as in steps 1-5 of reaction scheme 8. 1H NMR (400 MHz, CDCl3) δ ppm 2.08-2.19 (1H, m), 2.31 (3H, s), 2.68-2.99 (3H, m), 4.94 (1H,dd, J = 12.0, 5.2 Hz), 7.16 (1H, t, J = 8.0 Hz), 7.22 (1H, s), 7.44 (1H, d, J =7.2 Hz), 7.56 (1H, s), 7.76 (1H, d, J = 8.4 Hz), 7.89-8.02 (2H, m); LC / MS (ESI)m / z = 530.2 [M + H] + .
[0213]
[0374] Example 5: N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methyl-2-(trifluoromethyl)benzenesulfonamide (Compound 14)
[0375] [ka]
[0376] Compound 14 (9.39 mg, yield 27%, purity 97.57%) was obtained as a grayish-white solid by reacting with commercially available 1-bromo-3-methyl-2-(trifluoromethyl)benzene in the same manner as in steps 1-5 of reaction scheme 8. 1 H NMR (400 MHz, CDCl3) δ ppm 2.11-2.17 (1H, m), 2.59 (3H, q, J = 3.2 Hz), 2.70-2.83 (2H, m),2.87-2.97 (1H, m), 4.92-4.98 (1H, m), 7.47 (1H, LC / MS (ESI) m / z = 496.2 [M+H] + .
[0214]
[0377] Example 6: 2-Chloro-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-4-fluoro-3-methylbenzenesulfonamide (Compound 15)
[0378] [ka]
[0379] Compound 15 (15.26 mg, yield 41%, purity 99.84%) was obtained as a white solid by reacting commercially available 1-bromo-2-chloro-4-fluoro-3-methylbenzene in the same manner as in steps 1-5 of reaction scheme 8. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.95-2.04 (1H, m), 2.26 (3H, s), 2.58-2.68 (2H, m), 2.80-2.90(1H, m), 5.07 (1H, m), 7.35-7.54 (3H, m), 7.81 (1H, d, J = 8.8 Hz), 8.12 (1H,m), 11.09 (1H, s), 11.47-11.86 (1H, m); LC / MS (ESI) m / z = 480.2 [M + H] + .
[0215]
[0380] Example 7: N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-2,3-dimethylbenzenesulfonamide (compound 16)
[0381] [ka]
[0382] Compound 16 (74.33 mg, yield 39%, purity 98.92%) was obtained as a white solid by reacting commercially available 1-iodo-2,3-dimethylbenzene in the same manner as in steps 1-5 of reaction scheme 8. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.96-2.04 (1H, m), 2.28 (3H, s), 2.35-2.47 (1H, m), 2.53 (3H,s), 2.57-2.69 (1H, m), 2.80-2.92 (1H, m), 5.07 (1H, dd, J = 13.2, 5.6 Hz),7.26-7.38 (1H, m), 7.43-7.50 (3H, m), 7.70-7.95 (2H, m), 11.10 (1H, s), 11.46(1H, s); LC / MS (ESI) m / z = 442.2 [M+H] + .
[0216]
[0383] Example 8: N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-methyl-2-(trifluoromethoxy)benzenesulfonamide (Compound 17)
[0384] [ka]
[0385] Compound 17 (1.85 mg, yield 25%, purity 98.26%) was obtained as a white solid by reacting intermediate A8 in the same manner as in steps 1-5 of reaction scheme 8. 1 H NMR (400 MHz, CD3OD) δ ppm 2.01-2.26 (1H, m), 2.39 (3H, s), 2.59-2.97 (3H, m), 5.06 - 5.13(1H, m), 7.40-7.46 (1H, m), 7.48-7.52 (1H, m), 7.58-7.64 (2H, m), 7.71-7.77(1H, m), 7.91-7.98 (1H, m); LC / MS (ESI) m / z = 512.2 [M + H] + LC / MSt R = 2.253 minutes.
[0217]
[0386] Example 9: N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-4-fluoro-2,3-dimethylbenzenesulfonamide (compound 18)
[0387] [ka]
[0388] Compound 18 (79.37 mg, yield 41%, purity 98.26%) was obtained as a grayish-white solid by reacting with commercially available 4-fluoro-2,3-dimethylaniline in the same manner as steps 1-4 of reaction scheme 4. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.94-2.04 (1H, m), 2.16 (3H, s), 2.51-2.60 (5H, m), 2.79-2.92(1H, m), 5.07 (1H, dd, J = 12.8, 5.2 Hz), 7.18-7.30 (1H, m), 7.40-7.50 (2H, m),7.74-7.83 (1H, m), 7.93 (1H, dd, J = 8.8, 5.6 Hz), 11.09 (1H, s), 11.50 (1H, brs); LC / MS (ESI) m / z = 460.1 [M+H] + .
[0218]
[0389] Example 10: 2-bromo-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-3-ethyl-benzenesulfonamide (compound 19)
[0390] [ka]
[0391] Compound 19 (73.48 mg, 138.66 umol, 50% yield, 98.19% purity) was obtained as a yellow solid by reacting intermediate B1 in the same manner as in steps 1-4 of reaction scheme 4. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.15 (3H, t, J = 7.6 Hz), 1.95-2.07 (1H, m), 2.40-2.49 (2H, m),2.53-2.63 (1H, m), 2.75-2.93 (3H, m), 5.00-5.15 (1H, m), 7.45-7.55 (2H, m),7.55-7.61 (1H, m), 7.63-7.65 (1H, m), 7.80-7.83 (1H, m), 8.06-8.08 (1H, m),11.10 (1H, s), 11.61 (1H, m); LC / MS (ESI) m / z = 522.2 [M + H] + .
[0219]
[0392] Example 11: 2-bromo-N-[2-(2,6-dioxo-3-piperidyl)-1,3-dioxo-isoindorin-5-yl]-4-fluoro-3-methylbenzenesulfonamide (compound 20)
[0393] [ka]
[0394] Intermediate B2 was reacted in the same manner as in steps 1-4 of reaction scheme 4, and compound 20 was separated from the resulting mixture of two products to obtain compound 20 (22 mg, 39.94 umol, yield 49%, purity 95.19%) as a yellow solid. The structure of the compound was determined by NMR analysis. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.97-2.01 (1H, m), 2.28-2.33 (3H, m), 2.40-2.48 (1H, m),2.57-2.71 (1H, m), 2.81-2.93 (1H, m), 4.91-5.16 LC / MS (ESI)m / z = 524.1 [M + H] + .
[0220]
[0395]
[0396] [Example of experiment]
[0397] 1. Cell culture and materials
[0398] The NCI-H1155 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA) and maintained in RPMI 1640 (Roswell Park Memorial Institute Medium 1640, Cytiva) supplemented with 10% FBS, 2 mM L-glutamine, and 100 units / mL streptomycin-penicillin. The HL-60 cell line was purchased from the Korean Cell Line Bank (KCLB, Seoul, Korea) and maintained in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, and 100 units / mL streptomycin-penicillin. The NCI-H2023 cell line was purchased from ATCC and maintained in Dulbecco's Modified Eagle Medium (DMEM / F12 1:1 medium, Cytiva) mixed 1:1 with F12 supplemented with 5% FBS, 0.005 mg / mL insulin, 0.01 mg / mL transferrin, 30 nM sodium selenite, 10 nM hydrocortisone, 10 nM β-estradiol, and 100 units / mL streptomycin-penicillin. HEKa cell lines were purchased from ATCC and maintained in a Keratinocyte Growth Kit (ATCC) supplemented with 6 mM L-glutamine, 0.4% bovine pituitary extract, 0.5 ng / mL rhTGF-α, 100 ng / mL hydrocortisone hemysuccinate, 5 mg / mL rh insulin, 1 mM epinephrine, and 5 mg / mL apo-transferrin, as well as in Dermal Cell Basal Medium (ATCC) supplemented with 100 units / mL streptomycin-penicillin. HEK-293 hGSPT1 HiBiT-tagged cell lines were purchased from Synthego Corporation (Redwood City, CA) and maintained in DMEM medium supplemented with 10% FBS, 2 mM L-glutamine, and 100 units / mL streptomycin-penicillin.
[0221]
[0399] 2.CRBN binding ability analysis
[0400] CRBN binding ability analysis was commissioned by Eurofins and performed using the E3scan® platform. The experimental method used was as follows: CRBN-DDB1 protein complexes were generated using the HEK-293 cell line and then labeled with DNA for qPCR detection. Streptoavidin-coated magnetic beads were reacted with biotinylated small molecule ligands that bind to CRBN for 30 minutes to generate affinity beads immobilized with the small molecule ligands. The ligand-immobilized affinity beads were blocked with an excess of biotin and washed with blocking buffer (SeaBlock (Pierce), 1% BSA, 0.05% Tween20, 1 mM DTT) to remove unbound ligands and prevent nonspecific binding. The binding reaction was carried out by mixing CRBN-DDB1 ligase, affinity beads, and the test compound in 1× binding buffer (20% SeaBlock, 0.17× PBS, 0.05% Tween20, 6 mM DTT). The test compound was prepared in 100% DMSO solution at a concentration 111 times higher than the final concentration. The solution of the test compound was diluted to 11 concentrations by a 3-fold serial dilution. The test compound was dispensed with 100% DMSO using a non-contact dispensing method. Subsequently, the compound was directly diluted in the experimental solution to a final DMSO concentration of 0.9%. All reactions were carried out in a 384-well polypropylene plate. The final volume of each reaction solution was set to 0.02 mL. The experimental plate was allowed to react at room temperature with shaking for approximately 1 hour, and the affinity beads were washed with washing buffer (1× PBS, 0.05% Tween20). The beads were then redispersed in elution buffer (1×PBS, 0.05% Tween20, 0.5 μM non-biotinylated affinity ligand) and reacted at room temperature for approximately 30 minutes with shaking. The CRBN-DDB1 concentration in the eluate was measured by qPCR. Kd was calculated by analyzing solutions of the test compound at 11 concentrations and three control groups (DMSO).
[0222]
[0401] Reference compound 1 and reference compound 2 are compounds having the following structures, described as "compound 1" and "compound 5" in International Publication No. 2022 / 066835.
[0402] [ka]
[0223]
[0403] The results of the analysis of the binding ability to the CRBN-DDB1 complex in this experimental example are shown in Table 1 below.
[0404] [Table 1]
[0224]
[0405] The example compounds showed binding ability to CRBN-DDB1 (low Kd) that was equal to or higher than that of reference compounds 1 and 2. However, since binding ability to CRBN-DDB1 does not necessarily translate to GSPT1 degradation activity, GSPT1 degradation activity was also evaluated as described below.
[0225]
[0406] 3. Evaluation of GSPT1 degradation ability
[0407] Generation of the HEK293 HiBiT-GSPT1 cell line
[0408] The HEK293 cell line expressing HiBiT-GSPT1 was generated by Synthego (California, USA). A DNA donor capable of expressing the HiBiT protein fragment consisting of 11 amino acids (VSGWRLFKKIS (SEQ ID NO: 1)) was used (CCACTCCTCTCCGGCCGGGCGCCCCTGCCTCCATTTCCCGCTCTCTGTCCACCACACACACGGCCCCCCCGATAATG). GTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCGGCGGTAGCGATCCGGGCAGTGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGGAGCAGCAGCGGCAGCAGCAGCAGCGACTCGGC (Sequence ID 2, the underlined portion being the HiBiT nucleotide sequence) was generated and injected into HEK293 cells using electroporation along with a CRISPR / Cas9 system capable of inducing double-strand breaks at the N-terminus of the GSPT1 gene. Single clones were obtained from the cell lines in which gene editing was induced by single-cell sorting. To verify the accuracy of gene editing, the edited GSPT1 gene sequence from the obtained single clone was amplified using the following two primers [Forward (5'-3'): TTGGCGTTGACGTTGAGTTG (Sequence ID 3), Reverse (5'-3'): ACACGAGGAGGAGGGTTGAG (Sequence ID 4)], and the edited HiBiT-GSPT1 gene sequence was determined by Sanger sequencing.
[0226]
[0409] hGSPT1 HiBiT Analysis
[0410] HEK-293 hGSPT1 HiBiT-tagged cells were seeded in triple rows in a white 96-well analysis plate at a density of 5,000 cells per well. After incubation overnight, cells were treated with final concentrations of the test compound (1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 1 μM, 3 μM, and 10 μM) using a medium mixed with the test compound at 3x concentrations. After incubation for 72 hours, the levels of GSPT1 HiBiT-tagged protein were assessed using the Nano-Glo® HiBiT Lytic Detection System (Promega) as described by the manufacturer. Luminescence signals were measured using a Varioskan LUX multimode microplate reader.
[0227]
[0411] GSPT1 degradation activity is EC 50 DC 50 , and D maxThe evaluation was conducted from three aspects. Dmax(%) represents the maximum decomposition of GSPT1 at the highest concentration. In addition, D calculated in each experiment was obtained using 4-parameter logistic regression. max Assuming the value was the most effective, relative EC 50 The value was calculated. In this test system, the concentration required to induce a 50% degradation of GSPT1 in absolute terms is DC. 50 By defining DC 50 Calculated. EC 50 DC 50 , and D max The calculated values are shown in Table 2 below.
[0228]
[0412] [Table 2]
[0229]
[0413] For reference compound 2, the Dmax is 42.8%, and DC 50 It was greater than 10 μM. Reference compound 1 was EC 50 = 198.3 nM, DC 50 =454.5nM, D max =78.3%, showing better GSPT1 degradation activity than reference compound 2. On the other hand, the example compound showed better EC than reference compound 1 and reference compound 2. 50 DC 50 , and D max From that perspective, it showed equivalent or improved results.
[0230]
[0414] 4. Test method for determining GSPT1 degradation ability by immunoblot analysis
[0415] To determine whether the results of the GSPT1 HiBiT test, an artificially created test system for high-throughput screening of compounds, can be reproduced in cancer cell lines, and to determine the selectivity of the compounds of the present invention for the degradation of various neosubstrates, the NCI-H1155 lung cancer cell line was treated with the example compounds, and then the expression levels of GSPT1 and other known neosubstrates were determined by immunoblotting.
[0231]
[0416] NCI-H1155 cells were seeded in a 6-well plate (2 × 10 cells per well). 6 (1 cell). After incubation overnight, cells were treated with reference compounds 1, 3, 4, and 5 at concentrations of 0 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, and 1000 nM, respectively. Cells were harvested after 6 hours. In addition, to observe the time course of GSPT1 degradation, cells were treated with reference compounds 1, 2, 3, 4, 8, and 11 at concentrations of 100 nM, respectively. Cells were harvested at 0 hours, 2 hours, 4 hours, 8 hours, 24 hours, 48 hours, and 72 hours. The harvested cells were centrifuged, washed with PBS, lysed in RIPA buffer supplemented with a protease inhibitor cocktail (Roche) and a phosphatase inhibitor cocktail (Roche), and then frozen overnight in a cryogenic freezer at -80°C. The samples were thawed on ice, centrifuged, and 1× LDS loading buffer and 1× reducing agent were added, and the samples were heated to 95°C. The prepared samples were loaded onto NuPAGE 4-12% Bis-Tris protein gels and transferred to nitrocellulose membranes. The membranes were blocked with 5% bovine serum albumin and incubated overnight with primary antibodies. The corresponding protein signals were then detected using HRP-conjugated secondary antibodies and an iBright CL1500 imaging system. The antibodies used were as follows:
[0232]
[0417] Primary antibodies: Rabbit anti-human eRF3 / GSPT1 [EPR22908-103] (ab234433, abcam), rabbit anti-human IKAROS (5443, CST), rabbit anti-human HELIOS (D8W4X) (42427, CST), rabbit anti-human AIOLOS (D1C1E) (15103, CST), rabbit anti-human CK1a [EPR1961(2)] (ab108296, abcam), mouse anti-human SALL4 (ab57577, abcam), mouse anti-β-actin-peroxidase antibody (A3854, Sigma), and rabbit anti-human N-MYC (D1V2A) (84406, CST)
[0233]
[0418] Secondary antibodies: goat anti-rabbit IgG, HRP-conjugated (7074, CST) and equine anti-mouse IgG, HRP-conjugated (7076, CST).
[0419] The results of measuring the degradation activity of GSPT1 and various neosubstrates are shown in Figures 1 and 2.
[0420] Compounds 3, 4, and 5 all exhibited GSPT1 degradation activity equivalent to or improved compared to reference compound 1 (see Figure 1). In addition, none of the evaluated example compounds significantly affected the expression levels of other neosubstrates, even at the highest concentrations. As a result, it was confirmed that the compounds of the present invention exhibit selective degradation activity against GSPT1.
[0234]
[0421] On the other hand, when cancer cell lines were treated with reference compound 1 at a concentration of 100 nM and the degree of GSPT1 degradation over time was observed, the GSPT1 expression level gradually decreased up to 24 hours, but then increased again between 48 and 72 hours (see Figure 2). In contrast, compounds 2, 3, 4, 8, and 11 showed a stable decrease in GSPT1 expression levels throughout the measurement period. Therefore, it was confirmed that the compounds of the present invention exhibit significantly more stable and sustained GSPT1 degradation activity compared to reference compound 1.
[0235]
[0422] 5. Real-time cell proliferation analysis
[0423] To determine whether the duration of GSPT1 degradation affects the ability to inhibit cancer cell growth, cancer cells were treated with reference compound 1 and example compounds, and then real-time cancer cell growth was measured using the Incucyte S3 live cell analysis system (Sartorius, Ann Arbor, MI, USA).
[0236]
[0424] Real-time cell proliferation analysis was performed at Seoul National University. NCI-H1155 cells were seeded in a clear 96-well plate at a density of 4,000 cells per well. The cells were cultured overnight at 37°C in a humidified 5% CO2 incubator, and then treated with various concentrations of reference compound 1 and test compounds. After treatment with the compounds, cell growth was measured in real time for 72 hours using the Incucyte S3 live cell analysis system (Sartorius, Ann Arbor, MI, USA). The measurement results are shown in Figure 3.
[0237]
[0425] When treated with 100 nM reference compound 1, NCI-H1155 lung cancer cells tended to inhibit cell growth up to 48 hours, but cell growth rapidly increased after 48 hours (shown as black circles in Figure 3). This is consistent with the result that GSPT1 expression levels rebounded from 48 hours after treatment with 100 nM reference compound 1 (Figure 2). EC of reference compound 1 50 Considering that the concentration is 198.3 nM (see Table 2), these results suggest that reference compound 1 does not exhibit a sustained GSPT1 degradation effect at doses effective for GSPT1 degradation.
[0238]
[0426] In contrast, compounds 3, 4, 5, 15, and 19 showed sustained inhibition of cancer cell growth at a concentration of 100 nM (indicated as black circles in Figure 3). These compounds showed no rebound in cell growth, or only a very slight rebound, compared to reference compound 1, even at relatively low concentrations of 30 nM (indicated as black diamonds in Figure 3), as well as at 100 nM. Overall, it was confirmed that the compounds of the present invention can induce GSPT1 degradation and inhibition of cancer cell growth more consistently and stably than reference compound 1.
[0239]
[0427] 6.pH stability
[0428] Approximately 1 mg of reference compound 1 (MW=497.40) powder was added to a 20 mL bottle, 10 mL of MeOH was added, and then it was mixed well. Approximately 2.4 g of acetic acid, 2.48 g of boric acid, and 3.92 g of phosphoric acid were placed in a 500 mL bottle, 500 mL of purified water was added, and then it was mixed well. The mixed solution was divided equally into seven bottles and adjusted to pH 2.7, pH 4.4, pH 5.2, pH 6.0, pH 7.1, pH 8.1, and pH 9.1 using 1 N HCl solution or 1 N NaOH solution. 10 μL of the MeOH solution of reference compound 1 was transferred to the seven bottles, 990 μL of buffer solution was added, and then it was mixed well. Approximately 2 mg of compound 3 (MW=461.88) powder was placed in a 2 mL flask and then dissolved by adding 1 mL of DMSO. Approximately 2.4 g of acetic acid, 2.48 g of boric acid, and 3.92 g of phosphoric acid were placed in a 500 mL bottle, 500 mL of purified water was added, and the mixture was thoroughly mixed. The mixed solution was divided equally into six bottles and adjusted to pH 2.0, pH 4.0, pH 7.0, pH 8.0, pH 9.0, and pH 11.0 using 1 N HCl solution or 1 N NaOH solution. 10 μL of compound 3 solution (2 mg / ml DMSO solution) was transferred to the six bottles, 990 μL of buffer solution was added, and the mixture was thoroughly mixed. HPLC analysis was performed under the conditions described in Tables 3 and 4 below.
[0240]
[0429] [Table 3]
[0430] [Table 4]
[0241]
[0431] The results of measuring the pH stability of reference compound 1 and compound 3 are shown in Tables 5 and 6, respectively.
[0432] [Table 5]
[0433] [Table 6]
[0242]
[0434] As shown in Table 5, the residual amounts of reference compound 1 were only 87%, 86.5%, and 79.2% after 24 hours in buffer solutions at pH 4.4, pH 5.2, and pH 6.0, respectively. Furthermore, under neutral conditions at pH 7.1, reference compound 1 began to show instability at 87.4% residual amount after 4 hours, and after 24 hours, the residual amount was only 54.2%. This indicates that reference compound 1 was extremely unstable (Table 5). From the above results, it can be seen that reference compound 1 is unstable at physiological pH (neutral pH) and does not exhibit sustained efficacy. This is consistent with the results showing that GSPT1 expression levels recovered 48 hours after treatment of cancer cell lines with reference compound 1 (Figure 2), and that cell proliferation resumed (Figure 3).
[0243]
[0435] In contrast, compound 3 was extremely stable at pH 4.0 for 24 hours and remained stable throughout the experiment even under neutral conditions of pH 7.0 (81.12% of the compound remained after 24 hours). Therefore, it was confirmed that compound 3 exhibits superior pH stability compared to reference compound 1. From the above results, it can be seen that compound 3 can act more stably than reference compound 1 at physiological pH (neutral pH). The above results are consistent with the results shown in Figures 2 and 3. Unlike reference compound 1, treatment of cancer cell lines with compound 3 stably reduced GSPT1 expression levels for 72 hours (Figure 2), and there was no rebound in cell proliferation (Figure 3).
[0244]
[0436] 7. Proteomics analysis using TMT-labeled mass spectrometry
[0437] To determine whether the compound of the present invention selectively degrades only GSPT1 at the level of the entire intracellular proteome, TMT-labeled proteomics analysis was performed.
[0245]
[0438] Cell lysing solutions were prepared by dissolving tablets containing protease inhibitors and phosphatase inhibitors in a mixed solution of 8M urea, 1% SDS, and 50mM Tris, pH 8.5. Three samples with DMSO, four samples with compound 3, and four samples with compound 4 were used to treat HL60 cell lines for 4 hours each, and then the cells were lysed with the cell lysing solution. The lysed cell solutions were subjected to three 10-second treatments on ice using an ultrasonic homogenizer, and then centrifuged at 14,000 g for 15 minutes at 4°C. Only the supernatant was separated and subjected to proteomics analysis at the Korea Basic Science Institute (KBSI). Each sample was digested into peptide fragments using an S-Trap mini-spin column (Protifi, USA) according to the manufacturer's recommended method. Each pre-treated sample was labeled with TMT using the 11Plex TMT labeling kit (Thermo Scientific) according to the manufacturer's recommended method. Next, mass spectrometry was performed using an LC-MS / MS system consisting of an UltiMate 3000 RSLCnano system (Thermo Fisher Scientific) equipped with an Orbitrap Eclipse Tribrid mass spectrometer (Thermo Fisher Scientific) and a nanoelectrospray source (EASY-Spray Sources, Thermo Fisher Scientific). The results were analyzed by filtering for only reliable peptides with a global FDR < 1% and the highest-ranked protein fragments, and only proteins with a normalized spectral count of 4 or higher were used for analysis.
[0246]
[0439] Figure 4 shows the results of the quantitative analysis of 6,534 endogenous proteins. As shown in Figure 4, compounds 3 and 4 reduced only the abundance of GSPT1 in the overall proteome. These results support the idea that compounds 3 and 4 exhibit a selective profile for GSPT1 at the overall proteome level and possess neosubstrate specificity for GSPT1 only.
[0247]
[0440] 8. Evaluation of inhibitory ability on protein translation rate
[0441] GSPT1 is an enzyme that mediates the termination step of protein translation, and degradation of GSPT1 slows down the rate of protein translation. Therefore, degradation of GSPT1 is known to induce suppression of the expression levels of oncogenic proteins (e.g., c-MYC, N-MYC, L-MYC, BCL-2, MCL-1, etc.) that are maintained at high expression levels in cancer cells in a protein translation-dependent manner (Mullard, Nat Rev Drug Discov. 2022, 21:865~867). On the other hand, degradation of GSPT1 is known to activate a cell death mechanism called the "integrative stress response" (Surka et al., Blood 2021, 137(5):661~677). This response is mediated by ATF-4 and is known to ultimately lead to caspase-3 dependent cell death.
[0248]
[0442] In NCI-H1155, a lung cancer cell line known to be highly sensitive to GSPT1 degradation agents in inducing cell death, the rate of protein translation was measured using puromycin to determine whether pharmacodynamic changes were induced by the compound of the present invention. Puromycin is a commonly used substance for measuring the rate of protein translation because it can be inserted into the protein sequence in place of tyrosyl-tRNA during the protein translation process.
[0443] The NCI-H1155 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA). Cells were cultured in RPMI 1640 medium (Cytiva) as recommended. The HL-60 cell line was purchased from the Korean Cell Line Bank (KCLB, Seoul, Korea) and cultured in RPMI 1640 (Cytiva) supplemented with 10% FBS, 2 mM L-glutamine, and 100 units / mL streptomycin-penicillin. The NCI-H2023 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA). Cells were cultured in DMEM / F12 1:1 medium (Cytiva) as recommended.
[0249]
[0444] NCI-H1155 cells, HL-60 cells, and NCI-H2023 cells were seeded in 6-well plates (2 × 10 cells per well). 6 (Individual). After incubation overnight, the following experiment was performed.
[0250]
[0445] First, NCI-H1155 cells were treated with 1 μM compound 3. Six hours after compound treatment, the cells were treated with 1 μM puromycin. Cells were collected at 0, 10, 20, 30, and 60 minutes after puromycin treatment. NCI-H2023 cells were similarly treated with 1 μM compound 3 and reference compound 1, respectively. Forty-eight hours after compound treatment, the cells were treated with 1 μM puromycin. Cells were collected at 0, 30, 60, and 90 minutes after puromycin treatment. The DMSO-treated group was used as a control group.
[0251]
[0446] On the other hand, to confirm the effect of compound 3 on inhibiting protein translation on the expression level of the downstream oncogenic protein N-MYC, NCI-H1155 cells were treated with 1 μM compound 3. Protein translation was labeled by treatment with 1 μM puromycin at 0, 2, 4, 8, and 24 hours after compound treatment. Cells were harvested 30 minutes after puromycin treatment. In addition, to confirm the expression levels of N-MYC, ATF-4, and cleavage caspase 3, NCI-H1155 cells and HL60 cells were treated with 0.3 μM and 1 μM compound 3, respectively. Cells were harvested at 0, 2, 4, 6, 8, and 24 hours.
[0252]
[0447] Cells collected at each time point were centrifuged, washed with PBS, lysed in RIPA buffer supplemented with a protease inhibitor cocktail (Roche) and a phosphatase inhibitor cocktail (Roche), and then frozen overnight in a -80°C cryogenic freezer. The samples were thawed on ice, centrifuged, and heated to 95°C with the addition of 1× LDS loading buffer and 1× reducing agent. The prepared samples were loaded onto NuPAGE 4-12% Bis-Tris protein gels and transferred to nitrocellulose membranes. The membranes were blocked with 5% bovine serum albumin and incubated overnight with primary antibodies. The corresponding protein signals were then detected using HRP-conjugated secondary antibodies and an iBright CL1500 imaging system. The antibodies used were as follows:
[0253]
[0448] Primary antibodies: Mouse anti-puromycin (MABE343, sigma), rabbit anti-human eRF3 / GSPT1 [EPR22908-103] (ab234433, abcam), rabbit anti-human ATF-4 (D4B8) (11815, CST), rabbit anti-human cleaved caspase-3 (Asp175) (9661, CST), mouse anti-β-actin-peroxidase antibody (A3854, Sigma)
[0254]
[0449] Secondary antibodies: Equine anti-mouse IgG, HRP-conjugated (7076, CST), goat anti-rabbit IgG, HRP-conjugated (7074, CST)
[0255]
[0450] The analysis results are shown in Figures 5 to 8.
[0256]
[0451] As shown in Figure 5, when treated with compound 3, the protein translation rate, along with GSPT1 degradation, was significantly reduced compared to the DMSO control group. As shown in Figure 6, inhibition of protein translation due to GSPT1 degradation was observed approximately 4 hours after treatment with compound 3, and the expression level of the downstream oncogenic protein N-MYC was suppressed 24 hours after treatment with compound 3, when protein translation was completely inhibited (Figure 6, left). This indicates that GSPT1 degradation, inhibition of protein translation, and a decrease in N-MYC expression levels occur sequentially. A decrease in N-MYC expression levels was also observed 24 hours after treatment with compound 3 in samples not labeled with puromycin (Figure 6, right). In addition, as GSPT1 expression decreased, the expression of ATF-4 protein, which mediates the integrated stress response, increased, and the activation (cleavage) of caspase 3, which induces cell death, was sequentially induced 24 hours after treatment with compound 3 (Figure 6, right). These pharmacodynamic changes were also observed in the acute myeloid leukemia (AML) cell line HL60 (Figure 7).
[0257]
[0452] On the other hand, in NCI-H2023 cells, in which cell death is not known to be induced by GSPT1 degradation, compound 3 only partially inhibited GSPT1 degradation and therefore did not inhibit protein translation (Figure 8, left). In contrast, reference compound 1 was observed to exhibit strong GSPT1 degradation activity and inhibit protein translation even in NCI-H2023 cells (Figure 8, right). The above results support the usefulness of the compounds of the present invention as personalized medicines, as they exhibit particularly excellent anticancer activity against carcinomas sensitive to GSPT1 degradation.
[0258]
[0453] 9. Analysis of cell viability
[0454] The inhibitory efficacy of the compounds of the present invention on cell proliferation was observed using the lung cancer cell line NCI-H1155, and the acute myeloid leukemia (AML) cell lines HL60, MOLM13, MOLM14, MV-4-11, and U937.
[0259]
[0455] The NCI-H1155 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA). Cells were cultured in RPMI 1640 medium (Cytiva) as recommended. Exponentially growing NCI-H1155 cells were plated at 6,000 cells per well in SPL33596 white 96-well analysis plates and cultured overnight at 37°C in a humidified 5% CO2 incubator. Cells were finally treated with medium mixed with 3x concentrated test compounds at concentrations of 1.5 nM, 4.6 nM, 13.7 nM, 41.2 nM, 123.5 nM, 370.4 nM, 1.111 μM, 3.333 μM, and 10 μM. The HL-60 cell line was purchased from the Korean Cell Line Bank (KCLB, Seoul, Korea). Cells were cultured in RPMI 1640 medium (Cytiva) as recommended. Exponentially growing HL-60 cells were plated at 4,000 cells per well in SPL33596 white 96-well analysis plates and cultured overnight at 37°C in a humidified 5% CO2 incubator. Cells were finally treated with medium mixed with 3x concentrations of the test compound at concentrations of 1.5 nM, 4.6 nM, 13.7 nM, 41.2 nM, 123.5 nM, 370.4 nM, 1.111 μM, 3.333 μM, and 10 μM. After incubation for 72 hours, cytotoxicity was measured using Promega Cell Titer Glo reagent as recommended by the manufacturer. Luminescence signals were measured using a Varioskan LUX multimode microplate reader. Relative IC50 was measured as in the experiment described in "3. Evaluation of GSPT1 Degradation Ability" above. 50 and absolute IC 50The following calculations were performed. Experiments using MOLM13, MOLM14, MV-4-11, and U937 cell lines were commissioned by Seoul National University and performed using WST-8 reagent under 72-hour drug treatment conditions. Exponentially growing MOLM13, MOLM14, MV-4-11, and U937 cells were plated at 4,000 cells per well in SPL30096 transparent 96-well analysis plates, respectively, and cultured overnight at 37°C in a humidified 5% CO2 incubator. Cells were finally treated with medium mixed with 2x concentration test compounds at concentrations of 1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, and 10 μM. After incubation for 72 hours, cytotoxicity was measured using CELLOMAX® WST-8 reagent (PRECAREGENE, CM-VA0500) according to the manufacturer's recommendations. Light absorption at a wavelength of 450 nm was measured using a SpectraMAX i3x microplate reader (Molecular Devices, SpectraMAX i3x).
[0260]
[0456] The results of evaluating the cell proliferation activity of compounds in various cancer cell lines are shown in Table 7 below.
[0457] [Table 7]
[0261]
[0458]
[0459] As shown in Table 7 above, compounds 1-20 generally showed improved anticancer efficacy compared to reference compound 1 and reference compound 2 in the lung cancer cell lines and AML cell lines tested.
[0262]
[0460] Meanwhile, we commissioned Wuxi Apptec to conduct cell proliferation inhibition experiments on various cell lines of small cell lung cancer (SCLC) and lung adenocarcinoma (LUAD).
[0263]
[0461] Small cell lung cancer (SCLC): NCI-H526, NCI-H69, NCI-H2029, NCI-H889, NCI-H1963, NCI-H524, NCI-H82, NCI-H446, NCI-H211, SHP77
[0264]
[0462] Lung adenocarcinoma (LUAD): NCI-H1975, A549, NCI-H358, NCI-H460
[0463] Exponentially growing cells were plated onto Greiner CELLSTAR #655090 black 96-well analysis plates at cell counts per well under conditions specified by Wuxi Apptec, and incubated overnight at 37°C in a humidified 5% CO2 incubator. Cells were ultimately treated with culture media mixed with the test compound at concentrations 10 times higher than the target concentration, at concentrations of 1.5 nM, 4.6 nM, 13.7 nM, 41.2 nM, 123.5 nM, 370.4 nM, 1.111 μM, 3.333 μM, and 10 μM. After incubation for 72 hours, cytotoxicity was measured using Promega Cell Titer Glo reagent according to the manufacturer's recommendations. Luminescence signals were measured using a 2104 EnVision microplate reader (PerkinElmer, 2104 EnVision Multilabel Reader).
[0265]
[0464] As shown in Figure 9a, compounds 3 and 4 showed only slight cell proliferation inhibitory activity against LUAD cell lines, but exhibited excellent overall anticancer effects against SCLC cell lines.
[0266]
[0465] Since SCLC is primarily known as a carcinoma exhibiting a neuroendocrine phenotype (Nat Rev Dis Primers. 2021 / 1 / 14;7(1):3.), we investigated whether the compounds of the present invention exhibit anticancer efficacy against neuroendocrine pulmonary carcinoma (pulmonary NEC), a type of non-small cell lung cancer (NSCLC) that exhibits a neuroendocrine phenotype, and against neuroendocrine prostate cancer (NEPC), a type of prostate cancer that exhibits a neuroendocrine phenotype and is known to have a very poor prognosis. This experiment was performed by Wuxi Apptec, as well as with cells derived from small cell lung cancer (SCLC) and lung adenocarcinoma (LUAD).
[0267]
[0466] Pulmonary neuroendocrine carcinoma (pulmonary NEC): NCI-H1770, NCI-H2106
[0467] Neuroendocrine prostate cancer (NEPC): NCI-H660
[0268]
[0468] EC of Compounds 3 and 4 related to LUAD cell line, SCLC cell line, lung NEC cell line, and NEPC cell line 50 The results of the calculations are shown in Figure 9b. As shown in Figure 9b, compounds 3 and 4 hardly inhibited the proliferation of LUAD cells, but showed excellent cell proliferation inhibitory activity against SCLC, pulmonary NEC, and NEPC. Therefore, it was found that the compounds of the present invention, which have excellent GSPT1 degradation activity, exhibit particularly excellent anticancer effects against carcinomas showing a neuroendocrine phenotype. This supports the usefulness of the compounds of the present invention as personalized medicines.
[0269]
[0469] 10. Cytotoxicity testing and derivation of therapeutic range in normal cells
[0470] We investigated whether the compounds of the present invention exhibit safety in normal cells and, consequently, an improved therapeutic range. For this purpose, we compared and evaluated the cytotoxicity of the compounds using HEKa cells, which are primary skin cells donated from healthy adults.
[0270]
[0471] HEKa cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA). Cells were cultured in dermal cell basal medium (ATCC) as recommended. HEKa cells were plated at 10,000 cells per well in SPL33596 white 96-well analysis plates and cultured overnight at 37°C in a humidified 5% CO2 incubator. Cells were treated with medium mixed with 3x concentrated test compounds at concentrations of 1.5 nM, 4.6 nM, 13.7 nM, 41.2 nM, 123.5 nM, 370.4 nM, 1.111 μM, 3.333 μM, and 10 μM. After 72 hours of incubation, cytotoxicity was measured using Promega Cell Titer Glo reagent as recommended by the manufacturer. Luminescence signals were measured using a Varioskan LUX multimode microplate reader. Absolute IC50 was measured similarly to the experiment described in "3. Evaluation of GSPT1 Degradation Ability" above. 50 I calculated it.
[0271]
[0472] Table 8 shows the results of comparing the cytotoxicity of compounds against normal cells. The therapeutic index in Table 8 is the IC of NCI-H1155 and HL60 listed in Table 7. 50 The calculation was performed using the values.
[0473] [Table 8]
[0272]
[0474] As shown in Table 8, the compounds of the present invention were found to be safer and have a broader therapeutic range compared to reference compound 1, due to their overall lower cytotoxicity to normal cells (HEKa cells).
[0273]
[0475] In addition, Figure 10 shows a comparison of the in vitro therapeutic index of reference compound 1 with that of compounds 3 and 4.
[0274]
[0476] As shown in Figure 10, reference compound 1 did not show a significant difference between the concentration that exhibited anticancer activity against NCI-H1155 or HL60 and the concentration that exhibited cytotoxicity against HEKa cells (i.e., it showed a low therapeutic index). In contrast, compounds 3 and 4 showed a significantly broader therapeutic range (significantly higher therapeutic index) compared to reference compound 1. In particular, compound 3 showed almost no cytotoxicity against HEKa cells and exhibited a very broad therapeutic range (Figure 10, bottom).
[0275]
[0477] 11. Evaluation of in vivo anticancer efficacy using acute myeloid leukemia (AML) cell lines
[0478] Champions Oncology was commissioned to evaluate the in vivo anticancer efficacy of acute myeloid leukemia (AML) cell lines, and the evaluation was performed according to Champions Oncology's internal IACUC guidelines. First, the HL60-Luc cell line (5 × 10 cells), which is an HL60 cell line of acute myeloid leukemia labeled with luciferase, was evaluated. 6 Compound 3 (1 cell / 0.2 mL of PBS) was injected into the tail vein of fully immunodeficient 6-8 week old female NCG mice (Charles River). Bioluminescence was quantified to measure the progression of acute myeloid leukemia (AML). Bioluminescence was recorded from 4 to 10 days post-transplant. When bioluminescence greater than the background value (bioluminescence of mice without HL60 cell transplantation) was measured in more than 90% of all subjects, the animals were randomly assigned to each group and administration of compound 3 was initiated. Compound 3 was prepared by dissolving it in a mixture of 5% DMSO, 10% Solutol HS-15, and 85% sterile saline. Compound 3 was administered orally to each group at doses of 5 mg / kg once daily, 15 mg / kg once or twice daily, and 30 mg / kg once daily. Bioluminescence was measured both dorsally and ventrally, based on total luminescence (total luminous flux, photons / second, number of photons per second). AML progression was measured both dorsally and ventrally twice a week until the end of medication, and then once a week thereafter. Body weight was measured twice a week.
[0276]
[0479] Figure 11a shows the results of evaluating the efficacy of the compounds in an HL-60-Luc AML animal model. As shown in Figure 11a, compound 3 inhibited the progression of AML when administered orally at a dose of 5 mg / kg once daily. Furthermore, at doses of 15 mg / kg once daily or higher, compound 3 showed tumor remission in addition to inhibiting the progression of AML.
[0277]
[0480] On the other hand, to confirm whether the progression of AML remained suppressed after discontinuation of medication, the mice were followed up until day 60 of the experiment. As a result, when compound 3 was administered at a dose of 15 mg / kg twice daily, no recurrence of AML occurred even more than one month after discontinuation of medication. Compound 3 was confirmed to be safe as it did not cause weight loss in the mice at the administered dose (Figure 11b). Weight loss was observed in the experimental group where AML progressed rapidly, regardless of medication. As a result of the above experiment, compound 3 was confirmed to be safe in vivo and to have excellent anticancer efficacy.
[0278]
[0481] 12. Evaluation of in vivo anticancer efficacy using lung cancer cell lines
[0482] We commissioned Seoul National University to evaluate the in vivo anticancer efficacy of lung cancer cell lines, and the evaluation was conducted according to Seoul National University's internal IACUC guidelines. H1155 cell line 5×10 6 Compound 3 was subcutaneously transplanted into 5-week-old female Balb / c nude mice. The body weight and tumor volume of the mice were measured every 3 days. Compound 3 was prepared by dissolving compound 3 in a mixture of 5% DMSO, 10% Solutol HS-15, and 85% sterile saline. Compound 4 was prepared by dissolving compound 4 in a mixture of 5% NMP, 5% Solutol HS-15, and 90% sterile saline. The tumor volume was approximately 100 mm³. 3Compounds 3 and 4 were administered starting from the point when the patient reached a certain level. Compound 3 was administered for 5 days at doses of 5 mg / kg once daily, 15 mg / kg once daily, 30 mg / kg once daily, 15 mg / kg twice daily, or 30 mg / kg, followed by a 9-day rest period. Compound 4 was administered orally once daily at doses of 3 mg / kg and 10 mg / kg for 6 days. Cancer tissue was removed 6 and 24 hours after the final dose, and pharmacodynamic changes were observed.
[0279]
[0483] The results of evaluating the therapeutic action and anticancer efficacy of compounds 3 and 4 in an animal model of NCI-H1155 lung cancer are shown in Figures 12 and 13.
[0280]
[0484] When compound 4 was administered at a dose of 3 mg / kg, the protein expression level of GSPT1 was partially decreased 6 and 24 hours after the end of administration, but no significant change was observed in the expression level of the downstream oncogenic protein N-MYC. In contrast, when compound 4 was administered at a dose of 10 mg / kg, the protein expression level of GSPT1 was completely decreased 6 and 24 hours after the end of administration, and the expression level of the downstream oncogenic protein N-MYC was also significantly decreased (Figure 12a). In addition, when compound 4 was administered at a dose of 10 mg / kg, the tumor volume was significantly reduced on day 6 (Figure 12b).
[0281]
[0485] On the other hand, compound 3 significantly reduced tumor growth without significant weight loss at all evaluated doses (Figure 13). Furthermore, similar to the results in the AML animal model, compound 3 inhibited the growth of lung cancer tissue and showed complete tumor regression at doses of 15 mg / kg once daily or higher. In addition, follow-up was conducted up to day 40 of the experiment to confirm whether lung cancer recurrence was still suppressed after discontinuation of the drug. As a result, with the exception of one out of nine animals, no lung cancer recurrence was observed even about one month after discontinuation of the drug when compound 3 was administered at a dose of 15 mg / kg twice daily.
[0282]
[0486] The present invention has been described herein based on exemplary embodiments. However, it should be understood that the present invention is not limited to the embodiments described, and that all modifications, alterations, modifications, and alternative forms that do not depart from the spirit and essential features of the invention are within the scope of the invention.
Claims
1. A compound represented by the following formula I, or its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt. [Formula I] 【Chemistry 1】 [In formula I, R 1 is halogen, C 1 to C 6 alkyl, C 1 to C 6 alkoxy, C 1 to C 6 haloalkyl, or C 1 to C 6 haloalkoxy, and R 2 However, R 2a C may be replaced with 1 ~C 6 It is alkyl, R 2a However, hydroxy, halogen, C 1 ~C 6 Alkoxy, C 1 ~C 6 Haloalkoxy, or -NR'R'' R' and R'' are either hydrogen or C, respectively. 1 ~C 6 They may be alkyl, or R' and R'' may, together with the nitrogen atom to which they are bonded, form a 3- to 8-membered heterocyclic ring which may contain one additional heteroatom selected from N, O, and S. R 3 However, it is either hydrogen or a halogen.
2. R 1 However, halogen, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, or C 1 ~C 6 It is a haloalkoxy, R 2 However, R 2a C may be replaced with 1 ~C 6 It is alkyl, R 2a However, hydroxy or C 1 ~C 6 It is a haloalkoxy, R 3 However, it is hydrogen or halogen. The compound described in claim 1, or its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt.
3. R 1 However, halogen or C 1 ~C 6 It is alkyl, R 2 However, C 1 ~C 6 It is alkyl, R 3 However, it is hydrogen or halogen. The compound described in claim 2, or its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt.
4. R 1 However, it is a halogen, R 2 However, C 1 ~C 6 It is alkyl, R 3 However, it is hydrogen. The compound described in claim 3, or its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt.
5. R 1 is F, Cl, Br, I, -OCH 2 F, -OCHF 2 , -OCF 3 ien-CH 2 F, -CHF 2 , -CF 3 , or -CH 3 And, R 2 However, -CH 3 ien-CH 2 CH 3 ien-CH 2 OCF 3 ien-CH 2 OCHF 2 ien-CH 2 OCH 2 F, -CH 2 OH, or -CH 2 CH 2 OH, R 3 However, it is H or F. The compound described in claim 2, or its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt.
6. R 1 However, it is a halogen, R 2 However, C was replaced with NR'R'' 1 ~C 6 It is alkyl, R' and R'' are either hydrogen or C, respectively. 1 ~C 6 They may be alkyl, or R' and R'' may, together with the nitrogen atom to which they are bonded, form a 3- to 8-membered heterocyclic ring which may contain one additional heteroatom selected from N, O, and S. R 3 However, it is hydrogen. The compound described in claim 1, or its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt.
7. R' and R'' are either hydrogen or C, respectively. 1 ~C 3 Either they are alkyl, or R' and R'' together with the nitrogen atom to which they are bonded, they form a morpholinyl ring, a thiomorpholinyl ring, a piperadinyl ring, or a piperidinyl ring. The compound according to claim 6, or a stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt.
8. R 2 is -CH 2 -morpholinyl, -CH 2 -CH 2 -morpholinyl, -CH 2 -NH 2 -, -CH 2 -NH(CH 3 ), -CH 2 -N(CH 3 ) 2 -, -CH 2 CH 2 -NH 2 -, -CH 2 -CH 2 NH(CH 3 ), or -CH 2 -CH 2 -N(CH 3 ) 2 is The compound described in claim 6, or its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt.
9. The following formula: 【Chemistry 2】 【change】 The compound according to claim 1, which is represented by any one of the following, or a stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt thereof.
10. A pharmaceutical composition for treating disorders of uncontrolled cell proliferation in mammals, comprising a therapeutically effective amount of a compound according to any one of claims 1 to 9, or a stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt thereof.
11. The pharmaceutical composition according to claim 10, wherein the impairment of uncontrolled cell proliferation is cancer.
12. The pharmaceutical composition according to claim 11, wherein the cancer is selected from childhood acute leukemia, medulloblastoma, brain cancer, lung cancer, hematological cancer, bladder cancer, colon cancer, cervical cancer, endometrial cancer, ovarian cancer, squamous cell carcinoma, kidney cancer, peritoneal cancer, breast cancer, stomach cancer, colorectal cancer, prostate cancer, pancreatic cancer, genitourinary cancer, lymphatic cancer, laryngeal cancer, skin cancer, malignant melanoma, colorectal cancer, endometrial cancer, thyroid cancer, rhabdomyosarcoma, liver cancer, and combinations thereof.
13. The pharmaceutical composition according to claim 12, wherein the cancer has a neuroendocrine phenotype.
14. The pharmaceutical composition according to claim 13, wherein the cancer is neuroendocrine prostate cancer, castration-resistant prostate cancer, or pulmonary neuroendocrine tumor.
15. The pharmaceutical composition according to claim 10, further comprising at least one agent known to treat cancer.
16. At least one of the aforementioned drugs, Uracil mustard, chlormetine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, pipobromane, triethylenemelamine, triethylenethiophosphoramine, busulfan, carmustine, lomustine, streptozocin, dacarbazine, temozolomide, thiotepa, altretamine, methotrexate, 5-fluorouracil, floxuridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate, pe Ntostatin, bortezomib, vinblastine, vincristine, vinorelbine, vindesine, bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin, dexamethasone, clofarabine, cladribine, pemetrexed, idarubicin, paclitaxel, docetaxel, ixabepyrone, mitramycin, topotecan, irinotecan, deoxycoformycin, mitomycin-C, L-asparaginase, interferon Etoposide, Teniposide 17α-Ethinylestradiol, Diethylstilbestrol, Testosterone, Prednisone, Fluoxymesterone, Drostanolone Propionate, Testolactone, Megestrol Acetate, Tamoxifen, Methylprednisolone, Methyltestosterone, Prednisolone, Triamcinolone, Chlorotrianicene, Hydroxyprogesterone, Aminoglutethimide, Estramustine, Medroxyprogesterone Acetate , leuprolide, flutamide, toremifene, goserelin, cisplatin, carboplatin, hydroxyurea, amsacrin, procarbazine, mitotane, mitoxantrone, levamizole, navelbine, anastrozole, letrozole, capecitabine, raloxifene, doroxifene, hexamethylmelamine, oxaliplatin, gefitinib, capecitabine, erlotinib, azacitidine, temozolomide, gemcitabine, or vasostatin, The pharmaceutical composition according to claim 15, comprising a DNA methyltransferase inhibitor, an HDAC- inhibitor, a glucocorticoid, an mTOR inhibitor, a cytotoxic agent, a BCL2 inhibitor, an FLT3 inhibitor, an IDH1 / 2 inhibitor, a CDK inhibitor, a transcription inhibitor, or an HSP inhibitor, or a combination thereof.
17. The DNA methyltransferase inhibitor is 5-aza-2'-deoxycytidine, 5-azacitidine, zebralin, epigallocatechin-3-gallate, procaine, or a combination thereof. The aforementioned HDAC inhibitor is vorinostat, entinostat, panobinostat, trichostatin A, mosetinostat, bellinostat, dasinostat, gibinostat, tubastatin A, prasinostat, droxinostat, xinostat, romidepsin, valproic acid, AR-42 (OSU-HDAC42), tasejinarin, licorinostat, apicidine, or a combination thereof. The glucocorticoid is dexamethasone, prednisolone, methylprednisolone, betamethasone, triamcinolone, fludrocortisone, beclomethasone, or a combination thereof. The aforementioned mTor inhibitor is BEZ235, everolimus, sirolimus, temsirolimus, rapamycin, AZD8055, or a combination thereof. The cytotoxic agent is selected from alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, or chemotherapeutic agents selected from anthracyclines, cytarabine, purine analogs, sorafenib, gemtuzumab ozogamicin, rituximab, or combinations thereof. The alkylating agent is selected from carboplatin, cisplatin, cyclophosphamide, chlorambucil, melphalan, carmustine, busulfan, lomustine, dacarbazine, oxaliplatin, ifosfamide, mechloretamine, temozolomide, thiotepa, bendamustine, and streptozocin. The aforementioned antimetabolites are selected from gemcitabine, 5-fluorouracil, capecitabine, hydroxyurea, mercaptopurine, pemetrexed, fludarabine, nelarabine, cladribine, clopharabine, cytarabine, decitabine, pralatrexate, phloxuridine, methotrexate, and thioguanine. The aforementioned antitumor antibiotic is selected from doxorubicin, mitoxantrone, bleomycin, daunorubicin, dactinomycin, epirubicin, idarubicin, plicamycin, mitomycin, pentostatin, and barrubicin. The mitotic inhibitor is selected from irinotecan, topotecan, rubitecan, cabazitaxel, docetaxel, paclitaxel, etoposide, vincristine, ixabepyrone, vinorelbine, vinblastine, and teniposide. The BCL2 inhibitor is venetoclax, navitoclax, ovatoclax mesylate, subtoclax, or risaftoclax. The FLT3 inhibitor is midostaurin, quizartinib, gilteritinib, sorafenib, clenolanib, or pexidartinib. The IDH1 / 2 inhibitor is ivosidenib, enasidenib, borasidenib, ortasidenib, AGI-6780, AGI-5198, or GSK321. The aforementioned CDK inhibitors include samraciclib, albocidicib, fadracilib, sericiclib, zocilacrib, atubeciclib, enitocilib, boriclib, SY5609, XL201, Q-901, KRLS-017, GTAEXS-617, TGN-1062, THZ1, THZ2, SY-1365, YKL-5-124, ICEC0942, LY3405105, LD C4297, BS-181, SNS-32, AT-7519, AZD-4573, KB-0742, AU-07, BTXA-51, GFH-009, JS-101, PRT-2527, QHRD-107, TP-1287, SYHX-1903, CTX-439, KIN-004, SY-12882, THZ-531, CT-7439, AU-003, or AU-004. The aforementioned transcription inhibitor is lurubinectedin. The HSP inhibitor is pimitespiv, luminespiv, tanespimycin, albespimycin, ganetespiv, onarespiv, geldanamycin, or locaglamide. The pharmaceutical composition according to claim 16.
18. A method for adjusting cereblon activity or GSPT1 activity in at least one cell, comprising the step of contacting at least one cell in vitro with an effective amount of a compound according to any one of claims 1 to 9, or a stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt thereof.
19. A method for treating a disorder of uncontrolled cell proliferation, comprising the step of administering a therapeutically effective amount of a compound according to any one of claims 1 to 9, or a stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt thereof, to a target.