Adeno-associated virus capsid protein, adeno-associated virus containing the same and use
By inserting the RGD short-chain peptide GRGDSP into AAV2, AAV6, and AAV9 capsids, the efficiency and targeting of AAVs for brain tumors are enhanced, addressing the limitations of current AAVs and enabling effective gene therapy for brain tumors.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- ハンジョウ シンチャン ジーン セラピューティクスインコーポレイティド
- Filing Date
- 2024-03-12
- Publication Date
- 2026-05-28
AI Technical Summary
Current adeno-associated viruses (AAVs) face inefficiencies in targeting and infection of brain tumors due to limitations in crossing the blood-brain barrier and poor transfection efficiency, limiting their clinical application in treating malignant brain tumors.
Genetic engineering is used to insert the RGD short-chain peptide GRGDSP derived from human fibronectin into specific positions of AAV2, AAV6, and AAV9 capsids to enhance targeting and infection efficiency for brain tumor treatment.
The modified AAVs demonstrate improved in vivo and in vitro cell infection efficiency and targeted delivery to brain tissue, making them effective vectors for treating brain tumors and related diseases.
Smart Images

Figure 2026517247000001_ABST
Abstract
Description
[Technical Field]
[0001] [Priority rights and related applications] This disclosure claims priority under Chinese Patent Application 202310560310.8, filed on 15 May 2023, with the title of the invention "Adeno-associated virus capsid protein, adeno-associated virus comprising the same and use," which is incorporated into this publication by reference in its entirety, including its attachments.
[0002] This disclosure relates to the technology of viral vectors, and in particular to adeno-associated virus capsid proteins, adeno-associated viruses containing them, and their use. [Background technology]
[0003] Malignant brain tumors often have a poor prognosis. The drugs used for clinical treatment are very limited. Gene therapy shows great potential for application in the treatment of malignant brain tumors. 1 Adeno-associated viruses (AAVs) are widely used in in vivo gene therapy, but no AAVs are yet used for the clinical treatment of tumors. 2,3 The efficiency and targeting of AAV infection in tumors are the main bottlenecks in its application.
[0004] The function of AAVs is highly dependent on the capsid. The AAV capsid determines AAV's tissue targeting, transfection efficiency, and in vivo immune response. Capsid modification is currently an important means of improving AAV function. 4 .
[0005] Possible routes of administration in brain tumor treatment include local intratumor injection, intravascular administration, and intracranial cerebrospinal fluid administration. Currently, the AAV type commonly used in brain tumor research is wild-type AAV2. Disadvantages of AAV2 include low in vivo infection efficiency in brain tumor tissue, inability to cross the blood-brain barrier (BBB), inability to target brain tumors with blood administration, and poor infection efficiency and targeting in brain tissue after cerebrospinal fluid administration. 3,5 Other AAV types used in brain tumor treatment include AAV6 and AAV9, but they have similar drawbacks to AAV2. 6 .
[0006] Inserting functional short-chain peptides into AAV capsids is an important AAV capsid modification technique currently being used. 4 Many tumor cells highly express integrins, and the arginine-glycine-aspartate domain (RGD domain, also known as the RGD short-chain peptide) is a crucial site for many ligand proteins that bind to integrins. Therefore, attempts have been made to increase the affinity of AAV to tumor cells by inserting RGD domain-containing short-chain peptides into specific sites on the AAV capsid. For example, the RGD short-chain peptide (QAGTFALRGDNPQG) was inserted into position 587 of AAV2. 7 The RGD short-chain peptide (CDCRGDCFC) was inserted at position 588 of AAV2. 8 .
[0007] In theory, AAV containing RGD short-chain peptides can improve the infection efficiency of tumor cells. However, in practice, it depends on many factors, such as the specific sequence for inserting the RGD short-chain peptide, the specific type of AAV, the capsid insertion site, and the three-dimensional structure of the protein after insertion. When used in the development of tumor therapeutics, the practicality of such RGD-modified AAV also depends on the type of tumor cells, the microenvironment where the tumor cells exist, and the specific administration method. For example, when the RGD short-chain peptide CDCRGDCFC is inserted at the 588th position of the AAV2 capsid, the new AAV has enhanced affinity for tumor cells. However, when the same short-chain peptide is inserted at the 453rd position of the AAV2 capsid, the new AAV completely loses its infectivity to cells. 9 。
Summary of the Invention
Problems to be Solved by the Invention
[0008] To modify and select a novel AAV suitable for brain tumor treatment, the present disclosure selected the RGD short-chain peptide GRGDSP derived from human fibronectin and inserted it at the 453rd and 588th positions of AAV2, the 454th and 588th positions of AAV6, and the 455th and 588th positions of AAV9 using genetic engineering techniques. The present disclosure comprehensively analyzed and evaluated the virus productivity, cell infection efficiency in vivo and in vitro, and brain tissue targeting of the newly generated six AAV modified types, and finally identified multiple novel AAV capsids that can be used in the research and development of late-stage gene drugs.
Means for Solving the Problems
[0009] In a first aspect of the present invention, an adeno-associated virus capsid protein containing a targeting peptide, wherein the targeting peptide is (i) the amino acid sequence shown in SEQ ID NO: 23, (ii) An amino acid sequence having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 23, and having, or partially having, the function of the amino acid sequence shown in SEQ ID NO: 23. (iii) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted, or inserted in the amino acid sequence shown in SEQ ID NO: 23, and which has or partially has the function of the amino acid sequence shown in SEQ ID NO: 23, or (iv) An amino acid sequence encoded by a nucleotide sequence that hybridizes a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 23 under stringency conditions of medium stringency, medium to high stringency, high stringency, or very high stringency, and which has, or partially has, the function of the amino acid sequence shown in SEQ ID NO: 23. Adeno-associated virus capsid proteins containing one or more of these are provided.
[0010] In some embodiments, the adeno-associated virus is one or more selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, rh.10, rh.39, rh.43, and rh.74.
[0011] In some preferred embodiments, the adeno-associated virus is one or more selected from AAV2, AAV6, and AAV9.
[0012] In some embodiments, AAV2 includes AAV2 VP1, AAV2 VP2 and / or AAV2 VP3, and / or AAV6 includes AAV6 VP1, AAV6 VP2 and / or AAV6 VP3, and / or AAV9 includes AAV9 VP1, AAV9 VP2 and / or AAV9 VP3.
[0013] In some specific embodiments, the targeting peptide is inserted at amino acid position 453 and / or amino acid position 588 of AAV2 VP1, AAV2 VP2 and / or AAV2 VP3, and / or the targeting peptide is inserted at amino acid position 454 and / or amino acid position 588 of AAV6 VP1, AAV6 VP2 and / or AAV6 VP3, and / or the targeting peptide is inserted at amino acid position 455 and / or amino acid position 588 of AAV9 VP1, AAV9 VP2 and / or AAV9 VP3.
[0014] In some specific embodiments, the targeting peptide is inserted at amino acid position 453 of AAV2 VP1, AAV2 VP2 and / or AAV2 VP3, and / or the targeting peptide is inserted at amino acid position 454 of AAV6 VP1, AAV6 VP2 and / or AAV6 VP3, and / or the targeting peptide is inserted at amino acid position 588 of AAV9 VP1, AAV9 VP2 and / or AAV9 VP3.
[0015] In a second aspect of the present invention, a polynucleotide encoding the adeno-associated virus capsid protein described in the first aspect of the present invention is provided.
[0016] In a third aspect of the present invention, an adeno-associated virus comprising the adeno-associated virus capsid protein described in the first aspect of the present invention is provided.
[0017] In some embodiments, the adeno-associated virus further comprises a transgene.
[0018] In some optional embodiments, the transgene is a therapeutic transgene, a prophylactic transgene, or a diagnostic transgene.
[0019] In a fourth aspect of the present invention, there is provided a transgene delivery vector comprising the adeno-associated virus described in the third aspect of the present invention.
[0020] In a fifth aspect of the present invention, there is provided a pharmaceutical composition comprising (a) the adeno-associated virus described in the third aspect of the present invention, or the transgene delivery vector described in the fourth aspect of the present invention, and optionally (b) a pharmaceutically acceptable carrier.
[0021] In a sixth aspect of the present invention, there is provided the use of the adeno-associated virus described in the third aspect of the present invention, the transgene delivery vector described in the fourth aspect of the present invention, or the pharmaceutical composition described in the fifth aspect of the present invention, in the preparation of a reagent for delivering a transgene to a cell.
[0022] In some embodiments, the cell is derived from a subject.
[0023] In some preferred embodiments, the subject is a mammalian subject.
[0024] In some more preferred embodiments, the subject is a human.
[0025] In some embodiments, the cell is derived from brain tissue.
[0026] In some embodiments, the subject has a brain disease.
[0027] In some embodiments, the adeno-associated virus, the transgene delivery vector, or the pharmaceutical composition is administered to a subject by one or more of intravenous, intra-arterial, subcutaneous, intraperitoneal, intramuscular, intrathecal, intracerebral, or intratumoral.
[0028] In some preferred embodiments, the adeno-associated virus, the transgene delivery vector, or the pharmaceutical composition is administered to a subject intravenously, arterially, in cerebrospinal fluid, in brain tissue, or in a tumor, one or more of these methods.
[0029] In a seventh aspect of the present invention, the use of the adeno-associated virus described in the third aspect of the present invention, the transgene delivery vector described in the fourth aspect of the present invention, or the pharmaceutical composition described in the fifth aspect of the present invention in the preparation of a pharmaceutical for the treatment of a disease is provided.
[0030] In some preferred embodiments, the disease includes brain diseases. [Effects of the Invention]
[0031] The adeno-associated virus capsid protein and adeno-associated virus provided in this disclosure have good productivity, improved in vivo and in vitro cell infection efficiency compared to wild-type adeno-associated virus, good targeting towards brain tissue, and are useful as delivery vectors for treating brain tumors and other brain-related diseases. [Brief explanation of the drawing]
[0032] [Figure 1] AAV capsid model and modification site. The left side shows a three-dimensional model of an AAV capsid and one of its individual capsid proteins (VP3). The right side is a magnified view of the left side, showing the location of the modification site in the individual VP3. One AAV particle is composed of 60 individual capsid proteins. Any of these individual proteins can be modified by the method disclosed herein. [Figure 2] Map of the RC2(A), RC6(B), and RC9(C) plasmids required for packaging wild-type AAV2, AAV6, and AAV9. [Figure 3]Comparison of the infection efficiency of HEK293 cells with in vitro AAV2 and its modified AAV. The leftmost column shows the nuclei of HEK293 cells after DAPI staining. The middle column shows the red fluorescent protein RFP in the same field of view. The rightmost column is an overlay of the two figures on the left. Higher red fluorescence intensity indicates better expression efficiency of the corresponding AAV. [Figure 4] Comparison of the infection efficiency of HEK293 cells by AAV6 and its modified AAVs in vitro. The leftmost column shows the nuclei of HEK293 cells after DAPI staining. The middle column shows the red fluorescent protein RFP in the same field of view. The rightmost column is an overlay of the two figures on the left. Higher red fluorescence intensity indicates better expression efficiency of the corresponding AAV. [Figure 5] Comparison of the infection efficiency of HEK293 cells with in vitro AAV9 and its modified AAVs. The leftmost column shows the nuclei of HEK293 cells after DAPI staining. The middle column shows the red fluorescent protein RFP in the same field of view. The rightmost column is an overlay of the two figures on the left. Higher red fluorescence intensity indicates better expression efficiency of the corresponding AAV. [Figure 6] Quantitative analysis of the in vitro infection efficiency of AAV to HEK293 cells. The infection efficiency of AAV is defined as the percentage of RFP-positive cells out of all DAPI-positive HEK293 cells. See Figures 3 to 5 for representative figures. AAV2.1, AAV6.1, and AAV9.1 are wild-type AAV2, AAV6, and AAV9, respectively. AAV2.2 and AAV2.3 are modified AAV2. AAV6.2 and AAV6.3 are modified AAV6. AAV9.2 and AAV9.3 are modified AAV9. [Figure 7] Comparison of the infection efficiency of U251 human glioblastoma cells with in vitro AAV2 and its modified AAV. The leftmost column shows the nuclei of U251 cells after DAPI staining. The middle column shows the red fluorescent protein RFP in the same field of view. The rightmost column is an overlay of the two figures on the left. Higher red fluorescence intensity indicates better expression efficiency of the corresponding AAV. [Figure 8]Comparison of the infection efficiency of U251 human glioblastoma cells with in vitro AAV6 and its modified AAVs. The leftmost column shows the nuclei of U251 cells after DAPI staining. The middle column shows the red fluorescent protein RFP in the same field of view. The rightmost column is an overlay of the two figures on the left. Higher red fluorescence intensity indicates better expression efficiency of the corresponding AAV. [Figure 9] Comparison of the infection efficiency of U251 human glioblastoma cells with in vitro AAV9 and its modified AAVs. The leftmost column shows the nuclei of U251 cells after DAPI staining. The middle column shows the red fluorescent protein RFP in the same field of view. The rightmost column is an overlay of the two figures on the left. Higher red fluorescence intensity indicates better expression efficiency of the corresponding AAV. [Figure 10] Quantitative analysis of the in vitro infection efficiency of AAVs in U251 human glioblastoma cells. The infection efficiency of AAVs is defined as the percentage of RFP-positive cells out of all DAPI-positive U251 cells. See Figures 7-9 for representative figures. AAV2.1, AAV6.1, and AAV9.1 are wild-type AAV2, AAV6, and AAV9, respectively. AAV2.2 and AAV2.3 are modified AAV2. AAV6.2 and AAV6.3 are modified AAV6. AAV9.2 and AAV9.3 are modified AAV9. [Figure 11] Expression distribution map of AAV-mediated red fluorescent protein around the lateral ventricle of mice. 5 μL of AAV-CAG-RFP virus was slowly injected into one lateral ventricle of adult mice using a microsyringe (8.3 × 10⁹ vg / mouse for each AAV). Mice were reared for 4 weeks after site-specific injection, and coronal sections of brain tissue were obtained and scanned with red fluorescence. "V" in the figure indicates the location of the lateral ventricle. AAV2.1, AAV6.1, and AAV9.1 are wild-type AAV2, AAV6, and AAV9, respectively. AAV2.2 and AAV2.3 are modified AAV2. AAV6.2 and AAV6.3 are modified AAV6. AAV9.2 and AAV9.3 are modified AAV9. [Figure 12]Quantitative intensity analysis of AAV-mediated red fluorescent protein in the periventricular region (A) and hippocampal region (B) of mice. Relative fluorescence intensity was measured using ImageJ software. Except for the periventricular region, no fluorescent protein signals were detected in other brain regions. AAV2.1, AAV6.1, and AAV9.1 are wild-type AAV2, AAV6, and AAV9, respectively. AAV2.2 and AAV2.3 are modified AAV2. AAV6.2 and AAV6.3 are modified AAV6. AAV9.2 and AAV9.3 are modified AAV9. [Figure 13] Expression distribution map of AAV-mediated red fluorescent protein in mouse liver. 5 μL of AAV-CAG-RFP virus was slowly injected into one lateral ventricle of adult mice using a microsyringe (8.3 × 10⁹ vg / mouse for each AAV). After site-specific injection, mice were reared for 4 weeks, and coronal sections of liver tissue were obtained and scanned with red fluorescence. A stronger red fluorescence signal indicates greater expression of "leaked" AAV. AAV2.1, AAV6.1, and AAV9.1 are wild-type AAV2, AAV6, and AAV9, respectively. [Figure 14] AAV expression levels in mouse liver. AAV expression level is defined as the percentage of RFP-positive cells out of all DAPI-positive hepatocytes. AAV2.1, AAV6.1, and AAV9.1 are wild-type AAV2, AAV6, and AAV9, respectively. AAV2.2 and AAV2.3 are modified AAV2. AAV6.2 and AAV6.3 are modified AAV6. AAV9.2 and AAV9.3 are modified AAV9. [Figure 15] Detection and quantification of AAV DNA "leaked" into surrounding mouse tissues; A: Liver; B: Skeletal muscle; C: Heart; D: Kidney; E: Spleen. [Figure 16] Detection and quantification of AAV RNA "leaked" into surrounding mouse tissues; A: Liver; B: Skeletal muscle; C: Heart; D: Kidney; E: Spleen; F: Dorsal ganglion. [Figure 17]After infecting HEK293 cells with AAV and detecting EGFP mRNA levels by qPCR 72 hours later, the results were as follows: NC group (mean = 1), AAV6 group (mean = 311.7), AAV6.2 group (mean = 11390), AAV9 group (mean = 84.57), and AAV9.2 group (mean = 545.2). [Figures 18A-18B] After infecting HEK293 cells with AAV and monitoring EGFP protein levels in Western blotting for 72 hours, the results were as follows: AAV6 group (mean = 1), AAV6.2 group (mean = 3.3), AAV9 group (mean = 0.4), and AAV9.2 group (mean = 1.1). [Figure 19] After infecting BT474 cells with AAV and detecting EGFP mRNA levels by qPCR 72 hours later, the results were as follows: NC group (mean = 1), AAV6 group (mean = 50.02), AAV6.2 group (mean = 219.4), AAV9 group (mean = 1.423), and AAV9.2 group (mean = 2.878). [Figures 20A-20B] After infecting BT474 cells with AAV and monitoring EGFP protein levels in Western blotting for 72 hours, the results were as follows: AAV6 group (mean = 1), AAV6.2 group (mean = 2.8), AAV9 group (mean = 0.06), and AAV9.2 group (mean = 0.05). [Figure 21A-21I] This is a schematic diagram showing the results of infecting different cell lines with AAV6 and AAV6.2, respectively, and detecting the EGFP fluorescence intensity using a microplate reader. In Figure 21A, the cells are NCI-H196 (human small cell lung cancer cells), Figure 21B, SK-N-SH (human neuroblastoma cells), Figure 21C, T98G (human glioma cells), Figure 21D, A172 (human glioblastoma cells), Figure 21E, U-87MG (human stellate glioblastoma cells), Figure 21F, SK-BR-3 (human breast cancer cells), Figure 21G, PC-3 (human prostate cancer cells), Figure 21H, A-375 (human malignant melanoma cells), and Figure 21I, HCT116 (human colorectal cancer cells). [Modes for carrying out the invention]
[0033] To make this disclosure easier to understand, technical and scientific terms are defined. Unless otherwise explicitly defined herein, all other technical and scientific terms used have the meanings that are commonly understood by a person of the art in which this disclosure belongs.
[0034] In this specification, the numerical range expressed as "numerical value A to numerical value B" refers to the range that includes the limit values A and B.
[0035] In this specification, "basic" or "substantial" means that the standard deviation from the theoretical model or theoretical data is within 5%, preferably 3%, and more preferably 1%.
[0036] In this specification, "may" means that both the case in which a certain process is performed and the case in which a certain process is not performed are included.
[0037] In this specification, “optional” or “optionally” means that the events described below may or may not occur, and this description includes both cases in which the events occur and cases in which they do not occur.
[0038] In this specification, “several specific / preferred embodiments,” “other specific / preferred embodiments,” “embodiments,” etc., mean that certain elements relating to the embodiment described (e.g., features, structure, properties, and / or characteristics) are included in at least one of the embodiments described herein and may or may not be present in other embodiments. It should also be understood that the above elements may be combined in any way with various embodiments.
[0039] According to this disclosure, the terms “polypeptide,” “protein,” and “peptide” can be used interchangeably herein and refer to polymeric forms of amino acids of any length, and may include coding amino acids and non-coding amino acids, chemically or biochemically modified or derived amino acids, and polypeptides having similar peptide backbones.
[0040] According to this disclosure, the terms “nucleic acid molecule,” “polynucleotide,” and “nucleic acid” can be used interchangeably and refer to polymeric forms of nucleotides of any length, including deoxyribonucleotides, ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure and may perform any known or unknown function. Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, regulatory regions, isolated RNA of any sequence, nucleic acid probes, and primers. Nucleic acid molecules may be linear or cyclic.
[0041] According to this disclosure, the three-letter and one-letter abbreviations for the amino acids used are as described in J.biol.chem, 243, p3558 (1968).
[0042] According to this disclosure, "addition" of an amino acid refers to adding an amino acid to the C-terminus or N-terminus of an amino acid sequence. According to this disclosure, "deletion" of an amino acid refers to removing one, two, or three or more amino acids from an amino acid sequence. According to this disclosure, "insertion" of an amino acid refers to inserting an amino acid residue at an appropriate location in an amino acid sequence, where all or some of the inserted amino acid residues are adjacent to each other, or the inserted amino acids are not adjacent to each other. According to this disclosure, "substitution" of an amino acid refers to the substitution of one amino acid residue at a location in an amino acid sequence with another amino acid residue, where the "substitution" may be a conservative amino acid substitution.
[0043] According to this disclosure, “conservative modification,” “conservative substitution,” or “conservative replacement” refers to the substitution of an amino acid in a protein with another amino acid having similar characteristics (e.g., charge, side chain size, hydrophobic / hydrophilicity, main chain structure and rigidity), thereby enabling frequent modification of the protein without altering its biological activity. Those skilled in the art generally know that a single amino acid substitution in a non-essential region of a polypeptide does not fundamentally alter its biological activity (see, for example, Watson et al. (1987), Molecular Biology of the Gene, The Benjamin / Cummings Pub.Co., p. 224, (4th edition)). Furthermore, the likelihood of impaired biological activity by substitution of amino acids with similar structure or function is low. Exemplary conservative substitutions are described below in “Exemplary Conservative Amino Acid Substitutions.”
[0044] [Table 1]
[0045] According to this disclosure, “medium to very high stringency conditions” include “medium stringency conditions,” “medium to high stringency conditions,” “high stringency conditions,” or “very high stringency conditions,” and describe the conditions for nucleic acid hybridization and washing. Guidelines for carrying out the hybridization reaction are as described in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1–6.3.6, which are incorporated herein by reference. The document describes both water-containing and water-free methods, and either one of these can be adopted. For example, specific hybridization conditions are as follows: (1) Low-stringent hybridization conditions: Wash with 6×sodium chloride / sodium citrate (SSC) at approximately 45°C, then wash twice with 0.2×SSC and 0.1% SDS at at least 50°C (under low-stringency conditions, the washing temperature may be increased up to 55°C); (2) Medium-stringent hybridization conditions: Wash with 6×SSC at approximately 45°C, then wash with 0.2×SSC and 0.1% SDS at 60°C Wash once or multiple times with SDS; (3) High stringent hybridization conditions: Wash once or multiple times with 6×SSC at approximately 45°C, then at 65°C with 0.2×SSC and 0.1%SDS (preferred); (4) Very stringent hybridization conditions: Wash once or multiple times with 0.5M sodium phosphate and 7%SDS at 65°C, then at 65°C with 0.2×SSC and 1%SDS.
[0046] "Identity" refers to the sequence similarity between two polynucleotide sequences or two polypeptides. If the positions of two alignment sequences are occupied by the same base or single amino acid subunit, for example, if each position of two DNA molecules is occupied by adenine, then the molecules are said to have homology at that position. The percentage of identity between two sequences is expressed as a function obtained by dividing the number of matching or homologous positions shared by the two sequences by the number of alignment positions and multiplying the result by 100%. For example, if, when the sequences are optimally aligned, 6 out of 10 positions in two sequences are matching or homologous, then the two sequences have 60% homology. Typically, a comparison is performed when the two sequences are aligned to obtain the highest possible percentage of identity.
[0047] "Administration," "giving," and "processing" refer to the contact between an exogenous drug, therapeutic agent, diagnostic agent, or composition and an animal, human, subject, cell, tissue, organ, or biofluid, when applied to an animal, human, experimental subject, cell, tissue, organ, or biofluid. "Administration," "giving," and "processing" include, for example, therapeutic, pharmacokinetic, diagnostic, research, and experimental methods. Processing of cells includes contact between a reagent and cells, and contact between a reagent and a fluid, in which the fluid comes into contact with the cells. "Administration," "giving," and "processing" also include processing cells in vitro, for example, using a reagent, diagnostic agent, binding composition, or another cell. "Processing" includes therapeutic, preventive or precautionary measures, research, and diagnostic applications, when applied to human, veterinary medicine, or subject research.
[0048] "Treatment" means administering, orally or parenterally, a therapeutic agent containing one of the antibodies disclosed herein, which has been shown to be therapeutically effective against one or more disease symptoms, to a patient having one or more disease symptoms. Typically, the therapeutic agent is administered in a dose that effectively alleviates one or more disease symptoms, such as inducing regression of symptoms or inhibiting the progression of symptoms to a clinically measurable degree, in the treated patient or population. The amount of therapeutic agent that can effectively alleviate any specific disease symptom (also called the "therapeutic dose") varies depending on several factors, such as the patient's disease state, age and weight, and the drug's ability to exert a therapeutic effect on the patient. Whether or not disease symptoms have been alleviated can be assessed by any clinical test method commonly used by physicians and other healthcare professionals to assess the severity and progression of the symptoms.
[0049] In this specification, the term "prevention" refers to preventive treatment for subjects who are not currently, and have not been, affected by the disease but are at risk of developing it, or who have been affected by the disease in the past, are not currently affected but are at risk of recurrence. In some embodiments, subjects have a higher risk of developing or recurring the disease compared to the average healthy individual in the subject group.
[0050] An "effective dose" refers to an amount sufficient to improve or prevent the symptoms or condition of a medical illness. An effective dose may also refer to an amount sufficient to allow / promote a diagnosis. The effective dose applicable to a particular patient or animal medical subject may be adjusted depending on factors such as the illness being treated, the patient's overall health, the method and route of administration, the dosage, and the severity of side effects. The effective dose may also be the maximum dose or administration plan to avoid serious side effects or toxic effects.
[0051] In this specification, “therapeutic dose” means an amount sufficient to provide therapeutic benefit in the treatment of a disease or to delay / minimize one or more symptoms associated with the disease. A therapeutic dose refers to the amount of a therapeutic agent that, when used alone or in combination with other therapeutic methods, provides therapeutic benefit in the treatment of a disease. The term “therapeutic dose” may include amounts that improve the overall therapeutic effect, amounts that reduce or eliminate the symptoms, signs, or causes of a disease, and / or amounts that enhance the therapeutic effect of another therapeutic agent.
[0052] In this specification, “protective dose” means an amount sufficient to prevent or prevent the recurrence of a disease or one or more symptoms associated with a disease. A protective dose refers to the amount of a therapeutic agent that, when used alone or in combination with other agents, provides a protective benefit in preventing a disease. The term “protective dose” may also include amounts that improve the overall protective effect or enhance the protective effect of another protective agent.
[0053] In this specification, the term “subject” means either a human (i.e., male or female of any age, e.g., pediatric subject (e.g., infant, child or adolescent) or adult subject (e.g., young adult, middle-aged or elderly)) or a non-human animal. In some embodiments, the non-human animal is a mammal (e.g., primate (e.g., crab-eating macaque or rhesus macaque), a commercial mammal (e.g., cattle, pig, horse, sheep, goat, cat or dog) or a bird). The non-human animal may be male or female at any developmental stage. The non-human animal may be a transgenic animal or a genetically modified animal.
[0054] In this disclosure, the RGD short-chain peptide GRGDSP (SEQ ID NO:23) derived from human fibronectin was selected as a targeting peptide and inserted into the capsid proteins of AAV2, AAV6, and AAV9 using genetic engineering technology. Its productivity, in vivo and in vitro cell infection efficiency, and targeting of brain tissue were then evaluated.
[0055] AAV Capsid Protein In some embodiments of this disclosure, an AAV capsid protein comprising a targeting peptide, wherein the targeting peptide is (i) The amino acid sequence shown in SEQ ID NO: 23, (ii) An amino acid sequence having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 23, and having, or partially having, the function of the amino acid sequence shown in SEQ ID NO: 23. (iii) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted, or inserted in the amino acid sequence shown in SEQ ID NO: 23, and which has or partially has the function of the amino acid sequence shown in SEQ ID NO: 23, or (iv) An amino acid sequence encoded by a nucleotide sequence that hybridizes a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 23 under stringency conditions of medium stringency, medium to high stringency, high stringency, or very high stringency, and which has, or partially has, the function of the amino acid sequence shown in SEQ ID NO: 23. AAV capsid protein containing one or more of the following is provided.
[0056] In this disclosure, AAV is a tiny, non-enveloped virus with a 25 nm capsid. No diseases are known or shown to be associated with wild-type viruses. AAV has a single-stranded DNA (ssDNA) genome. AAV exhibits long-term episomal transgene expression. AAV vectors, containing as few as 300 base pairs, are packaged and can be incorporated. The exogenous DNA capacity limit is approximately 4.7 kb. AAV vectors, such as the AAV vector described by Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985), are used to introduce DNA into cells. Using AAV vectors, multiple nucleic acids were introduced into different cell types (see, for example, Hermonat et al., Proc.Natl.Acad.Sci.USA 81:6466-6470 (1984); Tratschin et al., Mol.Cell.Biol.4:2072-2081 (1985); Wondisford et al., Mol.Endocrinol.2:32-39 (1988); Tratschin et al., J.Virol.51:611-619 (1984); and Flotte et al., J.Biol.Chem.268:3781-3790 (1993)). Numerous selectable AAV variants exist (over 100 have been cloned), and AAV variants have been identified according to desired characteristics.
[0057] In some embodiments, the AAV is one or more selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, rh.10, rh.39, rh.43, and rh.74.
[0058] In some preferred embodiments, the AAV is one or more selected from AAV2, AAV6, and AAV9.
[0059] The AAV capsid is icosahedron-shaped and composed of 60 individual VP capsid proteins, including 5 VP1 proteins, 5 VP2 proteins, and 50 VP3 proteins. All VP1, VP2, and VP3 proteins are produced by transcription and translation from the AAV Cap gene. VP1 is the longest, containing approximately 735 amino acids. VP2 and VP3 are "shortened" versions of VP1 and do not contain the amino acids at the N-terminus of the VP1 protein. Following conventional rules, capsid protein modification sites are named based on the amino acid sequence of the VP1 protein. For example, insertion site 453 in AAV2 means that a short-chain peptide is inserted after the 453rd amino acid of AAV2 VP1 alone (containing 735 amino acids), and that AAV2 VP1, VP2, and VP3 all contain this short-chain peptide. Similarly, insertion site 454 in AAV6 means that a short-chain peptide is inserted after the 454th amino acid of AAV6 VP1 alone (containing 736 amino acids), and that AAV6 VP1, VP2, and VP3 all contain this short-chain peptide.
[0060] In some embodiments, AAV2 includes AAV2 VP1, AAV2 VP2 and / or AAV2 VP3. In some embodiments, AAV6 includes AAV6 VP1, AAV6 VP2 and / or AAV6 VP3. In some embodiments, AAV9 includes AAV9 VP1, AAV9 VP2 and / or AAV9 VP3.
[0061] In this specification, descriptions of the insertion sites of targeting peptides in VP2 and VP3 should be referenced to the descriptions of the amino acid positions in the corresponding VP1. For example, the amino acid sequence of AAV2 VP2 (SEQ ID NO: 15) has a total of 598 amino acids, which correspond to amino acids 138-735 of AAV2 VP1.
[0062] For example, the amino acid sequence of AAV2 VP1 is as follows (SEQ ID NO: 14). [ka] (A total of 735 amino acids)
[0063] The amino acid sequence of AAV2 VP2 is as follows (SEQ ID NO: 15). [ka] (AAV2 VP1 contains amino acids 138-735, totaling 598 amino acids)
[0064] The amino acid sequence of AAV2 VP3 is as follows (SEQ ID NO: 16). [ka] (AAV2 VP1 contains amino acids 203-735, totaling 533 amino acids)
[0065] The amino acid sequence of AAV6 VP1 is as follows (SEQ ID NO: 17). [ka] (A total of 736 amino acids)
[0066] The amino acid sequence of AAV6 VP2 is as follows (SEQ ID NO: 18). [ka] (AAV6 VP1 contains amino acids 138-736, totaling 599 amino acids)
[0067] The amino acid sequence of AAV6 VP3 is as follows (SEQ ID NO: 19). [ka] (AAV6 VP1 contains amino acids 20-736, totaling 534 amino acids)
[0068] The amino acid sequence of AAV9 VP1 is as follows (SEQ ID NO: 20). [ka] (A total of 736 amino acids)
[0069] The amino acid sequence of AAV9 VP2 is as follows (SEQ ID NO: 21). [ka] (AAV9 VP1 contains amino acids 138-736, totaling 599 amino acids)
[0070] The amino acid sequence of AAV9 VP3 is as follows (SEQ ID NO: 22). [ka] (AAV9 VP1 contains amino acids 203-736, totaling 534 amino acids)
[0071] In some embodiments, the targeting peptide is inserted at amino acid position 453 and / or amino acid position 588 of AAV2 VP1, AAV2 VP2, and / or AAV2 VP3. Specifically, by inserting the targeting peptide at amino acid position 453 and / or amino acid position 588 of AAV2 VP1, the targeting peptide is inserted at all of the amino acid positions 453 and / or amino acid position 588 corresponding to AAV2 VP1 in AAV2 VP2, and at all of the amino acid positions 453 and / or amino acid position 588 corresponding to AAV2 VP1 in AAV2 VP3.
[0072] In some embodiments, the targeting peptide is inserted at amino acid position 454 and / or amino acid position 588 of AAV6 VP1, AAV6 VP2, and / or AAV6 VP3. Specifically, by inserting the targeting peptide at amino acid position 454 or amino acid position 588 of AAV6 VP1, the targeting peptide is inserted at all of the amino acid positions 454 and / or 588 corresponding to AAV6 VP1 in AAV6 VP2, and at all of the amino acid positions 454 and / or 588 corresponding to AAV6 VP1 in AAV6 VP3.
[0073] In some embodiments, the targeting peptide is inserted at amino acid position 455 and / or amino acid position 588 of AAV9 VP1, AAV9 VP2, and / or AAV9 VP3. Specifically, by inserting the targeting peptide at amino acid position 455 or amino acid position 588 of AAV9 VP1, the targeting peptide is inserted at amino acid position 455 and / or amino acid position 588 in AAV9 VP2, and at all of amino acid positions 455 and / or amino acid position 588 in AAV9 VP3, corresponding to AAV9 VP1.
[0074] In some preferred embodiments, the targeting peptide is inserted at the 453rd amino acid position of AAV2 VP1, so that in AAV2 VP2, the targeting peptide is inserted at the 453rd amino acid position corresponding to AAV2 VP1, and in AAV2 VP3, the targeting peptide is inserted at the 453rd amino acid position corresponding to AAV2 VP1. In some preferred embodiments, the targeting peptide is inserted at the 454th amino acid position of AAV6 VP1, so that in AAV6 VP2, the targeting peptide is inserted at the 454th amino acid position corresponding to AAV6 VP1, and in AAV6 VP3, the targeting peptide is inserted at the 588th amino acid position corresponding to AAV9 VP1, and in AAV9 VP3, the targeting peptide is inserted at the 588th amino acid position corresponding to AAV9 VP1.
[0075] The targeting peptides disclosed herein can be modified by methods known in this field that generate peptidomimetics. For example, see Qvit et al., Drug Discov Today. February 2017;22(2):454-462; Farhadi and Hashemian, Drug Des Devel Ther. 2018;12:1239-1254; Avan et al., Chem. Soc. Rev., 2014,43,3575-3594; Pathak et al., Indo American Journal of Pharmaceutical Research, 2015.8; Kazmierski, WM, ed., Peptidomimetics Protocols, Human Press (Totowa NJ 1998); Goodman et al., eds., Houben-Weyl Methods of Organic Chemistry: Synthesis of Peptides and Peptidomimetics, Thiele Verlag (New York 2003); and Mayo et al., J. Biol. Chem., 278:45746 (2003). In some cases, the pseudo-peptide-type peptides and fragments disclosed herein, modified as described above, exhibit improved in vivo stability compared to non-pseudo-peptide-type peptides.
[0076] One method for generating pseudopeptides includes substituting one or more, for example, all, amino acids in a peptide sequence with a D-amino acid enantiomer. Such sequences are referred to herein as “retro” sequences. Another method involves reversing the order of amino acid residues from the N-terminus to the C-terminus of the original peptide so that the order of amino acid residues from the C-terminus to the N-terminus of the modified pseudopeptide is the same as the order of amino acid residues from the C-terminus to the N-terminus of the modified pseudopeptide. Such sequences are referred to as “inverso” sequences.
[0077] Pseudopeptides can be inverted and reversed forms, i.e., the “inverted-reverse” forms of the peptides disclosed herein. Novel pseudopeptides can consist of D-amino acids arranged such that the order of amino acid residues from the N-terminus to the C-terminus in the pseudopeptide corresponds to the order of amino acid residues from the C-terminus to the N-terminus in the original peptide.
[0078] Another method for preparing pseudopeptides includes using chemically distinct but recognized amino acid functional analogs, i.e., artificial amino acid analogs, to substitute one or more amino acid residues in the peptide. Artificial amino acid analogs include β-amino acids and β-substituted β-amino acids ("β"). 3 This includes amino acids, phosphorus-containing analogs of amino acids such as ∀-aminophosphonic acid and ∀--aminophosphinic acid, and amino acids having non-peptide bonds. Using artificial amino acids, pseudopeptides such as ptydomimetic oligomers (e.g., ptydomimetic amides or ester analogs), β-peptides, cyclic peptides, oligoureas or oligourethane peptides, or heterocyclic molecules can be produced.
[0079] Polynucleotides In some embodiments of this disclosure, polynucleotides encoding the AAV capsid protein of this disclosure are provided.
[0080] The polynucleotides in this disclosure may be in DNA form or RNA form. The DNA form includes cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be coding or non-coding strands.
[0081] The sequences encoding AAV capsid proteins in this disclosure include sequences encoding only AAV capsid proteins / targeting peptides, sequences encoding AAV capsid proteins / targeting peptides and various additional coding sequences, sequences encoding AAV capsid proteins / targeting peptides (and any additional coding sequences) and non-coding sequences.
[0082] The "polynucleotide encoding the AAV capsid protein / targeting peptide" may include the polynucleotide encoding the AAV capsid protein / targeting peptide, and may further include additional coding and / or non-coding sequences.
[0083] This disclosure further relates to a polynucleotide that hybridizes with the above sequence, wherein the two sequences have at least 50%, preferably at least 70%, and more preferably at least 80% identity. In particular, this disclosure relates to a polynucleotide that can hybridize with the polynucleotide described herein under stringency conditions, where the stringency conditions are medium stringency, medium to high stringency, high stringency, or very high stringency.
[0084] AAV and AAV Vectors In some embodiments of this disclosure, an AAV comprising the AAV capsid protein described herein is provided.
[0085] In some embodiments, the AAV further includes a transgene.
[0086] In some specific embodiments, the transgene includes a nucleotide sequence encoding a gene product. A "gene" is a polynucleotide containing at least one open reading frame that, after transcription and translation, encodes a specific protein. A "gene product" is a molecule produced by the expression of a specific gene. Gene products include, for example, polypeptides, aptamers, interfering RNA, mRNA, and the like.
[0087] In some specific embodiments, the transgene is a therapeutic transgene, a prophylactic transgene, or a diagnostic transgene.
[0088] In some exemplary embodiments, the transgene is a therapeutic transgene that encodes the gene sequence of a therapeutic agent, such as encoding the gene sequence of an anti-cancer (brain tumor) agent or a therapeutic agent for another brain disease.
[0089] In some respects of this disclosure, transgene delivery vectors including the AAV described herein are also provided.
[0090] Pharmaceutical composition and administration method In some embodiments of the present disclosure, a pharmaceutical composition is provided comprising (a) the AAV or the transgene delivery vector, and optionally (b) a pharmaceutically acceptable carrier.
[0091] In some embodiments, the pharmaceutical composition described herein is a pharmaceutical composition comprising the above-mentioned AAV or transgene delivery vector as an active ingredient, wherein the AAV or transgene delivery vector comprises (i) a targeting peptide and (ii) a transgene such as a therapeutic transgene, for example, a therapeutic agent for treating brain tumors or other diseases of the brain.
[0092] As used herein, the term "pharmaceutically acceptable carrier" includes saline, solvents, dispersion media, coatings, antimicrobial and antifungal agents, isotonic agents, absorption retarders, and the like, all of which are compatible with drug administration.
[0093] Pharmaceutical compositions are typically prepared to suit the intended route of administration. Examples of routes of administration include parenteral administration, such as injection or infusion into, for example, intravenous, intra-arterial, subcutaneous, intraperitoneal, intramuscular, intracerebrospinal fluid, brain tissue, or tumor. Therefore, delivery can be systemic or local.
[0094] Methods for preparing appropriate pharmaceutical compositions are known in this field; see, for example, Remington: The Science and Practice of Pharmacy, 21st ed., 2005; and Drugs and the Pharmaceutical Sciences: A Series of Textbooks and Monographs (Dekker, NY). For example, a solution or suspension used for parenteral administration may contain components such as sterile diluents such as water for injection, saline solution, fixative oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antimicrobial agents such as benzyl alcohol or methyl parahydroxybenzoate; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates, or phosphates; and tonicity adjusting reagents such as sodium chloride or glucose. The pH may be adjusted with an acid or alkali such as hydrochloric acid or sodium hydroxide. Parenteral formulations can be sealed in ampoules, disposable syringes, or multi-dose vials made of glass or plastic.
[0095] Pharmaceutical compositions suitable for injection may include sterile aqueous solutions (water-soluble) or dispersions, and sterile powders for the temporary preparation of sterile injection solutions or dispersions. For intravenous administration, suitable vectors include physiological saline, antimicrobial water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate buffer (PBS). In all cases, the above compositions must be sterile and flow to a degree suitable for injection. They must be stable under preparation and storage conditions and must be protected from contamination by microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerin, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. For example, coating agents such as lecithin can be used to maintain the required particle size in the case of dispersions, and surfactants can be used to maintain appropriate fluidity. Microbial protection can be achieved by using various antimicrobial and antifungal agents, such as p-hydroxybenzoate methyl, chlorobutanol, phenol, ascorbic acid, and thimerosal. In many cases, the above composition preferably contains, for example, sugars, polyols such as mannitol and sorbitol, and isotonic agents such as sodium chloride. By including reagents that delay absorption, such as aluminum monostearate and gelatin, in the above composition, the absorption of the injectable composition can be extended.
[0096] A sterile injection solution can be prepared by mixing a desired amount of the active compound with one or a combination of the components exemplified above in a suitable solvent, and then filtering and sterilizing the mixture. Typically, the active compound is mixed with a sterile solvent (vehicle) to prepare a dispersion, the solvent comprising the underlying dispersion medium and other desired components selected from those exemplified above. When sterile powder is used in the preparation of a sterile injection solution, preferred preparation methods are vacuum drying and freeze-drying, which allow for the production of powders of the active ingredient and any other desired components from a pre-sterilized filtered solution.
[0097] In one embodiment, the therapeutic compound can be prepared with a carrier that protects the therapeutic compound from rapid in vivo elimination, such as a sustained-release formulation including an implant and a microencapsulated administration system. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyacid anhydride, polyglycolic acid, collagen, poly(orthoester), and polylactic acid can be used. Such formulations can be prepared by standard techniques or purchased from, for example, Alza Corporation or Nova Pharmaceuticals, Inc. Liposome suspensions (containing liposomes targeting specific cells with monoclonal antibodies against cellular antigens) are also useful as pharmaceutically acceptable carriers. These can be prepared by methods known to those skilled in the art, such as the method described in, for example, U.S. Patent No. 4,522,811.
[0098] The pharmaceutical composition may be contained in a kit, container, packaging, or dispenser, along with instructions for administration.
[0099] Uses and Methods In some embodiments of this disclosure, the use of the adeno-associated virus described herein, the transgene delivery vector described herein, and / or the pharmaceutical composition described herein is provided in the preparation of reagents for delivering transgenes to cells.
[0100] In some other embodiments of the present disclosure, a method for delivering a transgene to a cell is provided, comprising the step of contacting the cell with the AAV described in the present disclosure, the transgene delivery vector described in the present disclosure, and / or the pharmaceutical composition described in the present disclosure.
[0101] The AAVs described in this disclosure are used to deliver transgenes, such as therapeutic transgenes, to tissues such as the central nervous system (brain), heart, muscle, or dorsal root ganglia or spinal cord (peripheral nervous system). In some embodiments, the AAVs described in this disclosure can deliver transgenes, such as therapeutic transgenes, to specific brain regions such as the cerebral cortex, cerebellum, hippocampus, substantia nigra, or amygdala. In some embodiments, the AAVs described in this disclosure can deliver transgenes / therapeutic transgenes to neurons, astrocytes, and / or glial cells.
[0102] In some embodiments, the AAV described herein is used to deliver a nucleic acid sequence encoding a therapeutic agent to a subject suffering from a brain disease. In some specific embodiments, the AAV described herein is used to deliver a nucleic acid sequence encoding a therapeutic agent to a subject suffering from a brain tumor. Brain tumors include gliomas (e.g., glioblastoma multiforme (GBM)), metastatic cancers (e.g., cancers originating from lung cancer, breast cancer, melanoma, or colorectal cancer), meningiomas, pituitary adenomas, and acoustic neuromas. Therefore, a subject diagnosed with a brain tumor can be systemically administered an AAV encoding an immunotherapy agent, for example, by intravenous administration, for example, by a targeting peptide as described herein.
[0103] In some other specific embodiments, the AAV described herein is used to deliver a nucleic acid sequence encoding a therapeutic agent to a subject suffering from another brain disorder. Other brain disorders include, but are not limited to, cerebrovascular disorders (e.g., arteriosclerosis, cerebral stenosis, cerebral infarction, cerebral hemorrhage, arteriovenous malformations, aneurysms, etc.), central nervous system infections (e.g., encephalitis, meningitis), and neurodegenerative diseases (e.g., Alzheimer's disease, Parkinson's disease).
[0104] In some embodiments, the AAV described herein may also be administered together with a chemotherapeutic agent. In some embodiments, the chemotherapeutic agent may be a toxin or cytotoxic agent and may include, but not be limited to, temozolomide, lomustine, or a combination thereof. See, for example, Herrlinger et al., Lancet. February 16, 2019;393(10172):678-688. The method may further include radiotherapy, surgery, or both.
[0105] In some specific embodiments of this disclosure, the use of the adeno-associated virus described herein, the transgene delivery vector described herein, and / or the pharmaceutical composition described herein is provided in the preparation of pharmaceuticals for the treatment of diseases.
[0106] In some other specific embodiments of the present disclosure, a method for treating a disease is provided, comprising the step of administering to a subject an adeno-associated virus described in the present disclosure, a transgene delivery vector described in the present disclosure, and / or a pharmaceutical composition described in the present disclosure.
[0107] In this disclosure, the disease described above may be any disease that can be treated with a transgene adeno-associated virus. In some preferred embodiments, the disease described above may be a brain disease. In some specific embodiments, the brain disease includes, but is not limited to, brain tumors, cerebrovascular disorders (e.g., cerebral arteriosclerosis, cerebral stenosis, cerebral infarction, cerebral hemorrhage, arteriovenous malformations, aneurysms, etc.), central nervous system infections (e.g., encephalitis, meningitis), and neurodegenerative diseases (e.g., Alzheimer's disease, Parkinson's disease). Examples
[0108] The following describes the present disclosure in detail with reference to specific embodiments, but these embodiments are for illustrative purposes only and the present disclosure is not limited thereto. The following embodiments may serve as guidelines for those skilled in the art to make further improvements, but they do not limit the present disclosure.
[0109] Unless otherwise specified, the experimental methods in the following examples are standard procedures and should be carried out in accordance with the techniques and conditions described in the literature in this field or in the product instruction manuals. Unless otherwise specified, the materials, reagents, etc. used in the following examples are commercially available.
[0110] Materials and methods In the following examples, recombinant AAVs are prepared by a general three-plasmid cotransfection method. The three plasmids consist of an RC plasmid (nucleotide sequence containing the capsid), a Helper plasmid (providing the necessary cofactors for generating AAVs), and a pAAV plasmid (providing the nucleotide sequence to be delivered, typically containing the promoter and cDNA necessary for protein translation). The serotype of the AAV is determined by the RC plasmid. For example, RC2 is used for packaging and preparing AAV2 type, RC6 is used for packaging and preparing AAV6 type, and RC9 is used for packaging and preparing AAV9 type. Capsid modification is achieved by genetically modifying the RC plasmid.
[0111] 1. Construction of the AAV capsid plasmid In the following examples, three capsid plasmids, RC2, RC6, and RC9 (the nucleotide sequence of RC2 is shown in SEQ ID NO:1, the nucleotide sequence of RC6 is shown in SEQ ID NO:2, and the nucleotide sequence of RC9 is shown in SEQ ID NO:3), are used. Using molecular biological techniques, the nucleotide sequence corresponding to the short-chain peptide GRGDSP (SEQ ID NO:4) was inserted at the 453rd amino acid position in the VP1 gene (SEQ ID NO:5) of the RC2 plasmid, yielding the corresponding RC2.2 plasmid (SEQ ID NO:6). Similarly, the nucleotide sequence corresponding to the short-chain peptide GRGDSP (SEQ ID NO:4) was inserted at the 588th amino acid position in the VP1 gene (SEQ ID NO:5) of the RC2 plasmid, yielding the corresponding RC2.3 plasmid (SEQ ID NO:7). The nucleotide sequence corresponding to the short-chain peptide GRGDSP (SEQ ID NO: 4) was inserted at the 454th amino acid position in the VP1 gene (SEQ ID NO: 8) of the RC6 plasmid, yielding the corresponding RC6.2 plasmid (SEQ ID NO: 9). The nucleotide sequence corresponding to the short-chain peptide GRGDSP (SEQ ID NO: 4) was inserted at the 588th amino acid position in the VP1 gene (SEQ ID NO: 8) of the RC6 plasmid, yielding the corresponding RC6.3 plasmid (SEQ ID NO: 10). The nucleotide sequence corresponding to the short-chain peptide GRGDSP (SEQ ID NO: 4) was inserted at the 455th amino acid position in the VP1 gene (SEQ ID NO: 11) of the RC9 plasmid, yielding the corresponding RC9.2 plasmid (SEQ ID NO: 12). The nucleotide sequence corresponding to the short-chain peptide GRGDSP (SEQ ID NO: 4) was inserted at position 588 of the corresponding amino acid in the VP1 gene (SEQ ID NO: 11) of the RC9 plasmid, yielding the corresponding RC9.3 plasmid (SEQ ID NO: 13). All nucleotide synthesis and plasmid construction were performed by Nanjing GenScript Biotechnology Corporation. The specific relevant sequences are as follows: SEQ ID NO:1 (Nucleotide sequence of RC2 plasmid): [ka] [ka] SEQ ID NO:2 (Nucleotide sequence of RC6 plasmid): [ka] [ka] SEQ ID NO:3 (Nucleotide sequence of RC9 plasmid): [ka] [ka] SEQ ID NO:4 (Nucleotide sequence corresponding to the short-chain peptide GRGDSP): [ka] SEQ ID NO: 5 (AAV2 VP1 gene sequence) [ka] SEQ ID NO: 6 (Nucleotide sequence of RC2.2 plasmid): [ka] [ka] SEQ ID NO:7 (Nucleotide sequence of RC2.3 plasmid): [ka] [ka] SEQ ID NO:8 (AAV6 VP1 gene sequence): [ka] SEQ ID NO:9 (Nucleotide sequence of RC6.2 plasmid): [ka] [ka] SEQ ID NO:10 (Nucleotide sequence of RC6.3 plasmid): [ka] [ka] SEQ ID NO:11 (AAV9 VP1 gene sequence): [ka] SEQ ID NO:12 (Nucleotide sequence of RC9.2 plasmid): [ka] [ka] SEQ ID NO:13 (Nucleotide sequence of RC9.3 plasmid): [ka] [ka]
[0112] 2. Packaging and titer measurement of AAV virus AAV virus packaging was performed according to a standard three-plasmid cotransfection method. The RC plasmid, Helper plasmid, and pAAV-CAG-RFP plasmid were chemically transfected into HEK293 cells. AAV virus particles were purified from HEK293 T cells by iodixanol density gradient separation. AAV titer was measured by a standard qPCR method. All AAVs were designed to express a red fluorescent protein (RFP) targeting the cell nucleus using the CAG generic promoter. Both AAV virus packaging and titer measurement were performed by Guangzhou PackGene Biotech. PackGene Biotech provided reagents and equipment other than the RC plasmid.
[0113] 3. Measurement of AAV infection efficiency in in vitro cells To verify the infection efficiency of various AAVs in in vitro cultured cells, target cells (HEK293 cells and U251 human glioblastoma cells) were seeded in a 24-well cell culture plate at a cell density of 100,000 cells per well. Subsequently, 10 cells were added to each well. 9 The AAV (Viral Genome, equivalent to a genome copy) to be detected was added to vg, and six double wells were set up for each AAV. After incubation for 4 days, the cells were fixed with 4% paraformaldehyde for 15 minutes. Then, the cell nuclei were stained with 0.05% DAPI. Finally, all cells were imaged under a fluorescence microscope and quantitatively analyzed.
[0114] 4. Measurement of in vivo mouse ventricular injection and AAV infection efficiency All mouse in vivo experiments were outsourced to Wuhan Servicebio. Female C57BL6 mice aged 6-8 weeks were deeply anesthetized and immobilized in a fixation device. After the lateral ventricles of the mice were positioned (coordinates: with the anterior fontanelle as the reference point, within a range of -0.11 to -0.35 mm posterior to the anterior fontanelle, 0.90-0.10 mm to the left and right, needle insertion depth 2.2 mm), 5 μL of AAV virus was injected into one lateral ventricle (8.3 × 10) using a microsyringe.9 It was slowly injected into the (vg / mouse) body.
[0115] After site-specific injection, the animals were reared for 4 weeks, and then the hearts were perfused with pre-cooled PBS and tissue was collected. For brain tissue and some liver tissue, fresh tissue was frozen, frozen sections were prepared, and fluorescence imaging was performed. For the remaining liver, skeletal muscle, heart, kidney, spleen, pancreas, and dorsal ganglia (DRG), AAV virus DNA and RNA were extracted after rapid tissue freezing and quantitative analysis was performed by qPCR.
[0116] Example 1: Fabrication of a modified AAV As shown in Figure 1, this embodiment involves modifying the molecules of capsid plasmids RC2, RC6, and RC9 (Figure 2) to insert the short-chain peptide GRGDSP at positions 453 and 588 of wild-type AAV2 (also named AAV2.1) to obtain modified AAV2.2 and AAV2.3, respectively; inserting the short-chain peptide GRGDSP at positions 454 and 588 of wild-type AAV6 (also named AAV6.1) to obtain modified AAV6.2 and AAV6.3, respectively; and inserting the short-chain peptide GRGDSP at positions 453 and 588 of wild-type AAV9 (also named AAV9.1) to obtain modified AAV9.2 and AAV9.3, respectively. All six modified AAVs were successfully packaged, and the titers of the resulting viruses were approximately equivalent to those of the wild type (Table 1). This embodiment demonstrates the compatibility between the newly inserted GRGDSP short-chain peptide at the designed site and the original AAV capsid.
[0117] [Table 2] However, "-" indicates that the targeting peptide has not been inserted.
[0118] Example 2: Improving the cell infection efficiency of modified AAV To measure the cell infection efficiency of modified AAVs, this example first used HEK293 cells, a tool cell for in vitro culture. As shown in Figures 3 to 5, most AAVs effectively infected HEK293 cells. Numerous DAPI-positive HEK293 cells simultaneously expressed AAV-mediated red fluorescence. Compared to wild-type AAV2 (AAV2.1) (Figure 3), the infection efficiency of AAV2.2 was comparable, but the infection efficiency of AAV2.3 was decreased. Compared to wild-type AAV6 (AAV6.1) (Figure 4), the infection efficiency of both AAV6.2 and AAV6.3 was improved. Compared to wild-type AAV9 (AAV9.1) (Figure 5), the infection efficiency of both AAV9.2 and AAV9.3 was also improved. The infection positivity percentages for each AAV are shown in Figure 6 (significance analysis method: modified and wild-type AAVs were compared using ANOVA + Dunnett post hoc, with ****P<0.0001).
[0119] In this study, we also evaluated the infection efficiency of all AAVs using in vitro cultured U251 human glioblastoma cells. As shown in Figures 7 to 9, the infection efficiency of each AAV to U251 tumor cells varied. Compared to wild-type AAV2 (AAV2.1) (Figure 7), the infection efficiency of AAV2.2 was comparable, but the infection efficiency of AAV2.3 decreased. Compared to wild-type AAV6 (AAV6.1) (Figure 8), the infection efficiency of AAV6.2 improved significantly, but the infection efficiency of AAV6.3 decreased. Compared to wild-type AAV9 (AAV9.1) (Figure 9), the infection efficiency of AAV9.2 improved dramatically, and the infection efficiency of AAV9.3 decreased slightly, but remained within an acceptable range. Based on the comparison, wild-type AAV2 and AAV6 were found to have a higher affinity for U251 tumor cells than wild-type AAV9. Figure 10 shows the infection positivity percentages for each AAV (significance analysis method: modified and wild-type AAVs were compared using ANOVA + Dunnett post hoc, with ****P<0.0001).
[0120] Based on the above, inserting the GRGDSP short-chain peptide into positions 453 / 454 / 455 of AAV2 / 6 / 9 improved their cell infection efficiency, and although the infection efficiency of AAV9.3 decreased slightly, it remained within an acceptable range.
[0121] Example 3: Modified AAV has higher brain directivity To study the targeting behavior of each AAV in brain tissue, this example involved site-targeted injection of an AAV carrying a red fluorescent protein gene (AAV-CAG-RFP) into the lateral ventricles of adult mice, and observing the expression of the AAV in brain tissue. Previous studies have shown that much of the AAV injected into the lateral ventricles "leaks" into the systemic circulatory system, infecting other tissues and posing a safety risk of off-target effects. This example focused on observing whether the modified AAV reduced expression in tissues other than brain tissue. As shown in Figures 11 and 12, after injection into the lateral ventricles, AAV-mediated red fluorescence was mainly expressed in brain tissue surrounding the lateral ventricles. Wild-type AAV2 (AAV2.1) had low overall expression efficiency, modified AAV2.2 showed slight improvement, but AAV2.3 showed extremely low expression in brain tissue. Wild-type AAV6 (AAV6.1) showed higher fluorescent protein expression than AAV2, while modified AAV6.2 and AAV6.3 had expression efficiencies comparable to AAV6. Wild-type AAV9 (AAV9.1) had the highest overall expression efficiency, while modified AAV9.2 showed a significantly lower expression efficiency, reducing its practical use in vivo. AAV9.3 also showed a slight decrease, but no significant difference was observed compared to wild-type AAV9, and it remains within an usable range. Statistical significance analysis method in Figure 12: Modified and wild-type AAVs were compared using ANOVA + Dunnett post hoc, with *P<0.05.
[0122] Similar to previous studies, histological data from this embodiment showed that much of the AAV2 and AAV9 injected into the lateral ventricle leaked into the surrounding area, resulting in high AAV expression in the liver (Figures 13 and 14). Wild-type AAV9 (AAV9.1) showed particularly high expression in the liver. AAV2.2, AAV6.2, and AAV9.2, obtained by inserting GRGDSP at positions 453 / 454 / 455, were able to reduce AAV expression in the liver. On the other hand, modified AAV2.3 at position 588 showed higher liver expression than the corresponding wild-type AAV2, modified AAV6.3 at position 588 showed liver expression comparable to the corresponding wild-type AAV6, but AAV9.3 showed lower liver expression than wild-type AAV9. In Figure 14, the significance analysis method was used to compare the modified and wild-type AAV using ANOVA + Dunnett post hoc, with *P<0.05, ***P<0.001, and ****P<0.0001.
[0123] In this example, the expression distribution of AAV in each major surrounding tissue was systematically measured by qPCR (Figures 15 and 16). Similar to the histological data above, this example again demonstrated at the DNA and RNA levels that the modified AAV obtained by inserting GRGDSP at positions 453 / 454 / 455 could effectively reduce the "leakage" of AAV injected into the lateral ventricle compared to the wild type. Statistical significance analysis methods in Figures 15 and 16: Modified and wild-type AAV were compared using ANOVA + Dunnett post hoc, respectively, with *P<0.05, **P<0.01, and ***P<0.001.
[0124] Based on the above, inserting the GRGDSP short-chain peptide into positions 453 or 454 of AAV2 and AAV6 improves the affinity of AAV to brain tissue, effectively reduces "off-target" infection in surrounding tissues, and significantly improves targeting of brain tissue. Inserting the GRGDSP short-chain peptide into position 588 of AAV9 (AAV9.3) resulted in slightly lower expression in brain tissue compared to wild-type AAV9, but no significant difference was observed. Wild-type AAV9 had the highest overall expression efficiency in brain tissue compared to other wild-types, and AAV9.3 was within a usable range. Furthermore, AAV9.3 showed lower expression in the liver compared to wild-type AAV9, reducing the "leakage" of wild-type AAV9, making AAV9.3 also a useful and ideal vector.
[0125] Example 4: In vitro evaluation of AAV capsid-mediated protein expression ability before and after modification using qPCR (transcription level) and Western blot (protein level). According to the experimental results of Examples 2 and 3 above, the ability of modified AAV6.2 and AAV9.2 to express the target protein in in vitro cell lines (e.g., qualitative experiment by counting the number of RFP-positive cells) and liver targeting were both superior to those before modification. Therefore, in Example 4, AAV6.2 and AAV9.2 were further studied as examples, and the ability of AAV6.1, AAV6.2;AAV9.1, and AAV9.2 to infect target cells and express the target protein was relatively quantified by qPCR and WB.
[0126] Experimental method: AAV virus packaging and titer measurement: AAV virus packaging was performed according to a standard three-plasmid cotransfection method. RC plasmids (same as in Example 1; specifically, RC6, RC6.2, RC9, and RC9.2 from Example 1), Helper plasmid, and pAAV-CAG-EGFP plasmid were transfected into HEK293 cells by chemical methods. AAV virus particles were purified from HEK293 T cells by iodixanol density gradient separation. AAV titer was measured by a standard qPCR method. All AAVs were designed to express enhanced green fluorescent protein (EGFP) using the CAG generic promoter. Both AAV virus packaging and titer measurement were performed by Shandong Vigene Biosciences Co., Ltd. Shandong Vigene Biosciences provided reagents and equipment other than the RC plasmids.
[0127] The titer of the packaging virus is as follows: [Table 3]
[0128] Cell resuscitation HEK293 (donated by NovoCodex Biopharmaceuticals Co., Ltd.) and BT474 (donated by NovoCodex Biopharmaceuticals Co., Ltd.) cells were removed from the liquid nitrogen storage tank into culture dishes, revived, and cultured for three generations under appropriate conditions.
[0129] Cell dissemination and viral infection 1) Collect cells in the logarithmic growth phase and place them in a 24-well plate, 1 × 10⁶ cells per well. 5 For the individual cells, 10,000 cells were seeded per well in a 96-well plate. 2) After the cells reached 70-80% confluence, they were infected with the virus. The culture medium was changed 2-4 hours before infection, and 1 ml of medium was added to each well. 4 × 10 cells per well in a 6-well plate. 10 VG virus (N=3), 10 per well in a 24-well plate 10 We added the vg virus (N=3).
[0130] RNA extraction Cellular RNA was extracted using an RNA extraction kit from Yeasen Biotechnology (Shanghai) Co., Ltd., and its concentration was immediately measured and reverse transcription performed.
[0131] RNA reverse transcription RNA was reverse transcribed into cDNA using TransGen Biotech's reverse transcription kit.
[0132] qPCR 1. Primer design and synthesis: Primers were designed using primer 5, and synthesis was outsourced to Nanjing GenScript Biotechnology Corporation. 2. The primer sequence is as follows. After obtaining the primers, DEPC water was added according to the instructions, thoroughly vortex-mixed, and stored at -20°C. hActin-F:CATGTACGTTGCTATCCAGGC(SEQ ID NO:24) hActin-R:CTCCTTAATGTCACGCACGAT(SEQ ID NO:25) EGFP-F:GACCACTACCAGCAGAACAC(SEQ ID NO:26) EGFP-R:GAACTCCAGCAGGACCATG(SEQ ID NO:27)
[0133] qPCR reaction system and conditions The experiment was conducted using a qPCR kit from TransGen Biotech.
[0134] Reaction system design 2×Green qPCR SuperMix 10μl Upstream primer (10 mM) 0.4 μl Downstream primer (10 mM) 0.4 μl Template cDNA 1 μl ddH2O 8.2 μl
[0135] After spotting was complete, the lid was closed, the system was briefly centrifuged to homogenize it and remove air bubbles, and detection was performed using a real-time quantitative PCR instrument. The reaction conditions were 94°C -- 30 sec; 94°C -- 5 s; 60°C -- 30 s; Melt curve - 40 cycles. The data was analyzed using the delta-delta Ct method.
[0136] Western blot (WB) (1) Preparation of cell-derived protein samples a. Prepare the cell lysate and add 100 mM PMSF to the RIPA cell lysate in a volume ratio of RIPA:PMSF = 100:1 (Beyotime Biotech Inc.), and store on ice. b. Wash the cell samples at this point three times with PBS buffer pre-cooled to 4°C. c. Add 200 μl of RIPA lysate per well to a 6-well plate, gently shake the culture plate, place the culture plate in an icebox, and place the icebox on a shaker to allow the cells to react for 10 minutes to ensure complete lysis. d. Using a pipette, gently tap the cell lysate until no obvious cell clumps remain, transfer to a 1.5 mL centrifuge tube, and centrifuge at 4°C and 12,000 rpm for 10 min. Carefully aspirate 150 μl of the supernatant (the remainder is subjected to BCA) into a new 1.5 mL centrifuge tube, add 50 μl of 4× SDS protein loading buffer, heat in a metal bath at 100°C for 10 min, and store long-term at -20°C.
[0137] (2) Measurement of protein concentration a. 20 μl of the above protein sample was carefully aspirated into a 96-well plate. b. 5 mg / mL BSA protein standards were dispensed into the 96-well plate in 0, 2, 4, 6, 8, 12, 16, and 20 μl portions, and PBS buffer was added until the final volume reached 20 μl. c. Working solution (BCA reagent:Cu reagent = 50:1, 200 μl / well) (Beyotime Biotech Inc.) was added. d. The reaction was carried out in a 37°C chamber in the dark for 30 minutes. Absorbance at 562 nm was measured using a microplate reader, a standard curve was created, and the corresponding protein sample concentrations were calculated.
[0138] (3) SDS-PAGE Western blotting analysis a. Electrophoresis conditions: Electrophoresis was performed at a constant voltage of 70V for 50 minutes, then at a constant voltage of 110V for 70 minutes. The bromophenol blue at the front of the gel plate was observed to determine whether to terminate the electrophoresis. b. Transfer: 1× transfer buffer pre-cooled in the refrigerator was removed, the transfer apparatus was immersed in it, and the PVDF membrane was activated with anhydrous methanol for 30 seconds. The transfer apparatus was then arranged in a wet state in the following direction: black side - metal mesh - 3-layer filter paper - gel - PVDF membrane - 3-layer filter paper - metal mesh - white side. Clips were inserted into the transfer chamber in the direction of (black to black, red to red), and transfer buffer was added up to the blotting marker line. Transfer was performed at 4°C and 200mA for 2 hours. c. After the blocking transfer was complete, the presence of excess residual marker on the separated gel was checked. If there was no excess residue, the PVDF membrane was completely immersed in a plastic container with 5% skim milk, the plastic container was placed in a low-speed rotating shaker, and incubated at room temperature for 1-2 hours. d. After antibody incubation blocking was complete, the PVDF membrane was briefly washed with Ultrapure water, the membrane was cut according to the size of the protein, and the resulting membrane was placed in the septum of the incubation box. The corresponding 1:1000 diluted primary antibody was added. The antibody incubation box was placed on a slow-speed shaker and incubated at 4°C for 16-20 hours. After the primary antibody incubation was complete, the primary antibody was collected, rinsed with 1×TBST, and rapidly incubated at room temperature for 10 minutes on a shaker (repeat 3 times). Secondary antibody (1:10000) was added, the antibody incubation box was placed on a slow-speed shaker and incubated at room temperature for 1 hour, and the solution was discarded. Rinse with 1×TBST and rapidly incubated at room temperature for 10 minutes on a shaker (repeat 3 times). e. Development: ECL luminescence solution (Solution A:Solution B = 1:1) was added, exposure was performed, image data was saved, and grayscale analysis was performed using ImageJ.
[0139] Experimental results and analysis Cell samples from 24-well and 6-well plates were lysed to extract RNA and proteins, and the levels of EGFP mRNA and protein were measured using relative quantitative qPCR and Western blot (β-actin as an endogenous control). The results are shown in Figures 17 to 20B. As shown in Figure 17, the results indicate that in HEK293 cells, all capsids mediated EGFP expression, and EGFP levels were significantly elevated compared to the NC group (blank control group - no AAV for infection added). After adding short-chain peptides to the capsids, infectivity was significantly increased compared to before modification (AAV6.2 increased 36.5 times compared to AAV6, and AAV9.2 increased 6.44 times compared to AAV9), with AAV6.2 being significantly superior to AAV9.2 (20.8 times).
[0140] As shown in Figures 18A and 18B, the WB experimental results and qPCR results were consistent, and in HEK293 cells, the ability to express EGFP protein mediated by modified AAV was significantly increased compared to before modification, with AAV6.2 being superior to AAV9.2.
[0141] As shown in Figure 19, in BT474 cells, the modified AAV6.2 had a high infectivity to BT474 cells (AAV6.2 was 4.4 times more effective than AAV6), but AAV9 and AAV9.2 had low infectivity to BT474 cells, and no significant difference was observed before and after modification.
[0142] As shown in Figures 20A and 20B, the WB experimental results and qPCR results were consistent, and the ability of the modified AAV6.2-mediated EGFP protein expression was significantly increased compared to the pre-modification state. No expression of AAV9 or AAV9.2-mediated EGFP was detected in BT474 cells.
[0143] Therefore, qPCR and WB experimental results showed that AAV6.2 has higher infectivity compared to the unmodified cell, and (in HEK293 and BT474 cells) AAV6.2-mediated EGFP expression ability is superior to that of AAV9.2.
[0144] Furthermore, regarding the results of this embodiment, as demonstrated in Examples 2 and 3, the modified AAV9.2 improves the affinity of the corresponding AAV to brain tissue, effectively reduces "off-target" infection of surrounding tissues, and significantly improves target-directivity to brain tissue. Therefore, the low infectivity to human embryonic kidney cells HEK293T and human breast cancer cells BT474 does not mean that it cannot be used as a vector targeting brain tissue.
[0145] Example 5: In vitro verification of the relationship between AAV6 and AAV6.2-mediated protein expression capacity and infection time. According to the results of Example 4, (for example, by relative quantitative experiments measuring mRNA and protein levels) the modified AAV6.2 showed significantly superior ability to mediate the expression of the target protein in an in vitro cell system compared to the original. Therefore, in Example 5, AAV6.2 was further investigated as an example.
[0146] This example verifies the ability and superiority of novel capsid-mediated target protein expression after capsid modification. Since gastric cancer, breast cancer, colorectal cancer, prostate cancer, and melanoma are prone to brain metastasis, experiments were conducted using corresponding cell lines and brain-derived tumor cell lines. In this experiment, AAV6 and AAV6.2 with the same titer were used to infect cell lines of different origins, and the EGFP fluorescence intensity was measured using a microplate reader to quantify the AAV-mediated target protein expression ability.
[0147] Experimental method Cells were seeded in 96-well plates using different cell lines (see Table 2; all purchased from Wuhan Pricella Biotechnology Co., Ltd.). The number of cells per well at seeding time was determined according to the characteristics of the cells. Cells with a doubling time of approximately 24 hours were seeded at 5,000 to 10,000 cells, while cells with a doubling time of approximately 84 hours or more were seeded at 20,000 to 30,000 cells.
[0148] After the confluence reached 40-50%, the virus (using AAV6-CAG-EGFP and AAV6.2-CAG-EGFP prepared in Example 4) was added.
[0149] At corresponding time points, the culture medium for the corresponding group was replaced with a virus-free complete medium (n=6). Culturing was stopped 72 hours after infection, and EGFP fluorescence intensity was measured using a microplate reader. Infection times were 0h, 4h, 6h, 8h, 12h, 24h, 36h, 48h, 60h, and 72h.
[0150] Experimental results and analysis [Table 4]
[0151] The experimental results are shown in Table 2 and Figures 21A to 21I above. The results show that both AAV6 and AAV6.2 could infect small cell lung cancer, neuroblastoma, glioma, glioblastoma cells, breast cancer, prostate cancer, malignant melanoma cells, and colorectal cancer cells, and the ability to express the target protein mediated by the novel capsid after capsid modification was significantly increased.
[0152] References 1. Lawler, SE et al. “Genetic strategies for brain tumor therapy.” Cancer gene therapy vol. 13,3 (2006): 225-33. doi:10.1038 / sj.cgt.7700886 2. Vance, Melisa, Mitchell, Angela, Samulski, Richard. “AAV Biology, Infectivity and Therapeutic Use from Bench to Clinic”. Gene Therapy - Principles and Challenges, edited by Doaa Hashad, IntechOpen, 2015. 10.5772 / 61988. 3. Santiago-Ortiz, Jorge L, and David V Schaffer. “Adeno-associated virus (AAV) vectors in cancer gene therapy.” Journal of controlled release : official journal of the Controlled Release Society vol. 240 (2016): 287-301. doi:10.1016 / j.jconrel.2016.01.001 4. Buning, Hildegard, and Arun Srivastava. “Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors.” Molecular therapy. Methods & clinical development vol. 12 248-265. 26 Jan. 2019, doi:10.1016 / j.omtm.2019.01.008 5. Davidson, B L et al. “Recombinant adeno-associated virus type 2, 4, and 5 vectors: transduction of variant cell types and regions in the mammalian central nervous system.” Proceedings of the National Academy of Sciences of the United States of America vol. 97,7 (2000): 3428-32. doi:10.1073 / pnas.97.7.3428 6. Dirren, Elisabeth et al. “Intracerebroventricular injection of adeno-associated virus 6 and 9 vectors for cell type-specific transgene expression in the spinal cord.” Human gene therapy vol. 25,2 (2014): 109-20. doi:10.1089 / hum.2013.021 7. Girod, A et al. “Genetic capsid modifications allow efficient re-targeting of adeno-associated virus type 2.” Nature medicine vol. 5,9 (1999): 1052-6. doi:10.1038 / 12491 8. Shi, Wenfang, and Jeffrey S Bartlett. “RGD inclusion in VP3 provides adeno-associated virus type 2 (AAV2)-based vectors with a heparan sulfate-independent cell entry mechanism.” Molecular therapy : the journal of the American Society of Gene Therapy vol. 7,4 (2003): 515-25. doi:10.1016 / s1525-0016(03)00042-x 9. Boucas, Jorge et al. “Engineering adeno-associated virus serotype 2-based targeting vectors using a new insertion site-position 453-and single point mutations.” The journal of gene medicine vol. 11,12 (2009): 1103-13. doi:10.1002 / jgm.1392
Claims
1. An adeno-associated virus capsid protein containing a targeting peptide, wherein the targeting peptide is (i) The amino acid sequence shown in SEQ ID NO: 23, (ii) An amino acid sequence having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 23, and having, or partially having, the function of the amino acid sequence shown in SEQ ID NO:
23. (iii) An amino acid sequence in which one or more amino acid residues are added, substituted, deleted, or inserted in the amino acid sequence shown in SEQ ID NO: 23, and which has or partially has the function of the amino acid sequence shown in SEQ ID NO: 23, or (iv) An amino acid sequence encoded by a nucleotide sequence that hybridizes a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 23 under stringency conditions of medium stringency, medium to high stringency, high stringency, or very high stringency, and which has, or partially has, the function of the amino acid sequence shown in SEQ ID NO:
23. Adeno-associated virus capsid proteins containing one or more of the following types.
2. The adeno-associated virus is one or more selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, rh. 10, rh. 39, rh. 43, and rh.
74. Preferably, the adeno-associated virus is one or more selected from AAV2, AAV6, and AAV9, the adeno-associated virus capsid protein according to claim 1.
3. AAV2 includes AAV2 VP1, AAV2 VP2 and / or AAV2 VP3, and / or AAV6 includes AAV6 VP1, AAV6 VP2 and / or AAV6 VP3, and / or The adeno-associated virus capsid protein according to claim 1 or 2, wherein AAV9 comprises AAV9 VP1, AAV9 VP2 and / or AAV9 VP3.
4. The targeting peptide is inserted into amino acid positions 453 and / or 588 of AAV2 VP1, AAV2 VP2 and / or AAV2 VP3, and / or The targeting peptide is inserted into amino acid positions 454 and / or 588 of AAV6 VP1, AAV6 VP2 and / or AAV6 VP3, and / or The adeno-associated virus capsid protein according to claim 3, wherein the targeting peptide is inserted into amino acid positions 455 and / or 588 of AAV9 VP1, AAV9 VP2 and / or AAV9 VP3.
5. The targeting peptide is inserted at amino acid position 453 of AAV2 VP1, AAV2 VP2 and / or AAV2 VP3, and / or The targeting peptide is inserted at amino acid position 454 of AAV6 VP1, AAV6 VP2 and / or AAV6 VP3, and / or The adeno-associated virus capsid protein according to claim 3, wherein the targeting peptide is inserted at amino acid position 588 of AAV9 VP1, AAV9 VP2 and / or AAV9 VP3.
6. A polynucleotide encoding an adeno-associated virus capsid protein according to any one of claims 1 to 5.
7. An adeno-associated virus comprising the adeno-associated virus capsid protein according to any one of claims 1 to 5.
8. Furthermore, it contains transgenes, The adeno-associated virus according to claim 7, wherein the transgene is optionally a therapeutic transgene, a prophylactic transgene, or a diagnostic transgene.
9. A transgene delivery vector comprising adeno-associated virus according to claim 7 or 8.
10. (a) an adeno-associated virus according to claim 7 or 8 or a transgene delivery vector according to claim 9, and optionally, (b) A pharmaceutically acceptable carrier, A pharmaceutical composition containing the following:
11. Use of the adeno-associated virus according to claim 7 or 8, the transgene delivery vector according to claim 9, or the pharmaceutical composition according to claim 10 in the preparation of reagents for delivering transgenes to cells.
12. The aforementioned cells are derived from the subject, Preferably, the subject is a mammalian subject, The use according to claim 11, more preferably, wherein the subject is a human.
13. The use according to claim 11 or 12, wherein the cells are derived from brain tissue.
14. The use according to claim 12 or 13, wherein the subject suffers from a brain disease.
15. The adeno-associated virus, the transgene delivery vector, or the pharmaceutical composition is administered to a subject via one or more methods, such as intravenous, intra-arterial, subcutaneous, intraperitoneal, intramuscular, intracerebrospinal fluid, brain tissue, or tumor. Preferably, the use according to any one of claims 11 to 14, in which the drug is administered to the subject intravenously, intraarterially, intracerebrospinal fluid, intrabrain tissue, or intratumor, in one or more ways.
16. The use of the adeno-associated virus according to claim 7 or 8, the transgene delivery vector according to claim 9, or the pharmaceutical composition according to claim 10 in the preparation of a pharmaceutical for treating a disease, Preferably, the disease includes brain diseases.