Composition for predicting or diagnosing hearing loss
Real-time PCR-based methods for detecting point mutations and copy number variations in specific genes address the limitations of NGS, enabling rapid and cost-effective hearing loss diagnosis, improving accessibility and accuracy.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- SEOUL NAT UNIV HOSPITAL
- Filing Date
- 2024-06-13
- Publication Date
- 2026-06-17
AI Technical Summary
Current genetic diagnosis methods for hearing loss, such as next-generation sequencing (NGS), are costly, time-consuming, and prone to errors, limiting their widespread adoption, especially in detecting point mutations and copy number variations in hearing loss genes, and existing screening kits are limited in scope and accuracy.
A composition and system using real-time PCR to detect point mutations and copy number variations in multiple hearing loss-related genes, including specific primer sets for genes like STRC and OTOA, enabling simultaneous screening and rapid, cost-effective prediction or diagnosis of hearing loss.
The method allows for rapid and inexpensive prediction or diagnosis of hearing loss by detecting multiple mutations, reducing the need for complex and costly NGS, and providing accurate results for both clinicians and patients.
Smart Images

Figure 2026519715000001 
Figure 2026519715000002 
Figure 2026519715000003
Abstract
Description
Technical Field
[0001] This specification discloses a composition, a system, and a method for providing information for predicting or diagnosing hearing impairment, including a reagent for detecting point mutations or copy number mutations in multiple genes.
Background Art
[0002] Sensorineural hearing loss becomes extremely common with aging, and about one-third of people in their 60s have significant hearing loss. If sensorineural hearing loss is left untreated, it may lead to serious sequelae and social losses, such as difficulties in language development and brain development in children, and an increased incidence of depression and dementia in adults. Approximately 60% of sensorineural hearing loss is caused by gene mutations, and the number of genes involved in hearing loss in humans exceeds 100 even with the currently identified ones, characterized by extremely high diversity or heterogeneity.
[0003] Most hearing loss treatments are limited to auditory rehabilitation, which is roughly classified into hearing aids and cochlear implants. Identifying the genes causing hearing loss plays an important role in determining the appropriate timing of such auditory rehabilitation and cochlear implant surgery, and is also an important factor in the treatment of imminent hearing loss genes.
[0004] Currently, next-generation sequencing (NGS) is being applied clinically. Genetic diagnosis of hearing loss using NGS, while varying somewhat depending on the diagnostic testing department of each hospital, costs at least 700,000 won out-of-pocket for patients and requires an average turnover time of approximately two months. Furthermore, the analysis requires a significant amount of manpower, inevitably leading to errors, and there is a risk of significant differences in interpretation depending on the genetic knowledge of the clinician reading the results report. Therefore, currently, only a select few hospitals with a patient population that can afford the necessary financial resources and with the aforementioned systems perfectly in place can afford to accept the 2-3 month turnover time (the time from the test to the results report) to perform the test.
[0005] Therefore, despite the introduction of NGS, genetic diagnosis in the field of hearing loss has not yet become widespread. Thus, there is a need for a mutation screening system that is easy to implement, inexpensive, and easy to interpret for both patients and healthcare professionals.
[0006] In particular, due to the characteristics of Koreans as a single ethnic group, although the genes causing hearing loss remain diverse, the spectrum of mutations is considerably more limited compared to multi-ethnic nations, thus providing a genetic basis for successful mutation screening kits. Currently, there are real-time PCR-based screening kits for 22 mutations in 10 common causative genes of congenital hearing loss in Korean children, but there are no screening kits for mutations in other genes that account for the majority of all hearing loss gene mutations.
[0007] Furthermore, for copy number variations (CNVs) in the STRC gene, the most important cause of moderate hearing loss in Koreans, there are only two methods: 1) performing the MLPA method separately, or 2) analyzing the NGS results using very complex software. This makes clinical application difficult, and there is a limitation in that both different testing methods must be used to examine point mutations in other hearing loss genes.
[0008] On the other hand, the G-Scan, a neonatal chromosomal abnormality screening test, includes a hearing loss gene screening test as an optional test item. However, although this kit includes approximately 270 mutations in five hearing loss genes, the number of hearing loss genes is very limited, and it cannot detect copy number mutations in the STRC gene. Furthermore, it includes several mutations with unknown pathogenic potential, which poses a serious problem that causes confusion for clinicians. Above all, the G-Scan has an even greater limitation in that it is not intended to investigate the cause of hearing loss in patients, but rather to screen all newborns for the presence or absence of hearing loss along with other congenital metabolic disorders.
[0009] Therefore, in order to popularize genetic diagnosis of hearing loss, the inventors conducted research on a method that can predict or diagnose hearing loss by simultaneously detecting point mutations and copy number mutations related to hearing loss, which is faster and less expensive than NGS, and have completed the present invention. [Overview of the project] [Problems that the invention aims to solve]
[0010] [Cross-reference of related applications] This application claims the benefit and priority of Korean Patent Application No. 10-2023-0075676, filed on 13 June 2023, with the title of the invention being "Composition for Predicting or Diagnosing Hearing Loss," and the entire contents of all such documents are incorporated herein by reference.
[0011] The inventors have confirmed that hearing loss can be predicted or diagnosed by detecting point mutations in multiple genes associated with hearing loss, or copy number mutations in at least one gene selected from the group consisting of STRC and OTOA, using real-time PCR.
[0012] Therefore, in one embodiment, the present invention aims to provide compositions, systems, and information provision methods for predicting or diagnosing hearing loss. [Means for solving the problem]
[0013] In one aspect, the present invention relates to a composition for predicting or diagnosing hearing loss, wherein the composition comprises MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RP The present invention provides a composition for predicting or diagnosing hearing loss, comprising a reagent for detecting a point mutation in at least one gene selected from the group consisting of S6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9, or a copy number variation (CNV) in at least one gene selected from the group consisting of STRC and OTOA.
[0014] In another embodiment, the present invention provides a system for predicting or diagnosing hearing loss, comprising the aforementioned composition for predicting or diagnosing hearing loss.
[0015] In another embodiment, the present invention relates to a method for providing information for predicting or diagnosing hearing loss, wherein the method provides information from a sample of a subject, including MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, PO The present invention provides an information-providing method that includes the step of detecting a point mutation in at least one gene selected from the group consisting of U4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9, or a copy number variation (CNV) in at least one gene selected from the group consisting of STRC and OTOA. [Effects of the Invention]
[0016] In one aspect, the present invention relates to MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP By including a reagent capable of detecting point mutations in at least one gene selected from the group consisting of 31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9, or copy number mutations in at least one gene selected from the group consisting of STRC and OTOA, it is possible to simultaneously screen for multiple mutations based on real-time PCR rather than NGS, exhibiting excellent effects such as low cost and rapid prediction or diagnosis of hearing loss. [Modes for carrying out the invention]
[0017] The present invention will be described in detail below.
[0018] In one aspect of the present invention, “prediction of hearing loss” may mean predicting or diagnosing whether a subject is likely to develop hearing loss, has a relatively high probability of developing hearing loss, what the causative factors of hearing loss are, or whether hearing loss has already developed. Also in one aspect of the present invention, “diagnosis of hearing loss” may mean confirming the presence or characteristics of a pathological condition in a subject, and in the context of one aspect of the present invention, diagnosis may mean confirming the presence or absence of hearing loss. Compositions and systems according to one aspect of the present invention can be used to delay the onset of hearing loss or prevent its onset by providing special and appropriate management to any specific subject, specifically animal subjects, and more specifically subjects at high risk of developing hearing loss. Also, “for predicting or diagnosing hearing loss” may include predicting or diagnosing the genetic cause of hearing loss. Furthermore, compositions and systems according to one aspect of the present invention can be used clinically to determine treatment by diagnosing hearing loss early and selecting the most appropriate treatment method.
[0019] In one aspect, the present invention relates to MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SO The present invention provides a composition for predicting or diagnosing hearing loss, comprising a reagent for detecting a point mutation in at least one gene selected from the group consisting of X10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9, or a copy number variation (CNV) in at least one gene selected from the group consisting of STRC and OTOA.
[0020] A composition according to one aspect of the present invention may be used for polymerase chain reaction (real-time PCR).
[0021] A composition according to one aspect of the present invention may include a reagent for detecting a point mutation in at least one gene selected from the group consisting of MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9. When a point mutation in the gene is detected from a sample of the subject, the composition according to one aspect of the present invention can predict or diagnose that the subject has a gene copy number mutation, specifically, can predict or diagnose that the subject has hearing loss.
[0022] The point mutation according to one aspect of the present invention may be at least one mutation selected from Table A below.
[0023] [Table A] TIFF2026519715000001.tif217170TIFF2026519715000002.tif216170TIFF2026519715000003.tif44170<00......
[0026] [Table B] TIFF2026519715000004.tif222170TIFF2026519715000005.tif217170
[0027] When at least one of the point mutations shown in Table B is detected from a sample of the subject, the composition according to one aspect of the present invention may predict or diagnose that the subject has hearing loss.
[0028] The composition according to one aspect of the present invention may further include a reagent for detecting a point mutation of at least one gene selected from the group consisting of MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G. When the point mutation of the gene is detected from a sample of the subject, the composition according to one aspect of the present invention may predict or diagnose that the subject has hearing loss.
[0029] The point mutation according to one aspect of the present invention may be at least one mutation selected from Table C below.
[0030] [Table C] TIFF2026519715000006.tif212170TIFF2026519715000007.tif217170TIFF2026519715000008.tif217170TIFF2026519715000009.tif217170TIFF2026519715000010.tif218170TIFF2026519715000011.tif211170TIFF2026519715000012.tif213170TIFF2026519715000013.tif66170
[0031] A composition according to one aspect of the present invention may predict or diagnose a subject having hearing loss if at least one of the point mutations in Table C is detected in the subject's sample.
[0032] A composition according to one aspect of the present invention may include a reagent for detecting copy number variation (CNV) of at least one gene selected from the group consisting of STRC and OTOA.
[0033] A composition according to one aspect of the present invention can predict or diagnose a subject having a gene copy number mutation if the value calculated by dividing the copy number of at least one gene selected from the group consisting of STRC and OTOA measured in a subject's sample by the copy number of the standard gene EFTUD2 is less than 0.8 or greater than 1.2, and specifically, can predict or diagnose hearing loss. Specifically, if the value calculated by dividing the copy number of at least one gene selected from the group consisting of STRC and OTOA measured in a subject's sample by the copy number of the standard gene EFTUD2 is less than 0.8, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less or 0.1 or less, or greater than 1.2, 1.3 or greater, 1.4 or greater, 1.5 or greater, 1.6 or greater or 1.7 or greater, a subject can predict or diagnose a subject having a gene copy number mutation, and more specifically, can predict or diagnose hearing loss. According to one embodiment of the present invention, if the value obtained by dividing the copy number of at least one gene selected from the group consisting of STRC and OTOA measured in a subject's sample by the copy number of the standard gene EFTUD2 exceeds 1.2, then values between 0.8 and 1.2 are interpreted as normal, values between 0.3 and 0.7 as a one-allele copy loss, values between 0 and 0.2 as a two-allele copy loss, and values between 1.3 and 1.7 as a one-allele copy gain. As a result, if the value is not within the normal range of 0.8 to 1.2, it can be predicted or diagnosed that the subject has a gene copy number variation, and more specifically, it can be predicted or diagnosed that the subject has hearing loss.
[0034] The hearing loss according to one aspect of the present invention may be sensorineural hearing loss, conductive hearing loss, or mixed hearing loss.
[0035] The hearing loss according to one aspect of the present invention may be moderate hearing loss.
[0036] The hearing loss according to one aspect of the present invention may be hearing loss caused by a gene copy number mutation or a point mutation, or hearing loss resulting from a gene copy number mutation or a point mutation.
[0037] The detection reagent according to one aspect of the present invention may be a primer or a probe.
[0038] Specifically, the primer refers to a single-stranded polynucleotide that can act as a starting point in the polymerization reaction of nucleotides by polymerase. For example, the primer may be a single-stranded polynucleotide that can act as a starting point for template-directed DNA synthesis under appropriate conditions in an appropriate temperature and buffer, i.e., in the presence of four different nucleoside triphosphates and polymerase. The appropriate length of the primer can vary depending on various factors, such as temperature and the intended use of the primer. The length of the primer may be 15 to 30 nucleotides. For example, the shorter the length of the primer, the more stable the hybridization complex with the template can be formed at a lower annealing temperature. The length of the primer may be about 5 to 100 nucleotides (hereinafter referred to as "nt"), about 10 to 80 nt, about 10 to 60 nt, about 10 to 50 nt, about 10 to 40 nt, about 10 to 30 nt, or about 10 to 20 nt.
[0039] Specifically, the probe refers to an oligonucleotide that can specifically bind to a target nucleic acid. The probe may be bound to a labeling substance. The length of the probe may be approximately 50-400 nt, approximately 100-350 nt, approximately 150-300 nt, or approximately 200-250 nt.
[0040] The probes or primers can be chemically synthesized using the phosphoramidite solid support method or other widely known methods. These nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, "capping," substitution of a native nucleotide with at least one congener, and modifications between nucleotides, such as modifications to uncharged linkers (e.g., methylphosphonates, phosphotriesters, phosphoramidites, carbamates, etc.) or charged linkers (e.g., phosphorothioates, phosphorodithioates, etc.).
[0041] A composition according to one aspect of the present invention may be applied to a sample of a subject, the sample being MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIO according to one aspect of the present invention BP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LM X1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL 2. This means all samples obtained from individuals in which a point mutation in at least one gene selected from the group consisting of JAG1, KCNQ4, KITLG, MITF, MYH14, MYH9, MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G, or a copy number mutation in at least one gene selected from the group consisting of STRC and OTOA, can be detected. Specifically, the sample may be at least one selected from the group consisting of saliva, biopsy, blood, tissue, liquid culture, feces, and urine, and may be prepared by processing by methods commonly used in the art of the present invention.
[0042] A primer according to one aspect of the present invention may include a primer for detecting gene copy number mutations.
[0043] A primer for detecting gene copy number mutations according to one aspect of the present invention may include at least one primer set selected from the group consisting of a first primer set of SEQ ID NOs: 1 and 2, a second primer set of SEQ ID NOs: 3 and 4, a third primer set of SEQ ID NOs: 5 and 6, a fourth primer set of SEQ ID NOs: 7 and 8, a fifth primer set of SEQ ID NOs: 9 and 10, and a sixth primer set of SEQ ID NOs: 11 and 12.
[0044] In another embodiment, the present invention provides a system for predicting or diagnosing hearing loss, comprising the aforementioned composition for predicting or diagnosing hearing loss. The description relating to the aforementioned composition for predicting or diagnosing hearing loss may apply to the system. Hearing loss, MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC , TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, MYH9, MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, USH1G, point mutations, gene copy number variations, detection reagents, and explanations regarding the prediction or diagnosis of hearing loss are as described above.
[0045] The system according to one aspect of the present invention may be an RT-PCR system or a microarray system.
[0046] Specifically, the RT-PCR system may include a pair of primers capable of amplifying nucleic acids containing the point mutation or gene copy number variation region, as well as other test tubes or other suitable containers, reaction buffers, deoxyribonucleotides (dNTPs), enzymes such as Taq polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC water, sterile water, etc. It may also include a primer pair specific to the gene used as a quantitative control group.
[0047] Alternatively, the microarray chip system may specifically include a microarray having a substrate on which nucleic acids containing the point mutation or gene copy number variation region are immobilized. The microarray may consist of a conventional microarray, except that it contains the polynucleotide, primer or probe of the present invention. Nucleic acid hybridization on a microarray and detection of the hybridization result are well known in the art. For example, the detection can be performed by labeling the nucleic acid sample with a labeling substance that can generate a detectable signal, such as a fluorescent substance including Cy3 and Cy5, then performing hybridization on the microarray, and detecting the signal generated from the labeling substance to detect the hybridization result.
[0048] The system according to one aspect of the present invention may further include a manual.
[0049] The above description relating to one aspect of the present invention includes the following compounds from a subject's sample: MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A It may be stated that hearing loss is predicted or diagnosed if a point mutation in at least one gene selected from the group consisting of 1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, MYH9, MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G, or a copy number mutation in at least one gene selected from the group consisting of STRC and OTOA, is detected.
[0050] The description of one aspect of the present invention may state that hearing loss is predicted or diagnosed if at least one of the point mutations in Tables A to C is detected in a sample of a subject.
[0051] The description of one aspect of the present invention may state that if the value calculated by dividing the copy number of at least one gene selected from the group consisting of STRC and OTOA measured in a subject's sample by the copy number of the standard gene EFTUD2 is less than 0.8 or greater than 1.2, the subject can be predicted or diagnosed to have a gene copy number mutation, and more specifically, to be predicted or diagnosed to have hearing loss. Specifically, the description may state that if the value calculated by dividing the copy number of at least one gene selected from the group consisting of STRC and OTOA measured in a subject's sample by the copy number of the standard gene EFTUD2 is less than 0.8, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less or 0.1 or less, or greater than 1.2, 1.3 or greater, 1.4 or greater, 1.5 or greater, 1.6 or greater or 1.7 or greater, the subject can be predicted or diagnosed to have a gene copy number mutation, and more specifically, to be predicted or diagnosed to have hearing loss.
[0052] A system according to one aspect of the present invention may be applied to a subject's sample, where the sample means all samples obtained from an individual in which point mutations or gene copy number mutations according to one aspect of the present invention can be detected, and specifically, the sample may be at least one selected from the group consisting of saliva, biopsy, blood, tissue, liquid culture, feces, and urine, and may be prepared by processing by methods commonly used in the art of the present invention.
[0053] In another embodiment, the present invention relates to a method for providing information for predicting or diagnosing hearing loss, wherein the method provides information from a sample of a subject, including MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, PO The present invention provides an information-providing method that includes the step of detecting a point mutation in at least one gene selected from the group consisting of U4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9, or a copy number variation (CNV) in at least one gene selected from the group consisting of STRC and OTOA. The detection step may include performing a real-time polymerase chain reaction (real-time PCR).Hearing loss, MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TM C1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, C The explanations regarding OL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, MYH9, MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, USH1G, point mutations, gene copy number variations, detection reagents, primers, probes, and the prediction or diagnosis of hearing loss are as described above.
[0054] An information provision method according to one aspect of the present invention provides information from a subject's sample, including MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, PO The method for providing information according to one aspect of the present invention may further include the step of detecting a point mutation in at least one gene selected from the group consisting of U4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9.
[0055] An information provision method according to one aspect of the present invention may further include the step of detecting a point mutation in at least one gene selected from the group consisting of MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G. An information provision method according to one aspect of the present invention may further include the step of predicting or diagnosing that a subject has hearing loss if a point mutation in the gene is detected in a sample of the subject.
[0056] A point mutation according to one aspect of the present invention may be at least one mutation selected from Tables A to C. An information provision method according to one aspect of the present invention may further include the step of predicting or diagnosing that a subject has hearing loss if the point mutation is detected in a sample of the subject.
[0057] An information provision method according to one aspect of the present invention may include the step of detecting a copy number variation (CNV) of at least one gene selected from the group consisting of STRC and OTOA.
[0058] The detection of copy number variation according to one aspect of the present invention may include the steps of: measuring the copy number of at least one gene selected from the group consisting of STRC and OTOA and a standard gene of EFTUD2 from a sample of a subject; calculating a value by dividing the copy number of at least one gene selected from the group consisting of STRC and OTOA by the copy number of the standard gene; and providing information that, if the calculated value is less than 0.8 or greater than 1.2, the subject can be predicted or diagnosed to have a gene copy number variation, specifically, to predict or diagnose hearing loss. Specifically, the method may include a step of providing information that predicts or diagnoses a subject having a gene copy number variation if the value obtained by dividing the copy number of at least one gene selected from the group consisting of STRC and OTOA measured in the subject's sample by the copy number of the standard gene EFTUD2 is less than 0.8, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less, or 0.1 or less, or greater than 1.2, 1.3 or greater, 1.4 or greater, 1.5 or greater, 1.6 or greater, or 1.7 or greater.
[0059] The hearing loss according to one aspect of the present invention may be sensorineural hearing loss, conductive hearing loss, or mixed hearing loss.
[0060] One aspect of the present invention may describe hearing loss that is moderate.
[0061] The hearing loss according to one aspect of the present invention may be hearing loss due to gene copy number mutation or point mutation, or hearing loss caused by gene copy number mutation or point mutation.
[0062] The detection step according to one aspect of the present invention may be performed using at least one primer set selected from the group consisting of the first primer set of SEQ ID NOs: 1 and 2, the second primer set of SEQ ID NOs: 3 and 4, the third primer set of SEQ ID NOs: 5 and 6, the fourth primer set of SEQ ID NOs: 7 and 8, the fifth primer set of SEQ ID NOs: 9 and 10, and the sixth primer set of SEQ ID NOs: 11 and 12.
[0063] The subject sample according to one aspect of the present invention may include the subject's nucleic acid, which may include DNA, mRNA, or cDNA synthesized from mRNA.
[0064] Embodiment The configuration and effects of the present invention will be described in more detail below with reference to examples. However, the following examples are provided to aid in understanding the present invention and do not limit the scope and scope of the present invention. [Examples]
[0065] Detection of point mutations in hearing-impaired patients From 2010 to 2022, over a 13-year period, DNA was extracted from actual hearing-impaired patients, regardless of age, at Bundang Seoul National University Hospital / Sejong Chungnam National University Hospital in South Korea.
[0066] By comparing with a reference sequence, we identified genes and mutations that cause hearing loss. These are shown in Tables 1-14.
[0067] [Table 1]
[0068] Table 2
[0069] Table 3
[0070] Table 4
[0071] Table 5
[0072] Table 6
[0073] Table 7
[0074] Table 8
[0075] Table 9
[0076] Table 10
[0077] Table 11
[0078] Table 12
[0079] [Table 13]
[0080] [Table 14] [Examples]
[0081] Detection of copy number variations in hearing-impaired patients Using DNA extracted from the hearing-impaired patient in Example 1, a primer set was prepared for detecting copy number variations (CNVs) in STRC and OTOA.
[0082] The kit used for performing real-time PCR was the QuantiNova™ SYBR® Green PCR kit (QIAGEN, Cat.nos.208054), and the real-time PCR instrument used was the Applied Biosystems ViiA® 7 Real-Time PCR System. In the instrument's program, the experimental design selection menu was set to 96-Well Block (0.2mL), Comparative Ct (ΔΔCt), SYBR® Green Reagents, and Fast in the [Experiment Properties] tab of Setup.
[0083] In the [Setup Define] tab, the gene exons were entered in the Targets field for each experiment type, and the IDs of the experimental samples, i.e., gDNAs, were entered in the Samples field. Then, the ID of the reference sample was selected as the Reference sample, and the EFTUD2 gene was selected as the Endogenous control.
[0084] The reference sample (a gDNA sample without mutations) used to detect copy number variations and the sample to be tested were precisely adjusted to a concentration of 50 ng / μL for mixing with the PCR kit.
[0085] The PCR kit components and gDNA were mixed as follows: 10 μL of 2x SYBR Green PCR Master Mix, 0.1 μL of QN ROX Reference Dye (1:200), 1 μL of forward primer (10 pmol / μL), 1 μL of reverse primer (10 pmol / μL), 6.9 μL of RNase-free water, and 1 μL of Template gDNA (50 ng / μL) were mixed. The mixture was placed in a 0.2 mL PCR tube and inserted into the instrument. The instrument program's Run Method was set to Hold Stage: 95°C for 2 minutes, PCR Stage: 95°C for 5 seconds, and 59°C for 20 seconds, and Number of Cycles: 40 was entered. Data acquisition was turned on and Start Run was executed. After the operation was complete, the analysis report was reviewed, the data was moved to the desired location by pressing Export, and the result values were analyzed.
[0086] The reference sample had a RQ (Relative Quantity) value of 1. The RQ values of the experimental samples were checked, and values in the range of 0.8 to 1.2 were interpreted as normal, values in the range of 0.3 to 0.7 were interpreted as a decrease of 1 allele copy, and values in the range of 0 to 0.2 were interpreted as a decrease of 2 allele copies.
[0087] If a value in the range of 1.3 to 1.7 was obtained, it was interpreted as an increase of one allele copy.
[0088] Subjects whose values are outside the normal range can be determined to have a copy number mutation in the relevant gene.
[0089] At that time, real-time PCR was performed using EFTUD2 as the standard gene. The primer set and PCR product sizes are shown in Table 15 below.
[0090] [Table 15]
[0091] The value obtained by dividing the copy number of the STRC or OTOA gene of the present invention by the copy number of the standard gene (EFTUD2) is the same as the ratio shown in Table 15.
[0092] As shown in Table 15, copy number mutations were detected in the STRC and OTOA genes in patients with hearing loss, and it was confirmed that hearing loss can be predicted or diagnosed if a copy number mutation is detected in at least one gene selected from the group consisting of STRC and OTOA.
[0093] As a result, the composition according to one aspect of the present invention is MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP By including a reagent capable of detecting point mutations in at least one gene selected from the group consisting of 31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9, or copy number mutations in at least one gene selected from the group consisting of STRC and OTOA, it was confirmed that multiple mutations can be screened simultaneously based on real-time PCR rather than NGS, demonstrating excellent effects such as low cost and rapid prediction or diagnosis of hearing loss.
[0094] [Sequence List] <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing 1.3 / / EN" "ST26SequenceListing_V1_3.dtd"> <st26sequencelisting dtdversion="V1_3" filename="22p379ind_配列表.xml" softwarename="WIPO Sequence" softwareversion="2.3.0" productiondate="2023-06-12"> <applicantfilereference>22p379 / ind< / applicantfilereference> <applicantname languagecode="ko"> Seoul National University Hospital< / applicantname> <applicantnamelatin>SEOUL NATIONAL UNIVERSITY HOSPITAL< / applicantnamelatin> <inventiontitle languagecode="ko">Composition for predicting or diagnosing hearing loss < / inventiontitle> <sequencetotalquantity> 14< / sequencetotalquantity> <sequencedata sequenceidnumber="1"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> INSDFeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q2"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / INSDSeq_feature-table> <INSDSeq_sequence>gtcctctgtcccagctcttg< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="2"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q4"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>gctgctcctcatcttgttcc< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="3"> <insdseq> <INSDSeq_length> 20< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q6"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ggaggcatgtcctgtgagt< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="4"> <insdseq> <INSDSeq_length> 20< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q8"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ctggccctacagttgtccat< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="5"> <insdseq> <INSDSeq_length> 20< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q10"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gacctggctctttcagcact< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="6"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q12"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>ggctctcctttccctcatgt< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="7"> <insdseq> <INSDSeq_length> 20< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q14"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> tcaaactgaccctggcttct< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="8"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q16"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>gttcggaggaaccactcaca< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="9"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q18"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>ccctgcttcctgtcaacact< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="10"> <insdseq> <INSDSeq_length> 20< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q20"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> tccagctgaccttctcatgg< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="11"> <insdseq> <INSDSeq_length> 20< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q22"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gacgactccattgctgatga< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="12"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q24"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>cacccatactgtcccaggag< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="13"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q26"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>atggatgatgatgacgacga< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="14"> <insdseq> <INSDSeq_length>22< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..22< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q28"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>tcctcctgatgtacctgtgaga< / INSDSeq_sequence> < / insdseq> < / sequencedata> < / st26sequencelisting>
Claims
1. A composition for predicting or diagnosing hearing loss, The composition is MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX1, SOX10 A composition for predicting or diagnosing hearing loss, comprising a reagent for detecting a point mutation in at least one gene selected from the group consisting of TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9, or a copy number variation (CNV) in at least one gene selected from the group consisting of STRC and OTOA.
2. The composition according to claim 1, further comprising a reagent for detecting a point mutation in at least one gene selected from the group consisting of MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G.
3. The composition according to claim 1, wherein the point mutation is at least one mutation selected from Table A below. [Table A]
4. The composition according to claim 1, wherein the point mutation is at least one mutation selected from Table B below. [Table B]
5. The composition according to claim 2, wherein the point mutation is at least one mutation selected from Table C below. [Table C]
6. The composition according to claim 1, wherein the hearing loss is sensorineural hearing loss, conductive hearing loss, or mixed hearing loss.
7. The composition according to claim 1, wherein the hearing loss is moderate hearing loss.
8. The composition according to claim 1, wherein the hearing loss is due to a gene copy number mutation or a point mutation.
9. The composition according to claim 1, wherein the detection reagent is a primer or a probe.
10. The primers include primers for detecting gene copy number mutations, The composition according to claim 9, wherein the primers for detecting gene copy number mutations include at least one primer set selected from the group consisting of a first primer set of SEQ ID NOs: 1 and 2, a second primer set of SEQ ID NOs: 3 and 4, a third primer set of SEQ ID NOs: 5 and 6, a fourth primer set of SEQ ID NOs: 7 and 8, a fifth primer set of SEQ ID NOs: 9 and 10, and a sixth primer set of SEQ ID NOs: 11 and 12.
11. A system for predicting or diagnosing hearing loss, comprising the composition according to any one of claims 1 to 10.
12. A method for providing information to predict or diagnose hearing loss, The aforementioned information provision method involves obtaining the following from the subject's sample: MYO15A, CDH23, GJB2, LOXHD1, TMPRSS3, ADGRV1, CLCNKB, COL11A2, KCNQ1, LRTOMT, MET, MYO3A, MYO7A, OTOA, OTOF, OTOGL, PCDH15, PDZD7, PTPRQ, SERPINB6, SLC26A4, STRC, TMC1, TRIOBP, USH2A, NF1, NF2, NLRP12, NLRP3, NOG, OPA1, PAX3, POU3F4, POU4F3, PRPS1, RPS6KA3, SIX 1. An information provision method comprising the step of detecting a point mutation in at least one gene selected from the group consisting of SOX10, TECTA, WFS1, ACTG1, LMX1A, MYO6, AIFM1, ATP2B2, BCAP31, CHD7, COCH, COL11A1, COL2A1, COL4A5, DIAPH1, EFTUD2, EYA1, EYA4, GATA3, GREB1L, GRHL2, JAG1, KCNQ4, KITLG, MITF, MYH14, and MYH9, or a copy number variation (CNV) in at least one gene selected from the group consisting of STRC and OTOA.
13. The information provision method according to claim 12, further comprising the step of detecting a point mutation in at least one gene selected from the group consisting of MPZL2, MT-RNR1, MT-TL1, OTOG, GSDME, PTPN11, ATP1A3, ILDR1, CD164, COL1A1, COL4A4, HARS2, MT-TS1, P2RX2, PJVK, POLD1, SLC26A5, TMEM43, TMTC4, TWNK, USH1C, and USH1G.
14. The information provision method according to claim 12, wherein the point mutation is at least one mutation selected from Table A below. [Table A]
15. The information provision method according to claim 12, wherein the point mutation is at least one mutation selected from Table B below. [Table B]
16. The information provision method according to claim 13, wherein the point mutation is at least one mutation selected from Table C below. [Table C]
17. The information provision method according to claim 12, wherein the hearing loss is sensorineural hearing loss.
18. The information provision method according to claim 12, wherein the hearing loss is moderate hearing loss.
19. The information provision method according to claim 12, wherein the hearing loss is due to a gene copy number mutation or a point mutation.
20. The information providing method according to claim 12, wherein the detection step is performed using at least one primer set selected from the group consisting of a first primer set of sequence numbers 1 and 2, a second primer set of sequence numbers 3 and 4, a third primer set of sequence numbers 5 and 6, a fourth primer set of sequence numbers 7 and 8, a fifth primer set of sequence numbers 9 and 10, and a sixth primer set of sequence numbers 11 and 12.
21. The information provision method according to claim 12, wherein the information provision method provides information that predicts or diagnoses a subject having hearing loss if a point mutation or copy number mutation of the gene is detected in a sample of the subject.
22. The detection of the copy number variation involves measuring the copy number of at least one gene selected from the group consisting of STRC and OTOA, and the standard gene of EFTUD2, from the subject's sample. A step of calculating a value by dividing the copy number of at least one gene selected from the group consisting of STRC and OTOA by the copy number of the standard gene, The information provision method according to claim 21, comprising the step of providing information to predict or diagnose that the subject has hearing loss if the calculated value is less than 0.8 or greater than 1.2.