Yeast platform
Genetically modified Saccharomyces boulardii yeast with a modified Leu2 and chromosomal insertion of therapeutic proteins addresses genetic instability, providing a stable platform for effective protein expression and oral therapy.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-17
- Publication Date
- 2026-06-26
AI Technical Summary
Current protein-based therapies using Saccharomyces boulardii yeast for oral administration face challenges due to genetic instability and low transgene copy numbers, making it difficult to produce a stable therapeutic platform that expresses desired proteins effectively.
Genetically modified Saccharomyces boulardii yeast strains are developed with a modified 3-isopropylmalate dehydrogenase (Leu2) and site-directed chromosomal insertion of nucleic acids encoding therapeutic proteins, enhancing genetic stability and constitutive expression of therapeutic proteins.
The modified yeast strains provide a stable platform for expressing therapeutic proteins, offering a 'plug-and-play' gene therapy solution with improved genetic stability and expression levels across generations.
Smart Images

Figure 2026521118000001_ABST
Abstract
Description
Technical Field
[0001] Cross - reference to Related Applications This application claims the benefit of the priority date of U.S. Provisional Application No. 63 / 467,484, filed on May 18, 2023, the content of which is incorporated herein by reference in its entirety.
[0002] Government Support This invention was made with government support under R44AI155277 and R44DK129133 awarded by the National Institutes of Health. The government has certain rights in this invention.
[0003] This disclosure is in the field of bioengineered yeast strains as therapeutic platforms. Engineered strains of Saccharomyces boulardii yeast that contain a modified 3 - isopropylmalate dehydrogenase (Leu2) and a nucleic acid encoding a therapeutic protein, as well as methods for treating or preventing a disease or condition in a subject that requires it, are described.
Background Art
[0004] The following discussion is provided merely to assist the reader's understanding of this disclosure and does not admit to explaining or constituting prior art with respect to it.
[0005] Therapies using protein - based biological agents are currently hindered by problems such as the need to be injected or intravenously infused, and thus there is a current need for patient - friendly oral protein therapies. Engineered strains of Saccharomyces boulardii (S. boulardii) yeast for oral administration have been presented as promising therapeutic options. However, it has been difficult to produce an engineered S. boulardii therapeutic platform that produces any desired therapeutic protein for treating a particular disease or condition due to genetic instability and low transgene copy numbers.
[0006] Using a modified 3-isopropylmalate dehydrogenase (Leu2) selective transgene expression cassette has been shown to improve the genetic stability of the selected transgene and increase constitutive expression of the therapeutic protein across generations throughout the manufacturing process, making the resulting genetically modified S. bouludi a desirable platform for "plug-and-play" gene therapy. [Overview of the project]
[0007] In one embodiment, the disclosure provides a genetically modified strain of Saccharomyces boulardii yeast comprising a nucleic acid encoding 3-isopropylmalate dehydrogenase (Leu2) and at least one site-directed chromosomal insertion of a nucleic acid encoding a therapeutic protein (i.e., a transgene).
[0008] In some embodiments, the nucleic acid encoding Leu2 includes one or more modifications selected for mutation or deletion.
[0009] In some embodiments, one or more modifications reduce the enzymatic activity of Leu2.
[0010] In some embodiments, Leu2 comprises an amino acid sequence selected from SEQ ID NO: 2 or 3.
[0011] In some embodiments, the yeast contains a complete or partial deletion of wild-type Leu2.
[0012] In some embodiments, genetically modified strains of Saccharomyces bouloidii yeast include a complete or partial deletion of URA3.
[0013] In some embodiments, genetically modified strains of Saccharomyces bouloidii yeast include a complete or partial deletion of GAP1.
[0014] In some embodiments, the therapeutic protein is selected from binding proteins, antigen-binding domains, immunoglobulins, antibodies, cytokines, glycoproteins, anti-cytokines, hormones, chemokines, enzymes, antimicrobial peptides, or any combination thereof.
[0015] In some embodiments, the nucleic acid encoding the therapeutic protein is incorporated into at least two different chromosomes.
[0016] In some embodiments, genetically engineered strains of Saccharomyces bouloidii yeast contain nucleic acids encoding the Leu2 promoter.
[0017] In some embodiments, the Leu2 promoter includes a nucleic acid sequence selected from SEQ ID NO: 4 or 5.
[0018] In some embodiments, the therapeutic protein is a binding protein comprising a structure selected from VHH, Fc-VHH, VHH-Fc, VHH-VHH, VHH-VHH-VHH-VHH, Fc-VHH-VHH, VHH-Fc-VHH, and VHH-VHH-Fc, where each or both of the VHH domains or Fc domains are bound to another VHH domain or Fc domain via an optional linker sequence.
[0019] In some embodiments, the therapeutic protein is a binding protein that binds to TcdA, TcdB, or a combination thereof.
[0020] In some embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO: 6.
[0021] In some embodiments, the therapeutic protein is a binding protein that binds to TNF-α.
[0022] In some embodiments, the binding protein is IgG or contains at least one VHH domain.
[0023] In some embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO: 7 or 8.
[0024] In some embodiments, the therapeutic protein is a binding protein that binds to TNF-α and IL-17A.
[0025] In some embodiments, the binding protein is IgG or comprises at least two VHH domains.
[0026] In some embodiments, the therapeutic protein comprises the amino acid sequences of SEQ ID NOs: 9-11.
[0027] In some embodiments, the therapeutic protein expresses human cytokine IL-10.
[0028] In some embodiments, IL-10 is in Fc-fusion or non-Fc-fusion.
[0029] In some embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO: 15.
[0030] In some embodiments, the therapeutic protein expresses human cytokine IL-22.
[0031] In some embodiments, IL-22 is in Fc-fusion or non-Fc-fusion.
[0032] In some embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO: 16.
[0033] In some embodiments, the therapeutic protein expresses human hormone insulin.
[0034] In some embodiments, insulin is in Fc-fusion or non-Fc-fusion.
[0035] [[ID=四十八]] In some embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO: 17.
[0036] In some embodiments, the genetically modified strain of Saccharomyces bouloidii yeast contains at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten or more copies of nucleic acids encoding therapeutic proteins that are incorporated into the yeast genome.
[0037] In some embodiments, the present disclosure provides a method for treating or preventing a disease or condition, comprising orally administering a therapeutically effective dose of a genetically modified strain of Saccharomyces bouloidis yeast to a subject in need thereof.
[0038] In some embodiments, the disease or condition is selected from inflammatory conditions, infections, irritable bowel syndrome (IBS), malignancies, neurodegenerative diseases, diabetes, obesity, fatty liver disease, metabolic diseases, graft-versus-host disease (GVHD), autoimmune diseases, or pain.
[0039] In some embodiments, the inflammatory condition is selected from inflammatory bowel disease (IBD), intestinal inflammation, Crohn's disease, and ulcerative colitis.
[0040] In some embodiments, the infection is C. difficile infection.
[0041] In another aspect, the disclosure provides a method for expressing a therapeutic protein in a subject, comprising orally administering a genetically modified strain of Saccharomyces bouloidii yeast to the subject.
[0042] In one embodiment, the present disclosure provides a pharmaceutical composition comprising a genetically modified strain of Saccharomyces bouloidii yeast and a pharmaceutically acceptable carrier or diluent.
[0043] In some embodiments, the Disclosure provides the use of a genetically modified strain of Saccharomyces bouloidii yeast according to any one of claims 1 to 30 in the manufacture of a pharmaceutical product for the treatment of a disease or condition, the disease or condition being selected from inflammatory conditions, infections, irritable bowel syndrome (IBS), neurodegenerative diseases, diabetes mellitus, obesity, fatty liver disease, malignant tumors, metabolic diseases, graft-versus-host disease (GVHD), autoimmune diseases, or pain.
[0044] In one embodiment, the disclosure provides the use of a genetically modified Saccharomyces bouloidii yeast stain for expressing a therapeutic protein in a subject.
[0045] Both the above summary and the following descriptions and detailed descriptions of the drawings are illustrative and descriptive. They are intended to provide further details of this disclosure, but should not be construed as limiting them. Other purposes, advantages, and novel features will be readily apparent to those skilled in the art from the following detailed description of this disclosure.
[0046] It should be understood that all combinations of the aforementioned concepts and any additional concepts discussed in more detail below are provided as part of the subject matter of the inventions disclosed herein and may be used in any combination to achieve the interests described herein. [Brief explanation of the drawing]
[0047] [Figure 1] The expression levels of clones with DHFR selection and modified Leu2 selection in individual screened S. bouloidi clones transformed with exemplary Leu2-selective cassettes or DHFR-selective cassettes are shown. The expression levels of therapeutic proteins were measured by ELISA assay. YPD culture supernatants were diluted 40-fold for 02_DHFR clones, 40-fold for 02_Leu2 clones (Figure 1A), 25-fold for 06_DHFR, 40-fold for 06_Leu2 clones (Figure 1B), 5-fold for 06m_DHFR clones, and 10-fold for 06m_Leu2 clones (Figure 1C). [Figure 2] This figure shows the antibody expression levels against cytokines in genetically modified yeast cells transformed with therapeutic transgenes encoding antibodies in modified Leu2 cassettes (Leu2 strain) or DHFR cassettes (DHFR strain). The strains (06_Leu2 and 06_DHFR) were incubated in YPD for 3 hours to test the acute expression of antibodies (anti-TNF-α (human)) from the Leu2 and DHFR selected strains (Figure 2A). The same strains from Figure 2A were incubated in YPD for 24 hours to test antibody expression levels (Figure 2B). The FZY085 strain is a genetically modified yeast cell that expresses antibodies against TNF-α (mouse). Antibody expression levels were determined by ELISA of a series of diluted supernatants from cultures incubated in YPD for 3 hours, with each dilution represented on the x-axis (Figure 2C). (Circles represent the Leu2 strain, and squares represent the DHFR strain.) The supernatant was serially diluted 2-fold at dilution ratios of 2, 4, 8, 16, 32, 64, 128, 256, 512, and 1024. The same strains were also incubated in YPD for 24 hours to test the 24-hour expression of the Leu2 and DHFR strains, and the supernatant was serially diluted 2-fold at dilution ratios of 10, 20, 40, 80, 160, 320, 640, 1280, 2560, and 5120. Antibody expression levels were determined by ELISA at each dilution shown on the x-axis (Figure 2D, circles represent the Leu2 strain, and squares represent the DHFR strain). [Figure 3] This image shows the 3-hour acute and 24-hour acute expression of exemplary therapeutic proteins, determined by ELISA in genetically modified yeast cells (Leu2 strains 02_3 and 02_4) transformed with therapeutic transgenes in modified Leu2 GOI cassettes. Genetically modified yeast cells were cultured in M2 (synthetic medium with Leu2 selectivity + yeast extract) for 20, 44, 52, or 112 hours, as shown on the x-axis, followed by 3 hours (left) or 24 hours (right) of culture in YPD medium. [Figure 4]This shows the exemplary copy numbers of therapeutic transgenes in genetically modified yeast cells transformed with therapeutic transgenes in modified Leu2 GOI cassettes (Leu2 strains 02_3 and 02_4) and DHFR GOI cassettes (DHFR strains 02_1 and 02_2). DHFR strains were cultured in M3 medium (leucine-supplemented M2 medium) and passaged daily for 10 days. The copy numbers of therapeutic transgenes were determined from genomic DNA collected at site 1 and site 2 on days 0, 2, and 10 of passage (Figure 4A). Leu2 strains were cultured in M1 medium (synthetic medium with Leu2 selectivity) and passaged daily for 10 days, and then passaged daily in M2 medium for approximately 5 days (112 hours). The copy number of the therapeutic transgene was determined from genomic DNA collected at sites 1 and 2 for Leu2 strain 02_3, and at site 1 for 02_4, at passage days 0, 2, and 10 (Figures 4B and 4C). [Figure 5] This shows the percentage of genetically modified yeast cells expressing exemplary therapeutic transgenes after transformation with therapeutic transgenes in modified Leu2 GOI cassettes (Leu2 strains 02_3 and 02_4) and DHFR GOI cassettes (DHFR strains 02_1 and 02_2) during continuous long-term culture (10 passages). Leu2 strains were cultured in M2 or M1 medium for 10 days, and DHFR strains were cultured in M3 medium for 10 days. Cultured cells were spread onto corresponding plates on day 0 (P0) and day 10 (P10), and single colonies that grew on these plates were randomly selected and seeded in YPD medium in 96-well culture plates and cultured overnight with shaking. Therapeutic protein expression was detected by ELISA using the culture supernatant from each single colony. Clones with positive expression of therapeutic protein are identified as specific protein-expressing cells. [Figure 6]This shows the growth of genetically modified yeast cells expressing exemplary therapeutic transgenes after transformation with therapeutic transgenes in modified Leu2 GOI cassettes (Leu2 strains 02_3 and 02_4) and DHFR GOI cassettes (DHFR strains 02_1 and 02_2). Leu2 strains were cultured for 10 days with daily subculturing in M2 or M1 medium, and DHFR strains were cultured for 10 days with daily subculturing in M3 medium. Growth rates were evaluated at day 1 (P1), day 3 (P3), day 5 (P5), day 8 (P8), and day 10 (P10) by measuring OD600 (Figure 6A). Leu2 strains 02_3 and 02_4 were cultured in M2 medium, and OD600 was measured at multiple time points over a 120-hour period, as shown on the x-axis in Figure 6B. [Figure 7] This shows representative therapeutic protein expression in genetically modified yeast cells expressing exemplary therapeutic transgenes after transformation with therapeutic transgenes in modified Leu2 GOI cassettes (Leu2 strains 02_3 and 02_4) and DHFR GOI cassettes (DHFR strains 02_1 and 02_2). Leu2 strains were cultured in M2 or M1 medium, and DHFR strains were cultured in M3 medium. The supernatants were assayed for transgene expression by ELISA at day 0 (P0) and day 10 (P10) under different culture medium conditions (Figure 7A, B). [Figure 8] The growth rates of genetically modified yeast cells expressing exemplary therapeutic transgenes, as well as the parental strains MYA-796, FZY025, and FZY071, after transformation with therapeutic transgenes in modified Leu2 GOI cassettes (Leu2 strains 02_3 and 02_4) and DHFR GOI cassettes (DHFR strains 02_1 and 02_2), in M2 medium (Figure 8A) and M1 medium (Figure 8B) are shown. [Modes for carrying out the invention]
[0048] Embodiments provided herein are described more fully below. However, aspects of this disclosure may be embodied in different forms and should not be construed as being limited to the embodiments described herein. Rather, these embodiments are provided to make this disclosure thorough and complete and to fully convey the scope of the invention to those skilled in the art. The terms used in this description are for the purpose of describing specific embodiments only and are not intended to limit them.
[0049] Unless otherwise indicated by the context, the various features described herein are specifically intended to be used in any combination. Furthermore, this disclosure also intends that in some embodiments, any feature or combination of features described herein may be excluded or omitted. For example, where it is stated herein that a complex includes components A, B, and C (or A, B, and / or C), it is specifically intended that any one of A, B, or C, or any combination thereof, may be omitted or excluded, either individually or in any combination.
[0050] Unless otherwise expressly indicated, all specific embodiments, features, and terms are intended to include both the enumerated embodiments, features, or terms and their biological equivalents.
[0051] I. Definition As used in the description of this invention and in the appended claims, the singular forms "a," "an," and "the" are intended to also include the plural forms unless the context clearly indicates otherwise.
[0052] The terms “substantially” and “about” are used herein to describe and explain small variations. When used in relation to an event or situation, these terms may refer to instances in which the event or situation occurs exactly, as well as instances in which the event or situation occurs fairly approximately. When used in relation to a number, these terms may refer to a variation of that number of ±10% or less, e.g., ±5%, ±4%, ±3%, ±2%, ±1%, ±0.5%, ±0.1%, or ±0.05%. When referring to a first number being “substantially” or “about” the same as a second number, these terms may refer to the first number being within a variation of the second number of ±10% or less, e.g., ±5%, ±4%, ±3%, ±2%, ±1%, ±0.5%, ±0.1%, or ±0.05%. Where used herein to describe any selection of components, scopes, dosage forms, etc. of the disclosure, the terms “acceptable,” “effective,” or “sufficient” are intended to indicate that such components, scopes, dosage forms, etc. are suitable for the purposes of the disclosure.
[0053] Furthermore, quantities, ratios, and other numerical values may be presented in range form as described herein. Such range forms are used for convenience and brevity and include numerical values explicitly designated as limits to the range, but should be understood flexibly to also include all individual numerical values or subranges contained within that range, as if each numerical value and subrange were explicitly designated. For example, a ratio in the range of about 1 to about 200 includes the explicitly listed limits of about 1 and about 200, but should be understood to also include individual ratios such as about 2, about 3, and about 4, as well as subranges such as about 10 to about 50, about 20 to about 100.
[0054] Furthermore, as used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the related enumerated items, as well as the absence of any combination when interpreted as an alternative ("or").
[0055] Where used herein, the term “contains” is intended to mean that a composition and method contains the enumerated elements but does not exclude other elements. Where used to define a composition and method, “essentially consisting of” means excluding other elements that have any essential importance to the composition or method. “Consists of” means excluding other components for the claimed composition and elements that are not more than a trace of the substantial method steps. The embodiments and implementations defined by each of these transitional terms are within the scope of this disclosure. Thus, methods and compositions are intended to include (contain) additional steps and components, or alternatively, include (essentially consisting of) steps and compositions of no importance, or alternatively, intend (consist of) only the described method steps or compositions.
[0056] As used herein, “optional” or “optionally” means that the events or circumstances described below may or may not occur, and the descriptions include both cases in which the events or circumstances occur and cases in which they do not occur.
[0057] The term "antibody" refers to immunoglobulins or immunoglobulin-like molecules, including IgA, IgD, IgE, IgG, and IgM, combinations thereof, or fragments thereof. Examples of antibody fragments include Fab fragments and single-chain variable fragments (scFv). Antibodies generally consist of heavy (H) and light (L) chains interconnected by disulfide bonds. There are two types of light chains: lambda (λ) and kappa (κ). There are five major heavy chain classes (or isotypes) that determine the functional activity of antibody molecules: IgM, IgD, IgG, IgA, and IgE. Each heavy and light chain contains a constant region and a variable region (also known as a "domain"). The heavy and light chain variable regions, collectively called the "Fab region," specifically bind to a given antigen. The light and heavy chain variable regions contain a "framework" region interrupted by three hypervariable regions, also called "complementarity-determining regions" or "CDRs." The framework regions and CDRs are defined (see Kabat et al., Sequences of Proteins of Immunological Interest, USD Department of Health and Human Services, 1991). The Kabat database is currently maintained online. The sequences of framework regions on different light or heavy chains are relatively conserved within species, and the framework regions act to form a scaffold for orienting CDRs correctly through non-covalent interactions between chains.
[0058] CDRs are primarily involved in binding to epitopes on antigens. The CDRs on each chain are typically referred to as CDR1, CDR2, and CDR3, sequentially numbered starting from the N-terminus, and typically identified by the chain on which a particular CDR is located. Thus, HCDR3 is located in the variable domain of the heavy chain of the antibody where it is found, while LCDR1 is the CDR1 from the variable domain of the light chain of the antibody where it is found. Antibodies that bind to IL-31RA are specific V H Region and V LAntibodies possess a regional sequence, and therefore a specific CDR sequence. Antibodies with different specificities generally have different CDRs. While the CDR differs from antibody to antibody, only a limited number of amino acid positions within the CDR are directly involved in antigen binding. These positions within the CDR are called specificity-determining residues (SDRs).
[0059] The Fc fragment region (Fc) of an antibody plays a role in regulating immune cell activity. The Fc region functions to ensure that each antibody generates an appropriate immune response to a given antigen by binding to a specific class of proteins (called "Fc receptors") found on certain cells, such as B lymphocytes, follicular dendritic cells, natural killer cells, macrophages, and neutrophils. Since the constant domains of the heavy chain constitute the Fc region of an antibody, the class of the heavy chain in an antibody determines their class effects. The heavy chains in antibodies include alpha, gamma, delta, epsilon, and mu, corresponding to the antibody isotypes IgA, IgG, IgD, IgE, and IgM, respectively. Therefore, different isotypes of antibodies have different class effects because their different Fc regions bind to different types of receptors.
[0060] IgG, the most abundant antibody isotype in human serum, has four subclasses: IgG1, IgG2, IgG3, and IgG4, all of which are highly conserved. The amino acid sequences of the constant regions of these peptides are known in the art; see, for example, Rutishauser, U. et al. (1968) "Amino acid sequence of the Fc region of a human gamma G-immunoglobulin" PNAS 61(4):1414-1421, Shinoda et al. (1981) "Complete amino acid sequence of the Fc region of a human delta chain" PNAS 78(2):785-789, and Robinson et al. (1980) "Complete amino acid sequence of a mouse immunoglobulin alpha chain (MOPC 511)" PNAS 77(8):4909-4913.
[0061] As used herein, the terms “antigen-binding domain,” “antigen-binding fragment,” or “antigen-binding protein” refer to antigen-binding molecules and fragments that possess the ability to bind to an antigen. Non-limiting examples include single-domain antibodies such as VHH antibodies or “camelid-like antibodies,” and antibodies consisting only of heavy chains.
[0062] As used herein, the terms “single-domain antibody” or “sdAb” refer to an antibody fragment having a single monomeric variable antibody domain that is still capable of selectively binding to a specific antigen.
[0063] South American camelids (e.g., alpacas and llamas) produce two isotypes of immunoglobulins, IgG2 and IgG3, which lack a light chain and are heavy chain antibodies or HCAbs. The VH domain of the HCAb, called the VHH fragment, is a single-domain antibody.
[0064] The terms “individual,” “subject,” and “patient” are used interchangeably herein and refer to individual organisms, vertebrates, mammals, or humans. In some embodiments, the individual, subject, or patient is a human.
[0065] As used herein, the terms “treatment” or “to treat” mean to alleviate or eliminate a disease or condition, and / or to improve or relieve one or more symptoms of a disease or condition.
[0066] As used herein, the terms “prevent” or “prevention” mean preventing the development of a disease or condition in an individual at risk of developing it, or preventing the recurrence of that disease or condition (i.e., recurrence after treatment).
[0067] The term "pharmaceutical composition" refers to a combination of at least one active agent and an inactive or active carrier, which makes the composition particularly suitable for in vivo or ex vivo diagnostic or therapeutic use.
[0068] The term "pharmaceutically acceptable carrier" refers to any of the standard pharmaceutical carriers, such as phosphate-buffered saline, water, emulsions (e.g., oil / water emulsion or water / oil emulsion), and various types of wetting agents. The composition may also include stabilizers and preservatives. For examples of carriers, stabilizers, and adjuvants, see, for example, Martin, Remington's Pharmaceutical Sciences, 15. th See Ed., Mack Publ. Co., Easton, PA (1975).
[0069] II. Genetically modified strains of Saccharomyces bouloidii yeast Saccharomyces bouraudii (S. bouraudii) is closely related to Saccharomyces cerevisiae (S. cerevisiae). However, these strains are fundamentally different in terms of ploidy. S. cerevisiae is spore-forming and can exist in both haploid and diploid states, while S. bouraudii is an obligate diploid that does not form spores. Because S. bouraudii is diploid, the efficiency of genomic integration of the transgene into both alleles at any given genomic locus is low, and genomic stability due to heterozygosity at the allele level is low, making it difficult to genetically engineer S. bouraudii with transgenes. By developing modified 3-isopropylmalate dehydrogenase (Leu2) S. bouloudi using a modified 3-isopropylmalate dehydrogenase (Leu2) cassette in conjunction with a target gene (GOI) cassette, these issues were unexpectedly resolved with more robust expression levels, stability, and copy number of the desired target gene (i.e., therapeutic transgene).
[0070] This disclosure provides a genetically modified strain of S. bouloidis yeast comprising a nucleic acid encoding Leu2 and at least one site-directed chromosomal insertion of a nucleic acid encoding a therapeutic protein (i.e., a transgene).
[0071] In some embodiments, a genetically modified strain of S. bouloidii yeast includes one or more modifications (e.g., mutants, mutations, deletions, insertions, etc.) that enable selection of a specific genetically modified strain of S. bouloidii (e.g., a selection marker). In some embodiments, one or more modifications enable selection including partial deletion of the gene used as a selection marker. In some embodiments, one or more modifications enable selection including complete deletion of the gene used as a selection marker. In some embodiments, one or more modifications reduce the enzymatic activity of Leu2.
[0072] For example, the genetically modified S. bouloidii yeast disclosed includes a nucleic acid sequence encoding modified Leu2 incorporated into the yeast genome. In some embodiments, modified Leu2 includes one or more modifications compared to wild-type Leu2. In some embodiments, the nucleic acid encoding Leu2 is modified in the nicotinamide adenine dinucleotide (NAD+) binding region of Leu2. In some embodiments, the modification is a single point mutation or a base pair deletion. In some embodiments, the mutation is K90E. In some embodiments, the deletion can be any number of nucleotide base pair deletions. In some embodiments, the number of deleted base pairs can be about 1 to about 40 base pairs. In some embodiments, the number of deleted base pairs can be about 1 to about 5, about 1 to about 10, about 1 to about 15, about 5 to about 10, about 5 to about 15, about 5 to about 20, about 10 to about 15, about 10 to about 20, about 10 to about 25, about 15 to about 20, about 15 to about 25, about 15 to about 30, about 20 to about 25, about 20 to about 30, about 20 to about 35, about 25 to about 30, about 25 to about 35, about 25 to about 40, about 30 to about 35, about 30 to about 40, or about 35 to about 40. In some embodiments, the deletion is 24 base pairs long and contains the nucleotide sequence TTGGCCTCTTTGCCATCTGCGTCC (Sequence ID 13). In some embodiments, the deletion is between positions 271-278 of the wild-type Leu2 amino acid coding sequence. In some embodiments, the deletion includes the amino acid sequence of LASLPSAS (SEQ ID NO: 14). In some embodiments, Leu2 includes an amino acid sequence selected from SEQ ID NO: 2 or 3. In some embodiments, Leu2 includes an amino acid sequence having at least 55%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 2 or 3. In some embodiments, Leu2 includes the amino acid sequence of SEQ ID NO: 2. In some embodiments, Leu2 includes the amino acid sequence of SEQ ID NO: 3.
[0073] In some embodiments, the genetically engineered strains of S. bouloidii yeast disclosed herein include a nucleic acid encoding the Leu2 promoter. The Leu2 promoter may be modified to weaken the promoter. In some embodiments, the Leu2 promoter includes a nucleic acid sequence selected from SEQ ID NO: 4 or 5. In some embodiments, the Leu2 promoter includes the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the Leu2 promoter includes the nucleic acid sequence of SEQ ID NO: 5.
[0074] Furthermore, in some embodiments, the genetically modified strains of S. bouloidii yeast disclosed herein include a complete or partial deletion of wild-type Leu2. In some embodiments, the genetically modified strains of S. bouloidii yeast include a complete or partial deletion of URA3. In some embodiments, the genetically modified strains of S. bouloidii yeast include a complete or partial deletion of GAP1. In some embodiments, the genetically modified strains of S. bouloidii yeast are ura3(- / -). In some embodiments, the genetically modified strains of S. bouloidii yeast are gap1(- / -).
[0075] In some embodiments, the nucleic acid encoding the therapeutic transgene is integrated into the yeast genome at one or more site-specific chromosomal locations. In some embodiments, the nucleic acid encoding the therapeutic transgene is integrated into at least two different chromosomes. In some embodiments, the nucleic acid encoding the therapeutic transgene is integrated into at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, or at least sixteen different chromosomes.
[0076] In some embodiments, the genetically engineered strains of S. bouloidii yeast disclosed herein include at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten or more copies of the nucleic acid encoding the therapeutic transgene incorporated into the yeast genome.
[0077] In some embodiments, genetically modified strains of S. bouloidii yeast are nutrient-dependent. In some embodiments, nutrient-dependent genetically modified strains of S. bouloidii yeast are less likely to survive in the environment compared to a suitable reference standard (e.g., the parental strain of S. bouloidii yeast).
[0078] Genetically engineered strains of S. boudii may contain nucleic acid sequences encoding any therapeutic gene of interest (i.e., a transgene) to express any therapeutic protein. In some embodiments, the genetically engineered strains of S. boudii express a therapeutic transgene. In some embodiments, the therapeutic protein is selected from binding proteins, antigen-binding domains, immunoglobulins, antibodies, cytokines, glycoproteins, anti-cytokines, hormones, chemokines, enzymes, antimicrobial peptides, or any combination thereof.
[0079] In some embodiments, non-limiting examples of the therapeutic proteins disclosed encode binding proteins.
[0080] In some embodiments, non-limiting examples of the therapeutic proteins disclosed encode cytokines.
[0081] In some embodiments, the binding protein comprises a structure selected from VHH, Fc-VHH, VHH-Fc, VHH-VHH, VHH-VHH-VHH-VHH, Fc-VHH-VHH, VHH-Fc-VHH, and VHH-VHH-Fc, where each or both of the VHH domains or Fc domains are bound to another VHH domain or Fc domain via an optional linker sequence.
[0082] In some embodiments, the binding protein binds to Clostridioides difficile toxin A (TcdA), Clostridioides difficile toxin B (TcdB), or a combination thereof, referred to as antitoxin ABAB. In some embodiments, the therapeutic protein contains the amino acid sequence of SEQ ID NO: 6.
[0083] In some embodiments, the binding protein binds to tumor necrosis factor alpha (TNF-α). In some embodiments, the binding protein is IgG or contains at least one VHH domain. In some embodiments, the therapeutic protein contains an amino acid sequence selected from SEQ ID NO: 7 or 8.
[0084] In some embodiments, the binding protein binds to TNF-α and IL-17A. In some embodiments, the binding protein is IgG or contains at least two VHH domains. In some embodiments, the therapeutic protein contains an amino acid sequence selected from SEQ ID NOs: 9-11.
[0085] In some embodiments, the cytokine is human IL-10. In some embodiments, IL-10 is Fc-fused or non-Fc-fused. In some embodiments, the therapeutic protein contains the amino acid sequence of SEQ ID NO: 15.
[0086] In some embodiments, the cytokine is human IL-22. In some embodiments, IL-22 is Fc-fused or non-Fc-fused. In some embodiments, the therapeutic protein contains the amino acid sequence of SEQ ID NO: 16.
[0087] In some embodiments, the cytokine is insulin. In some embodiments, the insulin is Fc-fused or non-Fc-fused. In some embodiments, the therapeutic protein contains the amino acid sequence of SEQ ID NO: 17.
[0088] In some embodiments, the nucleic acids encoding the therapeutic proteins disclosed herein include a linker (e.g., a peptide linker). In some embodiments, the linker has the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 12). Other linkers that may be used include, but are not limited to, glycine repeats, glycine and serine repeats, and alanine repeats. Generally, a linker capable of linking one or more domains of a binding protein for expression in genetically engineered yeast contains about 3 to about 20 amino acids. For example, a peptide linker may have 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids.
[0089] III. Treatment or prevention of diseases and conditions The disclosed genetically modified strains of S. bouloidii yeast can be used to treat any disease or condition by selecting a desired therapeutic protein to be expressed in the genetically modified strain of S. bouloidii yeast, which can target the disease or condition and thereby treat or prevent the disease or condition. The disclosure provides a method for treating or preventing a disease or condition, the use of the disclosed genetically modified yeast strain, and / or the disclosed genetically modified yeast for use in treating a disease or condition, including orally administering a therapeutically effective amount of the genetically modified strain of S. bouloidii yeast disclosed herein to a subject in need. The disclosure further provides a method for expressing a therapeutic protein of interest in a subject, comprising orally administering the genetically modified strain of S. bouloidii yeast disclosed herein to the subject.
[0090] In some embodiments, non-limiting examples of diseases or conditions are selected from inflammatory conditions, infections, irritable bowel syndrome (IBS), malignancies, neurodegenerative diseases, diabetes, obesity, fatty liver disease, metabolic diseases, graft-versus-host disease (GVHD), autoimmune diseases, or pain. In some embodiments, inflammatory conditions are selected from inflammatory bowel disease (IBD), intestinal inflammation, Crohn's disease, and ulcerative colitis. In some embodiments, infections can be any infection, for example, infections caused by C. difficile or C. difficile infection.
[0091] The therapeutically effective dose may be administered in one or more doses, applications, or dosages. Such delivery depends on several variables, including, but not limited to, the duration for which individual dose units are used and the bioavailability of the genetically modified S. bouludii strains disclosed herein. However, it is understood that the specific dose level of the genetically modified S. bouludii stein disclosed herein for any particular subject will depend on a variety of factors, including the activity of the specific compound used, the subject's age, weight, overall health, sex, and diet, administration time, excretion rate, drug combination, and the severity and form of administration of the specific disorder being treated.
[0092] IV. Pharmaceutical compositions and kits The disclosed genetically modified strains of S. bouloidii yeast can be provided in the form of genetically modified strains of Saccharomyces yeast and pharmaceutical compositions such as compositions comprising pharmaceutically acceptable carriers, excipients, and / or diluents. Not limited examples of suitable carriers, excipients, and diluents include lactose, dextrose, sucrose, trehalose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginic acid, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, minerals, and the like.
[0093] Pharmaceutical compositions can be prepared for any route of administration, but generally, pharmaceutical compositions are suitable for oral administration.
[0094] In some embodiments, the genetically modified strains of S. bouloidii yeast disclosed herein are dissolved in water or another pharmaceutically acceptable aqueous carrier in which the conjugate exhibits good solubility, with or without other pharmaceutically acceptable excipients or preservatives.
[0095] Furthermore, a kit is provided herein. The kit may comprise one or more genetically modified strains of S. bouloidii yeast disclosed herein, housed in a suitable container, along with instructions for use in the manner disclosed herein, which may be optional.
[0096] V. Array [Table 1-1] [Table 1-2] [Examples]
[0097] These embodiments are provided for illustrative purposes only and do not limit the scope of the claims provided herein.
[0098] Example 1. Development of a Saccharomyces bouloidi yeast strain for biological therapy. Preparation of S. blaudi background strains ura3(- / -), gap1(- / -), leu2(- / -)
[0099] The probiotic yeast Saccharomyces bouraudii (S. bouraudii) was genetically engineered to promote multiple copies of a target gene (GOI) for the development of therapeutic probiotic yeast strains using nutritional requirement markers. A background strain was used: a double knockout version of URA3 and GAP1 from the parental diploid strain MYA-796 derived from ATCC (Saccharomyces cerevisiae Meyen ex. ECHansen (also known as Saccharomyces bouraudii or Saccharomyces cerevisiae var. bouraudii), GenBank JRHY00000000). The nuclear sequence spanning from 75592 to 77147, including Leu2 on chromosome III, was targeted using CRISPR / Cas9 to create a double knockout of Leu2.
[0100] Optimization of GOI cassettes with modified Leu2 compared to DHFR GOI cassettes with Leu2 selectivity were prepared using a modified Leu2 gene. Specifically, the NAD+ binding region of the Leu2 gene was targeted with either a K90E mutation or a 24bp deletion (SEQ ID NO: 13) at the NAD+ binding site using a Leu2 promoter selected from SEQ ID NO: 4 or 5. Background strains were individually transformed with GOI insertion cassettes containing the K90E mutation-modified version of the Leu2 gene. Furthermore, background strains were transformed with GOI insertion cassettes containing a DHFR selectivity marker. Transformants were individually harvested, seeded on YPD, and cultured overnight (shaking) to induce therapeutic protein expression from Leu2 and DHFR selectivity clones. The culture supernatant was diluted 40-fold for DHFR selection and Leu2 selection for GOI expression measurement by ELISA (Figure 1A), 25-fold for DHFR selection and 40-fold for Leu2 selection for GOI expression measurement by ELISA (Figure 1B), or 5-fold for DHFR selection and 10-fold for Leu2 selection for GOI expression measurement by ELISA (Figure 1C).
[0101] Example 2: Comparison of exemplary protein copy numbers using Leu2 selection compared to DHFR selection The background strain described in Example 1 was transformed with a GOI cassette consisting of an exemplary DNA sequence encoding an antibody against a cytokine, a therapeutic protein, or a quadruspecific antibody-coding transgene of interest, and either a K90E mutant modified version of the Leu2 gene or the DHFR gene. Transformants were individually isolated, seeded on YPD, and cultured overnight (with shaking) to induce expression, and the copy number of the cytokine, therapeutic protein, or quadruspecific antibody was determined. The results demonstrated that Leu2 selection produced similar copy numbers to DHFR selection (Table 2). [Table 2]
[0102] Example 3: Comparison of exemplary protein expression using Leu2 selection compared to DHFR selection in 3-hour acute expression and 24-hour expression. The background strain described in Example 1 was transformed with a GOI cassette consisting of an exemplary DNA sequence encoding the antibody and a K90E mutant modified version of the Leu2 gene or the DHFR gene. Genetically modified yeast cells were first cultured overnight in selective minimum (M1) medium, then seeded in YPD with an OD600 of 0.2 for 24-hour expression and with an OD600 of 3 for 3-hour acute expression. The cultures were incubated at 30°C with shaking at 250 rpm for 24-hour expression and at 37°C with shaking at 250 rpm for 3-hour acute expression. The culture supernatant was collected, and the antibody (anti-TNF-α (human)) was measured by ELISA at 3-hour acute expression (Figure 2A) and 24-hour expression (Figure 2B). Furthermore, for 3-hour acute expression, the supernatant was diluted at dilution ratios of 2, 4, 8, 16, 32, 64, 128, 256, 512, and 1024, and antibody (anti-TNF-α (mouse)) levels were measured by ELISA (Figure 2C). For 24-hour anti-TNF-α (mouse) expression, the supernatant was diluted at dilution ratios of 10, 20, 40, 80, 160, 320, 640, 1280, 2560, and 5120, and cytokine protein levels were measured by ELISA (Figure 2D). The Leu2 strain had much higher or similar cytokine expression compared to the DHFR strain.
[0103] Example 4. Evaluation of Leu2 strain expression at various time points under different culture conditions. The background strain described in Example 1 was transformed with a GOI cassette consisting of the antitoxin ABAB and a K90E mutant modified version of the Leu2 gene. Genetically modified yeast cells (02_3 and 02_4, which are Leu2 stains) were first cultured in M1 medium, then seeded in M2 medium at an OD600 of 0.2, and cultured for 20, 44, 52, and 112 hours. At different time points, yeast cells were harvested and resuspended in YPD to prepare samples for 3-hour acute expression and 24-hour expression measurements. For 3-hour acute expression samples, genetically modified yeast cells were resuspended in 1 ml of YPD at a density of OD600 of 9. For 24-hour expression, genetically modified yeast cells were resuspended in 0.2 ml of YPD at a density of OD600 of 3. The prepared samples were then frozen at -80°C for at least 18 hours. Subsequently, the samples were thawed at room temperature (RT), restored to a volume of 3 ml using YPD (adjusted to a density of OD600 3 for 3-hour acute expression and a density of OD600 0.2 for 24-hour expression), and then cultured at 37°C with shaking at 250 rpm. Quantitative ELISA was performed, and expression levels were analyzed using reference materials (Figure 3A-B).
[0104] Example 5. Evaluation of the stability of the Leu2 strain. The background strain described in Example 1 was transformed with a GOI cassette consisting of the antitoxin ABAB and either a K90E mutant modified version of the Leu2 gene or the DHFR gene. Genetically modified yeast cells were cultured for 10 days at 30°C and 250 rpm with shaking in M1 medium for the Leu2 strain and in M3 medium for the DHFR strain, subculturing daily at a seeding density of OD600 0.2. This corresponds to approximately 120 generations of the therapeutic strain. Cells were collected at subculturing 0, 2, and 10 for genomic DNA extraction, and qPCR was performed to measure the copy number of small fragments (approximately 200 bp) within the GOI cassette at two different integration sites. The Leu2 strain produced a higher copy number compared to the DHFR strain (Figure 4A-B). Leu2 cells were also collected from the M2 medium culture at 0, 52, and 115 hours of culture for genomic DNA extraction (Figure 4C). The copy number was maintained more stably in the Leu2 strain.
[0105] Furthermore, genetically modified yeast cells were seeded at an OD600 of 0.2 in M1 and M2 medium for the Leu2 strain and in M3 medium for the DHFR strain. Each passage was cultured for 24 hours, and 10 passages were continued at 30°C with shaking at 250 rpm. On day 0 (P0) and day 10 (P10), the cultured cells were spread onto corresponding plates, and single colonies that grew on these plates were randomly selected and seeded in YPD medium in 96-well culture plates and cultured overnight with shaking. Therapeutic protein expression was detected by ELISA using the culture supernatant from each single colony. Clones exhibiting positive expression of the therapeutic protein were identified as specific protein-expressing cells. Leu2 maintained 100 percent of ABAB-expressing cells, while the DHFR strain showed a decrease in the percentage of ABAB-expressing cells at passage 10 (Figure 5).
[0106] Example 6. Evaluation of Leu2 strain proliferation The background strain described in Example 1 was transformed with a GOI cassette consisting of the antitoxin ABAB and either a K90E mutant modified version of the Leu2 gene or the DHFR gene. Genetically modified yeast cells were seeded at an OD600 of 0.2 in M1 and M2 medium for the Leu2 strains (02_4 and 02_3) and in M3 medium for the DHFR strains (02_2 and 02_1). Each passage was cultured for 24 hours, and 10 passages were continued at 30°C with shaking at 250 rpm. The growth of the genetically modified yeast cells was evaluated by measuring the OD600 for each passage (passes 1, 3, 5, 8, and 10). Growth of the Leu2 strain in M1 medium was robust, and growth in M2 medium was comparable to that of the DHFR strain (Figure 6A).
[0107] Furthermore, OD600 was continuously measured for Leu2 strains cultured in M2 medium for 0, 20, 24, 28, 44, 48, 52, and 115 hours, demonstrating that the growth pattern increased with increasing culture time (Figure 6B).
[0108] Example 7. Evaluation of Leu2 strain expression The background strain described in Example 1 was transformed with a GOI cassette consisting of the antitoxin ABAB and a K90E mutant modified version of the Leu2 gene or the DHFR gene. Genetically modified yeast cells were seeded at an OD600 of 0.2 in M1 and M2 medium for the Leu2 strains (02_3 and 02_4) and in -M3 medium for the DHFR strains (02_2 and 02_1). Each passage was cultured for 24 hours, and 10 passages were continued at 30°C with shaking at 250 rpm. Subsequently, cultured cells from passages 0 (P0) and 10 (P10) were seeded at an OD600 of 0.2 in YPD and cultured for 24 hours in the same manner as in the subculture medium. The culture supernatant was assayed for ABAB expression by ELISA (Figure 7 left). OD600 was measured at the end of growth in YPD, and expression / OD600 was calculated (Figure 7 right). The Leu2 strain shows increased ABAB expression and proliferation in P10 compared to the DHFR strain.
[0109] Example 8. Evaluation of potent containment of Leu2 strain The background strain described in Example 1 was transformed with a GOI cassette consisting of the antitoxin ABAB and a K90E mutant modified version of the Leu2 gene or the DHFR gene. Genetically modified yeast cells for the Leu2 strains (02_4 and 02_3) and the DHFR strains (02_2 and 02_1), as well as related parent strains derived from the above Leu2 and DHFR strains (MYA-796, FZY025, FZY071, etc.), were individually cultured overnight at 30°C with shaking at 250 rpm in 1 ml of M1 or M2 medium in 24-well plates at a seeding density of 0.1 OD600. The Y-axis represents OD600 (cell density indicates yeast cell proliferation), and the x-axis represents the time at which proliferation (OD600) was recorded. Based on the rightward growth shift of the Leu2 strain compared to the DHFR strain and related parent strain in either selective medium (M1) (Figure 8A) or nutrient restriction medium (M2) (Figure 8B), this indicates that the slow / arrest-like growth of the Leu2 strain has a strong containment ability and less adverse impact on the environment. ***
[0110] These embodiments are provided for illustrative purposes only and do not limit the claims provided herein. While specific embodiments have been described, it should be understood that modifications and changes can be made by those skilled in the art without departing from the broader aspects of the art defined in the following claims.
[0111] This disclosure should not be limited in terms of the specific embodiments described in this application. Many modifications and variations can be made without departing from its spirit and scope, as may be apparent to those skilled in the art. In addition to those enumerated herein, functionally equivalent methods and compositions within the scope of this disclosure will be apparent to those skilled in the art from the foregoing description. Such modifications and variations are intended to fall within the scope of the appended claims. This disclosure is limited only by the conditions of the appended claims, together with the entire scope of equivalents to which such claims are entitled. This disclosure is not limited to specific methods, reagents, compounds, or compositions, which are, of course, modifiable. It should also be understood that the terms used herein are intended solely to describe specific embodiments and are not intended to limit them.
[0112] In addition, if any feature or aspect of the present disclosure is described from the perspective of the Markush group, a person skilled in the art will recognize that the present disclosure is also described from the perspective of any individual member or subgroup member of the Markush group.
[0113] All publications, patent applications, registered patents, and other documents referenced herein are incorporated herein in such a manner as each individual publication, patent application, registered patent, or other document, or the whole thereof, is specifically and individually indicated to be incorporated by reference. Definitions contained in the text incorporated by reference are excluded to the extent that they conflict with the definitions in this disclosure.
Claims
1. A genetically modified strain of Saccharomyces boulardii yeast comprising a nucleic acid encoding 3-isopropylmalate dehydrogenase (Leu2) and at least one site-directed chromosomal insertion of a nucleic acid encoding a therapeutic protein.
2. The genetically modified strain of Saccharomyces bouloidii yeast according to claim 1, wherein the nucleic acid encoding Leu2 comprises one or more modifications selected for mutation or deletion.
3. The genetically modified strain of Saccharomyces boulardii yeast according to claim 1 or 2, wherein one or more of the modifications reduce the enzymatic activity of Leu2.
4. The genetically modified strain of Saccharomyces boulaudii yeast according to any one of claims 1 to 3, wherein Leu2 comprises an amino acid sequence selected from SEQ ID NO: 2 or 3.
5. The yeast is a genetically modified strain of Saccharomyces bouloidii yeast according to any one of claims 1 to 4, comprising a complete or partial deletion of wild-type Leu2.
6. A genetically modified strain of Saccharomyces bouloidii yeast according to any one of claims 1 to 5, further comprising a complete or partial deletion of URA3.
7. A genetically modified strain of Saccharomyces boulaudii yeast according to any one of claims 1 to 6, further comprising a complete or partial deletion of GAP1.
8. The therapeutic protein is selected from binding proteins, antigen-binding domains, immunoglobulins, antibodies, cytokines, glycoproteins, anti-cytokines, hormones, chemokines, enzymes, antimicrobial peptides, or any combination thereof, in the genetically modified strain of Saccharomyces boulardii yeast according to any one of claims 1 to 7.
9. The genetically modified strain of Saccharomyces bouloidii yeast according to any one of claims 1 to 8, wherein the nucleic acid encoding the therapeutic protein is incorporated into at least two different chromosomes.
10. A genetically modified strain of Saccharomyces bouloidii yeast according to any one of claims 1 to 9, further comprising a nucleic acid encoding the Leu2 promoter.
11. The genetically modified strain of Saccharomyces boulardii yeast according to claim 10, wherein the Leu2 promoter comprises a nucleic acid sequence selected from SEQ ID NO: 4 or 5.
12. The therapeutic protein is a binding protein comprising a structure selected from VHH, Fc-VHH, VHH-Fc, VHH-VHH, VHH-VHH-VHH-VHH, Fc-VHH-VHH, VHH-Fc-VHH, and VHH-VHH-Fc, wherein each or both of the VHH domains or Fc domains are bound to another VHH domain or Fc domain via an optional linker sequence, the genetically modified strain of Saccharomyces bouloidii yeast according to claim 8.
13. The genetically modified strain of Saccharomyces boulardii yeast according to any one of claims 1 to 11, wherein the therapeutic protein is a binding protein that binds to TcdA, TcdB, or a combination thereof.
14. The therapeutic protein comprises the amino acid sequence of Saccharomyces bouloidii yeast according to claim 13.
15. The genetically modified strain of Saccharomyces boulaudii yeast according to any one of claims 1 to 11, wherein the therapeutic protein is a binding protein that binds to TNF-α.
16. The genetically modified strain of Saccharomyces boulardii yeast according to claim 15, wherein the binding protein is IgG or comprises at least one VHH domain.
17. The therapeutic protein comprises the amino acid sequence of Saccharomyces bouloidii yeast according to claim 15 or 16.
18. The genetically modified strain of Saccharomyces bouloidii yeast according to any one of claims 1 to 11, wherein the therapeutic protein is a binding protein that binds to TNF-α and IL-17A.
19. The genetically modified strain of Saccharomyces bouloidii yeast according to claim 18, wherein the binding protein is IgG or comprises at least two VHH domains.
20. The therapeutic protein comprises the amino acid sequence of Saccharomyces bouloidii yeast according to claim 18 or 19.
21. The therapeutic protein is a genetically modified strain of Saccharomyces boulardii yeast according to any one of claims 1 to 11, which expresses the human cytokine IL-10.
22. The genetically modified strain of Saccharomyces boulaudii yeast according to claim 21, wherein IL-10 is Fc-fused or non-Fc-fused.
23. The therapeutic protein comprises the amino acid sequence of Saccharomyces bouloidii yeast according to claim 21 or 22.
24. The therapeutic protein is a genetically modified strain of Saccharomyces bouloidii yeast according to any one of claims 1 to 11, which expresses the human cytokine IL-22.
25. The genetically modified strain of Saccharomyces boulaudii yeast according to claim 24, wherein IL-22 is Fc-fused or non-Fc-fused.
26. The therapeutic protein comprises the amino acid sequence of Saccharomyces bouloidii yeast according to claim 24 or 25.
27. The therapeutic protein is a genetically modified strain of Saccharomyces boulardii yeast according to any one of claims 1 to 11, which expresses human cytokine insulin.
28. The genetically modified strain of Saccharomyces boulaudii yeast according to claim 27, wherein the insulin is Fc-fused or non-Fc-fused.
29. The therapeutic protein is a genetically modified strain of Saccharomyces bouloidii yeast according to claim 27 or 28, comprising the amino acid sequence of Sequence ID No.
17.
30. The yeast comprises at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten or more copies of the nucleic acid encoding the therapeutic protein incorporated into the yeast genome, the genetically modified strain of Saccharomyces boulaudii yeast according to any one of claims 1 to 29.
31. A method for treating or preventing a disease or condition, comprising orally administering a therapeutically effective amount of a genetically modified strain of Saccharomyces bouloidii yeast described in any one of claims 1 to 30 to a subject in need thereof.
32. The method according to claim 31, wherein the disease or condition is selected from inflammatory conditions, infections, irritable bowel syndrome (IBS), malignant tumors, neurodegenerative diseases, diabetes mellitus, obesity, fatty liver disease, metabolic diseases, graft-versus-host disease (GVHD), autoimmune diseases, or pain.
33. The method according to claim 32, wherein the inflammatory condition is selected from inflammatory bowel disease (IBD), enteritis, Crohn's disease, and ulcerative colitis.
34. The method according to claim 32, wherein the infectious disease is C. difficile infection.
35. A method for expressing a therapeutic protein in a subject, comprising orally administering to the subject a genetically modified strain of Saccharomyces bouloidii yeast described in any one of claims 1 to 30.
36. A pharmaceutical composition comprising a genetically modified strain of Saccharomyces bouloidii yeast according to any one of claims 1 to 30, and a pharmaceutically acceptable carrier or diluent.
37. Use of a genetically modified strain of Saccharomyces bouloidii yeast according to any one of claims 1 to 30 in the manufacture of a pharmaceutical product for the treatment of a disease or condition, wherein the disease or condition is selected from inflammatory conditions, infections, irritable bowel syndrome (IBS), neurodegenerative diseases, diabetes mellitus, obesity, fatty liver disease, malignant tumors, metabolic diseases, graft-versus-host disease (GVHD), autoimmune diseases, or pain.
38. Use of a genetically modified strain of Saccharomyces boulardii yeast according to any one of claims 1 to 30 for expressing a therapeutic protein in a target.