Pharmaceutical composition for the prevention or treatment of targeted cancer, containing BRCA-specific siRNA as an active ingredient.

A BRCA-specific siRNA composition, delivered via a SIRPα fusion protein, addresses the low efficacy of PARP inhibitors in wild-type BRCA cancers by enhancing cancer cell sensitivity and treatment outcomes.

JP2026521192APending Publication Date: 2026-06-26KOREA INST OF SCI & TECH +1

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
KOREA INST OF SCI & TECH
Filing Date
2024-06-14
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing PARP inhibitors exhibit low anticancer efficacy in breast and ovarian cancers with wild-type BRCA genes, necessitating an effective treatment method for these cancers.

Method used

A pharmaceutical composition containing BRCA-specific siRNA conjugated to a fusion protein with SIRPα and a linker peptide for targeted delivery to cancer cells, enhancing the sensitivity of cancer cells to PARP inhibitors.

Benefits of technology

The BRCA-specific siRNA composition effectively suppresses BRCA gene expression, significantly increasing the sensitivity of cancer cells to PARP inhibitors, particularly in cancers with wild-type BRCA genes, thereby enhancing treatment efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026521192000001_ABST
    Figure 2026521192000001_ABST
Patent Text Reader

Abstract

The present invention aims to improve the sensitivity of cancer cells to PARP inhibitors and provides BRCA-specific siRNA. The siRNA of the present invention can induce cancer cell death in conjunction with PARP inhibitors in patients with wild-type BRCA genes who have low therapeutic efficacy from PARP inhibitors. The fusion protein-siRNA complex for siRNA transmission of the present invention is taken up into cells via CD47, resulting in highly efficient uptake while being more specifically transmitted to cancer cells, thereby maximizing the effect of targeting cell death.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention provides wild-type BRCA-specific siRNA for the purpose of improving the sensitivity of cancer cells to PARP inhibitors, and specifically provides a pharmaceutical composition for preventing or treating cancer for combined administration with a PARP inhibitor containing the siRNA as an active ingredient, and the like.

Background Art

[0002] The BRCA1 and BRCA2 genes play important roles in the process of DNA repair, and mutations occurring in these genes are known to be associated with an increased risk of developing breast cancer and ovarian cancer. In the case of ovarian cancer, about 10% of all ovarian cancer patients are hereditary ovarian cancer, and in the case of breast cancer, about 7% of patients are known to be due to genetic predisposition. Many hereditary breast and ovarian cancers are caused by mutations in the BRCA1 and BRCA2 genes.

[0003] In the case of cancer cells having BRCA1 / 2 mutations, it is known that DNA is repaired by the mechanism of base excision repair (BER), and PARP protein is essential for the activation of the BER pathway. Here, as PARP inhibitors for treating breast and ovarian cancers having BRCA mutations, olaparib, veliparib, niraparib, and rucaparib have been approved. Also, recently, it has been known that RARP inhibitors induce a strong anti-tumor immune response via STING in BRCA-deficient ovarian cancer cells. However, BRCA [corrected to BRCA1 / 2] mutations are observed in only about 10% of all ovarian and breast cancer patients, and in about 90% of ovarian and breast cancer patients having a wild-type BRCA gene without mutations, the anti-cancer effect of PARP inhibitors is low, and there is still a need for an effective treatment method for these cancers.

[0004] On the other hand, siRNA (small interfering RNA) is a small RNA fragment, 18-27 nt in size, produced when double-stranded RNA is cleaved by a Dicer. It is used to specifically bind to mRNA with a complementary sequence and suppress the expression of that mRNA. While various RNAi-based drugs have been approved by the FDA for knockdown of target genes that cause disease, siRNA-based drugs for cancer treatment must solve the problems of effective intracellular delivery and target cell-specific delivery. That is, siRNA-based anticancer drugs require not only an siRNA sequence that induces effective knockdown of the target gene, but also a delivery system that can efficiently deliver the siRNA only to the target cells and into their interior.

[0005] CD47, as a cell membrane protein, interacts with SIRPα to protect cells from macrophages. Cancer cells overexpress CD47 to evade the innate immune system, and furthermore, CD47 overexpression is highly correlated with a poor prognosis, particularly in ovarian cancer. Recently, we have confirmed that siRNA can be specifically delivered to cancer cells using SIRPα.

[0006] The inventors conducted this research to develop an effective therapeutic access method for ovarian and breast cancers with wild-type BRCA genes, and completed the present invention. [Prior art documents] [Patent Documents]

[0007] [Patent Document 1] KR 10-2228271 [Non-patent literature]

[0008] [Non-Patent Document 1] Engineered SIRPVariants as Immunotherapeutic Adjuvants to Anticancer Antibodies.Science, 3416141, 88-91. [Overview of the Initiative] [Problems that the invention aims to solve]

[0009] The technical problem that this invention aims to solve is to enhance the cancer cell death effect of PARP inhibitors in cancers possessing wild-type BRCA1 and / or BRCA2 genes, in which a high correlation between BRCA gene mutations and cancer development has been revealed.

[0010] The present invention aims to provide a pharmaceutical composition for cancer treatment containing the siRNA as an active ingredient, for use in combination with a PARP inhibitor.

[0011] Furthermore, the present invention aims to provide a pharmaceutical composition for enhancing the efficacy of a PARP inhibitor, which contains the siRNA as an active ingredient.

[0012] Furthermore, the present invention aims to provide a fusion protein-siRNA complex in which siRNA is conjugated to a fusion protein, which is covalently linked to a SIRPα protein and a linker peptide that is cleaved by a lysosomal degrading enzyme, in order to deliver the siRNA to cancer cells specifically and with high efficiency.

[0013] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the following description. [Means for solving the problem]

[0014] To solve the aforementioned problems, the present invention provides a pharmaceutical composition for the prevention or treatment of cancer, comprising BRCA (Breast Cancer Susceptibility Gene) 1-specific siRNA (small interfering RNA) and / or BRCA2-specific siRNA as active ingredients.

[0015] In one embodiment of the present invention, the pharmaceutical composition is intended for use in combination with a PPAR (poly ADP-ribose polymerase) inhibitor.

[0016] In another embodiment of the present invention, the BRCA1-specific siRNA is an oligonucleotide of 15-31 nt length that can complementarily bind to MBRCA1 mRNA, and specifically comprises or can be composed of the nucleotide sequence shown in SEQ ID NO: 3.

[0017] In another embodiment of the present invention, the BRCA2-specific siRNA is an oligonucleotide of 15 to 31 nt length that can complementarily bind to BRCA2 mRNA, and specifically comprises or can be composed of the nucleotide sequence shown in Sequence ID No. 5.

[0018] Furthermore, the present invention provides a composition for enhancing the sensitivity of cancer cells to PPAR inhibitors, comprising the BRCA1-specific siRNA and / or BRCA2-specific siRNA as active ingredients.

[0019] In one embodiment of the present invention, the PPAR inhibitor is one or more selected from the group consisting of olaparib, veliparib, niraparib, rucaparib, and talazoparib.

[0020] Another embodiment of the present invention is a cancer in which a high correlation is known between BRCA gene mutations and the onset, metastasis, or recurrence of cancer, and non-limiting examples include ovarian cancer, breast cancer, and prostate cancer.

[0021] As another embodiment of the present invention, the cancer is a cancer with a high correlation between BRCA gene mutation and cancer onset, metastasis, or recurrence, and it is a cancer in which there is no mutation in the BRCA gene or a patient has a wild-type BRCA gene, and it is known that the effect of PARP inhibitor on cancer cell death is low.

[0022] As another embodiment of the present invention, the cancer is a cancer with a high correlation between BRCA gene mutation and cancer onset, metastasis, or recurrence, and it is a cancer in which there is no mutation in the BRCA1 gene or a cancer having a wild-type BRCA1 gene.

[0023] In another embodiment of the present invention, the cancer is a cancer with a high correlation between BRCA gene mutation and cancer onset, metastasis, or recurrence, and it is a cancer in which there is no mutation in the BRCA2 gene or a cancer having a wild-type BRCA2 gene.

[0024] As another embodiment of the present invention, the cancer is a cancer with a high correlation between BRCA gene mutation and cancer onset, metastasis, or recurrence, and it is a cancer in which there is no mutation in both the BRCA1 and BRCA2 genes or a cancer having wild-type BRCA1 and BRCA2 genes.

[0025] On the other hand, the siRNA of the present invention can be provided by conjugating the siRNA to a fusion protein in which a SIRPα protein and a linker peptide are covalently linked for cancer cell-specific siRNA delivery. The siRNA conjugated to the fusion protein is taken into cells through the interaction between SIRPα and the CD47 protein and can effectively act on cancer cells overexpressing CD47.

[0026] The present invention provides the above-described fusion protein-siRNA complex for efficiently delivering siRNA to CD47-overexpressing cancer cells.

[0027] In one embodiment of the present invention, the linker peptide constituting the fusion protein is not limited as long as the linker peptide is cleaved in the cell and releases siRNA in the complex. In the specific experiments of the present invention, a linker peptide with a sequence that is cleaved by a lysosomal degrading enzyme was used.

[0028] In another embodiment of the present invention, the SIRPα protein is modified to improve its affinity for CD47.

[0029] Furthermore, the present invention provides a method for preventing or treating cancer, comprising the steps of (1) administering the BRCA1-specific siRNA and / or BRCA2-specific siRNA to an individual, and (2) administering a PARP inhibitor to the individual.

[0030] In one embodiment of the present invention, in the method described above, the individual may be a patient with ovarian cancer, breast cancer, or prostate cancer who does not have a mutation in the BRCA1 gene, does not have a mutation in the BRCA2 gene, or does not have mutations in both the BRCA1 and BRCA2 genes.

[0031] Furthermore, the present invention provides the use of the BRCA1-specific siRNA and / or BRCA2-specific siRNA for drug preparation aimed at enhancing the cancer cell killing effect of PARP inhibitors. [Effects of the Invention]

[0032] The BRCA-specific siRNA of the present invention possesses approximately 80% or more of the wild-type BRCA gene and can enhance sensitivity to PARP inhibitors in cancers that show poor efficacy with PARP inhibitors. Since the siRNA of the present invention is provided fused with the SIRPα protein and exhibits excellent cancer cell targeting and intracellular transduction capabilities while showing almost no cytotoxicity, it is expected to be conveniently used in conjunction with PARP inhibitors in the treatment of cancer patients possessing the wild-type BRCA gene. [Brief explanation of the drawing]

[0033] [Figure 1] Figure 1 is a schematic diagram illustrating the mechanism of action of vSIRPα-siBRCA. [Figure 2] Figure 2 shows the results of confirming the target gene expression suppression effects of three types of siRNAs that suppress the expression of BRCA1 or BRCA2. Figure 2A shows the results of the silencing effect of BRCA1 siRNA #1-3, and Figure 2B shows the results of the silencing effect of BRCA2 siRNA #1-3. [Figure 3] Figure 3A confirms that the vSIRPα-linker gene was inserted into the pET28a vector, Figure 3B confirms the expression of the vSIRPα-linker in cells transformed with the vector by Coomassie gel staining, and Figure 3C confirms this again by RP-HPLC. [Figure 4A] Figure 4A is a simplified diagram illustrating the manufacturing process and structure of vSIRPα-siBRCA. [Figure 4B] Figure 4B shows the formation of vSIRPα-siBRCA confirmed by nucleic acid staining. [Figure 5] Figure 5A shows the results of treating ID8 cells with vSIRPα-siBRCA-Cy5, staining the nuclei, and observing them with a confocal microscope, while Figure 5B shows the results of treating pre-cultured ID8 cells with vSIRPα-siBRCA-Cy5 together with anti-CD47 antibody, staining the nuclei, and observing them with a confocal microscope. [Figure 6] Figure 6A shows the results of examining the survival rate of ID8 cells treated with vSIRPα-siBRCA1 or Lipo-siBRCA1. Figure 6B shows the results of examining the survival rate of ID8 cells treated with vSIRPα-siBRCA1, vSIRPα-siBRCA2, or vSIRPα-siBRCA1 / 2. [Figure 7]Figure 7A shows the results of RT-PCR analysis to confirm the expression level of the BRCA1 gene in ID8 cells treated with vSIRPα-siBRCA1 at various concentrations. Figure 7B shows the results of RT-PCR analysis to confirm the expression level of the BRCA2 gene in the same cells after treating them with vSIRPα-siBRCA2 at various concentrations. Figures 7C and 7D show the results of RT-PCR analysis to confirm the expression level of the BRCA1 or BRCA2 gene in ID8 cells after treating them with 400 nM vSIRPα-siBRCA1 and vSIRPα-siBRCA2, respectively. [Figure 8] Figure 8 shows the results of flow cytometry for γH2AX after treating ID8 cells with vSIRPα-siBRCA1, vSIRPα-siBRCA2, or vSIRPα-siBRCA1 / 2, followed by the addition of a PARP inhibitor. [Figures 9A-9D] Figures 9A to 9D show the results of IC50 analysis via MTS assay after treating ID8 cells cultured with vSIRPα-siBRCA with a PARP inhibitor (olaparib or talazoparib). [Modes for carrying out the invention]

[0034] The inventors aimed to improve the sensitivity of ovarian and breast cancer cells to PARP inhibitors using siRNA targeting BRCA mRNA, for the effective treatment of ovarian and breast cancers possessing the wild-type BRCA gene, and developed a SIRPα-siBRCA conjugate to effectively deliver the siRNA specifically to cancer cells. (Figure 1)

[0035] The BRCA1 and BRCA2 genes play a crucial role in the DNA repair process. In cancer cells with BRCA1 / 2 mutations, DNA repair occurs via the BER mechanism, which requires the PARP protein. However, while PARP inhibitors can achieve potent antitumor effects in hereditary breast and ovarian cancers caused by BRCA1 and BRCA2 gene mutations, they have a lower anticancer effect in breast and ovarian cancers with wild-type BRCA genes that do not exhibit mutations.

[0036] The inventors confirmed that when cells in which the BRCA1 and / or BRCA2 genes were knocked down or knocked out were treated with a PARP inhibitor, the expression level of γH2AX, a marker of DNA damage, increased. Furthermore, they confirmed that when the expression of BRCA2 or BRCA1 was suppressed in BRCA1 or BRCA2-deficient cells, the level of cancer cell death by the PARP inhibitor increased.

[0037] Herein, the present inventors provide an siRNA capable of suppressing the expression of the BRCA1 or BRCA2 gene in order to enhance the anticancer effect of PARP inhibitors in cancers having the wild-type BRCA1 and / or BRCA2 gene.

[0038] In this invention, "siRNA (short interfering RNA)" means double-stranded RNA capable of inducing RNAi that suppresses gene activity. In this invention, siRNA means siRNA capable of suppressing the expression of wild-type BRCA1 or wild-type BRCA2 genes. In this specification, the term "siBRCA1" is used interchangeably for siRNA that suppresses the expression of wild-type BRCA1 genes, and the term "siBRCA2" is used interchangeably for siRNA that suppresses the expression of wild-type BRCA2 genes.

[0039] Unless otherwise specified herein, the BRCA gene refers to a wild-type BRCA gene without mutations.

[0040] The inventors searched for siRNAs that more effectively suppress the expression of wild-type BRCA1 or wild-type BRCA2 genes and selected the siRNAs listed in Table 3 below.

[0041] The BRCA-specific siRNA of the present invention can be synthesized chemically or enzymatically. The method for producing siRNA is not particularly limited, and methods well known in the art can be used. Examples include, but are not limited to, methods for directly chemically synthesizing siRNA, methods for synthesizing siRNA using in vitro transcription, methods for cleaving long double-stranded RNA synthesized by in vitro transcription using enzymes, methods for expression through intracellular transduction of shRNA expression plasmids or viral vectors, and methods for expression through intracellular transduction of PCR (polymerase chain reaction)-induced siRNA expression cassettes.

[0042] On the other hand, while the introduction of the aforementioned siRNA into cells can be carried out using methods such as microinjection, calcium phosphate coprecipitation, electroporation, and liposome utilization, the inventors have developed a "fusion protein-siRNA complex" in which the siRNA is attached to a fusion protein in which the SIRPα protein and linker peptide are covalently linked. This complex aims to improve the cancer cell targeting ability and intracellular transmission ability of the siRNA.

[0043] Accordingly, in the present invention, BRCA1 or BRCA2-specific siRNA can be provided in the form of the fusion protein-siRNA complex described above.

[0044] The fusion protein-siRNA complex of the present invention can be delivered into cells rapidly and efficiently compared to direct administration of siRNA.

[0045] In the fusion protein of the present invention, the linker peptide is preferably cleaved in the cytoplasm so that the siRNA is released as a complex, and more preferably, it may be a peptide with a sequence that is cleaved by a lysosomal degrading enzyme so that it is cleaved when it enters the cell.

[0046] The fusion protein-siRNA complex of the present invention is readily soluble in physiological solutions, making it easily absorbed and possessing excellent bioavailability. Specifically, the complex of the present invention facilitates cancer cell-specific intracellular delivery and exhibits superior potential stability compared to the use of siRNA or SIRPα protein alone. Furthermore, it is extremely stable, as there is no risk of uncontrolled replication and no need to utilize viral or non-viral vectors for siRNA delivery, thus eliminating concerns about interference and potential side effects due to transfusion. Moreover, it offers significant economic advantages, as synthesis is extremely inexpensive compared to the use of vectors and other carriers, and its delivery efficiency is also extremely excellent (maximum preventive or therapeutic effect can be achieved by administering low concentrations of siRNA and SIRPα protein).

[0047] The siRNA used in the production of the fusion protein-siRNA complex of the present invention is not limited as long as it can silence the wild-type BRCA gene (BRCA1 or BRCA2 gene) or suppress the expression of said gene. From the perspective of silencing effect, it is preferable to use siRNA that contains or is composed of the base sequence shown in SEQ ID NO: 3 or 5, and the siRNA may have maleimide attached to its 3' end for conjugation with the fusion protein.

[0048] In the present invention, "complex" means a covalent complex comprising the fusion protein and siRNA described below, formed by chemical bonding between them. The electrochemical bonding is not particularly limited as long as it is commonly used in the industry, and preferably, a derivative containing a maleimide group at the terminus of the siRNA can be linked to the cysteine ​​residue of the fusion protein via a linker, meaning that the thiol of the cysteine ​​residue present in the fusion protein reacts with the maleimide group of the siRNA to form a bond.

[0049] The siRNA of the present invention aims to enhance the anticancer effect of PARP inhibitors by suppressing the expression of BRCA1 and / or BRCA2 in cancer cells, thereby improving the sensitivity of cancer cells to PARP inhibitors. Accordingly, the composition containing the siRNA of the present invention is provided for co-administration with a PARP inhibitor, and the composition containing the siRNA is administered simultaneously, sequentially, or alternately with the PARP inhibitor, but preferably the PARP inhibitor can be administered 24 hours after the administration of the siRNA.

[0050] In other words, the pharmaceutical composition for the prevention or treatment of cancer of the present invention aims to increase the sensitivity of cancer cells to PARP inhibitors, and it is preferable to understand the pharmaceutical composition for the prevention or treatment of cancer of the present invention as a composition of a pharmaceutical adjuvant for the prevention or treatment of cancer.

[0051] The composition of the present invention is formulated to include, in addition to the active ingredients described above, one or more pharmaceutically acceptable carriers for administration.

[0052] In compositions formulated as liquid-phase solutions, acceptable pharmaceutical carriers suitable for sterilization and biological use may include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, glucose solution, maltodextrin solution, glycerol, ethanol, and mixtures of one or more of these components. General additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed.

[0053] Furthermore, the aforementioned pharmaceutical composition for cancer treatment or prevention may be manufactured using pharmaceutically suitable and physiologically acceptable adjuvants in addition to the active ingredient, and such adjuvants may include excipients, disintegrants, sweeteners, binders, coatings, leavening agents, lubricants, moisteners, or solubilizers such as flavoring agents.

[0054] In the present invention, there are no particular limitations on the formulation of the pharmaceutical composition, but it is preferable to provide it in the form of an injectable preparation such as an aqueous solution, suspension, or emulsion, with the addition of a diluent, dispersant, surfactant, binder, and lubricant.

[0055] The pharmaceutical composition for cancer treatment or prevention of the present invention targets receptors on cancer cells and already possesses specificity for cancer cells, therefore, the route of administration is not particularly limited. However, it is preferably administered by conventional methods via intravenous, intra-arterial, intraperitoneal, intramuscular, intra-arterial, intraperitoneal, intrathoracic, transdermal, nasal, nasal, inhalation, topical, rectal, oral, intraocular, or intradermal routes. Most preferably, it can be injected by intravenous injection, but is not particularly limited thereto. Depending on the purpose, intraperitoneal, intramuscular, subcutaneous, oral, intranasal, intrapulmonary, or rectal administration may be performed.

[0056] The composition of the present invention may further comprise suitable carriers, excipients, and diluents commonly used in the manufacture of pharmaceutical compositions and the like. The "carrier" is a compound that facilitates the addition of the compound into cells or tissues. The "diluent" is a water-diluted compound that not only stabilizes the biologically active form of the target compound but also dissolves the compound.

[0057] Examples of carriers, excipients, and diluents included in the pharmaceutical composition of the present invention include lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylbenzoic acid, propylbenzoic acid, talc, magnesium stearate, and mineral oil. When formulation, it can be prepared using commonly used fillers, bulking agents, binders, wetting agents, disintegrants, surfactants, and other diluents or excipients.

[0058] As used in this invention, the term "administration" means providing a predetermined composition of the present invention to an individual by any suitable method.

[0059] The amount of composition used in this invention varies depending on the individual's sex, weight, age, etc., but above all depends on the condition of the individual being treated, the specific category or type of disease being treated, the route of administration, and the attributes of the therapeutic agent used.

[0060] In the present invention, the term "individual" is not limited to mammals, but it is preferable that the individual be a cancer patient without mutations in the BRCA1 and / or BRCA2 genes, or a cancer patient having wild-type BRCA1 and / or wild-type BRCA2 genes. A cancer patient having wild-type BRCA genes is a patient who exhibits a lower-than-expected response to cancer treatment with PARP inhibitors, and who possesses approximately 80% or more wild-type BRCA genes.

[0061] The embodiments will be described in detail below with reference to the attached drawings. However, various modifications have been made to the embodiments, and the scope of the patent application will not be limited or restricted by such embodiments. All modifications, equivalents, or substitutes to the embodiments should be understood to be included within the scope of the patent.

[0062] The terms used in the embodiments are for illustrative purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as “includes” or “having” indicate the presence of features, figures, steps, actions, components, parts, or combinations thereof described in the specification, and should not be understood as preemptively excluding the possibility of the presence or addition of one or more other features, figures, steps, actions, components, parts, or combinations thereof.

[0063] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as those generally understood by a person of ordinary skill in the art to which the embodiments belong. Commonly used, predefined terms should be interpreted as having the meaning consistent with their meaning in the context of the relevant art, and not as ideal or overly formal unless explicitly defined herein.

[0064] Furthermore, when explaining with reference to the drawings, the same reference numerals will be assigned to the same components regardless of the reference numerals in the drawings, and redundant explanations will be omitted. In the description of this embodiment, if it is determined that a specific explanation of related prior art would obscure the gist of the embodiment, such detailed explanation will be omitted.

[0065] [Experimental Methods and Materials] 1.Material The DNA plasmid for encrypting enhanced vSIRPα was purchased from Cosmo Genetech (Seoul, South Korea). BRCA1 siRNA, BRCA2 siRNA, and BRCA1 siRNA conjugated with Cy5 were purchased from Integrated DNA Technologies (IDT; Coralville, IA, USA). Kanamycin, isopropylβ-D-1-thiogalactopyranoside (IPTG), maleimide-PEG2-NHS ester, and cathepsin B were purchased from Sigma-Aldrich (St. Louis, MO, USA). The pET28a vector and Lipofectame3000 were purchased from Invitrogen (Carlsbad, CA, USA), and the T4 DNA ligase and Nde1 and HindIII restriction enzymes were purchased from New England Biolabs (Ipswich, MA, USA). LB broth, phenol chloroform isoamyl alcohol, and bromophenol blue were purchased from Sigma-Aldrich. The RNeasy Mini Kit and Ni-NTA agarose were provided by Qiagen (Hilden, Germany). For some cell experiments, RPMI medium, FBS (fetal bovine serum), and penicillin-streptomycin mixture (Pen-Strep) were provided by Gibco (Carlsbad, CA, USA). Anti-mouse CD47 antibody (MIAP301) and PE anti-H2A.X Phospho (Ser139) were supplied by BioLegend (San Diego, CA, USA), and iScript™ Reverse Transcription Super mix was supplied by Bio-Rad Laboratories (Hercules, CA, USA).SYBR Green PCR Master Mix was purchased from Life Technologies (Carlsbad, CA, USA). CellTiter 96 Aqueous One Solution Cell Proliferation Assay was provided by (Madison, WI, USA). Olaparib was purchased from Santa Cruz Biotechnology (Dallas, TX, USA), and talazoparib (BMN673) was purchased from Selleck Chemical (Houston, TX, USA).

[0066] 2. Preparing the vSIRPα-linker To produce a fusion protein containing the vSIRPα protein, lysosomal cleavable linker (GFLG) peptide, and a region for siRNA binding, the following sequence was inserted into the C-terminal gene of vSIRPα to produce a vSIRPα-linker DNA fragment:CATATGGAAGAGGAGCTGCAGATCATCCAGCCTGACAAGTCCGTGCTGGTCGCTGCTGGTGAAACTGCCACTCTGCGTTGTACGATTACCAGCCTGTTCCCGGTGGGTCCAATCCAGTGGTTCCGTGGTGCTGGTCCGGGTCGTGTTCTGATCTACAACCAGCGTCAAGGTCCGTTCCCGCGTGTAACTACCGTTAGCGATACCACGAAGCGTAACAACATGGACTTTTCCATCCGCATTGGCAATATTACCCCGGCCGACGCGGGCACCTACTATTGCATCAAATTTCGCAAAGGCTCCCCGGATGATGTAGAATTTAAATCTGGCGCAGGCACCGAACTGTCTGTTCGCGCAAAACCGGTCGAC GGTGGGTTTCTGGGTGGGGGAGGATGCGGT TGAAAGCTT (Sequence ID 1). The underlined region is the GFLG encrypted sequence.

[0067] To obtain recombinant vSIRPα from E. coli BL21, a pET28a-vSIRPα-linker vector was prepared by inserting a vSIRPα-linker DNA fragment into a pET28a vector, and E. coli BL21 was transformed with this vector. After selecting colonies and culturing them in LB culture medium, plasmid DNA was separated by a standard method, and the plasmid DNA was subjected to electrophoresis on a 0.8% agarose gel to confirm the DNA composition of the vSIRPα-linker plasmid. The transformed E. coli BL21 was cultured at 20°C for 14-16 hours under 0.5 mM IPTG conditions to induce protein expression. The following day, the cell culture medium was centrifuged at 5,000 rpm for 15 minutes to obtain E. coli BL21, and the cells were lysed by sonication over 2 hours. The lysed samples were centrifuged at 13,000 rpm for 10 minutes at 4°C and purified using a Ni-NTA column. After purification, vSIRPα expression was confirmed by SDS-PAGE and HPLC.

[0068] 3.siBRCA preparation First, three siRNAs capable of inhibiting BRCA1 or BRCA2 expression were designed and manufactured. Table 1 below shows the specific sequence information for the three BRCA1 siRNAs, and Table 2 below shows the specific sequence information for the three BRCA2 siRNAs. Figures 2A and 2B show the results of measuring the BRCA1 or BRCA2 expression inhibition level of each siRNA using the TriFECTa kit (IDT). The final optimized BRCA1 and BRCA2 siRNAs are shown in Table 3 below. In Tables 1-3 below, * indicates deoxyribonucleotide (DNA).

[0069] [Table 1]

[0070] [Table 2]

[0071] [Table 3]

[0072] 4. Synthesis and properties of vSIRPα-siBRCA Amine-modified siBRCA (10 nmol) was conjugated with maleimide-NHS (300 nmol) in 50 mM HEPES (pH 7.4) at 4°C for 4 hours. The maleimide-conjugated siBRCA was purified using a NAP-10 column and lyophilized. Next, recombinant vSIRPα (10 nmol) containing a linker was conjugated to the maleimide-conjugated siBRCA (10 nmol) via a thiol-maleimide coupling reaction under 50 mM HEPES (pH 7.0-7.4) conditions for 4 hours. After 12% SDS-PAGE, the gel was stained with GelRed Nucleic Acid dye (10,000X) and scanned with GelDotTMXR+ (Bio-Rad) to confirm the synthesis of vSIRPα-siBRCA.

[0073] 5. Intracellular uptake and cytotoxicity The mouse ovarian cancer cell line ID8 was cultured in an incubator at 37°C and 5% CO2 using RPMI 1640 containing 10% FBS, 1% Pen-Strep, 1% L-glutamine, 0.5% sodium pyruvate, and 1.7 μl β-mercaptoethanol. The cells were placed in 35 mm coverslip dishes in 2 × 10⁶ containers. 5 Cells from cells / dish were seeded.

[0074] For experiments to confirm intracellular uptake, vSIRPα-siBRCA utilized siBRCA1 with Cy5 conjugation. To confirm whether intracellular uptake of vSIRPα-siBRCA is CD47-dependent, ID8 cells were pre-cultured with anti-CD47 antibody for 30 minutes. After culturing, the cells were fixed with 4% formaldehyde, cultured with DAPI at room temperature for 10 minutes, and the nuclei were stained and observed under a confocal microscope.

[0075] To confirm the cytotoxicity of vSIRPα-siBRCA, ID8 cells were placed in a 96-well microplate with each well-done 3 × 10⁶ cells. 3 Cells were seeded and treated with lipofectamine (Lipo-siBRCA1), a mixture of vSIRPα-siBRCA1 or siBRCA1, at various concentrations. After 48 hours, cell viability was assessed using a cell proliferation assay kit. The absorbance of the solution was measured at 490 nm using a plate reader.

[0076] 6. In vitro gene silencing ID8 cells were placed in a 6-well plate in 2 × 10⁶ rows. 5 Cells / dish were seeded and cultured for 48 hours after being treated with PBS, siBRCA1, siBRCA2, and lipofectamine, or vSIRPα-siBRCA1. The final concentration of each sample was set to 600 nM. RNA was isolated using the RNeasy Mini Kit according to the manufacturer's guidelines, and cRNA was synthesized using iScript™ Reverse Transcription Super mix. Similarly, ID8 cells were cultured for 48 hours after being treated with PBS, siBRCA1, siBRCA2, and lipofectamine (Lipo-siBRCA2), or vSIRPα-siBRCA2, and RNA was obtained and analyzed by RT-PCR in the same manner as above.

[0077] 7. DNA damage analysis via flow cytometry We measured the reduction in the activation of DNA repair mechanisms and the level of DNA damage caused by PARP inhibitors (PARPi).

[0078] ID8 cells were placed in a 6-well plate in 2 × 10⁶ rows. 5 Cells were seeded at a rate of 1 / dish and cultured for 48 hours with PBS, vSIRPα-siBRCA1, vSIRPα-siBRCA2, and vSIRPα-siBRCA1 / 2. Next, the cells were trypsinized and placed in 6-well plates at a rate of 2 × 10⁶ cells. 5 Cells / dish were seeded and treated with olaparib or talazoparib at the indicated concentration over a period of 24–48 hours.

[0079] Next, after detaching the cells with Trypsin-EDTA, they were blocked for 30 minutes using a PBS solution containing 1% FBS, and then stained with phospho-H2AX antibody after incubation for 2 hours. After washing with PBS, flow cytometry was measured via a FACS instrument.

[0080] [Experimental Results] 1. Synthesis of vSIRPα-siBRCA1 / 2 junctions and their properties in experimental tubes The C-terminus of vSIRPα contains a linker sequence that can bind to maleimide-modified siBRCA and is cleaved in the cytoplasm after CD47-mediated intracellular uptake. PCR products from plasmids prepared by cloning the DNA sequence coding for the vSIRPα-linker into a pET28a vector coding for vSIRPα were analyzed by agarose gel electrophoresis, confirming that a 400 bp vSIRPα-linker gene was inserted into the plasmid vector as expected (Figure 3A).

[0081] The recombinant plasmid vector was used to transform E. coli BL21 cells, and the transformed BL21 cells were cultured and vSIRPα expression was induced, which was then confirmed by SDS-PAGE and RP-HPLC (Figures 3B and 3C).

[0082] For vSIRPα-siBRCA synthesis, the cysteine ​​residue of the modified vSIRPα protein was conjugated to maleimide-conjugated siBRCA via a thiol-maleimide bond (Figure 4A). The formation of the vSIRPα-siBRCA conjugate was confirmed by PAGE gel analysis via nuclear staining, and this was confirmed by a slight shift in the band due to siBRCA conjugation compared to the vSIRPα+ linker (Figure 4B).

[0083] 2. CD47-mediated intracellular uptake (endocytosis) of vSIRPα-siBRCA conjugates in vitro. Due to their high negative charge, siRNAs have difficulty penetrating cell membranes. To efficiently deliver siRNA into cancer cells, vSIRPα-siBRCA was designed, and the absorption efficiency of the vSIRPα-siBRCA conjugate was confirmed using siBRCA conjugated with Cy5. The degree of intracellular uptake of the conjugate was confirmed by comparing it with siBRCA conjugated with Cy5.

[0084] ID8 cells are characterized by relatively high CD47 expression levels. ID8 cells were treated with either vSIRPα-siBRCA or siBRCA, stained, and observed under a confocal microscope (Figures 5A and 5B). The results showed that the vSIRPα-siBRCA conjugate was absorbed into cancer cells with high efficiency within 3-6 hours, while untreated siBRCA showed extremely low absorption even after 6 hours (Figure 5A). From these findings, it can be seen that the vSIRPα-siBRCA conjugate is taken up into cells more efficiently than siRNA, and moreover, can be selectively absorbed by CD47-overexpressing cells (Figure 5B).

[0085] 3. Cytotoxicity and gene silencing of vSIRPα-siBRCA conjugates in vitro The cytotoxicity of vSIRPα-siBRCA conjugates was evaluated by checking the cell viability 48 hours after treatment of ID8 cells with vSIRPα-siBRCA conjugates. The cytotoxicity of vSIRPα-siBRCA conjugates was compared with that of Lipo-siBRCA.

[0086] As a result, the viability of cells treated with Lipo-siBRCA1 decreased from 100 nM and significantly decreased at a concentration of 2 μM, while vSIRPα-siBRCA1 did not show significant toxicity up to 2 μM (Figure 6A). Furthermore, vSIRPα-siBRCA2 did not show significant toxicity up to 1 μM, but when cells were simultaneously treated with 1 μM of vSIRPα-siBRCA1 and vSIRPα-siBRCA2, cell viability slightly decreased (Figure 6B). Lipo-siBRCA is a lipofectamine. TM Unlike the previous study, it did not show significant toxicity up to 2 μM.

[0087] Next, we treated ID8 cells containing wild-type BRCA with vSIRPα-siBRCA zygotes to confirm the expression level of the BRCA gene. The vSIRPα-siBRCA zygotes were used to treat the cells at concentrations of 200 nM or 400 nM, and the same experiment was performed using the same amount of Lipo-siBRCA for comparison.

[0088] As a result, it was confirmed that 200 nM vSIRPα-siBRCA1, like the same amount of Lipo-siBRCA1, downwardly regulated the BRCA1 gene, and that 200 nM vSIRPα-siBRCA2 also showed the same gene silencing effect (Figure 7). Specifically, 200 nM vSIRPα-siBRCA2 reduced the expression level of the BRCA2 gene by approximately 75%, 400 nM vSIRPα-siBRCA2 reduced the expression level of the BRCA2 gene by approximately 90%, and 400 nM vSIRPα-siBRCA1 reduced the expression level of the BRCA1 gene by approximately 85% (Figures 7A and 7B). Furthermore, it was confirmed that simultaneous treatment with 400 nM vSIRPα-siBRCA1 and vSIRPa-BRCA2 reduced the expression levels of the BRCA1 and BRCA2 genes by 85-90%, respectively (Figures 7C and 7D).

[0089] 4. DNA damage induced by PARP inhibitor treatment in BRCA-silenced cells To evaluate the level of PARP inhibitor-mediated DNA damage in BRCA gene-silencing cells, the expression level of γH2AX (phospho-H2AX), a DNA damage marker, was measured by flow cytometry.

[0090] The aforementioned BRCA-silenced ID8 cells were treated with vSIRPα-siBRCA1 and vSIRPα-siBRCA2, either individually or in combination. After 48 hours, each cell group was treated with the PARP inhibitor talazoparib and cultured for another 48 hours. As a result, a significant increase in γH2AX expression levels was observed in ID8-sgBRCA1 / 2 cells.

[0091] Flow cytometry of BRCA silenced cells treated with 0.01 μM talazoparib revealed that γH2AX levels increased approximately 1.32 times in BRCA1 silenced cells, approximately 2.16 times in BRCA2 silenced cells, and 3.06 times in BRCA1 / 2 silenced cells compared to the control group (Figure 8).

[0092] From these results, it was found that silencing the BRCA2 gene improved the sensitivity of cells to PARP inhibitors more than silencing the BRCA1 gene, and in particular, simultaneous silencing of BRCA1 / 2 resulted in the most significant improvement in sensitivity to PARP inhibitors.

[0093] 5. PARP inhibitor-mediated cell death by RCA1 or BRCA2 expression silencing Knockdown and knockout of the BRCA gene have shown a high correlation with the efficacy of PARP inhibitors in inducing synthetic lethal cell death. Therefore, it was necessary to confirm whether PARP inhibitors could induce cell death in tumor cells after silencing BRCA1 / 2 expression. BRCA1 and / or BRCA2 can be effectively knocked down by treating ID8 cells with vSIRPα-siBRCA zygotes. ID8 cells were treated with vSIRPα-siBRCA zygotes over 48 hours and then treated with various concentrations of talazoparib over 72 hours. Compared to normally expressing BRCA cells, the IC50 of talazoparib decreased 3.23-fold and 4.34-fold, respectively, in BRCA1-knockdown ID8 cells and BRCA2-knockdown ID8 cells (Figures 9A and 9D). In particular, the IC50 of talazoparib decreased 28.11-fold in cells treated with both vSIRPa-siBRCA1 and vSIRPa-BRCA2. These results suggest that the efficacy of talazoparib is enhanced by BRCA2 knockdown in BRCA1-null cancer cells. To confirm this, BRCA2 was knocked down in BRCA1-deficient ID8 cells, and it was confirmed that BRCA2 knockdown reduced the IC50 of talazoparib by approximately 3.6 times (Figures 9B and 9D).

[0094] When the same experiment was performed using the PARP inhibitor olaparib, the IC50 values ​​for olaparib were found to be approximately 13.97 times lower in ID8-BRCA1 / 2 silencing cells than in ID8 control cells, approximately 3.76 times lower in ID8-BRCA1 silencing cells, and 2.77 times lower in BRCA2 silencing cells (Figures 9C and 9D).

[0095] From the above, it can be seen that suppression of BRCA1 and / or BRCA2 expression increases sensitivity to PARP inhibitors in ovarian cancer cells.

[0096] Although embodiments of the present invention have been described in detail above with reference to the drawings, the present invention is not limited to the embodiments described above, and a person with ordinary skill in the art can apply various technical modifications and variations based on the above. For example, the described techniques may be performed in a different order than described, and / or the components of the described systems, structures, devices, circuits, etc. may be combined or combined in a different manner than described, or substituted or replaced by other components or equivalents, and still achieve appropriate results.

[0097] Therefore, other realizations, other embodiments, and those equivalent to the claims described below also fall within the scope of the claims.

Claims

1. A pharmaceutical composition for the prevention or treatment of cancer, comprising BRCA (Breast Cancer Susceptibility Gene) 1-specific siRNA (small interfering RNA) and / or BRCA2-specific siRNA as active ingredients, The aforementioned composition is a pharmaceutical composition administered in combination with a PPAR (poly ADP-ribose polymerase) inhibitor.

2. The BRCA1-specific siRNA is an oligonucleotide of 15 to 31 nt length that can complementarily bind to BRCA1 mRNA. The pharmaceutical composition according to claim 1, wherein the BRCA2-specific siRNA is an oligonucleotide of 15 to 31 nt length that can complementarily bind to BRCA2 mRNA.

3. The BRCA1-specific siRNA includes the base sequence shown in Sequence ID No. 3, The pharmaceutical composition according to claim 1, wherein the BRCA2-specific siRNA comprises the base sequence shown in Sequence ID No.

5.

4. The pharmaceutical composition according to claim 1, wherein the cancer is one or more cancers selected from the group consisting of ovarian cancer, breast cancer, and prostate cancer.

5. The pharmaceutical composition according to claim 4, wherein the cancer is a cancer comprising the wild-type BRCA1 gene and / or the wild-type BRCA2 gene.

6. The pharmaceutical composition according to claim 1, wherein the siRNA is attached to a fusion protein in which a SIRPα protein and a linker peptide that is cleaved by a lysosomal degrading enzyme are covalently linked.

7. A composition for enhancing the sensitivity of cancer cells to PPAR (poly ADP-ribose polymerase) inhibitors, comprising BRCA (Breast Cancer Susceptibility Gene) 1-specific siRNA (small interfering RNA) and / or BRCA2-specific siRNA as active ingredients.

8. The BRCA1-specific siRNA includes the base sequence shown in Sequence ID No. 3, The composition according to claim 7, wherein the BRCA2-specific siRNA comprises the base sequence shown in SEQ ID NO:

5.

9. The composition according to claim 7, wherein the cancer is one or more cancers selected from the group consisting of ovarian cancer, breast cancer, and prostate cancer.

10. The composition according to claim 7, wherein the cancer cells are cancer cells containing the wild-type BRCA1 gene and / or the wild-type BRCA2 gene.

11. The composition according to claim 7, wherein the siRNA is attached to a fusion protein in which a SIRPα protein and a linker peptide that is cleaved by a lysosomal degrading enzyme are covalently linked.

12. A fusion protein-siRNA complex is formed in which a fusion protein, which is covalently linked to a SIRPα protein and a linker peptide that is cleaved by a lysosomal degrading enzyme, is joined to an siRNA, The siRNA is a fusion protein-siRNA complex containing the base sequence shown in SEQ ID NO: 3 or SEQ ID NO: 5.