Small molecule TRAIL gene induction in normal and tumor cells as an anticancer therapy

Abstract

To provide small molecule TRAIL gene induction in normal and tumor cells as an anti-cancer therapy. [Solution] Methods and compositions related to TIC10 are described according to embodiments of the present invention. The compositions and methods have utility in treating diseases, particularly cancer, in subjects in need of such treatment (including human subjects as well as subjects of other species). The compositions have utility in treating brain tumors in subjects in need of such treatment. According to embodiments of the present invention, there is provided a method of treating a subject having or at risk of having cancer, comprising administering a pharmaceutically effective amount of TIC10 or a pharmaceutically acceptable salt, hydrate, or solvate thereof; and a pharmaceutically acceptable carrier.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 61 / 480,743, filed April 29, 2011, the entire contents of which are incorporated herein by reference.

[0002] References to assistance This application was made with government support under Grant No. U54CA105008 awarded by the National Institutes of Health. The United States Government has certain rights in the invention.

[0003] FIELD OF THEINVENTION The present invention relates generally to methods and compositions for treating a proliferative disease, such as cancer, in a subject in need of such treatment. [Background technology]

[0004] 2. Background of the Invention TNF-related apoptosis-inducing ligand (TRAIL; Apo2L) is an endogenous protein that selectively induces apoptosis in cancer cells.

[0005] TRAIL is a potent inducer of apoptosis in a wide range of human cancer cell lines through cell surface proapoptotic death receptor 4 (DR4; TRAIL-R1) and death receptor 5 (DR5; TRAIL-R2) by engagement of either the extrinsic or intrinsic apoptotic pathways. TRAIL plays a direct role in tumor suppression by immune surveillance, but this antitumor mechanism is lost during disease progression. The ability of TRAIL to selectively trigger apoptosis in cancer cells has led to ongoing clinical trials using the administration of recombinant TRAIL and longer-lived TRAIL agonistic antibodies targeting either of its two proapoptotic death receptors.

[0006] Despite its potential, recombinant TRAIL has properties that limit its effectiveness (e.g., short serum half-life, stability, cost and delivery). Delivery of recombinant TRAIL or TRAIL agonist antibodies to the brain is limited by the inability of recombinant TRAIL and TRAIL agonist antibodies to cross the blood-brain barrier.

[0007] There is a continuing need for anti-cancer compositions and methods. Summary of the Invention [Means for solving the problem]

[0008] Summary of the Invention According to an embodiment of the present invention,

[0009] [ka] A pharmaceutical composition is provided that includes the above-mentioned medicament, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and a pharma- ceutically acceptable carrier. The composition has utility in treating diseases in subjects in need of such treatment, including human subjects as well as subjects of other species. The composition has utility in treating cancer in subjects in need of such treatment, including human subjects as well as subjects of other species.

[0010] According to an embodiment of the present invention, a pharmaceutical composition is provided comprising TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; a pharma- ceutically acceptable carrier; and a second therapeutic agent.

[0011] According to an embodiment of the present invention, a pharmaceutical composition is provided comprising TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; a pharma- ceutically acceptable carrier; and a second anti-cancer agent, wherein TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof is a first anti-cancer agent.

[0012] According to an embodiment of the present invention, a pharmaceutical composition is provided comprising TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; a pharma- ceutically acceptable carrier; and a mitotic inhibitor.

[0013] According to an embodiment of the present invention, a pharmaceutical composition is provided comprising TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; a pharma- ceutically acceptable carrier; and paclitaxel, docetaxel or a combination thereof.

[0014] According to an embodiment of the present invention, a pharmaceutical composition is provided comprising TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; a pharma- ceutically acceptable carrier; and an anti-angiogenic agent.

[0015] According to an embodiment of the present invention, a pharmaceutical composition is provided comprising TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; a pharma- ceutically acceptable carrier; and bevacizumab.

[0016] According to an embodiment of the present invention, there is provided a pharmaceutical composition formulated for oral administration comprising TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier.

[0017] According to an embodiment of the present invention, there is provided a method of treating a subject in need of treatment, the method comprising administering a pharma- ceutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier.

[0018] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer is provided, the method comprising administering a pharma- ceutical effective amount of TIC10, a pharma- ceutical acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutical acceptable carrier.

[0019] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer is provided, the method comprising administering a pharma- tically effective amount of TIC10; and a pharma- tically acceptable carrier.

[0020] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer is provided, the method comprising administering a pharma- tically effective amount of a pharma- tically acceptable derivative of TIC10; and a pharma- tically acceptable carrier.

[0021] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer is provided, the method comprising administering a pharma- ceutical effective amount of TIC10, a pharma- ceutical acceptable salt, ester, amide, hydrate and / or solvate thereof; and a pharma- ceutical acceptable carrier.

[0022] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer is provided, the method comprising administering a pharma- tically effective amount of TIC10 or a pharma- tically acceptable salt, hydrate or solvate thereof; and a pharma- tically acceptable carrier.

[0023] According to an embodiment of the present invention, there is provided a method of treating a subject having or at risk of having cancer, comprising administering a pharma- ceutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier; and further comprising assaying TNF-related apoptosis-inducing ligand in a sample obtained from the subject to assess the efficacy of the treatment.

[0024] According to an embodiment of the present invention, there is provided a method of treating a subject having or at risk of having cancer, comprising administering a pharma- ceutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier; and further comprising assaying TNF-related apoptosis-inducing ligand in a blood, serum, plasma or cerebrospinal fluid sample obtained from the subject to assess the efficacy of the treatment.

[0025] According to an embodiment of the present invention, there is provided a method of treating a subject having or at risk of having cancer, comprising administering a pharma- ceutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier; and further comprising administering a therapeutically effective amount of a second anti-cancer agent, wherein TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof is the first anti-cancer agent.

[0026] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer is provided, the method comprising administering a pharma- ceutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier; and further comprising administering a therapeutically effective amount of an antimitotic agent.

[0027] According to an embodiment of the present invention, there is provided a method of treating a subject having or at risk of having cancer, the method comprising administering a pharma- ceutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier; and further comprising administering a therapeutically effective amount of paclitaxel, docetaxel, bevacizumab, or any two or more thereof.

[0028] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer is provided, the method comprising oral administration of a pharma- ceutical effective amount of TIC10, a pharma- ceutical acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutical acceptable carrier.

[0029] According to an embodiment of the present invention, there is provided a method of treating a subject having or at risk of having cancer, comprising administering a pharma- ceutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier, wherein the administration is by a route selected from the group consisting of rectal, nasal, pulmonary, epidural, ocular, auricular, intra-arterial, intracardiac, intraventricular, intradermal, intravenous, intramuscular, intraperitoneal, intraosseous, intrathecal, intravesical, subcutaneous, topical, transdermal, transmucosal, sublingual, buccal, vaginal and inhalation routes of administration.

[0030] According to an embodiment of the present invention, a method of treating a subject having or at risk of having a brain tumor is provided, the method comprising administering a pharma- tically effective amount of TIC10, a pharma- tically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- tically acceptable carrier. In a preferred embodiment of the present invention, for example, the following items are provided: (Item 1) [ka] , a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier. (Item 2) 13. The pharmaceutical composition of claim 1, further comprising a second therapeutic agent. (Item 3) 3. The pharmaceutical composition of claim 2, wherein the second therapeutic agent is an anticancer agent. (Item 4) 4. The pharmaceutical composition of item 3, wherein the anticancer agent is a mitotic inhibitor. (Item 5) 4. The pharmaceutical composition of item 3, wherein the anticancer agent is selected from the group consisting of paclitaxel, docetaxel, and combinations thereof. (Item 6) 3. The pharmaceutical composition of claim 2, wherein the second therapeutic agent is an antiangiogenic agent. (Item 7) 7. The pharmaceutical composition of item 6, wherein the antiangiogenic agent is bevacizumab. (Item 8) 2. The pharmaceutical composition according to item 1, which is formulated for oral administration. (Item 9) 1. A method of treating a subject in need thereof, comprising: A pharma- ceutical effective amount [ka] , a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier. (Item 10) 10. The method according to item 9, further comprising assaying TNF-related apoptosis-inducing ligand in a sample obtained from the subject. (Item 11) 10. The method of claim 9, wherein the subject has or is at risk of having cancer. (Item 12) 12. The method of claim 11, further comprising administering an additional anti-cancer agent. (Item 13) 13. The method of claim 12, wherein the additional anti-cancer agent is an anti-mitotic agent. (Item 14) 13. The method of claim 12, wherein the additional anticancer agent is paclitaxel, docetaxel, bevacizumab, or any two or more thereof. (Item 15) 11. The method of claim 10, wherein an increased TNF-related apoptosis-inducing ligand is assayed in a blood sample obtained from the subject. (Item 16) 10. The method of claim 9, wherein the administration is oral administration. (Item 17) 7. The method of item 6, wherein the administration is selected from the group consisting of rectal, nasal, pulmonary, epidural, ocular, auricular, intra-arterial, intracardiac, intraventricular, intradermal, intravenous, intramuscular, intraperitoneal, intraosseous, intrathecal, intravesical, subcutaneous, topical, transdermal, transmucosal, sublingual, buccal, vaginal and inhalation routes of administration. (Item 18) 1. A method of treating a subject having or at risk of having a brain tumor, comprising: A pharma- ceutical effective amount [ka] (Item 19) A method comprising administering to a subject a compound of the present invention, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a pharma- ceutically acceptable carrier. 1. A method of treating a subject in need thereof, comprising: A pharma- ceutical effective amount [ka] or a pharma- ceutically acceptable salt, ester, amide, hydrate or solvate thereof; and a pharma- ceutically acceptable carrier. (Item 20) For the manufacture of a medicament for treating cancer, [ka] , and their pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs. (Item 21) Compounds for Treating Cancer [ka] , pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof. (Item 22) A pharmaceutical composition substantially as described herein. (Item 23) A method of treatment substantially as described herein. [Brief description of the drawings]

[0031] [Figure 1] Figure 1 is a graph showing the activity of a luciferase reporter in HCT116 Bax- / - cells under the transcriptional regulation of the first 504 base pairs of the human TRAIL gene promoter upstream of the transcription start; [Diagram 2] Figure 2 is a graph showing RT-qPCR analysis of TRAIL mRNA levels in HCT116 p53- / - cells; [Diagram 3] Figure 3 is a graph showing surface TRAIL levels induced by TIC10 in a panel of cancer cells; [Figure 4] Figure 4 is a graph showing surface TRAIL levels in HCT116 p53- / - cells following TIC10 treatment under the indicated conditions and time points; [Diagram 5] Figure 5 is a graph showing HCT116 p53- / -TRAIL surface levels by flow cytometry 72 hours after the start of TIC10 treatment; [Figure 6] Figure 6 shows the cell cycle profiles of HCT116 p53- / - and human foreskin fibroblast (HFF) cells treated with TIC10; [Figure 7] FIG. 7 is a graph showing quantification of colony formation assay of cancer cells treated with TIC10; [Figure 8] FIG. 8 is a graph showing a similar experiment as in FIG. 7 except that HFF cells were counted at the end time point; [Figure 9] Figure 9 is a graph showing sub-G1 analysis of HCT116 WT, p53- / - and Bax- / - cells following treatment with DMSO, TIC10 or rhTRAIL (25 ng / mL); [Figure 10] FIG. 10 is an image showing the results of Western blot analysis; [Figure 11] FIG. 11 is a graph showing sub-G1 analysis of TIC10-treated cancer cells preincubated with or without zVAD-fmk; [Figure 12] FIG. 12 is a graph showing sub-G1 analysis of MDA-MB-231 cells in which TRAIL was stably knocked down by short hairpin RNA; [Figure 13] FIG. 13 is a graph showing demonstration of MDA-MB-231 shTRAIL knockdown by flow cytometry analysis of TIC10-treated cells; [Figure 14] FIG. 14 is a graph showing sub-G1 analysis of TIC10-induced cell death in H460 cells with overexpression of endogenous DR5 or a DR5 construct in which its death domain has been replaced with EGFP; [Figure 15] FIG. 15 is a graph showing sub-G1 analysis of HCT116 cells treated with DMSO, TIC10, or rhTRAIL in the presence or absence of TRAIL sequestering antibody RIK-2; [Figure 16] FIG. 16 is a graph showing surface TRAIL induced by TIC10 using freshly excised human colon cancer cells; [Figure 17]FIG. 17 is a graph showing the results of a cell viability assay of the primary colon cancer cells of FIG. 16 treated with DMSO, TIC10 or 5-FU; [Figure 18] FIG. 18 is a graph showing that TIC10 or rhTRAIL can reduce cell viability of HCT116 cells after 1 hour preincubation at the indicated temperatures; [Figure 19] FIG. 19 is a graph showing HCT116 p53− / − xenografts treated with TIC10, TRAIL or vehicle; [Figure 20] FIG. 20 is a graph showing the results of bioluminescence imaging of luciferase-infected HCT116 p53− / − xenografts treated with TIC10 or vehicle; [Figure 21] FIG. 21 is a graph showing RKO xenografts treated with TIC10, TRAIL or vehicle; [Figure 22] Figure 22 shows box plots of tumor volumes 9 days after initiation of treatment with TIC10, TRAIL, or vehicle in MDA-MB-231 vector or shTRAIL xenografts; [Figure 23] FIG. 23 is a graph showing the relative tumor volumes of DLD-1 xenografts treated with TRAIL, TIC10 or DMSO; [Figure 24] FIG. 24 is a graph showing a comparison of ip and oral administration of TIC10 in SW480 xenografts; [Diagram 25] FIG. 25 is a graph showing TIC10 or vehicle administered as a single dose orally in HCT116 xenografts; [Figure 26] FIG. 26 is a graph showing the body weight of athymic female nude mice treated with a single dose of TIC10; [Figure 27] FIG. 27 is a graph showing the body weight of C57 / B6 female mice at the end of the fourth week of treatment with oral TIC10; [Figure 28]FIG. 28 is a graph showing overall survival of εμ-myc treated with oral TIC10 weekly between weeks 9 and 12; [Figure 29] FIG. 29 is a graph showing cell viability of DLD-1 cells treated with TIC10 along with paclitaxel; [Diagram 30] FIG. 30 is a graph showing cell viability of SW620 cells treated with TIC10 along with paclitaxel; [Diagram 31] FIG. 31 is a graph showing cell viability of DLD-1 cells treated with TIC10 together with Taxotere; [Diagram 32] FIG. 32 is a graph showing cell viability of SW620 cells treated with TIC10 together with Taxotere; [Diagram 33] FIG. 33 is a graph showing the percentage of cohorts retaining tumor tissue after treatment with TIC10 or Taxotere alone, in combination, or with vehicle in H460 xenografts; [Diagram 34] FIG. 34 is a graph showing a plot of relative tumor volume for FIG. 33 ; [Diagram 35] FIG. 35 is a graph showing the percentage of cohorts retaining tumor tissue after treatment with TIC10 or paclitaxel alone, in combination, or with vehicle in H460 xenografts; [Diagram 36] FIG. 36 is a graph showing a plot of relative tumor volume for FIG. 35 ; [Figure 37] FIG. 37 is a graph showing the percentage of cohorts implanted with HCT116 p53− / − tumors in the cecum and treated with TIC10, bevacizumab, or the combination of TIC10 and bevacizumab, that had palpable tumors at primary and distant sites at the end point; [Figure 38] FIG. 38 is a graph showing the body weight of mice implanted with intracecal HCT116 p53− / − tumors treated with vehicle, TIC10, bevacizumab, or the combination of TIC10 and bevacizumab; [Figure 39] FIG. 39 is a graph showing TRAIL serum levels in tumor-free mice following TIC10 or doxorubicin; [Diagram 40] FIG. 40 is a graph showing the absorbance profile of TIC10, which has a peak absorbance at 239 nm; [Diagram 41] FIG. 41 is a graph showing the calibration curve for TIC10 spiked into mouse plasma and quantified using area under the curve (AUC) by HPLC analysis; [Diagram 42] FIG. 42 is a graph showing the plasma concentration of TIC10 following intravenous administration to C57 / B6 female mice; [Diagram 43] FIG. 43 is a graph showing analysis of surface TRAIL on HFF cells following TIC10 treatment (0, 2.5, 5 or 10 μM from left to right); [Diagram 44] FIG. 44 is a graph showing sub-G1 analysis of co-cultures of HCT116 p53− / − cells and pretreated HFFs; [Diagram 45] FIG. 45 is a graph showing surface TRAIL in GBM cell lines after incubation with TIC10; [Figure 46] FIG. 46 is a graph showing extrapolated GI50 values ​​from cell viability assays of the indicated GBM cell lines after 72 hours of treatment with TIC10 or DMSO; [Figure 47] FIG. 47 shows the results of cell viability assays of freshly excised glioblastoma tissues treated with DMSO, TIC10 or temozolomide; [Figure 48] FIG. 48 is a graph showing subcutaneous xenografts of T98G in mice receiving a single dose of vehicle, TIC10 or bevacizumab; [Figure 49] FIG. 49 is a graph showing overall survival of mice bearing SF767 intracranial tumors treated with a single oral dose of vehicle, TIC10, bevacizumab, or TIC10 and bevacizumab; [Figure 50] FIG. 50 is a graph showing transcriptional changes associated with FOXO signaling from gene expression profiling of HCT116 p53− / − cells 48 hours after TIC10 treatment compared to DMSO; [Figure 51] FIG. 51 is an image of a Western blot analysis of DR5 in HCT116 cells treated with TIC10 or DMSO; [Figure 52] FIG. 52 is a graph showing flow cytometry analysis of surface DR5 levels in cancer and normal cells treated with TIC10; [Figure 53] FIG. 53 is an image of a Western blot analysis of whole cell lysates (W) and cytoplasmic (C) and nuclear (N) extracts of HCT116 cells treated with DMSO or TIC10; [Figure 54] FIG. 54 is an image of the results of a chromatin immunoprecipitation assay for TIC10-induced translocation of Foxo3a to the TRAIL promoter 48 hours after TIC10 treatment (0, 2.5, 5 or 10 μM from left to right) in HCT116 p53− / − cells; [Figure 55] FIG. 55 is a graph showing the results of flow cytometry analysis of cell surface TRAIL levels induced by TIC10 with or without transient knockdown of Foxo1 and / or Foxo3a in HCT116 p53− / − cells using siRNA; [Figure 56] FIG. 56 is a graph showing sub-G1 analysis of TIC10-induced cell death with or without stable knockdown of Foxo3a in HCT116 cells; [Figure 57] FIG. 57 is a graph showing flow cytometry analysis of surface TRAIL induced by TIC10 with or without stable knockdown of Foxo3a in HCT116 cells; [Figure 58]FIG. 58 is a graph showing tumor volume of HCT116 xenografts with or without stable knockdown of Foxo3a following a single oral dose of vehicle or TIC10; [Figure 59] FIG. 59 is an image of a Western blot analysis of HCT116 p53− / − cells treated with TIC10 (2.5, 5, 10 μM) for 72 hours; [Figure 60] FIG. 60 is an image of a Western blot analysis of HCT116 p53− / − cells treated with TIC10; [Figure 61] FIG. 61 is a graph showing the time course of protein expression levels of TIC10-induced effects as measured by densitometry of Western blots of replicate experiments as in FIG. 60; [Figure 62] FIG. 62 is an image of a Western blot analysis of the effect induced by TIC10 on Foxo3a in DLD1 human colon cancer cells, MDA-MB-468 human breast cancer cells and T98G human glioblastoma multiforme cell line; [Figure 63] FIG. 63 is an image of a Western blot analysis showing overexpression of myr-Akt; [Figure 64] Figure 64 is a graph showing flow cytometry analysis of surface TRAIL in HCT116 cells overexpressing empty vector or myristilated Akt (myr-Akt) subjected to TIC10 treatment; [Figure 65] Figure 65 is a graph showing the sub-G1 content of HCT116 cells overexpressing empty vector or myr-Akt subjected to TIC10 treatment; [Figure 66] Figure 66 is a graph showing RT-qPCR analysis of TRAIL mRNA in HCT116 p53- / - cells after incubation with A6730 (Akt inh), U0126 monoethanolate (MEK inh) or both; [Figure 67]Figure 67 is a graph showing induction of surface TRAIL as in Figure 66 with or without stable knockdown of Foxo3a; [Figure 68] Figure 68 is a graph showing sub-G1 analysis of MDA-MB-231 with or without TRAIL knockdown by shRNA after incubation with Akt inh, MEK inh, or both; [Figure 69] FIG. 69 is a graph showing surface TRAIL analysis of HCT116 p53− / − cells after incubation with A6730 (Akt inh), U0126 monoethanolate (MEK inh) or both; [Figure 70] Figure 70 is a graph showing RT-qPCR analysis of TRAIL mRNA levels following transient knockdown of Akt and / or ERK in HCT116 p53- / - cells; [Figure 71] FIG. 71 is an image showing confirmation of Akt and ERK knockdown by Western blot analysis; [Figure 72] FIG. 72 is a graph showing surface TRAIL analysis following transient knockdown of Akt and / or ERK in HCT116 cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] Detailed Description of the Invention Scientific and technical terms used herein are intended to have the meanings commonly understood by those of ordinary skill in the art.Such terms are found defined and used in context in a variety of standard references, including, by way of example, J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; FMAusubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002; B. Alberts et al., Molecular Biology of the Cell, 4th Ed., Garland, 2002; DL Nelson and MMCox, Lehninger Principles of Biochemistry, 4th Ed., WH Freeman & Company, 2004; Engelke, DR, RNA Interference (RNAi): Nuts and Bolts of RNAi Technology, DNA Press LLC, Eagleville, PA, 2003; Herdewijn, P. (Ed.), Oligonucleotide Synthesis: Methods and Applications, Methods in Molecular Biology,Humana Press,2004;A.Nagy,M.Gertsenstein,K.Vintersten,R.Behringer,Manipulating the Mouse Embryo:A Laboratory Manual,3rd edition,Cold Spring Harbor Laboratory Press;December 15,2002,ISBN-10:0879695919;Kursad Turksen(Ed.),Embryonic stem cells:methods and protocols in Methods Mol Biol. 2002; 185, Humana Press; Current Protocols in Stem Cell Biology, ISBN: 9780470151808.

[0033] The singular terms "a," "an," and "the" are not intended to be limiting and include plural referents unless expressly stated otherwise or the context clearly indicates otherwise.

[0034] Because p53 is often inactivated in late-stage cancers, thereby causing resistance to many standard-of-care therapies such as 5-FU and doxorubicin, methods and compositions according to embodiments of the present invention relate to TRAIL-inducing compound 10 (TIC10), which the inventors identified as a small molecule transcriptional inducer of the TRAIL gene by screening for TRAIL-inducing compounds that upregulate the TRAIL gene by a p53-independent mechanism.

[0035] TIC10 induces the expression of TRAIL in both normal and cancer cells.The terms "induce the expression of TRAIL", "TRAIL induced by TIC10" and their grammatical equivalents used herein to describe the effect of TIC10 or its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs refer to the detectable increase in TRAIL caused by cells contacted with TIC10 or its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs.The detectable increase in TRAIL can be measured by assaying for TRAIL protein or TRAIL nucleic acid using well-known protein or nucleic acid assay methods.

[0036] TIC10-induced TRAIL persists in cancer cells as well as in normal cells and serum, resulting in a TRAIL-mediated bystander effect on cancer cells and tumors. TIC10 inactivates Akt and ERK, leading to the nuclear translocation of Foxo3a and the induction of TRAIL transcription.

[0037] TIC10-induced TRAIL is dependent on Foxo3a, which upregulates the TRAIL death receptor DR5, among other targets, allowing sensitization of some TRAIL-resistant tumor cells. TIC10-triggered TRAIL induction is sustained in tumor, stromal and host cells.

[0038] According to aspects of the present invention, pharmaceutical compositions comprising TIC10 or a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof, and methods for their use are provided.

[0039] According to an aspect of the present invention, there is provided a pharmaceutical composition comprising a compound of structure (I).

[0040] [ka] The compound of structure (I) is also referred to herein as TRAIL-inducing compound 10 (TIC10) and NSC350625.

[0041] Compounds of structure (I) (TIC10) can be obtained commercially or synthesized using standard chemical synthesis methods.

[0042] Pharmaceutical compositions according to embodiments of the present invention may also be pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs of the compounds of structure (I).

[0043] Pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs of the compounds of structure (I) can be obtained commercially or synthesized using standard chemical synthetic methods.

[0044] The term "pharmaceutical acceptable derivatives" as used with respect to compounds of structure (I) are compounds of structure (I) further substituted at any substitutable position that substantially retain the indicated activity of the compounds of structure (I) to induce expression of TRAIL in cells. For example, compounds of structure (I) are optionally further substituted at any substitutable position with one or more of the following: F, Cl, Br, lower alkyl groups, lower alkoxy groups, or fluorinated lower alkyl groups (e.g., CF3).

[0045] A "pharmaceutically acceptable" salt, ester, amide, hydrate, prodrug, or solvate is suitable for use in a subject without undue toxicity or irritation to the subject, and is effective for the intended use.

[0046] Pharmaceutically acceptable salts include pharmaceutically acceptable acid addition salts and base addition salts. Pharmaceutically acceptable salts are well known in the art and are, for example, those described in detail in SM Berge et al., J.Pharm.Sci.,66:1-19,1977. Exemplary pharma- ceutically acceptable salts are those salts suitable for use in a subject without undue toxicity or irritation to the subject and effective for their intended use, and include salts of inorganic acids (e.g., hydrochloric, hydrobromic, hydroiodic, nitric, phosphoric, sulfuric, and sulfamic acids); organic acids (e.g., acetic, adipic, alginic, ascorbic, aspartic, benzenesulfonic, benzoic, 2-acetoxybenzoic, butyric, camphorsulfonic, cinnamic, citric, digluconic, ethanesulfonic, formic, fumaric, glutamic, glycolic, glycerophosphoric, hemisulfuric, nitric, and tert-butanoic acids); acid), heptanoic acid, hexanoic acid, 2-hydroxyethanesulfonic acid (isethionic acid), lactic acid, maleic acid, hydroxymaleic acid, malic acid, malonic acid, mandelic acid, mesitylenesulfonic acid, methanesulfonic acid, naphthalenesulfonic acid, nicotinic acid, 2-naphthalenesulfonic acid, oxalic acid, pamoic acid, pectinic acid, phenylacetic acid, 3-phenylpropionic acid, picric acid, pivalic acid, propionic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, sulfanilic acid, tartaric acid, p-toluenesulfonic acid, trichloroacetic acid, trifluoroacetic acid and undecanoic acid); inorganic bases (e.g., ammonia, hydroxides, carbonates and bicarbonates of ammonium);Organic bases (e.g., primary, secondary, tertiary and quaternary amine compounds, ammonium, arginine, betaine, choline, caffeine, diolamine, diethylamine, diethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, dicyclohexylamine, dibenzylamine, N,N-dibenzylphenethylamine, 1-ephenamine, N,N'-dibenzylethylenediamine, ethanolamine, ethylamine, ethylenediamine, glucosamine, histidine, hydrabamine, isopropyl amines, 1h-imidazole, lysine, methylamine, N-ethylpiperidine, N-methylpiperidine, N-methylmorpholine, N,N-dimethylaniline, piperazine, trolamine, methylglucamine, purines, piperidine, pyridine, theobromine, tetramethylammonium compounds, tetraethylammonium compounds, trimethylamine, triethylamine, tripropylamine, and tributylamine) and metal cations (e.g., aluminum, calcium, copper, iron, lithium, magnesium, manganese, potassium, sodium, and zinc);

[0047] Illustrative examples of pharma- ceutically acceptable solvates include hydrates, ethanolates, and methanolates.

[0048] Exemplary pharma- ceutically acceptable amides include those derived from ammonia, primary C1-C6 alkylamines, and secondary C1-C6 dialkylamines, including amides in the form of 5- or 6-membered nitrogen-containing heterocycles.

[0049] A TIC10 prodrug is a form of TIC10 covalently bound to a moiety that is released from TIC10, resulting in intact, active TIC10. Prodrug forms are well known in the art, as exemplified in Sloan, KB, Prodrugs, M. Dekker, New York, 1992; and Testa, B. and Mayer, JM, Hydrolysis in drug and prodrug metabolism: chemistry, biochemistry, and enzymology, Wiley-VCH, Zurich, 2003.

[0050] As a first-line treatment

[0051] [ka] and a pharma- ceutical composition comprising: (a) a pharma- ceutical compound, a pharma- ...

[0052] According to an aspect of the present invention, there is provided a method of treating a subject in need of treatment, the method comprising administering a pharma- ceutical effective amount of:

[0053] [ka] , pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof; and a pharma- ceutically acceptable carrier.

[0054] A method of treating a subject in need of treatment is provided, the method comprising administering to the subject a pharma- ceutical effective amount of TRAIL effective to induce expression of TRAIL in the subject.

[0055] [ka] , pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof; and a pharma- ceutically acceptable carrier.

[0056] TRAIL protein can be assayed in a test sample obtained from a subject to detect TIC10-induced TRAIL expression.

[0057] Immunoassay methods can be used to assay TRAIL in a sample, including but not limited to enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunofiltration assay (ELIFA), flow cytometry, immunoblot, immunoprecipitation, immunohistochemistry, immunocytochemistry, luminescence immunoassay (LIA), fluorescent immunoassay (FIA) and radioimmunoassay. Assay methods for obtaining qualitative and / or quantitative results can be used. Specific details of assay methods suitable for both qualitative and quantitative assay of samples can be found in standard references, illustratively including E. Harlow and D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1988; F. Breitling and S. Duebel, Recombinant Antibodies, John Wiley & Sons, New York, 1999; H. Zola, Monoclonal Antibodies: Preparation and Use of Monoclonal Antibodies and Engineered Antibody Derivatives, Basics: From Background to Bench, BIOS Scientific Publishers, 2000; BKC Lo, Antibody Engineering: Methods and Protocols, Methods in Molecular Biology, Humana Press, 2003; FMAusubel et al., Eds., Short Protocols in Molecular Biology, Current Protocols, Wiley, 2002; S. Klussman, Ed., The Aptamer Handbook: Functional Oligonucleotides and Their Applications, Wiley, 2006; Ormerod, MG, Flow Cytometry: a practical approach, Oxford University Press, 2000; Givan, A.L., Flow Cytometry: first principles, Wiley, New York, 2001; Gorczyca, W., Flow Cytometry in Neoplastic Hematology: morphologic-immunophenotypic correlation, Taylor & Francis, 2006; Crowther, J.R., The ELISA Guidebook (Methods in Molecular Biology), Humana Press, 2000; Wild, D., The Immunoassay Handbook, 3rd Edition, Elsevier Science, 2005 and J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 3rd Ed., 2001 are included.

[0058] Aptamers can be used to assay samples for TRAIL. The term "aptamer" refers to peptides and / or nucleic acids that bind substantially specifically to a particular substance. In the case of nucleic acid aptamers, the aptamers are characterized by binding interactions with targets other than Watson / Crick base pairing or triple helix binding with second and / or third nucleic acids. Such binding interactions can include, for example, van der Waals interactions, hydrophobic interactions, hydrogen bonds and / or electrostatic interactions. Similarly, peptide-based aptamers are characterized by specific binding with targets, where the aptamers are not naturally occurring ligands for the targets. Techniques for identifying and producing peptide and nucleic acid aptamers and their uses are known in the art, as described, for example, in FMA Usubel et al., Eds., Short Protocols in Molecular Biology, Current Protocols, Wiley, 2002; S. Klussman, Ed., The Aptamer Handbook: Functional Oligonucleotides and Their Applications, Wiley, 2006; and J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 3rd Ed., 2001.

[0059] Spectroscopic analysis is used to assay samples for TRAIL. For example, mass spectrometry can be used in the assay according to the present invention. Mass spectrometry is carried out, for example, using time-of-flight (TOF) mass spectrometry or Fourier transform ion cyclotron resonance mass spectrometry. Mass spectrometry techniques are known in the art, and exemplary detailed descriptions of methods for protein and / or peptide assays can be found in Li J. et al., Clin Chem., 48(8):1296-304, 2002; Hortin, GL, Clinical Chemistry 52:1223-1237, 2006; Hortin, GL, Clinical Chemistry 52:1223-1237, 2006; A.L. Burlingame et al. (Eds.), Mass Spectrometry in Biology and Medicine, Humana Press, 2000; and D.M. Desiderio, Mass Spectrometry of Peptides, CRC Press, 1990.

[0060] The effect of the pharmaceutical composition of the present invention can be detected by assaying the localization of TRAIL on the cell surface. The detection of the localization of TRAIL can be performed by immunoassays such as flow cytometry, as well as immunohistochemistry.

[0061] The test sample may be any biological fluid, cell or tissue of the subject, illustratively including blood, plasma, serum, urine, saliva, ascites, cerebrospinal fluid, ventricular fluid, pleural fluid, lung and bronchoalveolar lavage samples, mucus, sweat, tears, semen, bladder washing samples, amniotic fluid, lymphatic fluid, peritoneal fluid, synovial fluid, bone marrow aspirate, tumor cells or tissue, organ cells or tissue (e.g., biopsy material). In a preferred embodiment, the test sample is blood, plasma or serum.

[0062] The test sample from the subject is purified for the assay of TRAIL or other biomarkers as necessary.The term "purified" in the context of a test sample refers to the separation of TRAIL or another biomarker from at least one other component present in the test sample.The purification of test sample is achieved by techniques including, illustratively, electrophoretic methods (e.g., gel electrophoresis and 2-D gel electrophoresis); chromatographic methods (e.g., HPLC, ion exchange chromatography, affinity chromatography, size exclusion chromatography, thin layer and paper chromatography).

[0063] Assays for TRAIL can be performed in cells and tissues. For example, immunohistochemical methods and in situ hybridization can be used to assay for TRAIL protein and / or nucleic acid in a cell or tissue test sample.

[0064] One or more standards may be used to allow for the quantitative measurement of TRAIL in a sample.

[0065] Assays of TRAIL in a test sample can be compared to assays of TRAIL in a control sample, which may, for example, be obtained from one or more normal subjects.

[0066] According to an embodiment of the present invention, the assay for TRAIL is used to monitor a subject.Thus, for example, test samples are obtained from a subject before, during and / or after treatment with the pharmaceutical composition of the present invention to evaluate the effectiveness of treatment.In a further example, test samples are obtained from a subject at various times to evaluate the course or progression of disease or cure.

[0067] In certain embodiments, one or more additional biomarkers are assayed in the test sample obtained from subject to help monitor the treatment with the pharmaceutical composition of the present invention.For example, one or more of the localization and / or phosphorylation of phospho-ERK, phospho-Akt, Foxo3a are assayed in the test sample obtained from subject to help monitor the treatment with the pharmaceutical composition of the present invention.Such additional biomarkers are assayed by immunoassay method such as the method described herein.

[0068] To detect the expression of TIC10-induced TRAIL, TRAIL nucleic acid can be assayed in the test sample obtained from the subject.The assay for detecting TRAIL nucleic acid, particularly mRNA or cDNA, includes but is not limited to polymerase chain reaction (PCR) (e.g., RT-PCR), dot blot, in situ hybridization, Northern blot and RNase protection.

[0069] In accordance with the present invention, methods and compositions for treating cancer are provided.

[0070] According to an aspect of the invention, there is provided a method of treating a subject having or at risk of having cancer, the method comprising administering a pharma- tically effective amount of

[0071] [ka] , pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof; and a pharma- ceutically acceptable carrier.

[0072] A method of treating a subject having or at risk of having cancer is provided, the method comprising administering to the subject a pharma- tically effective amount of TRAIL effective to induce expression of TRAIL in the subject.

[0073] [ka] , pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof; and a pharma- ceutically acceptable carrier.

[0074] The cancers treated with the methods and compositions described herein are characterized by abnormal cell proliferation, including but not limited to preneoplastic hyperproliferation, intraepithelial carcinoma, neoplasia and metastasis. The methods and compositions of the present invention can be used to prevent and ameliorate signs and / or symptoms of cancer. The terms "treat" and "treatment" used to refer to the treatment of cancer in a subject include preventing, inhibiting or ameliorating cancer in the subject (e.g., delaying the progression of cancer and / or reducing or ameliorating signs or symptoms of cancer).

[0075] A pharma- tically effective amount of the composition of the present invention is an amount that has a beneficial effect in the subject being treated. In a subject having or at risk of having cancer, such as a condition characterized by abnormal cell proliferation, including but not limited to preneoplastic hyperproliferation, intraepithelial carcinoma, neoplasm, metastasis, tumor, benign growth, or other conditions responsive to the composition of the present invention, a pharma-tically effective amount of the composition of the present invention is effective to ameliorate or prevent one or more signs and / or symptoms of the condition. For example, a pharma-tically effective amount of the composition of the present invention is effective to detectably increase apoptosis and / or reduce the proliferation of cells in a cancer condition characterized by abnormal cell proliferation, including but not limited to preneoplastic hyperproliferation, intraepithelial carcinoma, neoplasm, metastasis, tumor, benign growth, or other conditions responsive to the composition of the present invention.

[0076] TIC10 has a broad spectrum of activity as described herein in primary patient samples and cell lines that are resistant to conventional therapy, suggesting that the therapeutic action of TIC10 does not depend exclusively on molecules that are commonly altered in cancer (e.g., EGFR, Her2, KRAS, or PTEN). Elucidation of the therapeutic cellular mechanism of TIC10 identifies resistance mechanisms as described herein (e.g., overactivated Akt), and provides phospho-ERK, phospho-Akt, Foxo3a localization and phosphorylation, and surface and serum TRAIL as correlative biomarkers of TIC10 therapeutic activity in cancer.

[0077] Thus, according to an embodiment of the present invention, one or more correlative biomarkers of TIC10 therapeutic activity in cancer are assayed to assess treatment with the pharmaceutical compositions of the present invention.

[0078] The subject treated according to the method and with the composition of the present invention may be a mammal or a non-mammal. The mammalian subject may be any mammal, including but not limited to a human; a non-human primate; a rodent (e.g., a mouse, a rat, or a guinea pig); a domestic pet (e.g., a cat or a dog); a horse, a cow, a pig, a sheep, a goat, or a rabbit. The non-mammalian subject may be any non-mammal, including but not limited to a bird (e.g., a duck, a goose, a chicken, or a turkey). The subject may be of either sex and of any age. In an embodiment of the method comprising administering the pharmaceutical composition of the present invention to a subject, the subject is a human. The terms "subject" and "patient" are used interchangeably herein.

[0079] The pharmaceutical composition according to the present invention usually comprises about 0.1-99% of TIC10, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and a pharma- ceutically acceptable carrier. A combination of TIC10 and at least one of its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs in a pharmaceutical composition is also considered to be within the scope of the present invention. Furthermore, a combination of at least two of its pharma- ceutical acceptable derivatives, salts, esters, amides, hydrates, solvates and prodrugs in a pharmaceutical composition is also considered to be within the scope of the present invention.

[0080] According to an embodiment of the present invention, a combination of therapeutic agents is administered. According to an embodiment of the present invention, the method of treating cancer in a subject comprises administering a pharmaceutical composition of TIC10, its pharmaceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug; and at least one additional therapeutic agent. According to an embodiment of the present invention, the method of treating cancer in a subject comprises administering a pharmaceutical composition of TIC10, its pharmaceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug; and at least two additional therapeutic agents.

[0081] The term "additional therapeutic agent" is used herein to refer to a chemical substance, a mixture of chemical substances, a biological macromolecule (e.g., a nucleic acid, an antibody, a protein or portion thereof, e.g., a peptide), or an extract prepared from biological material (e.g., bacteria, plants, fungi, or animal (e.g., mammalian) cells or tissues) that is a biologically, physiologically, or pharmacologically active substance or substances that act locally or systemically in a subject.

[0082] Additional therapeutic agents that may be included in accordance with embodiments of the methods and compositions of the present invention include, but are not limited to, antibiotics, antivirals, antineoplastic agents, analgesics, antipyretics, antidepressants, antipsychotics, anticancer agents, antihistamines, anti-osteoporosis agents, anti-osteonecrosis agents, anti-inflammatory agents, anti-anxiety agents, chemotherapeutic agents, diuretics, growth factors, hormones, nonsteroidal anti-inflammatory agents, steroids, and vasoactive agents.

[0083] Combination therapy using TIC10, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs and one or more additional therapeutic agents may exhibit synergistic effects, e.g., greater therapeutic effects than may be observed when using a pharmaceutical composition of the invention comprising TIC10, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs or one or more additional therapeutic agents alone as monotherapy.

[0084] According to an embodiment, the combination therapy includes (1) a pharmaceutical composition comprising TIC10 of the present invention, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs, which are formulated together in a single composition with one or more additional therapeutic agents; and (2) co-administration of a pharmaceutical composition comprising TIC10 of the present invention, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs and one or more additional therapeutic agents (wherein the pharmaceutical composition comprising TIC10 of the present invention, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs and the one or more additional therapeutic agents are not formulated in the same composition). When a separate formulation is used, the pharmaceutical composition comprising TIC10 of the present invention, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs may be administered simultaneously with, at intermittent time points, at staggered time points, prior to, after, or combinations of one or more additional therapeutic agents.

[0085] Combination treatment may allow for a reduction in the effective dosage and an increase in the therapeutic index of a pharmaceutical composition comprising the TIC10 of the present invention, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs and one or more additional therapeutic agents used in the methods of the present invention.

[0086] According to an embodiment, the combination therapy includes (1) a pharmaceutical composition comprising the TIC10 of the present invention, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs, formulated together in a single composition with one or more additional anti-cancer agents; and (2) co-administration of a pharmaceutical composition comprising the TIC10 of the present invention, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs and one or more additional anti-cancer agents (wherein the pharmaceutical composition comprising the TIC10 of the present invention, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs and the one or more additional therapeutic agents are not formulated in the same composition). When a separate formulation is used, the pharmaceutical composition comprising TIC10 of the present invention, its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs may be administered simultaneously with, at intermittent time points, at staggered time points, prior to, after, or in combination with the administration of one or more additional anti-cancer agents.

[0087] Anticancer agents are described, for example, in Goodman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th Ed., Macmillan Publishing Co., 1990.

[0088] Illustrative examples of anticancer drugs include acivicin, aclarubicin, acodazole, acronine, adzelesin, aldesleukin, alitretinoin, allopurinol, altretamine, ambomycin, amethantrone, amifostine, aminoglutethimide, amsacrine, anastrozole, anthramycin, arsenic trioxide, asparaginase, asperlin, azacytidine, azetepa, azotomycin, batimasta t), benzodepa, bevacizumab, bicalutamide, bisantrene, bisnafide dimesylate, bizelesin, bleomycin, brequinar, bropirimine, busulfan, cactinomycin, calsterone, capecitabine, caracemide, carbetimer, carboplatin, carmustine, carubicin, carzelesin, cedefingol, celecoxib, chlorambucil, cirolemycin, cisplatin, cladribine, crisnatol mesylate mesylate), cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, decitabine, dexormaplatin, dezaguanine, dezaguanine mesylate, diaziquone, docetaxel, doxorubicin, droloxifene, dromostanolone, zuazomycin, edatrexate, eflomithine, elsamitrucin, enloplatin, enpromate, epipropidine, epirubicin, erbulozole, esorubicin, estramustine, etanidazole, etoposide, etoprine, fadrozole,Fazarabine, fenretinide, floxuridine, fludarabine, fluorouracil, flurocitabine, fosquidone, fostriecin, fulvestrant, gemcitabine, hydroxyurea, idarubicin, ifosfamide, ilmofosine, interleukin II (IL-2, including recombinant interleukin II or rIL2), interferon alpha-2a, interferon alfa-2a, rufa-2b, interferon alpha-n1, interferon alpha-n3, interferon beta-Ia, interferon gamma-Ib, iproplatin, irinotecan, lanreotide, letrozole, leuprolide, liarozole, lometrexol, lomustine, losoxantrone, masoprocol, maytansine, mechlorethamine hydrochloride hydrochlride, megestrol, melengestrol acetate, melphalan, menogaril, mercaptopurine, methotrexate, metoprine, meturedepa, mitindomide, mitocarcin, mitochromin, mitogillin, mitomalcin, mitomycin, mitosper, mitotane, mitoxantrone, mycophenolic acid, nelarabine , nocodazole, nogalamycin, ormnaplatin, oxisuran, paclitaxel, pegaspargase, periomycin, pentamustine, peplomycin, perfosfamide, pipobroman, piposulfan, piroxantrone hydrochloride, plicamycin, promestane, porfimer,Porfiromycin, prednimustine, procarbazine, puromycin, pyrazofurin, riboprine, rogletimide, safingol, semustine, simtrazene, sparfosate, sparsomycin, spirogermanium, spirom spiromustine, spiroplatin, streptonigrin, streptozocin, sulofenur, talisomycin, tamoxifen, tecogalan, tegafur, teloxantrone, temoporfin, teniposide, teroxirone, testolactone, thiamipiri thiamiprine, thioguanine, thiotepa, tiazofurin, tirapazamine, topotecan, toremifene, trestolone, triciribine, trimetrexate, triptorelin, tubulozole, uracil mustard, uredepa, vapreotide, verteporfin, vinblastine, vincristine sulfate, vindesine, vinepidine, vinglycinate, vinleurosine, vinorelbine, vinrosidine, vinzolidine, vorozole, zeniplatin, zinostatin, zoledronate, and zorubicin.

[0089] A synergistic effect of combination treatment of a pharmaceutical composition comprising TIC10 with one or more additional anti-cancer agents (e.g., one or more antimitotic agents and / or one or more anti-angiogenic agents) has unexpectedly been found, as described herein.

[0090] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer includes administration of a therapeutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a mitotic inhibitor.

[0091] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer includes administration of a therapeutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and a taxane mitotic inhibitor (e.g., but not limited to, paclitaxel and docetaxel).

[0092] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer includes administration of a therapeutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and an anti-angiogenic agent.

[0093] According to an embodiment of the present invention, a method of treating a subject having or at risk of having cancer includes administration of a therapeutically effective amount of TIC10, a pharma- ceutically acceptable derivative, salt, ester, amide, hydrate, solvate and / or prodrug thereof; and an anti-angiogenic agent (e.g., but not limited to, bevacizumab).

[0094] In certain embodiments of the compositions of the present invention, the amount of the adjunct anti-cancer agent administered is less than the amount of the adjunct anti-cancer agent required to achieve a therapeutic effect when administered without a therapeutically effective amount of structure (I), its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs. Thus, in certain embodiments of the compositions of the present invention, the amount of the adjunct anti-cancer agent in a unit dose of the composition is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90% less than the amount of the adjunct anti-cancer agent required to achieve a therapeutic effect when administered without a therapeutically effective amount of structure (I), its pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs.

[0095] According to embodiments of the invention, TRAIL may be induced or provided by methods or compositions such as by administration of one or more histone deacetylase (HDAC) inhibitors (e.g., vorinostat, as described in Nebbioso, A. et al., 2005, Nat Med 11, 77-84); one or more TRAIL agonist antibodies (e.g., lexatumumab and mapatumumab); and / or recombinant TRAIL (e.g., adenoviral TRAIL, as described in Abdulghani, J. et al., 2010, Exp. Opin. Ther. Targets 14:1091-1108) in addition to administration of TIC10.

[0096] Optionally, the method of treating a subject having or at risk of having cancer further comprises an adjunct anti-cancer treatment. The adjunct anti-cancer treatment can be radiation treatment of the subject or the affected area of ​​the subject's body.

[0097] TRAIL expression induced by a subject by administration of a pharmaceutical composition of the invention is detectable in a sample obtained from the subject (eg, a blood sample obtained from the subject).

[0098] Aspects of the invention include upregulation of the TRAIL gene by normal and tumor tissues, with serum levels of secreted TRAIL sustained for 3-4 days following a single dose of TIC10. Typically, the serum half-life of TRAIL protein is 20-30 minutes.

[0099] TIC10 has a calculated mass of 387.21 and crosses the blood-brain barrier.Administering TIC10 allows the induction of TRAIL in cells of the central nervous system, including illustratively glial cells and neurons of the brain and spinal cord.Furthermore, administering the pharmacologic acceptable derivative, salt, ester, amide, hydrate, solvate or prodrug of TIC10 across the blood-brain barrier allows the induction of TRAIL in cells of the central nervous system.

[0100] According to an embodiment of the present invention, there is provided a method of treating a subject having or at risk of having cancer of the central nervous system (CNS), the method comprising administering, by a route of administration other than direct administration to the CNS, a pharma- ceutical effective amount of:

[0101] [ka] , pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof; and a pharma- ceutically acceptable carrier.

[0102] According to an embodiment of the present invention, primary CNS cancers and CNS metastases of non-CNS cancers (also referred to herein as brain tumors) are treated. Primary CNS cancers treated according to an embodiment of the present invention include, but are not limited to, gliomas, meningiomas, pituitary adenomas and nerve sheath tumors. Glioblastoma multiforme is a primary CNS cancer treated according to an embodiment of the present invention. Oligodendroglioma is a primary CNS cancer treated according to an embodiment of the present invention.

[0103] Methods of the present invention encompass administration of a pharmaceutical composition of the present invention by routes of administration, including, but not limited to, oral, rectal, nasal, pulmonary, epidural, ocular, aural, intra-arterial, intracardiac, intraventricular, intradermal, intravenous, intramuscular, intraperitoneal, intraosseous, intrathecal, intravesical, subcutaneous, topical, transdermal and transmucosal (e.g., sublingual, buccal, vaginal and inhalation) routes of administration.

[0104] According to an aspect of the present invention, there is provided a method of treating a subject in need of treatment, the method comprising administering to a subject a pharma- ceutical effective amount of:

[0105] [ka] , and pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof.

[0106] The pharmaceutical compositions of the present invention may be in any dosage form suitable for administration to a subject, illustratively including solid, semi-solid and liquid dosage forms (e.g., tablets, capsules, powders, granules, suppositories, pills, solutions, suspensions, ointments, lotions, creams, gels, pastes, sprays and aerosols). Liposomes and emulsions are well-known types of pharmaceutical formulations that can be used to deliver pharmaceuticals, particularly hydrophobic pharmaceuticals. The pharmaceutical compositions of the present invention typically include a pharma-ceutically acceptable carrier (e.g., excipients, diluents and / or vehicles). Delayed release formulations and systems of the compositions (e.g., semipermeable matrices of solid hydrophobic polymers) may be used.

[0107] Pharmaceutical formulations of the compositions of the present invention may include a pharma- ceutically acceptable carrier. The term "pharma-ceutically acceptable carrier" refers to a carrier that is suitable for use in a subject without undue toxicity or irritation to the subject and is compatible with other ingredients included in the pharmaceutical composition.

[0108] Pharmaceutically acceptable carriers, pharmaceutical compositions and methods for preparing various dosage forms, as well as modes of administration, are well known in the art, as detailed, for example, in Pharmaceutical Dosage Forms: Tablets, eds. H. A. Lieberman et al., New York: Marcel Dekker, Inc., 1989; and L. V. Allen, Jr. et al., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, 8th Ed., Philadelphia, PA: Lippincott, Williams & Wilkins, 2004; A. R. Gennaro, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, 21st ed., 2005, especially chapter 89; and J. G. Hardman et al., Goodman & Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill Professional, 10th ed., 2001.

[0109] Pharmaceutical compositions according to aspects of the present invention are formulated for oral administration.

[0110] Solid dosage forms for administration or for suspension in liquid prior to administration include, illustratively, capsules, tablets, powders and granules. In such solid dosage forms, one or more active substances are mixed with at least one carrier (illustratively, a buffer (e.g., sodium citrate or alkali metal phosphates (illustratively, sodium phosphate, potassium phosphate and calcium phosphate)); a filler (e.g., starch, lactose, sucrose, glucose, mannitol and silicic acid); a binder (e.g., carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and acacia); a hygroscopic agent (e.g., glycerol); a disintegrant (e.g., agar, calcium carbonate, vegetable starch (e.g., potato or tapioca starch), They are mixed with, for example, alginic acid, certain complex silicates, and sodium carbonate; solution retarders (for example, paraffin); absorption enhancers (for example, quaternary ammonium compounds); wetting agents (for example, cetyl alcohol, glycerol monostearate and glycol); adsorbents (for example, kaolin and bentonite); lubricants (for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols or sodium lauryl sulfate); preservatives (for example, antibacterial and antifungal agents, including, for example, sorbic acid, gentamicin, and phenol); and stabilizers (for example, sucrose, EDTA, EGTA, and antioxidants).

[0111] The solid dosage form may optionally include a coating, such as an enteric coating. The enteric coating is typically a polymeric material. The preferred enteric coating material has the characteristics of being a biodegradable, gradually hydrolyzable and / or gradually water-soluble polymer. The amount of coating material applied to the solid dosage form generally affects the time interval between ingestion and drug release. A coating is applied with a thickness such that the entire coating does not dissolve in gastrointestinal fluids at a pH below 3 associated with gastric acid, but dissolves at a pH above 3 in the environment of the small intestine. It is expected that any anionic polymer that exhibits a pH-dependent solubility profile can be easily used as an enteric coating in the practice of the present invention to deliver active agents to the lower gastrointestinal tract. The selection of a particular enteric coating material depends on the properties (e.g., resistance to disintegration in the stomach; impermeability to gastric fluids and diffusion of active agents while in the stomach; ability to dissipate at the target intestinal site; physical and chemical stability during storage; non-toxicity; and ease of application).

[0112] Suitable enteric coating materials illustratively include cellulose polymers (e.g., hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose, methylcellulose, ethylcellulose, cellulose acetate, cellulose acetate phthalate, cellulose acetate trimellitate, hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose succinate, and sodium carboxymethylcellulose); acrylic acid polymers and copolymers, preferably those formed from acrylic acid, methacrylic acid, methyl acrylate, ammonium methyl acrylate, ethyl acrylate, methyl and / or ethyl methacrylate; vinyl polymers and copolymers (e.g., polyvinylpyrrolidone, polyvinyl acetate, polyvinyl acetate phthalate, vinyl acetate crotonic acid copolymer, and ethylene-vinyl acetate copolymer); shellac; and combinations thereof. Specific enteric coating materials include, for example, acrylic acid polymers and copolymers described in U.S. Pat. No. 6,136,345.

[0113] The enteric coating optionally contains a plasticizer to prevent the formation of pores and cracks that allow gastric juices to penetrate into the solid dosage form. Suitable plasticizers illustratively include triethyl citrate (Citroflex 2), triacetin (glyceryl triacetate), acetyl triethyl citrate (Citroflec A2), Carbowax 400 (polyethylene glycol 400), diethyl phthalate, tributyl citrate, acetylated monoglycerides, glycerol, fatty acid esters, propylene glycol, and dibutyl phthalate. In particular, coatings composed of anionic carboxyacrylic polymers typically contain approximately 10% to 25% by weight of plasticizer, in particular dibutyl phthalate, polyethylene glycol, triethyl citrate, and triacetin. The coating may also contain other coating excipients, such as detackifiers, antifoaming agents, lubricants (e.g., magnesium stearate) and stabilizers (e.g., hydroxypropyl cellulose, acids or bases) to solubilize or disperse the coating materials and to improve coating performance and the coated product.

[0114] The liquid dosage form for oral administration comprises one or more active substances and a pharma- ceutically acceptable carrier, which is formulated as an emulsion, solution, suspension, syrup or elixir.The liquid dosage form of the composition of the present invention may comprise a coloring agent, a stabilizing agent, a wetting agent, an emulsifying agent, a suspending agent, a sweetener, a flavoring agent or a perfuming agent.

[0115] For example, compositions for parenteral administration can be formulated as injectable liquid.Examples of suitable aqueous and non-aqueous carriers include water, ethanol, polyol (e.g., propylene glycol, polyethylene glycol, glycerol, etc.), suitable mixtures thereof; vegetable oils such as olive oil; and injectable organic esters such as ethyl oleate.Proper fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining a desired particle size in the case of dispersion, and / or by using a surfactant such as sodium lauryl sulfate.Stabilizers (e.g., sucrose, EDTA, EGTA, and antioxidants) are included as necessary.

[0116] For topical administration, the composition can be formulated as a "patch" formulation for administration to the skin for local effect and / or for transdermal delivery. Pharmaceutical formulations suitable for topical administration include, for example, ointments, lotions, creams, gels, pastes, sprays and powders. Ointments, lotions, creams, gels and pastes can contain, in addition to one or more active substances, a base (e.g., an absorbent base, a water-removable base, a water-soluble base or an oil-based base) and excipients (e.g., a thickening agent, a gelling agent, a coloring agent, a stabilizer, an emulsifier, a suspending agent, a sweetener, a flavoring agent or a fragrance).

[0117] Transdermal formulations may contain percutaneous absorption enhancers (e.g., acetone, azone, dimethylacetamide, dimethylformamide, dimethylsulfoxide, ethanol, oleic acid, polyethylene glycol, propylene glycol, and sodium lauryl sulfate). Ionotophoresis and / or sonophoresis can be used to enhance transdermal delivery.

[0118] Powders and sprays for topical administration of one or more active substances can contain excipients (e.g., talc, lactose and one or more silicic acids).Sprays can contain pharmaceutical propellants (e.g., fluorohydrocarbon propellants, carbon dioxide or suitable gases).Alternatively, sprays can be delivered from pump-type spray devices that do not require propellants.Spray devices deliver a metered amount of the composition contained therein, for example, using a valve to control the amount delivered.

[0119] Opthalmic formulations of one or more active agents may include ingredients such as preservatives, buffers and viscosity enhancing agents.

[0120] Suitable surfactants useful as pharma- ceutically acceptable carriers or excipients in the pharmaceutical compositions of the present invention include nonionic, cationic and / or anionic surfactants with good emulsifying, dispersing and / or wetting properties. Suitable anionic surfactants include both water-soluble soaps and water-soluble synthetic surfactants. Suitable soaps are the alkali metal or alkaline earth metal salts, unsubstituted or substituted ammonium salts of higher fatty acids (C10-C22), such as the sodium or potassium salts of oleic or stearic acid, or natural fatty acid mixtures available from coconut or tallow oil. Synthetic surfactants include sodium or calcium salts of polyacrylic acids; fatty sulfonates and sulfates; sulfonated benzimidazole derivatives and alkylaryl sulfonates. The fatty sulfonates and sulfates are usually in the form of alkali metal or alkaline earth metal salts, unsubstituted ammonium salts or ammonium salts substituted with alkyl or acyl radicals having 8 to 22 carbon atoms, for example the sodium or calcium salts of lignosulfonic acid or dodecylsulfonic acid, or mixtures of fatty alcohol sulfates obtained from natural fatty acids, alkali metal or alkaline earth metal salts of sulfate or sulfonate esters (for example sodium lauryl sulfate) and sulfonic acids of fatty alcohol / ethylene oxide adducts. Suitable sulfonated benzimidazole derivatives preferably contain 8 to 22 carbon atoms. Examples of alkylarylsulfonates are the sodium, calcium or alkanolamine salts of dodecylbenzenesulfonic acid or dibutyl-naphthalenesulfonic acid or naphthalene-sulfonic acid / formaldehyde condensates. Corresponding phosphates, for example salts of phosphoric acid esters, as well as adducts of p-nonylphenol with ethylene and / or propylene oxide or phospholipids, are also suitable.Suitable phospholipids for this purpose are natural (originating from animal or plant cells) or synthetic phospholipids of the cephalin or lecithin type (e.g. phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerine, lysolecithin, cardiolipin, dioctanylphosphatidylcholine, dipalmitoylphoshatidyl-choline and mixtures thereof).

[0121] Suitable non-ionic surfactants useful as pharma- ceutically acceptable carriers or excipients in the pharmaceutical compositions of the present invention include polyethoxylated and polypropoxylated derivatives of alkylphenols, fatty alcohols, fatty acids, aliphatic amines or amides containing at least 12 carbon atoms in the molecule, alkyl arenesulfonates and dialkyl sulfosuccinates, such as polyglycol ether derivatives of aliphatic and cycloaliphatic alcohols, saturated and unsaturated fatty acids and alkylphenols, said derivatives preferably containing 3-10 glycol ether groups and 8-20 carbon atoms in the (aliphatic) hydrocarbon moiety and 6-18 carbon atoms in the alkyl moiety of the alkylphenol. Further suitable non-ionic surfactants are water-soluble adducts of polyethylene oxide with polypropylene glycol, ethylenediaminopolypropylene glycol containing 1-10 carbon atoms in the alkyl chain, which adducts contain 20-250 ethylene glycol ether groups and / or 10-100 propylene glycol ether groups. Such compounds usually contain 1-5 ethylene glycol units per propylene glycol unit. Representative examples of nonionic surface-active substances are nonylphenol-polyethoxyethanol, castor oil polyglycol ethers, polypropylene / polyethylene oxide adducts, tributylphenoxypolyethoxyethanol, polyethylene glycol and octylphenoxypolyethoxyethanol. Fatty acid esters of polyethylene sorbitan (e.g. polyoxyethylene sorbitan trioleate), glycerol, sorbitan, sucrose and pentaerythritol are also suitable nonionic surface-active substances.

[0122] Suitable cationic surfactants useful as pharma- ceutically acceptable carriers or excipients in the pharmaceutical compositions of the invention include quaternary ammonium salts, preferably halides having four hydrocarbon radicals, optionally substituted with halo, phenyl, substituted phenyl or hydroxy; e.g., quaternary ammonium salts containing at least one C8-C22 alkyl radical as an N-substituent (e.g., cetyl, lauryl, palmityl, myristyl, oleyl, etc.) and unsubstituted or halogenated lower alkyl, benzyl and / or hydroxy-lower alkyl radicals as further substituents.

[0123] A more detailed description of suitable surfactants for this purpose may be found, for example, in "McCutcheon's Detergents and Emulsifiers Annual" (MC Publishing Crop., Ridgewood, New Jersey, 1981), "Tensid-Taschenbuch", 2nd ed. (Hanser Verlag, Vienna, 1981) and "Encyclopaedia of Surfactants" (Chemical Publishing Co., New York, 1981).

[0124] Structuring agents, thickening agents or gel-forming agents can be included in the pharmaceutical compositions and combination preparations of the present invention.Suitable such materials are, in particular, highly dispersed silicic acid (e.g., the product commercially available under the trade name Aerosil); bentonite; tetraalkylammonium salts of montmorillonite (e.g., the product commercially available under the trade name Bentone) (each of the alkyl groups can contain 1-20 carbon atoms); cetostearyl alcohol and processed castor oil products (e.g., the product commercially available under the trade name Antisettle).

[0125] In certain embodiments, pharma- ceutically acceptable carriers are particulate carriers (e.g., lipid particles, including liposomes, micelles, unilamellar or multilamellar vesicles; polymeric particles (e.g., hydrogel particles, polyglycolic acid particles, or polylactic acid particles); inorganic particles (e.g., calcium phosphate particles, such as those described in U.S. Pat. No. 5,648,097); and particulate inorganic / organic carriers (e.g., those described in U.S. Pat. No. 6,630,486).

[0126] The particulate pharma- ceutically acceptable carrier may be selected from among lipid particles, polymer particles, inorganic particles, and inorganic / organic particles. Mixtures of particle types may also be included as particulate pharma- ceutically acceptable carriers.

[0127] Particulate carriers are typically formulated so that the particles have an average particle size in the range of about 1 nm to 10 microns. In certain embodiments, particulate carriers are formulated so that the particles have an average particle size in the range of about 1 nm to 100 nm.

[0128] The dosage of the pharmaceutical composition of the present invention can vary based on factors such as, but not limited to, the route of administration; the age, health, sex and weight of the subject to which the composition is administered; the nature and extent of the subject's symptoms, if any, and the desired effect. The dosage can be adjusted depending on whether the treatment is brief or continuous. Those skilled in the art can determine the pharmacologic effective amount in light of these and other considerations specific to medical practice.

[0129] Typically, the daily dosage of the pharmaceutical composition of the present invention is contemplated to be in the range of about 0.001 to 100 milligrams per kilogram of subject body weight. The daily dose may be administered in two or more divided doses to obtain the desired effect. The pharmaceutical composition of the present invention may also be formulated for sustained release to obtain the desired effect.

[0130] Detailed information regarding customary ingredients, equipment and processes for preparing dosage forms can be found in Pharmaceutical Dosage Forms: Tablets, eds. H. A. Lieberman et al., New York: Marcel Dekker, Inc., 1989; and L. V. Allen, Jr. et al., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, 8th Ed., Philadelphia, PA: Lippincott, Williams & Wilkins, 2004; A. R. Gennaro, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, 21st ed,, 2005, especially chapter 89; and J. G. Hardman et al., Goodman & Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill Professional, 10th ed., 2001.

[0131] A commercial package according to an aspect of the invention comprises a pharmaceutical composition as described herein. According to an aspect of the invention, instructions for administering the pharmaceutical composition are included.

[0132] According to an aspect of the invention, a commercial package includes:

[0133] [ka] , pharma- ceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof; and a pharma- ceutically acceptable carrier.

[0134] One or more accessory components (eg, buffers or diluents) are optionally included in a commercial package of the invention.

[0135] Aspects of the compositions and methods of the present invention are illustrated in the following examples, which are provided for illustrative purposes and are not to be construed as limitations on the scope of the compositions and methods of the present invention. EXAMPLES

[0136] Reagents and cell-based assays HCT116 Bax was obtained from Bert Vogelstein (Johns Hopkins University, Baltimore, MA). - / - and HCT116 p53 - / - Cells and Akiva Mintz (Wake Forrest All cell lines were obtained from ATCC, except for the GBM cell line, which was obtained from the University of California, Winston-Salem, NC. Lentiviral infections were performed with MDA-MB-231 cells using TRAIL shRNA or vector, and with HCT116 using Foxo3a shRNA or vector purchased from Sigma-Aldrich (St. Louis, MO). H460 DR5ΔDD-EGFP cells were constructed by inserting amino acids 1-298 of the human DR5 gene into the pEGFP-N1 vector expressing the DR5(1-298) fusion protein using a cDNA encoding a DR5 fragment without the death domain. The fusion construct was transfected into H460 cells using Lipofectamine2000 (Invitrogen) and selected with G418. Positive clones were confirmed by florescence microscopy and Western blot analysis. Bioluminescence high-throughput screening using NCI Diversity Set II was performed on HCT116 Bax mice stably cotransfected to express a firefly luciferase construct under the transcriptional control of the first 504 base pairs of the TRAIL promoter upstream of the transcription start of the human TRAIL gene. - / -The screening was carried out in cells. Compounds were tested at working concentrations of 20nM, 200nM, 500nM and 1μM, and bioluminescent assessment of transcriptional activity was performed 12, 24, 36 and 48 hours after treatment. Details of the screening method are described in Wang et al., 2006, PNAS 103:11003-11008). TIC10 (NSC350625) was obtained from NCI DTP, reconstituted in DMSO at 20mM, aliquoted and stored at -20°C. A6730 and U0126 monoethanolate were obtained from Sigma. Purified recombinant TRAIL was produced as described in Kim et al., 2004, J. of Biol. Chem. 279:40044-40052. RIK-2 antibody (Santa-Cruz Biotechnology) was used at 1 μg / mL, and zVAD-fmk (Promega) was used at 20 μM.

[0137] Primary specimens from human patients All primary specimens from human patients for use in the examples described herein were received immediately after harvest, manually digested in complete DMEM, filtered through a 100 μm nylon mesh, and diluted to 2×10 in complete DMEM. 5 Cells / mL were plated.

[0138] mouse For subcutaneous xenografts, 1 × 10 cells were implanted into each dorsal flank of 4- to 6-week-old female athymic nu / nu mice (Charles River Laboratories). 6 (2.5 x 10 for T98G) 6 The indicated cell lines (100 x 100 cells) were inoculated as a 200 μL suspension in 1:1 Matrigel (BD):PBS. All intraperitoneal and intravenous injections were performed in a total volume of 200 μL. Oral formulations of TIC10 were administered using oral gavage and were administered as a 200 μL suspension containing 20% ​​Cremophor EL® (Sigma), 10% DMSO, and 70% PBS. Tumors were monitored using digital calipers at the indicated time points. All subcutaneous tumors were approximately 125 mm in size 1-4 weeks post-injection and prior to the start of treatment.3 The tumor burden reduction was monitored for 3 weeks after tumor disappearance and confirmed by visual inspection after euthanasia.

[0139] Intracecal transplantation was performed as described in Cespedes, MV et al., Am J Pathol, 2007, 170(3): p.1077-1085.

[0140] For intracranial xenografts, anesthetized athymic nude mice were inoculated with 2 × 10 cells as a suspension in 25 µL of serum- and antibiotic-free RPMI. 5 SF767 cells were implanted. The injection site was a burr hole made 1 mm lateral to the midline of the skull and 1 mm anterior to the coronal suture. The injectate was administered gradually over 5 minutes using a Hamilton syringe, and the burr hole was sealed using bone wax. Tumor engraftment was assessed by bioluminescence imaging 2 weeks after implantation. Bioluminescence imaging of tumors was performed on an IVIS imaging system as described in Wang et al., 2003, PNAS 100:15095-15100.

[0141] Near-infrared imaging of mice was performed on a Pearl Impulse imaging system (LI-COR) after tail vein injection of AngioSense® 680 (VisEn Medical, Woburn, MA) according to the manufacturer's protocol. Six-week-old Eμ-myc mice were obtained from The Jackson Laboratory (B6.Cg-Tg(IghMyc)22Bri / J).

[0142] For CBC / Differential and serum chemistry assays, 1 mL of blood was collected from anesthetized mice by terminal cardiac puncture of the left ventricle. For serum chemistry, 500 μL was placed into a microfuge tube and allowed to clot for 30 minutes at room temperature, then centrifuged. Serum was removed and centrifuged again to remove any additional clots, and serum was sent for analysis. For CBC / Differential, 500 μL of blood was collected into EDTA tubes and analyzed.

[0143] Statistical analysis. For pairwise comparisons, data were analyzed by two-tailed Student's t-test using Excel (Microsoft). Log-rank statistical analysis was performed using a web-based script interfaced with the statistical package R.

[0144] RT-qPCR Total RNA was extracted using RNeasy Minikit (Qiagen) by following the manufacturer's instructions. cDNA was generated using SuperScript II (Invitrogen) with 1 μg RNA and oligodT. Primers were TRAIL forward (CAGAGGAAGAAGCAACACATT, SEQ ID NO: 1), TRAIL reverse (GGTTGATGATTCCCAGGAGTTTATTTTG, SEQ ID NO: 2), GAPDH forward (CCACATCGCTCAGACACCAT, SEQ ID NO: 3), GAPDH reverse (GGCAACAATATCCACTTTACCAGAGT, SEQ ID NO: 4). PCR amplification was performed using an Applied Biosystems 7900HT Fast Real-time Detection System. Samples were normalized to 10 ng / μl, and then 20 ng of cDNA per sample was used as template for real-time PCR using SYBR Green Master Mix (Qiagen Corp, USA). Samples were normalized to GAPDH used under identical conditions. Quantification was performed using the 2ΔΔCt method crossing the threshold described in Livak et al., 2001, Methods. 2001 Dec;25(4):402-8, with GAPDH as an endogenous control for normalization. Reactions were performed in 384-well optical plates in a 7900HT instrument (Applied Biosystems) using a reaction volume of 10 μl. Data analysis used ABI PRISM 7900 Sequence Detection System 2.2 software. To exclude possible contamination with genomic DNA, control PCR reactions were also performed for each gene-specific primer set using control samples without cDNA template and without RT. Quadruplicates of each PCR reaction were performed and the resulting data were averaged.

[0145] Immunofluorescence The indicated cell lines were grown in log phase growth in 6-well plates in the absence or presence of the indicated working concentrations of TIC10 for 72 hours. Cells were fixed and permeabilized using Cytofix / Cytoperm solution (BD Biosciences, San Jose, CA) solution. Cells were incubated with anti-TRAIL (ab2435, Abcam, Cambridge, MA) at 1:100 or anti-active caspase-3 (559565, BD Pharmingen, San Diego, CA) at 1:250 in Perm / Wash solution (BD Biosciences) for 1 hour in the absence of light. Anti-rabbit Alexa Fluor 488 was incubated at 1:200 in Perm / Wash solution for 20 minutes at room temperature and rinsed with PBS. Hoechst33342 (Invitrogen) was used as a nuclear counterstain according to the manufacturer's protocol. Fluorescence imaging was performed on an Axiovert inverted microscope (Carl Zeiss MicroImaging) using an iVision imaging system (Biovision).

[0146] Flow cytometry and cell death assays For all flow cytometry analyses, floating and adherent cells were analyzed on a Coulter-Beckman Elite Epics hemocytometer. For surface TRAIL experiments, adherent cells were harvested by brief trypsinization, fixed in 4% paraformaldehyde in PBS for 20 min, incubated with anti-TRAIL antibody for 2 h (Abcam), washed, incubated with anti-rabbit Alexafluor488 (Invitrogen) for 30 min, and analyzed. Cells were gated on forward and side scatter to exclude debris and dead cells from the analysis. Surface TRAIL data are expressed as median fluorescence intensity relative to control samples unless otherwise indicated. For Sub-G1 and cell cycle profile experiments, all cells were pelleted and ethanol fixed before staining with propidium iodide (Sigma) in the presence of RNAse. Cell viability assays were performed in 96-well black-walled clear-bottom plates using CellTiter-Glo® (Promega) according to the manufacturer's protocol. Imaging and quantification of these assays were performed on an IVIS imaging system (Xenogen).

[0147] Colony formation assay The indicated cell lines were plated at 500 cells per well and treated with fresh complete medium the next day after attachment. After 3 days of treatment, the medium was replaced with drug-free medium and cells were allowed to grow for 10 days, receiving fresh medium once every 3 days. At the end of the 10-day period, cells were washed with PBS, fixed in methanol, stained with Coomassie blue, rinsed, and dried for quantification.

[0148] Tissue analysis. Mice were humanely sacrificed at the indicated time points, and excised normal tissues or tumors were fixed overnight at 4°C in 4% paraformaldehyde / PBS. When plasma samples were desired, 500 μL of blood was collected in EDTA-Vacutainer tubes (BD) by terminal cardiac puncture under anesthesia. Serum samples were collected in a similar manner, but in microcentrifuge tubes, and then incubated at room temperature for 30 minutes to clot. Serum was then removed after centrifugation for 5 minutes. Paraffin-embedded blocks, serial section slides, and hematoxylin and eosin staining were prepared according to standard procedures. TUNEL staining was performed using the ApopTag® Peroxidase In Situ Apoptosis Detection Kit (Millipore). For IHC analysis, slides were dewaxed in xylene and hydrated in decreasing grades of ethanol. Antigen retrieval was performed by boiling in 10 mM citric acid (pH 6.0) for 6 minutes. Samples were blocked with streptavidin and biotin blocking solution and goat serum (Vector Laboratories). Primary antibodies were incubated overnight at 4°C in a humidity chamber. Incubation with biotinylated secondary antibodies and deposition of DAB were performed according to the manufacturer's protocol (Vector Laboratories DAB Substrate Kit for Peroxidase). Samples were counterstained with hematoxylin (DAKO) for 6 min, rinsed in dH2O for 5 min, rinsed in PBS, dehydrated, and sealed with a coverslip. Images were recorded on an Axioskop microscope using QCapture software (QImaging).

[0149] co-culture HCT116 p53 - / -Co-culture of IL-17 and HFF cells was performed in a 1:1 mixture of complete DMEM and McCoy's 5A medium. For fluorescent images, the two types of cells were labeled separately using Fluorescent Cell Linkers Kits for gene cell membrane labeling (Sigma) according to the manufacturer's protocol. Cells were counterstained with Hoechst33342 as described in the immunofluorescence section. For flow cytometric analysis of cell death, the two populations of cells were differentiated by differences in light scattering and analyzed as described for sub-G1 analysis in the cell death assay section.

[0150] ELISA ELISA for TRAIL was performed using the Quantikine® TRAIL / TNFSF10 kit according to the manufacturer's protocol (DTRL00, R&D systems, Minneapolis, MN). Optical correction was performed using absorbance at 540 nm as suggested by the manufacturer. Absorbance was measured using a DTX880 plate reader (Beckman Coulter).

[0151] Pharmacokinetic analysis of TIC10 The absorbance profile of TIC10 was measured on a Gene Spec III spectrometer (Hitachi Solutions American, South San Francisco, CA). HPLC analysis was performed with absorbance detection at 239 nm on an Agilent 1200 series system (Agilent, Santa Clara, CA) using an Eclipse XDB-C18 column (Agilent) and a 100 μL injection loop. Isocratic elution at 1 mL / min was performed in .1% trifluoroacetic acid in dH2O. An acetonitrile (ACN) gradient was performed for elution as follows: 15-20% ACN from 0-5 min, 20-23% from 5-12 min, and 25% from 12-18 min. A calibration curve was generated by spiking certain concentrations of TIC10 into plasma collected from athymic nude mice from an unrelated experiment. For all plasma samples, blood was obtained by terminal cardiac puncture of the left ventricle and collected in EDTA tubes (BD). Samples were centrifuged at 500g for 10 min. Plasma was deproteinized by adding 30 μL of perchloric acid to 100 μL of sample, vortexed for 15 s, centrifuged for 2 min, and the supernatant was immediately injected into the HPLC. AUC was normalized to the internal serum peak with a retention time of 8.1 min. AUC data versus time was calculated using the formula AUC=Ae -αt +Be -βt The half-life was calculated using a two-compartment open model with first-order elimination from the central compartment using the t = time and A and B = the extrapolated concentrations at the beginning of the two phases (distribution and elimination). 1 / 2α = .693 / α and t 1 / 2β = .693 / β. Another formula used for the calculation is CL = Dose / AUC 0-∞ and V d =dose / (AUC 0-∞ ×β).

[0152] Gene expression analysis HCT116 p53 - / -Cells were grown in log phase and treated with DMSO or TIC10 (10 μM). After 48 hours, RNA was isolated using the RNeasy Mini Kit (Qiagen). Microarray analysis was performed using an Illumina HT-12 Beadchip (Illumina). RNA quality and concentration were assessed using an Agilent 2100 Bioanalyzer with an RNA Nano LabChip® (Agilent). TotalPrep was performed according to the manufacturer's instructions. TM cRNA was synthesized from 500 ng of RNA by Amplification (Ambion). First strand cDNA was generated using reverse transcription with T7 oligo(dT) as a primer. The cDNA was then subjected to second strand synthesis and RNA degradation with DNA polymerase and RNase H, followed by filtration purification. Biotinylated cRNA was generated in multiple copies using in vitro transcription (IVT). Labeled cRNA was purified using filtration, quantified by NanoDrop, and the volume was adjusted to a total of 750 ng / sample. Samples were fragmented, denatured, and then hybridized at 58°C for 18 hours. After hybridization, the bead chips were washed and fluorescently labeled. The bead chips were scanned using a BeadArray Reader (Illumina). The resulting scan data was imported into GenomeStudio1.0 (Illumina) to create a project. The results were exported to GeneSpring Gxll (Agilent Technologies). Measurements below 0.01 were then set to 0.01, arrays were normalized to the 50th percentile, and individual genes were normalized to the median value of controls. For network analysis of transcriptional changes induced by TIC10, the dataset was analyzed using Ingenuity Pathway Analysis software (Ingenuity Systems).

[0153] Western blot analysis Western blot analysis was performed as described in Wang, W. et al., PNAS 103, 11003-11008, 2006 using NuPAGE4-12% Bis-Tris and visualized using a Supersignal West Femto (Thermo Scientific) and X-ray film. Nuclear and cytoplasmic extracts were prepared using cytoplasmic lysis buffer (10 mM HEPES, 10 mM KCl and 2 mM MgCl2, 1 mM DTT) followed by nuclear lysis buffer (20 mM HEPES, 420 mM NaCl, 1.5 mM MgCl2, 250 μM EDTA, 25% glycerol). For all lysis buffers, fresh protease inhibitors (Roche) and 1 mM sodium orthovanadate were added immediately before use.

[0154] Chromatin immunoprecipitation assay Chromatin immunoprecipitation (ChiP) assays were performed as described for the TRAIL promoter in Nebbioso, A. et al., Nat Med, 11(1), 77-84, 2005, using a ChIP-grade antibody against Foxo3a (Abcam) or an equal concentration of rabbit IgG (SouthernBiotech) as a nonspecific control.

[0155] TIC10 induces p53-independent transcriptional induction of the TRAIL gene A cell-based bioluminescence reporter screen performed in TRAIL-resistant Bax-null HCT116 human colon cancer cells using the TRAIL gene promoter yielded the small molecule TIC10 as a TRAIL-inducing compound.

[0156] TIC10 induced TRAIL promoter-dependent transcriptional activity of a luciferase reporter construct under the regulatory control of the first 504 base pairs of the TRAIL promoter, which excludes the p53 DNA binding response element identified in Takimoto et al., 2000, Oncogene 19, 1735-1743. Figure 1 shows the expression of HCT116 Bax under the transcriptional control of the first 504 base pairs of the human TRAIL gene promoter upstream of the transcription start.- / - Graph showing luciferase reporter activity in cells (n=3). Error bars indicate the sd of replicate experiments. Between the indicated conditions and controls. * P<0.05.

[0157] TIC10 caused a dose-dependent increase in TRAIL messenger RNA. - / - FIG. 2 is a graph showing RT-qPCR analysis of TRAIL mRNA levels in cells (48 h, n=4). Error bars indicate sd of replicates. TIC10 caused a dose-dependent increase in TRAIL protein localized at the cell surface of several cancer cell lines in a p53-independent manner. FIG. 3 is a graph showing surface TRAIL levels induced by TIC10 in a panel of cancer cells (10 μM, 72 h, n=3). Error bars indicate sd of replicates. Between the indicated conditions and controls * P<0.05.

[0158] TIC10 exposure results in a significant and sustained presence of TRAIL on the cell surface of cancer cells. Time course analysis found that TRAIL localized to the cell surface as a delayed event, but this induction could persist over time even after TIC10 was removed from the culture medium. Figure 4 shows the upregulation of HCT116 p53 following TIC10 treatment under the indicated conditions and time points. - / - Graph showing surface TRAIL levels in cells (n=3). Error bars indicate sd of replicate experiments. Between the indicated conditions and controls. * P<0.05. Figure 5 shows the HCT116 p53 expression by flow cytometry 72 hours after the start of TIC10 treatment. - / - Graph showing TRAIL surface levels (5 μM, n=3). Cells were treated for the indicated times of preincubation and then changed to drug-free medium for the remainder of the time until analysis 72 h later. Error bars indicate sd of replicates. Between the indicated conditions and controls.* P<0.05.

[0159] TIC10 induces TRAIL-mediated apoptosis At equivalent doses, TIC10 inhibited the TRAIL-sensitive HCT116 p53 - / - TIC10-treated HCT116 p53 cells were treated with TIC10 and induced sub-G1 DNA content, suggesting cell death. - / - and cell cycle profiles of HFF cells (5 μM, 72 h, n = 3).

[0160] TIC10 reduced the clonogenic survival of cancer cell lines while sparing normal fibroblasts. Figure 7 is a graph showing quantification of colony formation assays of cancer cells treated with TIC10 (10 μM, 72 h, n=3). Error bars indicate standard deviation (sd) of replicates. Figure 8 is a graph showing a similar experiment as in Figure 7 except that HFF cells were counted at the end time point (n=3). Error bars indicate standard deviation (sd) of replicates.

[0161] TIC10 induced sub-G1 content in a p53-independent and Bax-dependent manner. Figure 9 shows the effect of DMSO, TIC10 (1, 5 or 10 μM) or rhTRAIL (25 ng / mL) treatment on HCT116 WT, p53 - / - and Bax - / - Graph showing sub-G1 analysis of cells (n=3). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise indicated, there is no significant difference between the indicated conditions and controls. * P<0.05.

[0162] Consistent with apoptotic cell death, HCT116 p53 treated with 5 μM TIC10 for 72 h - / - by immunofluorescence assay in cells and HCT116 p53 treated with 1 μM, 2.5 μM, 5 μM or 10 μM TIC10 for 72 h- / - TIC10 increased the levels of active caspase-3 as shown by Western blot analysis in cells. Figure 10 is an image showing the results of Western blot analysis. The sub-G1 content induced by TIC10 was significantly inhibited by co-incubation with the pan-caspase apoptosis inhibitor zVAD-fmk. Figure 11 is a graph showing the sub-G1 analysis of TIC10-treated cancer cells pre-incubated with or without zVAD-fmk (10 μM, 72 h, n=3). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise indicated, there is no significant difference between the indicated conditions and the control. * P<0.05.

[0163] TIC10-induced apoptosis appears to be specifically mediated by TRAIL, as shown by the inhibition of TIC10-induced cytotoxicity after stable knockdown of TRAIL with shRNA. Figure 12 is a graph showing sub-G1 analysis of MDA-MB-231 cells in which TRAIL was stably knocked down with short hairpin RNA (72 hours, n=3). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise indicated, there is a significant difference between the indicated conditions and controls. * P<0.05. FIG. 13 is a graph showing demonstration of MDA-MB-231 shTRAIL knockdown by flow cytometry analysis of TIC10-treated cells (5 μM, 72 h, n=3). Error bars indicate sd of replicate experiments. Values ​​are between the indicated conditions and controls unless otherwise indicated. * P<0.05.

[0164] Further evidence for the requirement of TRAIL in TIC10-induced tumor cell death was observed after disruption of the DR5 death domain, which regulates proapoptotic TRAIL signaling. Figure 14 is a graph showing sub-G1 analysis of TIC10-induced cell death in H460 cells with overexpression of endogenous DR5 or a DR5 construct in which its death domain was replaced with EGFP (10 μM, 72 h, n=3). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise indicated, there is a significant difference between the indicated conditions and controls. * P<0.05.

[0165] Experimental sequestration of TRAIL by using a blocking antibody demonstrated that TRAIL is required for TIC10-induced tumor cell death. Figure 15 is a graph showing sub-G1 analysis of HCT116 cells treated with DMSO, TIC10 (10 μM) or rhTRAIL (25 ng / mL) in the presence or absence of TRAIL sequestration antibody RIK-2 (72 h, n=3). Error bars indicate sd of replicate experiments. Values ​​between indicated conditions and controls unless otherwise indicated. * P<0.05.

[0166] The activity of TIC10 in freshly excised colon tumor cells from human patients was examined and found to induce TRAIL and potent cytotoxicity distinct from 5-FU. FIG. 16 is a graph showing surface TRAIL induced by TIC10 (10 μM, 72 hours) using freshly excised colon cancer cells. The tissue was a mucinous adenocarcinoma excised from an 85-year-old female patient. Data are presented as median fluorescence intensity. FIG. 17 is a graph showing the results of a cell viability assay of primary colon cancer cells from FIG. 16 treated with DMSO, TIC10 (.6, 1.25, 2.5, 5, 10, 20 μM) or 5-FU (5 μM) (n=3). Error bars indicate sd of replicate experiments.

[0167] The cytotoxic activity of TIC10 is thermostable, unlike TRAIL. Figure 18 is a graph showing that TIC10 (5 μM) or rhTRAIL (25 ng / mL) can reduce cell viability in HCT116 cells after 1 h preincubation at the indicated temperatures (72 h, n=3). Error bars indicate standard deviation (sd) of replicate experiments.

[0168] TIC10 is a potent TRAIL-mediated antitumor agent in vivo TIC10 inhibited HCT116 p53 to an extent comparable to that observed with TRAIL, when both were administered as multiple doses. - / - Figure 19 shows HCT116 p53 xenografts treated with three doses of TIC10 (ip), TRAIL (iv) or vehicle (ip) administered on days 0, 3 and 6 as indicated by the grey vertical bars. - / - Graphs showing xenografts (n=10). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise indicated, there is no significant difference between the indicated conditions and controls. * P < 0.05 and ** P<.005.

[0169] Single-dose experiments in mice bearing HCT116 WT and RKO human colon cancer xenografts confirmed the potent antitumor activity of TIC10 and clearly demonstrated the superiority of TRAIL in RKO xenografts under the given conditions. Figure 20 shows the effect of luciferase-infected HCT116 p53 mice receiving a single ip injection of TIC10 or vehicle. - / - Graph showing the results of bioluminescence imaging of xenografts (n=6). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise indicated, there is no significant difference between the indicated conditions and controls. * P < 0.05 and ** P<.005.

[0170] Figure 21 is a graph showing RKO xenografts with a single dose of TIC10 (ip), TRAIL (iv) or vehicle (ip, n=10). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise indicated, there is no significant difference between the indicated conditions and controls. * P < 0.05 and ** P<.005.

[0171] TIC10 induced regression of MDA-MB-231 human breast cancer xenografts, an effect that was significantly inhibited by stable knockdown of TRAIL, whereas tumors treated with TRAIL progressed. Figure 22 shows box plots of tumor volumes 9 days after initiation of treatment with a single dose of TIC10 (ip), TRAIL (iv) or vehicle (DMSO, ip) in MDA-MB-231 vector or shTRAIL xenografts (n=8). Error bars indicate standard deviation (sd) of replicate experiments. Values ​​are between the indicated conditions and controls unless otherwise indicated. * P < 0.05 and ** P < .005. TUNEL staining of tumors from MDA-MB-231 vector and shTRAIL xenografts 2 days after treatment with 50 mg / kg or 100 mg / kg TIC10 shows increased TUNEL staining in vector-treated but not shTRAIL-treated cells.

[0172] This directly demonstrates that the antitumor activity of TIC10 is superior to that of TRAIL when administered as a single dose under these conditions and is at least partially regulated by TRAIL produced by tumor cells. In DLD-1 xenografts, TIC10 induced tumor stagnation after one week of treatment, whereas tumors treated with TRAIL progressed after a single dose. Figure 23 is a graph showing the relative tumor volumes of DLD-1 xenografts treated with TRAIL (iv), TIC10 (ip) or DMSO (ip) as a single dose at the indicated concentrations on day 0 (n=8).

[0173] TIC10 as a single dose delivered intraperitoneally or orally also induced sustained regression of SW480 xenografts, suggesting favorable bioavailability. Figure 24 is a graph showing a comparison of a single dose of ip and oral administration of TIC10 at 30 mg / kg administered on day 0 in SW480 xenografts (n=6).

[0174] Dosing of a single dose of TIC10 administered orally in the HCT116 xenograft model revealed sustained antitumor efficacy at 25 mg / kg. Figure 25 is a graph showing TIC10 or vehicle administered as a single dose orally in HCT116 xenografts (n=6). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise indicated, there is a significant difference between the indicated conditions and controls. * P < 0.05 and ** P<.005.

[0175] The lack of adverse effects on body weight or liver histology, as well as the lack of apparent toxicity in multiple doses delivered at doses 4-fold higher than this therapeutic dose in previous xenografts, suggests that TIC10 has a wide therapeutic window. Figure 26 is a graph showing the body weight of athymic female nude mice treated with a single dose of TIC10 (100 mg / kg, ip). Figure 27 is a graph showing the body weight of C57 / B6 female mice at the end of the fourth week of treatment with oral TIC10 (25 mg / kg) once a week for four weeks. Histological analysis by H&E staining of livers from athymic female nude mice harvested 3 days after treatment with TIC10 (100 mg / kg, ip) showed no apparent toxicity of TIC10.

[0176] Chronic exposure of immunocompetent mice to oral TIC10 at 25 mg / kg weekly for 4 weeks did not result in any changes in the panel of serum chemistry markers, as shown in Tables IA and IB.

[0177] Tables IA and IB show the serum chemistry of C57 / B6 mice treated weekly with vehicle or TIC10 (25 mg / kg) for 4 weeks.

[0178] [Table 1] To test the efficacy of TIC10 in an immunocompetent preclinical cancer model, we used εμ-Myc transgenic mice that spontaneously develop lymphoma. We used the same oral dosing schedule as above, which proved safe at 9-12 weeks of age. TIC10 significantly extended the survival of these mice by 4 weeks. Figure 28 is a graph showing the overall survival of εμ-myc treated with oral TIC10 (25 mg / kg) weekly during weeks 9-12. P values ​​were determined by log-rank test. For plots of relative tumor volume, tumor size is expressed relative to tumor size at day 0, defined as the day treatment began. Histological analysis by H&E staining of axillary lymph nodes of εμ-myc and WT C57 / B6 mice at 14 weeks of age showed no obvious toxicity of TIC10.

[0179] Synergistic combination of TIC10 with chemotherapeutic agents Surprisingly, in vitro synergy between TIC10 and the taxanes paclitaxel and docetaxel (trade name Taxotere) is observed. FIG. 29 is a graph showing cell viability of DLD-1 cells treated with TIC10 together with paclitaxel under the indicated conditions (72 hours, n=3). Error bars indicate sd of replicates. FIG. 30 is a graph showing cell viability of SW620 cells treated with TIC10 together with paclitaxel under the indicated conditions (72 hours, n=3). Error bars indicate sd of replicates. FIG. 31 is a graph showing cell viability of DLD-1 cells treated with TIC10 together with Taxotere under the indicated conditions (72 hours, n=3). Error bars indicate sd of replicates. Figure 32 is a graph showing cell viability of SW620 cells treated with TIC10 with Taxotere under the indicated conditions (72 hours, n=3). Error bars indicate the sd of replicate experiments.

[0180] The combination of TIC10 with either the taxane paclitaxel or docetaxel synergized to produce durable cures in H460 non-small cell lung cancer xenografts. Figure 33 shows the percentage of cohorts that retain tumor tissue after treatment with TIC10 (30 mg / kg, ip) or taxotere (20 mg / kg, iv) alone, in combination, or with vehicle (DMSO, ip) as a single dose in H460 xenografts (n=8). Figure 34 shows a plot of relative tumor volume for Figure 33. Error bars show the sd of replicate experiments.

[0181] Figure 35 is a graph showing the percentage of cohorts retaining tumor tissue after treatment with TIC10 (30 mg / kg, ip) or paclitaxel (20 mg / kg, iv) alone, in combination, or with vehicle (DMSO, ip) as a single dose in H460 xenografts (n=8). Figure 36 is a graph showing plots of relative tumor volume for Figure 35. Error bars indicate sd of replicate experiments.

[0182] In this example, when both TIC10 and bevacizumab were given once a week in a metastatic orthotopic mouse model of p53-deficient colorectal cancer, TIC10 was found to synergize with bevacizumab to reduce the incidence of primary cecal tumors and distant metastatic sites, including lung, liver, lymph nodes, and peritoneum. - / - Graph showing the percentage of cohorts implanted with tumors that had palpable tumors at primary and distant sites at the end point (n=5). As indicated by the timeline, treatment was administered once a week starting 2 weeks after implantation, and cohorts received vehicle, TIC10 (25 mg / kg, orally), bevacizumab (bev, 10 mg / kg, iv) or a combination of TIC10 and bevacizumab.

[0183] TIC10 alone and in combination with bevacizumab was well tolerated using this multiple dose regimen and did not significantly alter body weight at the end point. Figure 38 is a graph showing the body weight of mice at the end point. Error bars indicate the sd of replicates.

[0184] TIC10 induces tumor-specific cell death through direct and bystander effects mediated by TRAIL HCT116 p53 after a single dose of TIC10 (100 mg / kg, ip) on day 0 - / -Immunohistochemical (IHC) analysis of xenograft tumors revealed elevated protein levels of TRAIL and cleaved caspase-8, an initiator caspase involved in TRAIL-mediated apoptosis.

[0185] Fragmented nuclei observed by histological examination and increased TUNEL (TdT-mediated dUTP nick end labeling) staining further confirmed that TIC10 induced apoptosis in treated tumors. Furthermore, HCT116 p53 - / - TIC10 induced TRAIL not only in the tumor but also in the stromal fibroblasts bordering the tumor, as shown by H&E and IHC analysis for TRAIL at the border between tumor and stromal fibroblasts in xenograft tumors.

[0186] Focusing on TIC10-induced TRAIL expression in fibroblasts, soluble TRAIL was assayed in tumor-free mice treated with TIC10 to determine whether normal cells secrete TRAIL in response to TIC10. TIC10 rapidly increases serum levels of TRAIL in a manner that lasts for over 72 hours, longer than the serum half-life of recombinant TRAIL (approximately 30 minutes). Figure 39 is a graph showing TRAIL serum levels in tumor-free mice after TIC10 (100 mg / kg, iv) or doxorubicin (30 mg / kg, ip) (n=2). Error bars indicate the sd of repeated experiments.

[0187] Serum TRAIL induced by TIC10 was detected as early as 2 hours after administration, which is more rapid than the kinetics observed in vitro in the examples described herein. Pharmacokinetic analysis revealed that TIC10 was rapidly distributed and had a plasma half-life of approximately 6.5 hours. Table II shows the results of the pharmacokinetic analysis of TIC10 in the plasma of C57B6 mice. Figure 40 is a graph showing the absorbance profile of TIC10 with a peak absorbance at 239 nm. Figure 41 is a graph showing the calibration curve for TIC10 added to mouse plasma and quantified using area under the curve (AUC) by HPLC analysis. Figure 42 is a graph showing the plasma concentration of TIC10 after intravenous administration at 25 mg / kg to C57 / B6 female mice (n=3). Error bars indicate the standard error of the mean of replicate experiments.

[0188] [Table 2] TIC10 has a longer half-life than recombinant TRAIL and the effect of TIC10, ie, induction of TRAIL, is sustained over several days in vivo as seen in vitro.

[0189] IHC analysis of normal tissues from non-tumor-bearing athymic nude mice following administration of TIC10 (100 mg / kg, iv) on day 0 revealed that TRAIL was upregulated at the protein level in mouse brain, kidney, and spleen without apparent toxicity as determined by histological examination and TUNEL staining. Upregulation of TRAIL in response to TIC10 was not prominent in other tissues, including liver, at any time point.

[0190] The effect of TIC10 on normal fibroblasts and its selectivity over normal cells was examined in this example. TIC10 selectively induced apoptosis in p53-deficient tumor cells, whereas HCT116 p53- / - and did not induce apoptosis in normal fibroblasts in co-culture experiments with HFF cells.

[0191] TIC10 induces significant but moderate amounts of TRAIL on the surface of normal fibroblasts. Figure 43 is a graph showing the analysis of surface TRAIL of HFF cells after TIC10 treatment (0, 2.5, 5 or 10 μM from left to right) (72 hours, n=3). Error bars indicate sd of replicate experiments. Unless otherwise indicated, there is a significant difference between the indicated conditions and controls. * P<0.05.

[0192] To test whether normal cells contribute to the antitumor efficacy of TIC10 through a TRAIL-mediated bystander effect, normal fibroblasts preincubated with TIC10 were transplanted into co-cultures with p53-deficient colon cancer cells. This resulted in a modest but significant increase in TRAIL-specific cell death of a subpopulation of cancer cells. Figure 44 shows that HCT116 p53 - / - Graph showing sub-G1 analysis of co-cultures of cells with pretreated HFFs (24 h, n=3). Pretreatment of HFFs consisted of incubation with TIC10 (10 μM) or DMSO for 72 h. These experiments were performed in the presence or absence of a TRAIL-sequestering antibody (RIK-2). Scale bar is 100 μm. Error bars indicate sd of replicate experiments. Differences between the indicated conditions and controls unless otherwise indicated. * P<0.05.

[0193] Thus, as demonstrated herein, TIC10 has a favorable therapeutic index and induces TRAIL in tumor, stromal and normal cells, which may contribute to the antitumor efficacy of TIC10 via direct as well as bystander mechanisms.

[0194] TIC10 is an effective antitumor agent in glioblastoma multiforme (GBM) TIC10 induces TRAIL in the brain and is useful as an antitumor agent for brain tumors. In this example, the activity of TIC10 in GBM cell lines was tested and found to induce TRAIL and have a p53-independent GI50 in the low micromolar range similar to other cancer cell lines. Figure 45 is a graph showing surface TRAIL in GBM cell lines after incubation with TIC10 (5 μM, 72 hours, n=3). The results show that the TRAIL-induced ... * *P<0.05. Figure 46 is a graph showing extrapolated GI50 values ​​from cell viability assays of the indicated GBM cell lines after 72 hours of treatment with TIC10 or DMSO (n=3).

[0195] TIC10 has cytotoxic effect on freshly isolated GBM cells that are resistant to temozolomide and have been previously irradiated in this example. Figure 47 shows the results of cell viability assay of freshly excised glioblastoma tissue treated with DMSO, TIC10 or temozolomide (TMZ, 10 μM) (72 hours, n=3). The tissue was a grade IV glioblastoma containing oligodendroglioma cell components taken from a 38-year-old female patient who had previously undergone cytoreductive surgery and radiation.

[0196] TIC10 was tested in preclinical models of GBM as a monoagent and in combination with bevacizumab. TIC10 exerted p53-independent cytotoxicity against a panel of GBM cell lines (including temozolomide-resistant GBM cell lines such as T98G) and induced sustained regression of subcutaneous T98G xenografts to a similar extent as bevacizumab when given as a single oral dose. Figure 48 is a graph showing subcutaneous xenografts of T98G in mice receiving a single dose of vehicle, TIC10 (30 mg / kg, PO) or bevacizumab (10 mg / kg, iv) on day 0 (n=8). The difference between the indicated conditions and control was 10%. * P<0.05.

[0197] A single dose of TIC10, as a single agent in invasive intracranial xenografts of human GBM using the SF767 cell line, significantly doubled overall survival in mice and, in cooperation with bevacizumab, tripled survival in mice bearing such brain tumors.

[0198] FIG. 49 is a graph showing overall survival of mice bearing SF767 intracranial tumors treated with a single oral dose of vehicle (n=8), TIC10 (25 mg / kg, n=7), bevacizumab (10 mg / kg, iv, n=6) or TIC10 and bevacizumab (n=7) two weeks after implantation.

[0199] Table III shows the change in overall survival for the cohort of mice bearing SF767 intracranial tumors.

[0200] [Table 3] TIC10-induced TRAIL upregulation is Foxo3a dependent To identify the molecular events supporting TIC10-induced TRAIL upregulation, we analyzed TIC10-treated HCT116 p53 - / - Gene expression profiles in cells were measured. Changes in transcription of target genes of the FOXO family of transcription factors (including Foxo3a, previously shown to regulate the TRAIL gene promoter at binding sites contained within regions selected as described in Modur, V. et al., 2002, J. Biol. Chem. 277:47928-47937) were observed. Figure 50 shows the change in transcription of HCT116 p53 after 48 hours of TIC10 treatment (10 μM) compared to DMSO. - / - Figure 1 shows transcriptional changes associated with FOXO signaling from gene expression profiling of cells (n=3). All of these changes were P<.05 between DMSO and TIC10 treatment groups. Error bars indicate sd of replicates. Values ​​are between indicated conditions and controls unless otherwise indicated. * P<0.05.

[0201] The FOXO target gene DR5 was upregulated by TIC10 in several cancer cell lines and to a lesser extent in normal cells, which was also observed in tumors treated with TIC10. Figure 51 is an image of a Western blot analysis of DR5 in HCT116 cells treated with the indicated concentrations of TIC10 or DMSO for 72 hours. Ran is shown as a loading control. Figure 52 is a graph showing flow cytometry analysis of surface DR5 levels in cancer and normal cells treated with TIC10 (72 hours, n=3). Error bars indicate the sd of replicate experiments. Unless otherwise indicated, there is a significant difference between the indicated conditions and controls. * P<0.05.

[0202] IHC analysis of DR5 in HCT116 xenograft tumors treated with vehicle (ip) or TIC10 (100 mg / kg, ip) shows that high expression of DR5 was evident in xenograft tumors treated with TIC10, consistent with the in vitro observations.

[0203] The FOXO family member Foxo3a (but not Foxo1a) underwent nuclear translocation in response to TIC10, as measured by immunofluorescence and Western blot analysis of Foxo3a in HCT116 cells and by immunofluorescence analysis of Foxo3a in H460 and SW480 cells treated with DMSO or TIC10, 10 μM, for 48 h.

[0204] Figure 53 is an image of a Western blot analysis of whole cell lysates (W) and cytoplasmic (C) and nuclear (N) extracts of HCT116 cells treated with DMSO or TIC10 (48 hours, 10 μM). β-actin and lamin B1 are shown as cytoplasmic and nuclear loading controls, respectively.

[0205] A TIC10 dose-dependent increase in the amount of Foxo3a localized to the TRAIL promoter as shown by chromatin immunoprecipitation assay was found. p53 - / - 13 is an image of the results of a chromatin immunoprecipitation assay for TIC10-induced translocation of Foxo3a to the TRAIL promoter 48 hours after TIC10 treatment (0, 2.5, 5 or 10 μM from left to right) in cells.

[0206] Transient knockdown of Foxo3a and Foxo1 revealed that Foxo3a specifically mediated TIC10-induced TRAIL upregulation. Figure 55 shows the knockdown of HCT116 p53 using siRNA. - / - Graph showing the results of flow cytometry analysis of cell surface TRAIL levels induced by TIC10 (10 μM) with or without transient knockdown of Foxo1 and / or Foxo3a in cells (72 h, n=3). Knockdown is confirmed by Western blot analysis. Error bars indicate sd of replicate experiments. Differences between indicated conditions and controls unless otherwise indicated. * P<0.05.

[0207] Stable knockdown of Foxo3a significantly inhibited the upregulation of TIC10-induced TRAIL production and subsequent tumor cell death. Figure 56 is a graph showing sub-G1 analysis of TIC10-induced cell death with or without stable knockdown of Foxo3a in HCT116 cells (10 μM, 72 hours, n=3). Error bars indicate sd of replicate experiments. Unless otherwise indicated, between the indicated conditions and controls. *P<0.05. Figure 57 is a graph showing flow cytometry analysis of surface TRAIL induced by TIC10 with or without stable knockdown of Foxo3a in HCT116 cells (10 μM, 72 h, n=3). Error bars indicate sd of replicate experiments. Values ​​are between the indicated conditions and controls unless otherwise indicated. * P<0.05. The results of stable knockdown of Foxo3a were confirmed by Western blot analysis.

[0208] Stable knockdown of Foxo3a in tumor cells also significantly inhibited the antitumor activity of TIC10 and the TIC10-induced TRAIL-mediated apoptosis signature in tumors in vivo. Figure 58 is a graph showing tumor volume of HCT116 xenografts with or without stable knockdown of Foxo3a after a single oral dose of vehicle or TIC10 (25 mg / kg) on ​​day 0 (n=10). Error bars indicate sd of replicate experiments. Values ​​are between the indicated conditions and controls unless otherwise indicated. * P<0.05.

[0209] IHC analysis and TUNEL staining of HCT116 tumors with or without stable knockdown of Foxo3a were performed 3 days after a single dose of TIC10 (25 mg / kg, orally), and showed that stable knockdown of Foxo3a in tumor cells significantly inhibited the antitumor activity of TIC10 and also the characteristics of TRAIL-mediated apoptosis induced by TIC10 in tumors in vivo.

[0210] Dual inactivation of Akt and ERK by TIC10 cooperatively induces TRAIL TIC10-induced changes in regulators of Foxo3a (e.g., IKK, Akt, and ERK) were measured. Figure 59 shows the results of a 72-hour treatment with TIC10 (2.5, 5, 10 μM) of HCT116 p53 - / - 1 shows an image of a Western blot analysis of cells.

[0211] Both pAkt and pERK levels were found to be abolished in a dose-dependent manner by TIC10 treatment concomitant with dephosphorylation of their respective phosphorylation sites on Foxo3a. Time course analysis revealed that TIC10-induced inactivation of Akt and ERK occurred after 48 hours, a kinetic that was in concert with Foxo3a dephosphorylation and TRAIL upregulation. Figure 60 shows the upregulation of p53 in HCT116 cells treated with TIC10 (10 μM) for the indicated times. - / - Figure 61 is an image of a Western blot analysis of cells. Figure 61 is a graph showing the time course of protein expression levels of TIC10-induced effects measured by densitometry of Western blots of replicate experiments as in Figure 60 (n=3). Data are presented relative to control samples for each time point and normalized to Ran. TRAIL was quantified by flow cytometry in parallel experiments (n=3).

[0212] These TIC10-induced effects on Foxo3a were evident in several cancer cell lines of various tumor types, including human cancer cell lines with diverse genetic backgrounds containing oncogenic alterations in p53, KRAS, PTEN, etc. Figure 62 shows a Western blot analysis of TIC10-induced effects on Foxo3a in DLD1 human colon cancer cells, MDA-MB-468 human breast cancer cells, and T98G human glioblastoma multiforme cell line (10 μM, 72 hours).

[0213] Akt was found to be a determinant of cytotoxic sensitivity to TIC10 and its TRAIL upregulation, and Akt hyperactivation can suppress even basal levels of TRAIL, as shown by immunofluorescence analysis of Foxo3a in HCT116 cells overexpressing empty vector or myristylated Akt (myr-Akt) with TIC10 treatment (10 μM, 48 hours). Confirmation of myr-Akt overexpression by Western blot analysis is shown in Figure 63. Figure 64 is a graph showing flow cytometric analysis of surface TRAIL in HCT116 cells overexpressing empty vector or myristylated Akt (myr-Akt) with TIC10 treatment (10 μM, 48 hours). FIG. 65 is a graph showing the sub-G1 content of HCT116 cells overexpressing empty vector or myr-Akt subjected to TIC10 treatment (10 μM, 72 hr, n=3).

[0214] The dual inhibition of Akt and MAPK pathways cooperatively leads to the nuclear translocation of Foxo3a and the subsequent upregulation of TRAIL. A6730 and U0126 monoethanolate are commercially available and previously reported inhibitors of Akt1 / 2 (Desplat, V. et al., 2008, J. Enz. Inhib. Med. Chem., 23:648-658) and MEK (Favata, MF et al., 1998, J. Biol. Chem., 273:18623-18632), which were used in this example to determine whether the dual inhibition of Akt and MAPK pathways cooperatively leads to the nuclear translocation of Foxo3a and the subsequent upregulation of TRAIL. The combination of MEK inhibitor and Akt inhibitor was found to cooperatively induce Foxo3a-dependent TRAIL upregulation and synergistically induce TRAIL-mediated cell death. FIG. 66 shows HCT116 p53 expression after incubation with 10 μM A6730 (Akt inhibitor), U0126 monoethanolate (MEK inhibitor), or both. - / -Graph showing RT-qPCR analysis of TRAIL mRNA in cells (48 hr, n=3). P<.05 for Akt+MEK inh compared to all other conditions. Unless otherwise indicated, between the indicated conditions and controls. * P<0.05.

[0215] Figure 67 is a graph showing the induction of surface TRAIL as in Figure 66 with or without stable knockdown of Foxo3a (n=3). Unless otherwise indicated, there is a significant difference between the indicated conditions and the control. * P<0.05.

[0216] Figure 68 is a graph showing sub-G1 analysis of MDA-MB-231 cells with or without shRNA-mediated TRAIL knockdown after 48 hours of incubation with 10 μM Akt inh, MEK inh, or both (n=3). Unless otherwise indicated, the difference between the indicated conditions and controls is * P<0.05. Figure 69 shows the HCT116 p53 expression levels after incubation with 10 μM A6730 (Akt inhibition), U0126 monoethanolate (MEK inhibition), or both. - / - Graph showing surface TRAIL analysis of cells (48 hr, n=3).

[0217] The siRNA experiments in this example demonstrate that ERK and Akt can be inhibited to cooperatively upregulate TRAIL. - / - Graph showing RT-qPCR analysis of TRAIL mRNA levels after transient knockdown of Akt and / or ERK in cells (48 hours after knockdown) (n=3). P<.05 for the combination of siERK and siAkt compared to all other conditions.

[0218] Figure 71 is an image showing confirmation of Akt and ERK knockdown by Western blot analysis. Error bars indicate sd of replicate experiments. Figure 72 is a graph showing surface TRAIL analysis after transient knockdown of Akt and / or ERK in HCT116 cells (48 hours after knockdown) (n=3).

[0219] TIC10 causes dual inactivation of Akt and ERK, which cooperatively result in the nuclear translocation of their mutual substrate Foxo3a, which transcriptionally induces the TRAIL gene as a unique target gene enhancing cell death and potent antitumor effects in vivo.

[0220] Any patents or publications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0221] The compositions and methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Modifications herein and other uses will occur to those skilled in the art. Such modifications and other uses can be made without departing from the scope of the invention as set forth in the claims.

Claims

1. 2. A composition for use in a method of inducing expression of TRAIL in a subject, the composition comprising the compound NSC350625, or a pharma- ceutically acceptable salt, ester, amide, hydrate, or solvate thereof.

2. A combination for use in a method of inducing expression of TRAIL in a subject, the combination comprising the composition of claim 1 and one or more additional therapeutic agents.

3. 3. The combination of claim 2, wherein the one or more additional therapeutic agents are selected from the group consisting of histone deacetylase inhibitors, antibiotics, antivirals, antineoplastic agents, analgesics, antipyretics, antidepressants, antipsychotics, anticancer agents, antihistamines, anti-osteoporosis agents, anti-osteonecrosis agents, anti-inflammatory agents, anti-anxiety agents, chemotherapeutic agents, diuretics, growth factors, hormones, nonsteroidal anti-inflammatory agents, steroids and vasoactive agents.

4. The combination of claim 2 or 3, wherein the one or more additional therapeutic agents are anti-cancer agents.

5. The combination according to claim 3 or 4, wherein the anti-cancer agent comprises one or more antimitotic agents and / or one or more anti-angiogenic agents.

6. The combination according to any one of claims 3 to 5, wherein the anti-cancer agent comprises a taxane mitotic inhibitor.

7. The combination according to any one of claims 3 to 6, wherein the anticancer drug comprises paclitaxel, docetaxel, or a combination thereof.

8. The combination according to any one of claims 3 to 7, wherein the anticancer drug comprises bevacizumab.

9. The combination of any one of claims 2 to 8, wherein the composition is administered to the subject simultaneously, at intermittent time points, at staggered time points, prior to, after, or a combination thereof with respect to the administration of the one or more additional therapeutic agents.

10. The composition according to claim 1 or the combination according to any one of claims 2 to 9, wherein the composition is formulated in a solid, semi-solid or liquid dosage form.

11. 11. The composition or combination of claim 10, wherein the solid, semi-solid or liquid dosage form comprises a capsule, tablet, powder, granule, suppository, pill, solution, suspension, syrup, elixir, ointment, lotion, cream, gel, paste, spray, aerosol, liposome or emulsion.

12. 12. The composition or combination of claim 10 or 11, wherein the composition further comprises a pharma- ceutically acceptable carrier.

13. The composition or combination of claim 12, wherein the pharma- ceutically acceptable carrier is an excipient, diluent, or vehicle.

14. The composition or combination according to any one of claims 10 to 13, wherein the composition is formulated in a solid dosage form.

15. The composition or combination of claim 14 , wherein the solid dosage form comprises a coating.

16. 16. The composition or combination of claim 15, wherein the coating is an enteric coating.

17. 17. The composition or combination of claim 16, wherein the enteric coating comprises a polymeric material.

18. 18. The composition or combination of claim 16 or 17, wherein the enteric coating comprises a plasticizer.

19. The composition or combination according to any one of claims 14 to 18, wherein the solid dosage form comprises a buffer, a filler, a binder, an absorbent, a disintegrant, a dissolution retarder, an absorption enhancer, a wetting agent, an adsorbent, a lubricant, a preservative, and / or a stabilizer.

20. The composition or combination according to any one of claims 10 to 13, wherein the composition is formulated in a liquid dosage form.

21. 21. The composition or combination of claim 20, wherein the liquid dosage form comprises colorants, stabilizers, wetting agents, emulsifying agents, suspending agents, sweetening agents, flavoring agents, and / or perfuming agents.

22. 22. The composition or combination of claim 20 or 21, wherein the liquid dosage form is an injectable liquid comprising an aqueous and / or non-aqueous carrier selected from the group consisting of water, ethanol, a polyol, a vegetable oil, an injectable organic ester, and mixtures thereof.

23. The composition or combination according to any one of claims 10 to 13, wherein the composition is formulated into an ointment, lotion, cream, gel, paste, spray, or powder.

24. 24. The composition or combination of claim 23, wherein the composition further comprises a base selected from the group consisting of an absorbent base, a water-removable base, a water-soluble base, an oil-based base, and mixtures thereof.

25. 25. The composition or combination of claim 23 or 24, wherein the composition further comprises a thickening agent, a gelling agent, a coloring agent, a stabilizer, an emulsifying agent, a suspending agent, a sweetener, a flavoring agent, a fragrance, a transdermal absorption enhancer, a pharmaceutical propellant, a preservative, a buffering agent, a thickening agent, and combinations thereof.

26. The composition or combination according to any one of claims 10 to 25, wherein the composition further comprises a non-ionic, cationic and / or anionic surfactant.

27. The composition according to any one of claims 1 and 10 to 26 or the combination according to any one of claims 2 to 26, wherein the pharma- ceutically acceptable salts include pharma- ceutically acceptable acid addition salts and / or pharma- ceutically acceptable base addition salts.

28. The composition according to any one of claims 1 and 10 to 26 or the combination according to any one of claims 2 to 26, wherein the pharma- ceutically acceptable solvates include hydrates, ethanolates and / or methanolates.

29. The composition according to any one of claims 1 and 10 to 26 or the combination according to any one of claims 2 to 26, wherein the pharma- ceutically acceptable amide comprises an amide derived from ammonia, a primary C1-C6 alkylamine and / or a secondary C1-C6 dialkylamine.

30. 30. The composition or combination of claim 29, wherein the primary C1-C6 alkylamine and / or secondary C1-C6 dialkylamine is in the form of a 5- or 6-membered nitrogen-containing heterocycle.

31. The composition of any one of claims 1 and 10 to 30 or the combination of any one of claims 2 to 30, wherein the subject has or is at risk of having cancer.

32. 32. The composition or combination of claim 31 , wherein the cancer is selected from the group consisting of brain cancer, colon cancer, breast cancer, glioblastoma multiforme, and colorectal cancer.

33. The composition according to any one of claims 1 and 10 to 32 or the combination according to any one of claims 2 to 32, characterized in that said composition is administered by a route of administration selected from the group consisting of oral, rectal, nasal, pulmonary, epidural, ocular, auricular, intra-arterial, intracardiac, intraventricular, intradermal, intravenous, intramuscular, intraperitoneal, intraosseous, intrathecal, intravesical, subcutaneous, topical, transdermal, transmucosal, sublingual, buccal, vaginal and inhalation routes of administration.

34. The composition of any one of claims 1 and 10 to 33 or the combination of any one of claims 2 to 33, wherein the method comprises administering the composition to the subject and monitoring the treatment.

35. 35. The composition or combination of claim 34, wherein said monitoring is performed at one or more time points before, during and / or after said treatment.

36. 36. The composition or combination of claim 34 or 35, wherein said monitoring comprises performing an assay for the quantitative measurement of TNF-related apoptosis-inducing ligand (TRAIL) expression in a test sample of the subject.

37. 37. The composition or combination of claim 36, wherein said monitoring comprises comparing said TRAIL expression in said test sample with TRAIL expression in a control sample of said subject.

38. 38. The composition or combination of claim 36 or 37, wherein the test sample and / or the control sample is a biological fluid, a cell or a tissue.

39. 39. The composition or combination of claim 38, wherein the biological fluid is blood, plasma, serum, urine, saliva, ascites, cerebrospinal fluid, pleural fluid, lung and bronchoalveolar lavage samples, mucus, sweat, tears, semen, bladder washing samples, amniotic fluid, lymphatic fluid, peritoneal fluid, synovial fluid, or bone marrow aspirate.

40. 39. The composition or combination of claim 38, wherein the cell is a tumor cell, a tissue cell or an organ cell.

41. 39. The composition or combination of claim 38, wherein the tissue is a biopsy.

42. The composition or combination of any one of claims 36 to 41, wherein the test sample of the subject is purified by electrophoretic or chromatographic methods.

43. The composition or combination according to any one of claims 36 to 42, wherein the TRAIL expression is determined by assaying TRAIL protein or TRAIL nucleic acid.

44. The composition or combination of claim 43, wherein the TRAIL nucleic acid is mRNA or cDNA.

45. The composition or combination of any one of claims 36 to 44, wherein the assay is immunohistochemistry, PCR, RT-PCR, dot blot, in situ hybridization, Northern blot, or RNase protection.

46. The composition or combination of any one of claims 36 to 45, wherein said monitoring further comprises assaying one or more additional biomarkers in said test sample of said subject.

47. 47. The composition or combination of claim 46, wherein said additional biomarkers are one or more of phospho-ERK, phospho-Akt, Foxo3a localization and / or phosphorylation.

48. 1. A method of obtaining expression levels of TRAIL as an indication of whether a subject having or at risk of having cancer is treated with the compound NSC350625, or a pharma- ceutically acceptable salt, ester, amide, hydrate, or solvate thereof, comprising: determining the expression level of TRAIL in a test sample of said subject; if the expression level of TRAIL is positive, then the subject is a candidate for treatment with the compound NSC350625, or a pharma- ceutically acceptable salt, ester, amide, hydrate, or solvate thereof.

Images