LOX inhibitors

Abstract

The present disclosure relates to compounds of Formula I or pharmaceutically acceptable salts thereof. Formula (I) is as defined herein. Compounds of Formula I are pharmacologically active as lysyl oxidase (LOX) inhibitors and are believed to be useful, for example, in the treatment of cancer. [Formula 1] TIFF2022507335000187.tif27170

Description

[Technical Field]

[0001] The present invention relates to compounds useful as inhibitors of lysyl oxidase (LOX) and lysyl oxidase-like (LOXL) family members (LOXL1, LOXL2, LOXL3, LOXL4), pharmaceutical compositions containing such compounds, and compounds for use in the treatment of LOX- and / or LOXL-mediated conditions, such as cancer, and LOX inhibitors for use in the treatment of EGFR-associated cancers. [Background technology]

[0002] LOX (protein-6-lysine oxidase, EC 1.4.3.13) is an extracellular enzyme that catalyzes the oxidative deamination of primary amines of lysines and hydroxylysines in proteins such as collagen and tropoelastin, producing the aldehyde peptidyl-[α]-aminoadipic acid-[δ]-semialdehyde, which spontaneously condenses to form inter- and intrachain crosslinks (Lucero and Kagan 2006). LOX plays an important role in connective tissue remodeling, regulating the maturation of proteins in the extracellular matrix (ECM), thereby contributing to the tensile strength and function of the ECM. Other proteins, such as basic fibroblast growth factor (BGF), PDGFR-β, and other cationic proteins, have been reported as substrates for LOX oxidation (Kagan and Li 2003; Li, Nugent et al. 2003; Lucero and Kagan 2006; Lucero, Ravid et al. 2008).

[0003] LOX is secreted as a precursor protein that undergoes proteolytic processing by procollagen C-proteinase (bone morphogenetic protein 1 (BMP-1)) and mammalian tolloid-like protein (mTLL-1) (Uzel, Scott et al. 2001) to generate an 18-kDa propeptide and a 32-kDa active LOX enzyme (Lucero and Kagan 2006). The catalytic domain contains copper and a lysine-tyrosylquinone (LTQ) cofactor. LTQ is formed by posttranslational oxidation of the catalytic tyrosine (Tyr349) and subsequent condensation with a lysine (Lys314) within the catalytic site, forming a stable covalent modification that is essential for the catalytic mechanism (Lucero and Kagan 2006) (Kagan and Li 2003).

[0004] LOX is part of a protein family consisting of five paralogous LOXs: LOX-like 1 [LOXL1], LOX-like 2 [LOXL2], LOX-like 3 [LOXL3], and LOX-like 4 [LOXL4], all of which contain a conserved catalytic domain. LOX enzymes play a crucial role in maintaining the stability of the extracellular matrix (ECM) by initiating and regulating the cross-linking of collagen and elastin within the ECM. The activity of these enzymes is key to maintaining the normal tensile and elastic properties of connective tissues in many organ systems in the body. LOX expression decreases during aging, suggesting that its activity may be particularly important for development.

[0005] In addition to its role in tissue remodeling, LOX also plays a crucial role in primary cancer and metastasis. Studies have shown that LOX plays a fundamental role in primary tumor growth in colorectal and lung cancer (Gao, Xiao et al. 2010; Baker, Cox et al. 2011) and glioblastoma (Mammoto, Jiang et al. 2013).

[0006] LOX expression is elevated in over 70% of breast cancer patients with estrogen receptor-negative disease, 80% of head and neck cancer patients, 33% of primary colorectal cancer (CRC), and 48% of metastatic tissues from CRC patients (Baker, Cox et al. 2011), as well as in cirrhotic hepatocellular carcinoma (HCC) patients with a history of alcoholism (Huang, Ho et al. 2013). As discussed in more detail herein, LOX is also overexpressed in many other cancers, including lung, prostate, and pancreatic cancers.

[0007] Increased LOX expression is also associated with metastasis and decreased patient survival (Baker, Cox et al. 2011; Wilgus, Borczuk et al. 2011).

[0008] Other members of the LOX family have been implicated in proliferative diseases such as cancer. LOXL2 is another member of the LOX family involved in cross-linking extracellular collagen and elastin (Vadasz, Kessler et al. 2005) (Kim, Kim et al. 2010). In addition to a conserved C-terminal region, the LOXL2 protein contains a scavenger receptor cysteine-rich region commonly found in cell surface receptors and adhesion molecules, as well as cytokine receptor-like domains.

[0009] LOXL2 expression has been found to be upregulated in breast, gastric, colon, esophageal, head and neck, lung, and laryngeal cancers (Barker, Cox et al. 2012), as reviewed by Barker et al., and renal cell carcinoma (Hase, Jingushi et al. 2014) (Nishikawa, Chiyomaru et al. 2015).

[0010] Studies have suggested that LOX and LOXL2 do not compensate for each other, as manipulating LOX expression in a colorectal cancer model did not affect LOXL2 levels (Baker, Cox et al. 2011). Thus, although LOX and LOXL2 are involved in similar extracellular processes, they appear to have distinct roles.

[0011] LOXL1 was found to be overexpressed in metastatic non-small cell lung cancer (NSCLC), and its metastatic phenotype could be reduced by inhibiting it with LOXL1 siRNA (Lee, Kim et al. 2011).

[0012] LOXL3 mRNA was expressed in highly invasive breast cancer cells, Hs578T, but not in the less invasive and non-metastatic breast cancer cells, MCF7 and T47D (Kirschmann, Seftor et al. 2002). Overexpression of LOXL3 in MDCK epithelial cells induces the epithelial-mesenchymal transition (EMT) process, a key step in metastatic progression (Peinado, Del Carmen Iglesias-de la Cruz et al. 2005).

[0013] A study of LOXL4 mRNA levels in head and neck squamous cell carcinoma (HNC) found that high expression of the LOXL4 gene was detected in 71% of all cancers but only 9% of healthy mucosa samples, suggesting that LOXL4 may serve as a selective molecular marker for primary and metastatic HNC (Scola and Gorogh 2010). Upregulation of LOXL4 was demonstrated in invasive HNC, revealing a significant correlation between LOXL4 expression and regional lymph node metastasis and higher tumor stage (Gorogh, Weise et al. 2007). LOXL4 promotes gastric cancer metastasis (Li, Zhao et al. 2015). LOXL4, together with LOXL2, was found to be required for metastatic niche formation in a breast orthotopic mouse model (Wong, Gilkes et al. 2011).

[0014] LOX and LOXL are involved in fibrotic diseases such as liver fibrosis, pulmonary fibrosis, renal fibrosis, cardiac fibrosis, myelofibrosis, and scleroderma. Both LOX and LOXL are highly expressed in fibrotic areas, surrounding myofibroblasts, and serum of patients with fibrotic conditions (Kagan 1994) (Kim, Peyrol et al. 1999) (Siegel, Chen et al. 1978) (Jourdan-Le Saux, Gleyzal et al. 1994) (Murawaki, Kusakabe et al. 1991).

[0015] LOX is also implicated in cardiovascular disease, and as discussed in the detailed description of the present invention, LOX inhibition may prove beneficial in the treatment or prevention of cardiovascular conditions, including hypertensive heart disease, heart failure, cardiac hypertrophy, and atherosclerosis.

[0016] LOX is associated with amyloid-β (Aβ)-related pathological hallmarks (e.g., cerebral amyloid angiopathy and senile plaques) in the pathogenesis of both Alzheimer's disease (AD) and hereditary cerebral hemorrhage with amyloidosis of the Dutch type (HCHWA-D) (Wilhelmus, Bol et al. 2013). LOX activity is increased in hippocampal samples from AD and non-Alzheimer's dementia (Gilad, Kagan et al. 2005). LOX is increased at sites of brain injury (Gilad, Kagan et al. 2001) and spinal cord injury, and its inhibition promotes functional recovery in a unilateral spinal cord dissection model (Gilad and Gilad 2001).

[0017] LOXL is involved in lung disease. LOXL2 and LOXL3 likely contribute to primary pulmonary alveolar proteinosis (PAP), as both are expressed in PAP tissue but not in normal lung tissue (Neufeld and Brekhman 2009).

[0018] LOX inhibition may be beneficial for the treatment of various ocular conditions. Inhibition of LOX or LOXL2 prevents angiogenesis and fibrosis after laser-induced choroidal neovascularization (CNV). Therefore, inhibitors of LOX and LOXL may be useful for the treatment of conditions characterized by angiogenesis, such as age-related macular degeneration (AMD), diabetic retinopathy, and retinopathy of prematurity (Stalmans, Marshall et al. 2010).

[0019] LOX is involved in inflammatory conditions and may be useful in the treatment of conditions including, but not limited to, acute respiratory distress syndrome (ARDS) (Mambetsariev, Tian et al. 2014).

[0020] LOX is the major isoenzyme expressed in human adipose tissue and its expression is strongly upregulated in samples from obese patients. β-Aminopropionitrile reduces weight gain, improves the metabolic profile of diet-induced obesity in rats (Miana, Galan et al. 2015), and reduces local adipose tissue inflammation (Halberg, Khan et al. 2009).

[0021] LOX is upregulated in endometriosis and may be involved in the establishment and progression of endometrial lesions (Ruiz, Dutil et al. 2011) (Dentillo, Meola et al. 2010).

[0022] Certain LOX inhibitors are known. These include β-aminopropionitrile (BAPN), haloamines, 1,2-diamines, allyl and propargyl amines, hydrazines, semicarbazides and thiolactones, benzylamines, mercaptopyridines, and pyridazinone compounds (Pinnell and Martin 1968), (Tang, Simpson et al. 1984), (Palfreyman, McDonald et al. 1989), (Sayre 2007), (Carrington, Bird et al. 1984), (Levene, Sharman et al. 1992), (Liu, Nellaiappan et al. 1997), (Williamson and Kagan 1987), (Anderson, Bartlett et al. 2007), (Schohe-Loop, Burchardt et al. 2003), (Burchardt 2006, Aslam, Miele et al. 2015). However, these compounds are generally either nonselective, lack efficacy, or are not suitable for use in patients. The only LOX inhibitor to have advanced to clinical trials in humans is believed to be BAPN. However, this compound is believed to have not been in clinical use since 1978. More recent LOX and LOXL2 inhibitors have been described, namely, LOX inhibitors containing hydrazine and hydrazide groups (Burke et al., 2017), haloarylamine derivatives that are LOXL2 inhibitors (Chang et al., 2017), pyridines (Rowbottom et al., 2016a, Rowbottom et al., 2016b), pyrimidines (Rowbottom & Hutchinson, 2017a), and chromenones (Rowbottom & Hutchinson, 2017b).

[0023] WO 2017 / 141049A1 discloses methylamine derivatives as LOX inhibitors.

[0024] WO 2004 / 110996 A1 relates to compounds that are disclosed as exhibiting neurokinin (NK) inhibitory properties and being useful in the treatment of neurokinin-mediated conditions.

[0025] WO 2007 / 027734 A2 relates to bicyclic and bridged nitrogen heterocycles that are disclosed as being effective as modulators of one or more chemokine receptors (CCRs) and useful in the treatment of inflammatory and immune disorder conditions and diseases.

[0026] WO 2011 / 050198 A1 and WO 2012 / 145581 A1 relate to disubstituted octahydropyrrolo[3,4-c]pyrroles that are disclosed as being orexin receptor modulators useful for the treatment of diseases or conditions mediated by orexin activity, such as insomnia.

[0027] WO 2009 / 137308 A1 relates to selective ligands of neuronal nicotinic receptors (NNRs) that are disclosed as being useful for treating conditions or disorders in which modulation of α4β2 NNR activity is therapeutically beneficial. Summary of the Invention [Problem to be solved by the invention]

[0028] It is an object of the present invention to provide novel compounds useful in the treatment of diseases, disorders, and / or conditions affected and / or mediated by LOX, such as cancer or fibrosis. [Means for solving the problem]

[0029] In one aspect, the present invention provides a compound of formula (I): [ka] or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 1, 2, 3, or 4, and are represented by the formula [ka] The two ring carbon atoms of the cyclic diamine moiety of (i) optionally linked by a bond; (ii)-(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4; or (iii) optionally linked by a spiro carbon atom; and Each ring carbon atom of the cyclic diamine moiety is selected from the group consisting of C1 to C6 alkyl, -OR 2a C1-C6 alkyl substituted with, or NR 2a R 2b and optionally substituted by 1 or 2 substituents independently selected from C1-C6 alkyl substituted with L 1 and L 2 each independently represents a bond, —O—, —C(O)—, —C(O)O—, —OC(O)—, or —C(O)NR 3 -, -NR 3 C(O)-, -NR 3 -,-SO2NR 3 -, -NR 3 SO2-, -S-, -SO2-, -SO2O-, -OSO2-, -NR 3 SO2NR 4 -, -NR 3 C(O)NR 4 -, -NR 3 C(O)O- or -OC(O)NR 3 - selected from L 3 is selected from a bond, C1-C4 alkylene, C2-C4 alkenylene, or C2-C4 alkynylene, wherein: L 3Any of the alkylene, alkenylene, or alkynylene groups in the formula (I) may be selected from halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 6 R 7 , -NR 6 C(O)R 7 , -NR 6 R 7 , -SO2NR 6 R 7 , -NR 6 SO2R 7 , -SR 6 , -SO2R 6 , -SO2OR 6 , -OSO2R 6 , -NR 6 SO2NR 7 R 8 , -NR 6 C(O)NR 7 R 8 , -NR 6 C(O)OR 7 , or OC(O)NR 6 R 7 and optionally substituted by 1 or 2 substituents independently selected from X, Y, and Z are each independently selected from a bond or a 3-12 membered ring system containing 0, 1, 2, or 3 heteroatoms selected from N, O, or S in the ring system, wherein: Any of the ring systems in X, Y, and Z may be selected from halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 4 R 5 , -NR 3 C(O)R 4 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2R4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -R 3 C(O)NR 4 R 5 , -NR 3 C(O)OR 4 , or OC(O)NR 4 R 5 and optionally substituted with one or more substituents independently selected from R 1 is selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or a 3-12 membered ring system (e.g., cycloalkyl, heterocyclyl, aryl, or heteroaryl) containing 0, 1, 2, or 3 heteroatoms selected from N, O, or S in the ring system, wherein: R 1 Any of the alkyl, alkenyl, or alkynyl groups in the formula (I) may be selected from halo, cyano, amino, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 4 R 5 , -NR 3 C(O)R 4 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -NR 3 C(O)NR 4 R 5 , -NR 3C(O)OR 4 , or OC(O)NR 4 R 5 and R 1 Any of the ring systems in the ring system may be halo, cyano, oxo, hydroxy, carboxy, or R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 4 R 5 , -NR 3 C(O)R 4 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -NR 3 C(O)NR 4 R 5 , -NR 3 C(O)OR 4 , or OC(O)NR 4 R 5 and optionally substituted with one or more substituents independently selected from R 2 is independently selected at each occurrence from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or C3-C6 cycloalkyl, wherein: R 2 Any of the alkyl, alkenyl, alkynyl, or cycloalkyl groups in the formula (I) may be selected from halo, cyano, oxo, R 2a , -OR 2a , -C(O)R 2a , -C(O)OR 2a , -OC(O)R 2a , -C(O)NR 2a R2b , -NR 2a C(O)R 2b , -NR 2a R 2b , -SO2NR 2a R 2b , -NR 2a SO2R 2b , -SR 2a , -SO2R 2a , -SO2OR 2a , -OSO2R 2a , -NR 2a SO2NR 2b R 2c , -NR 2a C(O)NR 2b R 2c , -NR 2a C(O)OR 2b , or OC(O)NR 2a R 2b and optionally substituted with 1, 2, or 3 substituents independently selected from R 2a , R 2b , and R 2c is independently selected at each occurrence from hydrogen or unsubstituted C1-C4 alkyl; R 3 , R 4 , and R 5 is independently selected at each occurrence from hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, wherein: R 3 , R 4 , and R 5 Any alkyl or cycloalkyl in the formula (I) may be halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , or C(O)OR 2 and R 4 is optionally substituted C1-C6 alkyl and R 5 is optionally substituted C1-C6 alkyl, R 4 and R 5 is -C(O)NR4 R 5 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2NR 4 R 5 , -R 3 C(O)NR 4 R 5 , or OC(O)NR 4 R 5 together with the nitrogen atom to which they are attached may form a 3- to 6-membered heterocycloalkyl; R 6 , R 7 , and R 8 is independently selected at each occurrence from hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, wherein: R 6 , R 7 , and R 8 Any alkyl or cycloalkyl in the formula (I) may be halo, cyano, oxo, hydroxy, carboxy, R 2a , -OR 2a , -C(O)R 2a , -C(O)OR 2a , -C(O)NR 2a R 2b , -NR 2a C(O)R 2b , -NR 2a R 2b , -SO2NR 2a R 2b , -NR 2a SO2R 2b , -SR 2a , -SO2R 2a , -SO2OR 2a , -OSO2R 2a , -NR 2 SO2NR 2a R 2b , -NR 2a C(O)NR 2b R 2c , -NR 2a C(O)OR 2b , or OC(O)NR 2a R 2band optionally substituted with 1, 2, or 3 substituents independently selected from R 11 and R 12 is independently selected from hydrogen and C1-C6 alkyl, and q is 0, 1, or 2; However, L 2 , Y., L. 3 and at least one of Z is not a bond; provided that —SO—(CH)—NH in Formula I is linked to the remainder of the compound of Formula I through a carbon atom; However, when X is a bond, L 1 is a bond, -C(O)-, -OC(O)-, -NR 3 C(O)-, -NR 3 selected from SO2-, -SO2-, and OSO2-; However, when Y is a bond, L 2 is a bond, -C(O)-, -C(O)O-, -C(O)NR 3 -,-SO2NR 3 -, -SO2-, and -SO2O-; and However, the compound is [ka] isn't it.

[0030] Also provided is a pharmaceutical composition comprising a compound of the invention, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

[0031] Also provided is a compound of the invention or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of the invention for use as a pharmaceutical. In some embodiments, a compound of the invention or a pharmaceutically acceptable salt thereof is provided for use in treating a disease or medical condition mediated by LOX.

[0032] Also provided is a method of treating a disease or medical condition mediated by LOX in a subject, the method comprising administering to the subject an effective amount of a compound of the invention or a pharmaceutical composition of the invention.

[0033] In some embodiments, the compounds of the invention or pharmaceutically acceptable salts thereof, or pharmaceutical compositions of the invention are for use in the treatment of proliferative diseases, particularly cancer.

[0034] In some embodiments, the compound of the invention or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of the invention is for use in treating or preventing cancer associated with overexpression of EGFR.

[0035] In some embodiments, the compound of the invention or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of the invention is for use in the treatment of a fibrotic disease, such as liver fibrosis, pulmonary fibrosis, renal fibrosis, cardiac fibrosis, myelofibrosis, or scleroderma. DETAILED DESCRIPTION OF THE INVENTION

[0036] definition Unless otherwise stated, the following terms used in the specification and claims have the following meanings defined below.

[0037] It should be recognized that references to "treating" or "treatment" include prevention as well as the alleviation of established symptoms of a condition. Thus, "treating" or "treatment" of a disease state, disorder, or condition includes (1) preventing or delaying the onset of clinical symptoms of the disease state, disorder, or condition in a person who may be afflicted with or predisposed to the disease state, disorder, or condition but who has not yet experienced or displayed clinical or subclinical symptoms of the disease state, disorder, or condition; (2) inhibiting the disease state, disorder, or condition, i.e., arresting, reducing, or delaying the occurrence of the disease or its recurrence (in the case of maintenance treatment) or at least one clinical or subclinical symptom thereof; or (3) relieving or attenuating the disease, i.e., causing regression of the disease state, disorder, or condition, or at least one clinical or subclinical symptom thereof.

[0038] "Therapeutically effective amount" means the amount of a compound that, when administered to a mammal for treating a disease, is sufficient to effect such treatment for the disease. The "therapeutically effective amount" will vary depending on the compound, the disease and its severity, and the age, weight, etc., of the mammal being treated.

[0039] The term "halo" or "halogen" refers to one of the halogens of Group 17 of the periodic table. Specifically, the term refers to fluorine, chlorine, bromine, and iodine. Preferably, the term refers to fluorine or chlorine.

[0040] C m~n The term C denotes a group having m to n carbon atoms. m~n is referred to herein as C m ~C n It is also called.

[0041] "C 1~6 The term "alkyl" means a linear or branched hydrocarbon chain containing 1, 2, 3, 4, 5, or 6 carbon atoms, for example, methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, and n-hexyl. 1~4 "Alkyl" means such a group containing up to four carbon atoms. An alkylene group is a divalent alkyl group, which in turn may be linear or branched and has two points of attachment to the rest of the molecule. Furthermore, the alkylene group may correspond, for example, to one of the alkyl groups listed in this paragraph. Alkyl and alkylene groups may be unsubstituted or substituted with one or more substituents. Possible substituents are described below. Substituents for alkyl groups may be halogen, for example, fluorine, chlorine, bromine, and iodine, OH, C1-C4 alkoxy. Alternatively, other substituents for alkyl groups may be used.

[0042] "C 1~6 Haloalkyl" e.g. "C 1~4The term "haloalkyl" means a hydrocarbon chain substituted with at least one halogen atom, selected independently for each occurrence, such as fluorine, chlorine, bromine, and iodine. The halogen atom can be located at any position on the hydrocarbon chain. For example, C 1~6 Haloalkyl can mean chloromethyl, fluoromethyl, trifluoromethyl, chloroethyl, for example, 1-chloromethyl and 2-chloroethyl, trichloroethyl, for example, 1,2,2-trichloroethyl, 2,2,2-trichloroethyl, fluoroethyl, for example, 1-fluoromethyl and 2-fluoroethyl, trifluoroethyl, for example, 1,2,2-trifluoroethyl and 2,2,2-trifluoroethyl, chloropropyl, trichloropropyl, fluoropropyl, trifluoropropyl.

[0043] "C 2~6 The term "alkenyl" includes branched or linear hydrocarbon chains containing at least one double bond and having 2, 3, 4, 5, or 6 carbon atoms. The double bond may exist as an E or Z isomer. The double bond may be in any available position on the hydrocarbon chain. For example, "C 2~6 "Alkenyl" can be ethenyl, propenyl, butenyl, butadienyl, pentenyl, pentadienyl, hexenyl, and hexadienyl.

[0044] "C 2~6 The term "alkynyl" includes branched or linear hydrocarbon chains containing at least one triple bond and having 2, 3, 4, 5, or 6 carbon atoms. The triple bond may be in any available position on the hydrocarbon chain. For example, "C 2~6 "Alkynyl" can be ethynyl, propynyl, butynyl, pentynyl, and hexynyl.

[0045] As used herein, the term "cycloalkyl" means a saturated monocyclic or polycyclic (e.g., bicyclic) aliphatic ring system containing ring carbon atoms. The term cycloalkyl includes both fused and bridged polycyclic ring systems.

[0046] "C 3~6 The term "cycloalkyl" includes saturated hydrocarbon ring systems containing 3, 4, 5, or 6 carbon atoms. For example, "C3-C6 cycloalkyl" can be cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, bicyclo[2.1.1]hexane, or bicyclo[1.1.1]pentane.

[0047] As used herein, "cycloalkenyl" refers to a cycloalkyl group having at least one carbon-carbon double bond in at least one ring.

[0048] The terms "heterocyclyl," "heterocyclic," or "heterocycle" include non-aromatic saturated or partially saturated monocyclic or fused, bridged, or spiro bicyclic heterocyclic ring systems. Monocyclic heterocycles can contain about 3 to 12 (preferably 3 to 7) ring atoms, including 1 to 5 (preferably 1, 2, or 3) heteroatoms selected from nitrogen, oxygen, or sulfur in the ring. Bicyclic heterocycles can contain 7 to 17 member atoms, preferably 7 to 12 member atoms, in the ring. Bicyclic heterocyclic rings can be fused, spiro, or bridged ring systems. Examples of heterocyclic groups include cyclic ethers such as oxiranyl, oxetanyl, tetrahydrofuranyl, dioxanyl, and substituted cyclic ethers. Heterocycles containing at least one nitrogen atom in the ring include, for example, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydrotriazinyl, tetrahydropyrazolyl, tetrahydropyridinyl, homopiperidinyl, homopiperazinyl, 3,8-diaza-bicyclo[3.2.1]octanyl, 8-aza-bicyclo[3.2.1]octanyl, 2,5-diaza-bicyclo[2.2.1]heptanyl, etc. Exemplary sulfur-containing heterocycles include tetrahydrothienyl, dihydro-1,3-dithiol, tetrahydro-2H-thiopyran, and hexahydrothiepin. Other heterocycles include dihydrooxathiolyl, tetrahydrooxazolyl, tetrahydrooxadiazolyl, tetrahydrodioxazolyl, tetrahydrooxathiazolyl, hexahydrotriazinyl, tetrahydrooxazinyl, tetrahydropyrimidinyl, dioxolinyl, octahydrobenzofuranyl, octahydrobenzimidazolyl, and octahydrobenzothiazolyl. Sulfur-containing heterocycles also include oxidized sulfur heterocycles containing SO or SO groups. Examples include the sulfoxide and sulfone forms of tetrahydrothienyl and thiomorpholinyl, such as tetrahydrothienyl 1,1-dioxide and thiomorpholinyl 1,1-dioxide.Suitable examples of heterocyclyl groups having one or two oxo (=O) include 2oxopyrrolidinyl, 2-oxoimidazolidinyl, 2-oxopiperidinyl, 2,5-dioxopyrrolidinyl, 2,5-dioxoimidazolidinyl, and 2,6-dioxopiperidinyl. Particular heterocyclyl groups are saturated monocyclic 3- to 7-membered heterocyclyl groups containing one, two, or three heteroatoms selected from nitrogen, oxygen, or sulfur, such as azetidinyl, tetrahydrofuranyl, tetrahydropyranyl, pyrrolidinyl, morpholinyl, tetrahydrothienyl, tetrahydrothienyl 1,1-dioxide, thiomorpholinyl, thiomorpholinyl 1,1-dioxide, piperidinyl, homopiperidinyl, piperazinyl, or homopiperazinyl. As will be appreciated by those skilled in the art, any heterocycle may be attached to another group through any suitable atom, for example, a carbon atom or a nitrogen atom, e.g., the terms "piperidino" or "morpholino" refer to a piperidin-1-yl or morpholin-4-yl ring attached through the ring nitrogen.

[0049] As used herein, the term "heterocycloalkyl" is a subset of heterocyclyl and means a saturated monocyclic or polycyclic (e.g., bicyclic) aliphatic ring system containing, e.g., 3 to 12 ring atoms, at least one heteroatom selected from nitrogen, oxygen, and sulfur in the ring.

[0050] The term "bridged ring system" includes ring systems in which two rings share more than two atoms. See, for example, Advanced Organic Chemistry, by Jerry March, 4th Edition, Wiley Interscience, pages 131-133, 1992. Examples of bridged heterocyclyl ring systems include aza-bicyclo[2.2.1]heptane, 2-oxa-5-azabicyclo[2.2.1]heptane, aza-bicyclo[2.2.2]octane, aza-bicyclo[3.2.1]octane, and quinuclidine.

[0051] The term "spiro bicyclic ring system" includes ring systems in which two rings share one common spiro carbon atom, i.e., a heterocyclic ring is linked to a further carbocyclic or heterocyclic ring through a single common spiro carbon atom. Examples of spirocyclic systems include 3,8-diaza-bicyclo[3.2.1]octane, 2,5-diaza-bicyclo[2.2.1]heptane, 6-azaspiro[3.4]octane, 2-oxa-6-azaspiro[3.4]octane, 2-azaspiro[3.3]heptane, 2-oxa-6-azaspiro[3.3]heptane, 6-oxa-2-azaspiro[3.4]octane, 2,7-diaza-spiro[4.4]nonane, 2-azaspiro[3.5]nonane, 2-oxa-7-azaspiro[3.5]nonane, and 2-oxa-6-azaspiro[3.5]nonane.

[0052] "Heterocyclyl-C m~n "Alkyl" is C m~n Includes a heterocyclyl group covalently linked to an alkylene group, both as defined herein.

[0053] The term "aromatic" when applied to a substituent as a whole includes monocyclic or polycyclic ring systems having 4n+2 electrons in a conjugated pi system within the ring or ring system, where all atoms contributing to the conjugated pi system lie in the same plane.

[0054] The term "aryl" includes aromatic hydrocarbon ring systems. The ring systems have 4n+2 electrons in a conjugated π system within the ring, and all atoms contributing to the conjugated π system are in the same plane. For example, "aryl" can be phenyl and naphthyl. The aryl system may itself be substituted with other groups.

[0055] The term "heteroaryl" includes aromatic monocyclic or bicyclic rings incorporating one or more (e.g., 1 to 4, particularly 1, 2, or 3) heteroatoms selected from nitrogen, oxygen, or sulfur. The ring or ring system has 4n+2 electrons in a conjugated π system, and all atoms contributing to the conjugated π system lie in the same plane.

[0056] Examples of heteroaryl groups are monocyclic and bicyclic groups containing 5 to 12 ring members, more typically 5 to 10 ring members. Heteroaryl groups can be, for example, 5- or 6-membered monocyclic rings or 9- or 10-membered bicyclic rings, e.g., fused 5- and 6-membered rings or bicyclic structures formed from two fused 6-membered rings. Each ring can contain up to about four heteroatoms, typically selected from nitrogen, sulfur, and oxygen. Typically, heteroaryl rings will contain up to three heteroatoms, more typically up to two, e.g., a single heteroatom. In one embodiment, a heteroaryl ring contains at least one ring nitrogen atom. The nitrogen atoms in a heteroaryl ring can be basic, as in the case of an imidazole or pyridine nitrogen, or essentially non-basic, as in the case of an indole or pyrrole nitrogen. Generally, the number of basic nitrogen atoms present in a heteroaryl group will be fewer than five, including any amino group substituents on the ring.

[0057] Examples of heteroaryl include furyl, pyrrolyl, thienyl, oxazolyl, isoxazolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazenyl, benzofuranyl, indolyl, isoindolyl, benzothienyl, benzoxazolyl, benzimidazolyl, benzothiazolyl, benzothiazolyl, indazolyl, purinyl, benzofurazanyl, quinolyl, and isoquinoline. aryl, quinazolinyl, quinoxalinyl, cinnolinyl, pteridinyl, naphthyridinyl, carbazolyl, phenazinyl, benzoisoquinolinyl, pyridopyrazinyl, thieno[2,3-b]furanyl, 2H-furo[3,2-b]pyranyl, 5H-pyrido[2,3-d]-o-oxazinyl, 1H-pyrazolo[4,3-d]oxazolyl, 4H-imidazo[4,5-d]thiazolyl, pyrazino[2,3-d]pyridazinyl, imidazo[2,1-b]thiazolyl, and imidazo[1,2-b][1,2,4]triazinyl. Examples of heteroaryl groups containing at least one nitrogen atom in a ring position include pyrrolyl, oxazolyl, isoxazolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazenyl, indolyl, isoindolyl, benzoxazolyl, benzimidazolyl, benzothiazolyl, benzothiazolyl, indazolyl, purinyl, benzofurazanyl, quinolyl, isoquinolyl, quinazolinyl, cinnolinyl, and pteridinyl. "Heteroaryl" also covers partially aromatic bicyclic or polycyclic ring systems in which at least one ring is aromatic and one or more of the other rings are non-aromatic, saturated, or partially saturated, provided that at least one ring contains one or more heteroatoms selected from nitrogen, oxygen, or sulfur.Examples of partially aromatic heteroaryl groups include, for example, tetrahydroisoquinolinyl, tetrahydroquinolinyl, 2-oxo-1,2,3,4-tetrahydroquinolinyl, dihydrobenzthienyl, dihydrobenzfuranyl, 2,3-dihydro-benzo[1,4]dioxinyl, benzo[1,3]dioxolyl, 2,2-dioxo-1,3-dihydro-2-benzothienyl, 4,5,6,7-tetrahydrobenzofuranyl, indolinyl, 1,2,3,4-tetrahydro-1,8-naphthyridinyl, 1,2,3,4-tetrahydropyrido[2,3-b]pyrazinyl, and 3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazinyl.

[0058] Examples of 5-membered heteroaryl groups include, but are not limited to, pyrrolyl, furanyl, thienyl, imidazolyl, furazanyl, oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, triazolyl, and tetrazolyl groups.

[0059] Examples of 6-membered heteroaryl groups include, but are not limited to, pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl, and triazinyl.

[0060] Particular examples of bicyclic heteroaryl groups containing a 6-membered ring fused to a 5-membered ring include, but are not limited to, benzofuranyl, benzothiophenyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzothiazolyl, benzisothiazolyl, isobenzofuranyl, indolyl, isoindolyl, indolizinyl, indolinyl, isoindolinyl, purinyl (e.g., adeninyl, guaninyl), indazolyl, benzodioxolyl, pyrrolopyridine, and pyrazolopyridinyl groups.

[0061] Particular examples of bicyclic heteroaryl groups containing two fused six-membered rings include, but are not limited to, quinolinyl, isoquinolinyl, chromanyl, thiochromanyl, chromenyl, isochromenyl, chromanyl, isochromanyl, benzodioxanyl, quinolidinyl, benzoxazinyl, benzodiazinyl, pyridopyridinyl, quinoxalinyl, quinazolinyl, cinnolinyl, phthalazinyl, naphthyridinyl, and pteridinyl groups.

[0062] "Heteroaryl-C m~n Alkyl- is C m~n Includes heteroaryl groups covalently linked to an alkylene group, both as defined herein. Examples of heteroaralkyl groups include pyridin-3-ylmethyl, and the like.

[0063] As used herein, the term "alkoxy" means -O-alkyl, where alkyl is as defined above. C1-C6 alkoxy includes alkyl having 1 to 6 carbon atoms. Examples of C1-C6 alkoxy include, but are not limited to, methoxy, ethoxy, n-propyloxy, iso-propyloxy, 2-methyl-1-propyloxy, 2-methyl-2-propyloxy, 2-methyl-1-butyloxy, 3-methyl-1-butyloxy, 2-methyl-3-butyloxy, 2,2-dimethyl-1-propyloxy, 2-methyl-1-pentyloxy, 3-methyl-1-pentyloxy, 4-methyl-1-pentyloxy, 2-methyl-2-pentyloxy, 3-methyl-2-pentyloxy, 4-methyl-2-pentyloxy, 2,2-dimethyl-1-butyloxy, 3,3-dimethyl-1-butyloxy, 2-ethyl-1-butyloxy, butyloxy, iso-butyloxy, t-butyloxy, pentyloxy, isopentyloxy, neo-pentyloxy, hexyloxy, and the like.

[0064] As used herein, the term "alkoxy-carbonyl" means -C(O)-O-alkyl.

[0065] As used herein, the term "alkyl-carbonyl" means --C(O)-alkyl.

[0066] As used herein, the term "halo" means fluoro, chloro, bromo, and iodo.

[0067] As used herein, the term "nitro" means --NO.sub.2.

[0068] As used herein, the term "hydroxy" means --OH.

[0069] As used herein, the term "carboxy" means --COOH.

[0070] As used herein, the term "nitrile" (sometimes called "cyano") means --CN.

[0071] As used herein, the term "oxo" means =O.

[0072] When a "cyclic diamine moiety" of any formula herein is referred to, the term refers to the [ka] means.

[0073] As used herein, "spiro carbon atom" refers to a carbon atom shared by two rings. Thus, when the cyclic diamine moieties of Formula I are connected through a spiro carbon atom, the cyclic diamine moieties form two rings. For example, when the cyclic diamine moieties are connected through a spiro carbon atom and m and n are both 4, the cyclic diamine moiety has the following structure: [ka] (i.e., the shared spiro carbon counts as one carbon in m and one carbon in n).

[0074] The term "optionally substituted" includes groups, structures, or molecules that are either substituted or unsubstituted.

[0075] Where an optional substituent is selected from "one or more" groups, this definition should be understood to include all substituents selected from one of the specified groups or substituents selected from two or more of the specified groups.

[0076] The phrase "compounds of the invention" refers to both the compounds disclosed generically and specifically herein.

[0077] [ka] A bond that terminates in means that the bond is connected to another atom not shown in the structure and represents the point of attachment of the chemical moiety to the remainder of the molecule or chemical formula. A bond that terminates inside a cyclic structure and does not terminate at an atom of the cyclic structure means that the bond can be attached to any atom in the cyclic structure, valence allowing.

[0078] When a moiety is substituted, it may be substituted anywhere on the moiety, consistent with chemical feasibility and valence requirements. A moiety may be substituted with one or more substituents, e.g., 1, 2, 3, or 4 substituents, and optionally, there are one or two substituents on a group. When two or more substituents are present, the substituents may be the same or different.

[0079] Substituents are present only in chemically possible positions, and which substitutions are chemically possible and which are not can be determined (either experimentally or theoretically) by one skilled in the art without undue effort.

[0080] Ortho, meta, and para substitution are terms well understood in the art. For the avoidance of doubt, "ortho" substitution refers to a substitution, whether on a simple group such as the fluoro group in the example below, or elsewhere in the molecule: [ka] A substitution pattern in which adjacent carbons have substituents as indicated by bonds terminating in a . [ka]

[0081] A "meta" substitution is a substitution pattern in which two substituents are one carbon away from each other, i.e., there is a single carbon atom between the substituted carbons. In other words, the substituent is on a second atom away from the atom of the other substituent. For example, the following group is meta-substituted: [ka]

[0082] "Para" substitution refers to a substitution pattern in which two substituents are two carbon atoms apart from each other, i.e., there are two carbon atoms between the substituted carbons. In other words, the substituent is on a third atom away from the atom of the other substituent. For example, the following group is para substituted: [ka]

[0083] The term "acyl" includes organic groups derived from organic acids, etc., by removal of the hydroxyl group, e.g., groups having the formula RC(O)-, where R is H, C 1~6 Alkyl, C 3~8 For example, R may be selected from the group consisting of H or C 1~3In one embodiment, the acyl is alkyl-carbonyl. Examples of acyl groups include, but are not limited to, formyl, acetyl, propionyl, and butyryl. A particular acyl group is acetyl (also represented as Ac).

[0084] Throughout the description and claims of this specification, the words "comprise" and "contain" and variations thereof mean "including but not limited to" and are not intended to (and do not) exclude other parts, additives, components, integers, or steps. Throughout the description and claims of this specification, the singular includes the plural unless the context otherwise requires. In particular, where the indefinite article is used, this specification should be understood to contemplate the plural as well as the singular, unless the context otherwise requires.

[0085] It should be understood that features, integers, properties, compounds, chemical moieties, or groups described in connection with a particular aspect, embodiment, or example of the invention are also applicable to any other aspect, embodiment, or example described herein, unless specifically inconsistent with each other. All features disclosed herein (including any accompanying claims, abstract, and drawings) and / or all method or process steps so disclosed may be combined in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive. The invention is not limited to the details of any of the foregoing embodiments. The invention extends to any novel one or any novel combination of features disclosed herein (including any accompanying claims, abstract, and drawings) or to any novel one or any novel combination of steps of any method or process so disclosed.

[0086] The reader is directed to all papers and documents in connection with this application that are filed contemporaneously or earlier herewith and that are open to public inspection herewith, the contents of all such papers and documents being incorporated herein by reference.

[0087] The various functional groups and substituents comprising the compounds of the invention are typically selected so that the molecular weight of the compound does not exceed 1000. More typically, the molecular weight of the compound will be less than 750, such as less than 700, or less than 650, or less than 600, or less than 550. More preferably, the molecular weight is less than 525, such as 500 or less.

[0088] Any suitable or preferred feature of any compound of the invention may also be a suitable feature of any other aspect.

[0089] The present invention contemplates pharmaceutically acceptable salts of the compounds of the present invention. These may include acid addition and base salts of the compounds. These may be acid addition and base salts of the compounds.

[0090] Suitable acid addition salts are formed from acids which form non-toxic salts. Examples include acetate, aspartate, benzoate, besylate, bicarbonate / carbonate, bisulfate / sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hybenzate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malate, maleate, malonate, mesylate, methylsulfate, naphthylate, 1,5-naphthalenedisulfonate, 2-napsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate / hydrogenphosphate / dihydrogenphosphate, saccharate, stearate, succinate, tartrate, tosylate, and trifluoroacetate.

[0091] Suitable base salts are formed from bases that form non-toxic salts. Examples include aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine, and zinc salts. Hemisalts of acids and bases, such as hemisulfate and hemicalcium salts, can also be formed. For a review of suitable salts, see "Handbook of Pharmaceutical Salts: Properties, Selection, and Use" by Stahl and Wermuth (Wiley-VCH, Weinheim, Germany, 2002).

[0092] Pharmaceutically acceptable salts of the compounds of the present invention can be prepared, for example, by the following method: (i) reacting the compound of the present invention with a desired acid or base; (ii) removing an acid- or base-labile protecting group from a suitable precursor of a compound of the invention or opening a suitable cyclic precursor, such as a lactone or lactam, with a desired acid or base; or (iii) converting one salt of a compound of the invention into another salt by reaction with an appropriate acid or base or by utilizing a suitable ion exchange column; It may be prepared by one or more of the following.

[0093] These methods are typically carried out in solution. The resulting salts may be precipitated and collected by filtration or recovered by evaporation of the solvent. The degree of ionization of the resulting salts may vary from completely ionized to nearly non-ionized.

[0094] Compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are called "isomers." Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereomers," and those that are non-superimposable mirror images of each other are called "enantiomers." When a compound has an asymmetric center, for example, when it is bonded to four different groups, a pair of enantiomers is possible. Enantiomers can be characterized by the absolute configuration of their asymmetric center and are described by the R- and S-sequencing rules of Cahn and Prelog, or designated as dextrorotatory or levorotatory (i.e., (+) or (-) isomers, respectively) depending on the way the molecule rotates the plane of polarized light. Chiral compounds can exist as either individual enantiomers or mixtures thereof. A mixture containing equal proportions of enantiomers is called a "racemic mixture." When a compound of the present invention has two or more stereocenters, any combination of (R) and (S) stereoisomers is contemplated. Combinations of (R) and (S) stereoisomers can result in diastereomeric mixtures or single diastereoisomers. The compounds of the present invention can exist as a single stereoisomer or can be a mixture of stereoisomers, such as racemic mixtures and other enantiomeric and diastereomeric mixtures. When the mixture is a mixture of enantiomers, the enantiomeric excess can be any of those disclosed above. When the compound is a single stereoisomer, the compound can still contain other diastereoisomers or enantiomers as impurities. Therefore, a single stereoisomer does not necessarily have 100% enantiomeric excess (ee) or diastereomeric excess (de), but can have at least about 85% ee or de.

[0095] The compounds of the present invention may have one or more asymmetric centers; therefore, such compounds can be produced as individual (R) or (S) stereoisomers or mixtures thereof. Unless otherwise specified, the description or naming of a particular compound in the specification and claims is intended to include both individual enantiomers and mixtures thereof, such as racemic mixtures. Methods for the determination of stereochemistry and separation of stereoisomers are well known in the art (see the discussion in Chapter 4 of "Advanced Organic Chemistry," 4th edition, J. March, John Wiley and Sons, New York, 2001), and include, for example, synthesis from optically active starting materials or resolution of racemates. Some of the compounds of the present invention may have geometric isomeric centers (E and Z isomers). It should be understood that the present invention encompasses all optical isomers, diastereoisomers, and geometric isomers, and mixtures thereof, that possess LOX inhibitory activity.

[0096] The compounds and salts described herein may be isotopically labeled (or "radiolabeled"). Thus, one or more atoms are replaced by an atom having an atomic mass or mass number different from that typically found in nature. Examples of radionuclides that may be incorporated include: 2 H (also written "D" for deuterium), 3 H (also written "T" for tritium), 11 C. 13 C. 14 C. 15 O. 17 O. 18 O. 18 F. The radionuclide used will depend on the specific application of the radiolabeled derivative. For example, in an in vitro competition assay: 3 H or 14 C is often useful. For radioactive imaging applications, 11 C or 18 F is often useful. In some embodiments, the radionuclide is 3 H. In some embodiments, the radionuclide is14 C. In some embodiments, the radionuclide is 11 C. Also, in some embodiments, the radionuclide is 18 It's F.

[0097] It should also be understood that certain compounds of the present invention can exist in solvated as well as unsolvated forms, such as hydrated forms, and it should be understood that the present invention encompasses all such solvated forms that possess LOX inhibitory activity.

[0098] It is also to be understood that certain compounds of the present invention may exhibit polymorphism, and that the present invention encompasses all such forms that possess LOX inhibitory activity.

[0099] The compounds of the present invention may exist in several different tautomeric forms, and reference to a compound of the present invention includes all such forms. For the avoidance of doubt, where a compound can exist in one of several tautomeric forms and only one form is specifically described or shown, all other forms are nevertheless encompassed by the compounds of the present invention. Examples of tautomeric forms include keto, enol, and enolate forms, such as in the following tautomeric pairs: keto / enol (exemplified below), imine / enamine, amide / iminoalcohol, amidine / amidine, nitroso / oxime, thioketone / enethiol, and nitro / acinitro. [ka]

[0100] The in vivo effects of the compounds of the invention may be exerted, in part, by one or more metabolites that are formed in the human or animal body following administration of the compounds of the invention.

[0101] Throughout the description and claims, the words "comprise" and "contain" and variations thereof mean "including but not limited to" and are not intended to (and do not) exclude other parts, additives, components, integers, or steps. Throughout the description and claims, the singular includes the plural unless the context otherwise requires. In particular, where the indefinite article is used, it should be understood herein that the plural as well as the singular is contemplated unless the context otherwise requires.

[0102] It should be understood that features, integers, properties, compounds, chemical moieties, or groups described in connection with a particular aspect, embodiment, or example of the invention are also applicable to any other aspect, embodiment, or example described herein, unless specifically inconsistent with each other. All features disclosed herein (including any accompanying claims, abstract, and drawings) and / or all method or process steps so disclosed may be combined in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive. The invention is not limited to the details of any of the foregoing embodiments. The invention extends to any novel one or any novel combination of features disclosed herein (including any accompanying claims, abstract, and drawings) or to any novel one or any novel combination of steps of any method or process so disclosed.

[0103] The reader is directed to all papers and documents in connection with this application that are filed contemporaneously or earlier herewith and that are open to public inspection herewith, the contents of all such papers and documents being incorporated herein by reference.

[0104] Further information regarding the preparation of compounds of the invention is provided in the Examples section. The general reaction schemes and specific methods described in the Examples form further aspects of the invention.

[0105] The compounds of the invention obtained from the processes defined above can be isolated and purified using techniques well known in the art.

[0106] The compounds of the present invention may exist in a single crystalline form or as a mixture of crystalline forms, or may be amorphous. Thus, compounds of the present invention intended for pharmaceutical use may be administered as crystalline or amorphous products. They may be obtained, for example, as solid plugs, powders, or films by methods such as precipitation, crystallization, freeze drying, or spray drying, or evaporative drying. Microwave or radio frequency drying can be used for this purpose.

[0107] The processes defined herein may further comprise the step of subjecting the compound of the invention to salt exchange, particularly in situations where the compound of the invention is formed as a mixture of different salt forms. Salt exchange suitably comprises immobilizing the compound of the invention on a suitable solid support or resin and eluting the compound with an appropriate acid to produce a single salt of the compound of the invention.

[0108] In a further aspect of the present invention there is provided a compound of the present invention obtainable by any one of the processes defined herein.

[0109] Some of the intermediates described in the above reaction schemes and in the examples herein are novel. Such novel intermediates or salts thereof, particularly pharmaceutically acceptable salts thereof, form a further aspect of the present invention.

[0110] compound In one embodiment, in the compounds of formula (I), q is 0 or 1.

[0111] In one embodiment, R 11 and R 12 are independently hydrogen and C 1~3alkyl. Preferably, R 11 and R 12 are independently selected from hydrogen, methyl, and ethyl. 11 and R 12 is independently selected from hydrogen and methyl.

[0112] In another embodiment, in the compound of formula (I), q is 0. Thus, Z is directly linked to the aminoethylsulfonyl group.

[0113] In one embodiment, the cyclic diamine moieties are (iii) optionally linked by a spiro carbon atom, wherein each ring carbon atom of said cyclic diamine moiety is selected from the group consisting of C1-C6 alkyl, -OR 2a C1-C6 alkyl substituted with, or NR 2a R 2b and optionally substituted with 1 or 2 substituents independently selected from C1-C6 alkyl substituted with

[0114] In one embodiment, the cyclic diamine moieties are (i) optionally linked by a bond, or (ii) -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4).

[0115] In one embodiment, the cyclic diamine moieties are (i) optionally linked by a bond, or (ii) -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4), and q is 0. Thus, compounds of formula (I) have the following formula Ia: [ka] or a pharmaceutically acceptable salt thereof. m and n are each independently selected from 1, 2, 3, or 4, and are represented by the formula [ka] The two ring carbon atoms of the cyclic diamine moiety of (CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4; Each ring carbon atom of the cyclic diamine moiety is selected from the group consisting of C1 to C6 alkyl, -OR 2a C1-C6 alkyl substituted with, or NR 2a R 2b and optionally substituted by 1 or 2 substituents independently selected from C1-C6 alkyl substituted with L 1 and L 2 each independently represents a bond, —O—, —C(O)—, —C(O)O—, —OC(O)—, or —C(O)NR 3 -, -NR 3 C(O)-, -NR 3 -,-SO2NR 3 -, -NR 3 SO2-, -S-, -SO2-, -SO2O-, -OSO2-, -NR 3 SO2NR 4 -, -NR 3 C(O)NR 4 -, -NR 3 C(O)O- or -OC(O)NR 3 - selected from L 3 is selected from a bond, C1-C4 alkylene, C2-C4 alkenylene, or C2-C4 alkynylene, wherein: L 3Any of the alkylene, alkenylene, or alkynylene groups in the formula (I) may be selected from halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 6 R 7 , -NR 6 C(O)R 7 , -NR 6 R 7 , -SO2NR 6 R 7 , -NR 6 SO2R 7 , -SR 6 , -SO2R 6 , -SO2OR 6 , -OSO2R 6 , -NR 6 SO2NR 7 R 8 , -NR 6 C(O)NR 7 R 8 , -NR 6 C(O)OR 7 , or OC(O)NR 6 R 7 and optionally substituted by 1 or 2 substituents independently selected from X, Y, and Z are each independently selected from a bond or a 3-12 membered ring system containing 0, 1, 2, or 3 heteroatoms selected from N, O, or S in the ring system, wherein: Any of the ring systems in X, Y, and Z may be selected from halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 4 R 5 , -NR 3 C(O)R 4 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2R4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -R 3 C(O)NR 4 R 5 , -NR 3 C(O)OR 4 , or OC(O)NR 4 R 5 and optionally substituted with 1, 2, or 3 substituents independently selected from R 1 is selected from hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or a 3-12 membered ring system (e.g., cycloalkyl, heterocyclyl, aryl, or heteroaryl) containing 0, 1, 2, or 3 heteroatoms selected from N, O, or S in the ring system, wherein: R 1 Any of the alkyl, alkenyl, or alkynyl groups in the formula (I) may be selected from halo, cyano, amino, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 4 R 5 , -NR 3 C(O)R 4 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -NR 3 C(O)NR 4 R 5 , -NR 3C(O)OR 4 , or OC(O)NR 4 R 5 and R 1 Any of the ring systems in the ring system may be halo, cyano, oxo, hydroxy, carboxy, or R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 4 R 5 , -NR 3 C(O)R 4 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -NR 3 C(O)NR 4 R 5 , -NR 3 C(O)OR 4 , or OC(O)NR 4 R 5 and optionally substituted with 1, 2, or 3 substituents independently selected from R 2 is independently selected at each occurrence from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or C3-C6 cycloalkyl, wherein: R 2 Any of the alkyl, alkenyl, alkynyl, or cycloalkyl groups in the formula (I) may be selected from halo, cyano, oxo, R 2a , -OR 2a , -C(O)R 2a , -C(O)OR 2a , -OC(O)R 2a , -C(O)NR 2a R2b , -NR 2a C(O)R 2b , -NR 2a R 2b , -SO2NR 2a R 2b , -NR 2a SO2R 2b , -SR 2a , -SO2R 2a , -SO2OR 2a , -OSO2R 2a , -NR 2a SO2NR 2b R 2c , -NR 2a C(O)NR 2b R 2c , -NR 2a C(O)OR 2b , or OC(O)NR 2a R 2b and optionally substituted with 1, 2, or 3 substituents independently selected from R 2a , R 2b , and R 2c is independently selected at each occurrence from hydrogen or unsubstituted C1-C4 alkyl; R 3 , R 4 , and R 5 is independently selected at each occurrence from hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, wherein: R 3 , R 4 , and R 5 Any alkyl or cycloalkyl in the formula (I) may be halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , or C(O)OR 2 and R 4 is optionally substituted C1-C6 alkyl and R 5 is optionally substituted C1-C6 alkyl, R 4 and R 5 is -C(O)NR4 R 5 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2NR 4 R 5 , -R 3 C(O)NR 4 R 5 , or OC(O)NR 4 R 5 together with the nitrogen atom to which they are attached may form a 3- to 6-membered heterocycloalkyl; R 6 , R 7 , and R 8 is independently selected at each occurrence from hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, wherein: R 6 , R 7 , and R 8 Any alkyl or cycloalkyl in the formula (I) may be halo, cyano, oxo, hydroxy, carboxy, R 2a , -OR 2a , -C(O)R 2a , -C(O)OR 2a , -C(O)NR 2a R 2b , -NR 2a C(O)R 2b , -NR 2a R 2b , -SO2NR 2a R 2b , -NR 2a SO2R 2b , -SR 2a , -SO2R 2a , -SO2OR 2a , -OSO2R 2a , -NR 2 SO2NR 2a R 2b , -NR 2a C(O)NR 2b R 2c , -NR 2a C(O)OR 2b , or OC(O)NR 2a R 2band optionally substituted with 1, 2, or 3 substituents independently selected from However, L 2 , Y., L. 3 and at least one of Z is not a bond; provided that —SO—(CH)—NH in Formula Ia is linked to the remainder of the compound of Formula Ia through a carbon atom; However, when X is a bond, L 1 is a bond, -C(O)-, -OC(O)-, -NR 3 C(O)-, -NR 3 selected from SO2-, -SO2-, and OSO2-; However, when Y is a bond, L 2 is a bond, -C(O)-, -C(O)O-, -C(O)NR 3 -,-SO2NR 3 -, -SO2-, and -SO2O-; and However, the compound is [ka] isn't it.

[0116] In compounds of formula (I) or (Ia), when Y is a bond, L 2 is a bond, -C(O)-, -C(O)O-, -C(O)NR 3 -,-SO2NR 3 -, -SO2-, and SO2O, and in particular L 2 is selected from a bond, —C(O)—, —C(O)O—, —C(O)NH—, —SO 2 NH—, —SO 2 —, and SO 2 O.

[0117] In the compounds of formula (I) or (Ia), when X is a bond, L 1 is a bond, -C(O)-, -OC(O)-, -NR 3 C(O)-, -NR 3 selected from SO2-, -SO2-, and OSO2-, in particular L 1 is selected from a bond, —C(O)—, —OC(O)—, —NHC(O)—, —NHSO2—, —SO2—, and OSO2—.

[0118] In some embodiments of the compounds disclosed herein, the compound of Formula I has the formula (Ib): [ka] It is a compound of the structure:

[0119] In some embodiments of compounds of Formula (I) or (Ia), X is a bond and L 1 When is a bond, R 1 is not hydrogen.

[0120] In embodiments, the compound of formula (I) or (Ia) has formula (II): [ka] or a pharmaceutically acceptable salt thereof.

[0121] In embodiments, the compound of Formula (I) or (Ia) has the formula (III): [ka] or a pharmaceutically acceptable salt thereof.

[0122] In embodiments, the compound of formula (I) or (Ia) has formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1b and R 1c taken together form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring; R 1b and R 1c The heterocycloalkyl formed by is selected from halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 4 R 5 , -NR 3 C(O)R 4 , -NR3R4, -SO2NR3R4, -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR2SO2NR4R5, -NR 3 C(O)NR 4 R 5 , -NR 3 C(O)OR 4 , or OC(O)NR 4 R 5 and optionally substituted with 1, 2, or 3 substituents independently selected from:

[0123] In an embodiment of the compound of formula (IV), R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 -SO2OR 3 , or OSO2R 3 (In the formula, R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0124] In an embodiment of the compound of formula (IV), R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1bThe heterocycloalkyl formed by 3 (where R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0125] In embodiments, the compound of Formula (I) or (Ia) has the formula (V): [ka] or a pharmaceutically acceptable salt thereof.

[0126] In embodiments, the compound of formula (I) or (Ia) has formula (VI): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3 (where R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0127] In embodiments, the compound of formula (I) or (Ia) has formula (VII): [ka] or a pharmaceutically acceptable salt thereof.

[0128] In embodiments, the compound of Formula (I) or (Ia) has the formula (VIII): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3 (where R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0129] In embodiments, the compound of formula (I) or (Ia) has formula (IX): [ka] or a pharmaceutically acceptable salt thereof.

[0130] In embodiments, the compound of formula (I) or (Ia) has formula (X): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1 is C1-C6 alkyl optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy, and specifically R 1 is unsubstituted C1-C6 alkyl or C1-C6 alkyl substituted by hydroxy, more particularly R1 is unsubstituted C1-C4 alkyl.

[0131] In embodiments, the compound of formula (I) or (Ia) has formula (XI): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3 (where R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0132] In embodiments, the compound of formula (I) or (Ia) has formula (XII): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1 is C1-C6 alkyl optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy, and specifically R 1 is unsubstituted C1-C6 alkyl or C1-C6 alkyl substituted by hydroxy, more particularly R 1 is unsubstituted C1-C4 alkyl.

[0133] In embodiments, the compound of Formula (I) or (Ia) has the formula (XIII): [ka] or a pharmaceutically acceptable salt thereof.

[0134] In embodiments, the compound of formula (I) or (Ia) has formula (XIV): [ka] or a pharmaceutically acceptable salt thereof.

[0135] In embodiments, the compound of formula (I) or (Ia) has formula (XV): [ka] or a pharmaceutically acceptable salt thereof.

[0136] In embodiments, the compound of formula (I) or (Ia) has formula (XVI): [ka] or a pharmaceutically acceptable salt thereof.

[0137] In embodiments, the compound of formula (I) or (Ia) has formula (XVII): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3 (where R 3 is unsubstituted C1-C6 alkyl, specifically R3 is unsubstituted C1-C4 alkyl).

[0138] In embodiments, the compound of formula (I) or (Ia) has formula (XVIII): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1 is C1-C6 alkyl optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy, and specifically R 1 is unsubstituted C1-C6 alkyl or C1-C6 alkyl substituted by hydroxy, more particularly R 1 is unsubstituted C1-C4 alkyl.

[0139] In embodiments, the compound of formula (I) or (Ia) has formula (XIX): [ka] or a pharmaceutically acceptable salt thereof.

[0140] In embodiments, the compound of Formula (I) or (Ia) has the formula (XX): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3(where R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0141] In embodiments, the compound of formula (I) or (Ia) has formula (XXI): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3 (where R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0142] In embodiments, the compound of formula (I) or (Ia) has formula (XXII): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1 is C1-C6 alkyl optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy, and specifically R 1 is unsubstituted C1-C6 alkyl or C1-C6 alkyl substituted by hydroxy, more particularly R 1 is unsubstituted C1-C4 alkyl.

[0143] In embodiments, the compound of Formula (I) or (Ia) has the formula (XXIII): [ka] or a pharmaceutically acceptable salt thereof, wherein R 1 is C1-C6 alkyl optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy, and specifically R 1 is unsubstituted C1-C6 alkyl or C1-C6 alkyl substituted by hydroxy, more particularly R 1 is unsubstituted C1-C4 alkyl.

[0144] In embodiments, the compound of formula (I) or (Ia) has formula (XXIV): [ka] is a compound of the structure m and n are each independently selected from 2 or 3; formula [ka] The cyclic diamine moiety of -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 1 is a bond, -C(O)-, -C(O)O-, -C(O)NR 3 - (e.g., -C(O)NH-), -SO2NR 3 - (e.g., -SO2NH-), -SO2-, or -SO2O-, and in particular L1 is selected from a bond or C(O)—, more particularly L 1 is a bond, L 2 is selected from a bond, —O—, —C(O)—, or C(O)NH—; one of X and Y is unsubstituted phenyl or unsubstituted 5-6 membered heteroaryl, and one of X and Y is a bond; However, when Y is a bond, L 2 is selected from a bond, —C(O)—, or —C(O)NH—; However, when X is a bond, L 1 is -C(O)-, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is selected from a bond, C-C cycloalkyl, C-C heterocycloalkyl, phenyl, or 5-6 membered heteroaryl; Any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy; Any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O, or S in the ring; and R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3 (where R3 is unsubstituted C1-C4 alkyl).

[0145] In specific embodiments of compounds of Formula (XXIV), X is unsubstituted phenyl or unsubstituted 5-6 membered heteroaryl, Y is a bond, and Z is a bond.

[0146] In further specific embodiments of compounds of Formula (XXIV), X is unsubstituted phenyl, Y is a bond, and Z is a bond.

[0147] In embodiments, the compound of Formula (I) or (Ia) has the formula (XXV): [ka] or a pharmaceutically acceptable salt thereof, wherein m and n are each independently selected from 2 or 3; formula [ka] The cyclic diamine moiety of -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is selected from a bond, —C(O)—, or —C(O)NH—; X is unsubstituted phenyl or unsubstituted 5-6 membered heteroaryl; L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is selected from a bond, C-C cycloalkyl, C-C heterocycloalkyl, phenyl, or 5-6 membered heteroaryl; Any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy; Any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O, or S in the ring; and R 1 is C1-C6 alkyl optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy, and specifically R 1 is unsubstituted C1-C6 alkyl or C1-C6 alkyl substituted by hydroxy, more particularly R 1 is unsubstituted C1-C4 alkyl.

[0148] In specific embodiments of compounds of Formula (XXV), X is unsubstituted phenyl and Z is a bond or unsubstituted phenyl.

[0149] In further specific embodiments of compounds of Formula (XXV), X is unsubstituted phenyl and Z is a bond.

[0150] In embodiments, the compound of formula (I) or (Ia) has formula (XXVI): [ka] or a pharmaceutically acceptable salt thereof.

[0151] In certain embodiments of Formula (XXVI), X is phenyl.

[0152] Particular embodiments of the present invention include, for example, compounds of the present invention 、 For example, a compound of any one of formulas (I) to (XXVI) 、 or a pharmaceutically acceptable salt thereof, wherein, unless otherwise specified, R 1 , R 2 , R 2a , R 2b , R 2c , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 12 , L 1 , L 2 , L 3 Each of X, Y, Z, m, n, o, p and the cyclic diamine moiety is as defined in the above or subsequent paragraphs (1) to (1 21 ) has any of the meanings defined in any one or more of the following: 1. Two ring carbon atoms of the cyclic diamine moiety are linked by a bond to form a fused cyclic diamine moiety, preferably the ring carbon atoms of the cyclic diamine moiety are unsubstituted, e.g. [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 is. 2. The two ring carbon atoms of the cyclic diamine moiety are -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4) to form a non-fused bridged cyclic diamine moiety, preferably the ring carbon atoms of the cyclic diamine moiety are unsubstituted, e.g., [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 is. 3. The cyclic diamine moiety is a non-fused, non-bridged cyclic diamine moiety, preferably the ring carbon atoms of the cyclic diamine moiety are unsubstituted, e.g. [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 is. 4. The cyclic diamine moiety is a 6- to 8-membered cyclic diamine moiety, and preferably the ring carbon atoms of the cyclic diamine moiety are unsubstituted. 5. The ring carbon atoms of the cyclic diamine moiety are unsubstituted. 6. The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~2 alkyl), and preferably the ring carbon atoms of the cyclic diamine moiety are unsubstituted. 7. The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~2 alkyl, and o is 1, 2, or 3 (particularly o is 1 or 2), and preferably the ring carbon atoms of the cyclic diamine moiety are unsubstituted. 8. The cyclic diamine moiety is -(CR 9 R 10 ) o Preferably the ring carbon atoms of the cyclic diamine moiety are unsubstituted, bridged by - (where o is 1 or 2). 9. The cyclic diamine moiety is -(CR 9 R 10 ) o - (where o is 1 or 2 and R 9 and R 10 is bridged by a cyclic diamine moiety, wherein each occurrence is independently selected from hydrogen and methyl, and preferably the ring carbon atoms of the cyclic diamine moiety are unsubstituted. 10. The cyclic diamine moiety is -CR 9 R 10 -(where R 9 and R 10 are each independently H and unsubstituted C 1~2 alkyl), for example, the cyclic diamine moieties are bridged by —CH—, —CH(CH)—, or —C(CH)—, and preferably the ring carbon atoms of the cyclic diamine moieties are unsubstituted. 11. The cyclic diamine moiety is -(CR9R10)2- (where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~2 alkyl), for example, the cyclic diamine moieties are bridged by -(CH2)2-, -CH2CH(CH3)-, -CH2C(CH3)2-, -CH2CH(CH2CH3)-, or CH2C(CH2CH3)2-, preferably the ring carbon atoms of the cyclic diamine moieties are unsubstituted. 12. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] is selected from. 13. Expression [ka] (where * is -YL 2 -L3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] and in particular [ka] is selected from. 14. Expression [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] is selected from. 15. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] is. 16. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] (where * is -YL 2 -L 3-Z represents the point of attachment to the SO2-CH2CH2-NH2, and L 4 is -(CR 9 R 10 ) o -(where R 9 and R 10 are, independently for each occurrence, H and C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2). is. 17. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to the SO2-CH2CH2-NH2, and L 4 is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2). is selected from. 18. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] is selected from. 19. Formula [ka] The cyclic diamine portion of [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to the SO2-CH2CH2-NH2, and L 4 is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2). is 20. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] is selected from. 21. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] is. 22. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] is selected from. 23 formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine moieties of are linked via a spiro carbon atom. 24. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 are linked through a spiro carbon atom, and n and m are independently selected from 3 and 4. 25. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 are linked through a spiro carbon atom, and n and m are both 3, or n and m are both 4. 26. Formula [ka] (where * is -YL 2 -L 3 -Z represents the point of attachment to -SO2-CH2CH2-NH2 The cyclic diamine portion of [ka] is selected from. 27. m and n are each independently selected from 2 or 3; for example, m is 2 and n is 2, or m is 3 and n is 2, or m is 3 and n is 3. 28. R 1 is selected from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or a 3-12 membered ring system (e.g., cycloalkyl, heterocyclyl, aryl, or heteroaryl) containing 0, 1, 2, or 3 heteroatoms selected from N, O, or S in the ring system, where R 1 Any of the alkyl, alkenyl, or alkynyl groups in the formula (I) may be selected from halo, cyano, amino, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , or OC(O)R 2 and R 1 Any of the ring systems in the ring system may be halo, cyano, oxo, hydroxy, carboxy, or R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 4 R 5 , -NR 3 C(O)R 4 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -NR 3 C(O)NR 4 R5 , -NR 3 C(O)OR 4 , or C(O)NR 4 R 5 and optionally substituted with 1, 2, or 3 substituents independently selected from: 29. R 1 is selected from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocyclyl (e.g., 3- to 7-membered heterocycloalkyl), phenyl, or 5- or 6-membered heteroaryl, wherein R 1 Any heterocyclyl or heteroaryl in R contains 1, 2, or 3 heteroatoms selected from N, O, or S in the ring; 1 The alkyl, alkenyl, or alkynyl in the formula (I) may be halo, cyano, amino, oxo, hydroxy, carboxy, or R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , or OC(O)R 2 and R 1 Any of the cycloalkyl, heterocyclyl, phenyl, or heteroaryl in R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 4 R 5 , -NR 3 C(O)R 4 , -NR 4 R 5 , -SO2NR 4 R 5 , -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R5 , -NR 3 C(O)NR 4 R 5 , -NR 3 C(O)OR 4 , or C(O)NR 4 R 5 and optionally substituted with 1, 2, or 3 substituents independently selected from: 30. R 1 is selected from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocyclyl (e.g., 3- to 7-membered heterocycloalkyl), phenyl, or 5- or 6-membered heteroaryl, wherein R 1 Any heterocyclyl or heteroaryl in R contains 1, 2, or 3 heteroatoms selected from N, O, or S in the ring; 1 The alkyl, alkenyl, or alkynyl in the formula (I) may be halo, cyano, amino, oxo, hydroxy, carboxy, or R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , or OC(O)R 2 and R 1 Any of the cycloalkyl, heterocyclyl, phenyl, or heteroaryl in R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , or OC(O)R 2 and optionally substituted with 1, 2, or 3 substituents independently selected from: 31. R 1 is selected from C1-C6 alkyl, C3-C6 cycloalkyl, or 3-7 membered heterocycloalkyl, where R 1 Any heterocycloalkyl in R contains 1 or 2 heteroatoms selected from N, O, or S in the ring; 1Any of the alkyls in the formula may be halo, cyano, amino, oxo, hydroxy, carboxy, or R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , or OC(O)R 2 and R 1 Any cycloalkyl or heterocycloalkyl in the formula (I) may be halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , or OC(O)R 2 and R 2 is unsubstituted C1-C6 alkyl, specifically R 2 is unsubstituted C1-C4 alkyl. 32. R 1 is selected from C1-C6 alkyl, C3-C6 cycloalkyl, or 3-7 membered heterocycloalkyl, where R 1 Any heterocycloalkyl in R contains 1 or 2 heteroatoms selected from N, O, or S in the ring; 1 Any alkyl in R may be optionally substituted with one or two substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy, and R 1 Any cycloalkyl or heterocycloalkyl therein may be optionally substituted with one or two substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy. 33. R 1 is C1-C6 alkyl optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy. 34. R 1is C1-C6 alkyl optionally substituted with 1 or 2 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy. 35. R 1 is C1-C6 alkyl optionally substituted with one substituent selected from halo, cyano, amino, oxo, hydroxy, or carboxy, and specifically R 1 is C1-C6 alkyl optionally substituted with hydroxy or carboxy. 36. R 1 is unsubstituted C1-C6 alkyl or C1-C6 alkyl substituted with hydroxy. 37. R 1 is unsubstituted C1-C4 alkyl or C1-C4 alkyl substituted with hydroxy. 38. R 1 is an unsubstituted C1-C4 alkyl. 39. R 1 is -NR 1a R 1b and R 1a and R 1b together with the nitrogen atom to which they are attached, (where * represents the point of attachment to the rest of the compound) [ka] Form. 40. R 1 is -NR 1a R 1b and R 1a and R 1b together with the nitrogen atom to which they are attached, [ka] (where * represents the point of attachment to the rest of the compound) Form. 41. R 2is independently selected at each occurrence from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or C3-C6 cycloalkyl, wherein R 2 Any of the alkyl, alkenyl, alkynyl, or cycloalkyl groups in the formula (I) may be selected from halo, cyano, oxo, R 2a , -OR 2a , -C(O)R 2a , -C(O)OR 2a , or OC(O)R 2a and optionally substituted with 1, 2, or 3 substituents independently selected from: 42. R 2 is independently selected at each occurrence from unsubstituted C1-C6 alkyl, unsubstituted C2-C6 alkenyl, or C2-C6 alkynyl. 43. R 2 is independently selected at each occurrence from unsubstituted C1-C6 alkyl or unsubstituted C2-C6 alkenyl. 44. R 2 is independently selected at each occurrence from unsubstituted C1-C6 alkyl or unsubstituted C3-C6 cycloalkyl. 45. R 2 is independently selected at each occurrence from C1-C6 alkyl, where R 2 Any alkyl in the group may be halo, cyano, oxo, or R 2a , -OR 2a , -C(O)R 2a , -C(O)OR 2a , or OC(O)R 2a and optionally substituted with 1, 2, or 3 substituents independently selected from: 46. ​​R 2 is independently selected at each occurrence from unsubstituted C1-C6 alkyl, specifically unsubstituted C1-C4 alkyl. 47. R 3 , R 4 , and R 5 is independently selected at each occurrence from hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, where R 3 , R 4 , and R 5Any alkyl or cycloalkyl in the formula (I) may be halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , or C(O)OR 2 and optionally substituted with 1, 2, or 3 substituents independently selected from: 48. R 3 , R 4 , and R 5 is independently selected at each occurrence from hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, where R 3 , R 4 , and R 5 Any alkyl or cycloalkyl in the formula (I) may be halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , or C(O)OR 2 and R 2 is selected from unsubstituted C1-C6 alkyl, in particular unsubstituted C1-C4 alkyl. 49. R 3 , R 4 , and R 5 is independently selected at each occurrence from hydrogen or C1-C6 alkyl, where R 3 , R 4 , and R 5 Any alkyl therein may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, and carboxy. 50. R 3 , R 4 , and R 5 is, for each occurrence, hydrogen. 51. R 6 , R 7 , and R 8 is independently selected at each occurrence from hydrogen or C1-C6 alkyl, where R 6 , R 7 , and R 8Any of the alkyls in the formula may be halo, cyano, oxo, hydroxy, carboxy, or R 2a , -OR 2a , -C(O)R 2a , -C(O)OR 2a , -C(O)NR 2a R 2b , -NR 2a C(O)R 2b , -NR 2a R 2b , -SO2NR 2a R 2b , -NR 2a SO2R 2b , -SR 2a , -SO2R 2a , -SO2OR 2a , -OSO2R 2a , -NR 2 SO2NR 2a R 2b , -NR 2a C(O)NR 2b R 2c , -NR 2a C(O)OR 2b , or OC(O)NR 2a R 2b and optionally substituted with 1, 2, or 3 substituents independently selected from: 52. R 6 , R 7 , and R 8 is independently selected at each occurrence from hydrogen or C1-C6 alkyl, where R 6 , R 7 , and R 8 Any of the alkyls in the formula may be halo, cyano, oxo, hydroxy, carboxy, or R 2a , -OR 2a , -C(O)R 2a , -C(O)OR 2a , -C(O)NR 2a R 2b , -NR 2a C(O)R 2b , -NR 2a R 2b , -NR 2a C(O)NR 2b R 2c , -NR 2a C(O)OR2b , or OC(O)NR 2a R 2b and optionally substituted with 1, 2, or 3 substituents independently selected from: 53. R 6 , R 7 , and R 8 is independently selected at each occurrence from hydrogen or C1-C6 alkyl, where R 6 , R 7 , and R 8 Any of the alkyl groups in the formula (I) may be halo, cyano, oxo, hydroxy, carboxy, -OR, or 2a , -C(O)R 2a , -C(O)OR 2a , -C(O)NR 2a R 2b , -NR 2a C(O)R 2b , -NR 2a C(O)NR 2b R 2c , -NR 2a C(O)OR 2b , or OC(O)NR 2a R 2b and optionally substituted with 1, 2, or 3 substituents independently selected from: 54. R 6 , R 7 , and R 8 is independently selected at each occurrence from hydrogen or C1-C6 alkyl, where R 6 , R 7 , and R 8 Any alkyl in the formula may be halo, cyano, oxo, carboxy, -C(O)R 2a , -C(O)OR 2a , -C(O)NR 2a R 2b , -NR 2a C(O)R 2b , -NR 2a C(O)NR 2b R 2c , -NR 2a C(O)OR 2b , or OC(O)NR 2a R 2band optionally substituted with 1, 2, or 3 substituents independently selected from: 55. R 6 , R 7 , and R 8 is independently selected at each occurrence from hydrogen or C1-C6 alkyl, where R 6 , R 7 , and R 8 Any alkyl in the formula may be halo, cyano, oxo, carboxy, -C(O)R 2a , -C(O)OR 2a , -NR 2a C(O)R 2b , or NR 2a C(O)OR 2b and optionally substituted with 1, 2, or 3 substituents independently selected from: 56. R 6 , R 7 , and R 8 is independently selected at each occurrence from hydrogen or C1-C6 alkyl, where R 6 , R 7 , and R 8 The alkyl in each group is oxo, carboxy, or -C(O)R 2a , -C(O)OR 2a , -NR 2a C(O)R 2b , or NR 2a C(O)OR 2b and optionally substituted with 1, 2, or 3 substituents independently selected from: 57. R6, R7, and R8, at each occurrence, are independently selected from hydrogen or C1-C6 alkyl, where R 6 , R 7 , and R 8 The alkyl in each group is oxo, carboxy, or -C(O)R 2a , or C(O)OR 2a and optionally substituted with 1, 2, or 3 substituents independently selected from: 58. R 6 , R 7 , and R 8is independently selected at each occurrence from hydrogen or unsubstituted C1-C6 alkyl, specifically hydrogen or unsubstituted C1-C4 alkyl. 59. R 2 is independently selected at each occurrence from unsubstituted C1-C6 alkyl or unsubstituted C2-C6 alkenyl; R 3 , R 4 , and R 5 is independently selected at each occurrence from hydrogen or C1-C6 alkyl, where R 3 , R 4 , and R 5 any alkyl in which may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, carboxy; and R 6 , R 7 , and R 8 is independently selected at each occurrence from hydrogen or C1-C6 alkyl, where R 6 , R 7 , and R 8 Any of the alkyl groups in the formula (I) may be halo, cyano, oxo, hydroxy, carboxy, -OR, or 2a , -C(O)R 2a , -C(O)OR 2a , -NR 2a C(O)R 2b , or NR 2a C(O)OR 2b and optionally substituted with 1, 2, or 3 substituents independently selected from: 60. X and Y are each independently selected from a bond, phenyl, or 5- to 6-membered heteroaryl, and the phenyl or 5- to 6-membered heteroaryl in X or Y is not halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 3 R 4 , -NR 3 C(O)R 4 , -NR 3 R4 , -SO2NR 3 R 4 , -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -NR 3 C(O)NR 4 R 5 , -NR 3 C(O)OR 4 , or -OC(O)NR 3 It may be optionally substituted with 1, 2, or 3 substituents independently selected from R4. 61. X, Y, and Z are each independently selected from a bond, phenyl, or 5- to 6-membered heteroaryl, and any phenyl or 5- to 6-membered heteroaryl in X, Y, or Z is not selected from halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 3 R 4 , -NR 3 C(O)R 4 , -NR 3 R 4 , -SO2NR 3 R 4 , -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -NR 3 C(O)NR 4 R 5 , -NR 3 C(O)OR 4 , or -OC(O)NR 3 R 4and optionally substituted with 1, 2, or 3 substituents independently selected from: 62. X, Y, and Z are each independently selected from a bond, phenyl, or 5- to 6-membered heteroaryl, and any phenyl or 5- to 6-membered heteroaryl in X, Y, or Z is not selected from halo, cyano, oxo, hydroxy, carboxy, R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 3 R 4 , -NR 3 C(O)R 4 , -NR 3 R 4 , -SO2NR 3 R 4 , -NR 3 SO2R 4 , -SR 3 , -SO2R 3 , -SO2OR 3 , -OSO2R 3 , -NR 3 SO2NR 4 R 5 , -NR 3 C(O)NR 4 R 5 , -NR 3 C(O)OR 4 , or -OC(O)NR 3 R 4 and optionally substituted with one or more substituents independently selected from: 63. At least one of X, Y, and Z is selected from optionally substituted phenyl or optionally substituted 5- or 6-membered heteroaryl, and at least one of X, Y, and Z is a bond. 64. At least one of X, Y, and Z is selected from unsubstituted phenyl or unsubstituted 5- or 6-membered heteroaryl, and at least one of X, Y, and Z is a bond. 65. At least one of X, Y, and Z is unsubstituted phenyl, and at least one of X, Y, and Z is a bond. 66. One of X and Y is unsubstituted phenyl or unsubstituted 5-6 membered heteroaryl, and one of X and Y is a bond. 67. One of X and Y is unsubstituted phenyl, and one of X and Y is a bond. 68. X is selected from a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl. 69. X is an unsubstituted 5-membered heteroaryl, for example, pyrrolyl, furanyl, thienyl, imidazolyl, furazanyl, oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, triazolyl, or tetrazolyl. 70. X is unsubstituted 6-membered heteroaryl, for example, pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl, and triazinyl. 71. X is selected from a bond or unsubstituted phenyl. 72. X is unsubstituted phenyl. 73. X is a bond and L 1 is a bond, -C(O)-, -OC(O)-, -NR 3 C(O)-, -NR 3 selected from SO2-, -SO2-, and OSO2-, in particular L 1 is selected from —C(O)— or —NHC(O)—. 74. X is a bond and L 1 When is a bond, R 1 is not hydrogen. 75. X is unsubstituted phenyl, Y is a bond, and L 2 is a bond, -C(O)-, -C(O)O-, -C(O)NR 3 -,-SO2NR 3 -, -SO2-, or -SO2O-, and in particular L 2 is selected from —C(O)— or —C(O)NH—. 76. X is a bond, Y is unsubstituted phenyl, and L 1 is a bond, -C(O)-, -OC(O)-, -NR 3 C(O)-, -NR 3selected from SO2-, -SO2-, or -OSO2-, in particular L 1 is selected from —C(O)— or —NHC(O)—. 77. Y is selected from a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl. 78. Y is an unsubstituted 5-membered heteroaryl, for example, pyrrolyl, furanyl, thienyl, imidazolyl, furazanyl, oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, triazolyl, or tetrazolyl. 79. Y is unsubstituted 6-membered heteroaryl, for example, pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl, and triazinyl. 80. Y is selected from a bond or unsubstituted phenyl. 81. Y is unsubstituted phenyl. 82. Y is a bond and L 2 is a bond, -C(O)-, -C(O)O-, -C(O)NR 3 -,-SO2NR 3 -, -SO2-, or -SO2O-, and in particular L 2 is selected from —C(O)— or —C(O)NH—. 83. Z is selected from a bond, a C3-C6 cycloalkyl, a C3-C6 heterocycloalkyl, a phenyl, or a 5-6 membered heteroaryl, wherein any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z is optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy, and any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O, or S in the ring. 84. Z is selected from a bond, unsubstituted C3-C6 cycloalkyl, unsubstituted C3-C6 heterocycloalkyl, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl. 85. Z is an unsubstituted C3-C6 heterocycloalkyl, for example, cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl. 86. Z is an unsubstituted C3-C6 heterocycloalkyl, for example, azetidinyl, tetrahydrofuranyl, tetrahydropyranyl, pyrrolidinyl, morpholinyl, tetrahydrothienyl, thiomorpholinyl, piperidinyl, or piperazinyl. 87. Z is an unsubstituted 5-membered heteroaryl, for example, pyrrolyl, furanyl, thienyl, imidazolyl, furazanyl, oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, triazolyl, or tetrazolyl. 88. Z is unsubstituted 6-membered heteroaryl, for example, pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl, and triazinyl. 89. Z is selected from a bond or unsubstituted phenyl. 90. Z is unsubstituted phenyl. 91. Z is a bond. 92. X is unsubstituted phenyl, Y is a bond, Z is a bond, and L 2 is a bond, -C(O)-, -C(O)O-, -C(O)NR 3 -,-SO2NR 3 -, -SO2-, or -SO2O-, and in particular L 2 is selected from —C(O)— or —C(O)NH—. 93. X is unsubstituted phenyl, Y is unsubstituted phenyl, and Z is a bond. 94. X is unsubstituted phenyl, Y is a bond, Z is unsubstituted phenyl, and L 2 is a bond, -C(O)-, -C(O)O-, -C(O)NR 3 -,-SO2NR 3 -, -SO2-, or -SO2O-, and in particular L 2 is selected from a bond, —C(O)—, or —C(O)NH—. 95. X is a bond, Y is an unsubstituted phenyl, Z is a bond, and L 1 is a bond, -C(O)-, -OC(O)-, -NR 3 C(O)-, -NR 3 selected from SO2-, -SO2-, or OSO2-, in particular L 1 is selected from —C(O)— or —NHC(O)—. 96. X is a bond, Y is a bond, Z is unsubstituted phenyl, and L 1 is a bond, -C(O)-, -OC(O)-, -NR 3 C(O)-, -NR 3 selected from SO2-, -SO2-, or OSO2-, in particular L 1 is selected from a bond, —C(O)—, or —NHC(O)—, and L 2 is a bond, -C(O)-, -C(O)O-, -C(O)NR 3 -,-SO2NR 3 -, -SO2-, or -SO2O-, and in particular L 2 is selected from a bond, —C(O)—, or —C(O)NH—. 97. X is a bond, Y is an unsubstituted phenyl, Z is an unsubstituted phenyl, and L 1 is a bond, -C(O)-, -OC(O)-, -NR 3 C(O)-, -NR 3 selected from SO2-, -SO2-, or OSO2, in particular L 1 is selected from —C(O)— or —NHC(O)—. 98. L 1 is a bond, -O-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)NR 3 -, -NR 3 C(O)-, or SO2-, and in particular L 1 is selected from a bond, —O—, —C(O)—, —C(O)O—, —OC(O)—, —C(O)NH—, —NHC(O)—, or SO2—. 99. L 1 is selected from a bond, —O—, —C(O)—, —C(O)NH—, or SO2—. 100. L 1 is selected from a bond, —O—, —C(O)—, or —C(O)NH—. 101. L 1 is selected from a bond or O—, and particularly L 1 is -O-. 102. L 2 is a bond, -O-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)NR 3 - or NR 3 C(O)-, and in particular L 2 is selected from a bond, —O—, —C(O)—, —C(O)O—, —OC(O)—, —C(O)NH—, or NHC(O)—. 103. L 2 is selected from a bond, —O—, —C(O)—, or —C(O)NH—. 104. L 2 is selected from a bond, —C(O)—, or —C(O)NH—. 105. L 2 is selected from a bond or C(O)—, and in particular L 2 is -C(O)-. 106. L 3 is selected from a bond or C1-C4 alkylene, where L 3 The alkylene in each group is halo, cyano, oxo, hydroxy, carboxy, or R 2 , -OR 2 , -C(O)R 2 , -C(O)OR 2 , -OC(O)R 2 , -C(O)NR 6 R 7 , -NR 6 C(O)R 7 , -NR 6 R 7 , -SO2NR 6 R 7 , -NR 6 SO2R 7 , -SR 6 , -SO2R 6 , -SO2OR 6 , -OSO2R 6 , -NR 6 SO2NR7 R 8 , -NR 6 C(O)NR 7 R 8 , -NR 6 C(O)OR 7 , or OC(O)NR 6 R 7 and optionally substituted with one or two substituents independently selected from L 3 Any alkylene in the formula (I) is a C1-C4 alkylene substituted with one or two halo (e.g., F) or one or two C 1~4 Halo and unsubstituted C alkylene, such as C-C alkylene substituted with alkyl (e.g., methyl). 1~4 It may be optionally substituted with one or two substituents independently selected from alkyl. 107. L 3 is a bond, unsubstituted C1-C4 alkylene, one or two C 1~4 It is selected from C1-C4 alkylene substituted by alkyl, or C1-C4 alkylene substituted by one or two halo (eg F). 108. L 3 is selected from a bond or unsubstituted C1-C4 alkylene. 109. L 3 is unsubstituted C1-C4 alkylene. 110. L 3 is R 2 , halo, or cyano. 111. L 3 is a C1-C4 alkylene optionally substituted with one or more substituents selected from chloro, fluoro, or methyl. 112. L 3 is R 2 or methylene optionally substituted with one or more substituents selected from halo. 113. L 3 is methylene optionally substituted with one or more substituents selected from chloro or fluoro. 114. Y is optionally substituted phenyl or optionally substituted 5-6 membered heteroaryl (optional substituents as defined above), and L 2 is a bond, -O-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)NR 3 -, -NR 3 C(O)-, -NR 3 -,-SO2NR 3 -, -NR 3 SO2-, -S-, -SO2-, -SO2O-, -OSO2-, -NR 3 SO2NR 4 -, -NR 3 C(O)NR 4 -, -NR 3 C(O)O- or -OC(O)NR 3 - is selected from. 115. Y is optionally substituted phenyl or optionally substituted 5-6 membered heteroaryl (optional substituents as defined above); L 2 is a bond, -O-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)NR 3 -, -NR 3 C(O)-, -NR 3 -,-SO2NR 3 -, -NR 3 SO2-, -S-, -SO2-, -SO2O-, -OSO2-, -NR 3 SO2NR 4 -, -NR 3 C(O)NR 4 -, -NR 3 C(O)O- or -OC(O)NR 3 - selected from, and Z is a bond. 116. Y is optionally substituted phenyl or optionally substituted 5-6 membered heteroaryl (optional substituents as defined above), and L 2 is -O-. 117. Y is optionally substituted phenyl or optionally substituted 5-6 membered heteroaryl (optional substituents as defined above), and L2 is —O— and Z is a bond. 118. Y is unsubstituted phenyl and L 2 is -O-. 119. Y is unsubstituted phenyl and L 2 is —O— and Z is a bond. 120. Y is a bond and L 2 is C(O) and L 3 is CH(F), Z is a bond, and q is 0. 121. R 9 and R 10 is independently selected at each occurrence from hydrogen and methyl.

[0153] Compounds of formula (I) In embodiments, there is provided a compound of Formula (I) or (Ia) or a pharmaceutically acceptable salt thereof: During the ceremony, m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 1 is selected from a bond, —O—, —C(O)—, or —NHC(O)—; L 2 is selected from a bond, —O—, —C(O)—, or C(O)NH—; one of X and Y is unsubstituted phenyl or unsubstituted 5-6 membered heteroaryl, and one of X and Y is a bond; However, when X is a bond, L 1 is selected from a bond, —C(O)—, or —NHC(O)—; However, when Y is a bond, L 2is selected from a bond, —C(O)—, or C(O)NH; L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is selected from a bond, C3-C6 cycloalkyl, C3-C6 heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, particularly Z is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; Any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy; Any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O, or S in the ring; and R 1 is unsubstituted C1-C6 alkyl.

[0154] Compound of formula (III) In embodiments, there is provided a compound of formula (III) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 1 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L1 is selected from a bond or O—; L 2 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 2 is selected from a bond, —C(O)—, or —C(O)NH—; Y is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; However, when Y is a bond, L 2 is selected from a bond, —C(O)—, or C(O)NH; L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 selected from C1-C4 alkylene substituted with alkyl (e.g., methyl), particularly L3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is selected from a bond, C3-C6 cycloalkyl, C3-C6 heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, particularly Z is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; Any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy; Any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O, or S in the ring; and R 1 is unsubstituted C1-C6 alkyl.

[0155] In embodiments, there is provided a compound of formula (III) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 1 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 1 is selected from a bond or O—; L 2 is selected from a bond, —C(O)—, or —C(O)NH—; Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 selected from C1-C4 alkylene substituted with alkyl (e.g., methyl), particularly L3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is a bond, and R 1 is unsubstituted C1-C6 alkyl.

[0156] In embodiments, there is provided a compound of formula (III) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 1 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 1 is selected from a bond or O—; L 2 is -C(O)-, Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is a bond, and R 1 is unsubstituted C1-C6 alkyl.

[0157] In embodiments, there is provided a compound of formula (III) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 1 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 1 is selected from a bond or O—; L 2 is -C(O)NH-, Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is a bond, and R 1is unsubstituted C1-C6 alkyl.

[0158] In embodiments, there is provided a compound of formula (III) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 1 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 1 is selected from a bond or O—; L 2 is selected from a bond, —C(O)—, or C(O)NH; Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is unsubstituted phenyl, and R 1 is unsubstituted C1-C6 alkyl.

[0159] In embodiments, there is provided a compound of formula (III) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 1 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 1 is selected from a bond or O—; L 2 is -C(O)-, Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is unsubstituted phenyl, and R 1 is unsubstituted C1-C6 alkyl.

[0160] In embodiments, there is provided a compound of formula (III) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 1 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 1 is selected from a bond or O—; L 2is -C(O)NH-, Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is unsubstituted phenyl, and R 1 is unsubstituted C1-C6 alkyl.

[0161] In embodiments, there is provided a compound of formula (III) or a pharmaceutically acceptable salt thereof: middle, L 1 is a bond and R 1 is a halogen.

[0162] Compound of formula (VIII) In embodiments, there is provided a compound of formula (VIII) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 2 is selected from a bond, —C(O)—, or —C(O)NH—; Y is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; However, when Y is a bond, L 2is selected from a bond, —C(O)—, or C(O)NH; L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is selected from a bond, C3-C6 cycloalkyl, C3-C6 heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, particularly Z is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; Any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy; Any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O, or S in the ring; and R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3 (where R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0163] In embodiments, there is provided a compound of formula (VIII) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is selected from a bond, —C(O)—, or —C(O)NH—; Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is a bond, and R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3 (where R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0164] In embodiments, there is provided a compound of formula (VIII) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is a bond or C(O)—, Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is a bond, and R 1a and R 1b are taken together to form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring, where R 1a and R 1b The heterocycloalkyl formed by the formula (I) is oxo, -SO2R 3 , -SO2OR 3 , or OSO2R 3 (where R 3 is unsubstituted C1-C6 alkyl, specifically R 3 is unsubstituted C1-C4 alkyl).

[0165] Compound of formula (IX) In embodiments, there is provided a compound of formula (IX) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is selected from a bond, —O—, —C(O)—, or —C(O)NH—; Y is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; However, when Y is a bond, L 2 is selected from a bond, —C(O)—, and —C(O)NH—; L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene, and Z is selected from a bond, C3-C6 cycloalkyl, C3-C6 heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, particularly Z is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; Any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy; Any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O, or S in the ring.

[0166] In embodiments, there is provided a compound of formula (IX) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o-(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is selected from a bond, —C(O)—, or —C(O)NH—; Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene, and Z is a bond.

[0167] In embodiments, there is provided a compound of formula (IX) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is a bond or C(O)—, Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3is selected from a bond or unsubstituted C1-C4 alkylene, and Z is a bond.

[0168] Compound of formula (X) In embodiments, there is provided a compound of formula (X) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 2 is selected from a bond, —C(O)—, or —C(O)NH—; Y is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; with the proviso that when Y is a bond, L2 is selected from a bond, —C(O)—, or —C(O)NH—; L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is selected from a bond, C3-C6 cycloalkyl, C3-C6 heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, particularly Z is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; Any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy; Any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O, or S in the ring; and R 1 is unsubstituted C1-C6 alkyl.

[0169] In embodiments, there is provided a compound of formula (X) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is —C(O)— or C(O)NH—, Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is selected from a bond, C3-C6 cycloalkyl, C3-C6 heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, particularly Z is a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl; Any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy; Any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O, or S in the ring; and R 1 is unsubstituted C1-C6 alkyl.

[0170] In embodiments, there is provided a compound of formula (X) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is —C(O)— or C(O)NH—, Y is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene; Z is a bond, and R 1 is unsubstituted C1-C6 alkyl.

[0171] Compound of formula (XIX) In embodiments, there is provided a compound of formula (XIX) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; X is unsubstituted phenyl; L 1 is selected from a bond, —O—, —C(O)—, or —C(O)NH—, and particularly L 1 is selected from a bond or O—; L 2 is selected from a bond, —C(O)—, or —C(O)NH—; L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene, and R 1 is unsubstituted C1-C6 alkyl.

[0172] Compound of formula (XXII) In embodiments, there is provided a compound of formula (XXII) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is selected from a bond, —C(O)—, or —C(O)NH—; L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene, and R 1 is unsubstituted C1-C6 alkyl.

[0173] In embodiments, there is provided a compound of formula (XXII) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is -C(O)-, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene, and R 1 is unsubstituted C1-C6 alkyl.

[0174] In embodiments, there is provided a compound of formula (XXII) or a pharmaceutically acceptable salt thereof, wherein: m and n are each independently selected from 2 or 3; The cyclic diamine moiety is -(CR 9 R 10 ) o -(where R 9 and R 10 is, independently for each occurrence, H and unsubstituted C 1~4 alkyl, and o is 1, 2, 3, or 4, particularly o is 1 or 2), and the ring carbon atoms of the cyclic diamine moiety are unsubstituted; L 2 is a bond, L 3 is a bond, unsubstituted C1-C4 alkylene, C1-C4 alkylene substituted with 1 or 2 halo (e.g., F), or 1 or 2 C 1~4 C1-C4 alkylene substituted by alkyl (e.g., methyl), and in particular L 3 is selected from a bond or unsubstituted C1-C4 alkylene, and R 1 is unsubstituted C1-C6 alkyl.

[0175] In embodiments, there is provided a compound of the structure of formula (XXVI): or a pharmaceutically acceptable salt thereof, wherein: X is selected from a bond, unsubstituted phenyl, or phenyl substituted with one or more halo groups; L 1 is selected from a bond, —O—, and SO2—; and R 1 is selected from hydrogen, halogen, C1-C6 alkyl, or a 3-12 membered ring system (e.g., cycloalkyl, heterocyclyl, aryl, or heteroaryl) containing 0, 1, 2, or 3 heteroatoms selected from N, O, or S in the ring system, wherein: R 1 Any of the ring systems in 3and optionally substituted with one or more substituents independently selected from:

[0176] In one embodiment, there is provided a compound of formula (XXVI) or a pharmaceutically acceptable salt thereof, wherein X is phenyl substituted with one or more halo groups and L 1 is a bond and R 1 is hydrogen.

[0177] In another embodiment, there is provided a compound of formula (XXVI) or a pharmaceutically acceptable salt thereof, wherein X is a bond and L 1 is a bond and R 1 is a halogen.

[0178] In certain embodiments, the compound of formula (I) is a compound selected from the following, or a pharmaceutically acceptable salt of any of these compounds:

[0179] [Table 1]

[0180] [Table 2]

[0181] [Table 3]

[0182] [Table 4]

[0183] In certain embodiments, the compound of formula (I) is a compound selected from the following, or a pharmaceutically acceptable salt of any of these compounds:

[0184] [Table 5]

[0185] [Table 6]

[0186] [Table 7]

[0187] [Table 8]

[0188] In one embodiment, the compound of formula (I) is selected from the compounds of Table 1 or Table 2 and their pharmaceutically acceptable salts.

[0189] In one embodiment of the invention, the compound of formula (I) is [ka] or a pharmaceutically acceptable salt thereof.

[0190] Pharmaceutical Composition In another aspect, the present invention provides a pharmaceutical formulation comprising a compound of the present invention or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

[0191] Conventional procedures for the selection and preparation of suitable pharmaceutical formulations are described, for example, in "Pharmaceuticals - The Science of Dosage Form Designs", MEAulton, Churchill Livingstone, 1988.

[0192] Compositions of the invention may be in a form suitable for oral use (e.g., as tablets, lozenges, hard or soft capsules, aqueous or oily suspensions, emulsions, dispersible powders or granules, syrups or elixirs), topical use (e.g., as creams, ointments, gels, or aqueous or oily solutions or suspensions), inhaled administration (e.g., as a finely divided powder or liquid aerosol), insufflation administration (e.g., as a finely divided powder), or parenteral administration (e.g., as a sterile aqueous or oily solution for intravenous, subcutaneous, intramuscular, intraperitoneal, or intramuscular administration, or as a suppository for rectal administration).

[0193] The compositions of the invention may be obtained by conventional procedures using conventional pharmaceutical excipients, well known in the art. Thus, compositions intended for oral use may contain, for example, one or more coloring agents, sweetening agents, flavoring agents, and / or preservatives.

[0194] An effective amount of a compound of the invention for use in the treatment of a condition is an amount sufficient to symptomatically alleviate or slow the progression of the condition in a warm-blooded animal, especially a human.

[0195] The amount of active ingredient that is combined with one or more excipients to produce a single dosage form will necessarily vary depending upon the host treated and the particular route of administration. For example, a formulation intended for oral administration to humans will generally contain from 0.5 mg to 0.5 g of active agent (more preferably 0.5 to 100 mg, e.g., 1 to 30 mg), compounded with an appropriate and convenient amount of excipient which may vary, for example, from about 5 to about 98 percent by weight of the total composition.

[0196] The therapeutic or prophylactic dose of the compounds of the invention will of course vary according to well-known principles of medicine depending on the nature and severity of the condition, the age and sex of the animal or patient, and the route of administration.

[0197] When the compounds of the present invention are used for therapeutic or prophylactic purposes, they will generally be administered at a daily dose within the ranges described above, e.g., 0.1 mg / kg to 100 mg / kg, 1 mg / kg to 75 mg / kg, 1 mg / kg to 50 mg / kg, 1 mg / kg to 20 mg / kg, or 5 mg / kg to 10 mg / kg body weight, given in divided doses as needed. Generally, when parenteral routes are used, lower doses will be administered. Thus, for example, for intravenous or intraperitoneal administration, a dose within the range of, e.g., 0.1 mg / kg to 30 mg / kg body weight will generally be used. Similarly, for inhalation administration, a dose within the range of, e.g., 0.05 mg / kg to 25 mg / kg body weight will generally be used. Preferably, the compounds of the present invention are administered orally, e.g., in the form of a tablet or capsule formulation. The orally administered daily dose can be, for example, a total daily dose selected from 1 mg to 2000 mg, 5 mg to 2000 mg, 5 mg to 1500 mg, 10 mg to 750 mg, or 25 mg to 500 mg. Typically, a unit dosage form will contain about 0.5 mg to 0.5 g of a compound of the invention.

[0198] Therapeutic uses and applications In another aspect, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof for use as a pharmaceutical.

[0199] A further aspect of the present invention provides a compound of the present invention, or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or medical condition mediated by LOX.

[0200] Also provided is the use of a compound of the invention, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for treating a disease or medical condition mediated by LOX.

[0201] Also provided is a method of treating a disease or medical condition mediated by LOX in a subject in need thereof, the method comprising administering to the subject an effective amount of a compound of the invention or a pharmaceutically acceptable salt thereof.

[0202] Unless otherwise specified, reference to the treatment of a disease or medical condition mediated by LOX is intended to encompass a disease or medical condition mediated by any one of LOX, LOXL1, LOXL2, LOXL3, or LOXL4.

[0203] In the following section on uses, reference is made to compounds of the invention or pharmaceutically acceptable salts thereof for use in treating certain diseases or conditions. It should be understood that any reference herein to a compound for a particular use is also intended to refer to (i) the use of a compound of the invention, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for treating that disease or condition, and (ii) a method of treating a disease or condition in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound of the invention, or a pharmaceutically acceptable salt thereof.

[0204] The LOX-mediated disease or medical condition can be any of the diseases or medical conditions listed herein.

[0205] As discussed in the Background of the Invention, the role of the LOX family may have distinct roles in diseases such as cancer. Therefore, selective inhibition of LOX may be advantageous. In one embodiment, a compound of the invention, or a pharmaceutically acceptable salt thereof, is provided for use in the selective inhibition of LOX, LOXL1, LOXL2, LOXL3, or LOXL4. In another embodiment, it may be advantageous to inhibit more than one member of the LOX family. Thus, in another embodiment, a compound of the invention, or a pharmaceutically acceptable salt thereof, is provided for use in the inhibition of more than one member of the LOX family selected from LOX, LOXL1, LOXL2, LOXL3, or LOXL4.

[0206] Proliferative Disorders - LOX and Cancer A further aspect of the present invention provides a compound of the present invention, or a pharmaceutically acceptable salt thereof, for use in the treatment of a proliferative disorder. The proliferative disorder may be malignant or non-malignant.

[0207] As mentioned in the Background of the Invention, LOX plays an important role in primary cancer and metastasis. Evidence supporting this role of LOX in primary tumor growth and metastasis is described below.

[0208] Studies have shown that LOX plays a fundamental role in primary tumor growth in colorectal and lung cancer (Gao, Xiao et al. 2010; Baker, Cox et al. 2011) and glioblastoma (Mammoto, Jiang et al. 2013). mut / p53 wt Cells (which endogenously express low levels of LOX) have been engineered to express high levels of human LOX. Primary tumor growth is significantly increased in murine allograft models using these cells (Miller, Morton et al. 2015). Lysyl oxidase activity contributes to primary tumor growth in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC) by directly affecting senescence stability (Wiel, Augert et al. 2013).

[0209] LOX expression is elevated in over 70% of breast cancer patients with estrogen receptor-negative disease, 80% of head and neck cancer patients, 33% of primary colorectal cancers (CRC), and 48% of metastatic tissues from CRC patients (Baker, Cox et al. 2011), as well as in cirrhotic HCC patients with a history of alcoholism (Huang, Ho et al. 2013). LOX is also overexpressed in lung adenocarcinoma (Wilgus, Borczuk et al. 2011), LKB1-mutated lung cancer (Gao, Xiao et al. 2010), aggressive prostate adenocarcinoma (Stewart, Gray et al. 2008), uveal melanoma (Abourbih, Di Cesare et al. 2010), oral and oropharyngeal squamous cell carcinoma (Albinger-Hegyi, Stoeckli et al. 2010), thyroid cancer (Boufraqech, Nilubol et al. 2015), clear cell renal cell carcinoma (Vitalba et al. 2016), myeloproliferative neoplasms, especially myelofibrosis (Papadantonakis, Matsuura et al. 2012, Tadmor, Bejar et al. 2013), and pancreatic cancer (Sansom 2012, Miller, Morton et al. 2015).

[0210] Lysyl oxidase-like isoforms and cancer LOXL2 is another member of the LOX family involved in cross-linking extracellular collagen and elastin (Vadasz, Kessler et al. 2005) (Kim, Kim et al. 2010). In addition to a conserved C-terminal region, the LOXL2 protein contains a scavenger receptor cysteine-rich region commonly found in cell surface receptors and adhesion molecules, as well as cytokine receptor-like domains.

[0211] LOXL2 expression has been found to be upregulated in breast, gastric, colon, esophageal, head and neck, lung, and laryngeal cancers (Barker et al. 2012), as well as renal cell carcinoma (Hase, Jingushi et al. 2014) (Nishikawa, Chiyomaru et al. 2015). High LOXL2 expression has been associated with poor prognosis in patients with squamous cell carcinoma, laryngeal, esophageal, and breast cancer, increased metastasis in colon and breast cancer, and drug resistance in pancreatic cancer cells (Barker et al. 2012). Furthermore, LOXL2 upregulation has been shown to increase the invasiveness of non-invasive breast cancer cells (Akiri, Sabo et al. 2003). Furthermore, LOXL2 and LOXL4 are required for metastatic niche formation in a breast orthotopic mouse model (Wong et al., 2011). LOXL2 expression is associated with lymph node metastasis, histological grade, and poor prognosis in cholangiocarcinoma, and knockdown of LOXL2 reduces invasion and metastasis (Xu, Li et al., 2014). HCC metastasis depends on LOXL2, which is overexpressed in tumor tissues and serum of HCC patients (Wong, Tse et al., 2014).

[0212] LOXL2 transcription is regulated by HIF-1, and upregulation of LOXL2 during hypoxia downregulates E-cadherin, leading to epithelial-mesenchymal transition (EMT), a key step in tumor progression, invasion, and metastasis (Schietke, Warnecke et al. 2010). This is consistent with other reports showing that LOXL2 is involved in both EMT and tumor progression in murine squamous cell carcinoma and spindle cell carcinoma (Fong, Dietzsch et al. 2007) (Moreno-Bueno, Salvador et al. 2011). LOXL2 expression is specifically associated with CRC (Offenberg, Brunner et al. 2008). LOXL2 is also associated with activation of the Src kinase / focal adhesion kinase (Src / FAK) pathway, suggesting that LOXL2 secretion is a key pathway for inducing gastric tumor cell invasion and metastasis (Peng, Ran et al. 2009).

[0213] In certain cancers, such as basal-like breast cancer and laryngeal squamous cell carcinoma, perinuclear expression of LOXL2 is a marker of tumor aggressiveness and poor prognosis (Moreno-Bueno, Salvador et al. 2011) (Peinado, Moreno-Bueno et al. 2008).

[0214] Barry-Hamilton et al. reported that LOXL2 antibody treatment significantly reduced bone metastasis from intracardiac injection of breast cancer cells (Barry-Hamilton, Spangler et al. 2010). In addition, Barker et al. provided preclinical evidence that LOXL2 inhibition is highly effective against spontaneous metastasis of breast cancer cells to the lung, liver, and bone (Barker, Chang et al. 2011). Therefore, LOXL2 is also a promising therapeutic target for treating primary and metastatic cancers.

[0215] As discussed in the Background of the Invention, LOX and LOXL2 are thought to be involved in similar extracellular processes but have distinct roles.

[0216] Other members of the LOX family, LOXL1, LOXL3, and LOXL4, are also implicated in proliferative conditions, including cancer (see Background of the Invention).

[0217] Thus, in one embodiment, there is provided a compound of the present invention, or a pharmaceutically acceptable salt thereof, for use in treating cancer. In one embodiment, the cancer is non-metastatic. Thus, the compound of the present invention, or a pharmaceutically acceptable salt thereof, may be for use in treating a primary tumor in a subject.

[0218] The role of LOX in cancer metastasis Increased LOX expression is also associated with metastasis and decreased patient survival (Baker, Cox et al. 2011; Wilgus, Borczuk et al. 2011). Increased LOX expression is associated with disease grade, increased distant metastasis, and decreased overall survival in patients with estrogen receptor (ER)-negative tumors of breast cancer (Erler, Bennewith et al. 2006), head and neck cancer (Albinger-Hegyi, Stoeckli et al. 2010; Toustrup, Sorensen et al. 2011), gastric cancer (Kasashima, Yashiro et al. 2015), hepatocellular carcinoma (Zhu, Huang et al. 2015), non-small cell lung cancer (Liu, Ping et al. 2014), and astrocytoma (da Silva, Uno et al. 2015), and laryngeal cancer (Se, 2017). LOX expression is a determinant of poor survival in pancreatic cancer (Miller, Morton et al. 2015). Inhibition of LOX eliminates metastases in mice bearing orthotopically grown human breast cancer (Erler, Bennewith et al. 2006) and inhibits tumor angiogenesis in a human colorectal cancer model (Baker, Bird et al. 2013).

[0219] Polyclonal antibodies raised against LOX and shown to inhibit its enzymatic activity were able to block the metastatic spread of tumor cells to the lungs and liver of recipient mice in an orthotopic model of metastatic human breast cancer (Erler et al., 2006). Suppression of LOX expression using shRNA blocks the metastatic spread of breast cancer cells, and the nonselective small molecule inhibitor of LOX, BAPN, can block metastatic tumor growth of these cells in mice (Erler et al., 2006). Furthermore, inhibition of tumor-secreted LOX by genetic (shRNA), antibody (Ab), or the irreversible, nonselective small molecule inhibitor BAPN significantly reduced the invasion and metastasis of orthotopic human breast tumors or circulating human breast cancer cells (Bondareva, Downey et al. 2009; Erler, Bennewith et al. 2009; Leventhal, Yu et al. 2009), CRC (Baker, Cox et al. 2011), HCC (Huang, Ho et al. 2013), LKB1-mutant lung adenocarcinoma (Gao, Xiao et al. 2010), histopathological thyroid carcinoma (Boufraqech, Nilubol et al. 2015), and PDAC in mice (Sansom 2012; Miller, Morton et al. 2015). High expression of LOX in primary breast tumors leads to osteolytic lesion formation, and silencing or inhibition of LOX activity abrogates tumor-driven bone metastasis (Cox, Rumney et al. 2015). LOX inhibition with BAPN and the novel inhibitor CCT365623 significantly reduces metastatic lung tumor burden in a mouse model of spontaneous breast cancer that metastasizes to the lung (Tang et al. 2017).

[0220] LOX family members (especially LOX and LOXL2) play a critical role in the metastatic spread of cancer cells (Erler, Bennewith et al. 2006; Bondareva, Downey et al. 2009; Erler, Bennewith et al. 2009; Leventhal, Yu et al. 2009; Gao, Xiao et al. 2010). Hypoxia (when solid tumors reach approximately 1 cm in size) 3In response to the immune system's response to inadequate blood supply (a condition that occurs when the immune system's blood supply exceeds the normal blood supply), cancer cells produce and secrete LOX into the circulation (Erler, Bennewith et al. 2009).

[0221] LOX regulates cancer cell invasion in vitro. Thus, cancer cells expressing high levels of LOX exhibit an increased ability to invade 3D collagen I and Matrigel matrices (Kirschmann, Seftor et al. 2002) (Erler, Bennewith et al. 2006). Furthermore, experimental overexpression of LOX enhances cancer cell invasion, whereas genetic knockdown of LOX using RNA interference (RNAi, both small hairpin RNA [shRNA] and small interfering RNA [siRNA]) or antisense technology inhibits the in vitro invasive activity of cancer cells (Kirschmann, Seftor et al. 2002) (Erler, Bennewith et al. 2006). Similarly, the nonselective small molecule inhibitor of LOX, β-aminopropionitrile (BAPN), also blocks the in vitro invasive activity of several human cancer cell lines (Kirschmann, Seftor et al. 2002) (Erler, Bennewith et al. 2006). LOX enhances hypoxia-induced invasion and migration in cervical cancer cells, mediated by EMT that can be inhibited by BAPN (Yang, Li et al. 2013). These studies implicate LOX in invasive behavior in cancer cells.

[0222] One of the critical functions of LOX appears to be its remote action to precondition the niche at future sites of metastasis. Tumor cell metastasis is promoted by the formation of such "premetastatic niches" in destination organs using infiltrating bone marrow-derived dendritic cells (BMDCs). This "nest-building" activity is initiated when LOX is deposited at discrete sites in target organs (Erler, Bennewith et al. 2009). Studies have shown that bone marrow-derived cell recruitment is an essential process for niche conditioning and the metastatic spread of cancer (Kaplan et al. 2005). This mechanism supports the importance of LOX for the invasive activity of cancer cells and the earliest stages of metastasis, when cancer cells first migrate from the primary tumor. BMDCs and LOX colocalize in human metastatic tissues, and LOX inhibition has been shown to prevent BMDC recruitment and metastasis in a model of breast cancer metastasis (Erler, Bennewith et al. 2009).

[0223] In addition to its role in the early stages of metastasis, evidence suggests that LOX is required for the maintenance of cancer cell growth after reaching new metastatic sites, as inhibition of LOX even after the onset of metastatic disease results in the regression of these lesions (Erler, Bennewith et al. 2006; Erler, Bennewith et al. 2009; Bondareva, Downey et al. 2009). LOX depletion has been shown to have no effect on tumor cell growth on plastic but suppresses growth in a recombinant basement membrane (Matrigel) matrix (Erler, Bennewith et al. 2006). Furthermore, when LOX is inhibited by shRNA, cancer cells are less likely to colonize the lungs efficiently (Erler et al. 2006), and treatment of mice with an LOX-neutralizing antibody resulted in regression of metastatic lung tumors (Erler, Bennewith et al. 2006). Notably, lung colonization of human breast cancer cells was enhanced when cells were co-injected with conditioned medium from LOX-expressing cells, but this was blocked when mice were treated with conditioned medium in the presence of BAPN or LOX antibodies (Erler, Bennewith et al. 2009). These findings demonstrate that tumor-secreted LOX is required for the maintenance of metastatic growth.

[0224] LOX is essential for the phosphorylation of focal adhesion kinase (FAK) downstream of integrin signaling (Erler, Bennewith et al. 2006). FAK is a tyrosine kinase that interacts with several signaling molecules and is important for cell survival (van Nimwegen and van de Water 2007). LOX-mediated collagen cross-linking leads to tissue stiffening and increased activation of FAK / SRC signaling in in vitro and in vivo models of CRC. Cells expressing high levels of enzymatically active LOX have increased proliferation, invasion, and metastatic potential. Thus, LOX plays both cell-dependent and cell-autonomous roles in metastatic tumor growth at several levels, possibly enhancing the ability of cancer cells to locally invade by enhancing migration away from the primary site, conditioning the metastatic site for the arrival of BMDCs and subsequent tumor cells, and supporting the survival / proliferation of cancer cells after colonizing the niche.

[0225] The host response to tumor surgery may promote further lung metastasis through a LOX-mediated mechanism, and blocking LOX activity reduces the risk of lung metastasis after surgery (Chen, 2017).

[0226] Accordingly, the compounds of the invention, or pharmaceutically acceptable salts thereof, may be for use in treating metastatic cancer in a subject.

[0227] In another embodiment of the present invention, the compounds or pharmaceutically acceptable salts of the present invention may be used as inhibitors of tumor cell motility. In another embodiment, the compounds or pharmaceutically acceptable salts thereof may be used as inhibitors of the spread and invasiveness of mammalian cancer cells, resulting in the inhibition of metastatic tumor growth. Specifically, the compounds or pharmaceutically acceptable salts thereof may be used as anti-invasive agents for use in the containment and / or treatment of solid tumor disease. In another embodiment, the compounds or pharmaceutically acceptable salts thereof may be used to prevent or inhibit cancer metastasis.

[0228] LOX family, fibroblasts, and stroma Cancer-associated fibroblasts are recruited by cancer cell-recruiting fibroblasts via various growth factors and cytokines, creating a myofibroblastic microenvironment that promotes cancer growth, survival, local invasion, and metastasis (Karagiannis, Poutahidis et al. 2012). The persistent presence of myofibroblasts in cancer contributes to desmoplasia, a cancer-specific type of fibrosis. Desmoplasia and increased fibrosis are associated with the progression of several cancers, including breast cancer, pancreatic cancer, colorectal cancer, gastric cancer, and hepatocellular carcinoma (Barker, Cox et al. 2012). Desmoplasia is also an intrinsic mechanism of resistance to immunotherapy in stroma-rich tumors (Zhao and Subramanian 2017). LOX and LOX family members play essential roles in extracellular matrix remodeling and desmoplasia (Levental 2009; Xiao 2012). Expression of lysyl oxidase family members secreted by either cancer cells or activated fibroblasts has been found to be associated with the tumor ECM, tumor stroma, or tumor-associated vasculature of several cancers, including colorectal, pancreatic, breast, laryngeal, endometrial, testicular, hepatocellular, and renal cancers (reviewed by Barker et al. (2012)), and gastric cancer (Kasashima, Yashiro et al. (2014)) and is involved in their progression and metastasis (Akiri, Sabo et al. (2003); Barry-Hamilton, Spangler et al. (2010); Barker, Bird et al. (2013)) (Pickup, Laklai et al. (2013)). LOXL4 expression is enhanced in keratocystic odontogenic tumor (KCOT) parenchyma and primary KCOT stromal fibroblasts (Jiang, Sima et al. (2014)).

[0229] In one embodiment there is provided a compound of the invention, or a pharmaceutically acceptable salt thereof, for use in the treatment of fibrosis.

[0230] As discussed herein, the compounds of the invention, or pharmaceutically acceptable salts thereof, may be for use in the treatment of cancer, which may be non-metastatic or metastatic, and which may be a solid tumor or a hematological ("liquid") cancer, for example, selected from: (1) Carcinomas, such as tumors derived from stratified squamous epithelium (squamous cell carcinoma) and tumors arising in organs or glands (adenocarcinoma). Examples include: breast cancer, colon cancer, lung cancer, prostate cancer, ovarian cancer, esophageal cancer (including, but not limited to, esophageal adenocarcinoma and squamous cell carcinoma), basal-like breast cancer, basal cell carcinoma (a form of skin cancer), squamous cell carcinoma (various tissues), head and neck cancer (including, but not limited to, squamous cell carcinoma), gastric cancer (including, but not limited to, gastric adenocarcinoma and gastrointestinal stromal tumor), signet ring cell carcinoma, bladder cancer (including transitional cell carcinoma (a malignant neoplasm of the bladder)), bronchogenic carcinoma, colorectal cancer (including, but not limited to, colon and rectal cancer). (including but not limited to), anal cancer, gastric cancer, lung cancer (including but not limited to small cell carcinoma of the lung (SCLC) and non-small cell carcinoma of the lung (NSCLC), lung adenocarcinoma, squamous cell carcinoma, large cell carcinoma, bronchioloalveolar carcinoma, and mesothelioma), neuroendocrine tumors (including but not limited to carcinoids of the gastrointestinal tract, breast, and other organs), adrenocortical carcinoma, thyroid cancer, pancreatic cancer (including but not limited to pancreatic ductal adenocarcinoma, pancreatic adenocarcinoma, acinar cell carcinoma, intraductal papillary mucinous neoplasm with invasive carcinoma, mucinous cystic neoplasm with invasive carcinoma, islet cell carcinoma, and neuroendocrine tumors), breast cancer (including but not limited to ductal carcinoma, lobular carcinoma, inflammatory breast cancer, clear cell carcinoma, and mucinous carcinoma), ovarian cancer (including but not limited to serous tumors, endometrial tumors, and ovarian epithelial or surface epithelial-stromal tumors, including mucinous cystadenocarcinoma, sex cord-stromal tumors), liver and cholangiocarcinoma (including but not limited to hepatocellular carcinoma, cholangiocarcinoma, and hemangioma), prostate cancer, adenocarcinoma, brain tumors (including but not limited to glioma, glioblastoma, and medulloblastoma) ), germ cell tumors, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, renal carcinoma (including but not limited to renal cell carcinoma, clear cell carcinoma, and Wilms' tumor), medullary carcinoma, ductal carcinoma in situ or bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, cervical cancer, uterine cancer (including but not limited to endometrial adenocarcinoma, uterine papillary serous carcinoma, uterine clear cell carcinoma, uterine sarcoma, and leiomyosarcoma, mixed Mullerian tumor), testicular cancer, bone forming carcinoma, epithelial carcinoma, sarcomatoid carcinoma, nasopharyngeal carcinoma, laryngeal carcinoma, oral and oropharyngeal squamous cell carcinoma. (2) Sarcomas, such as osteosarcoma and osteogenic sarcoma (bone), chondrosarcoma (cartilage), leiomyosarcoma (smooth muscle), rhabdomyosarcoma (skeletal muscle), mesothelioma and mesothelioma (membranous lining of body cavities), fibrosarcoma (fibrous tissue), angiosarcoma and hemangioendothelioma (blood vessels), liposarcoma (fatty tissue), glioma and astrocytoma (neurogenic connective tissue found in the brain), myxosarcoma (primitive embryonic connective tissue), chordoma, endothelioma, lymphangiosarcoma, lymphangioendothelioma, synovioma, Ewing's sarcoma, mesenchymal and mixed mesodermal tumor (mixed connective tissue type), and other soft tissue sarcomas. (3) Myeloma and multiple myeloma. (4) Hematopoietic tumors, such as myeloid and granulocytic leukemia (malignant lesions of the myeloid and granulocytic leukemia lineage), lymphocytic, lymphocytic, and lymphoblastic leukemia (malignant lesions of the lymphoid and lymphocytic blood cell lineage), polycythemia vera and erythremia (malignant lesions of various blood cell products, but predominantly red blood cells), and myelofibrosis. (5) Lymphomas, such as Hodgkin's and non-Hodgkin's lymphoma. (6) Solid tumors of the nervous system, such as medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, and schwannoma. (7) Melanoma, uveal melanoma, and retinoblastoma; and (8) Mixed types, such as adenosquamous carcinoma, mixed mesodermal tumor, carcinosarcoma, and teratocarcinoma.

[0231] In particular embodiments, the compounds of the invention, or pharmaceutically acceptable salts thereof, may be for use in the treatment of a cancer selected from pancreatic cancer, colorectal cancer, breast cancer, and lung cancer.

[0232] The compound of the present invention or its pharmaceutically acceptable salt can be used to treat benign proliferative diseases.The benign disease can be benign tumors, such as hemangioma, hepatocellular adenoma, cavernous hemangioma, focal nodular hyperplasia, acoustic neuroma, neurofibroma, bile duct adenoma, bile duct cystadenoma, fibroma, lipoma, leiomyoma, mesothelioma, teratoma, myxoma, nodular regenerative hyperplasia, trachoma, pyogenic granuloma, lentigo, uterine fibroid, thyroid adenoma, adrenal cortical adenoma, or pituitary adenoma.The benign pathology can be endometriosis or keratocystic odontogenic tumor.

[0233] fibrotic disorders As discussed in the Background of the Invention, LOX and LOXL are involved in fibrotic disorders. Thus, the compounds of the present invention or pharmaceutically acceptable salts thereof can be used to treat fibrotic disorders. The fibrotic disorder can be a disorder characterized by excessive fibrosis, e.g., excess fibrous connective tissue in a tissue or organ, e.g., triggered by a repair or reactive process, e.g., in response to injury (e.g., scarring, healing), or excess fibrous tissue arising from a single cell system (e.g., fibroma).

[0234] LOX has been implicated in the pathogenesis of renal fibrosis, with its inhibition resulting in symptomatic relief (Di Donato, Ghiggeri et al. 1997; Haase 2009; Chen, Lin et al. 2015). Hyperuricemia leads to hypertension, intrarenal vascular disease, and renal injury, and is associated with increased expression of lysyl oxidase (LOX) and fibronectin in the kidney (Yang, Wang et al. 2010). Increased LOX activity is associated with delayed graft failure after kidney transplantation, possibly due to increased local fibrosis (Zhi, 2017).

[0235] Similar involvement of LOX or LOXL2 in reducing disease pathology and symptoms has been demonstrated in pulmonary fibrosis (Barry-Hamilton, Spangler et al. 2010) (Haase 2009; Cox, Bird et al. 2013; Chien, Richards et al. 2014).

[0236] LOX and LOXL2 are involved in liver fibrosis (Kagan 1994, Marshall and Smith 2011) (Ricard-Blum, Bresson-Hadni et al. 1996) (Smith and Van Vlasselaer 2011) (Georges, Hui et al. 2007), cirrhosis (the final stage of liver fibrosis) (Kagan 1994), and related diseases such as Wilson's disease and primary biliary cirrhosis (Vadasz, Kessler et al. 2005). Therapeutic indications for LOX family inhibitors (e.g., simtuzumab, humanized LOXL2 antibody) include several fibrotic conditions, namely, bone marrow fibrosis (primary bone marrow fibrosis, post-polycythemia vera bone marrow fibrosis, or post-essential thrombocythemia bone marrow fibrosis), idiopathic pulmonary fibrosis (IPF), liver fibrosis due to nonalcoholic steatohepatitis (NASH), HIV and / or hepatitis C infection or primary sclerosing cholangitis (PSC), and compensated cirrhosis due to NASH. Lysyl oxidase levels are increased in patients with scleroderma and systemic sclerosis (Chanoki, Ishii et al. 1995) (Rimar, Rosner et al. 2014).

[0237] LOX inhibitors support collagen remodeling and re-establishment of collagen structure in human Dupuytren's, keloid, and scar fibroblasts (Priyanka, 2016).

[0238] The fibrotic disorder may be any of those discussed in the previous three paragraphs. In one embodiment, the compound of the invention, or a pharmaceutically acceptable salt thereof, may be for use in treating a fibrotic disorder selected from the following: (i) fibrotic conditions affecting the lungs, such as pulmonary fibrosis secondary to cystic fibrosis, idiopathic pulmonary fibrosis, coal worker's progressive massive fibrosis, idiopathic fibrosing alveolitis, chronic fibrosing interstitial pneumonia, interstitial lung disease (ILD), diffuse parenchymal lung disease (DPLD), emphysema, and chronic obstructive pulmonary disease (COPD), or chronic asthma; or (ii) fibrotic conditions affecting the liver, such as cirrhosis and related conditions, such as chronic viral hepatitis B or C, Wilson's disease, non-alcoholic fatty liver disease (NAFLD), alcoholic steatohepatitis (ASH), non-alcoholic steatohepatitis (NASH), primary biliary cirrhosis (PBC), biliary cirrhosis, or autoimmune hepatitis; or (iii) fibrotic conditions affecting the kidney, e.g., diabetic nephropathy, vesicoureteral reflux, tubulointerstitial renal fibrosis, glomerulonephritis, e.g., focal segmental glomerulosclerosis, membranous glomerulonephritis, or mesangial capillary glomerulonephritis; (iv) fibrotic conditions affecting the heart or vascular system, such as endomyocardial fibrosis, previous myocardial infarction, atrial fibrosis, congestive heart failure, cardiomyopathy, hypertensive heart disease (HHD), hypertension (e.g., pulmonary hypertension), and fibrosis associated with hypertension, atherosclerosis, restenosis (e.g., lesions of the coronary arteries, carotid arteries, and brain), and heart disease associated with cardiac ischemic events; or (v) fibrotic conditions affecting the mediastinum, e.g., mediastinal fibrosis; or (vi) fibrotic conditions affecting bone, such as bone marrow fibrosis, e.g., primary bone marrow fibrosis, post-polycythemia vera or post-essential thrombocythemia bone marrow fibrosis, or (vii) a fibrotic condition affecting the retroperitoneum, e.g., retroperitoneal fibrosing skin, or (viii) fibrotic conditions affecting the skin, such as nephrogenic systemic fibrosis, keloid formation, scarring, systemic sclerosis, or scleroderma; or (ix) a fibrotic condition affecting the GI tract, such as fibrotic enteropathy, inflammatory bowel disease, ulcerative colitis, or Crohn's disease; or (x) fibrotic conditions affecting connective tissue, such as articular fibrosis or capsulitis, or (xi) fibrotic conditions affecting the eye, for example, ocular fibrosis after surgery or pseudoexfoliation syndrome glaucoma.

[0239] The LOX family, angiogenesis, and vascular permeability Angiogenesis, the formation of new blood vessels, is essential for tumor growth and progression.

[0240] LOX and LOXL2 are key players in promoting angiogenesis in several tumor models, including colorectal cancer (Baker, Bird et al. 2013), ovarian cancer, lung cancer (Zaffryar-Eilot, Marshall et al. 2013), melanoma (Osawa, Ohga et al. 2013), and glioblastoma (Mammoto, Jiang et al. 2013). LOX is overexpressed in tumor endothelial cells (Osawa, Ohga et al. 2013). Increased tumor expression of LOX is associated with increased VEGF expression (Mammoto, Jiang et al. 2013), (Baker, Bird et al. 2013).

[0241] Additionally, LOXL2 inhibition resulted in normalization of the vasculature and increased tumor perfusion in ovarian xenograft and lung allograft mouse models (Zaffryar-Eilot, Marshall et al. 2013).

[0242] Excessive angiogenesis is involved in several diseases, including cancer, as discussed above. LOX mediates vascular permeability by modulating endothelial barrier stiffness. Abnormal vascular permeability, such as that present in diseases such as pulmonary edema and acute respiratory distress syndrome (ARDS) or endotoxin-induced lung injury, can be normalized by LOX inhibition (Mammoto, Mammoto et al. 2013) (Ingber and Mammoto 2014).

[0243] Therefore, the compound of the present invention or a pharmaceutically acceptable salt thereof may be used as an anti-angiogenic agent. The compound of the present invention or a pharmaceutically acceptable salt thereof may be used for vascular normalization.

[0244] In one embodiment, the compounds of the invention or pharmaceutically acceptable salts thereof may be for use in the treatment of pulmonary embolism, emphysema, pleural effusion, pulmonary edema, cerebral swelling, multiple effusions, pericardial effusion, and ascites.

[0245] In one embodiment, the compounds of the invention or pharmaceutically acceptable salts thereof may be for use in the treatment of ischemia, ischemic stroke, ischemic heart disease, cerebral infarction, peripheral vascular disease, elephantiasis, lymphatic obstruction.

[0246] In one embodiment, the treatment is treatment of age-related macular degeneration (AMD), diabetic retinopathy, and retinopathy of prematurity.

[0247] Inflammatory disorders Exacerbated inflammation and lung barrier dysfunction are hallmarks of acute respiratory distress syndrome (ARDS), a condition associated with dangerously high morbidity and mortality. Increased LOX activity is associated with bacterial lipopolysaccharide (LPS)-induced inflammation. Inhibition of LPS-induced ECM cross-linking and stiffening by LOX inhibition reduced EC inflammatory activation and lung dysfunction. Therefore, LOX inhibitors may be useful for treating ARDS (Mambetsariev, Tian et al. 2014). Reduction of LOX and LOXL1 and reduced collagen cross-linking are associated with reduced inflammation in an angiotensin II-induced model of hypertension (Gonzalez, Rhaleb et al. 2014).

[0248] In certain embodiments, the provided compounds of the invention, or pharmaceutically acceptable salts thereof, can be useful for treating inflammatory conditions. The inflammatory conditions can be any of those described herein. For example, the compounds of the invention, or pharmaceutically acceptable salts thereof, can be for use in treating acute inflammation (e.g., mediated by acute infection).

[0249] In certain embodiments, the compounds of the invention, or pharmaceutically acceptable salts thereof, may be for use in the treatment of a chronic inflammatory disease, e.g., a disease selected from inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), psoriasis, sarcoidosis, rheumatoid arthritis, osteoarthritis, psoriatic arthritis, Reiter's syndrome, traumatic arthritis, rubella arthritis, acute synovitis, gouty arthritis, and spondylitis.

[0250] In certain embodiments, the compounds of the invention or pharmaceutically acceptable salts thereof may be for use in the treatment of rheumatoid arthritis, osteoarthritis, psoriatic arthritis, Reiter's syndrome, traumatic arthritis, rubella arthritis, acute synovitis, gouty arthritis or spondylitis, diabetes, or gout.

[0251] In certain embodiments, the compounds of the invention, or pharmaceutically acceptable salts thereof, may be for use in the treatment of psoriasis, eczema, sarcoidosis, allergic rhinitis, allergic conjunctivitis, asthma, acute respiratory distress syndrome, acute lung injury (ALI), acute respiratory distress syndrome (ARDS), endotoxin-induced lung injury, pulmonary inflammation, chronic obstructive pulmonary disease, and systemic cachexia.

[0252] In certain embodiments, the compounds of the invention or pharmaceutically acceptable salts thereof may be for use in the treatment of rheumatoid arthritis, osteoarthritis, psoriatic arthritis, Reiter's syndrome, traumatic arthritis, rubella arthritis, acute synovitis, gouty arthritis or spondylitis, diabetes, or gout.

[0253] In certain embodiments, the compounds of the invention, or pharmaceutically acceptable salts thereof, may be for use in the treatment of endotoxemia, toxic shock syndrome, inflammatory bowel disease, atherosclerosis, irritable bowel syndrome, Crohn's disease, ulcerative colitis, bone resorption diseases, osteoporosis, diabetes, reperfusion injury, graft-versus-host reaction, allograft rejection, sepsis, septic shock, endotoxin shock, gram-negative sepsis, glomerulonephritis, restenosis, vasculitis, or thrombosis.

[0254] In another embodiment, the compounds of the invention or pharmaceutically acceptable salts thereof may be for use in the treatment of polymyositis, systemic lupus, or interstitial nephritis.

[0255] cardiovascular disease Disruption of LOX-mediated collagen cross-linking using BAPN treatment in mouse models reduced myocardial fibrosis, making it useful as a potential therapeutic target for collagen regulation and age-related myocardial fibrosis (Rosin, Sopel et al. 2015). Increased LOX expression is associated with myocardial fibrosis and cardiac dysfunction (Zibadi, Vazquez et al. 2010; Gao, Xiao et al. 2010; Lopez, Gonzalez et al. 2010). Left atrial myocardium from patients with atrial fibrillation expresses higher levels of lysyl oxidase and fibronectin, as well as collagen cross-linking. Fibronectin upregulation is mediated by LOX in cardiac fibroblasts (Adam, Theobald et al. 2011). LOX inhibitors may be useful for preventing fibrotic atrial remodeling. Inhibition of LOX by using a blocking antibody reduced cardiac fibrosis and infarct expansion in a mouse model (Gonzalez-Santamaria, 2016).

[0256] Lysyl oxidase plays a causative role in experimental pulmonary hypertension, and its inhibition with BAPN reduces symptoms (Nave, Mizikova et al. 2014). LOX promotes the formation of cross-linked collagen and consequent insoluble collagen, leading to subsequent left ventricular stiffness and systolic dysfunction in patients with hypertensive heart disease (HHD) and heart failure (HF) of hypertensive origin (Lopez, Gonzalez et al. 2013) (Lopez, Querejeta et al. 2012). A role for LOXL1 has been suggested in cardiac hypertrophy, and BAPN administration inhibits angiotensin II-induced cardiac hypertrophy in vivo (Ohmura, Yasukawa et al. 2012). LOX knockdown attenuates cardiovascular fibrosis in high-fat diet-induced obesity (Martinez-Martinez, 2016).

[0257] Lysyl oxidase inhibition has been proposed as a therapeutic approach to reduce or prevent recurrent restenosis (Nuthakki, Fleser et al. 2004) (Brasselet, Durand et al. 2005). Increased LOX activity has been observed in atherosclerosis (Kagan, Raghavan et al. 1981). LOX is overexpressed in other pathologies associated with increased thrombosis, such as myeloproliferative neoplasms, chronic kidney disease, and arterial stenosis, and enhances platelet aggregation (Shinobu et al. 2016).

[0258] Thus, in one embodiment, the compounds of the invention, or pharmaceutically acceptable salts thereof, may be for use in the treatment of cardiovascular diseases, e.g., any one of the diseases listed in this section, such as atherosclerosis, treatment of myocardial fibrosis, fibrotic atrial remodeling, previous myocardial infarction, congestive heart failure, cardiomyopathy, hypertensive heart disease (HHD), hypertension (e.g., pulmonary hypertension), fibrosis associated with hypertension, restenosis (e.g., lesions of the coronary arteries, carotid arteries, and brain), and prevention of heart disease associated with cardiac ischemic events.

[0259] Neurological conditions As discussed in the Background of the Invention, LOX is associated with neurological conditions, including Alzheimer's disease and other neurological conditions. Thus, in one embodiment, the provided compounds of the present invention, or pharmaceutically acceptable salts thereof, can be for use in treating a neurological condition mediated by LOX or LOXL. The neurological condition can be Alzheimer's disease (AD), Hereditary Cerebral Hemorrhage with Amyloidosis of the Dutch Type (HCHWA-D), or non-Alzheimer's dementia.

[0260] LOX is increased at sites of brain injury (Gilad, Kagan et al. 2001) and spinal cord injury, and its inhibition leads to enhanced functional recovery in a unilateral spinal cord dissection model (Gilad and Gilad 2001). Thus, the compounds of the present invention or pharmaceutically acceptable salts thereof may be used to treat nerve injury, for example, to promote nerve regrowth and / or recovery after spinal cord injury.

[0261] Pulmonary disease Both LOXL2 and LOXL3 are expressed in PAP tissue but not in normal lung tissue, and are likely contributing to primary pulmonary alveolar proteinosis (PAP) (Neufeld and Brekhman 2009). Excessive lysyl oxidase activity is associated with the pathological pulmonary characteristics of bronchopulmonary dysplasia (Kumarasamy, Schmitt et al. 2009). The compounds of the present invention or pharmaceutically acceptable salts thereof may be used to treat primary pulmonary alveolar proteinosis (PAP) or bronchopulmonary dysplasia.

[0262] eye disease Increased LOXL2 levels are associated with failure after glaucoma surgery, and treatment with LOXL2 antibodies reduced pathological angiogenesis, inflammation, and ocular fibrosis (Park, Kim et al. 2014; Van Bergen, Marshall et al. 2013; Stalmans, Van Bergen et al. 2011). Expression of lysyl oxidase-type enzymes increases after laser-induced choroidal neovascularization (CNV) in age-related macular degeneration (AMD) models, paralleling fibrotic damage. Inhibition of LOX or LOXL2 prevents angiogenesis and fibrosis after laser-induced CNV. Therefore, inhibitors of LOX and LOXL may be useful for treating conditions characterized by angiogenesis, such as age-related macular degeneration (AMD), diabetic retinopathy, and retinopathy of prematurity (Stalmans, Marshall et al. 2010). LOXL1 expression is increased in the early stages of abnormal fiber formation in pseudoexfoliation syndrome / glaucoma tissues (Zenkel, Krysta et al. 2011) (Schlotzer-Schrehardt, Pasutto et al. 2008).

[0263] The compounds of the invention, or pharmaceutically acceptable salts thereof, may be for use in treating ocular conditions mediated by LOX or LOXL, such as any of the ocular conditions listed in the preceding paragraphs.

[0264] Other disorders LOX is a major isoenzyme expressed in human adipose tissue, and its expression is strongly upregulated in samples from obese patients. β-Aminopropionitrile reduces weight gain, improves the metabolic profile of diet-induced obesity in rats (Miana, Galan et al. 2015), and reduces local adipose tissue inflammation (Halberg, Khan et al. 2009). In certain embodiments, the compounds of the present invention or pharmaceutically acceptable salts thereof may be used to treat obesity.

[0265] LOX has been proposed as a novel therapeutic target in bacterial infections and subsequent fibrotic complications. LOX is upregulated in Staphylococcus aureus infections, and its inhibition with BAPN affects the resulting abscess morphology and collagenization (Beerlage, Greb et al. 2013). LOX is also involved in several parasitic diseases. LOX and LOXL are upregulated in the early stages of hepatic granuloma development in schistosomiasis (Decitre, Gleyzal et al. 1998), and BAPN inhibition reduces granuloma size and egg burden in combination with the antiparasitic agent PZQ compared with PZQ alone (Giboda, Zenka et al. 1992).

[0266] In one embodiment, the compounds are for use in treating bacterial infections, e.g., infections caused by Staphylococcus Aureus. The compounds of the present invention may be for use in treating or preventing infection-associated fibrosis, e.g., preventing or inhibiting abscess formation associated with an infection. Abscess formation can provide a microenvironment favorable to bacterial growth. Inhibiting abscess formation can be beneficial in that it may reduce or eliminate the shielding effect provided by the abscess and provide enhanced exposure of bacteria to antibiotics at the site of infection. Therefore, combination treatments including a compound of the present invention together with an antibiotic agent may provide enhanced antibacterial effects. The compounds of the present invention may also be for use in preventing or inhibiting tissue fibrosis after eradication of the infection and healing of the infected site.

[0267] In one embodiment, the compound is for use in the treatment of a parasitic infection, such as schistosomiasis.

[0268] EGFR-mediated pathologies Elevated levels of epidermal growth factor receptor (EGFR), a growth factor receptor tyrosine kinase, and / or its ligands are observed in many cancer types and are involved in promoting tumor growth. EGFR inhibitors have been targeted against several cancer types, including NSCLC, pancreatic cancer, squamous cell carcinoma, skin cancer, thyroid cancer, colorectal cancer, prostate cancer, gastric cancer, renal cancer, breast cancer, head and neck cancer, glioma, meningioma, mesothelioma, cervical cancer, and epidermoid carcinoma (reviewed by Bianco et al. (Bianco, Gelardi et al. 2007)). Elevated EGFR has been found to act as a strong indicator of poor prognosis in head and neck cancer, ovarian cancer, cervical cancer, bladder cancer, and esophageal cancer (Nicholson, Gee et al. 2001). EGFR inhibitors have also been proposed to treat metastatic prostate cancer (Ree, Bratland et al. 2008) and biliary tract cancers, such as cholangiocarcinoma with ERRFI1 mutations (Borad, Carpten et al. 2014).

[0269] Blockade of EGFR kinase activity does not achieve maximal therapeutic efficacy, and LOX inhibitors reduce the levels of surface EGFR, suggesting that these compounds may have an effect on reducing EGFR activation (Tang et al., 2017).

[0270] EGFR inhibition has been targeted for the treatment of several other diseases, including the prevention and treatment of obesity (Threadgill and Barrick 2007), the treatment of Alzheimer's disease (Ma 2013), the treatment of chlamydial infections and related disorders (Tsang and Furdui 2015), the treatment of viral diseases (Jung 2010), the promotion of axonal regeneration (He and Koprivica 2007), and the treatment of inherited skin disorders characterized by hyperkeratosis, keratinocyte hyperplasia, and / or ichthyosis (Alexandrescu 2009).

[0271] Given the role of LOX inhibition in modulating surface EGFR levels and EGFR signaling, LOX inhibitors may be useful in treating diseases that can be targeted by EGFR inhibition.

[0272] In certain embodiments, a compound of the present invention, or a pharmaceutically acceptable salt thereof, is provided for use in treating a disorder (e.g., a disease) that is ameliorated by inhibiting EGFR. The EGFR-mediated condition may be, for example, any of those listed in this section or elsewhere herein. The compound of the present invention, or a pharmaceutically acceptable salt thereof, may be for use in treating a cancer that overexpresses EGFR. The cancer that overexpresses EGFR may be, for example, NSCLC, pancreatic cancer, squamous cell carcinoma, skin cancer, thyroid cancer, colorectal cancer, prostate cancer, renal cancer, breast cancer, head and neck cancer, glioma, mesothelioma, epidermoid carcinoma, ovarian cancer, cervical cancer, bladder cancer, and esophageal cancer, or a biliary tract cancer, such as cholangiocarcinoma.

[0273] In one embodiment, there is provided a compound of the invention or a pharmaceutically acceptable salt thereof for use in therapy, wherein the compound is for use in the treatment of a fibrotic disease, such as liver fibrosis, lung fibrosis, kidney fibrosis, cardiac fibrosis, bone marrow fibrosis, or scleroderma.

[0274] In one embodiment, the compound is for use in treating a viral infection, for example, an infection with a rhinovirus, influenza virus, parainfluenza virus, coronavirus, adenovirus, respiratory syncytial virus, picornavirus, metapneumovirus, hantavirus, measles virus, Epstein-Barr virus, herpes simplex virus, or cytomegalovirus.

[0275] In one embodiment, the compound is for use in the treatment of a chlamydia infection.

[0276] In one embodiment, the compound is for use in the treatment of a genetic skin disorder, for example, the keratinization disorder is selected from Darier's disease, Hailey-Hailey disease, erythrodermic autosomal recessive lamellar ichthyosis, non-erythrodermic autosomal recessive lamellar ichthyosis, autosomal dominant lamellar ichthyosis, bullous congenital ichthyosiform erythroderma, palmoplantar keratoderma, variabilis erythrokeratoderma, verrucous epidermal nevus, pityriasis rubra pilaris, Netherton syndrome, idiopathic ichthyosis vulgaris, ichthyosis vulgaris, monilethrix, keratoderma pilaris, bullous ichthyosiform erythroderma, non-bullous congenital ichthyosis, Sjogren-Larsson syndrome, variabilis erythrokeratoderma, lenticular hyperkeratosis permanens, variabilis variabilis erythrokeratoderma patternis, Vorwinker's segmental keratoderma, harlequin ichthyosis, and Tay's syndrome.

[0277] LOX and EGFR In one aspect, the present invention relates to a lysyl oxidase inhibitor for use in the treatment or prevention of cancer associated with overexpression of EGFR.

[0278] In another aspect, the present invention relates to the use of a lysyl oxidase inhibitor in the manufacture of a medicament for treating or preventing cancer associated with overexpression of EGFR.

[0279] Suitably, in all aspects, the cancer may be selected from the group consisting of small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), pancreatic cancer, squamous cell carcinoma, skin cancer, thyroid cancer, colorectal cancer, prostate cancer, renal cancer, breast cancer, head and neck cancer, glioma, mesothelioma, epidermoid carcinoma, ovarian cancer, cervical cancer, bladder cancer, esophageal cancer, and biliary tract cancer, e.g., cholangiocarcinoma.

[0280] Suitably, in all aspects, the lysyl oxidase inhibitor may be a compound of the invention or a pharmaceutical composition of the invention.

[0281] Preferably, in all aspects of the present invention, the lysyl oxidase inhibitors of the present invention may downregulate the expression of MATN2 and / or activate SMAD2. Preferably, the lysyl oxidase inhibitors of the present invention may downregulate the expression of HTRA1. Optionally, in all aspects of the present invention, the lysyl inhibitors of the present invention may inhibit the maturation of lysyl oxidase and / or inhibit the catalytic activity of lysyl oxidase. Preferably, the lysyl oxidase inhibitors of the present invention may not inhibit MAO-A and / or MAO-B.

[0282] In a further aspect, the present invention relates to a method for treating or preventing cancer in a subject, said method comprising administering a therapeutically effective amount of a lysyl oxidase inhibitor of the present invention to said subject, wherein said subject has a cancer associated with overexpression of EGFR.

[0283] Optionally, the method may comprise determining the level of EGFR in a biological sample from the subject, and administering a lysyl oxidase inhibitor of the present invention to the subject when the presence of EGFR is determined to be overexpressed in the biological sample.

[0284] Optionally, the method includes determining a level of MATN2, pSMAD2, or HTRA1, or a combination thereof, in a biological sample of the subject; a) when the level of MATN2 is above the reference sample, and / or b) when the level of pSMAD2 is below the reference sample, and / or c) When the level of HTRA1 is higher than the reference sample, The method may further comprise the step of administering a lysyl oxidase inhibitor of the present invention to the subject.

[0285] Optionally, the subject may have a cancer selected from the group consisting of small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), pancreatic cancer, squamous cell carcinoma, skin cancer, thyroid cancer, colorectal cancer, prostate cancer, renal cancer, breast cancer, head and neck cancer, glioma, mesothelioma, epidermoid carcinoma, ovarian cancer, cervical cancer, bladder cancer, esophageal cancer, and biliary tract cancer, e.g., cholangiocarcinoma.

[0286] Preferably, in all aspects of the invention, the lysyl oxidase inhibitors of the invention may downregulate the expression of MATN2 or HTRA1 and / or activate SMAD2. Optionally, in all aspects of the invention, the lysyl inhibitors of the invention may inhibit the maturation of lysyl oxidase and / or inhibit the catalytic activity of lysyl oxidase. Preferably, the lysyl oxidase inhibitors of the invention may not inhibit MAO-A and / or MAO-B.

[0287] Disclosed herein is a method of increasing the sensitivity rate (efficacy rate) of a lysyl oxidase inhibitor of the present invention for treating cancer in a patient population, the method comprising selecting a subpopulation that overexpresses EGFR and / or MATN2 and / or HTRA1 biomarkers. Optionally, the subpopulation may underexpress pSMAD2.

[0288] Disclosed herein is a method for identifying a subject having a likelihood of increased responsiveness or sensitivity to a lysyl oxidase inhibitor of the present invention, comprising: a) determining the level of one or more of EGFR, MATN2, and HTRA1 in a biological sample of the subject; wherein an increase in the levels of EGFR, MATN2, HTRA1, or a combination thereof, compared to a reference sample indicates likely increased responsiveness or sensitivity to a lysyl oxidase inhibitor in the subject.

[0289] Disclosed herein is a method for identifying a subject having responsiveness or sensitivity to a lysyl oxidase inhibitor of the present invention, comprising: a) determining the level of one or more of EGFR, MATN2, and HTRA1 in a biological sample of the subject; wherein an increase in the level of one or more of EGFR, MATN2, and HTRA1 compared to a reference sample identifies a subject having responsiveness or sensitivity to a lysyl oxidase inhibitor.

[0290] Optionally, in all such methods, the method may comprise the further step of administering a therapeutically effective amount of a lysyl oxidase inhibitor of the present invention when the subject is identified as having a potential for increased responsiveness or sensitivity to a lysyl oxidase inhibitor.

[0291] In a further aspect, the present invention relates to a method for determining a treatment regimen for a subject having cancer, comprising: a) determining the level of one or more of EGFR, MATN2, and HTRA1 in a biological sample; b) administering a therapeutic regimen comprising a therapeutically effective amount of a lysyl oxidase inhibitor of the present invention when the levels of one or more of EGFR, MATN2, and HTRA1 are elevated compared to a reference sample; Includes:

[0292] Biomarkers As disclosed herein, clinical trials are useful for predicting response to LOX inhibitor therapy, preferably before a subject begins LOX inhibitor therapy. Such trials inform clinicians whether a patient is likely to respond to LOX inhibitor therapy, and if a patient is predicted to be unlikely to respond, the clinician can initiate an alternative therapy. This would benefit patients by targeting treatment with appropriate therapy earlier, rather than relying on the current "trial and error" approach. Thus, such trials allow for better targeting of LOX inhibitor therapy to patients earlier in the disease course, where maximum efficacy can be achieved, and may result in increased utilization of these agents because they are used more cost-effectively.

[0293] This may allow responders and non-responders to be identified so that alternative treatments can be offered to non-responders, and LOX inhibitor therapy can be offered to non-non-responders (who may therefore be moderate or good responders), and as a result, LOX inhibitor therapy can be used more targetedly and more cost-effectively.

[0294] For purposes of the biomarker and stratification aspects disclosed herein, a "LOX inhibitor" is an agent capable of reducing the expression, reducing the catalytic activity, or preventing the maturation of LOX. Preferably, the LOX inhibitor is a compound of the invention or a pharmaceutically acceptable salt thereof.

[0295] Any suitable source of lysyl oxidase may be utilized to determine LOX inhibition. The enzyme may be derived, isolated, or recombinantly produced from any source known in the art, including yeast, microorganisms, and mammals, that allows for the production of a suitable product capable of producing a detectable reagent or that is biologically active in a suitable assay. In one embodiment, the lysyl oxidase is of human, bovine, or other mammalian origin. See, e.g., Williams, et al., Anal. Biochem. 113:336 (1985); Kirschmann et al., supra, Cancer Res. 62:4478-83 (2002). LOX may be obtained from Accession No. NP00238 (preprotein sequence), Accession No. NM02317 (DNA sequence). Functional fragments or derivatives of lysyl oxidase that still substantially retain their enzymatic activity of catalyzing the oxidation of lysyl oxidase may also be used. The lysyl oxidase enzyme can sometimes be a preproprotein, a proprotein, a protein, or a biologically active fragment thereof.

[0296] The enzymatic activity of lysyl oxidase can be assessed by any suitable method. Exemplary methods for assessing lysyl oxidase activity include those described in, for example, Trackman et al., Anal. Biochem. 113:336-342 (1981), Kagan et al., Methods Enzymol. 82A:637-49 (1982), Palamakumbura et al., Anal. Biochem. 300:245-51 (2002), Albini et al., Cancer Res. 47:3239-45 (1987), and Kamath et al., Cancer Res. 61:5933-40 (2001).

[0297] The enzymatic activity of lysyl oxidase may be assessed by detecting and / or quantifying "lysyl oxidase by-products," such as H2O2 production, collagen pyridinium residue ammonium production, aldehyde product production, lysyl oxidation, or deoxypyridinoline (Dpd). Also, in vitro cell invasive ability, in vitro cell adhesion and growth, and in vivo metastatic growth may be detected and quantified. In vivo models include, but are not limited to, suitable syngeneic models, human tumor xenograft models, orthotopic models, metastatic models, transgenic models, and gene knockout models. See, e.g., Teicher, Tumors Models in Cancer Research (Humana Press 2001).

[0298] A compound is an inhibitor of lysyl oxidase expression or biological activity if it reduces the expression or activity of lysyl oxidase compared to that observed in the absence of the compound. In one embodiment, a compound is an inhibitor of lysyl oxidase if it reduces the incidence of metastases compared to that observed in the absence of the compound, and further tests suppress metastatic tumor growth.

[0299] Tumor inhibition can be quantified using any convenient measurement. For example, the occurrence of metastases can be assessed by examining the relative extent (e.g., number of organ systems involved) and relative tumor burden at such sites. Metastatic growth can be confirmed by microscopic or macroscopic analysis, as appropriate. Tumor metastasis can be reduced by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more.

[0300] Lysyl oxidase expression can be assessed using promoter analysis. Any convenient system for promoter activity analysis is available. Typically, a reporter gene system allows for the detection of promoter activity using a lysyl oxidase promoter attached to a reporter molecule such that promoter activity results in expression of the reporter molecule. See, for example, Chapter 9.6 of Ausubel et al., Current Protocols in Molecular Biology (John Wiley & Sons, current edition).

[0301] LOX can also be inhibited by degradation of its mRNA. This approach to gene regulation is described in Wilson et al., "Modulation of LDL receptor mRNA stability by phorbol esters in human liver cell culture models," Lipid Res. 38, 437-446 (1997).

[0302] The lysyl oxidase inhibitor compounds of the present invention may be used in LOX inhibition therapy as described herein.

[0303] IN VITRO method The present invention also provides an in vitro method for internalizing EGFR or reducing EGFR expression in a cell, said method comprising the step of contacting the cell with a LOX inhibitor of the present invention.

[0304] In another aspect, the invention further includes an in vitro method of downregulating MATN2 expression in a cell comprising contacting the cell with a LOX inhibitor of the invention.

[0305] In a further aspect, the present invention also provides upregulation of pSMAD2 in a cell comprising contacting the cell with a LOX inhibitor of the present invention.

[0306] Suitably, in all aspects, the cell may be a cell line, preferably a mammalian cell line.

[0307] Suitably, the cells may be cancer cells, preferably cancer cells with overexpression of EGFR.

[0308] Combination therapy, such as for the treatment of cancer LOX inhibition may be a useful method for improving the efficacy of other drugs or addressing resistance to drug treatment through several mechanisms. Specific inhibition of LOX by siRNA can induce apoptosis in laryngeal carcinoma Hep-2 cells and enhance their sensitivity to chemotherapy drugs such as cisplatin (Dong, Lu et al. 2014) and radiation (Dong, Xin et al. 2014). LOX expression and secretion increase in response to ionizing radiation (IR) and hypoxia, suggesting that LOX may contribute to the IR-induced migration phenotype in sublethally irradiated tumor cells and tumor progression. Therefore, LOX inhibitors can be used in combination with radiation therapy to reduce side effects in surrounding tissues receiving reduced radiation doses (Shen, Sharma et al. 2014). Inhibition of LOX and LOXL2 can alter vascular permeability or normalize the vasculature in the tumor environment, potentially enhancing drug delivery or efficacy (Ingber and Mammoto 2014; Marshall, Spangler et al. 2012). For example, it can improve the efficacy of treatment with chemotherapeutic agents such as Taxol in ovarian xenograft and lung allograft mouse models (Zaffryar-Eilot, Marshall et al. 2013). Pharmacological inhibition of lysyl oxidase improved drug delivery and reversed the adverse effects of VEGF ablation on drug delivery and treatment response in anti-VEGF-resistant tumors (Roehrig et al. 2017). The extracellular matrix has been proposed to play an important role in resistance to chemotherapeutic agents. Inhibition of LOX in cells growing in collagen (as an ECM surrogate) has been shown to reverse collagen-dependent resistance to chemotherapeutic agents such as erlotinib, cisplatin, and methotrexate (Smith and Holzer 2010). Drug diffusion and efficacy are reduced in 3D cell cultures (but not in 2D) by the enzymatic action of LOX and LOXL on the ECM, and sensitivity to doxorubicin and paclitaxel can be restored by inhibition with BAPN (Schuetze, Roehrig et al. 2015).LOX inhibition synergized with gemcitabine to kill tumors and significantly prolong tumor-free survival in a pancreatic mouse model. This was associated with stromal alterations and increased infiltration of macrophages and neutrophils into tumors. Thus, targeting LOX could improve outcomes in surgically resectable disease (Miller, Morton et al. 2015).

[0309] The compounds of the present invention may be used alone to provide therapeutic benefit. The compounds of the present invention may also be used in combination with one or more additional anti-tumor agents and / or radiation therapy.

[0310] Such chemotherapy may include one or more of the following categories of anti-cancer agents: (i) Antiproliferative / antineoplastic agents and combinations thereof, such as alkylating agents (e.g., cisplatin, oxaliplatin, carboplatin, cyclophosphamide, nitrogen mustard, uracil mustard, bendamustine, melphalan, chlorambucil, chlormethine, busulfan, temozolamide, nitrosoureas, ifosamide, melphalan, pipobroman, triethylene-melamine, triethylenethiophoporamine, carmustine, lomustine, sucralose, anti-metabolites (e.g., gemcitabine, and anti-folates, e.g., fluoropyrimidines such as 5-fluorouracil and tegafur, raltitrexed, methotrexate, pemetrexed, leucovorin, cytosine arabinoside, floxuridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate, pentostatin, and gemcitabine, and hydroxyurea, and trifluridine with trifluracil), antibiotics (e.g., anthracycline, anti-mitotic agents (e.g., vinca alkaloids, e.g., vincristine, vinblastine, vindesine, and vinorelbine, and taxoids, e.g., taxol and taxotere, and the polo kinase inhibitor, eribulin), proteasome inhibitors (e.g., carfilzomib, bortezomib), interferon therapy, and topoisomerase inhibitors (e.g., epipodophyllotoxins such as etoposide and teniposide, amsacrine, topotecan, irinotecan, mitoxantrone, and camptothecin), bleomcin, dactinomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, ara-C, paclitaxel (Taxol™), nab-paclitaxel, docetaxel, mithramycin, deoxyco-formycin, mitomycin-C, L-asparaginase, interferons (especially IFN-α), etoposide, teniposide,DNA-demethylating agents (e.g., azacitidine or decitabine), and histone deacetylase (HDAC) inhibitors (e.g., vorinostat, MS-275, panobinostat, romidepsin, valproic acid, mocetinostat (MGCD0103), and pracinostat SB939, and belinostat, panobinostat), trabectedin, (ii) cytostatic agents, such as antiestrogens (e.g., tamoxifen, fulvestrant, toremifene, raloxifene, droloxifene, and iodoxifene), antiandrogens (e.g., bicalutamide, flutamide, nilutamide, and cyproterone acetate), LHRH antagonists or agonists (e.g., goserelin, leuprorelin, and buserelin), progestogens (e.g., megestrol acetate), aromatase inhibitors (e.g., for example, anastrozole, letrozole, vorazole, and exemestane), and 5α-reductase inhibitors such as finasteride and navelbene, CPT-11, anastrazole, letrazole, capecitabine, cyclophosphamide, ifosamide, and droloxafine, and abiraterone, enzalutamide, somatostatin analogs such as lanreotide, (iii) anti-invasive agents, such as dasatinib, and bosutinib (SKI-606), and metalloproteinase inhibitors, inhibitors of urokinase plasminogen activator receptor function, or antibodies against heparanase; (iv) inhibitors of growth factor function: for example, such inhibitors include growth factor antibodies and growth factor receptor antibodies, such as the anti-erbB2 antibody trastuzumab [Herceptin™], the anti-HER2 antibody pertuzumab, the anti-EGFR antibody panitumumab, the anti-erbB1 antibody cetuximab, tyrosine kinase inhibitors, such as inhibitors of the epidermal growth factor family (e.g., EGFR family tyrosine kinase inhibitors, gefitinib, erlotinib, 6-acrylamido-N-(3-chloro-4-fluorophenyl)-7-(3-morpholinopropoxy)-quinazolin-4-amine (CI1033) , afatinib, vandetanib, osimertinib, and rociletinib) erbB2 tyrosine kinase inhibitors, for example, lapatinib), and antibodies against costimulatory molecules, for example, CTLA-4, 4-1BB, and PD1, or antibodies against cytokines (IL-10, TGF-β), inhibitors of the fibroblast growth factor receptor family, for example, ponatinib, nintedanib, lenvanitinib, dovitinib, lucitanib, danusertinib, brivatinib, erdafitinib, PD173074, PD-166866, AZD4547, BGJ398, LY2874455, TAS-120, ARQ 087, BLU9931, DEBIO 1347, FGF401, BAY-1163877, FIIN-2, H3B-6527, PRN1371, BLU554, S49076, SU5416, SU6668, ENMD-2076, GP-369, IMCA1, PRO-001, R3mab, antibodies that block FGF ligand binding (ligand traps), e.g., FP-1039, antibodies that disrupt FGFR dimerization, e.g., antibody-drug conjugates targeting the FGFR family, such as MFGR1877S, BAY1187982, inhibitors of the hepatocyte growth factor family, inhibitors of the insulin growth factor family, modulators of protein regulators of cell apoptosis (e.g., Bcl-2 inhibitors), inhibitors of the platelet-derived growth factor family, such as imatinib and / or nilotinib (AMN107), inhibitors of serine / threonine kinases (e.g., Ras / Raf signaling inhibitors, such as farnesyltransferase inhibitors, sorafenib, tipifarnib and lonafarnib, vemurafenib,dabrafenib), and inhibitors of cell signaling via MEK (e.g., trametinib, cobimetinib), and / or AKT kinase, c-kit inhibitors, abl kinase inhibitors, e.g., ponatinib, PI3 kinase inhibitors, Plt3 kinase inhibitors, CSF-1R kinase inhibitors, IGF receptor, kinase inhibitors, Aurora kinase inhibitors, and cyclin-dependent kinase inhibitors, e.g., CDK2 and / or CDK4 inhibitors, or CDK4 / CDK6 inhibitors, e.g., palbociclib, ribociclib, and abemaciclib, CCR2, CCR4, or CCR6 antagonists, mTOR kinase inhibitors, e.g., everolimus, yam Nuss kinase family inhibitors, for example ruxolitinib, Brunton's tyrosine kinase inhibitors, for example ibrutinib, c-Met kinase inhibitors such as anaplastic lymphoma kinase-ALK-, for example ceritinib, crizotinib, alectinib, cabozantinib, hedgehog signaling pathway inhibitors, for example vismodegib, sonidegib, and RAF kinase inhibitors, for example BAL3833 or other RAF inhibitors described in WO2006043090, WO2009077766, WO2011092469 or WO2015075483, (v) antiangiogenic agents, such as those that inhibit the effects of vascular endothelial growth factor [e.g., the anti-vascular endothelial growth factor antibody bevacizumab (Avastin™), the anti-VEGF2 antibody ramucirumab, the recombinant fusion protein ziv-aflibercept], thalidomide, pomalidomide, lenalidomide, and, for example, VEGF receptor tyrosine kinase inhibitors, such as regorafenib, vandetanib, vatalanib, sunitinib, axitinib, and pazopanib, and lenvatinib; (vi) gene therapy approaches, such as approaches to replace abnormal genes, e.g., abnormal p53 or abnormal BRCA1 or BRCA2, oncolytic viruses, e.g., talimogene laherparepvec; (vii) immunotherapeutic approaches, for example, antibody therapies such as denosumab, obinutuzumab, blinatumomab, dinutuximab, idarucizumab, daratumumab, durvalumab, necitumumab, elotuzumab, olaratumab, alemtuzumab, rituximab, ibritumomab tiuxetan (Zevalin®), and ofatumumab, interferons, for example, interferon alpha, pegylated interferon alpha-2b, interleukins, for example, IL-2 (aldesleukin), interleukin inhibitors, for example, IRAK4 inhibitors, cancer vaccines, for example, prophylactic vaccines and therapeutic vaccines, for example, HPV vaccines, for example, Gardasil, Cervarix, Oncophage, sipuleucel-T (Provenge), gp100, dendritic cell-based vaccines (e.g., Ad.p53 DC), toll-like receptor modulators, such as TLR-7, TLR-9 agonists, PD-1, PD-L1, PD-L2, and CTL4-A modulators (e.g., nivolumab, pembrolizumab, atezolizumab), antibodies and vaccines, other IDO inhibitors (e.g., indoximod), anti-PD-1 monoclonal antibodies (e.g., MK-3475 and nivolumab), anti-PDL1 monoclonal antibodies (e.g., MEDI-4736 and RG-7446), anti-PDL2 monoclonal antibodies, and anti-CTLA-4 antibodies (e.g., ipilimumab), antibody-drug conjugates, such as brentuximab vedotin, trastuzumab emtansine, (viii) cytotoxic agents, such as fludarabine (Fludara), cladribine, pentostatin (Nipent™), (ix) Targeted therapies, such as PI3K inhibitors, e.g., idelalisib, perifosine, and SMAC (second mitochondrial-derived activator of caspases) mimetics, also known as inhibitor of apoptosis protein (IAP) antagonists (IAP antagonists). These agents act to suppress IAPs, e.g., XIAP, cIAP1, and cIAP2, thereby remodeling the cellular apoptosis pathway. Specific SMAC mimetics include: Birinapant (TL32711, TetraLogic Pharmaceuticals), LCL161 (Novartis), AEG40730 (Aegera Therapeutics), SM-164 (University of Michigan), LBW242 (Novartis), ML101 (Sanford-Burnham Medical Research Institute), AT-406 (Ascenta Therapeutics / University of Michigan), GDC-0917 (Genentech), AEG35156 (Aegera Therapeutic), and HGS1029 (Human Genome Research Center) Sciences), and agents that target the ubiquitin proteasome system (UPS), such as bortezomib, ixazomib, carfilzomib, marizomib (NPI-0052), and MLN9708), and DNA repair inhibitors, such as olaparib, rucaparib, anti-apoptotic BCL protein family inhibitors, such as venetoclax. (xii) Chimeric antigen receptors, anti-cancer vaccines, and arginase inhibitors.

[0311] The additional anti-tumor agent can be a single agent or one or more additional agents listed herein.

[0312] Specific anti-cancer agents that may be used in conjunction with the compounds of the present invention include, for example: Such combination treatment may be achieved through the simultaneous, sequential, or separate administration of the individual components of the treatment. Such combinations utilize the compounds of this invention within the therapeutically effective dosage range described above and the other pharmaceutically active agent(s) within their approved dosage ranges.

[0313] When the term "combination" is used herein, it should be understood to mean simultaneous, separate, or sequential administration. In one aspect of the invention, "combination" means simultaneous administration. In another aspect of the invention, "combination" means separate administration. In a further aspect of the invention, "combination" means sequential administration. When administration is sequential or separate, the delay in administration of the second component should not be such that the beneficial effect of the combination is lost.

[0314] In some embodiments in which combination therapy is used, the amount of the compound of the present invention and the amount of the other pharmaceutically active agent, when combined, are therapeutically effective to treat the target disorder in a patient. In this context, the combined amount is a "therapeutically effective amount" if, when combined, they are sufficient to reduce or completely alleviate the symptoms or other adverse effects of the disorder, cure the disorder, reverse, completely stop, or slow the progression of the disorder, or reduce the risk of the disorder worsening. Typically, such amounts can be determined by one skilled in the art, for example, starting from the dosage ranges described herein for the compounds of the present invention and approved or other published dosage ranges for the other pharmaceutically active compound.

[0315] According to a further aspect of the present invention there is provided a compound of the invention as defined above, or a pharmaceutically acceptable salt thereof, and an additional anti-cancer agent as defined above, for use in the conjoint treatment of cancer.

[0316] According to a further aspect of the present invention there is provided a medicament comprising a compound of the invention as defined above or a pharmaceutically acceptable salt thereof and an additional anti-cancer agent as defined above for the conjoint treatment of cancer.

[0317] According to a further aspect of the present invention, there is provided a method of treating a human or animal subject suffering from cancer, which comprises administering to the subject a therapeutically effective amount of a compound of the present invention, or a pharmaceutically acceptable salt thereof, simultaneously, sequentially or in separate doses with an additional anti-cancer agent as defined above.

[0318] According to a further aspect of the present invention there is provided a compound of the present invention, or a pharmaceutically acceptable salt thereof, for simultaneous, sequential or separate use with an additional anti-cancer agent as defined above in the treatment of cancer.

[0319] The compounds of the present invention can also be used in combination with radiation therapy. Suitable radiation therapy treatments include, for example, X-ray therapy, proton therapy, or electron beam therapy. Radiation therapy can also be used with radionuclide agents, such as 131 I, 32 P, 90 Y, 89 Sr, 153 Sm, or 223 Such radionuclide therapy may involve the use of Ra. Such radionuclide therapy is well known and commercially available.

[0320] According to a further aspect of the present invention there is provided a compound of the invention as hereinbefore defined, or a pharmaceutically acceptable salt thereof, for use in the treatment of cancer in combination with radiotherapy.

[0321] According to a further aspect of the present invention, there is provided a method for treating a human or animal subject suffering from cancer, which comprises administering to the subject a therapeutically effective amount of a compound of the present invention, or a pharmaceutically acceptable salt thereof, simultaneously, sequentially, or in separate doses with radiation therapy.

[0322] synthesis In describing the synthetic methods set forth below and the reference synthetic methods used to prepare starting materials, it should be understood that all proposed reaction conditions, including the choice of solvents, reaction atmospheres, reaction temperatures, experimental times, and work-up procedures, can be selected by one skilled in the art.

[0323] It is understood by one skilled in the art of organic synthesis that the functionality present on various portions of the molecule must be compatible with the reagents and reaction conditions employed.

[0324] Necessary starting materials may be obtained by standard procedures of organic chemistry. The preparation of such starting materials is described in the context of the representative process modes below and within the accompanying examples. Alternatively, necessary starting materials may be obtained by analogous procedures illustrated which are within the ordinary skill of an organic chemist.

[0325] It will be appreciated that during the synthesis of the compounds of the invention in the processes defined below, or during the synthesis of certain starting materials, it may be desirable to protect certain substituents to prevent undesired reactions. The skilled chemist will know when such protection is necessary and how to put such protecting groups in place and to subsequently remove them.

[0326] For examples of protecting groups, see one of the many general works on the subject, such as 'Protective Groups in Organic Synthesis' by Theodora Green (publisher: John Wiley & Sons). Protecting groups may be removed by any convenient method described in the literature or known to the skilled chemist, as required for removal of the protecting group in question. Such methods will be chosen to effect removal of the protecting group with minimal disturbance to groups elsewhere in the molecule.

[0327] Thus, if the reactants contain groups such as amino, carboxy, hydroxy, etc., it may be desirable to protect the group in some of the reactions mentioned herein.

[0328] For example, suitable protecting groups for amino or alkylamino groups include, for example, acyl groups, such as alkanoyl groups, for example, acetyl or trifluoroacetyl, alkoxycarbonyl groups, for example, methoxycarbonyl, ethoxycarbonyl, or t-butoxycarbonyl groups, arylmethoxycarbonyl groups, for example, benzyloxycarbonyl, or aroyl groups, for example, benzoyl. The deprotection conditions for the above protecting groups necessarily vary with the choice of protecting group. Thus, for example, acyl groups, for example, alkanoyl or alkoxycarbonyl groups, or aroyl groups, can be removed, for example, by hydrolysis using a suitable base, for example, an alkali metal hydroxide, for example, lithium hydroxide or sodium hydroxide. Alternatively, acyl groups such as tert-butoxycarbonyl groups may be removed, for example, by treatment with a suitable acid, for example hydrochloric acid, sulfuric acid, or phosphoric acid, or trifluoroacetic acid, and arylmethoxycarbonyl groups, for example, benzyloxycarbonyl groups, may be removed, for example, by hydrogenation over a catalyst such as palladium-on-carbon, or by treatment with a Lewis acid such as BF3.OEt2. A suitable alternative protecting group for a primary amino group is, for example, a phthaloyl group, which may be removed by treatment with an alkylamine, for example dimethylaminopropylamine, or with hydrazine.

[0329] Suitable protecting groups for hydroxy groups are, for example, acyl groups, such as alkanoyl groups, for example, acetyl, aroyl groups, for example, benzoyl, or arylmethyl groups, for example, benzyl. The deprotection conditions for the above protecting groups will necessarily vary with the choice of protecting group. Thus, for example, acyl groups, such as alkanoyl or aroyl groups, can be removed by hydrolysis, for example, using a suitable base, for example, an alkali metal hydroxide, for example, lithium hydroxide, sodium hydroxide, or ammonia. Alternatively, arylmethyl groups, such as benzyl groups, can be removed by hydrogenation, for example, using a catalyst such as palladium on carbon.

[0330] Suitable protecting groups for carboxy groups are, for example, esterifying groups such as methyl or ethyl groups which may be removed by hydrolysis with a base such as, for example, sodium hydroxide, or for example, a t-butyl group which may be removed by treatment with an acid, for example an organic acid such as trifluoroacetic acid, or for example, a benzyl group which may be removed by hydrogenation using a catalyst such as, for example, palladium on carbon.

[0331] Resins can also be used as protecting groups.

[0332] Abbreviation The following abbreviations are used: Ac Acetyl Bn Benzyl BOC tert-butyloxycarbonyl BOC2O Di-tert-butyl dicarbonate Bu butyl t Bu t-butyl BnNH2 benzylamine CDCl3 deuterated chloroform cHex cyclohexane DCM dichloromethane DIPEA N,N-Diisopropylethylamine DMF N,N-dimethylformamide DMSO dimethyl sulfoxide Eq equivalent Et Ethyl EtOH ethanol EtOAc Ethyl acetate Et2O diethyl ether GP General Procedures hr(s) time HATU 1 -[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5b]pyridinium 3-oxide hexafluorophosphate HPLC High Performance Liquid Chromatography HRMS high resolution mass spectrometry m-CPBA meta-chloroperoxybenzoic acid Me methyl MeOH Methanol MgSO4 Magnesium Sulfate NMR nuclear magnetic resonance Pd-C Palladium-supported carbon Pd2(dba)3 tris(dibenzylideneacetone)dipalladium(0) min(s) minutes rt room temperature TEA Triethylamine THF tetrahydrofuran XPhos 2-Dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl

[0333] Testing Procedure: Unless otherwise noted, reactions were carried out in oven-dried glassware under a nitrogen or argon atmosphere using anhydrous solvents. All commercially available reagents and solvents were used as received. Column chromatography was performed on a Biotage SP1 purification system using Biotage Flash silica cartridges (SNAP KP-Sil). Semi-preparative HPLC was performed on an Agilent 6120 system at a flow rate of 20 mL / min, with eluents of 0.1% acetic acid in water and 0.1% acetic acid in methanol, and a gradient of 10–100% organic phase. 1H NMR spectra were recorded on a Bruker AMX500 (500 MHz) or AMX300 (300 MHz) spectrometer using an internal deuterium lock. Chemical shifts are given in parts per million (ppm) using the following internal references: CDCl3 (δH 7.26), MeOD (δH 3.31), and DMSO-d6 (δH 2.50). Signal multiplicities are reported as singlet (s), doublet (d), triplet (t), quartet (q), multiplet (m), or doublet of doublets (dd). Coupling constants J were measured to the nearest 0.1 Hz. High-resolution mass spectra were recorded on an Agilent 1200 Series HPLC and a diode array detector coupled to a 6210 time-of-flight mass spectrometer with a dual multimode APCI / ESI source, or on a diode array detector coupled to a Waters Acquity UPLC and a Waters G2 QToF mass spectrometer equipped with a multimode ESI / APCI source. Analytical separations were performed according to the methods listed below. The mobile phase was a mixture of methanol (solvent A) and water (solvent B), both containing 0.1% formic acid, with UV detection at 254 nm. Method I: Agilent 1200 Series HPLC on a Merck Purospher STAR (RP-18e, 30 mm x 4 mm) column using a 4-min gradient elution at a flow rate of 1.5 mL / min. Gradient elution was as follows: 10:90 (A / B) to 90:10 (A / B) over 2.5 min, 90:10 (A / B) over 1 min, then reversed back to 10:90 (A / B) over 0.3 min, and finally 10:90 (A / B) over 0.2 min. Method II: Agilent 1200 Series HPLC with a Merck Chromolith flash column (RP-18e, 25 mm x 2 mm) at 30 °C using a flow rate of 0.75 mL / min for a 4 min gradient elution. Gradient elution was as follows: 5:95 (A / B) to 100:0 (A / B) over 2.5 min, 100:0 (A / B) over 1 min, then reversed back to 5:95 (A / B) over 0.1 min, and finally 5:95 (A / B) over 0.4 min.Method III: Phenomenex Kinetex XB-C18 column (30 mm x 2.1 mm, 1.7 μm, 100 μL) at 30 °C using a 4 min gradient elution at a flow rate of 0.3 mL / min. Å ) Waters Acquity UPLC. Gradient elution was as follows: 10:90 (A / B) to 90:10 (A / B) over 3 min, 90:10 (A / B) over 0.5 min, then reversed back to 10:90 (A / B) over 0.3 min, and finally 10:90 (A / B) over 0.2 min. Method IV: A Phenomenex Kinetex C18 column (30 mm x 2.1 mm, 2.6 μm, 100 μL) was used with the flow rate and gradient elution according to Method III. Å ) Waters Acquity UPLC. The following reference masses were used for HRMS analysis: Agilent 1200 series, caffeine [M+H] + 195.087652, Hexakis(1H,1H,3H-tetrafluoropentoxy)phosphazene [M+H] + 922.009798, and hexakis(2,2-difluoroethoxy)phosphazene [M+H] + 622.02896 or reserpine [M+H] + 609.280657. Waters Acquity UPLC: Leucine enkephalin fragment ions [M+H] + 397.1876. All compounds were >95% pure by LCMS analysis unless otherwise stated.

[0334] General procedure for the synthesis of cyclic diamines General Procedure GP1 Intermediates according to the present invention can be prepared as illustrated in Scheme 1, where R and R' correspond to the substituents of each specific compound described herein. [ka]

[0335] In the first step, a solution (1-2.5 M) of aniline (1-1.2 eq), 2-cyclohexen-1-one (1.6-2.5 eq), L-proline (0.3 eq), and 37% aqueous formaldehyde (1 eq.) in DMSO was stirred at rt-50°C for up to 24 h. After cooling to rt, the mixture was diluted with EtOAc and then washed with water and brine. The organic phase was separated, dried over MgSO, filtered, and evaporated to dryness. The resulting residue was purified by flash chromatography (using a Biotage silica gel column and a gradient of EtOAc in cHex). This intermediate was used in the next step without further purification.

[0336] In the second step, sodium azide (1.5–2.5 eq.) was added portionwise to a solution of bridged piperidin-4-one (1 eq.) in concentrated H2SO4 (0.4–1 M) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and then at rt for 30 min–2 hr. The mixture was then cooled to 0 °C, diluted with ice, made basic by careful addition of NaOH pellets (or a 3 M aqueous solution of NaOH), and extracted with DCM (or EtOAc). The combined organic layers were dried over MgSO4, filtered, and evaporated under reduced pressure. The resulting residue was purified by flash chromatography (using a Biotage silica gel column and a gradient of MeOH in EtOAc (or a gradient of EtOAc in cHex)) to give the two individual regioisomers.

[0337] In the third step (using condition a), a solution of LiAlH4 in THF (1.0 M or 2.0 M, 2–6 eq) was added dropwise to a solution (0.3–1 M) of bridged homopiperazinone (1 eq) in anhydrous THF at 0 °C. The mixture was stirred under reflux for 3–24 h, then cooled to rt, and water (0.05 mL per 1 mmol of LiAlH4), a 2.0 M aqueous solution of NaOH (0.1 mL per 1 mmol of LiAlH4), and water (0.1 mL per 1 mmol of LiAlH4) were added. The mixture was stirred at rt for 30 min, diluted with EtOAc, dried over MgSO4, filtered, and concentrated under reduced pressure to give the bridged homopiperazine derivative. This material was used in the next step without further purification.

[0338] Alternatively (using condition b), to a solution (0.5 M) of the bridged homopiperazinone (1 eq) in THF was added dropwise 5 eq of BH3.THF complex (1.0 M) at 0 °C. The mixture was refluxed for 1-5 days, then quenched with ethanol and stirred again at reflux for 1 day. After cooling to rt, all volatiles were removed under reduced pressure. The resulting residue was used in the next step without further purification.

[0339] Intermediate 1: (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane [ka] Using 4-ethoxyaniline (8.6 mL, 60 mmol) and 4,4-dimethylcyclohex-2-en-1-one (12.5 mL, 95 mmol) in GP1 steps 1-3a gave the intermediate (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane, which was used in the next step without further purification (446 mg, 12%). 1H NMR(500MHz,CDCl3)δ 6.85(d,J=9.1Hz,2H),6.56(d,J=9.1Hz,2H),3.98(q,J=6.9Hz,2H),3.32-3.31(m,1H),3.29(d d,J=10.1 and 2.1Hz,1H),3.24(dd,J=13.6 and 3.8Hz,1H),3.14(dt,J=10.1 and 2.8Hz,1H),3.10-3.0 6(m,1H),2.88(dd,J=13.2 and 2.1Hz,1H),2.84(d,J=13.6,1H),2.32-2.20(m,1H),1.77(s,1H)1 .71(d,J=13.6Hz,1H),1.49-1.45(m,1H),1.38(t,J=6.9Hz,3H),1.15(s,3H),0.89(s,3H);HRMS C 17 H 27 NO[M+H] + Calculated value: 275.2123; measured value: 275.2119.

[0340] Intermediate 2: (1R,5S)-6-(4-ethoxyphenyl)-3,6-diazabicyclo[3.2.2]nonane [ka] Using 4-ethoxyaniline (6.44 mL, 50 mmol) and 2-cyclohexenone (9.68 mL, 100 mmol) in GP1 steps 1-3a gave the intermediate (1R,5S)-6-(4-ethoxyphenyl)-3,6-diazabicyclo[3.2.2]nonane (426.1 mg, 3% over 3 steps). HRMS C 15 H 23 NO[M+H] + Calculated value: 247.1810; measured value: 247.1858.

[0341] Intermediate 3: 4-(4-((1R,5S)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenyl)thiomorpholine-1,1-dioxide [ka] In GP1 steps 1-3b, 4-(4-aminophenyl)thiomorpholine-1,1-dioxide (5 g, 22.1 mmol) and 4,4-dimethylcyclohex-2-en-1-one (4.65 mL, 35.4 mmol) were used to give 4-(4-((1R,5S)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenyl)thiomorpholine-1,1-dioxide, which was used in the next step without further purification. HRMS C 19 H 30 N3O2S[M+H] + Calculated value: 364.2014; measured value: 364.2112.

[0342] Intermediate 4: (1S,4S)-2-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptane (HCl salt) [ka] A solution of 4-bromophenetole (0.72 mL, 5.04 mmol) and (1S,4S)-2-BOC-2,5-diazabicyclo-[2,2,2]-heptane (1 g, 5.04 mmol) in toluene (21 mL) was added to Pd(dba) (230.8 mg, 0.05 mmol), + / - BINAP (313.8 mg, 0.504 mmol), and NaO. t Bu (968.8 mg, 10.1 mmol) was reacted with HCl under reflux for 24 hours. After cooling to room temperature, the mixture was filtered through a Celite pad and then evaporated to dryness. The resulting residue was dissolved in DCM, washed with water, dried over MgSO4, filtered, and evaporated to dryness. The crude product was purified by flash chromatography (using a Biotage silica gel column and a gradient of 0 to 50% EtOAc in cHex) to give t-butyl-(1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (978.6 mg, 61%). 1H NMR(500MHz,DMSO-d6)δ 6.81-6.75(m,2H),6.55-6.49(m,2H),4.44-4.32(m,2H),3.94-3.84(m,2H),3.56-3.47(m,1H),3.30-3.16(m,2H),2.87(dd,1H,J= HRMS C 18 H 27 N2O3[M+H] + Calculated value: 319.2022; measured value: 319.1717.

[0343] A suspension of t-butyl (1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (965 mg, 3.03 mmol) in HCl / dioxane (4.0 M, 15 mL) was stirred at rt for 1 hr and then evaporated to dryness to give (1S,4S)-2-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptane (HCl salt). This intermediate was used in the next step without further purification. HRMS C 13 H 19 NO[M+H] + Calculated value: 219.1497; measured value: 219.1564.

[0344] Intermediate 5: 2-(4-ethoxyphenyl)octahydropyrrolo[3,4-c]pyrrole (HCl salt) [ka] A solution of 4-bromophenetole (3.57 mL, 23.6 mmol) and t-butyl hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (5 g, 23.6 mmol) in toluene / t-BuOH (4:1, 118 mL) with Pd(OAc) (265 mg, 5%), X-Phos (1.0 g, 10%), and NaO tThe reaction was carried out with Bu (2.72 g, 28.3 mmol) at 110 °C for 16 h. After cooling to rt, all volatiles were removed under reduced pressure. The resulting residue was purified by flash chromatography (using a Biotage silica gel column and a gradient of 0 to 30% EtOAc in cHex) to give t-butyl 5-(4-ethoxyphenyl)hexahydropyrrolo[3,4c]pyrrole-2(1H)-carboxylate (7.0 g, 89%). 1 H NMR(500MHz,CDCl3)δ 6.89-6.81(m,2H),6.56-6.48(m,2H),3.98(q,J= 7.0Hz,2H),3.68-3.59(m,2H),3.50-3.41(m,2H),3.38(d,J= HRMS C 19 H 29 N2O3[M+H] + Calculated value: 333.2159; measured value: 333.2173.

[0345] A suspension of t-butyl 5-(4-ethoxyphenyl)hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (7.0 g, 21 mmol) in HCl / dioxane (4.0 M, 105 mL) was stirred at rt for 1 h and then evaporated to dryness to give 2-(4-ethoxyphenyl)octahydropyrrolo[3,4-c]pyrrole (HCl salt). This residue was used in the next step without further purification.

[0346] Intermediate 6: cis-2-(4-fluorophenyl)octahydropyrrolo[3,4-c]pyrrole (HCl salt) [ka] Pd(OAc) (96.1 mg, 5%), X-Phos (409 mg, 10%), NaO tBu (988 mg, 10.3 mmol), 1-bromo-4-fluorobenzene (0.94 mL, 8.58 mmol), tert-butyl cis-hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (2.0 g, 9.43 mmol), and t tert-Butyl cis-5-(4-fluorophenyl)hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate was synthesized from BuOH / toluene (1:5, 43 mL) at 90 °C for 16 h. Chromatography (EtOAc / cyclohexane 0 → 30): white solid (1.91 g, 73%). 1 H NMR(500MHz,chloroform-d)δ 7.01-6.90(m,2H),6.54-6.43(m,2H),3.72-3.58(m,2H),3.53-3.44(m,2H),3.3 8(br,1H),3.26(br,1H),3.18(dd,J=9.4,3.7Hz,2H),3.00(br,2H),1.46(s,9H).

[0347] Treatment with 4M HCl in dioxane as described for intermediate 5 gave intermediate 6, which was used in the next step without further purification.

[0348] Intermediate 7: tert-butyl cis-5-(4-chlorophenyl)hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (HCl salt) [ka] Pd2dba3 (220 mg, 10%), X-Phos (225 mg, 20%), NaO t Bu (272 mg, 2.83 mmol), 1-chloro-4-iodobenzene (618 mg, 2.60 mmol), tert-butyl cis-hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (500 mg, 2.36 mmol), and ttert-Butyl cis-5-(4-chlorophenyl)hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate was synthesized from BuOH / toluene (1:5, 24 mL) at 100 °C for 16 h. Chromatography (basic alumina, EtOAc / petroleum ether 0→80%) afforded a pale yellow solid (590 mg, 78%). 1 H NMR (CDCl3, 300 MHz) 7.16(d,2H,J=9.0Hz),6.45(d,2H,J=9.0Hz),3.67-3.61(m,2H),3.53-3.46(m,2H),3. 38-3.21(m,2H),3.17(dd,2H,J=9.6,4.0Hz),3.04-2.94(m,2H),1.45(s,9H)ppm;LCMS m / z 323.0 actual value (M+H) + ,C 17 H 24 N2O2Cl.

[0349] Treatment with 4M HCl in dioxane as described for intermediate 5 gave intermediate 7, which was used in the next step without further purification.

[0350] Intermediate 8: 4-(4-(1,4-diazepan-1-yl)phenyl)thiomorpholine 1,1-dioxide (HCl salt) [ka] A solution of 1-fluoro-4-nitrobenzene (6.86 g, 48.6 mmol) and t-butyl 1,4-diazepane-1-carboxylate (9.74 g, 48.6 mmol) in DMF (73 mL) was reacted at 80° C. for 24 hrs. After cooling to rt, water was added to the mixture, and the resulting precipitate was filtered, washed with water, and dried under high vacuum to give t-butyl-4-(4-nitrophenyl)-1,4-diazepane-1-carboxylate (14.8 g, 95%). HRMS C 12 H 16 N3O4[M+H-tBu] + Calculated value: 266.1141; measured value: 266.1094.

[0351] A solution of tert-butyl-4-(4-nitrophenyl)-1,4-diazepane-1-carboxylate (10.5 g, 32.7 mmol) in MeOH (654 mL) was reacted with H generated by an H-Cube system using a 10% Pd-C cartridge. After evaporation of the volatiles, tert-butyl 4-(4-aminophenyl)-1,4-diazepane-1-carboxylate was recovered (7.2 g, 76%) and used in the next step without further purification.

[0352] A solution of t-butyl 4-(4-aminophenyl)-1,4-diazepane-1-carboxylate (7.2 g, 24.7 mmol) in a mixture of iPrOH / HO (3:1, v / v, 100 mL) and divinyl sulfone (2.48 mL, 24.7 mmol) was reacted at 80 °C for 24 h. After cooling to rt, the volatiles were removed under reduced pressure, and the resulting residue was purified by flash chromatography (using a Biotage silica gel column and a gradient of 0 to 80% EtOAc in cHex). This solid fraction (1 g, 2.44 mmol) was then suspended in HCl / dioxane (4.0 M, 15 mL) and stirred at rt for 1 h. After evaporation of the volatiles, 755 mg of 4-(4-(1,4-diazepan-1-yl)phenyl)thiomorpholine 1,1-dioxide was obtained and used in the next step without further purification. HRMS C 15 H 23 N3O2S[M+H] + The calculated value was 309.1511, and the measured value was 309.25.

[0353] Intermediate 9: t-butyl-(2-((3-(4-((1R,5S)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenoxy)propyl)sulfonyl)ethyl)carbamate [ka] A solution of (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (2 g, 7.29 mmol) and benzyl bromide (1.04 mL, 8.75 mmol) in CHCN (40 mL) was reacted with KCO (2.01 g, 14.58 mmol) at 50 °C for 12 h. After cooling to rt, the volatiles were removed and the residue was dissolved in DCM and washed with water. The organic layer was separated, dried over MgSO, filtered, and evaporated to dryness to give (1R,5S)-3-benzyl-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (3.01 g, quantitative). 1 H NMR(500MHz,DMSO-d6)δ 7.35-7.28(m,4H),7.26-7.21(m,1H),6.78-6.73(m,2H),6.52-6.47(m,2H),3.88(q,J=6.9Hz,2H),3.49(s,2H),3.33(d,J= 4.9Hz,1H),3.14(dd,J= 10.3,2.5Hz,1H),3.07-2.83(m,3H),2.28(t,J= 7.4Hz,1H),2.13(dd,J= 20.4,11.6Hz,2H),1.86(d,J= 12.7Hz,1H),1.29-1.22(m,4H),1.12(s,3H),0.76(s,3H);HRMS C 24 H 33 NO[M+H] + Calculated value: 365.2593; measured value: 365.2601.

[0354] A solution of (1R,5S)-3-benzyl-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (2.88 g, 7.9 mmol) in DCM (35 mL) was reacted with a 1.0 M solution of boron tribromide in DCM (23.7 mL) for 30 min at 0 °C and then quenched with aq. saturated NaHCO solution at 0 °C. The organic layer was collected, dried over MgSO, filtered, and evaporated to dryness. The resulting residue was purified by flash chromatography (using a Biotage column and a gradient of 0 to 25% MeOH in EtOAc). The resulting residue was used in the next step without further purification.

[0355] A solution of 4-((1R,5S)-3-benzyl-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenol (2.6 g, 7.73 mmol) and t-butyl-(2-((3-bromopropyl)sulfonyl)ethyl)carbamate (2.55 g, 7.73 mmol) in DMF (30 mL) was reacted with K2CO3 (2.16 g, 15.46 mmol) at 80 °C for 12 h. After cooling to rt, the mixture was diluted with DCM and washed with water. The organic layer was separated, dried over MgSO4, filtered, and evaporated to dryness. The residue was then purified by flash chromatography (using a Biotage silica gel column and a gradient of 0 to 50% EtOAc in cHex) to give t-butyl-(2-((3-(4-((1R,5S)-3-benzyl-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenoxy)propyl)sulfonyl)ethyl)carbamate (1.08 g, 24% over two steps). 1H NMR(500MHz,CDCl3)δ 7.38-7.24(m,5H),6.85-6.80(m,2H),6.55-6.50(m,2H),4.04(t,J= 5.7Hz,2H),3.68(q,J= 5.8Hz,2H),3.57-3.45(m,2H),3.30-3.16(m,6H),3.14-2.90(m,3H),2.36-2.24(m,4H),2.22-2.17(m,1H),1.97(dd,J= 12.3,2.1Hz,1H),1.46(s,9H),1.32(dd,J= 12.9,6.6Hz,1H),1.13(s,3H),0.85(s,3H);HRMS C 32 H 48 N3O5S(M+H + ) calculated value 586.3315; measured value 586.3530.

[0356] A solution of t-butyl (2-((3-(4-((1R,5S)-3-benzyl-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenoxy)propyl)sulfonyl)ethyl)carbamate (1.06 g, 1.82 mmol) in 2,2,2-trifluoroethanol (20 mL) was reacted with ammonium formate (1.15 g, 18.2 mmol) and 10% Pd—C (212 mg, 20% wt) under reflux for 2 hrs. After cooling to rt, the mixture was filtered through a Celite pad and evaporated to dryness. The resulting residue was used in the next step without further purification. HRMS C 25 H 42 N3O5S(M+H + ) calculated value 496.2845; measured value 496.2835.

[0357] Intermediate 10: cis-2-(4-bromophenyl)octahydropyrrolo[3,4-c]pyrrole (HCl salt) [ka] A mixture of 4-bromo-1-iodobenzene (1.39 g, 4.90 mmol), tert-butyl cis-hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (800 mg, 3.77 mmol), CuI (72.1 mg, 10%), L-proline (86.8 mg, 20%), KCO (67.7 mg, 4.90 mmol), and DMSO (19 mL) was stirred at 90 °C for 16 h. After cooling to rt, the mixture was diluted with EtOAc. The organic phase was washed with HO (3x) and brine, dried over MgSO, filtered, and the solvent was removed under reduced pressure. The crude was purified by chromatography (EtOAc / cyclohexane 0→25%) to give tert-butyl cis-5-(4-bromophenyl)hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate as a white solid (753 mg, 54%). 1 H NMR(500MHz,acetone-d6)δ 7.31-7.25(m,2H),6.55-6.50(m,2H),3.67-3.55(m,2H),3.55-3.44(m,2H),3.26(dd ,J=11.4,3.9Hz,2H),3.23-3.14(m,2H),3.11-3.01(m,2H),1.42(s,9H).MS(ES+)m / z 367 / 369(M+H) + .

[0358] Treatment with 4M HCl in dioxane as described for intermediate 5 gave intermediate 10, which was used in the next step without further purification.

[0359] Intermediate 11: cis-2-(perfluorophenyl)octahydropyrrolo[3,4-c]pyrrole (HCl salt) [ka] A mixture of tert-butyl cis-hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (0.50 g, 2.36 mmol), hexafluorobenzene (545 μL, 4.72 mmol), K2CO3 (391 mg, 2.83 mmol), and DMF (1.2 mL) was stirred at 70 °C for 5 h. After cooling to rt, the mixture was diluted with EtOAc (30 mL). The organic layer was washed with HO (3 × 30 mL), brine (30 mL), dried over MgSO4, filtered, and the solvent was removed under reduced pressure. The crude product was purified by chromatography (EtOAc / petroleum ether 0 → 25%) to give tert-butyl cis-5-(perfluorophenyl)hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate as a colorless oil (439 mg, 49%). 19F NMR (282 MHz, Chloroform-d) δ-152.85--153.25(m),-164.08--164.37(m),-168.38--168.67(m). 1 H NMR (300 MHz, chloroform-d) δ 3.80-3.54 (m, 4H), 3.48-3.22 (m, 4H), 3.03-2.85 (m, 2H), 1.47 (s, 9H). MS (ESI) m / z 323 [M- t Bu+2H] + .

[0360] Treatment with 4M HCl in dioxane as described for intermediate 5 gave intermediate 11, which was used in the next step without further purification.

[0361] Intermediate 12: tert-Butyl cis-5-(4-bromophenyl)-3a,6a-dimethylhexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate [ka] N-Benzyl-1-methoxy-N-((trimethylsilyl)methyl)methanamine (165 mmol) was added slowly via addition funnel to a solution of trifluoroacetic acid (2.90 mL, 30%) and 1-(4-bromophenyl)-3,4-dimethyl-1H-pyrrole-2,5-dione (35.4 g, 127 mmol) in DCM (211 mL). The mixture was stirred at rt for 20 h. 1 M NaOH (200 mL) was added to the solid, and the aqueous phase was extracted with DCM (2 × 150 mL), dried over MgSO4, filtered, and the solvent was removed under reduced pressure. The crude material was recrystallized from EtOAc / cyclohexane to give cis-5-benzyl-2-(4-bromophenyl)-3a,6a-dimethyltetrahydropyrrolo[3,4c]pyrrole-1,3(2H,3aH)-dione as a white crystalline solid (38.5 g, 73%). 1 H NMR (500MHz, acetone-d6)δ 7.74-7.67(m,2H),7.35-7.21(m,7H),3.59(s,2H),3.42-3.34(m,2H),2.28-2.23(m,2H),1.33(s,6H).

[0362] To a solution of cis-5-benzyl-2-(4-bromophenyl)-3a,6a-dimethyltetrahydropyrrolo[3,4-c]pyrrole-1,3(2H,3aH)-dione (20.0 g, 48.4 mmol) in 1,4-dioxane (194 mL) was added BH3.THF (1.0 M, 194 mL, 194 mmol), and the mixture was stirred at 90 °C for 16 h. After cooling to rt, it was carefully quenched with EtOH (ca. 200 mL) and stirred at 90 °C for 1 h. The solvent was removed under reduced pressure, and the crude was purified by chromatography (THF / cyclohexane 0→25%) to give cis-2-benzyl-5-(4-bromophenyl)-3a,6a-dimethyloctahydropyrrolo[3,4-c]pyrrole as a colorless syrup (13.8 g, 74%). 1H NMR(500MHz,chloroform-d)δ 7.34-7.19(m,7H),6.51-6.44(m,2H),3.60(s,2H),3.39(d,J=9.3Hz,2H),3 .08(d,J=9.3Hz,2H),2.78(d,J=9.2Hz,2H),2.47-2.38(m,2H),1.13(s,6H).

[0363] To a solution of cis-2-benzyl-5-(4-bromophenyl)-3a,6a-dimethyloctahydropyrrolo[3,4c]pyrrole (13.7 g, 35.7 mmol) in MeCN (119 mL) was added 1-chloroethyl chloroformate (4.62 mL, 42.8 mmol), and the mixture was stirred at 70 °C for 1 h. After cooling to rt, the solvent was removed under reduced pressure. DCM (119 mL) was added, followed by EtN (14.9 mL, 107 mmol) and BocO (9.82 mL, 42.8 mmol), and the mixture was stirred at rt for 16 h. The solvent was removed under reduced pressure. Cyclohexane (200 mL) was added, and the suspension was stirred for 10 min. The mixture was filtered, and the solid was washed extensively with cyclohexane. The filtrate was collected, and the solvent was removed under reduced pressure. The crude was purified by chromatography (EtOAc / cyclohexane 0→20%) to give tert-butyl cis-5-(4-bromophenyl)-3a,6a-dimethylhexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate as a white solid (14.1 g, quantitative). 1 H NMR (500 MHz, chloroform-d) δ 7.32-7.28 (m, 2H), 6.40-6.35 (m, 2H), 3.62-3.12 (m, 8H), 1.46 (s, 9H), 1.14 (s, 6H).

[0364] General Procedure GP2 [ka] toluene: tA mixture of aryl bromide (1.1 eqv.), amine R'NH2 (1.0 eqv.), Pd2dba3 (10 mol%), X-Phos (20 mol%), and sodium tert-butoxide (1.2 eqv) in BuOH (0.1–0.2 M) was degassed with argon for 5 min and stirred overnight at 100 °C. After cooling to room temperature, the reaction mixture was diluted with ethyl acetate, washed with water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated to give the crude product, which was purified by chromatography.

[0365] Intermediate 13: 4-(4-(cis-3a,6a-dimethylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl)phenyl)morpholine (HCl salt) [ka] According to general procedure GP2, morpholine (0.037 mL, 0.417 mmol), tert-butyl cis-5-(4-bromophenyl)-3a,6a-dimethylhexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (150 mg, 0.379 mmol), Pd2dba3 (35 mg, 10 mol%), X-Phos (36 mg, 20 mol%), sodium tert-butoxide (44 mg, 0.455 mmol), and t tert-Butyl cis-3a,6a-dimethyl-5-(4-morpholinophenyl)hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate was synthesized from BuOH / toluene (1:4, 5.0 mL) at 100 °C for 16 h. Chromatography (basic alumina, EtOAc / petroleum ether 0→100%) afforded an off-white solid (90 mg, 59%). 1 H NMR(CDCl3,300MHz)δ LCMS m / z 402.4 Actual value (M+H) + ,C 23 H 36N3O3.

[0366] Treatment with 4M HCl in dioxane as described for intermediate 5 gave intermediate 13, which was used in the next step without further purification.

[0367] Intermediate 14: cis-3a,6a-dimethyl-2-(4-(4-(methylsulfonyl)piperazin-1-yl)phenyl)octahydropyrrolo[3,4-c]pyrrole (HCl salt) [ka] According to general procedure GP2, 1-(methylsulfonyl)piperazine (90 mg, 0.55 mmol), tert-butyl cis-5-(4-bromophenyl)-3a,6a-dimethylhexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (200 mg, 0.50 mmol), Pd2dba3 (45 mg, 10 mol%), X-Phos (48 mg, 20 mol%), sodium tert-butoxide (58 mg, 0.60 mmol), and toluene: t tert-Butyl cis-3a,6a-dimethyl-5-(4-(4-(methylsulfonyl)piperazin-1-yl)phenyl)hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate was synthesized from BuOH (5:1, 6 mL) at 100 °C for 16 h. Chromatography (basic alumina, EtOAc / petroleum ether 0→100%) afforded a light brown solid (184 mg, 76%). 1 H NMR(CDCl3,300MHz)δ LCMS m / z 479.4 Actual value (M+H) + ,C 24 H 39 N4SO4.

[0368] Treatment with 4M HCl in dioxane as described for intermediate 5 gave intermediate 14, which was used in the next step without further purification.

[0369] Intermediate 15: 4-(4-(cis-3a,6a-dimethylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl)phenyl)thiomorpholine 1,1-dioxide (HCl salt) [ka] Thiomorpholine-1,1-dioxide (75 mg, 0.55 mmol) and tert-butyl cis-5-(4-bromophenyl)-3a,6a-dimethylhexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (200 mg, 0.50 mmol), Pd2dba3 (45 mg, 10 mol%), X-Phos (48 mg, 20 mol%), sodium tert-butoxide (58 mg, 0.60 mmol), and toluene according to general procedure GP2: t tert-Butyl cis-5-(4-(1,1-dioxidothiomorpholino)phenyl)-3a,6a-dimethylhexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate was synthesized from BuOH (5:1, 6 mL) at 100 °C for 16 h. Chromatography (basic alumina, EtOAc / petroleum ether 0→100%) afforded an off-white solid (184 mg, 81%). 1 H NMR(CDCl3,300MHz)δ LCMS m / z 450.4 Actual value (M+H) + ,C 23 H 36 N3SO 4.

[0370] Treatment with 4M HCl in dioxane as described for intermediate 5 gave intermediate 15, which was used in the next step without further purification.

[0371] Intermediate 16: 4-(4-(2,7-diazaspiro[4.4]nonan-2-yl)phenyl)thiomorpholine 1,1-dioxide (HCl salt) [ka] 1-Bromo-4-iodobenzene (344 mg, 1.22 mmol) and tert-butyl-2,7-diazaspiro[4.4]nonane-2-carboxylate (250 mg, 1.10 mmol) in toluene: t The mixture was suspended in BuOH (5:1, 12 mL) at room temperature, and the solution was degassed with argon for 5 minutes. Pd2dba3 (101 mg, 10 mol%), XantPhos (127 mg, 20 mol%), and sodium tert-butoxide (127 mg, 1.32 mmol) were then added with stirring, and the solution was bubbled with argon for an additional 5 minutes, after which it was heated to 100 °C overnight with stirring under nitrogen. After cooling to room temperature, the reaction mixture was diluted with ethyl acetate (20 mL), washed with water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on basic alumina eluting with 0–100% ethyl acetate / petroleum ether to give tert-butyl 7-(4-bromophenyl)-2,7-diazaspiro[4.4]nonane-2-carboxylate (300 mg, 71% yield) as a yellow oil. 1 H NMR(CDCl3,300MHz)δ LCMS m / z 381.3 actual value (M+H) + ,C 18 H 26 N2O2Br.

[0372] Thiomorpholine-1,1-dioxide (108 mg, 0.80 mmol), tert-butyl 7-(4-bromophenyl)-2,7-diazaspiro[4.4]nonane-2-carboxylate (278 mg, 0.73 mmol), Pd2dba3 (67 mg, 10 mol%), X-Phos (70 mg, 20 mol%), and sodium tert-butoxide (84 mg, 0.88 mmol), and toluene according to general procedure GP2: t tert-Butyl 7-(4-(1,1-dioxidethiomorpholino)phenyl)-2,7-diazaspiro[4.4]nonane-2-carboxylate was synthesized from BuOH (4:1, 10 mL) at 100 °C for 16 h. Chromatography (basic alumina, 30% to 100% EtOAc / petroleum ether) afforded an off-white solid (221 mg, 70%). 1 H NMR(CDCl3,300MHz)δ 6.92(d,2H,J=8.3Hz),6.50(d,2H,J=8.2Hz),3.62-3.59(m,4H),3.51-3.20(m,8H),3.16-3.12(m,4H),2.04-1.84(m,4H),1.46(s,9H)ppm;LCMS m / z 436.2 actual value (M+H) + ,C 22 H 34 N3O4S.

[0373] Treatment with 4M HCl in dioxane as described for intermediate 5 gave intermediate 16, which was used in the next step without further purification.

[0374] Intermediate 17: cis-2-Tosyloctahydropyrrolo[3,4-c]pyrrole (HCl salt) [ka] To a mixture of cis-tert-butyl hexahydropyrrolo[3,4-c]pyrrole-2(1H)-carboxylate (2.0 g, 9.43 mmol) and DIPEA (2.50 mL, 14.2 mmol) in DCM (47 mL) was added TsCl (1.89 g, 9.91 mmol), which was stirred at rt for 1 h and then diluted with DCM (100 mL). The organic phase was washed with HO (150 mL), dried over MgSO, filtered, and the solvent was removed under reduced pressure. The crude product was dissolved in DCM (25 mL). 4 M HCl in dioxane (25 mL) was added, and the mixture was stirred at rt for 3 h. EtOAc (50 mL) was added, and the precipitated solid was filtered, washed with EtOAc, and dried under vacuum to give cis-2-tosyloctahydropyrrolo[3,4-c]pyrrole as a white solid (2.86 g, quantitative). 1 H NMR(300MHz, methanol-d4)δ 7.76-7.65(m,2H),7.52-7.40(m,2H),3.64-3.50(m,2H),3.19-2.82(m,6H),2.46(s,3H),1.41-1.35(m,2H).MS(ESI)m / z 267[M+H] + .

[0375] Intermediate 18: tert-butyl (2-((4-bromobenzyl)sulfonyl)ethyl)carbamate [ka] To a solution of (4-bromophenyl)methanethiol (500 mg, 2.46 mmol) in anhydrous DMF (3 mL) was added sodium hydride (60%, 98 mg, 2.46 mmol) slowly over 45 minutes with stirring at room temperature under nitrogen. A solution of 2-(BOC-amino)ethyl bromide (368 mg, 1.64 mmol) in anhydrous DMF (2 mL) was then added dropwise with continuous stirring overnight. The reaction mixture was then partitioned between diethyl ether and water, and the organic phase was washed with water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 0–100% ethyl acetate / petroleum ether to give tert-butyl (2-((4-bromobenzyl)thio)ethyl)carbamate (482 mg, 57% yield) as a clear, colorless oil. 1 H NMR(CDCl3,300MHz)δ 7.42(d,2H,J=8.5Hz),7.19(d,2H,J=8.5Hz),4.83(br s,1H),3.66(s,2H),3.26(q,2H,J=6.2Hz),2.52(t,2H,J=6.6Hz),1.44(s,9H)ppm.

[0376] To a solution of tert-butyl (2-((4-bromobenzyl)thio)ethyl)carbamate (480 mg, 1.39 mmol) in dichloromethane (15 mL) was added mCPBA (70%, 752 mg, 3.05 mmol) over 2 minutes while stirring at room temperature under air for 18 hours. The reaction mixture was then quenched with aq. NaHCO solution and extracted with dichloromethane. The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 10–100% ethyl acetate / cyclohexane to give the title compound (379 mg, 72% yield) as a white solid. 1H NMR(CDCl3,300MHz)δ 7.55(d,2H,J=8.5Hz),7.29(d,2H,J=8.5Hz),5.11(br s,1H),4.20(s,2H),3.60(q,2H,J=6.1Hz),3.07(t,2H,J=6.0Hz),1.44(s,9H)ppm.

[0377] Intermediate 19: tert-butyl (2-((4-hydroxyphenyl)sulfonyl)ethyl)carbamate [ka] To a suspension of 4-mercaptophenol (500 mg, 3.96 mmol) and potassium carbonate (602 mg, 4.36 mmol) in anhydrous DMF (5 mL) was added 2-(BOC-amino)ethyl bromide (888 mg, 3.96 mmol) with stirring overnight under nitrogen at room temperature. The reaction mixture was then partitioned between diethyl ether and water, and the organic phase was washed with water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 5–100% ethyl acetate / petroleum ether to give tert-butyl (2-((4-hydroxyphenyl)thio)ethyl)carbamate (1.04 g, 98% yield) as a clear, colorless oil. 1 H NMR(CDCl3,300MHz)δ 7.35(br s,1H),7.28(d,2H,J=8.7Hz),6.77(d,2H,J=8.7Hz),5.06(br s,1H),3.26(q,2H,J=5.8Hz),2.87(t,2H,J=6.4Hz),1.44(s,9H)ppm;LCMS m / z 214.1 Actual value(M- t Bu+2H) + .

[0378] iiTo a solution of tert-butyl (2-((4-hydroxyphenyl)thio)ethyl)carbamate (1.04 g, 3.86 mmol) in dichloromethane (35 mL) was added mCPBA (70%, 2.09 g, 8.49 mmol) over 2 minutes while stirring at room temperature under air for 18 hours. The reaction mixture was then quenched with aq. NaHCO solution and extracted with dichloromethane. The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 10–100% ethyl acetate / cyclohexane to give the title compound (907 mg, 78% yield) as a white solid. 1 H NMR(DMSO-d6,300MHz)δ 10.62(s,1H),7.69(d,2H,J=8.8Hz),6.95(d,2H,J=8.8Hz),6.81(br t,1H,J=5.2Hz),3.30-3.26(m,2H),3.19-3.12(m,2H),1.32(s,9H)ppm;LCMS m / z 246.0 actual value(M- t Bu+2H) +

[0379] Intermediate 20: 4-(((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)methyl)benzoic acid [ka] To a solution of BOC-cysteamine (1.66 mL, 9.82 mmol) in anhydrous DMF (10 mL) was added sodium hydride (60%, 236 mg, 9.82 mmol) slowly over 1 h with stirring at room temperature under nitrogen. A solution of methyl 4-bromomethylbenzoate (750 mg, 3.27 mmol) in anhydrous DMF (5 mL) was then added dropwise with continuous stirring overnight. The reaction mixture was then partitioned between diethyl ether and water, and the organic phase was washed with water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 5–80% ethyl acetate / petroleum ether to give methyl 4-(((2-((tert-butoxycarbonyl)amino)ethyl)thio)methyl)benzoate (664 mg, 62% yield) as a clear, colorless oil. 1 H NMR(CDCl3,300MHz)δ 7.97(d,2H,J=8.5Hz),7.38(d,2H,J=8.5Hz),4.84(br s,1H),3.89(s,3H),3.74(s,2H),3.26(q,2H,J=6.2Hz),2.52(t,2H,J=6.6Hz),1.42(s,9H)ppm.

[0380] To a solution of methyl 4-(((2-((tert-butoxycarbonyl)amino)ethyl)thio)methyl)benzoate (660 mg, 2.03 mmol) in dichloromethane (25 mL) was added mCPBA (70%, 1.1 g, 4.46 mmol) over 2 minutes while stirring at room temperature under air for 18 hours. The reaction mixture was then quenched with aq. NaHCO solution and extracted with dichloromethane. The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 20–100% ethyl acetate / cyclohexane to give methyl 4-(((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)methyl)benzoate (648 mg, 89% yield) as a white solid. 1H NMR(CDCl3,300MHz)δ 8.08(d,2H,J=8.5Hz),7.50(d,2H,J=8.5Hz),5.10(br s,1H),4.31(s,2H),3.93(s,3H),3.60(q,2H,J=6.1Hz),3.08(t,2H,J=6.0Hz),1.44(s,9H)ppm.

[0381] To a solution of methyl 4-(((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)methyl)benzoate (300 mg, 0.839 mmol) in THF / methanol (2:1, 24 mL) was added 1 M aqueous NaOH (1.85 mL, 1.85 mmol) with stirring overnight at 25° C. The organic solvent was then removed and the reaction mixture was acidified to pH 4 with 1 M aqueous HCl, followed by partitioning between ethyl acetate and water. The organic phase was washed with brine, dried over anhydrous magnesium sulfate, filtered, and concentrated to give the title compound (283 mg, 98% yield) as a white solid that required no further purification. 1 H NMR(DMSO-d6,300MHz)δ 13.04(br s,1H),7.96(d,2H,J=8.4Hz),7.53(d,2H,J=8.4Hz),7.03(br t,1H,J=5.5Hz),4.62(s,2H),3.38-3.29(m,2H),3.18-3.14(m,2H),1.38(s,9H)ppm;LCMS m / z 244.1 actual value (M-BOC+2H) + .

[0382] Intermediate 21: tert-butyl (2-((4-fluorophenyl)sulfonyl)ethyl)carbamate [ka] To a solution of {2-[(4-fluorophenyl)sulfonyl]ethyl}amine hydrochloride (250 mg, 1.043 mmol) and triethylamine (0.36 mL, 2.608 mmol) in dichloromethane (10 mL) was added Boc anhydride (273 mg, 1.25 mmol) with stirring overnight at room temperature under nitrogen. The reaction mixture was then partitioned between dichloromethane and water, and the organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 5–100% ethyl acetate / petroleum ether to give the product (290 mg, 92% yield) as a pale yellow solid. 1 H NMR(CDCl3,300MHz)δ 7.96-7.91(m,2H),7.29-7.23(m,2H),5.15(br s,1H),3.58-3.52(m,2H),3.33-3.29(m,2H),1.41(s,9H)ppm;LCMS m / z 248.3 Actual value (M- t Bu+2H) + .

[0383] General procedure for the synthesis of aminoethylsulfone (AES) compounds General Procedure GP3 Compounds of the present invention can be prepared as illustrated in Scheme 3, where R corresponds to a substituent for each specific compound described herein. [ka]

[0384] A suspension (0.15-0.25 M) of cyclic amine (1 eq) in THF (and TEA (1 eq) if the amine is used as the HCl salt) is reacted with divinyl sulfone (1 eq) at 40°C for 6-12 hours. After completion of the reaction, all volatiles are removed under reduced pressure.

[0385] The resulting residue is dissolved (0.15 M) in either DCM or DMF (depending on its solubility) and reacted with benzylamine (2 eq) at rt for 12 h. The mixture is then either evaporated to dryness (if DCM was used as solvent) or diluted with ethyl acetate, washed with water, dried over MgSO, filtered, and evaporated to dryness (if DMF was used as solvent). The crude mixture is purified by flash chromatography using a Biotage silica column and a gradient of EtOAc in cHex or a gradient of MeOH in EtOAc.

[0386] The residue from the previous step is then dissolved in 2,2,2-trifluoroethanol (0.10 M) and reacted with ammonium formate (10 eq) and 10% Pd-C (20% wt) at 70 °C for 15–30 min. After cooling to rt, the mixture is then filtered through a Celite pad and evaporated to dryness. Purification of the residue is facilitated by transient protection of the product with a carbamate group (reaction of the residue with excess BOC0 in a DCM / TEA mixture at rt for 12 hr), followed by flash chromatography (using a Biotage silica gel column and a gradient of EtOAc in cHex), followed by deprotection under acidic conditions (4.0 M HCl in dioxane for 1 hr at rt).

[0387] General Procedure GP4 Compounds of the present invention can be prepared as illustrated in Scheme 4, where R corresponds to a substituent for each specific compound described herein. [ka]

[0388] In the first step, to a solution (0.25 M) of bromoalcohol (1 eq) and p-toluenesulfonyl chloride (1.2 eq) in DCM is added TEA (2 eq) dropwise at 0°C. The mixture is stirred at rt for 12-48 hrs and then washed with 1 M aq. NaOH. The organic phase is separated, dried over MgSO4, filtered, and evaporated to dryness to give the bromoalkyl-4-methylbenzenesulfonate intermediate, which is used in the next step without further purification.

[0389] In the second step, bromoalkyl-4-methylbenzenesulfonate (1 eq) and t-butyl-(2-mercaptoethyl)carbamate intermediate (1 eq) in DMF (0.5 M) are reacted with K2CO3 (1.2 eq) for 12 h at 50 °C. After cooling to rt, the mixture is diluted with DCM and washed with water. The organic phase is separated, dried over MgSO4, filtered, and evaporated to dryness. The residue is then purified by flash chromatography (using a Biotage silica gel column and a 0 to 40% EtOAc / cHex gradient) to give t-butyl (2-((bromoalkyl)thio)ethyl)carbamate.

[0390] In the third step, a 0.1 M solution of t-butyl (2-((2-bromoalkyl)thio)ethyl)carbamate intermediate (1 eq) in DCM is reacted with m-CPBA (6 eq) at rt for 12 h, then quenched with aq. saturated NaHCO. The organic phase is separated, further washed with water, dried over MgSO, filtered, and evaporated to dryness. The residue is then purified by flash chromatography (using a Biotage silica gel column and a 0-50% EtOAc / cHex gradient) to give the t-butyl (2-((2-bromoalkyl)sulfonyl)ethyl)carbamate intermediate.

[0391] In the fourth step, a 0.1 M solution of the appropriate homopiperazine compound (1 eq) and t-butyl((2-(bromoalkyl)sulfonyl)ethyl)carbamate intermediate (1 eq) in DMF is reacted with K2CO3 (4 eq) at 80 °C for 12 h. After cooling to rt, the mixture is diluted with DCM and washed with water. The organic phase is separated, dried over MgSO4, filtered, and evaporated to dryness. The residue is then purified by flash chromatography (using a Biotage silica gel column and a 50 to 100% EtOAc / cHex gradient) to give the t-butyl(2-((bromoalkyl)thio)ethyl)carbamate homopiperazine derivative.

[0392] In the fifth step, the intermediate obtained above is dissolved in a 4.0 M solution of HCl in dioxane (0.1 M), stirred at rt for 1 hr, and then evaporated to dryness to provide the desired AES-homopiperazine product.

[0393] General Procedure GP5 Compounds of the present invention can be prepared as illustrated in Scheme 5, where R, R', and R'' correspond to the substituents of each specific compound described herein. [ka]

[0394] In the first step using condition 1a, a solution (0.3 M) of t-butyl-(2-mercaptoethyl)carbamate (1 eq) and bromoacetate ester (1.2 eq) in DCM was reacted with TEA (1.3 eq) at rt for 16 h, then washed with 10% citric acid. The organic phase was separated, dried over MgSO, filtered, and evaporated to dryness to give a residue that was used in the next step without further purification.

[0395] Alternatively, condition 1b can be used, in which a solution of t-butyl-(2-mercaptoethyl)carbamate (1 eq) and bromoacetate ester (1 eq) in DMF (0.1-0.5 M) or DMSO (1 M) is reacted with K2CO3 (1-2.5 eq) at rt-80 °C for 2-24 h. After cooling to rt, the mixture is diluted with DCM (or EtOAc) and washed with water. The organic phase is separated, dried over MgSO4, filtered, and evaporated to dryness.

[0396] In the second step, a solution (0.1 M) of the intermediate from the previous step (1 eq) in DCM is reacted with m-CPBA (5 eq) at rt for 3-12 h, then quenched with aq. saturated NaHCO. The organic phase is separated, further washed with water, dried over MgSO, filtered, and evaporated to dryness. The residue is then purified by flash chromatography (using a Biotage silica gel column and a gradient of 0-50% EtOAc / DCM or 0-50% EtOAc / cHex) to give the sulfonylated intermediate.

[0397] In the third step, a solution of the sulfonylated intermediate (1 eq.) in EtOH (0.2 M) or in a mixture of MeOH / DCM (3:1, v / v, 0.2 M) is reacted with a 1 M aqueous solution of NaOH (or KOH) (0.4 M) at rt to 45° C. for 2 to 12 hours, then evaporated to dryness. This residue is used in the next step without further purification.

[0398] In the fourth step, DIPEA (8.5 eq) and HATU (1.3 eq) are added to a solution (0.15 M) of the residue from the previous step (1 eq) and cyclic amine (1 eq) in DMF. The mixture is stirred at rt for 16 hrs, diluted with DCM, and washed with saturated aqueous NaHCO3 and water. The organic layer is separated, dried over MgSO4, filtered, and evaporated to dryness. The residue is purified by flash chromatography using a Biotage silica gel column and a gradient of 50% to 100% EtOAc / cHex.

[0399] In the fifth step, a suspension (0.1 M) of t-butyl carbamate (1 eq) in 4.0 M HCl in dioxane is stirred at rt for 1-2 hrs. All volatiles are then removed under reduced pressure to give the desired aminoethyl sulfone as the HCl salt. Alternatively, the resulting residue can be triturated with EtO, filtered, and dried under high vacuum, or purified by preparative HPLC using a gradient of 10% to 100% MeOH (+0.1% formic acid) in water (+0.1% formic acid).

[0400] General Procedure GP6 Compounds of the present invention can be prepared as illustrated in Scheme 6, where R and R' correspond to the substituents of each specific compound described herein. [ka]

[0401] In the first step, to a solution (0.1 M) of the appropriate homopiperazine compound (1 eq) in DCM was added 3 eq of DIPEA (or 6 eq of TEA) and triphosgene (0.5–0.8 eq). The reaction mixture was stirred at rt for 15 min, then 1.1–3 eq of amine was added, and stirring was continued for 12–16 hr. All volatiles were removed under reduced pressure, and the resulting residue was purified by flash chromatography (using a Biotage silica gel column and a gradient of 0→20% EtOAc in DCM or 0→10% MeOH in EtOAc).

[0402] In the second step, the intermediate from the previous step is suspended in a solution of HCl in dioxane (4.0 M, 0.1 M), stirred at rt for 1-1.5 h, and then evaporated to dryness to give the desired compound as the HCl salt. Alternatively, the resulting residue can be triturated with EtO, filtered, and dried under high vacuum, or purified by preparative HPLC using a gradient of 10% to 100% MeOH (+0.1% formic acid) in water (+0.1% formic acid). [Example]

[0403] Example 1: 2-((2-((1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)ethyl)sulfonyl)ethan-1-amine (HCl salt) [ka] Using (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (600 mg, 2.19 mmol) in GP3 gave the intermediate N-benzyl-2-((2-((1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)ethyl)sulfonyl)ethan-1-amine as a colorless oil (569.2 mg, 52% over 2 steps). 1 H NMR(500MHz,DMSO-d6)δ 7.33-7.27(m,4H),7.24-7.20(m,1H),6.78-6.74(m,2H),6.51-6.47(m,2H),3.89(q,J= 7.0Hz,2H),3.69(s,2H),3.44-3.36(m,1H),3.33-3.21(m,5H),3.16-3.12(m,1H),3.10-3.04(m,1H),3.02-2.93(m,2H),2.90(t,J= 6.5Hz,2H),2.84-2.79(m,2H),2.33-2.26(m,1H),2.21(dd,J= HRMS C 28 H 42 N3O3S(M+H + ) calculated value 500.2947; measured value 500.5716.

[0404] Debenzylation, purification via carbamate protection, flash chromatography (EtOAc / cHex, 0→50%), and acidic deprotection route by Method GP3 gave 2-((2-((1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)ethyl)sulfonyl)ethan-1-amine (HCl salt) as a white solid (68.3 mg, 18%). 1 H NMR(500MHz,DMSO-d6)δ 6.77-6.73(m,2H),6.51-6.47(m,2H),3.87(q,J= 7.0Hz,2H),3.37-3.30(m,2H),3.26-3.15(m,3H),3.14-3.06(m,2H),3.01-2.92(m,4H),2.85-2.75(m,2H),2.33-2.28(m,1H),2.20(t,J= HRMS C 21 H 36 N3O3S(M+H + ) calculated value 410.2477; measured value 410.2481.

[0405] The following example compounds were prepared by the methods described above, using the appropriate reagent substitutions.

[0406] [Table 9]

[0407] [Table 10]

[0408] Example 5: 4-(4-((1R,5S)-3-(2-((2-aminoethyl)sulfonyl)ethyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenyl)thiomorpholine 1,1-dioxide (HCl salt) [ka] Using 2-bromoethanol (1.80 mL, 25.4 mmol) in steps 1–3 of GP4 gave the intermediate t-butyl (2-((2-bromoethyl)sulfonyl)ethyl)carbamate as a yellow solid (1.15 g, 38% over three steps). 1H NMR (500 MHz, CDCl3) δ 5.16 (br s, 1H), 3.72–3.64 (m, 4H), 3.55 (dd, J = 8.4 and 6.9 Hz, 2H), 3.32 (dd, J = 6.9 and 5.1 Hz, 2H), 1.46 (s, 9H).

[0409] Using 4-(4-((1R,5S)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenyl)thiomorpholine 1,1-dioxide (130 mg, 0.36 mmol) in GP4 steps 4–5 gave 4-(4-((1R,5S)-3-(2-((2-aminoethyl)sulfonyl)ethyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenyl)thiomorpholine-1,1-dioxide (HCl salt) (49.3 mg, 23% over two steps). H NMR (500 MHz, DMSO-d) δ; HRMS calculated for C H NO S (M+H) 499.2413; found 499.2418.

[0410] Example 6: 2-((3-((1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)propyl)sulfonyl)ethan-1-amine (HCl salt) [ka] Using 3-bromopropanol (2.71 mL, 30 mmol) in GP4 steps 1-3 gave the intermediate t-butyl (2-((3-bromopropyl)sulfonyl)ethyl)carbamate as a yellow solid (2.65 g, 27% over 3 steps). 1H NMR(500MHz,CDCl3)δ 5.17(br s,1H),3.67(q,J= 6.0Hz,2H),3.56(t,J= 6.2Hz,2H),3.25(t,J= 6.0Hz,2H),3.23-3.19(m,2H),2.46-2.40(m,2H),1.46(s,9H).

[0411] Using (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (83.1 mg, 0.30 mmol) in GP4 steps 4–5 gave 2-((3-((1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)propyl)sulfonyl)ethan-1-amine (HCl salt) (90.1 mg, 98% over two steps). 1 H NMR(500MHz,DMSO-d6)δ 8.49,8.39(2 br s,2H),6.85-6.79(m,2H),6.76-6.71(m,1H),6.65-6.61(m,1H),3.91(2q,J= 7.0Hz,2H),3.80-2.98(m,15H),2.60-2.47(m,1H),2.38-2.04(m,2H),1.76(d,J= 14.4Hz,1H),1.64,1.45(2dd,J= 14.4,7.5Hz,1H),1.27(2t,J= 7Hz,3H),1.23,1.09(2s,3H),0.81,0.74(2s,3H);HRMS C 22 H 38 N3O3S(M+H + ) calculated value 424.2634; measured value 424.2882.

[0412] Example 7: 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)ethan-1-one (HCl salt) [ka] Methyl 2-bromoacetate (1.6 mL, 16.7 mmol) was used in GP5 steps 1a-3 to give the intermediate 2-((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)acetic acid (sodium salt), which was used in the next step without further purification.

[0413] Using (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (877 mg, 3.2 mmol) in GP5 Steps 4-5 gave 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)ethan-1-one (HCl salt) (1.16 g, 97% over two steps). H NMR (500 MHz, DMSO-d6) δ 8.12(s,3H),6.86-6.73(m,2H),6.58(dd,J=12.0,9.1Hz,2H),4.77(s,2H),4.74-4.61(m, 2H),4.53-4.41(m,2H),3.90(qd,J=7.0,2.8Hz,2H),3.74-3.62(m,2H),3.31-3.22(m,2H) ,3.18(d,J=8.2Hz,1H),3.15-3.07(m,2H),2.91,2.75(2d,J=13.8Hz,1H),1.58(d,J=13.7 Hz,1H),1.39(m,1H),1.27(t,J=7.0Hz,3H),1.02,0.91(2s,3H),0.81,0.78(2s,3H);LCMS m / z 424(M+H)+.

[0414] The following example compounds were prepared by the methods described above, using the appropriate reagent substitutions.

[0415] [Table 11]

[0416] [Table 12]

[0417] [Table 13]

[0418] Example 15: 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)-2-fluoroethan-1-one (HCl salt) [ka] Ethyl 2-bromo-2-fluoroacetate (1.5 g, 8.11 mmol) was used in GP5 steps 1b-3 to give the intermediate 2-((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)-2-fluoroacetic acid (sodium salt), which was used in the next step without further purification.

[0419] In GP5 steps 4-5, (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (274.4 mg, 1 mmol) and 2-((2-((tert-butoxycarbonyl)amino)-ethyl)sulfonyl)-2-fluoroacetic acid (285.3 mg, 1 mmol) were used to give 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)-2-fluoroethan-1-one (HCl salt) (353.7 mg, 46% over 2 steps). 1H NMR (500MHz, DMSO-d6) (mixture of isomers) δ 7.22,7.17,6.96(3d,J= 45Hz,1H),6.82-6.73(m,2H),6.64-6.53(m,2H),4.73-4.65,4.55-4.49(2m,1H),4.36-4.30,4.24-4.17,4.16-4 .09(3m,1H),3.91-3.83(m,2H),3.74-3.59(m,2H),3.58-3.50(m,1H),3.33-3.01(m,5H),2.96,2.84,2.73(3d,J= 14Hz,1H),2.58-2.43(m,1H),1.73(d,J= 14Hz,1H),1.56-1.27(m,1H),1.26-1.21(m,3H),1.05,0.93,0.88(3s 3H),0.82,0.77,0.72(3s,3H);HRMS C 21 H 33 FN3O4S(M+H + ) calculated value 442.2176; measured value 442.2507.

[0420] The following example compounds were prepared by the methods described above, using the appropriate reagent substitutions.

[0421] [Table 14]

[0422] [Table 15]

[0423] [Table 16]

[0424] [Table 17]

[0425] [Table 18]

[0426] [Table 19]

[0427] Example 30: 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)-2,2-difluoroethan-1-one (formate salt) [ka] Ethyl 2-bromo-2,2-difluoroacetate (1.5 g, 7.39 mmol) was used in GP5 steps 1b-3 to give the intermediate 2-((2-((tert-butoxycarbonyl)amino)-1,1-difluoroethyl)sulfonyl)acetic acid (potassium salt), which was used in the next step without further purification.

[0428] In GP5 steps 4-5, (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (250 mg, 0.91 mmol) and 2-((2-((tert-butoxycarbonyl)amino)-1,1-difluoroethyl)sulfonyl)acetic acid (276.0 mg, 0.91 mmol) were used to give 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)-2,2-difluoroethan-1-one (formate salt) (78 mg, 17% over 2 steps). 1H NMR (500MHz, DMSO-d6) (mixture of isomers) δ 8.38(s,1H),6.82-6.76(m,2H),6.65-6.59(m,2H),4.56-4.53(m,1H),4.35-4.28,4.26-4.17(2m,1H),3.90(2q,J= 7Hz,2H),3.72-3.56(m,3H),3.52-3.46,3.30-3.22(2m,1H),3.21-3.10(m,2H),3.07-2.98(m,3H),2.60-2.50(m,1H),1.54(d,J= HRMS C 21 H 32 F2N3O4S(M+H + ) calculated value 460.2082; measured value 460.2869.

[0429] Example 31: (4-((2-aminoethyl)sulfonyl)phenyl)((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)methanone (HCl salt) [ka] Methyl-4-fluorobenzoate (0.52 mL, 7 mmol) was used in GP5 step 1b-3 to give 4-((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)benzoic acid (sodium salt), which was used in the next step without further purification.

[0430] Using (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (159.7 mg, 0.582 mmol) and 4-((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)benzoic acid (191.7 mg, 0.582 mmol) in GP5 steps 4–5, (4-((2-aminoethyl)sulfonyl)phenyl)((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)methanone (HCl salt) was obtained as a red solid (105.1 mg, 38% over two steps). 1 H NMR(500MHz,DMSO-d6)δ 8.00(d,J= 7.9Hz,1H),7.97(d,J= 7.9Hz,1H),7.65(d,J= 7.9Hz,1H),7.61(d,J= 7.9Hz,1H),6.79(d,J= 8.5Hz,1H),6.75(d,J= 8.6Hz,1H),6.61(d,J= 8.6Hz,1H),6.53(d,J= 8.6Hz,1H),4.84-4.78(m,0.5H),4.60-4.51(m,0.5H),3.94-3.84(m,2H),3.76-3.5 8(m,3.5H),3.56-3.53(m,0.5H),3.48-3.38(m,1H),3.23-3.02(m,4.5H),2.97(d,J= HRMS C 26 H 36 N3O4S(M+H + ) calculated value 486.2427; measured value 486.2389.

[0431] Example 32: (3-((2-aminoethyl)sulfonyl)phenyl)((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)methanone (HCl salt) [ka] To a solution of methyl 3-bromobenzoate (500 mg, 2.33 mmol) and t-butyl-(2-mercaptoethyl)carbamate (0.39 mL, 2.33 mmol) in dioxane (6.5 mL), Pd2dba3 (53.3 mg, 0.058 mmol), X-Phos (67.4 mg, 0.117 mmol), and DIPEA (0.81 mL, 4.66 mmol) were added sequentially. The mixture was stirred under reflux for 4 hours, then quenched with saturated aqueous NH4Cl and extracted with EtOAc. The combined organic layers were dried over MgSO4, filtered, and evaporated to dryness. The resulting oil was used in the next step without further purification.

[0432] The residue from the previous step was used in GP5 steps 2-3 to give 3-((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)benzoic acid (sodium salt), which was used in the next step without further purification.

[0433] In steps 4-5 of GP5, (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (159.7 mg, 0.582 mmol) and 3-((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)benzoic acid (sodium salt) (191.7 mg, 0.582 mmol) were used to give (3-((2-aminoethyl)sulfonyl)phenyl)((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)methanone (HCl salt) as a red solid (220.6 mg, 76% over two steps). 1H NMR(500MHz,DMSO-d6)δ 8.38(s,3H),8.05-7.98(m,1H),7.95 and 7.84(2s,1H),7.82-7.73(m,2H) ,6.83-6.73(m,2H),6.66-6.54(m,2H),4.90-4.80 and 4.70-4.60(2m,1H), 3.94-3.86(m,2H),3.81-3.62(m,3.5H),3.50-3.43(m,1H),3.28-2.96( m,5.5H),2.60-2.54 and 2.42-2.34(2m,1H),1.51-1.36(m,2H),1.27(t,J= 7Hz,3H),1.23,1.08,0.82,0.76,0.75(5s,6H);HRMS C 26 H 36 N3O4S(M+H + ) calculated value 486.2427; measured value 486.2380.

[0434] Example 33: 2-((4-((1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)phenyl)sulfonyl)ethan-1-amine (HCl salt) [ka] A solution of (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (548.8 mg, 2 mmol) and 2-((4-fluorophenyl)sulfonyl)acetonitrile (200 mg, 1 mmol) in DMF (3 mL) was stirred at 100 °C for 3 days. After cooling to rt, the mixture was diluted with DCM, washed with water, dried over MgSO, filtered, and evaporated to dryness. The resulting residue was purified by flash chromatography (Biotage silica gel column, gradient 60 to 100% EtOAc in cHex) to give an orange oil that was used in the next step without further purification.

[0435] This material was subsequently dissolved in a solution of BH in THF (1.0 M, 6 mL), stirred at rt for 12 h, quenched with EtOH (6 mL) at rt for 1 h, and then evaporated to dryness. To facilitate purification, the product was temporarily protected with a carbamate (by reacting the material with excess BOC O in a mixture of DCM / TEA as described above), purified by flash chromatography (Biotage silica gel column, gradient of 0% to 40% EtOAc in cHex), and then deprotected under acidic conditions (4.0 M HCl in dioxane) to give 2-((4-((1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)phenyl)sulfonyl)ethan-1-amine (HCl salt) (23.4 mg, 2% over two steps). 1 H NMR(500MHz,DMSO-d6)δ 7.68-7.62(m,2H),7.12-7.07(m,2H),6.83-6.78(m,2H),6.66-6.60(m,2H),4.17-4.05(m,1H),3.90(q,J= 7.0Hz,2H),3.73-3.68(m,1H),3.65-3.61(m,1H),3.55-3.50(m,1H),3.28-3. 24(m,1H),3.19-3.14(m,1H),3.12-2.93(m,5H),2.63-2.57(m,1H),1.53(d,J= 13.6Hz,1H),1.44(dd,J= 13.7,6.2Hz,1H),1.27(t,J= 7.0Hz,3H),0.93(s,3H),0.84(s,3H);HRMS C 25 H 36 N3O3S(M+H + ) calculated value 458.2447; measured value 458.2380.

[0436] Example 34: (1S,5S)-6-(4-(3-((2-aminoethyl)sulfonyl)propoxy)phenyl)-N-(2-hydroxyethyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxamide (formate salt) [ka] Using t-butyl (2-((3-(4-((1R,5S)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenoxy)propyl)sulfonyl)ethyl)carbamate (100.7 mg, 0.203 mmol) and ethanolamine (0.037 mL, 0.609 mmol) in GP6 steps 1-2 gave (1S,5S)-6-(4-(3-((2-aminoethyl)sulfonyl)propoxy)phenyl)-N-(2-hydroxyethyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxamide (formate) (13.8 mg, 13% over 2 steps). 1 H NMR(500MHz,DMSO-d6)δ 6.81(d,J= 9.1Hz,2H),6.56(d,J= 9.2Hz,2H),6.45(t,J= 5.5Hz,1H),4.29-4.22(m,1H),4.16(dd,J= 13.8 and 8.2Hz, 1H), 3.97 (t, J = 6.2Hz, 2H), 3.44 (d, J = 4.4Hz, 1H), 3.37 (t, J = 6.3Hz, 2H), 3.33-3.22 (m, 4H), 3.15 (dd, J = 10.4 and 2.5Hz, 1H), 3.12-2.99 (m, 5H), 2.81 (d, J = 13.3Hz, 1H), 2.74 (d, J = HRMS C 23 H 39 N4O5S(M+H + ) calculated value 483.2641; measured value 483.2707.

[0437] The following example compounds were prepared by the methods described above, using the appropriate reagent substitutions.

[0438] [Table 20]

[0439] Example 36: (1S,5S)-6-(4-(3-((2-aminoethyl)sulfonyl)propoxy)phenyl)-N-ethyl-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxamide (HCl salt) [ka] A solution of t-butyl-(2-((3-(4-((1R,5S)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-6-yl)phenoxy)propyl)sulfonyl)ethyl)carbamate (100 mg, 0.202 mmol) in DCM (2 mL) was reacted with TEA (0.090 mL, 0.606 mmol) and ethyl isocyanate (0.016 mL, 0.202 mmol) at rt for 12 hrs. After evaporation of volatiles and flash chromatography (using a Biotage silica gel column and a gradient of MeOH in EtOAc (0 to 10%)), the resulting residue was reacted with a solution of 4.0 M HCl in dioxane (2 mL) at rt for 1 hr. The mixture was evaporated to dryness to give (1S,5S)-6-(4-(3-((2-aminoethyl)sulfonyl)propoxy)phenyl)-N-ethyl-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxamide (HCl salt) (34.8 mg, 32% over two steps). 1H NMR(500MHz,DMSO-d6)δ 8.27(s,3H),6.82(d,J= 9.1Hz,2H),6.56(d,J= 9.1Hz,2H),4.29-4.22(m,1H),4.20-4.13(m,1H),3.98(t,J= 6.2Hz,2H),3.57-3.49(m,2H),3.44(d,J= 4.4Hz,1H),3.42-3.36(m,2H),3.26-3.18(m,2H),3.15(d,J= 10.3Hz,1H),3.10-3.00(m,3H),2.80(d,J= 13.3Hz,1H),2.72(d,J= 13.5Hz,1H),2.44-2.37(m,1H),2.13-2.04(m,2H),1.43(d,J= 13.5Hz,1H),1.31(dd,J= 13.5 and 6.4Hz,1H),0.99(t,J= 7.1Hz,3H),0.95(s,3H),0.77(s,3H);HRMS C 25 H 39 N4O4S(M+H + ) calculated value 467.2692; measured value 467.2807.

[0440] Example 37: (1S,5S)—N-(4-((2-aminoethyl)sulfonyl)phenyl)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxamide (formate salt) [ka] Using 4-nitrofluorobenzene (705.5 mg, 5 mmol) in GP5 steps 1b-2 gave tert-butyl (2-((4-nitrophenyl)sulfonyl)ethyl)carbamate (1 g, 60% over two steps). 1 H NMR(500MHz,CDCl3)δ 8.47-8.42(m,2H),8.17-8.13(m,2H),5.11-5.65(m,1H),3.60(q,J= 6.1Hz,2H),3.41(t,J= 6.1Hz,2H),1.41(s,9H);HRMS C8H 11 N2O4S(M-BOC+H + ) calculated value 231.0440; measured value 231.0531.

[0441] A solution of t-butyl-(2-((4-nitrophenyl)sulfonyl)ethyl)carbamate (200 mg, 0.605 mmol) in MeOH (12 mL) was reacted with H2 and 10% Pd-C using an H-Cube, followed by evaporation to dryness to give t-butyl(2-((4-aminophenyl)sulfonyl)ethyl)carbamate (170 mg, 94%). 1 H NMR(500MHz,DMSO-d6)δ 7.48-7.43(m,2H),6.81(t,J= 5.7Hz,1H),6.67-6.62(m,2H),3.21-3.10(m,4H),1.33(s,9H);HRMS C8H 12 N2O2S(M-BOC+H + ) calculated value 201.0698; measured value 201.0787.

[0442] GP6 steps 1-2: (1S,5S)-N-(4-((2-aminoethyl)sulfonyl)phenyl)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxamide (formate) (37 mg, 12% over 2 steps) using t-butyl-(2-((4-aminophenyl)sulfonyl)ethyl)carbamate (158.8 mg, 0.529 mmol) and (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (291 mg, 1.05 mmol). 1H NMR(500MHz,DMSO-d6)δ 7.77-7.72(m,2H),7.70-7.65(m,2H),6.81-6.76(m,2H),6.61-6.56(m,2H),4.38-4.27(m,2H),3.88(q,J= 7Hz,2H),3.51(d,J= 4.1Hz,1H),3.43(t,J= 7.3Hz,2H),3.17(d,J= 10.1Hz,1H),3.10(d,J= 10.2Hz,1H),3.05(d,J= 13.5Hz,1H),2.94-2.88(m,3H),2.53-2.48(m,1H),1.50(d,J= HRMS C 26 H 37 N4O4S(M+H + ) calculated value 501.2536; measured value 501.2990.

[0443] Example 38: (1S,5S)—N-(2-((2-aminoethyl)sulfonyl)ethyl)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxamide (HCl salt) [ka] Bromoethylphthalimide (889 mg, 3.5 mmol) was used in GP5 steps 1b-2 to give t-butyl (2-((2-(1,3-dioxoisoindolin-2-yl)ethyl)sulfonyl)ethyl)carbamate (200 mg, 12% over two steps). 1 LCMS m / z 283(M+H-Boc) + .

[0444] A suspension of t-butyl-(2-((2-(1,3-dioxoisoindolin-2-yl)ethyl)sulfonyl)ethyl)carbamate (200 mg, 0.52 mmol) in EtOH (5 mL) was reacted with hydrazine hydrate (65 μL, 2 mmol) at 80° C. for 2 hrs and then at rt for an additional 16 hrs. The formed precipitate was filtered off and the filtrate was evaporated to dryness to give t-butyl-(2-((2-aminoethyl)sulfonyl)ethyl)carbamate (140 mg, 100%). 1 H NMR(500MHz,DMSO-d6)δ 7.98(ddd,J=95.7,6.0,3.3Hz,1H),3.24(t,J=7.0Hz,4H),3.14(t,J=6.6Hz,2H),2.93(t,J=6.6Hz,2H),1.38(s,9H).

[0445] Using (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (137 mg, 0.5 mmol) and t-butyl-(2-((2-aminoethyl)sulfonyl)ethyl)-carbamate (140 mg, 0.55 mmol) in GP6 steps 1-2 gave (1S,5S)-N-(2-((2-aminoethyl)sulfonyl)ethyl)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxamide (HCl salt) (40 mg, 33% over 2 steps). 1H NMR(500MHz,DMSO-d6)δ 8.14(s,3H),6.84(d,J=6.4Hz,1H),6.82-6.74(m,2H),6.61-6.49(m,2H),4.30-4.18(m,1H),4.13(dd,J=13.9,8.0 Hz,1H),3.90(q,J=6.9Hz,2H),3.49(t,J=7.3Hz,2H),3.44(dd,J=11.4,4.9Hz,3H),3.35(t,J=6.8Hz,2H),3.22(p, J=6.2Hz,2H),3.16(dd,J=10.5,2.5Hz,1H),3.07(d,J=10.3Hz,1H),2.82(dd,J=25.0,13.5Hz,2H),2.43(d,J=7.4H) z,1H),1.43(d,J=13.6Hz,1H),1.32(dd,J=13.6,6.4Hz,1H),1.27(t,J=7.0Hz,3H),0.95(s,3H),0.78(s,3H);LCMS m / z 453(M+H) + .

[0446] Example 39: 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)propan-1-one (HCl salt) [ka] To a solution of t-butyl-(2-((2-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)-2-oxoethyl)sulfonyl)ethyl)carbamate (65 mg, 0.124 mmol) in DMF (2 mL) was added KCO (48.6 mg, 0.273 mmol) and methyl iodide (0.023 mL, 0.372 mmol). The mixture was stirred at 60 °C for 12 hrs, then cooled to rt before being diluted with DCM. This organic mixture was then washed with water, dried over MgSO, filtered, and evaporated to dryness. The resulting residue was purified by flash chromatography (using a Biotage silica gel column and a gradient of 0 to 50% EtOAc in cHex) to give t-butyl (2-((1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)-1-oxopropan-2-yl)sulfonyl)ethyl)carbamate (56.3 mg, 84%). HRMS C 27 H 44 N3O6S(M+H + ) calculated value 538.2951; measured value 538.3055.

[0447] The residue was suspended in a 4.0 M solution of HCl in dioxane (2 mL), and the mixture was stirred at rt for 1 h. After removal of volatiles, the residue was dissolved in water, washed with EtO, and evaporated to dryness to give 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)propan-1-one (HCl salt) (35.8 mg, 73%). 1H NMR (500MHz, DMSO-d6) (mixture of isomers) δ 6.81-6.75(m,2H),6.62-6.55(m,2H),5.10,4.98,4.89(3q,J= 6.7Hz,1H),4.78-4.58(m,1H),4.46-4.40,4.39-4.31,4.23-4.15(3m,1 H),3.91-3.84(m,2H),3.75-3.43(m,3H),3.28-3.04(m,5H),2.82-2.67( m,1H),2.53-2.41(m,1H),1.71-1.45(m,4H),1.42-1.29(m,1H),1.27-1 .22(m,3H),1.07,0.93,0.90,0.85,0.81,0.79,0.77,0.76(8s,6H);HRMS C 22 H 36 N3O4S(M+H + ) calculated value 438.2427; measured value 438.2531.

[0448] Example 40: 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)-4-methylpentan-1-one (HCl salt) [ka] In the same manner, using tert-butyl (2-((2-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)-2-oxoethyl)sulfonyl)ethyl)carbamate (165 mg, 0.31 mmol) and isobutyl bromide (40 μL, 0.37 mmol), 2-((2-aminoethyl)sulfonyl)-1-((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)-4-methylpentan-1-one (10 mg, 40%) was obtained as a solid. LCMS m / z 480 (M+H) + .

[0449] Example 41: Ethyl 4-((2-aminoethyl)sulfonyl)-5-((1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptan-2-yl)-5-oxopentanoate [ka] A mixture of tert-butyl (2-((2-((1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptan-2-yl)-2oxoethyl)sulfonyl)ethyl)carbamate (54 mg, 0.116 mmol), ethyl acrylate (126 μL, 0.116 mmol), and KCO (31.9 mg, 0.231 mmol) in DMF (1.0 mL) was stirred at rt for 1 h. Additional portions of ethyl acrylate (126 μL) were added every hour over 4 h, and the mixture was stirred at rt for an additional 16 h, then diluted with EtOAc (20 mL). The organic layer was washed with HO (3 × 20 mL), dried over MgSO, filtered, and the solvent was removed under reduced pressure. The crude was purified by chromatography (EtOAc / petroleum ether 0→80%) to give ethyl 4-((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)-5-((1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptan-2-yl)-5-oxopentanoate as a colorless oil (59 mg, 90%). 1 H NMR (300MHz, chloroform-d) δ for mixtures of isomers 6.88-6.63(m,2H),6.59-6.40(m,2H),5.25-4.68(m,2H),4.47-4.08(m,3H),4.03-3.80(m,3 H),3.73-2.99(m,8H),2.67-1.86(m,6H),1.50-1.41(m,9H),1.40-1.02(m,6H).MS(ESI)m / z 568[M+H] + .

[0450] A mixture of ethyl 4-((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)-5-((1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptan-2-yl)-5-oxopentanoate (59 mg, 0.104 mmol) and 4 M HCl (1.0 mL) in dioxane and DCM (1.0 mL) was stirred at rt for 3 h and then diluted with DCM (20 mL). The organic layer was washed with saturated NaHCO3 (2 × 20 mL), dried over MgSO4, filtered, and the solvent was removed under reduced pressure. The crude material was purified by chromatography (MeOH / DCM 0→15%) to give compound 41 as a colorless oil (22 mg, 45%). 1 H NMR (300 MHz, chloroform-d) for a mixture of isomers δ 6.88-6.78 (m, 2H), 6.57-6.46 (m, 2H), 5.09-4.72 (m, 1H), 4.48-4.31 (m, 1H), 4.21-3.83 (m, 5H), 3.70-2.99 (m, 8H), 2.60-1.86 (m, 6H), 1.74 (br, 2H), 1.44-1.35, 1.31-1.23, and 1.12-1.02 (m, 6H). MS (ESI) m / z 468 [M+H] + .

[0451] Example 42: (1-((2-aminoethyl)sulfonyl)cyclopropyl)((1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptan-2-yl)methanone [ka] A mixture of tert-butyl (2-((2-((1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptan-2-yl)-2oxoethyl)sulfonyl)ethyl)carbamate (74.3 mg, 0.159 mmol), 1,2-dibromoethane (68.6 μL, 0.800 mmol), KCO (110 mg, 0.800 mmol), and DMF (1.6 mL) was stirred at 80 °C for 20 h. Further batches of dibromoethane were added after 1 h and 17 h. After cooling to rt, the mixture was diluted with EtOAc (20 mL), washed with HO (3 × 20 mL) and brine (20 mL), dried over MgSO, and filtered. The solvent was removed under reduced pressure and the crude was purified by chromatography to give tert-butyl (2-((1-((1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptane-2-carbonyl)cyclopropyl)sulfonyl)ethyl)carbamate (16 mg, 33%) as a colorless oil. 1 H NMR(300MHz,chloroform-d)δ for mixture of isomers 6.90-6.77(m,2H),6.58-6.43(m,2H),5.48(br,1H),5.08-4.93(m,1H),4.39(m,1H),3.96(q,J=7.0Hz,2H ),3.90-3.49(m,5H),3.46-3.34(m,2H),3.08(m,1H),2.20-1.73(m,4H),1.61-1.33(m,14H).MS(ESI)m / z 494[M+H] + .

[0452] A mixture of tert-butyl (2-((1-((1S,4S)-5-(4-ethoxyphenyl)-2,5-diazabicyclo[2.2.1]heptane-2-carbonyl)cyclopropyl)sulfonyl)ethyl)carbamate (23.1 mg, 46.6 μmol) and 4 M HCl in dioxane (1.0 mL) and DCM (1.0 mL) was stirred at rt for 3 h. The solvent was removed under reduced pressure, and the crude was purified by HPLC (high pH) to give compound 42 as a colorless oil (8.5 mg, 46%). 1H NMR (300MHz, methanol-d4) δ for a mixture of isomers 6.88-6.72(m,2H),6.66-6.53(m,2H),5.07(br,1H),4.49(br,1H),3.96(q,J=7.0Hz,2H),3.86-3.60(m,1H),3 .56-3.35(m,3H),3.22-3.03(m,3H),2.14-1.91(m,3H),1.84-1.41(m,4H),1.35(t,J=7.0Hz,3H).MS(ESI)m / z 394[M+H] + .

[0453] Example 43: 1-((1S,4S)-5-(4-((2-aminoethyl)sulfonyl)phenyl)-2,5-diazabicyclo[2.2.1]heptan-2-yl)-2-methylpropan-1-one (HCl salt) [ka] To a solution of tert-butyl (1S,4S)-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (800 mg, 4.0 mmol) and isobutyryl chloride (0.59 mL, 5.64 mmol) in anhydrous DCM (40 mL) was added triethylamine (1.12 mL, 8.07 mmol) while stirring overnight at room temperature under nitrogen. The reaction mixture was then partitioned between dichloromethane and aqueous NaHCO. The organic phase was washed with water (×2) and brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product, which was purified by flash column chromatography on silica eluting with 0–30% methanol / dichloromethane to give tert-butyl (1S,4S)-5-isobutyryl-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate as a white solid (1.1 g, 100% yield). 1 H NMR(CDCl3,300MHz)δ 4.91-4.44(m,2H),3.55-3.28(m,4H),2.68-2.42(m,1H),1.94-1.73(m,2H),1.46-1.44(m,9H),1.20-1.08(m,6H)ppm.

[0454] tert-Butyl (1S,4S)-5-isobutyryl-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (90 mg, 0.33 mmol) and 4 M HCl in dioxane (2.0 mL, 8 mmol) were stirred under nitrogen at room temperature for 2 hours and then concentrated to dryness. The residue was combined with tert-butyl (2-((4-fluorophenyl)sulfonyl)ethyl)carbamate (85 mg, 0.28 mmol) and potassium carbonate (116 mg, 0.84 mmol) in anhydrous DMF (3 mL), and the reaction mixture was heated at 70° C. with stirring for 3 days. The reaction mixture was then cooled to room temperature, diluted with diethyl ether (30 mL), washed with water (3 × 30 mL) and brine (30 mL), dried over anhydrous magnesium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 0–30% methanol / dichloromethane to give tert-butyl (2-((4-((1S,4S)-5-isobutyryl-2,5-diazabicyclo[2.2.1]heptan-2-yl)phenyl)sulfonyl)ethyl)carbamate as a yellow oil (9 mg, 6% yield). 1 H NMR(CDCl3,300MHz)δ 7.69(d,2H,J=9.0Hz),6.59(d,2H,J=8.9Hz),5.25-5.07(m,1H),4.65-4.55(m,1H),4.18-3 .20(m,9H),2.72-2.38(m,1H),2.15-1.95(m,2H),1.42(s,9H),1.19-0.99(m,6H)ppm;LCMS m / z 452.4 actual value (M+H) + ,C 22 H 34 N3SO5.

[0455] This intermediate was dissolved in 4 M HCl in dioxane (0.5 mL, 2.0 mmol), and the reaction mixture was stirred under nitrogen at room temperature for 3 hours, then concentrated to dryness. Dichloromethane was added, the mixture was concentrated again, and the resulting residue was washed with diethyl ether and dried under vacuum to give the title compound (7 mg, 91% yield), isolated as an off-white solid. 1H NMR(DMSO-d6,300MHz)δ 8.11(br s,3H),7.63(d,2H,J=8.4Hz),6.80(d,2H,J=8.6Hz),4.81-4.73(m,2H),3.71-3.60(m,2H),3.53-3.42(m,2 LCMS m / z 352.3 actual value (M+H) + ,C 17 H 26 N3SO3.

[0456] Example 44: 4-((2-aminoethyl)sulfonyl)phenyl(1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxylate hydrochloride [ka] To a solution of (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (75 mg, 0.273 mmol) and DIPEA (0.29 mL, 1.64 mmol) in anhydrous DCM (5 mL) was added triphosgene (41 mg, 0.137 mmol) with stirring at room temperature under nitrogen for 1 h. tert-Butyl (2-((4-hydroxyphenyl)sulfonyl)ethyl)carbamate (99 mg, 0.328 mmol) was then added with continuous stirring over 72 h, followed by partitioning between dichloromethane and aqueous NaHCO. The organic phase was washed with water (×2) and brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on basic alumina, eluting with 20–100% ethyl acetate / petroleum ether to give 4-((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)phenyl(1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane-3-carboxylate as a white solid (71 mg, 43% yield).1 H NMR(CDCl3,300MHz)δ 7.93-7.88(m,2H),7.34-7.24(m,2H),6.88-6.84(m,2H),6.60-6.57(m,2H),5.25-5.19(m,1H),4.53-4.32(m,2H),3.98(q,2H,J=7.0Hz),3 .58-3.15(m,9H),2.58-2.53(m,1H),1.66-1.51(m,2H),1.43(s,9H),1.38(t,3H,J=7.0Hz),1.16-1.11(m,3H),0.94-0.93(m,3H)ppm;LCMS m / z 602.3 actual value (M+H) + ,C 31 H 44 N3O7S.

[0457] This intermediate was dissolved in 4 M HCl in dioxane (1.0 mL, 4.0 mmol), and the reaction mixture was stirred under nitrogen at room temperature for 3 hours, then concentrated to dryness. Dichloromethane was added, the mixture was concentrated again, and the resulting residue was washed with diethyl ether and dried under vacuum to give the title compound (56 mg, 88% yield), isolated as an off-white solid. 1 H NMR(DMSO-d6,300MHz)δ 8.21(br s,3H),7.99-7.94(m,2H),7.47-7.33(m,2H),6.80(d,2H,J=9.1Hz),6.62 (d,2H,J=9.2Hz),4.45-4.13(m,2H),3.91(q,2H,J=6.8Hz),3.72-3.60(m 4H),3.39-3.00(m,6H),1.59-1.45(m,2H),1.28(t,3H,J=7.0Hz),1.12-1.04(m,3H),0.84-0.83(m,3H)ppm;LCMS m / z 502.3 actual value (M+H) + ,C 26 H 36 N3SO5.

[0458] Example 45: 1-((1S,4S)-5-(4-(((2-aminoethyl)sulfonyl)methyl)phenyl)-2,5-diazabicyclo[2.2.1]heptan-2-yl)-2-methylpropan-1-one hydrochloride [ka] To a solution of tert-butyl (1S,2S)-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (800 mg, 4.0 mmol) and isobutyryl chloride (0.59 mL, 5.64 mmol) in anhydrous DCM (40 mL) was added triethylamine (1.12 mL, 8.07 mmol) with stirring overnight at room temperature under nitrogen. The reaction mixture was then partitioned between dichloromethane and aqueous NaHCO. The organic phase was washed with water (×2) and brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 0–30% methanol / dichloromethane to give tert-butyl (1S,2S)-5-isobutyryl-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (1.1 g, 100% yield) as a white solid. 1 H NMR(CDCl3,300MHz)δ 4.91-4.44(m,2H),3.55-3.28(m,4H),2.68-2.42(m,1H),1.94-1.73(m,2H),1.46-1.44(m,9H),1.20-1.08(m,6H)ppm.

[0459] tert-Butyl (1S,2S)-5-isobutyryl-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (150 mg, 0.556 mmol) and 4 M HCl in dioxane (3.5 mL, 14 mmol) were stirred under nitrogen at room temperature for 2 hours, then concentrated to dryness. The residue was extracted with toluene: tThis was combined with tert-butyl (2-((4-bromo-benzyl)sulfonyl)ethyl)carbamate (231 mg, 0.61 mmol) in BuOH (5:1, 6 mL) and the solution was degassed with nitrogen for 5 minutes. Pd2dba3 (51 mg, 10 mol%), X-Phos (53 mg, 20 mol%), and sodium tert-butoxide (134 mg, 1.39 mmol) were then added with stirring and the solution was bubbled with nitrogen for an additional 5 minutes, after which the flask was sealed and stirred at room temperature for 1 hour, then heated to 100 °C for 18 hours. The reaction mixture was then diluted with ethyl acetate (30 mL), washed with water (30 mL) and brine (30 mL), dried over anhydrous magnesium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on silica eluting with 80-100% ethyl acetate / cyclohexane then 0-30% methanol / ethyl acetate to give tert-butyl (2-((4-((1S,4S)-5-isobutyryl-2,5 diazabicyclo[2.2.1]heptan-2-yl)benzyl)sulfonyl)ethyl)carbamate as a yellow solid (132 mg, 51% yield). 1 H NMR(CDCl3,300MHz)δ 7.23(d,2H,J=8.7Hz),6.55(d,2H,J=8.7Hz),5.22-5.13(m,1H),5.02-4.45(m,2H),4.15(s,2H),3.70-3.40(m,5H), 3.20-3.11(m,1H),3.05-3.00(m,2H),2.72-2.36(m,1H),2.12-2.88(m,2H),1.43(s,9H),1.18-0.97(m,6H)ppm;LCMS m / z 466.3 actual value (M+H) + ,C 23 H 36 N3SO5.

[0460] This intermediate was dissolved in 4 M HCl in dioxane (1.7 mL, 6.71 mmol), and the reaction mixture was stirred at room temperature under nitrogen for 3 hours, then concentrated to dryness. Dichloromethane was added, the mixture was concentrated again, and the resulting residue was washed with diethyl ether and dried under vacuum to give the isolated title compound as an off-white solid (92 mg, 85% yield). 1 H NMR(DMSO-d6,300MHz)δ 8.23(br s,3H),7.21(d,2H,J=7.4Hz),6.63(d,2H,J=8.0Hz),4.76-4.45(m,4H),3.50- 3.15(m,7H),3.01-2.71(m,2H),2.01-1.89(m,2H),1.09-0.79(m,6H)ppm;LCMS m / z 366.2 actual value (M+H) + ,C 18 H 28 N3SO3.

[0461] Example 46: (4-(((2-aminoethyl)sulfonyl)methyl)phenyl)((1S,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonan-3-yl)methanone [ka] To a solution of (1R,5S)-6-(4-ethoxyphenyl)-9,9-dimethyl-3,6-diazabicyclo[3.2.2]nonane (105 mg, 0.383 mmol) and 4-(((2-((tert-butoxycarbonyl)amino)ethyl)sulfonyl)methyl)benzoic acid (125 mg, 0.364 mmol) in anhydrous dichloromethane (5 mL) was added DMAP (44 mg, 0.364 mmol) and triethylamine (0.25 mL, 1.82 mmol) with stirring under nitrogen. The reaction mixture was cooled to 0° C., and then EDCI.HCl (77 mg, 0.40 mmol) was added while warming to room temperature with continuous stirring overnight. The reaction mixture was then partitioned between dichloromethane and aqueous NaHCO3, and the organic phase was washed with water (x2) and brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product, which was purified using flash column chromatography on basic alumina, eluting with 40-100% ethyl acetate / petroleum ether to give the product (150 mg, 69% yield) as a white solid. 1 H NMR(CDCl3,300MHz)δ 7.47-7.36(m,4H),6.88-6.83(m,2H),6.60-6.51(m,2H),5.16-4.80(m,2H),4.27(s,2H),3.98(q,2H,J=7.0Hz),3.87-3.49(m,4H),3.3 3-3.09(m,6H),2.62-2.36(m,1H),1.66-1.50(m,2H),1.45(s,9H),1.38(t,3H,J=7.0Hz),1.28-1.13(m,3H),0.93-0.86(m,3H)ppm;LCMS m / z 600.3 actual value (M+H) + ,C 32 H 46 N3O6S.

[0462] This intermediate was dissolved in 4 M HCl in dioxane (1.45 mL, 5.8 mmol), and the reaction mixture was stirred at room temperature under nitrogen for 3 hours, then concentrated to dryness. Dichloromethane was added, the mixture was concentrated again, and the resulting residue was washed with diethyl ether and dried under vacuum to give the title compound (113 mg, 92% yield), isolated as an off-white solid.1 H NMR(DMSO-d6,300MHz)δ 8.33(br s,3H),7.52-7.34(m,4H),6.81-6.75(m,2H),6.63-6.57(m,2H),4.87-4.65(m,3H),3.90(q,2H,J=6.9Hz),3.81-3.63(m,2H), 3.51-3.42(m,3H),3.24-2.92(m,5H),2.58-2.36(m,1H),1.52-1.35(m,2H),1.27(t,3H,J=7.0Hz),1.09-0.75(m,6H)ppm;LCMS m / z 500.3 actual value (M+H) + ,C 27 H 38 N3SO4.

[0463] Materials and Methods LOX activity in cyst assays (Tang et al, 2017). Cell culture and transfection All cell lines used in this study were purchased from the American Type Culture Collection (ATCC). Mycoplasma contamination was routinely monitored by PCR. The cells used were Mycoplasma-negative. MDCK cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-strep solution (Pen-Strep). Lipofectamine 3000 was used according to the manufacturer's protocol for transfection of GFP constructs into MDCK cells. All cells were selected with 5 mg / ml G418 (Life Technologies). All cell culture reagents were purchased from Life Technologies.

[0464] To generate MDCK cysts, cells were cultured on Matrigel (Corning) in DMEM with 10% FBS supplemented with 2% Matrigel. Cysts were allowed to form for 10 days before further testing.

[0465] Cloning of LOX expression constructs Mouse LOX cDNA was purchased from OriGene. The full-length LOX cDNA was then PCR cloned into pEGFP-N1 (Clonetech) or the biosensor vector proGFP2-N1 (Hanson, 2004) using the following primers: GAGAGAGCTAGCATGCGTTTCGCCTGGG (forward primer) and TCTCTCCTCGAGATACGGTGAAATTGTGCAGCC (reverse primer). NheI and XhoI restriction sites were added to the forward and reverse primers accordingly for insertion into pEGFP-N1 or proGFP2-N1. Using LOX-GFP as a template, mutant LOX constructs were generated using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies) according to the production protocol. To generate the roGFP2 form of the LOX mutant construct, the LOX mutant cDNA was transferred from pEGFP-N1 to proGFP2-N1 using NheI and XhoI.

[0466] Confocal imaging and imaging analysis All micrographs were taken using a Leica TCS SP8 X confocal system. For LOX biosensor imaging, live MDCK cysts were used. The oxidized biosensor was excited with a 405 nm laser, while the reduced biosensor was excited with a 488 nm laser. Biosensor emission was recorded in the 500-530 nm range using sequential scanning. Ratio images were generated according to a previously published protocol {Kardash, 2011 #376}. While the previously published protocol generates YFP / CFP ratio images, we used it to generate oxidized / reduced (roGFP2 ratio) images. The roGFP2 ratio at the basal surface of MDCK cysts was used to demonstrate LOX inhibition. The LOX inhibitor was added 30 min before imaging.

[0467] The inhibition of LOX in cysts assayed with LOX inhibitors compared to control (DMSO vehicle-treated) cysts is shown in Table 3a. For clarity, the readout in DMSO-treated cysts represents 0% inhibition (no inhibition), and the readout in 1 mM BAPN is used as 100% inhibition (complete inhibition).

[0468] LOX isoform (LOX, LOXL2, LOXL3) activity assay LOX was extracted from pig skin as previously described (Shackleton and Hulmes, 1990). LOXL2 and LOXL3 were obtained from R&D Systems / Bio-techne. Enzyme activity was assessed using the Promega ROS Glo Assay Kit (G8821). Generally, test compounds were added to either 384-well assay plates (Greiner) using a Labcyte Echo™ Acoustic Handler or 96-well plates for final assay concentrations of 100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01, and 0.003 μM. Enzymes were diluted according to their specific, predetermined activity in assay buffer (100 mM CHES, pH 9, 0.05% (w / v) pluronic F-127, 0.5% (w / v) BSA, 1 mM MgCl2, 1 M urea, 100 mM NaCl) and added to the plate. For LOXL2, the mixture was incubated for 20 min, 1 h, or 20 h. For LOX and LOXL3, the incubation time was 1 h. Cadaverine and HO substrates were then added to each well (final assay concentrations of 19.56 mM and 25 μM, respectively), and the plate was incubated at room temperature for 1.5 h (for LOX) or 1 h (for LOXL2 and LOXL3). Finally, luciferin detection reagent was added, and the plate was incubated at room temperature for 20 min, protected from light. Luminescence was measured using a BMG LABTECH PHERAstar FS reader, and the resulting IC50 values ​​were calculated using GraphPad Prism software.

[0469] In other setups, LOXL2 enzyme was diluted according to a specific, predetermined activity in assay buffer (100 mM CHES, pH 9, 0.05% (w / v) pluronic F-127, 0.5% (w / v) BSA, 1 mM MgCl2, 1 M urea, 100 mM NaCl). Overall, 0.5 μl of test compound was added to 40 μl assay buffer plus LOXL2 (100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01, and 0.003 μM (final concentrations)) in a 96-well white polystyrene flat-bottom plate (Fisher) and incubated for the indicated time at room temperature. Ten μl of assay buffer containing 97.8 mM cadaverine and 125 M HO2 substrate (final assay concentrations of 19.56 mM and 25 μM, respectively) was added to each well, and the plate was incubated at room temperature for 1 hour. Finally, 50 μl / well of luciferin detection reagent was added, and the plate was incubated for 20 min at room temperature protected from light. Luminescence was measured using a SpectaMax M5 plate reader with an integration time of 500 ms / well, and the resulting IC50 values ​​were calculated using GraphPad Prism software.

[0470] Amine oxidase activity assay (Tang et al., 2017) Monoamine oxidase A (MAO-A) and monoamine oxidase B (MAO-B) activity was assessed using the Promega MAO-Glo Assay Kit (V1402). MAO substrate was prepared at 80 μM with the specific MAO-A / B reaction buffer. In total, 0.5 μl of test compound was added to 25 μl MAO substrate (100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01, and 0.003 μM (final concentrations)) in a 96-well white flat-bottom plate. In total, 25 μl of a 1:520 dilution of MAO-A enzyme (Promega, V1452) or 25 μl of a 1:52 dilution of MAO-B enzyme (Sigma, M7441) in the specific MAO-A / B reaction buffer was added to each well (enzyme prepared at 2× final concentration), and the plate was incubated at room temperature for 1 hour. Finally, 50 μl / well of luciferin detection reagent was added, and the plate was incubated for 20 min at room temperature protected from light. Luminescence was measured using a SpectaMax M5 plate reader with an integration time of 500 ms / well, and the resulting IC50 values ​​were calculated using GraphPad Prism software.

[0471] Diamine oxidase (DAO) catalytic activity was determined using the Promega ROS Glo Assay Kit (G8821). DAO was purchased from Sigma, and cadaverine dihydrochloride was used as the substrate at a concentration of 97.8 mM. The concentrations of chemical inhibitors were identical to those used in the MAO assay. Luminescence was measured using a SpectaMax M5 plate reader with an integration time of 500 ms / well, and the resulting IC50 values ​​were calculated using GraphPad Prism software.

[0472] In another setup, DAO and MAO assays were performed in 384-well plates (Greiner) and test compounds were added using a Labcyte Echo™ Acoustic Handler at the same final concentrations as in the 96-well setup. Luminescence was measured on a BMG LABTECH PHERAstar FS plate reader.

[0473] [Table 21]

[0474] [Table 22]

[0475] [Table 23]

[0476] [Table 24]

[0477] [Table 25]

[0478] [Table 26]

[0479] [Table 27]

[0480] [Table 28]

[0481] In vivo assessment of LOX inhibitors Animal procedures All procedures involving animals were approved by the Animal Welfare and Ethical Review Body of the Institute of Cancer Research and Cancer Research UK Manchester Institute in accordance with National Home Office regulations under the Animals (Scientific Procedures) Act 1986 and in accordance with the guidelines of the Committee of National Cancer Research Institute. Tumor size was determined by caliper measurement of tumor length, width, and depth, and volume was calculated as volume = 0.5236 × length × width × depth (mm). In accordance with our license to conduct animal experiments, animals were excluded from experiments if they showed signs of distress, excessive weight loss (>20%), or illness.

[0482] Oral tolerability of LOX inhibitors A suspension of test compound at the treatment regimen dose (200 mg / kg / day) in 5.25% Tween 20 / saline (v:v) or 5% DMSO in water was administered p.o. to two 6-week-old CD1, NCR, or Balb / c female mice at 0.2 ml / 20 g body weight once daily by metal gavage for four consecutive days.

[0483] Mice were observed for up to 15 days after the final dose and their weight was measured every 4 days. Compounds were considered to be tolerable if there was no >20% weight loss for more than 72 hours.

[0484] Compounds of the invention tested in vivo are well tolerated at the doses tested and exhibit <5% weight loss or weight gain in tolerability studies and longer therapy studies.

[0485] In vivo tumor model studies MDA-MB-231 xenografts. Six-week-old Ncr nude female mice obtained from Charles River were injected with 4 x 10^6 MDA-MB-231 Luc in 100 μl PB (50:50 Matrigel) into the third superior mammary fat pad. Approximately 10 days after cell inoculation, tumors grew to an average of 80 mm 3 When the animals reached a maturity of 100 mg / kg, ...

Claims

1. Formula (I): 【Chemistry 1】 (In the formula, m and n are each independently selected from 1, 2, 3, or 4, and are represented by the formula 【Chemistry 2】 The two ring carbon atoms of the cyclic diamine moiety are (i) optionally linked by a bond, thereby forming a fused cyclic diamine moiety; (ii) -(CR ９ R １０ ) ｏ - (where R ９ and R １０ is independently for each occurrence H and unsubstituted C １～４ alkyl, and o is 1, 2, 3, or 4; or (iii) may be optionally linked through a spiro carbon atom; and Each ring carbon atom of the cyclic diamine moiety is １ ~C ６ Alkyl, -OR ２ａ C substituted with １ ~C ６ Alkyl or NR ２ａ R ２ｂ C substituted with １ ~C ６ optionally substituted with 1 or 2 substituents independently selected from alkyl; L １ and L ２ each independently represents a bond, —O—, —C(O)—, —C(O)O—, —OC(O)—, or —C(O)NR ３ --, --NR ３ C(O)-, -NR ３ -, -SO ２ N.R. ３ --, --NR ３ SO ２ -, -S-, -SO ２ -, -SO ２ O-, -OSO ２ --, --NR ３ SO ２ N.R. ４ --, --NR ３ C(O)NR ４ --, --NR ３ C(O)O- or -OC(O)NR ３ - selected from L ３ is a bond, C １ ~C ４ Alkylene, C ２ ~C ４ Alkenylene, or C ２ ~C ４ alkynylene, In this case, L ３ In the above, alkylene, alkenylene, or alkynylene may each be selected from halo, cyano, oxo, hydroxy, carboxy, R ２ , -OR ２ , -C(O)R ２ , -C(O)OR ２ , -OC(O)R ２ , -C(O)NR ６ R ７ , -NR ６ C(O)R ７ , -NR ６ R ７ , -SO ２ N.R. ６ R ７ , -NR ６ SO ２ R ７ , -SR ６ , -SO ２ R ６ , -SO ２ OR ６ , -OSO ２ R ６ , -NR ６ SO ２ N.R. ７ R ８ , -NR ６ C(O)NR ７ R ８ , -NR ６ C(O)OR ７ , or OC(O)NR ６ R ７ and optionally substituted by 1 or 2 substituents independently selected from X, Y, and Z are each independently selected from a bond or a 3-12 membered ring system containing 0, 1, 2, or 3 heteroatoms selected from N, O, or S in the ring system; In this case, any of the ring systems in X, Y, and Z may be selected from halo, cyano, oxo, hydroxy, carboxy, R ２ , -OR ２ , -C(O)R ２ , -C(O)OR ２ , -OC(O)R ２ , -C(O)NR ４ R ５ , -NR ３ C(O)R ４ , -NR ４ R ５ , -SO ２ N.R. ４ R ５ , -NR ３ SO ２ R ４ , -SR ３ , -SO ２ R ３ , -SO ２ OR ３ , -OSO ２ R ３ , -NR ３ SO ２ N.R. ４ R ５ , -R ３ C(O)NR ４ R ５ , -NR ３ C(O)OR ４ , or OC(O)NR ４ R ５ and optionally substituted with one or more substituents independently selected from R １ is hydrogen, halogen, C １ ~C ６ Alkyl, C ２ ~C ６ Alkenyl, C ２ ~C ６ alkynyl, or a 3-12 membered ring system containing 0, 1, 2, or 3 heteroatoms selected from N, O, or S in the ring system (e.g., cycloalkyl, heterocyclyl, aryl, or heteroaryl); In this case, R １ Any of the alkyl, alkenyl, or alkynyl groups may be selected from halo, cyano, amino, oxo, hydroxy, carboxy, R ２ , -OR ２ , -C(O)R ２ , -C(O)OR ２ , -OC(O)R ２ , -C(O)NR ４ R ５ , -NR ３ C(O)R ４ , -NR ４ R ５ , -SO ２ N.R. ４ R ５ , -NR ３ SO ２ R ４ , -SR ３ , -SO ２ R ３ , -SO ２ OR ３ , -OSO ２ R ３ , -NR ３ SO ２ N.R. ４ R ５ , -NR ３ C(O)NR ４ R ５ , -NR ３ C(O)OR ４ or -OC(O)NR ４ R ５ and R １ Any of the ring systems in the formula (I) may be selected from the group consisting of halo, cyano, oxo, hydroxy, carboxy, R ２ , -OR ２ , -C(O)R ２ , -C(O)OR ２ , -OC(O)R ２ , -C(O)NR ４ R ５ , -NR ３ C(O)R ４ , -NR ４ R ５ , -SO ２ N.R. ４ R ５ , -NR ３ SO ２ R ４ , -SR ３ , -SO ２ R ３ , -SO ２ OR ３ , -OSO ２ R ３ , -NR ３ SO ２ N.R. ４ R ５ , -NR ３ C(O)NR ４ R ５ , -NR ３ C(O)OR ４ or -OC(O)NR ４ R ５ and optionally substituted with one or more substituents independently selected from R ２ is expressed independently for each occurrence as C １ ~C ６ Alkyl, C ２ ~C ６ Alkenyl, C ２ ~C ６ Alkynyl, or C ３ ~C ６ cycloalkyl; In this case, R ２ Any of the alkyl, alkenyl, alkynyl, or cycloalkyl groups may be selected from halo, cyano, oxo, R ２ａ , -OR ２ａ , -C(O)R ２ａ , -C(O)OR ２ａ , -OC(O)R ２ａ , -C(O)NR ２ａ R ２ｂ , -NR ２ａ C(O)R ２ｂ , -NR ２ａ R ２ｂ , -SO ２ N.R. ２ａ R ２ｂ , -NR ２ａ SO ２ R ２ｂ , -SR ２ａ , -SO ２ R ２ａ , -SO ２ OR ２ａ , -OSO ２ R ２ａ , -NR ２ａ SO ２ N.R. ２ｂ R ２ｃ , -NR ２ａ C(O)NR ２ｂ R ２ｃ , -NR ２ａ C(O)OR ２ｂ or -OC(O)NR ２ａ R ２ｂ and optionally substituted with 1, 2, or 3 substituents independently selected from R ２ａ , R ２ｂ , and R ２ｃ is independently for each occurrence hydrogen or unsubstituted C １ ~C ４ alkyl, R ３ , R ４ , and R ５ is independently for each occurrence hydrogen, C １ ~C ６ Alkyl, or C ３ ~C ６ cycloalkyl; In this case, R ３ , R ４ , and R ５ Any of the alkyl or cycloalkyl groups in the formula (I) may be selected from halo, cyano, oxo, hydroxy, carboxy, R ２ , -OR ２ , -C(O)R ２ or -C(O)OR ２ and R ４ is optionally substituted C １ ~C ６ is alkyl and R ５ is optionally substituted C １ ~C ６ When R is alkyl, ４ and R ５ is -C(O)NR ４ R ５ , -NR ４ R ５ , -SO ２ N.R. ４ R ５ , -NR ３ SO ２ N.R. ４ R ５ , -R ３ C(O)NR ４ R ５ or -OC(O)NR ４ R ５ together with the nitrogen atom to which they are attached may form a 3- to 6-membered heterocycloalkyl; R ６ , R ７ , and R ８ is independently for each occurrence hydrogen, C １ ~C ６ Alkyl, or C ３ ~C ６ cycloalkyl; In this case, R ６ , R ７ , and R ８ Any of the alkyl or cycloalkyl groups in the formula (I) may be selected from halo, cyano, oxo, hydroxy, carboxy, R ２ａ , -OR ２ａ , -C(O)R ２ａ , -C(O)OR ２ａ , -C(O)NR ２ａ R ２ｂ , -NR ２ａ C(O)R ２ｂ , -NR ２ａ R ２ｂ , -SO ２ N.R. ２ａ R ２ｂ , -NR ２ａ SO ２ R ２ｂ , -SR ２ａ , -SO ２ R ２ａ , -SO ２ OR ２ａ , -OSO ２ R ２ａ , -NR ２ SO ２ N.R. ２ａ R ２ｂ , -NR ２ａ C(O)NR ２ｂ R ２ｃ , -NR ２ａ C(O)OR ２ｂ or -OC(O)NR ２ａ R ２ｂ and optionally substituted with 1, 2, or 3 substituents independently selected from R １１ and R １２ are independently hydrogen and C １ ~C ６ alkyl, and q is 0, 1, or 2; However, L ２ , Y., L. ３ and at least one of Z is not a bond; However, in formula I, -SO ２ - (CH ２ ) ２ -NH ２ is linked to the remainder of the compound of formula I through a carbon atom, However, when X is a bond, L １ is a bond, —C(O)—, —OC(O)—, —NR ３ C(O)-, -NR ３ SO ２ -, -SO ２ - and -OSO ２ - selected from However, when Y is a bond, L ２ represents a bond, -C(O)-, -C(O)O-, or -C(O)NR ３ -, -SO ２ N.R. ３ -, -SO ２ - and -SO ２ O-, and However, the compound is 【Chemistry 3】 isn't it) or a pharma- ceutically acceptable salt thereof.

2. The cyclic diamine moieties are (i) optionally linked by a bond, thereby forming a fused cyclic diamine moiety, or (ii) -(CR ９ R １０ ) ｏ - (where R ９ and R １０ is independently for each occurrence H and unsubstituted C １～４ 2. The compound of claim 1, wherein q is 0; or a pharma- ceutically acceptable salt thereof; or wherein q is 1, 2, 3, or 4;

3. 3. The compound of claim 1 or claim 2, or a pharma- ceutically acceptable salt thereof, wherein the ring carbon atoms of the cyclic diamine moiety are unsubstituted.

4. The cyclic diamine moiety is -(CR ９ R １０ ) ｏ - (where R ９ and R １０ is independently for each occurrence H and unsubstituted C １～２ 4. The compound according to claim 1, wherein the aryl group is aryl, aryl or aryl;

5. The cyclic diamine moiety is -(CR ９ R １０ ) ｏ 5. The compound according to any one of claims 1 to 4, which is bridged by - (wherein o is 1 or 2), or a pharma- ceutically acceptable salt thereof.

6. 6. The compound of any one of claims 1 to 5, or a pharma- ceutically acceptable salt thereof, wherein X is selected from a bond, an unsubstituted phenyl, or an unsubstituted 5-6 membered heteroaryl.

7. The compound of formula (I) may be represented by formula (III): 【Chemistry 4】 The compound according to any one of claims 1 to 6, which is a compound of the structure: or a pharma- ceutically acceptable salt thereof.

8. R １ is optionally substituted by 1, 2, or 3 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy; １ ~C ６ The compound according to any one of claims 1 to 7, or a pharma- ceutically acceptable salt thereof, wherein R is an alkyl group.

9. L １ is a bond, —O—, —C(O)—, —C(O)O—, —OC(O)—, —C(O)NR ３ --, --NR ３ C(O)- or -SO ２ - or L １ is a bond, —O—, —C(O)—, —C(O)O—, —OC(O)—, —C(O)NH—, —NHC(O)—, or —SO ２ - or L １ is selected from a bond, —O—, —C(O)—, or —C(O)NH—; or L １ is selected from a bond or -O-; or L １ is -O-; 9. The compound according to any one of claims 1 to 8, or a pharma- ceutically acceptable salt thereof.

10. L １ is a bond and R １ The compound according to any one of claims 1 to 9, wherein is halogen.

11. The compound of formula (I) may be represented by formula (VIII): 【Chemistry 5】 The compound is of the structure: R １ａ and R １ｂ taken together form a 3- to 7-membered heterocycloalkyl optionally containing one additional heteroatom selected from O, N, or S in the ring; - R １ａ and R １ｂ The heterocycloalkyl formed by the formula: ２ , -OR ２ , -C(O)R ２ , -C(O)OR ２ , -OC(O)R ２ , -C(O)NR ４ R ５ , -NR ３ C(O)R ４ , -NR ３ R ４ , -SO ２ N.R. ３ R ４ , -NR ３ SO ２ R ４ , -SR ３ , -SO ２ R ３ , -SO ２ OR ３ , -OSO ２ R ３ , -NR ２ SO ２ N.R. ４ R ５ , -NR ３ C(O)NR ４ R ５ , -NR ３ C(O)OR ４ or -OC(O)NR ４ R ５ The compound according to any one of claims 1 to 5, or a pharma- ceutically acceptable salt thereof, optionally substituted with 1, 2, or 3 substituents independently selected from:

12. The compound of formula (I) may be represented by formula (X): 【Chemistry 6】 It is a compound of the structure R １ is optionally substituted by 1, 2, or 3 substituents independently selected from halo, cyano, amino, oxo, hydroxy, or carboxy; １ ~C ６ 6. The compound according to any one of claims 1 to 5, or a pharma- ceutically acceptable salt thereof, wherein R is an alkyl group.

13. L ２ is a bond, —O—, —C(O)—, —C(O)O—, —OC(O)—, —C(O)NR ３ - or -NR ３ C(O)-, or L ２ is selected from a bond, —O—, —C(O)—, —C(O)O—, —OC(O)—, —C(O)NH—, or —NHC(O)—; or L ２ is selected from a bond, —O—, —C(O)—, or —C(O)NH—; or L ２ is selected from a bond, —C(O)—, or —C(O)NH—; ２ is selected from a bond or -C(O)-; or L ２ The compound according to any one of claims 1 to 12, or a pharma- ceutically acceptable salt thereof, wherein is -C(O)-.

14. L ３ is a bond or C １ ~C ４ alkylene; - alkylene L ３ are each independently halo, cyano, oxo, hydroxy, carboxy, R ２ , -OR ２ , -C(O)R ２ , -C(O)OR ２ , -OC(O)R ２ , -C(O)NR ６ R ７ , -NR ６ C(O)R ７ , -NR ６ R ７ , -SO ２ N.R. ６ R ７ , -NR ６ SO ２ R ７ , -SR ６ , -SO ２ R ６ , -SO ２ OR ６ , -OSO ２ R ６ , -NR ６ SO ２ N.R. ７ R ８ , -NR ６ C(O)NR ７ R ８ , -NR ６ C(O)OR ７ or -OC(O)NR ６ R ７ The compound according to any one of claims 1 to 13, or a pharma- ceutically acceptable salt thereof, optionally substituted with 1 or 2 substituents independently selected from:

15. 15. The compound of any one of claims 1 to 14, or a pharma- ceutically acceptable salt thereof, wherein Y is selected from a bond, unsubstituted phenyl, or unsubstituted 5-6 membered heteroaryl.

16. Z is a bond, C ３ ~C ６ Cycloalkyl, C ３ ~C ６ selected from heterocycloalkyl, phenyl, or 5-6 membered heteroaryl; any cycloalkyl, heterocycloalkyl, phenyl, or heteroaryl in Z may be optionally substituted with 1, 2, or 3 substituents independently selected from halo, cyano, oxo, hydroxy, or carboxy; and any heterocycloalkyl or heteroaryl in Z contains 1 or 2 heteroatoms selected from N, O or S in the ring; 16. The compound according to any one of claims 1 to 15, or a pharma- ceutically acceptable salt thereof.

17. 17. The compound according to any one of claims 1 to 16, wherein m and n are each independently selected from 2 or 3, or a pharma- ceutically acceptable salt thereof.

18. The cyclic diamine moiety of formula I is 【Chemistry 7】 18. The compound according to any one of claims 1 to 17, or a pharma- ceutically acceptable salt thereof, selected from:

19. The cyclic diamine moiety of formula I is 【Chemistry 8】 19. The compound according to any one of claims 1 to 18, or a pharma- ceutically acceptable salt thereof, selected from:

20. The cyclic diamine moiety of formula I is 【Chemistry 9】 20. The compound according to any one of claims 1 to 19, or a pharma- ceutically acceptable salt thereof, selected from:

21. The cyclic diamine moiety of formula I is 【Chemistry 10】 21. The compound according to any one of claims 1 to 20, wherein:

22. The compound is 【Chemistry 11】 【Chemistry 12】 2. The compound of claim 1 selected from:

23. 2. The compound of claim 1, or a pharma- ceutically acceptable salt thereof, selected from: 【Table 1】 【Table 2】 【Table 3】

24. A compound according to any one of claims 1 to 23 for use as a medicament, for example for use in the treatment of a disease or medical condition mediated by LOX.

25. A compound according to any one of claims 1 to 23, wherein the compound is for use in the treatment of a proliferative disease, such as cancer.

26. 24. The compound according to any one of claims 1 to 23, wherein the compound is for use in the treatment of a fibrotic disease, such as liver fibrosis, lung fibrosis, kidney fibrosis, cardiac fibrosis, bone marrow fibrosis, scleroderma, etc.

Images