Modulators of TDP-43

Abstract

Provided herein are compositions and methods for reducing toxicity associated with TAR DNA-binding protein 43. Certain embodiments of the present disclosure relate to compositions that treat, inhibit, reduce, prevent, or delay a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis or a neurodegenerative disease. Certain embodiments of the present disclosure relate to methods of treating, inhibiting, reducing, preventing, or delaying a disease or condition associated with TDP-43 toxicity by administering to a subject in need thereof a compound of any one of Formulas (I), (II), (III), (IV), (V), (VI), (VII), or (VIII).

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 820,158, filed March 18, 2019, which is incorporated by reference in its entirety.

[0002] Electronic Format of Sequence Listing and Table References This application is filed together with an Electronic Sequence Listing entitled ALTER001WOSEQLIST.TXT, which was created on March 6, 2020 and is 1.9KB in size. The information in the Electronic Sequence Listing is incorporated herein by reference in its entirety.

[0003] The present disclosure relates to compounds, compositions and methods of using same to treat, prevent, inhibit, ameliorate, or slow the onset or development of diseases or conditions associated with TAR DNA binding protein 43 (TDP-43) toxicity, including, but not limited to, cystic fibrosis and neurodegenerative disorders including, for example, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease. [Background technology]

[0004] TDP-43, also known as TARDBP, has been implicated in transcriptional regulation (Berson et al., (2017), Curr Biol 27, 3579-3590 e3576; Ignatius et al., 1995, J Virol 69, 3584-3596), pre-mRNA splicing (Ayala et al., (2006), Febs Lett 580, 1339-1344; Bose et al., (2008), J Biol Chem 283, 28852-28859; Buratti and Baralle, (2001a), J Biol Chem 276, 36337-36343; Mercado et al., 2005, Nucleic Acids Res 33, 6000-6010), mRNA stability and transport (Alami et al., 2014, Neuro 81, 536-543; Ayala et al., (2011), Embo Journal 30, 277-288; Strong et al., 2007, Mol Cell Neurosci 35, 320-327), as well as translational regulation (Neelagandan et al., 2018, Nucleic Acids Res). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] U.S. Patent No. 6,800,634 [Patent Document 2] US Patent Application Publication No. 2012 / 0220610 [Patent Document 3] US Patent Application Publication No. 2017 / 0362221 [Non-patent literature]

[0006] [Non-Patent Document 1] Berson et al. (2017), Curr Biol 27, 3579~3590 e3576 [Non-Patent Document 2] Ignatius et al., 1995, J Virol 69, 3584–3596 [Non-Patent Document 3] Ayala et al. (2006), Febs Lett 580, 1339-1344 [Non-Patent Document 4] Bose et al., (2008), J Biol Chem 283, 28852-28859 [Non-Patent Document 5] Buratti and Baralle, (2001a), J Biol Chem 276, 36337~36343 [Non-Patent Document 6] Mercado et al., 2005, Nucleic Acids Res 33, 6000~6010 [Non-Patent Document 7] Alami et al., 2014, Neuron 81, 536-543 [Non-Patent Document 8] Ayala et al. (2011), Embo Journal 30, 277-288 [Non-Patent Document 9] Strong et al., 2007, Mol Cell Neurosci 35, 320–327 [Non-Patent Document 10] Neelagandan et al., 2018, Nucleic Acids Res [Non-Patent Document 11] Buratti and Baralle, (2001b), J Biol Chem 276, 36337~36343 [Non-Patent Document 12] Kuo et al., 2009, Nucl Acids Res 37, 1799–1808 [Non-Patent Document 13] Chillon et al. (1995), N Engl J Med 332, 1475~1480 [Non-Patent Document 14] Noone et al., 2001, Gastroenterology 121, 1310-1319 [Non-Patent Document 15] Kostuch et al., 2005, Eur Arch Oto-Rhino-L 262, 982–986 [Non-Patent Document 16] Casals et al. (2004), Clin Genet 65, 490–495 [Non-Patent Document 17] Miller et al., 1996, Am J Hum Genet 59, 45–51 [Non-Patent Document 18] Strong et al., 1993, Hum Mol Genet 2, 225-230 [Non-Patent Document 19] Groman et al., 2004, American Journal of Human Genetics 74, 176–179 [Non-Patent Document 20] Arai et al., 2006, Biochem Bioph Res Co 351, 602~611 [Non-Patent Document 21] Ling et al., 2013, Neuron 79, 416-438 [Non-Patent Document 22] Mackenzie et al., 2007, Ann Neurol 61, 427–434 [Non-Patent Document 23] Neumann et al., 2006, Science 314, 130-133 [Non-Patent Document 24] James et al., 2016, Brain 139, 2983-2993 [Non-Patent Document 25] Ihara et al., 2018, Ann Neurol 84, 741–753 [Non-Patent Document 26] McKee et al., 2013, Brain 136, 43-64 [Non-Patent Document 27] Nakashima-Yasuda et al., 2007, Acta Neuropathol 114, 221-229 [Non-Patent Document 28] Josephs et al., 2014, Acta Neuropathol 127, 811–824 [Non-Patent Document 29] Sephton et al., 2010, J Biol Chem 285, 38740~38740 [Non-Patent Document 30] Uchida et al., 2012, Brain 135, 833-846 [Non-Patent Document 31] Wils et al., 2010, PNAS 107, 3858-3863 [Non-Patent Document 32] Kabashi et al., 2010, Hum Mol Genet 19, 671-683 [Non-Patent Document 33] Li et al., 2010, PNAS 107, 3169–3174 [Non-Patent Document 34] Miguel et al., 2011, Neurobiol Dis 41, 398-406 [Non-Patent Document 35] Ash et al. (2010), Hum Mol Genet 19, 3206-3218 [Non-Patent Document 36] Fratta et al. (2018), EMBO J 37 [Non-Patent Document 37] White et al., 2018, Nature Neuroscience 21, 1138-1138 [Non-Patent Document 38] Fujiwara et al., 2015, Biochem Biophys Res Commun 460, 281–286 [Non-Patent Document 39] Mercado et al., 2015, Nucleic Acids Res 33, 6000~6010 [Non-Patent Document 40] Gumy et al., 2017, Neuron 94, 347-362 e347 [Non-Patent Document 41] Ihara et al., 2013, Hum Mol Genet, 22(22), 4474~4484 [Non-Patent Document 42] Voigt et al., 2010, PLoS One, 5(8), e12247 Summary of the Invention [Means for solving the problem]

[0007] Described herein are compounds for use in treating or reducing the occurrence or development of a disease or condition associated with TDP-43 toxicity, as well as methods of using same for treating, inhibiting, ameliorating, preventing, or slowing a disease or condition associated with TDP-43 toxicity.

[0008] Some embodiments provided herein relate to pharmaceutical compositions. In some embodiments, the pharmaceutical compositions are for use in treating diseases or conditions associated with TAR DNA binding protein 43 (TDP-43) toxicity. In some embodiments, the compositions comprise a therapeutically effective amount of a compound of formula (I), an analog, a derivative, or a pharma- ceutical acceptable salt thereof:

[0009] [ka]

[0010] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9 and R 10, R 10 and R 11 , or R 11 and R 12 at least one of, taken together, forms an optionally substituted benzene ring, wherein the benzene ring is optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, and wherein any one of the carbon atoms present in any one of the fused rings of formula (I) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (I) includes ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-208, ALT-207, ALT-210, ALT-211, ALT-302, In some embodiments, the compound of formula (I) is any one of the compounds of formula (II), (III), or (IV):

[0011] [ka]

[0012] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9, R 10 , R 11 , R 12 , R 13 and R 14are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, wherein any one of the carbon atoms present in any one of the fused rings of formula (II), (III), or (IV) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (II) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-208, ALT-207, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, or ALT-414. In some embodiments, the compound of formula (II) is ALT-59. In some embodiments, the compound of formula (III) is ALT-108, ALT-317, ALT-333 or ALT-403. In some embodiments, the compound of formula (IV) is ALT-205. In some embodiments, the pharmaceutical composition is for use in the treatment of cystic fibrosis. In some embodiments, the composition inhibits the progression or onset of cystic fibrosis. In some embodiments, the pharmaceutical composition is for use in the treatment of a neurodegenerative disease. In some embodiments, the composition inhibits the progression or onset of a neurodegenerative disease. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy or Parkinson's disease. In some embodiments, the compound of formula (I) is present in an amount of 0.01 mg to 3000 mg. In some embodiments, the composition is formulated for oral or parenteral administration.

[0013] Some embodiments provided herein relate to a method of reducing or inhibiting TAR DNA binding protein 43 (TDP-43) in a subject. In some embodiments, the method includes the steps of selecting a subject in need of a compound that reduces or inhibits TDP-43, and administering to the subject a therapeutically effective amount of any one compound of Formula (I), an analog, derivative, or pharma- ceutically acceptable salt thereof:

[0014] [ka]

[0015] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9 and R 10 , R 10 and R 11 , or R 11 and R 12and at least one of: taken together to form an optionally substituted benzene ring, wherein the benzene ring is optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, and wherein any one of the carbon atoms present in any one of the fused rings of formula (I) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (I) is a compound of any one of formulas (II), (III), or (IV):

[0016] [ka]

[0017] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9, R 10 , R 11 , R 12 , R 13 and R 14are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, where any one of the carbon atoms present in any one of the fused rings of formula (II), (III), or (IV) is optionally replaced with a nitrogen atom. In some embodiments, the subject is identified as having a disease or condition associated with TDP-43 toxicity. In some embodiments, the disease is cystic fibrosis or a neurodegenerative disease. In some embodiments, the method inhibits or delays the progression or onset of cystic fibrosis or a neurodegenerative disease. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in the elderly (HS senescence), chronic traumatic encephalopathy, or Parkinson's disease. In some embodiments, the compound of formula (I) is selected from the group consisting of ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-208, ALT-207, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of formula (I) is ALT-59. In some embodiments, the composition is administered orally or parenterally to the subject. In some embodiments, TDP-43 is reduced by at least 10%.

[0018] Some embodiments provided herein relate to a method of treating a subject suffering from a disease or condition associated with TAR DNA binding protein 43 (TDP-43) toxicity. In some embodiments, the method includes the steps of identifying a subject in need of a compound that reduces, inhibits, delays, ameliorate or prevents TDP-43 toxicity, and administering to the subject a therapeutically effective amount of a compound of formula (I), an analog, derivative or a pharmaceutically acceptable salt thereof:

[0019] [ka]

[0020] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9 and R 10 , R 10 and R 11 , or R 11 and R 12 and at least one of the fused rings of formula (I) optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, wherein any one of the carbon atoms present in any one of the fused rings of formula (I) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (I) is a compound of any one of formulas (II), (III), or (IV):

[0021] [ka]

[0022] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9, R 10 , R 11 , R 12 , R 13 and R 14are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, where any one of the carbon atoms present in any one of the fused rings of formula (II), (III), or (IV) is optionally replaced with a nitrogen atom. In some embodiments, the disease is cystic fibrosis or a neurodegenerative disease. In some embodiments, the method inhibits or delays the progression or onset of cystic fibrosis or a neurodegenerative disease. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in the elderly (HS senescence), chronic traumatic encephalopathy, or Parkinson's disease. In some embodiments, the compound of formula (I) is selected from the group consisting of ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-208, ALT-207, ALT-208, ALT-210, ALT-211, ALT- 302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403, or ALT-205. In some embodiments, the compound of formula (I) is ALT-59. In some embodiments, the composition is administered orally or parenterally to the subject. In some embodiments, the method reduces TDP-43 toxicity.

[0023] Some embodiments provided herein relate to the use of a compound of formula (I) in the manufacture of a medicament for the treatment of a disease or condition associated with TAR DNA binding protein 43 (TDP-43) toxicity in a subject, wherein the compound of formula (I) has the structure:

[0024] [ka]

[0025] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9 and R 10 , R 10 and R 11 , or R 11 and R 12 at least one of, taken together, forms an optionally substituted benzene ring, wherein the benzene ring is optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, and wherein any one of the carbon atoms present in any one of the fused rings of formula (I) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (I) has a formula of any one of the compounds of formula (II), (III), or (IV):

[0026] [ka]

[0027] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9, R 10 , R 11 , R 12 , R 13 and R 14are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, where any one of the carbon atoms present in any one of the fused rings of formula (II), (III), or (IV) is optionally replaced with a nitrogen atom. In some embodiments, the disease is cystic fibrosis or a neurodegenerative disease. In some embodiments, the medicament inhibits or delays the progression or onset of cystic fibrosis or a neurodegenerative disease. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in the elderly (HS senescence), chronic traumatic encephalopathy, or Parkinson's disease. In some embodiments, the compound of formula (I) is selected from the group consisting of ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-207, ALT-208, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of formula (I) is ALT-59.

[0028] In some embodiments, the compound of formula (I) is any one of the compounds of formula (V), (VI), (VII) or (VIII). Some embodiments provided herein relate to pharmaceutical compositions. In some embodiments, the pharmaceutical composition is for use in treating a disease or condition associated with TAR DNA binding protein 43 (TDP-43) toxicity. In some embodiments, the composition comprises a therapeutically effective amount of a compound of formula (V), an analog, derivative or a pharmaceutically acceptable salt thereof:

[0029] [ka]

[0030] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; R8 and R9, R9 and R 10 , or R 10 and R 11at least one of, taken together, forms an optionally substituted benzene ring, wherein the benzene ring is optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, and wherein any one of the carbon atoms present in any one of the fused rings of formula (V) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (V) includes ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-208, ALT-207, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of formula (V) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-202, ALT-204, ALT-208, ALT-207, ALT-210, ALT-211, ALT-302, ALT- 306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of formula (V) is a compound of any one of formulas (VI), (VII) or (VIII):

[0031] [ka]

[0032] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; 10 , R 11 , R 12 and R 13are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, wherein any one of the carbon atoms present in any one of the fused rings of formula (VI), (VII) or (VIII) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (VI) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-208, ALT-207, ALT- 210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413 or ALT-414. In some embodiments, the compound of formula (VI) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-202, ALT-204, ALT-208, ALT-207, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, or ALT-414. In some embodiments, the compound of formula (VI) is ALT-59. In some embodiments, the compound of formula (VII) is ALT-108, ALT-317, ALT-333 or ALT-403. In some embodiments, the compound of formula (VIII) is ALT-205. In some embodiments, the pharmaceutical composition is for use in the treatment of cystic fibrosis. In some embodiments, the composition inhibits the progression or onset of cystic fibrosis. In some embodiments, the pharmaceutical composition is for use in the treatment of neurodegenerative diseases. In some embodiments, the composition inhibits the progression or onset of neurodegenerative diseases. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy or Parkinson's disease.In some embodiments, the compound of formula (V) is present in an amount from 0.01 mg to 3000 mg. In some embodiments, the composition is formulated for oral or parenteral administration.

[0033] Some embodiments provided herein relate to a method of reducing or inhibiting TAR DNA binding protein 43 (TDP-43) in a subject. In some embodiments, the method includes the steps of selecting a subject in need of a compound that reduces or inhibits TDP-43, and administering to the subject a therapeutically effective amount of any one compound of Formula (V), analogs, derivatives, or pharma- ceutically acceptable salts thereof:

[0034] [ka]

[0035] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; R8 and R9, R9 and R 10 , or R 10 and R 11and at least one of: taken together to form an optionally substituted benzene ring, wherein the benzene ring is optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, and wherein any one of the carbon atoms present in any one of the fused rings of formula (V) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (V) is a compound of any one of formulas (VI), (VII), or (VIII):

[0036] [ka]

[0037] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; 10 , R 11 , R 12 and R 13are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, where any one of the carbon atoms present in any one of the fused rings of formula (VI), (VII), or (VIII) is optionally replaced with a nitrogen atom. In some embodiments, the subject is identified as having a disease or condition associated with TDP-43 toxicity. In some embodiments, the disease is cystic fibrosis or a neurodegenerative disease. In some embodiments, the method inhibits or delays the progression or onset of cystic fibrosis or a neurodegenerative disease. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in the elderly (HS senescence), chronic traumatic encephalopathy, or Parkinson's disease. In some embodiments, the compound of formula (V) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-208, ALT-207, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of formula (V) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-202, ALT-204, ALT-208, ALT-207, ALT-210, ALT-211, ALT-302, ALT- 306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of formula (V) is ALT-59. In some embodiments, the composition is administered orally or parenterally to the subject.In some embodiments, TDP-43 is reduced by at least 10%.

[0038] Some embodiments provided herein relate to a method of treating a subject suffering from a disease or condition associated with TAR DNA binding protein 43 (TDP-43) toxicity. In some embodiments, the method includes the steps of identifying a subject in need of a compound that reduces, inhibits, delays, ameliorate or prevents TDP-43 toxicity, and administering to the subject a therapeutically effective amount of a compound of formula (V), an analog, derivative or a pharmaceutically acceptable salt thereof:

[0039] [ka]

[0040] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; R8 and R9, R9 and R 10 , or R 10 and R 11and at least one of the fused rings of formula (V) optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, wherein any one of the carbon atoms present in any one of the fused rings of formula (V) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (V) is a compound of any one of formulas (VI), (VII), or (VIII):

[0041] [ka]

[0042] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; 10 , R 11 , R 12 and R 13are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, where any one of the carbon atoms present in any one of the fused rings of formula (VI), (VII), or (VIII) is optionally replaced with a nitrogen atom. In some embodiments, the disease is cystic fibrosis or a neurodegenerative disease. In some embodiments, the method inhibits or delays the progression or onset of cystic fibrosis or a neurodegenerative disease. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in the elderly (HS senescence), chronic traumatic encephalopathy, or Parkinson's disease. In some embodiments, the compound of formula (V) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-208, ALT-207, ALT-208, ALT-210, ALT-211, ALT- 302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of formula (V) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-202, ALT-204, ALT-208, ALT-207, ALT-208, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403, or ALT-205. In some embodiments, the compound of formula (V) is ALT-59. In some embodiments, the composition is administered orally or parenterally to the subject. In some embodiments, the method reduces TDP-43 toxicity.

[0043] Some embodiments provided herein relate to the use of a compound of formula (V) in the manufacture of a medicament for the treatment of a disease or condition associated with TAR DNA binding protein 43 (TDP-43) toxicity in a subject, wherein the compound of formula (V) has the structure:

[0044] [ka]

[0045] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; R8 and R9, R9 and R 10 , or R 10 and R 11 at least one of, taken together, forms an optionally substituted benzene ring, wherein the benzene ring is optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, and wherein any one of the carbon atoms present in any one of the fused rings of formula (V) is optionally replaced with a nitrogen atom. In some embodiments, the compound of formula (V) has a formula (VI), (VII), or (VIII):

[0046] [ka]

[0047] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; 10 , R 11 , R 12 and R 13are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, where any one of the carbon atoms present in any one of the fused rings of formula (VI), (VII), or (VIII) is optionally replaced with a nitrogen atom. In some embodiments, the disease is cystic fibrosis or a neurodegenerative disease. In some embodiments, the medicament inhibits or delays the progression or onset of cystic fibrosis or a neurodegenerative disease. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in the elderly (HS senescence), chronic traumatic encephalopathy, or Parkinson's disease. In some embodiments, the compound of formula (V) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-207, ALT-208, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of formula (V) is ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-202, ALT-204, ALT-207, ALT-208, ALT-210, ALT-211, ALT-302, ALT- 306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of Formula (V) is ALT-59. [Brief description of the drawings]

[0048] [Figure 1]FIG. 1 depicts a blot showing isolation of ALT-59 binding proteins. Solid-phase affinity precipitation was performed using cell lysates from PLC / PRF / 5 and MDA-MB-231 cells. Precipitated proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels and silver stained. A major band with an apparent molecular weight of 43 kDa was visualized from both samples. [Diagram 2] 1 is a table showing a list of potential ALT-59 binding proteins identified by mass spectrometry. ALT-59 precipitated protein samples were subjected to mass spectrometry for protein identification. TDP-43 (boxed) was ranked as the top hit and is likely the 43 kDa band visualized in FIG. 1. [Diagram 3] Figure 1 depicts the expression of histidine-tagged TDP-43 in Escherichia coli (E. coli) whole cell lysates. Transformant Rosetta (DE3) cells harboring pRETb / TDP43-His were either uninduced or induced with isopropyl β-D-1-thiogalactopyranoside (IPTG) alone or together with ALT-59 (30 or 60 μM) or polymyxin B nonapeptide (PMBN) or both. PMBN increases the permeability of the outer membrane of Gram-negative bacteria due to increased import of ALT-59. In the presence of PMBN, ALT-59 at a concentration of 60 μM increased the expression of TDP43-His, suggesting that ALT-59 can reduce the toxicity caused by TDP-43 expression in bacteria. However, the protein was expressed at a relatively low level and could not be purified due to the aggregation-prone nature of TDP-43. [Figure 4] Figures 4A and 4B depict the expression and purification of His-Sumo-TDP43. To increase solubility, a Sumo tag was inserted at the N-terminus of TDP-43. Figure 4A shows protein expression in whole cell lysates from two bacterial clones expressing His-Sumo-TDP43 with or without IPTG induction. Figure 4B shows eluted proteins after purification using Ni-NTA agarose. [Diagram 5] FIG. 1 depicts the inhibition of His-Sumo-TDP43 binding to TG12-biotin by ALT-59. Recombinant His-Sumo-TDP43 was incubated with TG12-biotin (TGTGTGTGTGTGTGTGTGTGTGTG-biotin (SEQ ID NO: 1)) in the presence of carrier or ALT-59. Streptavidin magnetic beads were added to disassemble the DNA-protein complexes, which were then boiled and fractionated by SDS-PAGE. Western blotting was performed to detect TDP-43 using an anti-TDP-43 antibody. [Figure 6] FIG. 1 depicts the elution of His-Sumo-TDP43 from DNA-protein complexes by ALT-59. Recombinant His-Sumo-TDP43 was incubated with TG12-biotin. Streptavidin magnetic beads were added to disassemble the DNA-protein complexes. After washing three times with binding buffer to remove unbound proteins, the DNA-protein complexes were divided into three parts, one was boiled and the other two were incubated with carrier or ALT-59. The supernatants were boiled and fractionated by SDS-PAGE. Western blotting was performed to detect TDP-43 using an anti-TDP-43 antibody. [Figure 7]Figures 7A-7C depict the changes in lysosomal-associated membrane protein 2 (LAMP2) pre-mRNA splicing after ALT-59 treatment. LAMP2 pre-mRNA contains 11 exons. Two long stretches of dinucleotide TG repeats were located in exon 9 and intron 9 (Figure 7A). Alternative splicing of LAMP2 pre-mRNA generates three isoforms, which share the same eight exons at the 5' end and are translated into proteins with different C-terminal tails. Primers located on exons 1 and 11 amplify fragments with different lengths from LAMP2A and LAMP2C mRNA (Figure 7B). Semiquantitative reverse transcription polymerase chain reaction (RT-PCR) experiments were performed using RNA samples purified from MDA-MB-231 cells treated with dimethyl sulfoxide (DMSO) or ALT-59. RT-PCR samples were separated using 1% agarose gels. Inhibition of TDP-43 by ALT-59 leads to the exclusion of exons 10 and 11, resulting in an increase in LAMP2C mRNA (Figure 7C). [Figure 8] FIG. 1 depicts the effect of ALT-59 treatment on pre-mRNA splicing of apolipoprotein A2 (ApoA2), cystic fibrosis transmembrane conductance regulator (CFTR) and polymerase delta interacting protein 3 (POLDIP3). RT-PCR experiments were performed using RNA samples purified from MDA-MB-231 cells treated with DMSO or ALT-59. TBE-PAGE gels were used to separate RT-PCR samples. Inhibition of TDP-43 by ALT-59 inhibited ApoA2 pre-mRNA splicing and CFTR exon 9 skipping, but did not alter POLDIP3 splicing. [Figure 9]9A-9D depict increased expression and glycosylation of CFTR after ALT-59 treatment. U-87MG cells were treated with DMSO, 3 μM or 6 μM ALT-59. Western blotting was performed to detect levels of CFTR using an anti-CFTR antibody. Multiple CFTR isoforms were detected. Shorter exposure (FIG. 9A, top panel) and longer exposure (FIG. 9A, bottom panel) of the same membrane showed increased signal from CFTR bands at 160 kDa, 240 kDa and 300 kDa, which are quantified in FIG. 9B, FIG. 9C and FIG. 9D, respectively. [Figure 10] FIG. 1 depicts photomicrographs showing increased CFTR localization on the plasma membrane in both MDA-MB-231 and U-87MG cells upon treatment with ALT-59. MDA-MB-231 and U-87MG cells were cultured on cover slips and treated with DMSO or 4 μM ALT-59. Cells were fixed, permeabilized, and immunostained. Images were taken using a Carl Zeiss LSM510 laser scanning microscope. Parameters were identical for all images. ALT-59 treatment caused a redistribution of CFTR from the perinuclear region to the plasma membrane. [Figure 11] FIG. 1 depicts photomicrographs showing increased CFTR localization on the plasma membrane in ALT-59-treated primary bronchial epithelial cells isolated from a cystic fibrosis patient homozygous for the ΔF508 mutation. Cells were cultured on coverslips and treated with vehicle or 4 μM ALT-59. Cells were fixed, permeabilized, and immunostained. Images were taken using a Carl Zeiss LSM510 laser scanning microscope. Parameters were identical for all images. ALT-59 treatment caused increased localization of ΔF508-CFTR on the plasma membrane. [Figure 12]FIG. 1 depicts photomicrographs showing increased CFTR localization on the plasma membrane in ALT-308 and ALT-410 treated primary bronchial epithelial cells isolated from a cystic fibrosis patient homozygous for the ΔF508 mutation. Cells were cultured on cover slips and treated with vehicle or 2 μM ALT-59. Cells were fixed, permeabilized and immunostained. Images were taken using a Carl Zeiss LSM510 laser scanning microscope. Parameters were identical for all images. ALT-59 treatment caused increased localization of CFTR on the plasma membrane. [Figure 13] FIG. 1 depicts the altered expression of proteins related to neurodegenerative diseases after ALT-59 treatment. U-87MG cells were treated with DMSO, 3 μM or 6 μM ALT-59 and subjected to Western blotting analysis. Protein expression was determined using the indicated antibodies. Beta-actin was used as an internal control to indicate equal loading of samples. The numbers under the bands indicate the relative amounts of the corresponding bands. [Figure 14] Figure 1 depicts the reduction of beta-secretase 1 (BACE1) expression upon ALT-59 treatment in T98G cells. Cells were treated with DMSO, 3 μM or 6 μM ALT-59 and subjected to Western blotting analysis. Protein expression was determined using anti-BACE1 antibody. Beta-actin was used as an internal control to indicate equal loading of samples. Numbers under the bands indicate the relative amounts of the corresponding bands. [Figure 15] FIG. 1 depicts the results from screening of ALT-59 analogs. U-87MG cells were treated with the indicated compounds at the indicated concentrations. BACE1 expression levels were used as a screening marker to indicate TDP-43 activity. [Figure 16] FIG. 1 depicts the results from screening of ALT-59 analogs. U-87MG cells were treated with the indicated compounds at the indicated concentrations. BACE1 expression levels were used as a screening marker to indicate TDP-43 activity. [Figure 17]FIG. 1 depicts the results from screening of ALT-59 analogs. U-87MG cells were treated with the indicated compounds at the indicated concentrations. BACE1 expression levels were used as a screening marker to indicate TDP-43 activity. [Figure 18] FIG. 16 depicts the chemical structures of compounds capable of inhibiting BACE1 protein expression as shown in FIG. 15. [Figure 19] FIG. 17 depicts the chemical structures of compounds capable of inhibiting BACE1 protein expression as shown in FIG. 16. [Figure 20] FIG. 18 depicts the chemical structures of compounds capable of inhibiting BACE1 protein expression as shown in FIG. 17. [Figure 21] FIG. 1 depicts photomicrographs of Caenorhabditis elegans, from left to right, wild-type C. elegans, transgenic C. elegans with human TDP-43 treated with a control, and transgenic C. elegans with human TDP-43 treated with a compound described herein. [Figure 22] FIG. 22 is a graphical depiction of the percentage of paralysis for the three C. elegans populations shown in FIG. 21 , illustrating that transgenic C. elegans carrying human TDP-43 exhibit phenotypic rescue upon treatment with compounds described herein. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0049] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, like symbols typically identify like components unless the context dictates otherwise. The illustrative embodiments described in the detailed description, drawings, and claims are not intended to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit and scope of the subject matter presented herein. It will be readily understood that aspects of the present disclosure, as generally described herein and illustrated in the figures, may be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are expressly contemplated herein. All references cited herein are expressly incorporated herein by reference in their entirety and for the specific disclosures referenced herein.

[0050] I. Disease TDP-43 preferentially binds to UG (or TG) single-stranded dinucleotide repeats via its RNA recognition motif (RRM) domain. The binding affinity increases with the number of repeats, and when there are more than eight such repeats, the equilibrium dissociation constant (Kd) is below 10 nM (Buratti and Baralle, (2001b), J Biol Chem 276, 36337-36343; Kuo et al., 2009, Nucl Acids Res 37, 1799-1808). UG / TG-rich motifs can be found in various genes involved in neurodegenerative disorders and cystic fibrosis, such as microtubule-associated protein tau (MAPT) and cystic fibrosis transmembrane conductance regulator (CFTR).

[0051] Thus, provided herein is a composition comprising a compound of formula (I), (II), (III) or (IV), an analog, derivative or pharma- ceutically acceptable salt thereof, including any of the compounds specifically disclosed herein, for use in treating a disease or condition associated with TDP-43 toxicity. Methods for treating a disease or condition associated with TDP-43 toxicity are also provided. Further embodiments relate to methods of reducing TDP-43 levels in a subject. Diseases or conditions associated with TDP-43 toxicity include, for example, cystic fibrosis and neurodegenerative diseases.

[0052] In some embodiments, the compound of formula (I) is any one of the compounds of formula (V), (VI), (VII) or (VIII). In some embodiments, provided herein is a composition comprising a compound of formula (V), (VI), (VII) or (VIII), an analog, a derivative or a pharma- ceutically acceptable salt thereof, including any of the compounds specifically disclosed herein, for use in treating a disease or condition associated with TDP-43 toxicity. Also provided is a method of treating a disease or condition associated with TDP-43 toxicity. Further embodiments relate to a method of reducing TDP-43 levels in a subject. Diseases or conditions associated with TDP-43 toxicity include, for example, cystic fibrosis and neurodegenerative diseases.

[0053] Cystic fibrosis is caused by mutations in the CFTR gene, which encodes an ABC transporter class ion channel protein that conducts chloride and thiocyanate ions across epithelial cell membranes. Mutations that affect the chloride channel function of CFTR impair epithelial fluid transport in the lungs, pancreas, and other organs, resulting in the fatal disease cystic fibrosis. CFTR mutations also contribute to a variety of other clinical conditions, such as congenital bilateral absence of the vas deferens (CBAVD) (Chillon et al., (1995), N Engl J Med 332, 1475-1480), idiopathic pancreatitis (Noone et al., 2001, Gastroenterology 121, 1310-1319), nasal polyps (Kostuch et al., 2005, Eur Arch Oto-Rhino-L 262, 982-986), bronchiectasis (Casals et al., (2004), Clin Genet 65, 490-495), and allergic bronchopulmonary aspergillosis (Miller et al., 1996, Am J Hum Genet 59, 45-51).

[0054] To function normally, CFTR must be translated as a full-length protein, correctly folded, glycosylated, and transported to the cell surface via the ER-Golgi secretory pathway. TDP-43 binds to a polymorphic TG repeat at the 3' splice site in CFTR intron 8, causing exon 9 skipping. CFTR transcripts lacking exon 9 are not processed normally and cannot conduct chloride across the cell membrane (Buratti and Baralle, (2001b), J Biol Chem 276, 36337-36343; Strong et al., 1993, Hum Mol Genet 2, 225-230). The number of consecutive thymidines immediately following the TG repeat has been correlated with exon 9 skipping. An allele with nine consecutive thymidines, designated 9T, has a shorter TG repeat (<12) and results in the highest expression of normal CFTR mRNA. 5T-TG with 5 thymidines and 12 TGs 12The 5T-TG allele exacerbates the skipping of exon 9, thereby resulting in reduced levels of functional CFTR protein. 12 The allele is found in approximately 10% of the general population and 91% of individuals with male infertility or non-classical cystic fibrosis (Groman et al., 2004, American Journal of Human Genetics 74, 176-179). Modulators capable of blocking the DNA / RNA binding activity of TDP-43 would increase the levels of functional full-length CFTR in individuals with longer TG repeats.

[0055] Abnormal accumulation of TDP-43 has been identified as a pathological hallmark of both amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). TDP-43-positive inclusions have been shown to be common in approximately 97% of ALS and approximately 50% of FTLD cases (Arai et al., 2006, Biochem Bioph Res Co 351, 602-611; Ling et al., 2013, Neuron 79, 416-438; Mackenzie et al., 2007, Ann Neurol 61, 427-434; Neumann et al., 2006, Science 314, 130-133). This pathology is also observed in other neurodegenerative diseases, such as 52% of patients with Alzheimer's disease (James et al., 2016, Brain 139, 2983-2993), 92.4% of patients with hippocampal sclerosis in the elderly (HS senescence) (Ihara et al., 2018, Ann Neurol 84, 741-753), 85% of patients with chronic traumatic encephalopathy (McKee et al., 2013, Brain 136, 43-64), and 10% of patients with Parkinson's disease (Nakashima-Yasuda et al., 2007, Acta Neuropathol 114, 221-229). TDP-43 positive individuals are 10 times more likely to be cognitively impaired at the time of death compared to TDP-43 negative individuals. Greater TDP-43 burden and more widespread TDP-43 distribution are associated with greater cognitive impairment and medial temporal lobe atrophy (Josephs et al., 2014, Acta Neuropathol 127, 811-824). Currently, there is an urgent unmet medical need to find effective treatments for neurodegenerative diseases.

[0056] TDP-43 is expressed at high levels during embryonic development, gradually decreases during postnatal development, and is maintained at low levels in adult neurons (Sephton et al., 2010, J Biol Chem 285, 38740-38740; Uchida et al., 2012, Brain 135, 833-846). High TDP-43 activity is essential for embryonic development but has been shown to be toxic to mature neurons. Overexpression of TDP-43 or TDP-43 mutants leads to neurodegenerative disease in various animal models including mice (Wils et al., 2010, PNAS 107, 3858-3863), zebrafish (Kabashi et al., 2010, Hum Mol Genet 19, 671-683), Drosophila (Li et al., 2010, PNAS 107, 3169-3174; Miguel et al., 2011, Neurobiol Dis 41, 398-406) and C. elegans (Ash et al., (2010), Hum Mol Genet 19, 3206-3218). In knock-in mice, TDP-43 mutants can be expressed under the control of the native TDP-43 promoter to avoid potential artifacts due to overexpression. White et al. (2018) showed that disease-causing mutant TDP-43 Q331K showed that the introduction of TDP-43 led to gain-of-function and cognitive dysfunction as well as a deficit in parvalbumin interneurons. M323K or TDP-43 Q331K Knock-in mice harboring TDP-43 also exhibited gain-of-function splicing activity and neuromuscular and neurodegenerative phenotypes. The F210I mutation in the RNA recognition motif 2 (RRM2) domain reduces the RNA / DNA binding ability of TDP-43 and does not cause any motor phenotype in knock-in mice. Importantly, the F210I mutation is a novel inhibitor of compound heterozygous TDP-43 M323K / TDP-43 F331IIt can partially rescue the toxicity caused by the M323K mutation in mice (Fratta et al., (2018), EMBO J 37; White et al., 2018, Nature Neuroscience 21, 1138-1138). These studies conclusively demonstrated that TDP-43 neurotoxicity is caused by a gain-of-function mechanism.

[0057] Thus, provided herein are compounds capable of disrupting or reducing the RNA / DNA binding activity of TDP-43 for the treatment of diseases caused by TDP-43 overexpression or mutation.

[0058] In some embodiments, the neurodegenerative disease is Alzheimer's disease, frontotemporal dementia, FTLD-U (frontotemporal dementia caused by a mutation in the progranulin protein), amyotrophic lateral sclerosis (ALS), Huntington's disease, Creutzfeldt-Jacob disease, triplet repeat disease, brain degenerative disease presenile dementia, senile dementia, parkinsonism linked to chromosome 17 (FTDP-17), The present invention is directed to a method for treating autism, comprising administering to a patient a therapeutically effective amount of a therapeutic agent selected from the group consisting of progressive supranuclear palsy (PSP), Huntington's disease (HD), Pick's disease, primary progressive aphasia, corticobasal dementia, Parkinson's disease, Parkinson's disease with dementia, dementia with Lewy bodies, Down's syndrome, multiple system atrophy, spinal muscular atrophy (SMA), spinocerebellar degeneration, spinal degenerative disease / motor neuron degenerative disease, Hallervorden-Spatz syndrome, cerebral infarction, cerebral trauma, chronic traumatic encephalopathy, transient ischemic attack, and any combination thereof.

[0059] II. Pharmaceutical Compositions of Compounds of Formulae (I) to (VIII) Embodiments provided herein relate to compounds for use in the treatment of diseases or conditions associated with TDP-43 toxicity, such as cystic fibrosis or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease, and methods of using them to treat diseases or conditions associated with TDP-43 toxicity.

[0060] As used herein, the terms "treating," "treatment," "therapeutic," or "therapy" have their ordinary meaning as understood in light of the present specification and do not necessarily imply a total cure or eradication of a disease or condition.

[0061] As used herein, the term "inhibit" has its ordinary meaning as understood in light of the present specification and refers to the delay or prevention of a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis or neurodegeneration. As used herein, the term "delay" has its ordinary meaning as understood in light of the present specification and refers to the slowing, postponement, or deferral of an event, such as the delay of a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis or neurodegeneration, to a later time than would otherwise be expected. The delay can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or an amount within a range defined by any two of the foregoing values. The terms inhibit and delay should not be construed as necessarily indicating 100% inhibition or delay. Partial inhibition or delay can be achieved.

[0062] The term "therapeutically effective amount" has its ordinary meaning as understood in light of this specification and is used to refer to the amount of an active compound or pharmaceutical agent that elicits the indicated biological or pharmaceutical response. For example, a therapeutically effective amount of a compound may be the amount required to prevent, alleviate or ameliorate the symptoms of a disease or to prolong the survival of a subject receiving therapy. This response may occur in a tissue, system, animal or human and includes alleviating the signs or symptoms of the disease being treated. Determination of a therapeutically effective amount is within the capabilities of one of ordinary skill in the art in light of the disclosure provided herein. The therapeutically effective amount of the compounds disclosed herein required as a dose will depend on the route of administration, the type of animal being treated, including humans, and the physical characteristics of the specific animal under consideration. Dosage can be tailored to achieve the desired effect, but will depend on factors such as body weight, dietary habits, concomitant medications, and other factors that would be recognized by a person skilled in the medical arts.

[0063] As used herein, the term "derivative" has its ordinary meaning as understood in light of the present specification and refers to chemically modified compounds where the modifications are considered routine by a chemist of ordinary skill, such as esters or amides of acids, or protecting groups such as benzyl groups for alcohols or thiols, or tert-butoxycarbonyl groups for amines.

[0064] As used herein, the term "analog" has its ordinary meaning as understood in light of the present specification and refers to compounds that include chemically modified forms of a specific compound or class per se and that retain the pharmaceutical and / or pharmacological activity characteristic of said compound or class.

[0065] As used herein, R, R, R, R, R, R, R 6、 R7, R8, R9, R 10 , R 11 , R 12 , R 13 and R 14Any "R" group, such as, represents a substituent that may be attached to the indicated atom. The R group may be substituted or unsubstituted.

[0066] Whenever a group is described as "optionally substituted," the group may be unsubstituted or substituted with one or more of the indicated substituents. Similarly, when a group is described as "unsubstituted or substituted," if substituted, the substituents may be selected from one or more of the indicated substituents. If no substituents are specified, the indicated "optionally substituted" or "substituted" group may be any of the following: alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicyclyl, aralkyl, heteroaralkyl, (heteroalicyclyl)alkyl, hydroxy, protected hydroxyl, alkoxy, aryloxy, acyl, mercapto, alkylthio, arylthio, cyano, halogen, thiocarbonyl, O-carbamyl, N-carbam ... This means that the amino group may be substituted with one or more groups individually and independently selected from -thiocarbamyl, N-thiocarbamyl, C-amido, N-amido, S-sulfonamido, N-sulfonamido, C-carboxy, protected C-carboxy, O-carboxy, isocyanato, thiocyanato, isothiocyanato, nitro, silyl, sulfenyl, sulfinyl, sulfonyl, haloalkyl, haloalkoxy, trihalomethanesulfonyl, trihalomethanesulfonamido, amino, mono-substituted amino and di-substituted amino groups, and protected derivatives thereof.

[0067] The term "alkyl," as used herein, has its ordinary meaning as understood in light of the present specification and refers to a fully saturated group, consisting only of carbon and hydrogen, having from 1 to about 25 carbon atoms. The term "lower alkyl" refers to an alkyl group having from 1 to about 6 carbon atoms, for example, methyl, ethyl, propyl, isopropyl, butyl, 3-methylpentyl, hexyl, and the like.

[0068] The term "lower alkoxy" has its ordinary meaning as understood in light of the present specification and refers to a group of the form RO-, where R is a lower alkyl. Suitable examples of lower alkoxy include, but are not limited to, methoxy, ethoxy, propyloxy, 2-propyloxy, butoxy, t-butoxy, hexyloxy, and the like. Similarly, "lower alkylthio" refers to a group of the form RS-, where R is a lower alkyl. "Lower alkylenedioxy" refers to a diradical of the form -O-R'-O-, where R' is a lower alkyl diradical. Exemplary alkylenedioxy moieties include, but are not limited to, methylenedioxy, 1,2-ethylenedioxy, 2,2-propylenedioxy, and the like.

[0069] The term "aryl" has its ordinary meaning as understood in light of this specification and refers to phenyl or naphthyl. "Aralkyl" refers to a moiety of the form Ar-R'-, where Ar is aryl and R' is a lower alkylene. Exemplary aralkyl groups include, but are not limited to, benzyl, phenethyl, 4-phenylhexyl, 2-naphthylmethyl, 1-naphthylethyl, and the like.

[0070] "Heterocyclic ring", as used herein, has its ordinary meaning as understood in light of the present specification and refers to a closed loop of 3 to 7 atoms containing carbon and at least one atom of O, N, S and / or P. Heterocyclic rings may be saturated or unsaturated. Exemplary heterocyclic rings include, but are not limited to, piperidine, furan, tetrahydro-furan, pyrrole, triazole, pyran, tetrahydropyran, thiazole, dioxine, 2,2-dimethyl-1,3-dioxolane, and the like. Heterocyclic rings in the context of this invention are defined as any of the following ring systems: R9, R 10 , R 11 , R 12 , R 13 and R 14 This can be condensed with a phenyl ring bearing a phenyl group, thereby forming ring systems such as benzimidazole, benzofuran, etc.

[0071] The term "halo," as used herein, has its ordinary meaning as understood in light of the specification and refers to fluoro, chloro, bromo, and iodo.

[0072] The term "pharmacologically acceptable" has its ordinary meaning as understood in light of this specification and refers to compounds and derivatives that are not unacceptably toxic to the organism or tissue being treated.

[0073] The term "salt" has its ordinary meaning as understood in light of the present specification and refers to a derivative of a compound of the present invention derived by simple addition of an acid to a basic compound of the present invention or addition of a base to an acidic compound of the present invention. For example, a compound of the present invention can form an acid addition salt such as hydrochloride, hydrobromide, acetate, tartrate, citrate, malonate, phosphate, nitrate, sulfate, mesylate, etc. The term "ester" has its ordinary meaning as understood in light of the present specification and refers to a derivative of a compound of the present invention derived by condensing a compound of the present invention having a free -OH group with a carboxylic acid. Exemplary esters include acetate, propionate, citrate, etc. The term "amide" has its ordinary meaning as understood in light of the present specification and refers to a derivative of a compound of the present invention derived by condensing a compound of the present invention having a free -NH group with a carboxylic acid. Exemplary acids include acetate, propionate, citric acid, malonate, etc.

[0074] In some embodiments, the compound for use in treating a disease or condition associated with TDP-43 toxicity comprises a compound of formula (I) or a pharma- ceutically acceptable salt thereof, wherein the compound of formula (I) or a pharma- ceutically acceptable salt thereof is

[0075] [ka]

[0076] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; R8 and R9, R9 and R 10 , or R 10 and R 11 at least one of, taken together, forms an optionally substituted benzene ring, wherein the benzene ring is optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, and wherein any one of the carbon atoms present in any one of the fused rings of formula (I) is optionally replaced with a nitrogen atom.

[0077] In some embodiments, the compound of formula (I) is any one of the compounds of formula (II), (III) or (IV). In some embodiments, the compound of formula (I) is any one of the compounds of formula (II), (III) or (IV). In some embodiments, the compound of formula (I) is any one of the compounds of formula (II), (III) or (IV), as further described in any of the embodiments herein, such as ALT-59, ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-110, ALT-201, ALT-202, ALT-204, ALT-207, ALT-208, ALT-210, ALT-211, ALT-302, ALT-408, ALT-411, ALT-110, ALT-201, ALT-202, ALT-404, ALT-207, ALT-208, ALT-210, ALT-211, ALT-302, ALT-408, ALT-41 ... Any one of the compounds described herein, including any one of LT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205.

[0078] In some embodiments, the compound for use in treating a disease or condition associated with TDP-43 toxicity comprises a compound of formula (II) or a pharma- ceutically acceptable salt thereof, wherein the compound of formula (II) or a pharma- ceutically acceptable salt thereof is

[0079] [ka]

[0080] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9, R 10 , R 11 , R 12 , R 13 and R 14 are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, wherein any one of the carbon atoms present in any one of the fused rings of formula (II) is optionally replaced with a nitrogen atom.

[0081] Some embodiments relate to analogs or derivatives of the compound of formula (II), where the compound of formula (II), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof, are used in the treatment of diseases or conditions associated with TDP-43 toxicity, including, for example, cystic fibrosis and neurodegenerative diseases. Examples of derivatives or analogs of the compound of formula (II) include the following compounds: ALT-59, which has the chemical name 5-(3-bromo-4-(dimethylamino)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0082] [ka]

[0083] ALT-212, which has the chemical name 2,2-dimethyl-5-(4-(trifluoromethyl)phenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0084] [ka]

[0085] ALT-215, which has the chemical name 2,2-dimethyl-5-(3-(trifluoromethyl)phenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0086] [ka]

[0087] ALT-308, which has the chemical name 5-(4-(tert-butyl)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0088] [ka]

[0089] ALT-309, which has the chemical name 5-(4-isopropylphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0090] [ka]

[0091] ALT-408, which has the chemical name phenyl 2-methoxy-4-(4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)butyrate, or a pharma- ceutically acceptable salt thereof:

[0092] [ka]

[0093] ALT-411, which has the chemical name methyl 2-(4-(4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)phenoxy)acetate, or a pharma- ceutically acceptable salt thereof:

[0094] [ka]

[0095] ALT-110, which has the chemical name 2,2-dimethyl-5-(3-(1,1,2,2-tetrafluoroethoxy)phenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0096] [ka]

[0097] ALT-201, which has the chemical name 5-(benzo[d][1,3]dioxol-5-yl)-3,3-dimethyl-3,4,5,6-tetrahydrobenzo[a]phenanthridin-1(2H)-one, or a pharma- ceutically acceptable salt thereof:

[0098] [ka]

[0099] ALT-202, which has the chemical name 5-(5-bromothiophen-2-yl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0100] [ka]

[0101] ALT-204, which has the chemical name 5-(3,4-dichlorophenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0102] [ka]

[0103] ALT-207, which has the chemical name 5-(4-ethoxy-3-methoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0104] [ka]

[0105] ALT-208, which has the chemical name 5-(3-bromo-4,5-dimethoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0106] [ka]

[0107] ALT-210, which has the chemical name 5-(3-((6-chlorobenzo[d][1,3]dioxol-5-yl)methoxy)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0108] [ka]

[0109] ALT-211, which has the chemical name 5-(7-methoxybenzo[d][1,3]dioxol-5-yl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0110] [ka]

[0111] ALT-302, which has the chemical name 5-(4-methoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0112] [ka]

[0113] ALT-306, which has the chemical name 2,2-dimethyl-5-(p-tolyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0114] [ka]

[0115] ALT-307, which has the chemical name 5-(3-bromo-4-methoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0116] [ka]

[0117] ALT-311, which has the chemical name 2,2-dimethyl-5-(4-(methylthio)phenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0118] [ka]

[0119] ALT-318, which has the chemical name 5-(4-(diethylamino)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0120] [ka]

[0121] ALT-322, which has the chemical name 2,2-dimethyl-5-(4-(4-methylpiperidin-1-yl)-3-nitrophenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0122] [ka]

[0123] ALT-324, which has the chemical name 2,2-dimethyl-5-(4-((1-methyl-1H-imidazol-2-yl)thio)-3-nitrophenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0124] [ka]

[0125] ALT-402, which has the chemical name 5-(3-iodo-5-methoxy-4-(prop-2-yn-1-yloxy)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0126] [ka]

[0127] ALT-404, which has the chemical name 8-(4-(diethylamino)phenyl)-11,11-dimethyl-8,10,11,12-tetrahydrobenzo[a][4,7]phenanthrolin-9(7H)-one, or a pharma- ceutically acceptable salt thereof:

[0128] [ka]

[0129] ALT-406, which has the chemical name ethyl 2-(2-chloro-6-methoxy-4-(4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)phenoxy)acetate, or a pharma- ceutically acceptable salt thereof:

[0130] [ka]

[0131] ALT-409, which has the chemical name 5-(4-(allyloxy)-3-methoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0132] [ka]

[0133] ALT-410, which has the chemical name 5-(4-propoxyphenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0134] [ka]

[0135] ALT-413, which has the chemical name 2-(4-(2,2-dimethyl-4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)-2-methoxyphenoxy)acetic acid, or a pharma- ceutically acceptable salt thereof:

[0136] [ka]

[0137] ALT-414, which has the chemical name 2-(4-(2,2-dimethyl-4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)-2-methoxyphenoxy)acetic acid, or a pharma- ceutically acceptable salt thereof:

[0138] [ka]

[0139] Includes.

[0140] In some embodiments, herein ALT-59, ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-110, ALT-201, ALT-202, ALT-204, ALT -207, ALT-208, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406 The compounds of formula (II), including analogs, derivatives, or pharma- ceutically acceptable salts thereof, such as the compounds designated ALT-409, ALT-410, ALT-413, or ALT-414, are formulated as pharmaceutical compositions for use in the treatment of diseases or conditions associated with TDP-43 toxicity, such as cystic fibrosis, or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease. In some embodiments, the pharmaceutical compositions comprising the compounds of formula (II), or analogs, derivatives, or pharma- ceutically acceptable salts thereof, inhibit, delay, treat, prevent, or ameliorate diseases or conditions associated with TDP-43 toxicity.

[0141] In some embodiments, the compound for use in treating a disease or condition associated with TDP-43 toxicity comprises a compound of formula (III) or a pharma- ceutically acceptable salt thereof, wherein the compound of formula (III) or a pharma- ceutically acceptable salt thereof is

[0142] [ka]

[0143] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9, R 10 , R 11 , R 12 , R 13 and R 14 are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, wherein any one of the carbon atoms present in any one of the fused rings of formula (III) is optionally replaced with a nitrogen atom.

[0144] Some embodiments relate to analogs or derivatives of the compound of formula (III), where the compound of formula (III), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof, are used in the treatment of diseases or conditions associated with TDP-43 toxicity, including, for example, cystic fibrosis and neurodegenerative diseases. Examples of derivatives or analogs of the compound of formula (III) include the following compounds: ALT-108, which has the chemical name 6-(3-bromo-4-methoxyphenyl)-6,8,9,10-tetrahydrobenzo[c]phenanthridin-7(5H)-one, or a pharma- ceutically acceptable salt thereof:

[0145] [ka]

[0146] ALT-317, which has the chemical name 6-(3,4-dihydroxyphenyl)-6,8,9,10-tetrahydrobenzo[c]phenanthridin-7(5H)-one, or a pharma- ceutically acceptable salt thereof:

[0147] [ka]

[0148] ALT-333, which has the chemical name 9,9-dimethyl-6-(p-tolyl)-6,8,9,10-tetrahydrobenzo[c]phenanthridin-7(5H)-one, or a pharma- ceutically acceptable salt thereof:

[0149] [ka]

[0150] ALT-403, which has the chemical name 6-(benzo[d][1,3]dioxol-5-yl)-6,8,9,10-tetrahydrobenzo[c][1,7]phenanthrolin-7(5H)-one, or a pharma- ceutically acceptable salt thereof:

[0151] [ka]

[0152] Includes.

[0153] In some embodiments, the compound of formula (III), including analogs, derivatives, or pharma- ceutically acceptable salts thereof, such as those referred to herein as ALT-108, ALT-317, ALT-333, or ALT-403, is formulated as a pharmaceutical composition for use in treating a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis, or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease. In some embodiments, the pharmaceutical composition comprising the compound of formula (III), or an analog, derivative, or pharma- ceutically acceptable salt thereof, inhibits, delays, treats, prevents, or ameliorates a disease or condition associated with TDP-43 toxicity.

[0154] In some embodiments, the compound for use in treating a disease or condition associated with TDP-43 toxicity comprises a compound of formula (IV) or a pharma- ceutically acceptable salt thereof, wherein the compound of formula (IV) or a pharma- ceutically acceptable salt thereof is

[0155] [ka]

[0156] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; and R3 and R8 are each independently H, lower alkyl, =O, =S, OH, NH2, aryl or aralkyl. wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, wherein the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R9, R 10 , R 11 , R 12 , R 13 and R 14 are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, wherein any one of the carbon atoms present in any one of the fused rings of formula (IV) is optionally replaced with a nitrogen atom.

[0157] Some embodiments relate to analogs or derivatives of the compound of formula (IV), where the compound of formula (IV), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof, are used in the treatment of diseases or conditions associated with TDP-43 toxicity, including, for example, cystic fibrosis and neurodegenerative diseases. An example of a derivative or analog of the compound of formula (IV) is the following compound: ALT-205, which has the chemical name 5-(benzo[d][1,3]dioxol-5-yl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[b]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0158] [ka]

[0159] Includes.

[0160] In some embodiments, the compound of formula (IV), including its analogs, derivatives, or pharma- ceutically acceptable salts, such as the compound referred to herein as ALT-205, is formulated as a pharmaceutical composition for use in the treatment of a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis, or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease. In some embodiments, the pharmaceutical composition comprising the compound of formula (IV), or its analogs, derivatives, or pharma- ceutically acceptable salts, inhibits, delays, treats, prevents, or ameliorates a disease or condition associated with TDP-43 toxicity.

[0161] In some embodiments, the compound of any one of formulas (I), (II), (III) or (IV), or an analog, derivative or pharma- ceutically acceptable salt thereof, includes compounds as disclosed in any one of U.S. Patent No. 6,800,634 or U.S. Patent Application Publication No. 2012 / 0220610 or U.S. Patent Application Publication No. 2017 / 0362221, each of which is expressly incorporated herein by reference in its entirety and for the specific disclosures referenced herein. Thus, the compounds provided herein include any of the compounds described herein, any of the compounds of formulas (I), (II), (III) and (IV) described herein, and any of the compounds described and disclosed in each of these references.

[0162] In some embodiments, the compound of any one of formulas (I), (II), (III) or (IV), including any of the compounds specifically disclosed herein, or analogs, derivatives or pharma- ceutically acceptable salts thereof, is prepared with a pharma- ceutically acceptable carrier that facilitates the incorporation of the compound into a product formulation and / or the delivery of the compound of any one of formulas (I), (II), (III) or (IV), including any of the compounds specifically disclosed herein, or analogs, derivatives or pharma- ceutically acceptable salts thereof to cells or tissues for treatment. In some embodiments, the pharmaceutical composition comprising the compound of any one of formulas (I), (II), (III) or (IV), including any of the compounds specifically disclosed herein, may comprise the compound of any one of formulas (I), (II), (III) or (IV), at least one pharma- ceutically acceptable carrier, and / or at least one additive. In some embodiments, the at least one additive may be a binder, a disintegrant, a surfactant, or a stabilizer.

[0163] In some embodiments, the compound of formula (I) is any one of the compounds of formula (V), (VI), (VII) or (VIII). In some embodiments, the compound for use in treating a disease or condition associated with TDP-43 toxicity comprises a compound of formula (V) or a pharma- ceutically acceptable salt thereof, wherein the compound of formula (V) or a pharma- ceutically acceptable salt thereof is

[0164] [ka]

[0165] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; R8 and R9, R9 and R 10 , or R 10 and R 11 at least one of, taken together, forms an optionally substituted benzene ring, wherein the benzene ring is optionally substituted with H, halo, lower alkyl, OH, lower alkoxy, or NO2, and wherein any one of the carbon atoms present in any one of the fused rings of formula (V) is optionally replaced with a nitrogen atom. In some embodiments, the oxygen at the ketone position of formula (V) is replaced by a sulfur to form a thioketone.

[0166] In some embodiments, the compound of formula (V) is any one of the compounds of formula (VI), (VII) or (VIII). In some embodiments, the compound of formula (V) is any one of the compounds of formula (VI), (VII) or (VIII). In some embodiments, the compound of formula (V) is any one of the compounds of formula (VI), (VII) or (VIII), as further described in any of the embodiments herein, such as ALT-59, ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-110, ALT-201, ALT-202, ALT-204, ALT-207, ALT-208, ALT-210, ALT-211, ALT-3 ... Any one of the compounds described herein, including any one of LT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205. In some embodiments, the compound of formula (V) is selected from the group consisting of ALT-59, ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-110, ALT-202, ALT-204, ALT-207, ALT-208, ALT-210, ALT-211, ALT-302, ALT-3 06, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, ALT-414, ALT-108, ALT-317, ALT-333, ALT-403 or ALT-205.

[0167] In some embodiments, the compound for use in treating a disease or condition associated with TDP-43 toxicity comprises a compound of formula (VI) or a pharma- ceutically acceptable salt thereof, wherein the compound of formula (VI) or a pharma- ceutically acceptable salt thereof is

[0168] [ka]

[0169] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; 10 , R 11 , R 12 and R 13 are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, where any one of the carbon atoms present in any one of the fused rings of formula (VI) is optionally replaced with a nitrogen atom. In some embodiments, the oxygen at the ketone position of formula (VI) is replaced with a sulfur to form a thioketone.

[0170] Some embodiments relate to analogs or derivatives of the compound of formula (VI), where the compound of formula (VI), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof, are used in the treatment of diseases or conditions associated with TDP-43 toxicity, including, for example, cystic fibrosis and neurodegenerative diseases. Examples of derivatives or analogs of the compound of formula (VI) include the following compounds: ALT-59, which has the chemical name 5-(3-bromo-4-(dimethylamino)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0171] [ka]

[0172] ALT-212, which has the chemical name 2,2-dimethyl-5-(4-(trifluoromethyl)phenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0173] [ka]

[0174] ALT-215, which has the chemical name 2,2-dimethyl-5-(3-(trifluoromethyl)phenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0175] [ka]

[0176] ALT-308, which has the chemical name 5-(4-(tert-butyl)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0177] [ka]

[0178] ALT-309, which has the chemical name 5-(4-isopropylphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0179] [ka]

[0180] ALT-408, which has the chemical name phenyl 2-methoxy-4-(4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)butyrate, or a pharma- ceutically acceptable salt thereof:

[0181] [ka]

[0182] ALT-411, which has the chemical name methyl 2-(4-(4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)phenoxy)acetate, or a pharma- ceutically acceptable salt thereof:

[0183] [ka]

[0184] ALT-110, which has the chemical name 2,2-dimethyl-5-(3-(1,1,2,2-tetrafluoroethoxy)phenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0185] [ka]

[0186] ALT-202, which has the chemical name 5-(5-bromothiophen-2-yl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0187] [ka]

[0188] ALT-204, which has the chemical name 5-(3,4-dichlorophenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0189] [ka]

[0190] ALT-207, which has the chemical name 5-(4-ethoxy-3-methoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0191] [ka]

[0192] ALT-208, which has the chemical name 5-(3-bromo-4,5-dimethoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0193] [ka]

[0194] ALT-210, which has the chemical name 5-(3-((6-chlorobenzo[d][1,3]dioxol-5-yl)methoxy)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0195] [ka]

[0196] ALT-211, which has the chemical name 5-(7-methoxybenzo[d][1,3]dioxol-5-yl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0197] [ka]

[0198] ALT-302, which has the chemical name 5-(4-methoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0199] [ka]

[0200] ALT-306, which has the chemical name 2,2-dimethyl-5-(p-tolyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0201] [ka]

[0202] ALT-307, which has the chemical name 5-(3-bromo-4-methoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0203] [ka]

[0204] ALT-311, which has the chemical name 2,2-dimethyl-5-(4-(methylthio)phenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0205] [ka]

[0206] ALT-318, which has the chemical name 5-(4-(diethylamino)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0207] [ka]

[0208] ALT-322, which has the chemical name 2,2-dimethyl-5-(4-(4-methylpiperidin-1-yl)-3-nitrophenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0209] [ka]

[0210] ALT-324, which has the chemical name 2,2-dimethyl-5-(4-((1-methyl-1H-imidazol-2-yl)thio)-3-nitrophenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0211] [ka]

[0212] ALT-402, which has the chemical name 5-(3-iodo-5-methoxy-4-(prop-2-yn-1-yloxy)phenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0213] [ka]

[0214] ALT-404, which has the chemical name 8-(4-(diethylamino)phenyl)-11,11-dimethyl-8,10,11,12-tetrahydrobenzo[a][4,7]phenanthrolin-9(7H)-one, or a pharma- ceutically acceptable salt thereof:

[0215] [ka]

[0216] ALT-406, which has the chemical name ethyl 2-(2-chloro-6-methoxy-4-(4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)phenoxy)acetate, or a pharma- ceutically acceptable salt thereof:

[0217] [ka]

[0218] ALT-409, which has the chemical name 5-(4-(allyloxy)-3-methoxyphenyl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0219] [ka]

[0220] ALT-410, which has the chemical name 5-(4-propoxyphenyl)-2,3,5,6-tetrahydrobenzo[a]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0221] [ka]

[0222] ALT-413, which has the chemical name 2-(4-(2,2-dimethyl-4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)-2-methoxyphenoxy)acetic acid, or a pharma- ceutically acceptable salt thereof:

[0223] [ka]

[0224] ALT-414, which has the chemical name 2-(4-(2,2-dimethyl-4-oxo-1,2,3,4,5,6-hexahydrobenzo[a]phenanthridine-5-yl)-2-methoxyphenoxy)acetic acid, or a pharma- ceutically acceptable salt thereof:

[0225] [ka]

[0226] Includes.

[0227] In some embodiments, herein ALT-59, ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-110, ALT-201, ALT-202, ALT-204, ALT -207, ALT-208, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406 The compounds of formula (VI), including analogs, derivatives or pharma- ceutically acceptable salts thereof, such as the compounds designated ALT-409, ALT-410, ALT-413 or ALT-414, have been formulated as pharmaceutical compositions for use in the treatment of diseases or conditions associated with TDP-43 toxicity, such as cystic fibrosis, or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease. In some embodiments, herein ALT-59, ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-110, ALT-202, ALT-204, ALT-207, A LT-208, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT The compounds of formula (VI), including analogs, derivatives, or pharma- ceutically acceptable salts thereof, such as those designated ALT-409, ALT-410, ALT-413, or ALT-414, are formulated as pharmaceutical compositions for use in the treatment of diseases or conditions associated with TDP-43 toxicity, such as cystic fibrosis, or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease. In some embodiments, the pharmaceutical compositions comprising the compounds of formula (VI), or analogs, derivatives, or pharma- ceutically acceptable salts thereof, inhibit, delay, treat, prevent, or ameliorate diseases or conditions associated with TDP-43 toxicity.

[0228] In some embodiments, the compound for use in treating a disease or condition associated with TDP-43 toxicity comprises a compound of formula (VII) or a pharma- ceutically acceptable salt thereof, wherein the compound of formula (VII) or a pharma- ceutically acceptable salt thereof is

[0229] [ka]

[0230] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; 10 , R 11 , R 12 and R 13 are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, where any one of the carbon atoms in any one of the fused rings of formula (VII) is optionally replaced with a nitrogen atom. In some embodiments, the oxygen in the ketone position of formula (VII) is replaced with a sulfur to form a thioketone.

[0231] Some embodiments relate to analogs or derivatives of the compound of formula (VII), where the compound of formula (VII), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof, are used in the treatment of diseases or conditions associated with TDP-43 toxicity, including, for example, cystic fibrosis and neurodegenerative diseases. Examples of derivatives or analogs of the compound of formula (VII) include the following compounds: ALT-108, which has the chemical name 6-(3-bromo-4-methoxyphenyl)-6,8,9,10-tetrahydrobenzo[c]phenanthridin-7(5H)-one, or a pharma- ceutically acceptable salt thereof:

[0232] [ka]

[0233] ALT-317, which has the chemical name 6-(3,4-dihydroxyphenyl)-6,8,9,10-tetrahydrobenzo[c]phenanthridin-7(5H)-one, or a pharma- ceutically acceptable salt thereof:

[0234] [ka]

[0235] ALT-333, which has the chemical name 9,9-dimethyl-6-(p-tolyl)-6,8,9,10-tetrahydrobenzo[c]phenanthridin-7(5H)-one, or a pharma- ceutically acceptable salt thereof:

[0236] [ka]

[0237] ALT-403, which has the chemical name 6-(benzo[d][1,3]dioxol-5-yl)-6,8,9,10-tetrahydrobenzo[c][1,7]phenanthrolin-7(5H)-one, or a pharma- ceutically acceptable salt thereof:

[0238] [ka]

[0239] Includes.

[0240] In some embodiments, the compound of formula (VII), including analogs, derivatives, or pharma- ceutically acceptable salts thereof, such as those referred to herein as ALT-108, ALT-317, ALT-333, or ALT-403, is formulated as a pharmaceutical composition for use in the treatment of a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis, or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease. In some embodiments, the pharmaceutical composition comprising the compound of formula (VII), or an analog, derivative, or pharma- ceutically acceptable salt thereof, inhibits, delays, treats, prevents, or ameliorates a disease or condition associated with TDP-43 toxicity.

[0241] In some embodiments, the compound for use in treating a disease or condition associated with TDP-43 toxicity comprises a compound of formula (VIII) or a pharma- ceutically acceptable salt thereof, wherein the compound of formula (VIII) or a pharma- ceutically acceptable salt thereof is

[0242] [ka]

[0243] wherein R1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons, where the aromatic ring is carbocyclic or heterocyclic, each position on the aromatic ring is independently H, halo, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6 and R7 are each independently H, lower alkyl, OH, NH2, aryl or aralkyl, where the aryl and aralkyl are substituted with 0-3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio and lower alkylamino; 10 , R 11 , R 12 and R 13 are each independently H, halo, lower alkyl, OH, lower alkoxy, or NO2, where any one of the carbon atoms present in any one of the fused rings of formula (VIII) is optionally replaced with a nitrogen atom. In some embodiments, the oxygen at the ketone position of formula (VIII) is replaced with a sulfur to form a thioketone.

[0244] Some embodiments relate to analogs or derivatives of the compound of formula (VIII), where the compound of formula (VIII), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof, are used in the treatment of diseases or conditions associated with TDP-43 toxicity, including, for example, cystic fibrosis and neurodegenerative diseases. Examples of derivatives or analogs of the compound of formula (VIII) include the following compounds: ALT-205, which has the chemical name 5-(benzo[d][1,3]dioxol-5-yl)-2,2-dimethyl-2,3,5,6-tetrahydrobenzo[b]phenanthridin-4(1H)-one, or a pharma- ceutically acceptable salt thereof:

[0245] [ka]

[0246] Includes.

[0247] In some embodiments, the compound of formula (VIII), including its analogs, derivatives, or pharma- ceutically acceptable salts, such as the compound referred to herein as ALT-205, is formulated as a pharmaceutical composition for use in the treatment of a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis, or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease. In some embodiments, the pharmaceutical composition comprising the compound of formula (VIII), or its analogs, derivatives, or pharma- ceutically acceptable salts, inhibits, delays, treats, prevents, or ameliorates a disease or condition associated with TDP-43 toxicity.

[0248] In some embodiments, the compound of any one of formulas (V), (VI), (VII) or (VIII), or an analog, derivative or pharma- ceutically acceptable salt thereof, includes compounds as disclosed in any one of U.S. Patent No. 6,800,634 or U.S. Patent Application Publication No. 2012 / 0220610 or U.S. Patent Application Publication No. 2017 / 0362221, each of which is expressly incorporated herein by reference in its entirety and for the specific disclosures referenced herein. Thus, the compounds provided herein include any of the compounds described herein, any of the compounds of formulas (V), (VI), (VII) and (VIII) described herein, and any of the compounds described and disclosed in each of these references.

[0249] In some embodiments, the compound of any one of formulas (V), (VI), (VII) or (VIII), including any of the compounds specifically disclosed herein, or analogs, derivatives or pharma- ceutically acceptable salts thereof, is prepared with a pharma- ceutically acceptable carrier that facilitates the incorporation of the compound into a product formulation and / or the delivery of the compound of any one of formulas (V), (VI), (VII) or (VIII), including any of the compounds specifically disclosed herein, or analogs, derivatives or pharma- ceutically acceptable salts thereof, to cells or tissues for treatment. In some embodiments, the pharmaceutical composition comprising the compound of any one of formulas (V), (VI), (VII) or (VIII), including any of the compounds specifically disclosed herein, may comprise at least one compound of formula (V), (VI), (VII) or (VIII), at least one pharma- ceutically acceptable carrier, and / or at least one additive. In some embodiments, the at least one additive may be a binder, a disintegrant, a surfactant, or a stabilizer.

[0250] The pharmaceutical compositions described herein may be formulated for oral, intranasal or parenteral administration. Oral administration may include formulation of the composition for oral administration, including administration to the digestive tract, buccal lining or respiratory tract via the oral cavity, for example, formulation of the composition as a solid or liquid formulation, such as a tablet, pill, capsule, pellet, dragee, gum, powder, soft gel, liquid, syrup, suspension, solution or inhalable composition. Intranasal administration may include formulation for administration via the nasal cavity, and may include drops, sprays, insufflation or inhalable compositions. Parenteral administration may include, for example, intraperitoneal, infusion, intramuscular, subcutaneous, intradermal or intravenous injection.

[0251] In some embodiments, the compositions described herein further comprise pharma- ceutically acceptable carriers and excipients depending on the desired delivery or administration mode format.

[0252] III. Method of Treatment Some embodiments relate to a method of treating, ameliorating, inhibiting, preventing or delaying a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy and Parkinson's disease. In some embodiments, the method comprises administering to a subject in need thereof a compound of any one of formulas (I), (II), (III) or (IV), including any of the compounds specifically disclosed herein, analogs, derivatives or pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising a compound of any one of formulas (I), (II), (III) or (IV), including any of the compounds specifically disclosed herein, analogs, derivatives or pharmaceutically acceptable salts thereof.

[0253] In some embodiments, the compound of formula (I) is a compound of any one of formulas (V), (VI), (VII) or (VIII). Some embodiments relate to a method of treating, ameliorating, inhibiting, preventing or delaying a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy and Parkinson's disease. In some embodiments, the method comprises administering to a subject in need thereof a compound of any one of formulas (V), (VI), (VII) or (VIII), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutical acceptable salts thereof, or a pharmaceutical composition comprising a compound of any one of formulas (V), (VI), (VII) or (VIII), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma-ceutical acceptable salts thereof.

[0254] As used herein, "subject" refers to an animal that is the object of treatment, inhibition or amelioration, observation or experiment. "Animal" includes cold-blooded and warm-blooded vertebrates and / or invertebrates, such as fish, shellfish or reptiles, and in particular mammals. "Mammals" includes, but is not limited to, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates, such as monkeys, chimpanzees and / or apes, and in particular humans. In some embodiments, the subject is a human.

[0255] In some embodiments, the method includes diagnosing a subject as suffering from a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease. In some embodiments, diagnosing includes making a determination that the subject has or is likely to develop a disease or condition associated with TDP-43 toxicity. In some embodiments, diagnosing a subject is equivalent to identifying the subject as having or likely to develop a disease or condition associated with TDP-43 toxicity.

[0256] In some embodiments, the method includes the steps of selecting a subject diagnosed or identified as having or likely to develop a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease, and administering to the subject a composition comprising a compound of any one of formulas (I), (II), (III), or (IV), an analog, derivative, or pharma- ceutically acceptable salt thereof, including any of the compounds specifically disclosed herein. In some embodiments, administration of a composition comprising a compound of any one of formulas (I), (II), (III), or (IV), an analog, derivative, or pharma- ceutically acceptable salt thereof, including any of the compounds specifically disclosed herein, to a subject in need thereof ameliorates, treats, prevents, delays, inhibits, or slows the onset and / or development of a disease or condition associated with TDP-43 toxicity.

[0257] In some embodiments, the method includes reducing or inhibiting TDP-43 in a subject suffering from TDP-43 toxicity. In some embodiments, the method includes selecting or identifying a subject having TDP-43 toxicity and administering to the subject a composition comprising a compound of any one of formulas (I), (II), (III) or (IV), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof. In some embodiments, administration of a composition comprising a compound of any one of formulas (I), (II), (III) or (IV), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof results in a reduction in TDP-43 activity levels in the subject. TDP-43 activity levels may be reduced by greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or by an amount within a range defined by any two of the foregoing values. In some embodiments, administration of a composition comprising a compound of any one of Formulas (I), (II), (III), or (IV), an analog, derivative, or pharma- ceutically acceptable salt thereof, including any of the compounds specifically disclosed herein, inhibits TDP-43 toxicity.

[0258] In some embodiments, as disclosed herein, a pharmaceutical composition comprising any one of the compounds of formula (I), (II), (III) or (IV), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof, may contain between 0.01 mg and 3000 mg of any one of the compounds of formula (I), (II), (III) or (IV), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof.

[0259] In some embodiments, the compound of formula (I) is any one of the compounds of formula (V), (VI), (VII) or (VIII). In some embodiments, the method includes the steps of selecting a subject diagnosed or identified as having or likely to develop a disease or condition associated with TDP-43 toxicity, such as cystic fibrosis or neurodegeneration, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease, and administering to the subject a composition comprising a compound of any one of formula (V), (VI), (VII) or (VIII), an analog, derivative, or pharma- ceutically acceptable salt thereof, including any of the compounds specifically disclosed herein. In some embodiments, administration of a composition comprising a compound of any one of Formulae (V), (VI), (VII) or (VIII), an analog, derivative or a pharma- ceutically acceptable salt thereof, including any of the compounds specifically disclosed herein, to a subject in need thereof ameliorates, treats, prevents, delays, inhibits or slows the onset and / or development of a disease or condition associated with TDP-43 toxicity.

[0260] In some embodiments, the method includes reducing or inhibiting TDP-43 in a subject suffering from TDP-43 toxicity. In some embodiments, the method includes selecting or identifying a subject having TDP-43 toxicity and administering to the subject a composition comprising a compound of any one of formulas (V), (VI), (VII) or (VIII), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof. In some embodiments, administration of a composition comprising a compound of any one of formulas (V), (VI), (VII) or (VIII), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof results in a reduction in TDP-43 activity levels in the subject. TDP-43 activity levels may be reduced by greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or by an amount within a range defined by any two of the foregoing values. In some embodiments, administration of a composition comprising a compound of any one of Formulas (V), (VI), (VII), or (VIII), an analog, derivative, or pharma- ceutically acceptable salt thereof, including any of the compounds specifically disclosed herein, inhibits TDP-43 toxicity.

[0261] In some embodiments, as disclosed herein, a pharmaceutical composition comprising any one of the compounds of formula (V), (VI), (VII) or (VIII), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof, may contain between 0.01 mg and 3000 mg of any one of the compounds of formula (V), (VI), (VII) or (VIII), including any of the compounds specifically disclosed herein, analogs, derivatives or pharma- ceutically acceptable salts thereof.

[0262] As will be appreciated by those skilled in the art, in certain circumstances, it may be necessary to administer amounts of the active ingredients disclosed herein that exceed or far exceed the dosage ranges set forth above in order to effectively and aggressively treat, particularly aggressive disease, or it may be necessary to administer amounts of the active ingredients disclosed herein that are below or significantly below the dosage ranges set forth above, e.g. for maintenance therapy.

[0263] Dosage amount and interval may be adjusted individually to provide plasma levels of active ingredient sufficient to maintain the modulating effect or minimal effective concentration (MEC). The MEC will vary for each active ingredient but can be estimated from in vitro data. The dosage required to achieve the MEC will depend on individual characteristics and route of administration. However, HPLC assays or bioassays can be used to determine plasma concentrations. Dosage intervals can also be determined using the MEC value. Compositions should be administered using a regimen that maintains plasma levels above the MEC for 10-90% of the time, preferably 30-90% and most preferably 50-90%. In cases of localized administration or selective uptake, the effective local concentration of the drug may not be related to the plasma concentration.

[0264] The active ingredients disclosed herein can be evaluated for efficacy and toxicity using known methods. For example, the toxicology of a particular active ingredient or a subset of active ingredients sharing a certain chemical moiety can be established by determining in vitro toxicity on cell lines, such as mammalian and preferably human cell lines. The results of such studies are often predictive of toxicity in animals, such as mammals or more specifically humans. Alternatively, the toxicity of a particular compound in an animal model, such as mice, rats, rabbits or monkeys, can be determined using known methods. The efficacy of a particular active ingredient can be established using several recognized methods, such as in vitro methods, animal models or human clinical trials. When selecting a model to determine efficacy, the skilled artisan can be guided by the state of the art to select the appropriate model, dose, route of administration and / or regime.

[0265] The toxicology of pharmaceutical compositions comprising a compound of any one of formulas (I), (II), (III) or (IV), its analogs, derivatives or pharma- ceutically acceptable salts, including any of the compounds specifically disclosed herein, can be established by determining in vitro toxicity on cell lines, such as mammalian and preferably human cell lines. The results of such studies are often predictive of toxicity in animals, such as mammals or, more specifically, humans. The toxicity of pharmaceutical compositions comprising a compound of any one of formulas (I), (II), (III) or (IV) can be established by determining in vivo toxicity in animal models, such as mice, rats, rabbits or monkeys.

[0266] In some embodiments, the compound of formula (I) is a compound of any one of formulas (V), (VI), (VII) or (VIII). The toxicology of a pharmaceutical composition comprising a compound of any one of formulas (V), (VI), (VII) or (VIII), its analogs, derivatives or pharma- ceutically acceptable salts, including any of the compounds specifically disclosed herein, can be established by determining in vitro toxicity on cell lines, such as mammalian and preferably human cell lines. The results of such studies are often predictive of toxicity in animals, such as mammals or, more specifically, humans. The toxicity of a pharmaceutical composition comprising a compound of any one of formulas (V), (VI), (VII) or (VIII) can be established by determining in vivo toxicity in animal models, such as mice, rats, rabbits or monkeys. EXAMPLES

[0267] The embodiments of the present invention are further defined in the following examples. It should be understood that these examples are given by way of illustration only. From the above discussion and these examples, a person skilled in the art can ascertain the essential features of the present invention, and can make various changes and modifications to the embodiments to adapt the present invention to various usages and conditions without departing from the spirit and scope thereof. Thus, in addition to those shown and described herein, various modifications of the embodiments of the present invention will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. The disclosures of each reference specified in this specification are incorporated herein by reference in their entirety and for the disclosures referred to herein.

[0268] Example 1 Purification of ALT-59 binding proteins Experiments were performed to identify potential ALT-59 target proteins. These experiments were performed using the following methods.

[0269] Tissue culture and cell treatment MDA-MB-231 and PLC / PRF / 5 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (Invitrogen) at 37°C in a CO2 incubator.

[0270] Solid-phase compound-protein complex disassembly Cells were lysed in lysis buffer containing 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.5, 0.3% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 150 mM NaCl (Sigma-Aldrich) and protease inhibitor cocktail (Roche) for 1 hour at 4°C with rotation, followed by centrifugation at 15000 for 20 minutes. Ten milligrams of ALT-59 dissolved in DMSO at 20 mM was added to the whole cell lysate containing 5 mg of protein and incubated on ice for 1 hour. Compounds aggregate due to their high hydrophobicity. Compound-protein complexes were sedimented at 1000 rpm and washed five times with lysis buffer to remove unbound proteins. Compound-protein complexes were boiled in SDS-PAGE protein sample buffer (1×) (80 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.1% bromophenol blue).

[0271] For silver staining, proteins were separated on a 10% SDS-PAGE gel. To prepare samples for protein identification using mass spectrometry, protein samples were run on a stacking gel and electrophoresis was stopped after compressing the samples into a single band. Gels were stained with Coomassie Brilliant Blue for 30 min and destained overnight with at least three changes of deionized water. Bands were excised and subjected to mass spectrometry for protein identification. Data from these experiments show that a major protein band with an apparent molecular weight of approximately 43 kDa was revealed by silver staining of samples from both cell lines (Figure 1). Mass spectrometry analysis identified TDP-43 as the number one hit, followed by abundant chaperonins and keratins (Figure 2).

[0272] Example 2 Recombinant TDP-43 expression and purification The expression vector pRETb / TDP43-His was constructed and used in the following experiments to purify recombinant TDP-43.

[0273] Rosetta (DE3) cells were transformed with pRETb / TDP43-His according to the manufacturer's instructions. After the culture from a single colony reached an OD of 0.6 after 5 hours of shaking at 37°C, it was split into six equal cultures and treated as indicated in Figure 3. (Lane 1) Uninduced blank; (Lane 2) 0.5 mM IPTG, 60 μM DMSO; (Lane 3) 0.5 mM IPTG, 60 μM ALT-59; (Lane 4) 0.5 mM IPTG, 2 μg / ml PMBN; (Lane 5) 0.5 mM IPTG, 2 μg / ml PMBN, 30 μM ALT-59; (Lane 6) 0.5 mM IPTG, 2 μg / ml PMBN, 60 μM ALT-59. Cells were grown overnight at 25°C on a shaker, then harvested, sonicated in protein sample buffer, boiled, and loaded onto a 10% SDS-PAGE gel. Proteins were visualized by Coomassie Brilliant Blue staining.

[0274] The results indicate low expression of TDP43-His in E. coli due to the inherent tendency of TDP-43 to aggregate. Treatment with 60 μM ALT-59 and PMBN, a cationic cyclic peptide that can specifically increase the permeability of the outer membrane of Gram-negative bacteria to hydrophobic compounds, increased protein expression, but expressed proteins from all cultures could not be directly purified by nickel-NTA agarose resin (Qiagen). The increased expression of TDP43-His in the presence of ALT-59 suggests a direct binding between the two (Figure 3).

[0275] Additional experiments were performed to increase recombinant TDP-43 expression and solubility. TDP-43 was inserted in frame after a Sumo tag, which was preceded by a His-tag on the pSumo-Kan vector. The resulting pSumo / TDP43 was introduced into Rosetta (DE3) cells. Two colonies were picked and cultured by shaking at 37°C until the outer diameter reached 0.6. Each culture was split into two, one of which received IPTG at a final concentration of 0.5 mM. Cells were grown overnight on a shaker at 25°C, then harvested, sonicated in protein sample buffer, boiled, and loaded onto a 10% SDS-PAGE gel. Protein purification using nickel-NTA agarose resin (Qiagen) followed by fractionation of the eluted proteins on a 10% SDS-PAGE gel was performed according to the manufacturer's instructions. Proteins were visualized by Coomassie brilliant blue staining.

[0276] Data from these experiments show that inserting a Sumo tag in front of TDP-43 dramatically increases TDP-43 expression (Figure 4A) and renders it soluble (Figure 4B).

[0277] Example 3 ALT-59 is a TG of TDP-43 12 Inhibits binding to To confirm the direct binding of ALT-59 to TDP-43, additional experiments were performed. One microgram of purified His-Sumo-TDP43 was incubated with 1 μg of TG 12 -biotin (TGTGTGTGTGTGTGTGTGTGTGTGTG-biotin (SEQ ID NO: 1)) in binding buffer containing 20 mM HEPES, pH 7.5, 0.3% CHAPS, 150 mM NaCl (Sigma-Aldrich) and protease inhibitor cocktail (Roche) in the presence of carrier (50% Cremophor EL, 50% absolute ethanol) or 30 μM ALT-59 dissolved in carrier for 4 hours on ice. DNA-protein complexes were disassembled by adding streptavidin magnetic beads (20 μl of settled beads, GE Healthcare Life Sciences) and rotating for 2 hours at 4°C. After washing five times with binding buffer, samples were boiled in protein sample buffer. In another experiment, the DNA-protein complexes bound to streptavidin magnetic beads were washed and divided into three portions, two of which were incubated with either the carrier or ALT-59 for 4 hours at 4°C with rotation to elute TDP-43 from TG12-biotin-streptavidin. The third portion and the eluate were mixed with protein sample buffer and boiled. Protein samples from the above experiment were loaded onto 4-20% Tris-glycine gels (Invitrogen) for fractionation. Western blotting was performed using anti-TDP-43 antibody (Proteintech Group).

[0278] Data from these experiments suggest that ALT-59 inhibits the TG of TDP-43. 12 ALT-59 can block the binding of TG to TG (Figure 5). 12 TDP43-TG 12 It can also be displaced from the complex (Figure 6), and ALT-59 can displace TDP-43 and TG 12 These results suggest that IgG binds with higher affinity than IgG.

[0279] Example 4 Inhibition of TDP-43 by ALT-59 alters LAMP2 pre-mRNA splicing The LAMP2 pre-mRNA consists of 11 exons (Figure 7A). Alternative splicing of the pre-mRNA results in three mature mRNA isoforms: LAMP2a, LAMP2b and LAMP2c. The three isoforms share the first eight exons followed by a different exon that contains a stop codon. Translation of the transcript generates three protein isoforms with different c-terminal sequences, which contain 45 or 46 amino acids. It has been shown that LAMP2C, but not 2A and 2B, are lysosomal membrane proteins that act as RNA / DNA receptors for their lysosomal degradation and thus serve as garbage-disposal proteins to remove unwanted nucleic acids (Fujiwara et al., 2015, Biochem Biophys Res Commun 460, 281-286).

[0280] Long stretches of TG repeats are found in exon 9 and intron 9 of the Lamp2 gene. A shorter stretch is located in intron 10. The presence of these high affinity TDP-43 binding sequences suggests a potential regulatory role of TDP-43 in LAMP2 pre-mRNA splicing. To test whether ALT-59 treatment affects LAMP2 alternative splicing, RT-PCR analysis was performed. MDA-MB-231 cells were cultured as described above and treated with DMSO or 6 μM ALT-59. Total RNA was extracted using the RNeasy Mini Kit (Qiagen), and equal amounts of RNA were reverse transcribed using the Superscript III First-Strand Synthesis System (Invitrogen). PCR reactions were performed using a forward primer located on exon 1 and a reverse primer located on exon 11. PCR samples were resolved in 1.2% agarose gels and stained with ethidium bromide.

[0281] Lamp2 forward primer: ATGGTGTGCTTCCGCCTCTTC (sequence number 2).

[0282] Lamp2 reverse primer: TTACACAGACTGATAACCAGTACG (SEQ ID NO:3).

[0283] The data obtained show that ALT-59 treatment reduces the level of LAMP2a mRNA and increases the level of LAMP2c mRNA (Figure 7C). Sufficient LAMP2C protein on the lysosomal membrane allows lysosomes to clear unwanted junk nucleic acids by importing them into the lumen for degradation. On the other hand, abnormally high expression of wild-type TDP-43 or gain-of-function mutants may lead to lower expression of LAMP2C and, consequently, accumulation of junk nucleic acids together with nucleic acid-binding proteins in the cytoplasm. This mechanism provides an explanation for the TDP-43 aggregates seen in patients with neurodegenerative disorders.

[0284] Example 5 Inhibition of TDP-43 by ALT-59 induces CFTR exon 9 inclusion TDP-43 has been reported to cause CFTR exon 9 skipping, ApoA2 exon 3 skipping, and POLDIP3 exon 3 inclusion. To further confirm that TDP-43 is the target of ALT-59, additional experiments were performed. RT-PCR analysis was performed as described above using the following primers for these genes. PCR samples were analyzed by polyacrylamide gel electrophoresis and stained with ethidium bromide.

[0285] CFTR forward primer: CAGAAGTAGTGATGGAGAATGTAAC (SEQ ID NO: 4).

[0286] CFTR reverse primer: GTTGACCTCCACTCAGTGTGATTC (SEQ ID NO:5).

[0287] ApoA2 forward primer: ATGAAGCTGCTCGCAGCAAC (SEQ ID NO: 6).

[0288] ApoA2 reverse primer: TCACTGGGTGGCAGGCTGTG (SEQ ID NO: 7).

[0289] POLDIP3 forward primer: TGCTCTGAAGCTCACCAAAA (sequence number 8).

[0290] POLDIP3 reverse primer: GGAACGGAAGCTATACCATCAT (SEQ ID NO:9).

[0291] Data from these experiments confirmed that, by inhibiting TDP-43, ALT-59 was indeed able to promote CFTR exon 9 inclusion and block ApoA2 splicing (Figure 8). In the case of ApoA2, inhibited TDP-43 nucleic acid binding by ALT-59 led to less mature mRNA and more ApoA2 pre-mRNA, which retained not only exon 3 (Mercado et al., 2015, Nucleic Acids Res 33, 6000-6010) but also all of the other exons and introns. The different observations could be explained by different experimental settings. While endogenous ApoA2 gene expression was determined in this study, Mercado et al. (2015) determined the splicing of an artificial minigene containing only exon 3 (133 nt) with its adjacent intronic regions (174 nt in intron 2 and 116 nt in intron 3). Splicing of POLDIP3 exon 3 remained unchanged, which is inconsistent with previous reports.

[0292] Example 6 Inhibition of TDP-43 by ALT-59 increases CFTR protein expression Additional experiments were performed to determine how ALT-59 treatment affects CFTR protein levels. U-87MG cells were maintained at 37°C in a CO2 incubator in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (Invitrogen) and treated with DMSO, 3 μM or 6 μM ALT-59. Cells were lysed using RIPA buffer (25 mM Tris, pH 7.4, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100, Complete protease inhibitor cocktail). Western blotting was performed using anti-CFTR (Novus Biologicals) and anti-beta-actin (Sigma-Aldrich) antibodies. Images were acquired using an Odyssey imager and quantified using Odyssey software (LI-COR).

[0293] The data obtained confirmed the increase in full-length CFTR expression by ALT-59 (Figure 9A). Multiple CFTR isoforms were detected with molecular weights of approximately 160, 240, and 300 kDa. Treatment with 3 μM ALT-59 did not affect the levels of CFTR160, but increased the levels of CFTR240 by 1-fold and CFTR300 by 10-fold. Treatment with 6 μM ALT-59 increased the levels of CFTR160, CFTR240, and CFTR300 by 30%, 3-fold, and 18-fold, respectively (Figures 9B-D). CFTR300 likely represents glycosylated CFTR.

[0294] Example 7 Inhibition of TDP-43 by ALT-59 increases CFTR localization on the plasma membrane To determine how ALT-59 treatment affects CFTR localization, immunofluorescence microscopy was performed.

[0295] MDA-MB-231 and U-87MG cells were cultured on cover slips under the conditions as described above. Cells were treated with DMSO or 4 μM ALT-59 for 3 days. Primary human bronchial epithelial cells isolated from a cystic fibrosis patient homozygous for Phe508del-CFTR (Lifeline Cell Technology) were cultured on cover slips in BrochiaLife cell culture medium supplemented with BrochiaLife LifeFactors kit (Lifeline Cell Technology) and maintained at 37°C in a CO2 incubator. Cells were treated with DMSO, 4 μM ALT-59, 2 μM ALT-308 or 4 μM ALT-410 for 3 days.

[0296] Cells were fixed in 4% paraformaldehyde for 15 min and permeabilized in 0.1% Triton X-100 for 2 min. After blocking in 5% BSA (Sigma-Aldrich), cells were incubated with anti-CFTR antibody (Alomone Labs) followed by Alexa Fluor 488 anti-rabbit secondary antibody. Reagents were buffered in GIBCO PBS (phosphate buffered saline). Images were taken using a Carl Zeiss LSM510 laser scanning microscope. Parameters were set identically for all images.

[0297] Data from these experiments show that ALT-59 causes redistribution of CFTR from the perinuclear region to the plasma membrane in MDA-MB-231 and U-87MG cells (Figure 10). ALT-59 treatment caused redistribution of CFTR from the perinuclear region to the plasma membrane. Treatment of primary bronchial epithelial cells isolated from cystic fibrosis patients homozygous for Phe508del-CFTR with ALT-59 and its derivatives ALT-308 and ALT-410 also leads to increased localization of Phe508del-CFTR on the plasma membrane (Figures 11-12).

[0298] Example 8 Inhibition of TDP-43 by ALT-59 alters the expression of proteins associated with neurodegenerative diseases U-87MG and T98G cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (Invitrogen) at 37°C in a CO2 incubator. Cells were treated with DMSO, 3 μM or 6 μM ALT-59 for 2 days and subjected to Western blotting analysis using the indicated antibodies. Protein bands were quantified using Image J software.

[0299] The obtained data show that in U-87MG cells, inhibition of TDP-43 by 3 μM and 6 μM ALT-59 reduces beta-secretase 1 (BACE1) protein levels by 20% and 50%, respectively. ALT-59 at 3 μM and 6 μM reduces Tau expression by 52% and 38%, respectively. In contrast, the treatment increases MAP2 expression by 1.42 and 2.51 times, respectively (Figure 13). The regulation of BACE1 expression by ALT-59 treatment was confirmed in T98G cells, in which ALT-59 at 3 μM and 6 μM reduces BACE1 expression by 31% and 53%, respectively (Figure 14).

[0300] BACE1 is responsible for the proteolytic processing of amyloid precursor protein (APP) into 40 or 42 amino acid-long amyloid-β peptides, which are components of amyloid plaques found in patients with neurodegenerative diseases. Microtubule-associated protein tau (MAPT) forms insoluble filaments that accumulate as neurofibrillary tangles in many diseases, including neurodegenerative diseases. MAP2 has been shown to be a critical traffic regulator that controls the axonal growth potential of sensory neurons by directing axonal cargo transport (Gumy et al., 2017, Neuron 94, 347-362 e347). Taken together, these data indicate that inhibition of TDP-43 by ALT-59 treatment can reduce the expression of pathological proteins associated with neurodegenerative diseases and, at the same time, increase the expression of beneficial proteins.

[0301] Example 9 Screening of ALT-59 derivatives Additional experiments were performed to screen compounds with higher potency and ability to penetrate the blood-brain barrier using BACE1 protein levels as an index. U-87MG cells were cultured as previously described and treated with compounds at concentrations as indicated in Figures 15-17 for 2 days. The cells were then subjected to Western blotting analysis using anti-BACE1 and anti-beta-actin antibodies.

[0302] Data from these experiments lead to the identification of compounds capable of reducing BACE1 protein expression. The chemical structures of compounds capable of reducing BACE1 expression are described herein and shown in Figures 18-20. These compounds are herein referred to as ALT-108, ALT-212, ALT-215, ALT-308, ALT-317, ALT-309, ALT-408, ALT-411, ALT-333, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-205, ALT-207, AL Referred to as T-208, ALT-210, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-403, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413 and ALT-414.

[0303] Example 10 ALT-59 treatment rescues paralysis caused by hTDP-43 expression in C. elegans The wild-type N2 strain or transgenic C. elegans expressing full-length (wild-type) human TDP-43 (strain no. CL6049, Caenorhabditis Genetics Center, Minneapolis, MN) were plated on freshly prepared nematode growth medium (NGM) Petri dishes with or without 10 μM ALT-59.

[0304] The uncoordinated phenotype was imaged and recorded under an inverted microscope, and the movement defect was quantified by counting body thrashes in the liquid.

[0305] Neuronal expression of full-length human TDP-43 in C. elegans leads to motor neuron dysfunction, causing the animals to have a coiled body posture, uncoordinated movements, and reduced body undulation in liquid (Ash et al., 2010). Thus, the C. elegans model used in this example is a suitable model for in vivo testing of the effects of the compositions provided herein on human TDP-43, which has a known correlation with neurodegenerative disorders. Treatment with ALT-59 rescued the coiled body posture and uncoordinated phenotype (Figure 21) and reduced the percentage of paralysis from 93% to 29.5% (Figure 22). These results demonstrate the in vivo therapeutic benefit of blocking the nucleic acid binding activity of TDP-43 using the compositions provided herein.

[0306] Example 11 Treatment of neurodegenerative disorders in mice A pharmaceutical composition is prepared comprising a compound of any one of formulas (I), (II), (III), (IV), (V), (VI), (VII) or (VIII), an analog, derivative or pharma- ceutical acceptable salt thereof, including any of the compounds specifically disclosed herein, wherein the pharmaceutical composition comprises a compound of any one of formulas (I), (II), (III), (IV), (V), (VI), (VII) or (VIII), present in a therapeutically effective amount.

[0307] TDP-43 toxicity originates from its nucleic acid binding activity (Ihara et al., 2013, Hum Mol Genet, 22(22), 4474-4484; Voigt et al., 2010, PLoS One, 5(8), e12247; Wils et al., 2010, PNAS 107, 3858-3863). Expression of the human TDP-43 gene in neurons throughout the mouse central nervous system causes degeneration of cortical and spinal motor neurons and spastic paralysis (Wils et al., 2010, PNAS 107, 3858-3863). A mouse model of TDP-43 neurodegeneration, mouse strain B6;SJL-Tg(Thy1-TARDBP)4Singh / J, is obtained from Jackson Laboratory (stock number: 012836). The mouse model is established for this purpose and is an accepted animal model for neurodegeneration and TDP-43 toxicity, and the compounds provided herein are used for screening in this animal model.The mouse strain expresses human TDP-43 gene and is used to test the in vivo efficacy of the compositions provided herein.The compound is administered to homozygous mice at 10mg / kg body weight by intraperitoneal injection, 3 times a week for 4 weeks.The motor phenotype of the treatment group is compared with the vehicle-treated control group.

[0308] Mice treated with the compound exhibit improved survival and remission of paralysis caused by TDP-43 expression in neurons.

[0309] Example 12 Treatment of neurodegenerative disorders using pharmaceutical compositions A pharmaceutical composition is prepared that includes a compound of any one of formulas (I), (II), (III), (IV), (V), (VI), (VII) or (VIII), an analog, derivative or pharma- ceutical acceptable salt thereof, including any of the compounds specifically disclosed herein. The pharmaceutical composition includes a compound of any one of formulas (I), (II), (III), (IV), (V), (VI), (VII) or (VIII), present in a therapeutically effective amount, for example, in an amount ranging from 0.01 mg to 3000 mg.

[0310] A pharmaceutical composition is prepared that includes a compound of any one of formulas (V), (VI), (VII) or (VIII), an analog, derivative or pharma- ceutically acceptable salt thereof, including any of the compounds specifically disclosed herein, The pharmaceutical composition includes a compound of any one of formulas (V), (VI), (VII) or (VIII) present in a therapeutically effective amount, for example, in an amount ranging from 0.01 mg to 3000 mg.

[0311] A subject suffering from a neurodegenerative disorder is identified by diagnosing the subject as having a neurodegenerative disorder. The subject is selected based on the extent of the neurodegenerative disorder. The severity of the neurodegenerative disorder is assessed before, during and after treatment. Assessment includes subject response, subject neurological examination and biomarker assessment.

[0312] The subjects are instructed to discontinue the use of any neurodegenerative treatments and to avoid any new treatments. The identified subjects are divided into control and treatment groups. At the beginning of the study, all subjects are assessed for disease severity. Each subject is administered the composition on the same day, where the control group is administered a placebo composition and the treatment group is administered a pharmaceutical composition. The treatment is repeated as necessary during the course of treatment.

[0313] The outcome of the treatment is assessed during the course of the study and after final treatment. The outcome of the treatment group is compared to the outcome of the control group. The efficacy of the pharmaceutical composition is evaluated based on assessments during the course of treatment and after treatment, compared to the control group. Subjects receiving the pharmaceutical composition exhibit improvement in neurological assessments, compared to the control group.

[0314] As used herein, section headings are for organizational purposes only and should not be construed as limiting the subject matter described in any way. All literature and similar materials cited in this application, including but not limited to patents, patent applications, papers, books, treatises, and Internet web pages, contain the disclosures specifically referenced herein and are expressly incorporated by reference in their entirety for all purposes. In the event that the definition of a term in an incorporated reference appears to differ from the definition provided in the present teachings, the definition provided in the present teachings shall prevail. There is an implicit "about" before the temperature, concentration, time, etc. discussed in the present teachings, whereby it will be understood that minor, insubstantial deviations are within the scope of the present teachings herein.

[0315] In this application, the use of the singular includes the plural unless specifically stated otherwise, and the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting.

[0316] As used in this specification and claims, the singular forms "a," "an," and "the" include plural references unless the content clearly dictates otherwise.

[0317] Although the present invention has been disclosed in the context of certain embodiments and examples, those skilled in the art will appreciate that the present invention extends beyond the specifically disclosed embodiments to other alternative embodiments and / or uses of the invention and to obvious modifications and equivalents thereof. In addition, while several variations of the present invention have been shown and described in detail, other modifications within the scope of the present invention will be readily apparent to those skilled in the art based on this disclosure. It is also contemplated that various combinations or subcombinations of the specific features and aspects of the embodiments may be made and still fall within the scope of the present invention. It should be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another to form various modes or embodiments of the disclosed invention. It is therefore intended that the scope of the invention disclosed herein should not be limited by the specific disclosed embodiments described above.

[0318] It should be understood, however, that this detailed description, while indicating preferred embodiments of the invention, is given by way of example only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art.

[0319] The terminology used in the description presented herein is not intended to be construed in any limited or restrictive manner. Rather, the terminology is merely utilized in conjunction with detailed descriptions of embodiments of systems, methods, and related components. Furthermore, the embodiments may include several novel features, no one of which is solely responsible for its desirable attributes or is considered essential to practice the invention described herein.

Claims

1. 1. A pharmaceutical composition for use in treating a disease associated with TAR DNA binding protein 43 (TDP-43) toxicity, comprising: the disease is selected from the group consisting of cystic fibrosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease; A therapeutically effective amount of a compound of formula (IV) or a pharma- ceutically acceptable salt thereof: 【Chemistry 1】 [In the formula, R 1 is H, OH or lower alkyl; R2 is an optionally substituted aromatic ring of 4, 5 or 6 carbons; wherein the aromatic ring is carbocyclic or heterocyclic and each position on the aromatic ring is independently H, halo, haloalkyl, lower alkyl, OH, lower alkoxy, NH2, lower alkylamino, di(lower alkyl)amino, SH, lower alkylthio, NO2, or two residues taken together form a heterocyclic ring; R3, R4, R5, R6, and R7 are each independently H, lower alkyl, OH, NH2, aryl, or aralkyl, where the aryl and aralkyl are substituted with 0 to 3 moieties selected from the group consisting of halo, OH, NH2, lower alkyl, lower alkoxy, SH, lower alkylthio, and lower alkylamino; R 8 , R 9 , R 10 , R 11 , R 12 and R 13 are each independently H, halo, lower alkyl, OH, lower alkoxy or NO 2 , wherein any one of the carbon atoms present in any one of the fused rings of formula (VI) is optionally replaced with a nitrogen atom.

23. A pharmaceutical composition comprising:

2. A pharmaceutical composition for use in treating a disease associated with TAR DNA binding protein 43 (TDP-43) toxicity, comprising: the disease is selected from the group consisting of cystic fibrosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease; therapeutically effective amounts of ALT-212, ALT-215, ALT-308, ALT-309, ALT-408, ALT-411, ALT-59, ALT-110, ALT-201, ALT-202, ALT-204, ALT-208, ALT-207, ALT-210, ALT-211; A pharmaceutical composition comprising a compound of ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-324, ALT-402, ALT-404, ALT-406, ALT-409, ALT-410, ALT-413, or ALT-414.

3. 2. The pharmaceutical composition of claim 1, wherein the compound is ALT-212, ALT-215, ALT-308, ALT-309, ALT-59, ALT-201, ALT-204, ALT-208, ALT-207, ALT-211, ALT-302, ALT-306, ALT-307, ALT-311, ALT-318, ALT-322, ALT-404 or ALT-410.

4. 2. The pharmaceutical composition of claim 1, wherein the compound is ALT-59.

5. A pharmaceutical composition for use in treating a disease associated with TAR DNA binding protein 43 (TDP-43) toxicity, comprising: the disease is selected from the group consisting of cystic fibrosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy, and Parkinson's disease; the pharmaceutical composition comprises a therapeutically effective amount of a compound or a pharma- ceutical acceptable salt thereof; The pharmaceutical composition, wherein the compound is ALT-108, ALT-317, ALT-333 or ALT-403.

6. 2. The pharmaceutical composition of claim 1, wherein the formula compound is ALT-308 or ALT-309.

7. 2. The pharmaceutical composition of claim 1, wherein the compound of formula (VI) is ALT-302 or ALT-306.

8. 8. A pharmaceutical composition according to any one of claims 1 to 7 for use in the treatment of cystic fibrosis.

9. 9. The pharmaceutical composition of claim 8, which inhibits the progression or development of cystic fibrosis.

10. 10. A pharmaceutical composition according to any one of claims 1 to 9 for use in the treatment of a neurodegenerative disease.

11. The pharmaceutical composition of claim 10, which inhibits the progression or onset of the neurodegenerative disease.

12. 12. The pharmaceutical composition according to claim 10 or 11, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in the elderly (HS senescence), chronic traumatic encephalopathy or Parkinson's disease.

13. 13. The pharmaceutical composition of claim 1, wherein the compound is present in an amount of 0.01 mg to 3000 mg.

14. 14. The pharmaceutical composition of any one of claims 1 to 13, formulated for oral or parenteral administration.

15. 15. The pharmaceutical composition of claim 1, further comprising a pharma- ceutically acceptable carrier or excipient.

16. 16. A pharmaceutical composition according to any one of claims 1 to 15 for use in a method of reducing or inhibiting TAR DNA binding protein 43 (TDP-43) in a subject, the method comprising: selecting a subject in need of a compound that reduces or inhibits TDP-43; administering to said subject a pharmaceutical composition according to any one of claims 1 to 15; 23. A pharmaceutical composition comprising:

17. The pharmaceutical composition of claim 16, wherein the subject is identified as having a disease or condition associated with TDP-43 toxicity.

18. 18. The pharmaceutical composition of claim 17, wherein the disease is cystic fibrosis or a neurodegenerative disease.

19. The pharmaceutical composition of claim 18, wherein the method inhibits or delays the progression or onset of the cystic fibrosis or the neurodegenerative disease.

20. 20. The pharmaceutical composition according to claim 18 or 19, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in the elderly (HS senescence), chronic traumatic encephalopathy or Parkinson's disease.

21. 21. The pharmaceutical composition of any one of claims 16 to 20, wherein the composition is administered orally or parenterally to the subject.

22. 22. The method of any one of claims 16 to 21, wherein TDP-43 is reduced by at least 10%.

23. 16. A pharmaceutical composition according to any one of claims 1 to 15 for use in a method for treating a subject suffering from a disease or condition associated with TAR DNA binding protein 43 (TDP-43) toxicity, the method comprising: identifying a subject in need of a compound that reduces, inhibits, delays, ameliorates or prevents TDP-43 toxicity; administering to said subject a pharmaceutical composition according to any one of claims 1 to 15; 23. A pharmaceutical composition comprising:

24. 24. The pharmaceutical composition of claim 23, wherein the disease is cystic fibrosis or a neurodegenerative disease.

25. The pharmaceutical composition of claim 24, wherein the method inhibits or delays the progression or onset of cystic fibrosis or the neurodegenerative disease.

26. 26. The pharmaceutical composition according to claim 24 or 25, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy or Parkinson's disease.

27. 27. The pharmaceutical composition of any one of claims 23 to 26, wherein the composition is administered orally or parenterally to the subject.

28. The pharmaceutical composition of any one of claims 23 to 27, wherein the method reduces TDP-43 toxicity.

29. 20. Use of a pharmaceutical composition according to any one of claims 1 to 15 in the manufacture of a medicament for the treatment of a disease or condition associated with TAR DNA binding protein 43 (TDP-43) toxicity in a subject.

30. 30. The use according to claim 29, wherein the disease is cystic fibrosis or a neurodegenerative disease.

31. 31. The use according to claim 30, wherein the medicament inhibits or delays the progression or onset of cystic fibrosis or of the neurodegenerative disease.

32. 32. The use according to claim 30 or 31, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, hippocampal sclerosis in elderly people (HS senescence), chronic traumatic encephalopathy or Parkinson's disease.

33. The pharmaceutical composition of claim 10 or 11, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, or Parkinson's disease.

34. The pharmaceutical composition of claim 18, wherein the disease is cystic fibrosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, or Parkinson's disease.

35. The pharmaceutical composition of claim 24, wherein the disease is cystic fibrosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, or Parkinson's disease.

36. The use described in claim 30, wherein the disease is cystic fibrosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, or Parkinson's disease.

Images