Animal models for hematopoietic deficiency, growth retardation, high carcinogenicity, and mental dysfunction

Abstract

To provide at least one kind of model animal selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction.SOLUTION: Provided is at least one kind of model animal selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction, the function and / or expression of ADH5 gene being defective or reduced, and one or both of the paired chromosomes having mutations on the function and / or expression reduction of ALDH2 gene.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to model animals for hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction, and the like. [Background technology]

[0002] When the decomposition function of various aldehydes in a living body is reduced, various types of endogenous DNA damage increase. Aldehydes mainly generate DNA interstrand crosslinks (ICLs) and nonenzymatic DNA-protein crosslinks (DPCs). In relation to this, individuals with genetically reduced aldehyde decomposition function may exhibit symptoms such as hematopoietic insufficiency, growth retardation, high carcinogenicity, small head, low body weight, and mental retardation. Non-Patent Document 1 reports the creation of mice lacking both the Adh5 gene and the Aldh2 gene. However, Non-Patent Document 1 does not analyze the above symptoms, especially hematopoietic insufficiency and carcinogenicity, and does not mention progressive or delayed pathology at all because the survival period of the mice is extremely short. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] 'The failure of two major formaldehyde catabolism enzymes (ADH5 and ALDH2) leads to partial synthetic lethality in C57BL / 6 mice', Nakamura et al. Genes and Environment (2020) 42:21. Summary of the Invention [Problem to be solved by the invention]

[0004] An objective of the present invention is to provide at least one model animal selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction. [Means for solving the problem]

[0005] In view of the above problems, the present inventors have conducted intensive research and found that an animal in which the function and / or expression of the ADH5 gene is deleted or reduced and which has a functional reduction mutation of the ALDH2 gene in one of the paired chromosomes can be used as at least one animal model selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction. Based on this finding, the present inventors have conducted further research and completed the present invention. That is, the present invention encompasses the following aspects.

[0006] Item 1. At least one model animal selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction, in which the function and / or expression of the ADH5 gene is deleted or reduced, and which has a mutation that reduces the function and / or expression of the ALDH2 gene in one or both of a paired chromosome.

[0007] Item 2. The model animal according to Item 1, wherein the ADH5 gene is deleted in both of a pair of chromosomes.

[0008] Item 3. The model animal according to Item 1 or 2, wherein the function-reducing mutation in the ALDH2 gene is a mutation in a multimerization domain.

[0009] Item 4. The model animal according to Item 3, wherein the function-reducing mutation in the ALDH2 gene is a mutation that causes a mutation in mouse ALDH2 protein E506 or an amino acid corresponding thereto.

[0010] Item 5. The model animal according to Item 3 or 4, wherein the function-reducing mutation in the ALDH2 gene is a mutation that causes substitution of E506 in mouse ALDH2 protein or a corresponding amino acid thereto with lysine.

[0011] Item 6. The model animal according to any one of Items 1 to 5, wherein the mental dysfunction includes mental retardation.

[0012] Item 7. A fertilized egg, sperm or embryo which develops in the model animal according to any one of Items 1 to 6.

[0013] Item 8. A cell in which the function and / or expression of the ADH5 gene is deficient or reduced, and which has a mutation that reduces the function and / or expression of the ALDH2 gene in one or both of the paired chromosomes.

[0014] Item 9. A method for screening for at least one preventive agent, ameliorator, or exacerbating agent selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction, using the model animal according to any one of Items 1 to 6, the fertilized egg, sperm, or embryo according to Item 7, or the cell according to Item 8.

[0015] Item 10. (a) A step of administering or contacting a test substance to the model animal according to any one of Items 1 to 6, the fertilized egg, sperm or embryo according to Item 7, or the cell according to Item 8; (b) evaluating at least one phenotype selected from the group consisting of hematopoietic deficiency, growth retardation, high carcinogenicity, and mental dysfunction of the model animal, the fertilized egg, sperm or embryo, or the cell to which a test substance has been administered or contacted; and (c1) when the phenotype is cured or alleviated, selecting the test substance as at least one preventive or ameliorative agent selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction; or (c2) when the phenotype is deteriorated, selecting the test substance as at least one exacerbating substance selected from the group consisting of hematopoietic failure, growth retardation, high carcinogenicity, and mental dysfunction; The screening method according to item 9, comprising: Effect of the Invention

[0016] According to the present invention, it is possible to provide at least one model animal selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction, and also to provide a method for screening a preventive agent, an ameliorating agent, or an exacerbating agent, using the model animal. [Brief description of the drawings]

[0017] [Figure 1] Observed frequency (Obs.) and expected frequency (Exp.) of mice 2 weeks after birth from crossing Adh5+ / -Aldh2+ / KI female mice (carrying one Adh5 allele deficiency and one Aldh2 allele E506K mutation; + / - / KI notation is the same below) with Adh5+ / -Aldh2KI / KI male mice. Chi-square test showed that there was no significant difference between observed and expected frequencies, and Adh5 and Aldh2 double-deficient mice (Adh5- / -Aldh2KI / KI) and mice with Adh5 deficiency and one Aldh2 allele E506K mutation (Adh5- / -Aldh2+ / KI) were born almost normally without intrauterine growth restriction (p = 0.17). [Diagram 2] Representative photographs from Test Example 2 are shown. The blue arrow indicates an Adh5- / -Aldh2KI / KI mouse. P0 is a photograph taken immediately after birth, while P2, P7, and P9 are photographs taken 2, 7, and 9 days after birth. Immediately after birth, the Adh5 gene / Aldh2 gene double-deficient mice are approximately the same size as their littermates, but growth retardation is observed about one week after birth. [Diagram 3] The results of body weight measurement in Test Example 2 (0 days after birth, 2 weeks, or 6 weeks after birth) are shown. **p < 0.01, ***p < 0.001 indicate significance in one-way ANOVA using Tukey's multiple comparison test. Immediately after birth, Adh5 gene / Aldh2 gene double-deficient mice have body weights comparable to those of their littermates, but growth retardation is observed 2 weeks after birth. [Figure 4] The results of the survival rate measurement in Test Example 2 are shown. The Kaplan-Meier curve using the log-rank (Mantel-Cox) test shows that the survival rate of Adh5 gene-Aldh2 gene double-deficient mice (Adh5- / -Aldh2KI / KI) was significantly decreased compared to mice of other genotypes (p<0.0001). [Diagram 5]The results of measuring the number of nucleated bone marrow cells in Test Example 3 are shown. Nucleated bone marrow cells were quantified in both femurs and tibias from 3-week-old mice (mean ± SD, n = at least 5 mice). *p < 0.05, ***p < 0.001 indicate significance in one-way ANOVA using Tukey's multiple comparison test. The number of bone marrow cells is significantly reduced in Adh5 gene / Aldh2 gene double-deficient mice (Adh5- / -Aldh2KI / KI) and mice with Adh5 gene deficiency and Aldh2 gene single allele E506K mutation (Adh5- / -Aldh2+ / KI). [Figure 6] The results of measurement of hematopoietic cell subsets in Test Example 3 are shown. The results of measurement of individuals 3 weeks after birth are shown (mean ± SD, n = at least 5 mice). LKS (Lin-c-Kit+Sca-1+), HSC (Lin-c-Kit+Sca-1+CD150+CD48-), CLP (Lin-c-KitlowSca-1lowCD127+CD135+), CMP (Lin-c-Kit+Sca-1-CD34+CD16 / 32-). *p < 0.05, **p < 0.01, ***p < 0.001 indicate significance in one-way ANOVA using Tukey's multiple comparison test. The decrease in hematopoietic stem cells is remarkable in Adh5 gene-Aldh2 gene double-deficient mice (Adh5- / -Aldh2KI / KI). [Figure 7]The results of the measurement of hematopoietic cell subsets in Test Example 3 are shown. The results of the measurement of individuals 3 weeks after birth are shown (mean ± SD, n = at least 5 mice). MPP (Lin-c-Kit+Sca-1+CD150-CD48-), HPC1 (Lin-c-Kit+Sca-1+CD150-CD48+), MEP (Lin-c-Kit+Sca-1-CD34-CD16 / 32-), GMP (Lin-c-Kit+Sca-1-CD34+CD16 / 32+), HPC2 (Lin-c-Kit+Sca-1+CD150+CD48+). **p < 0.01, ***p < 0.001 indicate significance in one-way ANOVA using Tukey's multiple comparison test. Adh5 / Aldh2 double-deficient mice (Adh5- / -Aldh2KI / KI) show a marked decrease in hematopoietic stem cells. [Figure 8] The results of measurement of hematopoietic cell subsets in Test Example 3 are shown. The results of measurement of individuals 8 to 9 months after birth are shown (mean ± SD, n = at least 5 mice). LKS (Lin-c-Kit+Sca-1+), HSC (Lin-c-Kit+Sca-1+CD150+CD48-), CLP (Lin-c-KitlowSca-1lowCD127+CD135+), CMP (Lin-c-Kit+Sca-1-CD34+CD16 / 32-). *p < 0.05, **p < 0.01 indicate significance in one-way ANOVA using Tukey's multiple comparison test. The decrease in hematopoietic stem cells is remarkable in mice carrying the Adh5 gene deficiency and the Aldh2 gene single allele E506K mutation (Adh5- / -Aldh2+ / KI). [Figure 9]The results of the measurement of hematopoietic cell subsets in Test Example 3 are shown. The results of the measurement of individuals aged 8 to 9 months are shown (mean ± SD, n = at least 5 animals). MPP (Lin-c-Kit+Sca-1+CD150-CD48-), HPC1 (Lin-c-Kit+Sca-1+CD150-CD48+), MEP (Lin-c-Kit+Sca-1-CD34-CD16 / 32-), GMP (Lin-c-Kit+Sca-1-CD34+CD16 / 32+), HPC2 (Lin-c-Kit+Sca-1+CD150+CD48+). ***p < 0.001 indicates significance in one-way ANOVA using Tukey's multiple comparison test. Mice lacking the Adh5 gene and carrying the E506K allele of the Aldh2 gene (Adh5- / -Aldh2+ / KI) show a marked decrease in hematopoietic stem cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] 1.Definition In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".

[0019] The "identity" of an amino acid sequence refers to the degree of amino acid sequence agreement between two or more comparable amino acid sequences. Thus, the higher the agreement between two amino acid sequences, the higher the identity or similarity between those sequences. The level of identity of an amino acid sequence can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes" Proc Natl Acad Sci USA. 87: 2264-2268 (1990), Karlin S, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences" Proc Natl Acad Sci USA. 90: 5873-7 (1993)). A program called BLASTX based on such a BLAST algorithm has been developed. Specific techniques for these analysis methods are known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). The "identity" of base sequences is also defined in the same manner as above.

[0020] In this specification, "conservative substitution" means that an amino acid residue is replaced with an amino acid residue having a similar side chain. For example, substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine is considered to be conservative substitution. In addition, substitution between amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having non-charged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues having non-polar side chains such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues having β-branched side chains such as threonine, valine, and isoleucine; and amino acid residues having aromatic side chains such as tyrosine, phenylalanine, tryptophan, and histidine are also considered to be conservative substitutions.

[0021] 2. Model animals and cells In one aspect, the present invention relates to at least one model animal selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction, which has a defective or reduced function and / or expression of ADH5 gene and a reduced function and / or expression mutation of ALDH2 gene in one or both of a pair of chromosomes (also referred to as "model animal of the present invention" in this specification). This will be described below.

[0022] The animal is not particularly limited, and examples thereof include mammals such as monkeys, mice (Mus genus), rats, dogs, cats, rabbits, pigs, horses, cows, sheep, goats, and deer. Among these, animals that can be used as experimental animals are preferred, more preferably Mus genus, and even more preferably Mus musculus. Furthermore, the mammal may be a lineage or a hybrid. Furthermore, in the case of mice, examples of lineages include C57BL / 6, C3H, ICR, and BALB / c, with C57BL / 6 being preferred. When humans are used as model animals, the use of cells derived from healthy individuals or disease patients, iPS cells, and the like is envisaged.

[0023] The ADH5 (alcohol dehydrogenase 5) gene is an enzyme gene that converts formaldehyde to formic acid in a glutathione-dependent manner. The nucleotide and amino acid sequences of the ADH5 gene in various mammals are publicly known or can be easily determined based on the nucleotide and amino acid sequences of the publicly known ADH5 genes (for example, by identity analysis with these). As an example, the mouse Adh5 gene is a gene identified by NCBI Gene ID: 11532, and its amino acid sequences include the amino acid sequence (sequence number 4) identified by NCBI RefSeq accession number: NP_001275507.1 and the amino acid sequence (sequence number 5) identified by NCBI RefSeq accession number: NP_031436.2, and its mRNA sequence includes the nucleotide sequence (sequence number 6) identified by NCBI RefSeq accession number: NM_001288578.1 and the nucleotide sequence (sequence number 7) identified by NCBI RefSeq accession number: NM_007410.3.

[0024] The ALDH2 (aldehyde dehydrogenase 2) gene is an enzyme gene that converts acetaldehyde to acetic acid. In various mammals, the nucleotide sequence and amino acid sequence of the ALDH2 gene are publicly known, or can be easily determined based on the nucleotide sequence and amino acid sequence of the publicly known ALDH2 gene (for example, by identity analysis with these). As an example, the mouse Aldh2 gene is a gene identified by NCBI Gene ID: 11669, and examples of its amino acid sequences include the amino acid sequence (sequence number 8) identified by NCBI RefSeq accession number: NP_001295379.1 and the amino acid sequence (sequence number 9) identified by NCBI RefSeq accession number: NP_033786.1, and examples of its mRNA sequence include the nucleotide sequence (sequence number 10) identified by NCBI RefSeq accession number: NM_001308450.1 and the nucleotide sequence (sequence number 11) identified by NCBI RefSeq accession number: NM_009656.4.

[0025] The ADH5 gene and ALDH2 gene targeted by the present invention also include functionally normal mutants that may occur in nature. The ADH5 gene and ALDH2 gene targeted by the present invention may have base mutations such as substitutions, deletions, additions, and insertions, so long as the enzyme activity of the encoded protein is not significantly impaired. As the mutation, a mutation that does not cause an amino acid substitution in the protein translated from the mRNA or a mutation that causes a conservative amino acid substitution is preferred.

[0026] The ADH5 gene and ALDH2 gene targeted by the present invention are, for example, genes whose encoded protein amino acid sequences have identity of, for example, 95% or more, preferably 98% or more, more preferably 99% or more to the amino acid sequences of proteins encoded by wild-type ADH5 gene and ALDH2 gene of the same species of animal. The ADH5 gene and ALDH2 gene targeted by the present invention are, for example, genes whose encoded protein amino acid sequences are identical to the amino acid sequences of proteins encoded by wild-type ADH5 gene and ALDH2 gene of the same species of animal, or have one or more (for example, 2 to 10, preferably 2 to 5, more preferably 2 to 3, and even more preferably 2) amino acid sequences substituted, deleted, added, or inserted relative to the amino acid sequence.

[0027] In the model animal of the present invention, the function and / or expression of the ADH5 gene targeted by the present invention is lost or reduced. That is, in the model animal of the present invention, a mutation is introduced into the ADH5 gene so that the function and / or expression of the ADH5 gene targeted by the present invention is lost or reduced. Here, the "function" of the ADH5 gene refers to the original activity of the ADH5 protein, and the enzymatic activity of converting formaldehyde to formic acid in a glutathione-dependent manner. In addition, the "expression" of the ADH5 gene includes both the expression of ADH5 mRNA and the expression of the ADH5 protein, but is preferably the expression of the ADH5 protein. "Deficient" refers to the activity of the ADH5 protein and / or the expression level of the ADH5 gene being below the detection limit for a sample obtained from the model animal of the present invention. Furthermore, "reduced" indicates that, for a sample obtained from the model animal of the present invention, the activity of the ADH5 protein and / or the expression level of the ADH5 gene are lower than the activity of the ADH5 protein and / or the expression level of the ADH5 gene before the introduction of the mutation (e.g., 1 / 20, 1 / 50, 1 / 100, 1 / 200, 1 / 500, 1 / 1000, 1 / 2000, 1 / 5000, 1 / 10000 or less). The activity of the ADH5 protein and / or the expression level of the ADH5 gene can be measured according to a known method.

[0028] The mutation introduced into the ADH5 gene is not particularly limited as long as it is a mutation that causes a loss or decrease in the function and / or expression of the ADH5 gene. Examples of the mutation include gene loss (gene disruption), a mutation in a protein coding region, a mutation in a splicing regulatory region, and a mutation in an expression control region (e.g., promoter, activator, enhancer, etc.). Examples of the mutation in a protein coding region include mutations corresponding to S75N and A278P in human ADH5 protein. Among these, gene loss (gene disruption) is preferable. In the model animal of the present invention, the ADH5 gene has a mutation in both of the paired chromosomes.

[0029] The model animal of the present invention has a mutation that reduces the function and / or expression of the ALDH2 gene that is the target of the present invention in one or both of the paired chromosomes. That is, in the model animal of the present invention, a mutation is introduced into the ALDH2 gene that is the target of the present invention in one or both of the paired chromosomes so that the function and / or expression of the ALDH2 gene is reduced. Examples of the mutation include a mutation in a protein coding region, a mutation in a splicing regulatory region, and a mutation in an expression control region (e.g., a promoter, an activator, an enhancer, etc.). The mutation is preferably a mutation (amino acid substitution, deletion, insertion) in the protein coding region of the ALDH2 gene. Here, the "function" of the ALDH2 gene refers to the original activity of the ALDH2 protein, the enzymatic activity of converting acetaldehyde to acetic acid. In addition, "reduced" means that the activity of ALDH2 protein and / or the expression level of ALDH2 gene in a sample obtained from the model animal of the present invention does not disappear, but is lower than the activity of ALDH2 protein and / or the expression level of ALDH2 gene before the introduction of mutation (for example, 1 to 30%, preferably 2 to 20%, more preferably 5 to 10%). This makes it possible to obtain a model animal that is more suitable for analysis, in which the survival period can be extended while exhibiting at least one phenotype selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction. The activity of ALDH2 protein and / or the expression level of ALDH2 gene can be measured according to a known method.

[0030] The mutation in the protein coding region of the ALDH2 gene is not particularly limited as long as it is a mutation that reduces the function of the ALDH2 gene. +) is added (coenzyme binding pocket region), the central region of catalytic activity (cysteine ​​residues as the active center, etc.), and the adhesive region for forming a multimer (multimer formation region). In the model animal of the present invention, the function-decreasing mutation of the ALDH2 gene is preferably a mutation that causes a mutation in the multimer formation region of the ALDH2 protein. The mutation in the multimer formation region is preferably a mutation of E506 (glutamic acid, the 506th amino acid from the N-terminus) of mouse ALDH2 protein (SEQ ID NO: 9) or an amino acid corresponding thereto in other organisms. The corresponding amino acid in other organisms can be easily identified by identity analysis with mouse ALDH2 protein. More specifically, for example, when the amino acid sequence of mouse ALDH2 protein (SEQ ID NO: 9: amino acid sequence 1) is compared with the amino acid sequence (amino acid sequence 2) of an organism other than mouse, and the two are aligned in parallel so as to maximize the identity, the residue in amino acid sequence 2 that corresponds to the amino acid residue E506 in amino acid sequence 1 (preferably an acidic amino acid residue, more preferably a glutamic acid residue) can be determined to be the "corresponding amino acid". The mutation in E506 in mouse or the corresponding amino acid in other species is preferably a substitution mutation, more preferably a substitution to lysine or the like.

[0031] In the model animal of the present invention, when the ALDH2 gene has a function-reducing mutation in the protein coding region, preferably a mutation in the multimer formation region, more preferably a mutation in mouse E506 or a corresponding amino acid, it is preferable that only one of the paired chromosomes has the mutation.

[0032] The model animal of the present invention has at least one phenotype selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction (preferably mental retardation). More specific examples of the phenotype include anemia, bone marrow cell deficiency, microcephaly, low body weight, organ shrinkage, low muscle mass, low fat mass (particularly low subcutaneous fat mass), spinal deformity, leukemia, and mental retardation.

[0033] In one aspect, the present invention also relates to a cell (sometimes referred to herein as the "cell of the present invention") that has a defective or reduced function and / or expression of the ADH5 gene and has a mutation that reduces the function and / or expression of the ALDH2 gene in one or both of a paired chromosome.

[0034] The cells of the present invention can be used as at least one model cell selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction (preferably mental retardation), for example, in the analysis of the disease, screening of therapeutic drugs, etc. The cells are not particularly limited, whether they are primary cultured cells or cell lines, and examples thereof include nerve cells, blood cells, hematopoietic stem cells / progenitor cells, gametes (sperm, ova), fibroblasts, epithelial cells, vascular endothelial cells, hepatocytes, keratinocytes, muscle cells, epidermal cells, endocrine cells, ES cells, iPS cells, tissue stem cells, cancer cells, etc. The organisms from which the cells are derived are also not particularly limited, and examples thereof include mammals such as humans, monkeys, mice (Mus musculus), rats, dogs, cats, rabbits, pigs, horses, cows, sheep, goats, and deer.

[0035] 3. Methods for producing model animals and cells The method for producing the model animal and the cell of the present invention is not particularly limited, and various known techniques for producing genetically modified animals can be used. For example, the following method can be mentioned.

[0036] In one aspect, the present invention relates to a method for producing at least one model animal selected from the group consisting of hematopoietic insufficiency, developmental retardation, high carcinogenicity, and mental dysfunction, comprising introducing mutations into the ADH5 gene and the ALDH2 gene in animal cells (sometimes referred to herein as the "production method of the present invention").

[0037] The cells to be mutagenized are not particularly limited, but from the viewpoint of the efficiency of producing model animals, fertilized eggs are preferable.

[0038] The method for introducing the mutation is not particularly limited, but from the viewpoint of the efficiency of producing a model animal, examples include a method of introducing an introducer containing at least one selected from the group consisting of a target-specific nuclease, an expression cassette for the nuclease, and the mRNA for the nuclease, as well as donor DNA, into a cell.

[0039] The target-specific nuclease is not particularly limited as long as it is a nuclease that can specifically cleave a specific site on genomic DNA to induce mutation. Examples of target-specific nucleases include Cas protein, TALEN protein, ZFN protein, etc.

[0040] The CRISPR / Cas system uses a Cas protein, which is a nuclease (RGN; RNA-guided nuclease), and a guide RNA. By introducing the system into a cell, the guide RNA binds to the target site, and the Cas protein that is called to the binding site can cut DNA.

[0041] The TALEN system using TALEN protein uses artificial nuclease (TALEN) that contains DNA cleavage domain (e.g. FokI domain) and also DNA binding domain of transcription activator-like (TAL) effector. By introducing the system into cells, TALEN binds to target site via DNA binding domain and cleaves DNA at the target site. The DNA binding domain that binds to target site can be designed according to known scheme (e.g. Zhang F et al. (2011) Nature Biotechnology 29 (2); this paper is incorporated herein by reference).

[0042] The ZFN system using ZFN protein uses artificial nuclease (ZFN) that comprises a nucleic acid cleavage domain that is conjugated to a DNA binding domain that comprises zinc finger array.By introducing this system into cells, ZFN binds to target site via DNA binding domain and cleaves DNA there.The DNA binding domain that binds to target site can be designed according to known scheme.

[0043] Among target-specific nucleases, Cas proteins are preferred from the viewpoint of being able to more freely determine the cleavage site, and a preferred example of the Cas protein is the Cas9 protein.

[0044] The target-specific nuclease expression cassette is not particularly limited as long as it is a DNA capable of expressing a target-specific nuclease in the cells of the subject of the production method of the present invention. A typical example of a target-specific nuclease expression cassette is a DNA containing a promoter and a target-specific nuclease coding sequence placed under the control of the promoter. The target-specific nuclease expression cassette may be a vector by itself or together with other sequences (e.g., a drug resistance gene, a replication origin, etc.). The type of vector is not particularly limited.

[0045] When the target-specific nuclease is a Cas protein, the introduced material in the production method of the present invention further includes at least one selected from the group consisting of a guide RNA expression cassette and a guide RNA.

[0046] The guide RNA is not particularly limited as long as it is used in the CRISPR / Cas system. For example, various types of guide RNAs can be used that can bind to a target site in genomic DNA and bind to a Cas protein, thereby guiding the Cas protein to the target site in genomic DNA.

[0047] The target-specific nuclease is not particularly limited as long as it is a nuclease that can specifically cleave a specific site on genomic DNA to induce mutation. Examples of target-specific nucleases include Cas protein, TALEN protein, ZFN protein, etc.

[0048] The CRISPR / Cas system uses a Cas protein, which is a nuclease (RGN; RNA-guided nuclease), and a guide RNA. By introducing the system into a cell, the guide RNA binds to the target site, and the Cas protein that is called to the binding site can cut DNA.

[0049] The TALEN system using TALEN protein uses artificial nuclease (TALEN) that contains DNA cleavage domain (e.g. FokI domain) and also DNA binding domain of transcription activator-like (TAL) effector. By introducing the system into cells, TALEN binds to target site via DNA binding domain and cleaves DNA at the target site. The DNA binding domain that binds to target site can be designed according to known scheme (e.g. Zhang F et al. (2011) Nature Biotechnology 29 (2); this paper is incorporated herein by reference).

[0050] The ZFN system using ZFN protein uses artificial nuclease (ZFN) that comprises a nucleic acid cleavage domain that is conjugated to a DNA binding domain that comprises zinc finger array.By introducing this system into cells, ZFN binds to target site via DNA binding domain and cleaves DNA there.The DNA binding domain that binds to target site can be designed according to known scheme.

[0051] Among target-specific nucleases, Cas proteins are preferred from the viewpoint of being able to more freely determine the cleavage site, and a preferred example of the Cas protein is the Cas9 protein.

[0052] The target-specific nuclease expression cassette is not particularly limited as long as it is a DNA capable of expressing a target-specific nuclease in the cells of the subject of the production method of the present invention. A typical example of a target-specific nuclease expression cassette is a DNA containing a promoter and a target-specific nuclease coding sequence placed under the control of the promoter. The target-specific nuclease expression cassette may be a vector by itself or together with other sequences (e.g., a drug resistance gene, a replication origin, etc.). The type of vector is not particularly limited.

[0053] When the target-specific nuclease is a Cas protein, the introduced material in the production method of the present invention further includes at least one selected from the group consisting of a guide RNA expression cassette and a guide RNA.

[0054] The guide RNA is not particularly limited as long as it is used in the CRISPR / Cas system. For example, various types of guide RNAs can be used that can bind to a target site in genomic DNA and bind to a Cas protein, thereby guiding the Cas protein to the target site in genomic DNA.

[0055] The target site of the target-specific nuclease is not particularly limited.

[0056] The donor DNA that can be used in the production method of the present invention is, for example, a donor DNA that contains at least a part of the ALDH2 gene and has a mutation that causes a mutation in the multimerization region of the ALDH2 protein encoded by the gene.

[0057] The donor DNA is a single-stranded DNA that contains a base sequence arranged in the following order from the 5' end: 5' homology arm sequence, donor DNA sequence, and 3' homology arm sequence.

[0058] The donor DNA sequence may be any base sequence, and is preferably a donor DNA sequence that contains a coding sequence for a multimerization region and in which a part of the multimerization region is mutated.

[0059] The 5' homology arm sequence is a homologous sequence to a base sequence on the 5' side outside the target site of a target-specific nuclease, and the 3' homology arm sequence is a homologous sequence to a base sequence on the 3' side outside the target site of a target-specific nuclease.

[0060] The method for introducing the substance into cells is not particularly limited, and known methods such as the microinjection method, the lentivirus method, the retrovirus method, etc. can be used.

[0061] The cells into which the mutation has been introduced can be developed into embryos as necessary, and transplanted into a foster mother to obtain offspring, thereby obtaining the model animal of the present invention.

[0062] The fertilized eggs, sperm, and embryos (e.g., frozen embryos) obtained during the above-mentioned production method of the present invention can develop into the model animal of the present invention, and these are also an embodiment of the present invention. In addition, fertilized eggs obtained by fertilizing the sperm and / or eggs of the model animal of the present invention are also fertilized eggs that can develop into the model animal of the present invention, and such fertilized eggs are also an embodiment of the present invention. These fertilized eggs are not particularly limited as long as they can be developed into a living organism from a frozen storage state, and examples of such fertilized eggs include eggs immediately after fertilization, pronuclear stage embryos, early embryos, and blastocysts.

[0063] Matters other than those explained above are the same as those explained in "2. Model animals and cells."

[0064] 4. Uses of model animals and cells The model animal of the present invention and the fertilized eggs, sperm, and embryos generated therefrom, as well as the cells of the present invention, can be used for analyzing the pathology, developing preventive methods, developing treatment methods, etc. of at least one disorder selected from the group consisting of hematopoietic failure, growth retardation, high carcinogenicity, and mental dysfunction.

[0065] In one aspect, the present invention relates to a method for screening for at least one preventive agent, ameliorator, or exacerbating agent selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction, using a model animal of the present invention, a fertilized egg or embryo developed therein, or a cell of the present invention.

[0066] The screening method is not particularly limited as long as it uses the model animal of the present invention or the cell of the present invention. For example, the screening method comprises steps (a), (b), and (c1) or (c2): (a) administering or contacting a test substance to the model animal according to any one of claims 1 to 6, the fertilized egg, sperm or embryo according to claim 7, or the cell according to claim 8; (b) evaluating at least one phenotype selected from the group consisting of hematopoietic deficiency, growth retardation, high carcinogenicity, and mental dysfunction of the model animal, the fertilized egg, sperm or embryo, or the cell to which a test substance has been administered or contacted; and (c1) when the phenotype is cured or alleviated, selecting the test substance as at least one preventive or ameliorative agent selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction; or (c2) when the phenotype is deteriorated, selecting the test substance as at least one exacerbating substance selected from the group consisting of hematopoietic failure, growth retardation, high carcinogenicity, and mental dysfunction; Includes.

[0067] The type of test substance is not particularly limited as long as it can be a candidate for a therapeutic drug, and examples thereof include proteins, peptides, non-peptide compounds (nucleotides, amines, carbohydrates, lipids, etc.), low molecular weight organic compounds, inorganic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc.

[0068] The administration can be carried out according to known methods, including enteral administration such as oral administration, tube feeding, and enema administration, and parenteral administration such as intravenous administration, intraarterial administration, intramuscular administration, intracardiac administration, subcutaneous administration, intradermal administration, and intraperitoneal administration.

[0069] The phenotype can be evaluated according to or in accordance with a known method. For example, phenotypes such as hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction can be evaluated by quantification of bone marrow cells, quantification of hematopoietic cell subsets, weight measurement, visual observation, CT analysis, dissection, behavioral tests, and the like.

[0070] The selected test substances are treated as candidate therapeutic substances and further analyzed to select useful therapeutic drugs.

[0071] Matters other than those explained above are the same as those explained in "2. Model animals and cells." EXAMPLES

[0072] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0073] Test Example 1. Creation of mutant mice Using the CRISPR / Cas9 method, Adh5 - / - We generated gene-edited mice carrying single or double mutations in ALDH2 and Aldh2-E506K (corresponding to human ALDH2-E504K, referred to herein as Aldh2-KI).

[0074] Specifically, the CRISPR / Cas9 method was performed as follows. The following reagents were purchased from Integrated DNA Technologies: HiFi Cas9 Nuclease V3, tracrRNA, crRNA (MmAdh5 exon2: TAAGGCTGCAGTCGCCTGGG (SEQ ID NO: 1), MmAldh2 exon12: GGCGTACACAGAAGTGAAGA (SEQ ID NO: 2)), and ssODN (MmAldh2-E506K: AGGGAGCTGGGCGAGTATGGCCTGCAGGCGTACACAaAgGTGAAaAcggTACGTACACAGCCTTCAG ACTCCGTGGCCTGGCC (SEQ ID NO: 3)). Frozen embryos (CLEA Japan) were thawed and cultured in KSOM medium (ARK Resource) to prepare mononuclear mouse embryos. For electroporation, 100-150 embryos 1 hour after thawing were placed in a chamber containing 40 μl of serum-free medium (Opti-MEM, Thermo) containing 100 ng / l HiFi Cas9 Nuclease V3, 100 ng / l Adh5 gRNA, 100 ng / l Aldh2 gRNA, and 300 ng / l ssODN. These were electroporated with a 5 mm gap electrode (CUY505P5, NepaGene) in a NEPA21 Super Electroporator (NepaGene). The poling pulse for electroporation was a voltage of 225 V, a pulse width of 1 ms for mouse embryos, a pulse interval of 50 ms, and a pulse number of 4. The first and second implantation pulses were a voltage of 20 V, a pulse width of 50 ms, a pulse interval of 50 ms, and a pulse number of 5. Mouse embryos that had developed to the two-cell stage after electroporation were transferred into the oviducts of surrogate females anesthetized with sevoflurane or isoflurane (Mylan).

[0075] Adh5 + / - Aldh2 WT / KI Female mice and Adh5 + / - Aldh2 KI / KI Male mice were mated and the offspring genotyped. - / - Aldh2 KI / KI Mice were born in approximate Mendelian ratios (Fig. 1 ).

[0076] Test Example 2. Phenotype Evaluation 1 The mice obtained in Test Example 1 were observed and weighed. The results are shown in Figures 2 and 3. - / - Aldh2 KI / KI The weight and size of the mice indicate that there is no prenatal growth retardation. - / - Aldh2 KI / KI In mice, severe growth retardation accompanied by poor weight gain was evident in all mice during the first 1-2 weeks after birth. - / - Aldh2 WT / KI Mice also express Adh5 between 2 and 6 weeks of age. - / - or Aldh2 KI / KI Lost weight compared to mice In addition, computed tomography (CT) and anatomical analysis were performed on the mice obtained in Test Example 1. CT analysis was performed on anesthetized mice using a CosmoScan FX system (RIGAKU) with the following parameters: X-ray tube (90 kV), current (88 A), field of view (60 mm), and voxel size (240 m). The data was analyzed and visualized using 3D Slicer v4.10.2. As a result, Adh5 - / - Aldh2 KI / KI At 3 weeks after birth, the mice exhibited small body size, extremely reduced organ size, reduced muscle and subcutaneous fat mass, and multisystem abnormalities including lordosis, but all animals were successfully breastfed by their mothers. - / - Aldh2 WT / KI So, at 6 months of age, Adh5 - / - Aldh2 KI / KI They showed similar symptoms to those in mice, but much milder. - / - Aldh2 WT / KI (8-9 months old) showed skin pigmentation in the tail and showed Fanconi anemia-like features. Furthermore, the survival rate of the mice obtained in Test Example 1 was measured. The results are shown in Figure 4. - / - Aldh2 KI / KIThe mice showed anemia and severe weakness and died of cachexia within 4 weeks of birth, whereas Adh5 - / - Aldh2 WT / KI Mice and mice with other genotypes did not suffer any survival disadvantage during this time. - / - or Aldh2 KI / KI The mice did not exhibit obvious developmental defects, consistent with previous reports.

[0077] Test Example 3. Phenotype Evaluation 2 Measurement of nucleated bone marrow cells and hematopoietic cell subsets was carried out for the mice obtained in Test Example 1. Specifically, the measurements were carried out as follows.

[0078] BM cells were flushed from femurs and tibias using a 26G needle, and spleens and thymuses were isolated by trituration followed by incubation with Ca2+ / Ca2+ supplemented with 1% heat-inactivated bovine serum (Gibco). 2+ and Mg 2+The cells were passed through a cell strainer in free Hank's Buffered Salt Solution (HBSS, Gibco). Red blood cells (RBCs) were lysed by resuspending the cells in RBC lysis buffer (eBioscience) for 5 min at room temperature. The cells were filtered through a 70 μm cell strainer to obtain a single cell suspension. Cell counts were measured with a hemocytometer. The antibodies used for FACS analysis were as follows: FITC-conjugated lineage cocktail (#133302, BioLegend), CD41 (FITC, #133903, BioLegend), FcεRIα (FITC, #134305, BioLegend), CD117 (APC, #105811, BioLegend), Sca-1 (PE, # 108107, BioLegend), CD48 (Brilliant Violet 421, #103428, BioLegend), CD150 (APC / Fire 750, #115940, BioLegend), CD135 (Brilliant Violet 421, #135313, BioLegend), CD127 (PE / Cy7, #135014, BioLegend), CD16 / 32 (Brilliant Violet 421, #135313, BioLegend), CD34 (APC / Fire 750, #135014, BioLegend), CD3ε (Alexa Fluor 488, #100321, BioLegend), CD19 (APC, #152410, BioLegend), CD4 (PE, #130310, BioLegend), CD8a (APC, #100712, BioLegend). Antibody staining was performed for 20 min at 4°C. Dead cells were excluded by staining with 7-AAD (BioLegend). Data were acquired on a CytoFLEX S FACS analyzer (Beckman Coulter) and analyzed with FlowJo v10.6.2.

[0079] Some of the results are shown in Figures 5 to 9. Adh5 in the pathological stage (3 weeks after birth) - / - Aldh2 KI / KIIn mice, the total number of nucleated bone marrow cells from the tibia and femur was significantly reduced compared to other animals. - c-Kit + Sca-1 + CD150 + CD48 - (CD150 + The number of multipotent self-renewing hematopoietic stem cells, defined as long-term hematopoietic stem cells (LT-HSCs), is increased by the Adh5 - / - Aldh2 KI / KI The levels of α-amyloides in mice were significantly decreased. - c-Kit + Sca-1 + CD150 - CD48 - (CD150 - Multipotent progenitor cells (MPPs) and Lin - c-Kit + Sca-1 + CD150 - CD48 + (CD48 + Immature hematopoietic progenitor cells, including hematopoietic stem cell-restricted progenitor type 1 (HPC-1) cells, were also observed. - c-Kit low Sca-1 low CD127 + CD135 + (Common lymphoid progenitors [CLPs]), Lin - c-Kit + Sca-1 - CD34 + CD16 / 32 - (CD34 + Common myeloid progenitor cells (CMPs) and Lin - c-Kit + Sca-1 - CD34 - CD16 / 32 - The number of further differentiated progenitors, including bispecific megakaryocyte / erythrocyte lineage-restricted progenitors [MEPs], was also significantly increased in Adh5. - / - Aldh2 KI / KI The levels of Adh5 in mice were significantly decreased. - / - Aldh2 KI / KICorresponding to the reduction in CLP in mice, the number of lymphocytes in peripheral blood and the weights of the thymus and spleen were reduced without any significant changes in lymphocyte distribution in these organs. - / - Aldh2 + / KI Mice did not show any abnormalities in bone marrow cells at 3 weeks of age, but at 8 to 9 months of age, the numbers of MPPs and CLPs were significantly reduced compared with mice lacking either the Adh5 or Aldh2 gene alone.

Claims

1. A model animal (excluding humans) that is a mammal in which the function and / or expression of the ADH5 gene is reduced compared to the activity of the ADH5 protein and / or the expression level of the ADH5 gene before the deletion or mutation is introduced, and that has a function-reducing mutation in the ALDH2 gene that causes a mutation in the multimerization region of the ALDH2 protein in only one of a pair of chromosomes, and that has at least one type selected from the group consisting of hematopoietic insufficiency, growth retardation, carcinogenicity, and mental dysfunction.

2. The model animal of claim 1 , wherein the ADH5 gene is deleted in both of a pair of chromosomes.

3. The model animal according to claim 1 , wherein the functionally reducing mutation in the ALDH2 gene is a mutation that causes a mutation in mouse ALDH2 protein E506 or a corresponding amino acid thereto.

4. The model animal according to claim 1 or 3, wherein the functionally reducing mutation in the ALDH2 gene is a mutation that causes a substitution of mouse ALDH2 protein E506 or a corresponding amino acid thereto with lysine.

5. The model animal according to any one of claims 1 to 4, wherein the mental dysfunction comprises mental retardation.

6. A fertilized egg or embryo which becomes the model animal according to any one of claims 1 to 5, A fertilized egg or embryo in which the function and / or expression of the ADH5 gene is reduced compared to the activity of the ADH5 protein and / or the expression level of the ADH5 gene before the deletion or mutation was introduced, and which has a function-reducing mutation in the ALDH2 gene that causes a mutation in the multimerization region of the ALDH2 protein in only one of the paired chromosomes.

7. A mammalian hematopoietic stem cell and / or progenitor cell, mammalian ES cell, or mammalian iPS cell, in which the function and / or expression of the ADH5 gene is reduced compared to the activity of the ADH5 protein and / or the expression level of the ADH5 gene before the deletion or mutation is introduced, and which has a function-reducing mutation in the ALDH2 gene that causes a mutation in the multimerization region of the ALDH2 protein in only one of the paired chromosomes.

8. (a) administering or contacting a test substance to the model animal according to any one of claims 1 to 5, or the fertilized egg or embryo according to claim 6; (b) evaluating at least one phenotype selected from the group consisting of hematopoietic deficiency, growth retardation, carcinogenicity, and mental dysfunction of the model animal to which a test substance has been administered or contacted, or the model animal developed from the fertilized egg or embryo; and (c1) when the phenotype is cured or alleviated, selecting the test substance as at least one preventive or ameliorative agent selected from the group consisting of hematopoietic deficiency, growth retardation, carcinogenicity, and mental dysfunction; or (c2) when the phenotype is aggravated, selecting the test substance as at least one exacerbating substance selected from the group consisting of hematopoietic failure, growth retardation, carcinogenicity, and mental dysfunction; A method for screening for at least one preventive agent, ameliorator, or exacerbating agent selected from the group consisting of hematopoietic insufficiency, growth retardation, carcinogenicity, and mental dysfunction, comprising:

9. (a) contacting a test substance with the cell according to claim 7, which is a hematopoietic stem cell and / or progenitor cell; (b) evaluating the hematopoietic deficiency phenotype of the cells contacted with the test substance; and (c1) selecting the test substance as an agent for preventing or improving hematopoietic failure when the phenotype is cured or alleviated; or (c2) selecting the test substance as a substance causing exacerbation of hematopoietic failure when the phenotype is aggravated; A method for screening for a preventive agent, ameliorating agent, or exacerbating agent for hematopoietic failure, comprising:

Images