Modulation of gene expression by aptamer-mediated control of alternative splicing

Abstract

To provide platforms and uses thereof for regulating target gene expression using exposure to aptamer ligands (e.g., small molecules).SOLUTION: Provided herein is a polynucleotide cassette for the regulation of the expression of a target gene comprising: a. a riboswitch; b. an alternatively-spliced exon, flanked by a 5' intron and a 3' intron, where the riboswitch comprises: (i) an effector region comprising a stem that includes the 5' splice site of the 3' intron, and (ii) an aptamer, where the alternatively-spliced exon comprises a stop codon that is in-frame with the target gene when the alternatively-spliced exon is spliced into the target gene mRNA.SELECTED DRAWING: Figure 1a

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Patent Application No. 62 / 110,919, filed February 2, 2015, which is incorporated by reference in its entirety. FIELD OF THE PRESENT APPLICATION

[0002] The present invention provides a platform and methods of using the platform to regulate expression of a target gene using exposure to a small molecule. The platform features a polynucleotide cassette that is placed within a target gene and includes a synthetic riboswitch arranged in a 5' intron-alternative exon-3' intron context. The riboswitch includes an effector region and an aptamer that binds a ligand (e.g., a small molecule) and provides control of target gene expression upon exposure to the ligand. [Background technology]

[0003] Splicing refers to the process by which intron sequences are removed from the nascent pre-messenger RNA (pre-mRNA) and exons are joined together to form the mRNA. Splice sites are located at the junctions between exons and introns and are defined by distinct consensus sequences at the 5' and 3' ends of the intron (i.e., splice donor and splice acceptor sites, respectively). Alternative pre-mRNA splicing, or alternative splicing, is a widespread process that occurs in the majority of human genes that contain multiple exons. It is carried out by a number of multicomponent structures called spliceosomes, which are collections of small nuclear ribonucleoproteins (snRNPs) and a wide variety of accessory proteins. By recognizing various cis-regulatory sequences, the spliceosome defines exon / intron boundaries, removes intron sequences, and splices the exons into the final translatable message (i.e., mRNA). In the case of alternative splicing, particular exons can be included or removed to alter the ultimate encoded message, thereby altering the resulting expressed protein. Summary of the Invention [Problem to be solved by the invention]

[0004] Regulation of the expression of target genes (e.g., therapeutic transgenes) is necessary in a variety of situations. In the context of therapeutic expression of genes, technologies that allow regulated expression of transgenes have the potential to enhance safety by controlling the level and timing of expression. Regulated systems for controlling protein expression are practical and, in some cases, play a crucial role for safe and effective therapeutic applications. [Means for solving the problem]

[0005] In one aspect, the invention provides a polynucleotide cassette for regulating expression of a target gene comprising (a) a riboswitch and (b) an alternatively spliced ​​exon flanked by a 5' intron and a 3' intron, wherein the riboswitch comprises (i) an effector region comprising a stem including the 5' splice site of the 3' intron, and (ii) an aptamer, wherein the alternatively spliced ​​exon comprises a stop codon in frame with the target gene when spliced ​​into the target gene mRNA. In one embodiment, the aptamer specifically binds a small molecule ligand.

[0006] In one embodiment, a polynucleotide for regulating expression of a target gene ("gene regulatory cassette", "regulatory cassette" or "polynucleotide cassette") comprises 5' and 3' introns derived from endogenous introns from the target gene. In one embodiment, the 5' and 3' introns are exogenous to the target gene. In one embodiment, the 5' and 3' introns are derived from intron 2 of the human β-globin gene. In one embodiment, the 5' intron comprises a stop codon in frame with the target gene. In one embodiment, the 5' and 3' introns are each independently from about 50 to about 300 nucleotides in length. In one embodiment, the 5' and 3' introns are each independently from about 125 to about 240 nucleotides in length. In one embodiment, the 5' and / or 3' intron comprises or has been modified to alter the sequence of an intron splice enhancer, intron splice enhancer, 5' splice site, 3' splice site, or branch point sequence.

[0007] In one embodiment, the effector region stem of the riboswitch is about 7 to about 20 base pairs in length, hi one embodiment, the effector region stem is 8 to 11 base pairs in length.

[0008] In one embodiment, the alternatively spliced ​​exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), mutated human Wilms tumor 1 exon 5, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6. In one embodiment, the alternatively spliced ​​exon is a modified DHFR exon 2 from SEQ ID NO: 15. In one embodiment, the alternatively spliced ​​exon has been modified by one or more of the group consisting of altering the sequence of an exon splice silencer, altering the sequence of an exon splice enhancer, adding an exon splice enhancer, and adding an exon splice donor. In one embodiment, the alternatively spliced ​​exon is synthetic (i.e., not derived from a naturally occurring exon).

[0009] In another aspect, the invention provides a method of modulating expression of a target gene comprising: (a) inserting a polynucleotide cassette of the invention (e.g., as described above and herein) into the target gene; (b) introducing the target gene comprising the polynucleotide cassette into a cell; and (c) exposing the cell to a small molecule ligand that specifically binds to the aptamer in an amount effective to induce expression of the target gene.

[0010] In one embodiment, expression of the target gene is about 5-fold greater in the presence of the small molecule ligand compared to the expression level in the absence of the small molecule ligand, hi one embodiment, expression of the target gene is about 10-fold greater in the presence of the small molecule ligand compared to the expression level in the absence of the small molecule ligand.

[0011] In one embodiment, the polynucleotide cassette is inserted into the protein coding region of the target gene. In one embodiment, two or more polynucleotide cassettes are inserted into the target gene. In one embodiment, the two or more polynucleotide cassettes contain different aptamers that specifically bind to different small molecule ligands. In another embodiment, the two or more polynucleotide cassettes contain the same aptamer or different aptamers that specifically bind to the same ligand.

[0012] In one embodiment, the target gene comprising the polynucleotide cassette is incorporated into a vector for expression of the target gene. In one embodiment, the vector is a viral vector. In a further embodiment, the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector.

[0013] In another aspect, the invention provides a method of regulating expression of a target gene in a mammalian eye, the method comprising: (a) introducing into the eye a vector comprising a target gene including (i) a riboswitch and (ii) a polynucleotide cassette comprising a 5' intron and an alternatively spliced ​​exon flanked by a 3' intron, where the synthetic riboswitch comprises an effector region comprising a stem including the 5' splice site of the 3' intron, and an aptamer that specifically binds to a ligand, where the alternatively spliced ​​exon comprises a stop codon in-frame with the target gene when the alternatively spliced ​​exon is spliced ​​into the target gene mRNA; and (b) providing to the mammal a ligand in an amount effective to induce expression of the target gene. In one embodiment, the ligand is a small molecule.

[0014] In one embodiment, the vector is introduced into the eye by intraocular injection. In one embodiment, the vector is a viral vector. In one embodiment, the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector.

[0015] In one embodiment, a polynucleotide for regulating expression of a target gene in the eye comprises 5' and 3' introns derived from endogenous introns from the target gene. In one embodiment, the 5' and 3' introns are exogenous to the target gene. In one embodiment, the 5' and 3' introns are derived from intron 2 of the human β-globin gene. In one embodiment, the 5' intron comprises a stop codon in frame with the target gene. In one embodiment, the 5' and 3' introns are each independently from about 50 to about 300 nucleotides in length. In one embodiment, the 5' and 3' introns are each independently from about 125 to about 240 nucleotides in length. In one embodiment, the 5' and / or 3' introns comprise or have been modified to alter the sequence of an intron splice enhancer, an intron splice enhancer, a 5' splice site, a 3' splice site, or a branch point sequence. In one embodiment, the effector region stem of the riboswitch is from about 7 to about 20 base pairs in length. In one embodiment, the effector region stem is 8-11 base pairs in length. In one embodiment, the alternatively spliced ​​exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), mutated human Wilms tumor 1 exon 5, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6. In one embodiment, the alternatively spliced ​​exon is a modified DHFR exon 2 from SEQ ID NO: 15, a modified exon 2 from human DHFR. In one embodiment, the alternatively spliced ​​exon has been modified by one or more of the group consisting of altering the sequence of an exon splice silencer, altering the sequence of an exon splice enhancer, adding an exon splice enhancer, and adding an exon splice donor. In one embodiment, the alternatively spliced ​​exon is synthetic (i.e., not derived from a naturally occurring exon).

[0016] In one aspect, the invention provides a recombinant polynucleotide comprising a target gene (e.g., as described above) that includes a polynucleotide cassette for regulated expression of the target gene, hi one embodiment, the polynucleotide cassette is positioned within the protein coding sequence of the target gene.

[0017] In one aspect, the present invention provides a vector comprising a target gene comprising a polynucleotide cassette for regulated expression of the target gene (e.g., as described above). In one embodiment, the vector is a viral vector. In one embodiment, the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector. [Brief description of the drawings]

[0018] [Figure 1a] Schematic diagram of the splicing construct "Con1" with a truncated human β-globin intron 2 (IVS2Δ) inserted within the coding sequence of the luciferase gene. The designations "Luci Exon 1" and "Luci Exon 2" refer to the division of the luciferase gene into 5' and 3' coding sequences. Splicing of the inserted intron sequence IVS2Δ results in a full-length mRNA that is translated into a full-length protein. [Figure 1b] Effects of intron insertion and splice site sequences on luciferase expression. Con1 to Con7 have different intron splice sites (see Table 1). Con1 has IVS2Δ with its native IVS2 5' and 3' splice sites ("5'ss" and "3'ss", respectively). Con2 to Con7 have IVS2Δ insertions but with different 5'ss and 3'ss sequences as listed in Table 1. Con8 does not have the IVS2Δ intron. Con1 to Con3 demonstrated no effect of intron insertion on luciferase expression compared to the luciferase control without intron insertion (Con8). Con4 to Con7, with weaker splice sites, showed reduced luciferase expression. [Figure 2a] Schematic diagram of an intron-exon-intron cassette with exon inclusion (I) and exclusion (II) splicing patterns indicated. The star (◆) denotes a stop codon in DHFR exon 2. When an alternative DHFR exon is included in the target gene (luciferase) mRNA by splicing (I), the resulting transcript contains an in-frame stop codon, which prevents luciferase gene expression. Only when the stop codon-containing alternative DHFR exon is excluded from the final mRNA is the target gene expressed (II). [Figure 2b] Effect of inclusion or exclusion of DHFR alternative exons on expression of the luciferase gene. Luciferase assays were performed on HEK293 cells transfected with various luciferase reporter constructs containing the intron-exon-intron cassettes shown in Figure 2a. DHFR exon 2 with a wild-type splice site sequence (DHFR_wt) was compared with DHFR exons that either contained a mutation in the 5'ss (DHFR_wt5ssC) or had the natural 5'ss replaced with the stronger Con1 5'ss (DHFR_Con15ss), or had a weak 5'ss from Con4 (DHFR_Con45ss). The construct used in lane 1 of 2b and 2c is Con1, and is shown in Figure 1 and Example 1. Insertion of DHFR exon 2 into luciferase mRNA caused a decrease in luciferase expression, but not when the 5'ss (i.e., splice donor) of DHFR exon 2 was mutated (DHFR_wt compared to DHFR_wt5ssC). When the 5'ss of the DHFR exon was replaced with the stronger 5'ss from Con1 (construct DHFR-Con1 5'ss), inclusion of the DHFR exon was promoted and led to a 545-fold lower luciferase expression compared to Con1. When the weak 5'ss (from Con4 in Example 1) was used to replace the wild-type 5'ss, the reduced splicing of this site prevented DHFR exon inclusion, thereby allowing enhanced luciferase expression. [Figure 2c] Exonic splicing enhancer (ESE) or suppressor (ESS) elements within DHFR exon sequences affect the splicing of alternative DHFR exons and regulate the expression of target genes. Mutation of the SRp40 binding site within DHFR exon 2 led to a drastic reduction in luciferase expression: there was a 2,982-fold difference between DHFR_wtmtSRp40 and Con1 expression (Fig. 2c DHFR_wtmtSRp40; Table 2). Mutation of the putative binding site of the splicing enhancer SC35 to create a stronger SC35 binding site (Table 2, StrSC35) further reduced luciferase expression (139-fold) compared to Con1 (Fig. 2c DHFR_wtStrSC35), likely due to an enhanced efficiency of inclusion of the DHFR exon. Replacement of the binding site of the splicing enhancer SC35 with that of the splicing inhibitor hnRNP A1 (Table 2, SC35hnRNP A1) led to a 4.3-fold increase in luciferase expression compared to wild-type DHFR exon 2 (Fig. 2c, DHFR_wt SC35hnRNP A1). [Figure 3a] Schematic diagram of an intron-exon-intron cassette containing a hairpin structure at the 5'ss of alternative DHFR exon 2. When the DHFR 5'ss is embedded within the hairpin structure, the DHFR exon is not included in the transcript and thus luciferase can be expressed (X represents the DHFR exon 5'ss embedded within the hairpin). [Figure 3b] The sequences and structures of the four different hairpins tested in the intron-exon-intron cassette illustrated in Figure 3a. [Figure 3c]Effect of hairpin structure in 5'ss of DHFR exon 2 on target gene expression. Constructs encompassing DHFR exons with Con1 5'ss sequence efficiently suppress luciferase expression due to inclusion of the DHFR exon in the spliced ​​mRNA (DHFR_Con15ss, FIG. 3c). However, embedding the 5'ss of the DHFR exon in a hairpin structure effectively prevents inclusion of the DHFR exon and allows luciferase expression (DHFR_Con1 5ss_HP15 FIG. 3c). Hairpin sequences with disrupted stems do not restore luciferase expression (FIG. 3c.DHFR_Con15ss_HP15x). The DHFR_wtmtSRp40 construct (Example 2) does not express luciferase unless the 5'ss of the DHFR exon is stably sequestered in a hairpin structure (DHFR_wtmtSRp40_HP15). Destabilization of the hairpin prevents luciferase expression in conjunction with a mutant SRp40 binding site with strong splicing activity (DHFR_wtmtSRp40_HP15x). [Figure 4a-4b] Schematic diagram of gene regulation by an intron-exon-intron regulatory cassette encompassing a synthetic riboswitch. In the absence of aptamer / ligand binding, the aptamer sequence disrupts hairpin stem formation, leaving the DHFR exon 5'ss available and leading to inclusion of the DHFR exon, thereby preventing translation and disrupting protein expression (Figure 4a). When aptamer / ligand binding occurs, a ligand-dependent conformational change in the aptamer stabilizes stem formation and sequesters the 5'ss of the DHFR exon, resulting in DHFR exon exclusion and luciferase gene expression (Figure 4b). [Figure 4c]Hairpin stem and theophylline aptamer geometries with different connecting stem lengths. The stem of the theophylline aptamer is directly ligated to the stem of the hairpin isolating the DHFR exon 5'ss, creating a synthetic stem of 20 bp. The stem sequence is truncated to create a series of hairpins with different stem lengths. Stem structures of DHFR_Theo1, 12, 13, and 14 with stem lengths of 20 bp, 9 bp, 8 bp, and 7 bp, respectively, are shown. Theophylline is symbolized as (▲). [Figure 4d] Effect of different stem lengths using theophylline aptamer on target gene expression in the presence and absence of theophylline. Graph showing luciferase expression regulated by theophylline aptamer containing regulatory cassette produced as described in Example 4 (FIG. 4c). In constructs Theo1 to 12 with stem lengths from 20 bp down to 9 bp, the hairpin stem was long enough to form a stable structure in the absence of aptamer / ligand binding. DHFR_Theo13 did not form a stable hairpin stem even in the absence of ligand, which resulted in the inclusion of the DHFR exon 5'ss without concealment, preventing luciferase expression. In the presence of theophylline, the hairpin is stable and therefore the DHFR exon 5'ss is unavailable to the splicing machinery. This results in the exclusion of the DHFR exon and allows luciferase expression. In the presence of 3 mM theophylline, DHFR_Theo_13 demonstrates a 43-fold induction over the uninduced baseline level of expression. DHFR_Theo_14 shows no luciferase expression with or without theophylline, suggesting that the 7 bp stem is too short to form a stable hairpin even when the aptamer binds to its ligand. As a result, the DHFR exon is spliced ​​into the transcript and luciferase expression is prevented. [Figure 5a-1]The sequence of the synthetic stem connecting the xpt-guanine aptamer and the DHFR exon 5'ss sequence, generated by sequential cleavage of the hairpin stem and the aptamer PI stem. Guanine is symbolized as (●). [Figure 5a-2] The sequence of the synthetic stem connecting the xpt-guanine aptamer and the DHFR exon 5'ss sequence, generated by sequential cleavage of the hairpin stem and the aptamer PI stem. Guanine is symbolized as (●). [Figure 5b] Effect of stem length on the ability of riboswitches to regulate luciferase expression in response to aptamer ligand binding. Eighteen riboswitches of different stem lengths were inserted into a regulatory cassette and the constructs were transfected into HEK293 cells and cultured in the presence or absence of 500 μM guanine. In the absence of guanine, constructs G14 to G18 demonstrate reduced luciferase expression compared to the unregulated Con1 control. In the presence of guanine, luciferase expression was restored to varying degrees. [Figure 5c] Further analysis of the effect of stem length on the ability of the riboswitch to regulate luciferase expression in response to aptamer ligand binding. Constructs G11 through G18 were validated using a luciferase assay. [Figure 5d] Figure 5d shows the basal and induced levels of luciferase relative to Con1. In the absence of guanine, constructs G14 to G17 demonstrate clear regulation of luciferase expression by the aptamer ligand (in this case guanine). In the absence of guanine, luciferase expression levels are low. In the presence of guanine, luciferase expression was significantly activated. Figure 5d shows the % of Con1 control expression achieved for these regulated constructs upon induction with guanine. [Figure 5e]A regulatory cassette containing the xpt-G17 riboswitch allowed for ligand-responsive regulation of gene expression in a number of different mammalian cell types. DHFR_G17 was transfected into HepG2, AML12, RD and C2C12 cell lines and assayed for inducible luciferase expression upon treatment with guanine. Fold induction of luciferase expression is shown when cells are cultured in the presence of ligand, compared to uninduced baseline expression levels in which no guanine was added to the cell culture medium. [Figure 5f] Regulation of luciferase by xpt-G17 containing regulatory cassette associated with viral vector. A construct with luciferase gene containing xpt-G17 regulatory cassette was transferred into AAV vector backbone and used to transfect cells. Cells were cultured in the presence or absence of guanine. Fold induction of luciferase in the presence of guanine is shown, and 1687-fold induction of expression was seen upon treatment with guanine. [Figure 5g] Regulation of antibodies by regulatory cassettes in response to aptamer-binding ligands. An intron-exon-intron regulatory cassette with an xpt-G17 riboswitch was inserted within the leader peptide sequence of an anti-KDR antibody sequence, and the resulting construct was transfected into HEK293 cells. As assayed by ELISA, there was an 80-fold induction of antibody protein expression by treatment of transfected cells with ligand compared to untreated cells. The induced expression level reached approximately 40% of the control construct containing the Con1 intron sequence. [Figure 5h] Regulation of secreted erythropoietin protein (EPO) by a regulatory cassette responsive to aptamer / ligand binding. An intron-exon-intron regulatory cassette with an xpt-G17 riboswitch was inserted into the mouse erythropoietin (Epo) gene and the resulting construct was transfected into HEK293 cells. Low levels of EPO expression were observed in the absence of guanine, as assayed by ELISA. In the presence of guanine, a 140-fold induction of EPO expression was observed. [Figure 6a]Various purine riboswitch stem constructs were tested with the regulatory cassette. Purines are symbolized as ●. [Figure 6b] Figures 6b-6e. Dose response of constructs with regulatory cassettes containing different aptamer-based riboswitches (the riboswitch stem illustrated in Figure 6a). Figure 6b is the response of the guanine aptamer-containing regulatory cassette to guanine. [Figure 6c] FIG. 6c is the response of a guanine aptamer-containing regulatory cassette to guanosine. [Figure 6d] FIG. 6d is the response of a guanine aptamer-containing regulatory cassette to 2′dG. [Figure 6e] FIG. 6e is the response of the adenine aptamer-containing regulatory cassette to adenine. [Figure 7a] Induction of EGFP using the xpt-G17 inclusion regulatory cassette by guanine. An intron-exon-intron cassette with the xpt-G17 riboswitch was cloned into the EGFP gene. HEK293 cells stably transfected with the construct were treated with 500 μM guanine, and GFP expression was assayed by flow cytometry analysis 6 hours after treatment. Guanine treatment resulted in enhanced EGFP expression, FIG. 7a, (B). [Figure 7b] Target gene expression in response to the presence or absence of ligand. HEK293 cells stably transfected with EGFP carrying an intron-exon-intron cassette containing a riboswitch encompassing xpt-G17 were treated with 500 μM guanine for 3 days and assayed by flow cytometry analysis every 24 hours for 3 days. The guanine-containing medium was washed from the cells and they were continued to be cultured without guanine treatment for an additional 10 days and EGFP expression was observed. EGFP expression increased when guanine was present in the cell medium. Withdrawal of guanine-EGFP resulted in loss of expression. [Figure 8a]Luciferase expression regulated by two copies of the xpt-G15 containing regulatory cassette. The graph shows the guanine dose response of constructs with a single xpt-G17 or xpt-G15 containing regulatory cassette inserted into the target gene, and a construct with a regulatory cassette containing two copies of xpt-G15 (xpt-G15 double). [Figure 8b] EGFP expression in tissue culture cells regulated by different regulatory cassettes. A cassette containing one copy of xpt-G17 (EGFP-xpt-G17) results in low uninduced baseline expression (A) and reaches a lower induced level of expression (D) compared to cells containing the EGFP-xpt-G15 construct. A cassette containing one copy of xpt-G15 (EGFP-xpt-G15) gave higher uninduced baseline expression (B) as well as higher induced expression (E). A construct containing a cassette containing two copies of xpt-G15 (EGFP-xpt-G15 double) reduced background uninduced expression (C) without reducing induced expression levels (F), thereby enhancing the fold induction. Cells were treated with guanine and imaged 24 hours after treatment. [Figure 8c] Regulatory cassettes containing the xpt-G15 and xpt-G17 riboswitches responded to both guanine and guanosine. Quantification of EGFP expression (mean fluorescence intensity) was analyzed by flow cytometry, and fold induction was calculated by dividing the mean fluorescence intensity (MFI) obtained with guanine or guanosine treatment by the MFI obtained without treatment. Treatment with guanine and guanosine gave similar levels and fold induction. [Figure 8d] Luciferase expression from a construct containing a regulatory cassette containing one copy of Ydhl-A5 plus one copy of xpt-G17. HEK293 cells transfected with this construct were treated with guanine or adenine, or both. The highest induction of luciferase was seen with the combination of both ligands at their highest concentrations. [Figure 9a]Effect of intron truncation on luciferase expression regulated by an intron-exon-intron regulatory cassette containing the xpt-G17 riboswitch. Figure 9a shows the fold induction and Figure 9b shows the luciferase expression rate compared to Con1. [Figure 9b] Effect of intron truncation on luciferase expression regulated by an intron-exon-intron regulatory cassette containing the xpt-G17 riboswitch. Figure 9a shows the fold induction and Figure 9b shows the luciferase expression rate compared to Con1. [Figure 9c] Schematic representation of the sequences deleted from the intron-exon-intron regulatory construct DHFR_G17. The deleted sequences are indicated by open bars and the remaining sequences are indicated by filled horizontal bars. [Figure 9d] The effect of various intron deletions on gene regulation shown in Figure 9c. Sequences within introns flanking alternative DFIFR exons altered exon splicing and relative gene regulation. For example, DHFR-G17_2IR_3 shows an intron deletion that results in a significant increase in the fold of target gene expression. Figure 9d shows the fold induction, whereas Figure 9e shows the absolute levels of protein expression relative to the Con1 control. [Figure 9e] The effect of various intron deletions on gene regulation shown in Figure 9c. Sequences within introns flanking alternative DFIFR exons altered exon splicing and relative gene regulation. For example, DHFR-G17_2IR_3 shows an intron deletion that results in a significant increase in the fold of target gene expression. Figure 9d shows the fold induction, whereas Figure 9e shows the absolute levels of protein expression relative to the Con1 control. [Figure 10a] Different exons can function as alternative exons in an intron-exon-intron regulatory cassette to regulate gene expression. Figure 10a shows that constructs with different exons have different uninduced baseline and induced (500 μM guanine) levels of luciferase expression. [Figure 10b]FIG. 10b shows the fold induction with these constructs, and CaMKIId-e16 produced a similar fold induction as the DHFR exon with an SRp40 activating mutation (mtDHFR). [Figure 11a] Regulation of luciferase expression in mice in vivo. A construct containing two copies of the xpt-G15 regulatory cassette (xpt-G15 double, Example 8, FIG. 8a) was delivered to mouse liver by hydrodynamic injection. Mice were orally administered various doses of guanosine 2 and 12 hours after DNA delivery and then imaged. Oral administration of the ligand resulted in dose-dependent activation of expression of the regulated target genes in mouse liver (FIGS. 11a and 11b). [Figure 11b] Regulation of luciferase expression in mice in vivo. A construct containing two copies of the xpt-G15 regulatory cassette (xpt-G15 double, Example 8, FIG. 8a) was delivered to mouse liver by hydrodynamic injection. Mice were orally administered various doses of guanosine 2 and 12 hours after DNA delivery and then imaged. Oral administration of the ligand resulted in dose-dependent activation of expression of the regulated target genes in mouse liver (FIGS. 11a and 11b). [Figure 11c] In another experiment, guanosine was administered intraperitoneally (FIG. 11c). Images show luciferase expression before and after guanosine treatment with either a 100 mg / kg or 300 mg / kg dose. [Figure 11d] In the graph (FIG. 11d), luciferase activity is expressed as mean photons / sec / mm2±sd (n=5). [Figure 12] EGFP transgene expression mediated by riboswitch-based AAV vectors in mouse retina. Fluorescent fundus photograph (exposure time: 30 s) showing AAV2 / 8-GTX7-mediated EGFP transgene expression in the retina 8 days after subretinal injection. [Figure 13a]Representative fundus images in a single mouse eye subretinally injected with AAV2 / 8-GTX7 showing the variation of EGFP transgene expression in the retina over time. A-E: Images taken under white light illumination with 200 ms exposure time 2, 8, 9, 10 and 12 days after vector injection. Circle indicates retinal area visible through the pupil that was considered as ROI for quantification. F-J: Images taken under 475 ± 25 nm light illumination with 30 s exposure time showing eGFP fluorescence 2, 8, 9, 10 and 12 days after vector injection. K-O: Images taken under 475 ± 25 nm light illumination with 30 s exposure time 2, 8, 9, 10 and 12 days after vector injection highlighting pixels above intensity threshold 50 within the ROI (circle). [Figure 13b] FIG. 13b shows high resolution images before (A) and after (B) induction. [Figure 13c] EGFP transgene expression in mouse retina quantified over time after subretinal injection of AAV2 / 8-GTX7. Fluorescent fundus photographs were taken at the following time points: 2, 8, 9, 10 and 12 days after subretinal injection of AAV2 / 8-GTX7. Exposure time: 30 seconds, pixel intensity threshold for analysis: 50. Intraperitoneal induction was performed after imaging at 8, 9 and 10 days after subretinal injection of AAV2 / 8-GTX7. In addition, intravitreal induction was performed 11 days after subretinal injection of AAV2 / 8-GTX7. Statistical significance shown based on one-way ANOVA with Dunnett's correction and 8 days after injection as control point. [Figure 13d]EGFP transgene expression in mouse retina quantified over time after subretinal injection of AAV2 / 8-GTX5 (positive control). Fluorescent fundus photographs were taken at the following time points: 2, 8, 9, 10 and 12 days after subretinal injection of AAV2 / 8-GTX5. Exposure time: 10 s, pixel intensity threshold for analysis: 190. Intraperitoneal administration of guanosine was performed after imaging 8, 9 and 10 days after subretinal injection of AAV2 / 8-GTX5. In addition, intravitreal administration of guanosine was performed 11 days after subretinal injection of AAV2 / 8-GTX5. One-way ANOVA with Bonferroni correction was applied and found to have no statistically significant differences in EGFP expression for treatment with guanosine. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] Detailed Description of the Invention The present invention provides a gene regulatory cassette comprising a riboswitch in the 5' intron-alternative exon-3' intron context. A gene regulatory cassette refers to a recombinant DNA construct that, when integrated into the DNA of a target gene, provides the ability to regulate expression of the target gene by aptamer / ligand-mediated alternative splicing of the resulting pre-mRNA. The riboswitch associated with the present invention includes a sensor region (e.g., an aptamer) and an effector region that together sense the presence of a small molecule ligand and are involved in altering the splicing of the alternative exon. In one embodiment, expression of the gene of interest is enhanced in the presence of the aptamer ligand and reduced in the absence of the ligand.

[0020] Riboswitches

[0021] The term "riboswitch," as used herein, refers to a regulatory segment of an RNA polynucleotide. Riboswitches in the context of the present invention include a sensor region (e.g., an aptamer) and an effector region that together participate in sensing the presence of a ligand (e.g., a small molecule) and altering the splicing of alternative exons. In one embodiment, the riboswitch is engineered and utilizes polynucleotides from more than one source. The term "synthetic," as used herein in reference to a riboswitch, refers to a non-naturally occurring riboswitch. In one embodiment, the sensor and effector regions are linked by a polynucleotide linker. In one embodiment, the polynucleotide linker forms an RNA stem (i.e., a region of the RNA polynucleotide that is double stranded).

[0022] Effector Region

[0023] In one embodiment, the effector region comprises a 3' intronic 5' splice site ("5'ss") sequence (i.e., an intronic splice site sequence located 3' to an alternative exon). The effector region comprises a 3' intronic 5'ss sequence and a sequence complementary to the 3' intronic 5'ss sequence. When the aptamer binds to its ligand, the effector region forms a stem, which prevents splicing to the splice donor site at the 3' end of the alternative exon (see, e.g., FIG. 4b). Under certain conditions (e.g., when the aptamer does not bind to its ligand), the effector region directs the inclusion of an alternative exon into the target gene mRNA in situations that provide access to the splice donor site at the 3' end of the alternative exon (see, e.g., FIG. 4a).

[0024] The stem portion of the effector region must be of sufficient length (and GC content) to substantially prevent alternative splicing of the alternative exon upon ligand binding of the aptamer, while still allowing utilization of the splice site when the ligand is not present in sufficient amounts. In an embodiment of the invention, the stem portion of the effector region comprises a stem sequence in addition to the 5'ss sequence of the 3' intron and its complementary sequence. In an embodiment of the invention, this additional stem sequence comprises a sequence from the aptamer stem. The length and sequence of the stem portion can be modified using known techniques to identify stems that allow acceptable background expression of the target gene in the absence of ligand, and allow acceptable expression levels of the target gene when the ligand is present (see, for example, Examples 4 and 5, and Figures 4c and 4d, 5a, 5b, 5c, 5d). For example, if the stem is too long, it may prevent utilization of the 5'ss sequence of the 3' intron in the presence or absence of ligand. If the stem is too short, it cannot form a stable stem that can sequester the 5'ss sequence of the 3' intron, in which case the alternative exon is spliced ​​into the target gene message in the presence or absence of a ligand. In one embodiment, the total length of the effector region stem is from about 7 base pairs to about 20 base pairs. In some embodiments, the length of the stem is from about 8 base pairs to about 11 base pairs. In some embodiments, the length of the stem is from 8 base pairs to 11 base pairs. In addition to the length of the stem, the GC base pair content of the stem can be altered to modify the stability of the stem.

[0025] Aptamers / Ligands

[0026] The term "aptamer" as used herein refers to an RNA polynucleotide that specifically binds to a ligand. The term "ligand" refers to a molecule that is specifically bound by an aptamer. In one embodiment, a ligand is a low molecular weight (less than about 1,000 daltons) molecule, including, for example, lipids, simple sugars, second messengers, other natural products and metabolites, nucleic acids, and most therapeutic agents. In one embodiment, a ligand is a polynucleotide having two or more nucleotide bases.

[0027] An aptamer has a binding region, which is capable of forming a complex with an intended target molecule (i.e., a ligand). The specificity of binding can be defined in terms of the relative dissociation constant (Kd) of the aptamer for its ligand, as compared to the dissociation constant of the aptamer for an unrelated molecule. Thus, a ligand is a molecule that binds to an aptamer with a higher affinity than an unrelated material. Typically, the Kd of an aptamer with respect to its ligand is at least about 10-fold lower than the Kd of the aptamer with an unrelated molecule. In other embodiments, the Kd is at least about 20-fold lower, at least about 50-fold lower, at least about 100-fold lower, and at least about 200-fold lower. Aptamers are typically about 15 to about 200 nucleotides in length. More typically, aptamers are about 30 to about 100 nucleotides in length.

[0028] Aptamers that can be incorporated as part of a riboswitch can be natural aptamers or modifications thereof, or de novo designed aptamers or synthetically screened aptamers by Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Examples of aptamers that bind small molecule ligands include, but are not limited to, theophylline, dopamine, sulforhodamine B, and cellobiose Kanamycin A, lividomycin, tobramycin, neomycin B, viomycin, chloramphenicol, streptomycin, cytokines, cell surface molecules, and metabolites. For reviews of aptamers that recognize small molecules, see, for example, Famulok, Science 9:324-9 (1999) and McKeague, M. & DeRosa, MCJ Nuc. Aci. 2012. In another embodiment, the aptamer is a complementary polynucleotide.

[0029] In one embodiment, the aptamer is designed to bind to a specific small molecule ligand. Methods for designing aptamers include, for example, SELEX. Methods for designing aptamers that selectively bind to small molecules using SELEX are disclosed, for example, in U.S. Patent Nos. 5,475,096, 5,270,163, and Abdullah Ozer, et al. Nuc. Aci. 2014, which are incorporated herein by reference. Variations of the SELEX process are described in U.S. Patent Nos. 5,580,737 and 5,567,588, which are incorporated herein by reference.

[0030] Selection techniques for identifying aptamers generally involve preparing large pools of DNA or RNA molecules of a desired length that contain randomized or mutagenized regions. For example, oligonucleotide pools for aptamer selection may be approximately 15-25 nucleotides in length and contain randomized 20-100 nucleotide regions flanked by specific sequence regions useful for PCR primer binding. The oligonucleotide pools are amplified using standard PCR techniques or other means that allow for the amplification of selected nucleic acid sequences. The DNA pool may be in vitro transcribed to create a pool of RNA transcripts when RNA aptamers are desired. The pool of RNA or DNA oligonucleotides is then subjected to selection based on their ability to specifically bind to a desired ligand. Selection techniques include, for example, affinity chromatography, but any protocol that allows for the selection of nucleic acids based on their ability to specifically bind to other molecules may be used. Selection techniques for identifying aptamers that bind small molecules and function within cells may involve cell-based screening methods. In the case of affinity chromatography, oligonucleotides are contacted with a target ligand immobilized on a substrate in a column or on magnetic beads. The oligonucleotides are preferably selected for ligand binding in the presence of salt concentrations, temperatures, and other conditions that mimic normal physiological conditions. Oligonucleotides that bind to the ligand in the pool are retained on the column or beads, and non-binding sequences are washed away. The oligonucleotides that bind to the ligand are then amplified by PCR (usually after elution, if RNA transcripts are utilized) after reverse transcription. The selection process is repeated for the selected sequences for a total of about 3-10 iterative rounds of the sorting procedure. The resulting oligonucleotides are then amplified, cloned, and sequenced using standard procedures to identify sequences of oligonucleotides that can bind to the target ligand. Once an aptamer sequence has been identified, the aptamer can be further optimized by performing additional rounds of selection starting from a pool of oligonucleotides containing the mutagenized aptamer sequence.

[0031] In vivo aptamer screening may use in vitro selection (e.g., SELEX) consisting of one or more rounds of: For example, Konig, J. et al. (RNA. 2007, 13 (4): 614-622, incorporated herein by reference) describe a coupled SELEX and yeast three-hybrid system for in vivo selection of aptamers.

[0032] Alternative exons

[0033] The alternative exon that is part of the gene regulatory polynucleotide cassette of the present invention can be any polynucleotide sequence that can be transcribed into pre-mRNA and selectively spliced ​​into the mRNA of a target gene. The alternative exon that is part of the gene regulatory cassette of the present invention comprises at least one sequence that inhibits translation, such that when the alternative exon is included in the target gene mRNA, it prevents or reduces expression of the target gene from that mRNA. In a preferred embodiment, the alternative exon comprises a stop codon (TGA, TAA, TAG) that is in-frame with the target gene when the alternative exon is included in the target gene mRNA by splicing. In an embodiment, the alternative exon comprises other sequences in addition to or instead of the stop codon that reduce or substantially prevent translation when the alternative exon is included in the target gene mRNA by splicing, including, for example, a microRNA binding site that leads to degradation of the mRNA. In one embodiment, the alternative exon comprises a miRNA binding sequence that leads to degradation of the mRNA. In one embodiment, an alternative exon encodes a polypeptide sequence that reduces the stability of a protein that encompasses it. In one embodiment, an alternative exon encodes a polypeptide sequence that directs a protein that encompasses it for degradation.

[0034] The base or background level of splicing of alternative exons can be optimized by altering exonic splice enhancer (ESE) and exonic splice suppressor (ESS) sequences and / or by introducing ESE or ESS sequences into alternative exons. Such changes to the sequence of alternative exons can be achieved using methods known in the art, including, but not limited to, site directed mutagenesis. Alternatively, oligonucleotides of desired sequences (e.g., including all or part of an alternative exon) can be obtained from commercial sources and cloned into a gene regulatory cassette. Identification of ESS and ESE sequences can be achieved by methods known in the art, including, for example, ESEfinder3.0 (Cartegni, L. et al. ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acid Research, 2003, 31(13): 3568-3571) and / or other available sources.

[0035] In one embodiment, the alternative exon may be derived from a sequence that is foreign to the target gene, but originates from the organism in which the target gene is expressed, hi one embodiment, the alternative exon is a synthetic sequence (see Example 10).

[0036] In one embodiment, the alternative exon is a naturally occurring exon (see Example 10). In another embodiment, the alternative exon is derived from all or a portion of a known exon (see Example 10). In this context, "derived" refers to an alternative exon that encompasses a sequence that is substantially homologous to a naturally occurring exon or a portion thereof, but that may contain various mutations, for example, to introduce or delete a stop codon in frame with the target gene sequence, or to introduce or delete an exon splice enhancer and / or to introduce or delete an exon splice suppressor. In one embodiment, the alternative exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), mutated human Wilms tumor 1 exon 5, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6.

[0037] 5' and 3' intron sequences

[0038] The alternative exon is flanked by 5' and 3' intron sequences. The 5' and 3' intron sequences that can be used in the gene regulatory cassette of the present invention can be any sequence that can splice out the target gene and generate either the target gene mRNA or the target gene containing the alternative exon in the mRNA depending on the presence or absence of a ligand that binds the aptamer. The 5' and 3' introns each have the sequences necessary for splicing to occur, i.e., splice donor, splice acceptor, branch point sequences. In one embodiment, the 5' and 3' intron sequences of the gene regulatory cassette are derived from one or more naturally occurring introns or portions thereof. In one embodiment, the 5' and 3' intron sequences are derived from a truncated human β-globin intron 2 (IVS2Δ). In other embodiments, the 5' and 3' intron sequences are derived from the SV40 mRNA intron (used in the pCMV-LacZ vector from Clonetech), intron 6 of the human triosephosphate isomerase (TPI) gene (Nott Ajit, et al. RNA. 2003, 9:6070617), or an intron from human factor IX (Sumiko Kurachi et al. J. Bio. Chem. 1995, 270(10), 5276), an endogenous intron of the target gene itself, or any genomic fragment or synthetic intron that contains sufficient elements for regulated splicing (Thomas A. Cooper, Methods 2005 (37):331) (Yi Lai, et al. Hum Gene Ther. 2006: 17(10): 1036).

[0039] In one embodiment, the alternative exons and riboswitches of the invention are designed to reside within an endogenous intron of a target gene. That is, an intron (or a substantially similar intron sequence) naturally occurs at that position in the target gene. In this case, the intron sequence immediately upstream of the alternative exon is also referred to as the 5' intron or 5' intron sequence, and the intron sequence immediately downstream of the alternative exon is also referred to as the 3' intron or 3' intron sequence. In this case, the endogenous intron is modified to include splice acceptor and splice donor sequences adjacent to the 5' and 3' ends of the alternative exon.

[0040] The splice donor and splice acceptor sites in the gene regulatory cassette of the present invention may be modified to be strengthened or weakened. That is, the splice sites may be modified to more closely resemble the splice donor or acceptor consensus by standard cloning methods, site-directed mutagenesis, etc. Splice sites that are more similar to the splice consensus tend to promote splicing, thereby being strengthened. Splice sites that are less similar to the splice consensus tend to hinder splicing, thereby being weakened. The splice donor consensus (U2) of the most common type of intron is A / CAG || GTA / GAGT (where || refers to the exon / intron boundary). The splice acceptor consensus is CAG || G (where || refers to the exon / intron boundary). The frequency of particular nucleotides in splice donor and acceptor sites has been described in the art (see, e.g., Zhang, MQ, Hum Mol Genet. 1988. 7(5):919-932). The strength of the 5'ss and 3'splice sites can be adjusted to regulate the splicing of alternative exons.

[0041] Additional modifications to the 5' and 3' introns within the gene regulatory cassette can be made to modify splicing, including modifying, deleting and / or adding intronic splicing enhancer elements and / or intronic splicing suppressor elements, and / or modifying branch site sequences.

[0042] In one embodiment, the 5' intron has been modified to include a stop codon in frame with the target gene. The 5' and 3' intron sequences may also be modified to remove cryptic splice sites, which may be identified using publicly available software (see, e.g., Kapustin, Y. et al. Nucl. Acids Res. 2011. 1-8). The length of the 5' and 3' intron sequences may be adjusted, for example, to meet the size requirements of the viral expression construct. In one embodiment, the 5' and 3' intron sequences are independently about 50 to about 300 nucleotides in length. In one embodiment, the 5' and 3' intron sequences are independently about 125 to about 240 nucleotides in length.

[0043] Target Gene

[0044] The gene regulatory cassette of the present invention is a platform that can be used to regulate the expression of any target gene that can be expressed in a target cell, tissue, or organism. The term "target gene" refers to a polynucleotide that can be introduced into a cell, transcribed into RNA, and translated and / or expressed under appropriate conditions. Alternatively, the target gene is endogenous to the target cell, and the gene regulatory cassette of the present invention is placed within the target gene (e.g., within an existing intron of the endogenous target gene). An example of a target gene is a polynucleotide that encodes a therapeutic polypeptide. In one embodiment, when a target gene is expressed using the gene regulatory cassette of the present invention, the target gene is not expressed as a fusion protein that contains an alternative exon. The inclusion of the alternative exon minimizes translation of the mRNA, for example, by causing degradation of the message containing the alternative exon, or otherwise prevents expression of a functional target gene, for example, by its premature cleavage. In one embodiment, the target gene is exogenous to the cell in which the recombinant DNA construct is to be transcribed. In another embodiment, the target gene is endogenous to the cell in which the recombinant DNA construct is to be transcribed. In one embodiment, the alternative exon may contain a stop codon in frame with the coding sequence of the target gene, hi other embodiments, the alternative exon may contain other sequences that drive transcript degradation and / or block translation of the target gene.

[0045] The target gene of the present invention may be a gene encoding a protein or a sequence encoding a non-protein-coding RNA. For example, the target gene may be a gene encoding a structural protein, an enzyme, a cell signaling protein, a mitochondrial protein, a zinc finger protein, a hormone, a transport protein, a growth factor, a cytokine, an intracellular protein, an extracellular protein, a transmembrane protein, a cytoplasmic protein, a nuclear protein, a receptor molecule, an RNA-binding protein, a DNA-binding protein, a transcription factor, a translation machinery, a channel protein, a motor protein, a cell adhesion molecule, a mitochondrial protein, a metabolic enzyme, a kinase, a phosphatase, an exchange factor, a chaperone protein, and a modulator of any of these. In an embodiment, the target gene encodes erythropoietin (Epo), human growth hormone (hGH), a transcription activator-like effector nuclease (TALEN), human insulin, CRISPR-associated protein 9 (cas9), or an immunoglobulin (or a portion thereof), including, for example, a therapeutic antibody.

[0046] Expression constructs

[0047] The present invention contemplates the use of recombinant vectors to introduce polynucleotides encoding target genes and including the gene regulatory cassettes of the present invention into target cells. In many embodiments, the recombinant DNA constructs of the present invention contain additional DNA elements including DNA segments that result in the replication of DNA in a host cell and the expression of the target gene at appropriate levels in the cell. Those skilled in the art will understand that expression control sequences (promoters, enhancers, etc.) are selected based on their ability to promote the expression of the target gene in a target cell. By "vector" is meant a recombinant plasmid, yeast, artificial chromosome (YAC), minichromosome, DNA minicircle, or virus (including virus-derived sequences) that contains a polynucleotide to be delivered into a host cell in vitro or in vivo. In one embodiment, the recombinant vector is a viral vector or a combination of multiple viral vectors.

[0048] Viral vectors for expression of target genes in target cells, tissues, or organisms are known in the art and include adenoviral (AV) vectors, adeno-associated viral (AAV) vectors, retroviral and lentiviral vectors, and herpes simplex virus type 1 (HSV1) vectors.

[0049] Adenovirus vectors include, for example, human adenovirus type 2 and human adenovirus type 5-based vectors that are replication-deficient due to deletion of the E1 and E3 regions. A transcription cassette is inserted into the E1 region, resulting in a recombinant E1 / E3 deleted AV vector. Adenovirus vectors also include helper-dependent large-capacity adenovirus vectors (also known as large-capacity "gutless" or "gutted" vectors), which do not contain viral coding sequences. These vectors contain cis-acting elements required for viral DNA replication and packaging, mainly the inverted terminal repeats (ITRs) and packaging signals (Ψ). These helper-dependent AV vector genomes have the potential to carry foreign DNA from a few hundred base pairs up to about 36 kb.

[0050] Recombinant adeno-associated virus "rAAV" vectors include any vector derived from any adeno-associated virus serotype, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, and AAV-8, AAV-9, AAV-10, etc. rAAV vectors have AAV wild-type genes deleted in whole or in part, preferably one or more of the Rep and / or Cap genes, but retain functional flanking ITR sequences. Functional ITR sequences are retained for rescue, replication, packaging, and potential chromosomal integration of the AAV genome. The ITRs need not be wild-type nucleotide sequences and may be altered (e.g., by insertion, deletion, or substitution of nucleotides) so long as the sequences provide functional rescue, replication, and packaging.

[0051] Alternatively, other systems such as lentiviral vectors can be used in embodiments of the present invention. Lentiviral-based systems transduce non-dividing cells as well as dividing cells, making them useful for applications that target non-dividing cells, such as the CNS. Lentiviral vectors are derived from human immunodeficiency viruses and similar viruses, and integrate into the host genome, providing the potential for very long-term gene expression.

[0052] Polynucleotides, including plasmids, YACs, minichromosomes, and minicircles carrying target genes, including gene regulatory cassettes, can also be introduced into cells or organisms by non-viral vector systems, for example using cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) and polyethyleneimine (PEI) polymer systems can also be used to deliver vectors into cells. Other methods for delivering vectors into cells include hydrodynamic injection and electroporation and the use of ultrasound for both cell cultures and organisms. For a review of viral and non-viral delivery systems for gene delivery, see Nayerossadat, N. et al. (Adv Biomed Res. 2012; 1 :27), incorporated herein by reference.

[0053] Methods for modulating expression of a target gene

[0054] In one aspect, the present invention provides a method of regulating expression of a target gene (e.g., a therapeutic gene) by (a) inserting a gene regulatory cassette of the present invention into the target gene; (b) introducing the target gene containing the gene regulatory cassette into a cell; and (c) exposing the cell to a ligand that binds to the aptamer. In one embodiment, the ligand is a small molecule. In an aspect, expression of the target gene in the target cell confers a desired property on the cell into which it is introduced or otherwise leads to a desired therapeutic outcome.

[0055] In a preferred embodiment, the gene regulatory cassette is inserted into the protein coding sequence of the target gene (rather than the 5' or 3' untranslated regions). In one embodiment, a single gene regulatory cassette is inserted into the target gene. In another embodiment, two, three, four or more gene regulatory cassettes are inserted into the target gene. In one embodiment, two gene regulatory cassettes are inserted into the target gene. When multiple gene regulatory cassettes are inserted into the target gene, they may each contain the same aptamer, such that a single ligand may be used to regulate alternative splicing in multiple cassettes, thereby regulating target gene expression. In another embodiment, multiple gene regulatory cassettes are inserted into the target gene, each containing a different aptamer, such that exposure to multiple different small molecule ligands regulates target gene expression. In another embodiment, multiple gene regulatory cassettes are inserted into the target gene, and each contains distinct 5' intron, alternative exon, and 3' intron sequences. This may be useful to reduce recombination and improve ease of incorporation into viral vectors.

[0056] Methods of Treatment and Pharmaceutical Compositions

[0057] One aspect of the invention provides a method of modulating the level of a therapeutic protein delivered by gene therapy. In this embodiment, the "target gene" may code for a therapeutic protein. The "target gene" may code for a protein that is endogenous or exogenous to the cell.

[0058] The therapeutic gene sequence, including a regulatory cassette with an aptamer-driven riboswitch, is delivered to a target cell in the body, for example, by a vector. The cell specificity of the "target gene" can be controlled by a promoter or other elements in the vector. Delivery of the vector construct including the target gene and transfection of the target tissue resulting in stable transfection of the regulated target gene is the first step in producing a therapeutic protein.

[0059] However, due to the presence of the regulatory cassette within the target gene sequence, the target gene is not expressed at a significant level, i.e., it is in the "off state" in the absence of a specific ligand that binds to the aptamer contained within the regulatory cassette riboswitch. Only when the aptamer-specific ligand is administered does it activate target gene expression.

[0060] Delivery of the vector construct containing the target gene and delivery of the activating ligand are generally separated in time. Delivery of the activating ligand controls when the target gene is expressed as well as the level of protein expression. The ligand can be delivered by a number of routes, including but not limited to orally, intramuscularly (EVI), intravenously (IV), intraocularly, or topically.

[0061] The timing of delivery of the ligand depends on the requirement for activation of the target gene. For example, if the therapeutic protein encoded by the target gene is constantly required, an oral small molecule ligand can be delivered daily or multiple times daily to ensure continuous activation of the target gene and thus continuous expression of the therapeutic protein. If the target gene has a long-lasting effect, the inducing ligand can be administered less frequently.

[0062] The present invention allows expression of a therapeutic transgene to be temporally controlled in a manner determined by the temporal administration of a ligand specific for an aptamer in a regulatory cassette. Expression of the therapeutic transgene only in response to ligand administration enhances the safety of gene therapy treatments by allowing the target gene to be turned off in the absence of ligand.

[0063] Different aptamers can be used to allow different ligands to activate target genes. In certain embodiments of the present invention, each therapeutic gene that contains a regulatory cassette has a specific aptamer in the cassette that is activated by a specific small molecule. This means that each therapeutic gene is only activated by a ligand that is specific for the aptamer contained therein. In these embodiments, each ligand only activates one type of therapeutic gene. This allows the possibility that several separate "target genes" can be delivered to an individual and each can be activated by delivery of a ligand that is specific for the aptamer contained in the regulatory cassette contained in each target gene.

[0064] The present invention allows any therapeutic protein, such as erythropoietin (EPO) or a therapeutic antibody, whose gene can be delivered to the body, to be produced by the body upon delivery of an activating ligand. This method of therapeutic protein delivery can then replace the ex vivo production of such therapeutic proteins, such as antibodies used in cancer or to block inflammatory or autoimmune diseases, which are then injected or infused. The body containing the regulated target gene becomes a factory that produces biologics, which are switched on when the gene-specific ligand is administered.

[0065] Dosage levels and timing of therapeutic protein administration can be important to therapeutic efficacy, for example, in the delivery of AVASTINR (an anti-VEGF antibody) to cancer. The present invention enhances the ease of dosing in response to observations regarding therapeutic protein levels and efficacy.

[0066] In one embodiment, the targeting protein may be a nuclease that can target and edit a specific DNA sequence. Such nucleases include Cas9, zinc finger-containing nucleases, or TALENs. In the case of these nucleases, the nuclease protein may only require a short enough time to edit the target endogenous gene. However, if an unregulated nuclease gene is delivered to the body, the protein may be present for the remaining life of the cell. In the case of nucleases, if the nuclease is present for a longer period of time, there is a high risk of off-target editing. Regulating the expression of such proteins has a significant safety advantage. In this case, a vector containing a nuclease target gene containing a regulatory cassette can be delivered to the appropriate cells in the body. The target gene is in an "off" state in the absence of a cassette-specific ligand, so no nuclease is produced. Only when an activating ligand is administered is the nuclease produced. When enough time has passed to allow sufficient editing to occur, the ligand is removed and not re-administered. This causes the nuclease gene to then be turned "off", no further nuclease is produced, and editing ceases. This approach can be used to correct genetic conditions, including many inherited retinal disorders such as LCA10, caused by mutations in CEP290, and Stargardt disease, caused by mutations in ABCA4.

[0067] Administration of regulated target genes encoding therapeutic proteins that are activated only by administration of a specific ligand can be used to regulate therapeutic genes to treat many different types of diseases, such as cancer using therapeutic antibodies, immune disorders using immunomodulatory proteins or antibodies, metabolic diseases, PNH using anti-C5 antibodies or antibody fragments as the regulated gene, or rare diseases such as ocular neovascularization using therapeutic antibodies, and dry AMD using immunomodulatory proteins.

[0068] A variety of specific target genes are suitable for use in the present invention, which allow for the treatment of a variety of specific diseases and conditions.For example, insulin or insulin analogs (preferably human insulin or analogs of human insulin) can be used as target genes for treating type I diabetes, type II diabetes, or metabolic syndrome; human growth hormone can be used as target genes for treating children suffering from growth abnormalities or adults with growth hormone deficiency; erythropoietin (preferably human erythropoietin) can be used as target genes for treating anemia caused by chronic kidney disease, anemia caused by myelodysplasia, or anemia caused by cancer chemotherapy.

[0069] The present invention may be particularly suitable for treating diseases caused by single gene defects, such as, for example, cystic fibrosis, hemophilia, muscular dystrophy, thalassemia, or sickle cell anemia. Thus, human β-, γ-, δ-, or ζ-globin may be used as a target gene for treating β-thalassemia or sickle cell anemia; human factor VIII or factor IX may be used as a target gene for treating hemophilia A or hemophilia B.

[0070] The ligands used in the present invention are typically combined with one or more pharma- ceutical acceptable carriers to form a pharmaceutical composition suitable for administration to a patient. Pharmaceutically acceptable carriers include solvents, binders, diluents, disintegrants, lubricants, dispersion media, coating agents, antibacterial and antifungal agents, isotonicity agents, and absorption retardants, etc., commonly used in the pharmaceutical arts. Pharmaceutical compositions may be in the form of tablets, pills, capsules, lozenges, etc., and are formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, intranasal, subcutaneous, oral, inhalation, transdermal (topical), transmucosal, and rectal.

[0071] A pharmaceutical composition comprising the ligand is administered to a patient in a dosing schedule that delivers to the patient an amount of ligand sufficient to favorably modulate the target gene. When the ligand is a small molecule and the dosage form is a tablet, pill, or the like, the pharmaceutical composition preferably comprises 0.1 mg to 10 g of ligand; 0.5 mg to 5 g of ligand; 1 mg to 1 g of ligand; 2 mg to 750 mg of ligand; 5 mg to 500 mg of ligand; or 10 mg to 250 mg of ligand.

[0072] The pharmaceutical composition may be administered once a day or multiple times a day (e.g., 2, 3, 4, 5 or more times a day). Alternatively, the pharmaceutical composition may be administered less frequently than once a day, for example, once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or once a month or once every few months. In some embodiments of the invention, the pharmaceutical composition may be administered to a patient only a few times, for example, once, twice, or three times.

[0073] The present invention provides a method of treating a patient in need of increased expression of a therapeutic protein encoded by a target gene, the method comprising administering to the patient a pharmaceutical composition comprising a ligand for an aptamer, wherein the patient has previously been administered recombinant DNA comprising a target gene, wherein the target gene includes a gene regulatory cassette of the present invention that provides the ability to regulate expression of the target gene by the aptamer ligand by alternatively splicing the pre-mRNA of the target gene, thereby enhancing expression of the therapeutic protein.

[0074] Products and Kits

[0075] Kits or articles of manufacture for use in the methods described herein are also provided. In embodiments, the kits include the compositions described herein (e.g., for compositions for delivery of vectors containing target genes including gene regulatory cassettes) in suitable packaging. Suitable packaging for the compositions described herein (such as ocular compositions for injection) is known in the art and includes, for example, vials (such as sealed vials) that bottle (vesicles, ampoules), jars, flexible packaging (e.g., sealed Mylar or poly bags), and the like. These articles may be further sterilized and / or sealed.

[0076] The present invention also provides kits that include the compositions described herein and may further include instructions for how to use the compositions, such as for the uses described herein. The kits described herein may further include other items that are desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and, for example, package inserts with instructions for administering in any of the ways described herein. For example, in some embodiments, the kit includes an rAAV for expression of a target gene comprising a gene regulatory cassette of the present invention, a pharma- ceutically acceptable carrier suitable for injection, and one or more of the following: buffers, diluents, filters, needles, syringes, and package inserts with instructions for administering. In some embodiments, the kit is suitable for intraocular injection, intramuscular injection, intravenous injection, and the like.

[0077] "Homology" and "homologous" as used herein refer to the percentage of identity between two polynucleotide sequences or two polypeptide sequences. The correspondence between one sequence and another can be determined by techniques known in the art. For example, homology can be determined by direct comparison of two polypeptide molecules by aligning the sequence information and using readily available computer programs. Alternatively, homology can be determined by hybridization of the polynucleotides under conditions that form stable duplexes between the homologous regions, followed by digestion with a single-strand specific nuclease and determining the size of the digested fragments. Two polynucleotides or two polypeptide sequences are "substantially homologous" to each other when, after optimal alignment with appropriate insertions or deletions, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of the nucleotides or amino acids, respectively, match over the defined length of the molecules, as measured using the methods described above.

[0078] "Percentage of sequence identity" with respect to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides of a candidate sequence that are identical to the amino acid residues or nucleotides of the reference polypeptide or nucleic acid sequence, after alignment of the sequences and, if necessary, introduction of gaps to achieve the maximum percentage of sequence identity. Alignment for purposes of determining percent amino acid or nucleic acid sequence identity can be accomplished by methods known to those of skill in the art, including, for example, BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software, which are publicly available computer software programs.

[0079] The term "polynucleotide" or "nucleic acid," as used herein, refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0080] "Heterologous" or "exogenous" means derived from a genotypically distinct entity from another entity to which it is compared or into which it is incorporated. For example, a polynucleotide introduced into a heterologous cell type by genetic engineering techniques is a heterologous polynucleotide (and may encode a heterologous polypeptide when expressed). Similarly, a cellular sequence (e.g., a gene or portion thereof) incorporated into a viral vector is a heterologous nucleotide sequence with respect to that vector.

[0081] It should be understood and assumed that variations in the principles of the invention disclosed herein may be made by those skilled in the art, and that such modifications are intended to be included within the scope of the invention. The following examples further illustrate the invention, but should not be construed as limiting the scope of the invention in any way. All references cited herein are incorporated by reference in their entirety. EXAMPLES

[0082] Example 1. Effect of splice site strength on expression of regulated genes

[0083] Experimental procedure

[0084] Plasmid constructs: Luci-BsaI-acceptor: A DNA fragment containing the CMV promoter was excised from the pHAGE-CMV-eGFP-W (Harvard University) vector by the restriction enzymes SpeI and NotI, and this fragment was cloned into the pHDM-G (Harvard University) vector digested with SpeI and NotI. A fragment containing the SV40 Ori sequence in the resulting vector was deleted by digestion with BsmI and BstXI, removing the 3' overhang, and ligated. The resulting vector was then subjected to site-directed mutagenesis (Agilent) to delete the BsaI site in the AmpR gene. The resulting vector was then digested with NotI and BamHI and ligated to a fragment containing the NotI-BsaI-BamHI sites to create the final Luci-BsaI-acceptor vector. pHDM-G was used as a template for human β-globin intron 2 ("IVS2Δ"), which contains a deletion of the middle part that is not likely to be important for splicing (see Table 5, SEQ ID NO: 1). pGL3-Promoter (Promega) was used as a template for the firefly luciferase gene. Construct 8: The luciferase gene was amplified by PCR using primers Luc-For-BsaI and Luci-Rev-BsaI. The PCR product was digested with BsaI and cloned into BsaI-digested Luci-BsaI-acceptor vector. Splicing constructs 1-7 (Con1-7, SEQ ID NO: 1-7) expressing the luciferase gene with intron IVS2Δ inserted with different 5'ss and 3'ss at each end of the intron sequence were made by ligating three BsaI-digested PCR products into BsaI-digested Luci-BsaI-acceptor. The pGL3-promoter vector was used as the luciferase template and pHDM-G was used as the template for IVS2Δ.The primer pairs used to amplify PCR fragments Con1 to 7 were as follows: Con1: Luci-For-BsaI / Luci-splice-Rev_1, IVS2-BsaI-For / IVS2-BsaI-Rev_1, and Luci-splice-For_1 / Luci-Rev-BsaI; Con2: Luci-For-BsaI / Luci-splice-Rev_2, IVS2-BsaI-For / IVS2-BsaI-Rev_2, and Luci-splice-Rev_3. Con3: Luci-For-BsaI / Luci-Splice-Rev_3, IVS2-BsaI-For / IVS2-BsaI-Rev_3, and Luci-Splice-For_3 / Luci-Rev-BsaI; Con4: Luci-For-BsaI / Luci-Splice-Rev_4, IVS2-BsaI-Fo Con5: Luci-For-BsaI / Luci-splice-Rev_1, IVS2-BsaI-For / IVS2-BsaI-Rev_1 and Luci-splice-For_5 / Luci-Rev-BsaI; Con6: Luci-For-BsaI / Luci Con7: Luci-For-BsaI / Luci-splice-Rev_1, IVS2-BsaI-For / IVS2-BsaI-Rev_1 and Luci-splice-For61 / Luci-Rev-BsaI; Con8: Luci-For-BsaI / Luci-splice-Rev_1, IVS2-BsaI-For / IVS2-BsaI-Rev_1 and Luci-splice-For71 / Luci-Rev-BsaI. All constructs were verified by DNA sequencing. Table 1. Splice sites of splicing constructs (Con1–7). Intron / exon boundaries are marked with ||. [Table 1]

[0085] Transfection: 3.5x10^4 HEK293 cells were plated in 96-well flat-bottom plates the day before transfection. Plasmid DNA (500ng) was added to the tubes or 96-well bottom plates. Separately, TransIT-293 reagent (Mirus; 1.4μL) was added to 50μL of Opti-memI medium (Life Technologies) and left at room temperature (RT) for 5 minutes. Then, 50μL of this diluted transfection reagent was added to the DNA, mixed, and incubated at room temperature ("RT") for 20 minutes. Finally, 7μL of this solution was added to the wells of cells in the 96-well plates.

[0086] Firefly luciferase assay of cultured cells: 24 hours after medium change, plates were removed from the incubator and allowed to equilibrate to RT for a few minutes in the lab bench, then aspirated. Glo-lysis buffer (Promega, 100 μL, RT) was added and plates were left at RT for at least 5 minutes. Well contents were then mixed by trituration with 50 μL, and 20 μL of each sample was mixed with 20 μL of clear glo reagent (Promega) diluted to 10% in glo-lysis buffer. 96 wells were spaced apart on an opalescent 384-well plate. Following a 5-minute incubation at RT, luminescence was measured using a Tecan instrument with a read time of 500 mSec. Luciferase activity was expressed as the mean relative light units (RLU) ± standard deviation.

[0087] result

[0088] To construct a splicing-based gene regulation platform, we first tested (i) the effect of inserting an intron within the coding sequence (CDS) of a gene of interest, in this case the firefly luciferase gene (FIG. 1a), and (ii) the effect of various 5'ss and 3'ss on gene expression. A truncated human β-globin intron 2 (IVS2Δ) with various 5'ss and 3'ss at each end was inserted into the coding sequence of the firefly luciferase gene to test splicing efficiency. Construct Con8 lacks the IVS2Δ intron, and Con1 (SEQ ID NO:1) has IVS2Δ with its native IVS2 5' and 3'ss sequence. Constructs Con2-Con7 (SEQ ID NO:2-7) have IVS2Δ with various 5' and 3'ss sequences listed in Table 1. As shown in Figure 1b, insertion of IVS2Δ with the native IVS2 splice site into the luciferase gene did not affect gene expression (compare Con1 vs. Con8). However, replacement of the IVS2 splice site of IVS2Δ with splice site sequences with various strengths significantly reduced luciferase expression. As shown in Figure 1b, Con2 and Con3 with altered 5'ss had similar expression levels as Con1 and Con8, however, the change in 5'ss in Con4 and the 3'ss change from Con5 to Con7 significantly reduced luciferase expression (compare Con4-Con7 to Con8). Therefore, differences in splice sites affect target gene expression. Con1 was used for further development.

[0089] Example 2. Intron-exon-intron cassettes and the effect of cis-elements on splicing in modulating target gene expression

[0090] Experimental procedure

[0091] Putative exon splice enhancer (ESE) sequences were predicted using ESEfinder 3.0. Wild-type human dihydrofolate reductase (DHFR) exon 2 with intron flanking sequences was synthesized (IDT) with either the native 5'ss (DHFR-wt; Table 2; SEQ ID NO: 47), the native 5'ss with four nucleotides mutated to C (DHFR-wt5ssC; Table 2; SEQ ID NO: 48), the 5'ss sequence from Con1 (DHFR-Con15ss; Table 2; SEQ ID NO: 49) or Con4 (SEQ ID NO: DHFR-Con45ss, SEQ ID NO: 50). To test the effect of ESE and exon splice suppressor (ESS) sequences within DHFR exon 2, various DHFR exon 2 mutants were synthesized (listed in Table 2).

[0092] All of these different DHFR exon 2 sequences were cloned approximately into the middle of the IVS2Δ intron in the Con1 construct using the Golden Gate cloning strategy (NEB).

[0093] The constructs were verified by DNA sequencing (Genewiz). DNA was transfected into HEK293 cells as described in Example 1 and assayed for luciferase activity. Table 2. Alternative splice regulatory sequences encompassing DHFR exon 2. The underlined sequences indicate alternative splice regulatory sequences within DHFR exon 2. [Table 2]

[0094] result

[0095] Wild-type human DHFR exon 2 and adjacent intron sequence (SEQ ID NO: 8) were inserted approximately in the middle of the IVS2Δ intron in the Con1 construct. This configuration creates a platform where a foreign exon within the intron sequence of a target gene can serve as an alternative exon, allowing expression of the target gene to be regulated by modifying alternative exon splicing. In this configuration (FIG. 2a), splicing events likely occur between the 5′ portion of the target gene and the DHFR exon, as well as between the DHFR exon and the 3′ portion of the target gene, resulting in inclusion of the DHFR exon in the target gene mRNA. When the DHFR exon is included in the mRNA, it contains a premature stop codon that is in frame, thereby reducing luciferase gene expression. However, when the 5'ss of an alternative DHFR exon (i.e., the splice donor site 5' to the 3' intron) becomes mutated or unavailable, preventing splicing at this site, the DHFR exon is removed from the mRNA, allowing the mRNA to be efficiently translated and the target gene protein to be expressed (Figure 2a).

[0096] We first tested the splicing of DHFR exon 2 with its native cis-element unaltered, as well as various other versions with strengthened or weakened 5'ss sequences. Insertion of a DHFR exon (SEQ ID NO: 8) with the native 5'ss and 3'ss into the intron sequence of Con1 to generate DHFR_wt significantly reduced luciferase expression compared to Con1 without the alternative DHFR exon. Expression from the DHFR_wt construct is 116-fold lower than Con1 (Figure 2b).

[0097] When the 5'ss of the DHFR exon was mutated to a non-functional sequence (DHFR_wt5ssC; SEQ ID NO: 48), inclusion of the DHFR exon was prevented and luciferase expression was restored to the level of Con1 (FIGS. 2aII, 2b, 2c).

[0098] When the 5'ss of the DHFR exon was replaced with a stronger 5'ss, in this case the 5'ss from Con1 (DHFR_Con1 5ss; SEQ ID NO: 49), inclusion of the DHFR exon was enhanced, leading to a 545-fold decrease in luciferase gene expression compared to Con1 (Figure 2b). However, when the weaker 5'ss from Con4 was used (DHFR_Con4 5ss; SEQ ID NO: 50), the DHFR exon was not included and luciferase expression was enhanced (Figure 2b).

[0099] Exonic splicing enhancer (ESE) or suppressor (ESS) elements play a crucial role in splicing, and their function is often context-dependent. The effect of putative splicing regulatory sequences located within DHFR exons was tested. When a putative splicing enhancer, the SRp40 binding site located within a DHFR exon, was mutated (Table 2, DHFR_mtSRp40; SEQ ID NO: 51), the inclusion of the DHFR exon was dramatically enhanced, resulting in a 2982-fold decrease in luciferase expression compared to Con1 (Figure 2c, DHFR_wt and DHFR_mtSRp40).

[0100] When another splicing enhancer, the SC35 binding site in a DHFR exon (predicted by ESE Finder), was mutated to a stronger SC35 binding sequence (Table 2, DHFR_StrSC35, SEQ ID NO: 52), inclusion of the DHFR exon was enhanced, resulting in a 139-fold decrease in luciferase expression compared to Con1 (Fig. 2c, DHFR_wtStrSC35), a slightly larger decrease than that seen with the construct including the native DHFR exon (DHFR_wt, Fig. 2b).

[0101] When the splicing enhancer, SC35 binding site, was mutated to a splicing inhibitor (hnRNP A1 binding site) (Table 2, DHFR_wtSC35hnRNPA1, SEQ ID NO: 53), inclusion of the DHFR exon was less effective in leading to enhanced luciferase expression (Fig. 2c, DHFR_wt and DHFR_wtSC35hnRNPA1).

[0102] An intron-exon-intron cassette was created in which expression of a target gene, in this case luciferase, can be switched on or off by the inclusion or exclusion of an alternative exon, in this case an alternative DHFR exon containing a stop codon present in frame. Splicing that results in the inclusion of the alternative exon reduced gene expression, while when splicing excluded the alternative exon, gene expression was enhanced. The strength or weakness of the alternative exon 5'ss, or sequences within the exon that alter splicing, alters the level of target expression through their effect on the inclusion or exclusion of the extraneous exon.

[0103] Example 3. Effect of hairpin formation at alternative exon 5' splice sites on regulation of target gene expression

[0104] Experimental procedure

[0105] Sequences encompassing DHFR exon 2 with the natural 3' and 5' ss sequences, with the 5' ss embedded in a hairpin structure, were synthesized (IDT) and cloned into the indicated vectors using the Golden Gate cloning strategy (NEB). Constructs were transfected into HEK293 cells and assayed for luciferase activity as described in Example 1.

[0106] result

[0107] We tested whether embedding the 5'ss of a DHFR exon within a hairpin stem structure could affect the splicing and inclusion of alternative DHFR exons and whether this would alter target gene expression (illustrated in Figure 3a).

[0108] Inclusion of the alternative DHFR exon with the Con1 5' splice site (DHFR_Con15ss; SEQ ID NO: 49) sequence abolished luciferase expression compared to Con1 (Figure 3c, DHFR_Con15ss). A 15 base pair (bp) hairpin structure with the entire sequence of the 5'ss embedded was designed into DHFR_Con 15ss to generate DHFR_Con 15ss_HP15 (SEQ ID NO: 54) (Figure 3a). The presence of the 15 bp hairpin structure fully restored luciferase expression to Con1 levels, as the hairpin abolished the accessibility of the 5'ss, thereby abolishing the inclusion of the alternative DHFR exon (Figure 3c, Con1, DHFR_Con15ss and DHFR_Con15ss_HP15).

[0109] In contrast, a 15 bp hairpin with a "broken stem" (Figure 3b, Con15ss_15HPx, SEQ ID NO: 55) failed to restore luciferase expression (Figure 3c, DHFR_Con15ss_HP15x), suggesting that the intact stem is a critical component of RNA secondary structure in regulating the accessibility of the 5' splice site and thereby determining the inclusion or exclusion of alternative exons.

[0110] The same experiment was performed using a construct containing a DHFR exon with a mutated SRp40 binding site with enhanced splicing efficiency (DHFR_wtmtSRp40, see Example 2). Embedding the 5'ss into the hairpin restored luciferase expression, whereas breaking the hairpin blocked luciferase expression (Figure 3c, DHFR_wtmtSRp40, DHFR_wtmtSRp40H_P15, and DHFR_wtmtSRp40_HP15x).

[0111] Thus, embedding the 5'ss of an alternative exon into a hairpin structure can restore target gene expression by preventing the accessibility of that 5'ss, thereby preventing the inclusion of the alternative exon into the mRNA and allowing expression of the target gene protein. A gene expression platform was created in which the expression of a target gene protein can be regulated by altering the availability of the 5'ss of an exogenous alternative exon via a secondary RNA structure.

[0112] The construct DHFR_wtmtSRp40 (SEQ ID NO:58) (hereinafter also referred to as "mtDHFR") was used for further riboswitch development.

[0113] Example 4. Use of theophylline aptamers to regulate target gene expression via alternative splicing

[0114] Experimental procedure

[0115] A DHFR-acceptor vector was constructed to facilitate cloning of aptamer sequences attached to hairpin stems of various lengths. The theophylline aptamer sequence used was: ggcgatacCAGCCGAAAGGCCCTTGgcagcgtc (SEQ ID NO: 9). Theophylline aptamer oligonucleotides ("oligos") with 4 nucleotide overhangs at the 5' end were synthesized (IDT), annealed, and ligated into the BsaI-digested DHFR-acceptor vector. HEK293 cells were transfected with a luciferase reporter construct with a regulatory cassette encompassing the theophylline aptamer as described in Example 1. Four hours after transfection, the medium was aspirated and fresh medium was added with or without 3 mM theophylline, and luciferase was assayed 20-24 hours after theophylline treatment. Fold induction was expressed as the luciferase activity obtained in the presence of the aptamer ligand divided by the value obtained in the absence of the aptamer ligand. The level of luciferase activity was expressed as a percentage of the level of luciferase activity produced by the Con1 construct lacking the IVS2Δ intron within the CDS of the luciferase gene (considered to be maximal expression).

[0116] result

[0117] To regulate the accessibility of the 5' splice site of the stop codon-containing alternative exon and thereby regulate the expression of the target gene protein, an aptamer sequence was attached to the stem of a hairpin structure that embeds an intron portion of DHFR5'ss and its complementary sequence. In this configuration, the insertion of the aptamer sequence prevents the formation of the hairpin stem and leaves the DHFR5'ss accessible, thereby resulting in the inclusion of the alternative DHFR exon and preventing the expression of the target gene protein (Figure 4a). As shown in Figure 4b, when aptamer / ligand binding occurs, the structural change of the aptamer caused by the ligand binding brings the DHFR5'ss and its complementary sequence together to form a stable stem, thereby hiding the DHFR5'ss and excluding the DHFR exon, resulting in the expression of the target gene protein.

[0118] The theophylline aptamer was tested by directly linking the weak stem of the theophylline aptamer to the hairpin stem (Figure 4c, DHFR_Theo1). If the stem is too long, it may form a stable structure in the absence of aptamer / ligand binding, whereas if it is too short, it will never form a stable stem, even in the presence of ligand. Therefore, the length of the stem needs to be optimized so that a stable secondary structure is only formed upon aptamer / ligand binding. To determine the optimal stem length that allows stem formation in the presence of ligand but not in its absence, the theophylline aptamer was cloned into mtDHFR (listed in Table 2 of Example 2) and a series of stem truncations were performed to create many constructs. Figure 4c shows four constructs of this series of truncations.

[0119] Figure 4d shows luciferase expression from this deletion series of constructs in the presence or absence of theophylline. For constructs theophylline 1 through theophylline 12, with stem lengths from 20 bp down to 9 bp, the stem length was sufficient to form stable secondary structures even in the absence of aptamer / ligand binding, resulting in luciferase expression at levels similar to Con1 in both the presence and absence of theophylline.

[0120] In the construct DHFR_Theo13, luciferase expression was repressed in the absence of theophylline, indicating the availability of the mtDHFR exon 5'ss, leading to inclusion of an alternative DHFR exon and repression of gene expression. However, in the presence of theophylline, luciferase expression was switched on, resulting in a 43-fold induction of expression levels without theophylline and approximately 56% of the luciferase levels expressed by the Con1 control vector. Thus, a mammalian On-riboswitch was created that enables expression of a target gene protein in the presence of the aptamer ligand, theophylline.

[0121] Example 5. Use of xpt guanine aptamers to regulate target gene expression via alternative splicing

[0122] Experimental procedure

[0123] The following array: cactcatataatCGCGTGGATATGGCACGCAAGTTTCTACCGGGCACCGTAAATGTCcgactatgggtg (SEQ ID NO: 10) The Xpt-guanine aptamer with the following structure was used to construct the riboswitch. Oligos containing the sequence of the guanine aptamer and a hairpin stem with a 4-nucleotide 5' overhang were synthesized (IDT), annealed, and then ligated into a DHFR-acceptor vector digested with BsaI. HEK293 cells were transfected as described in Example 1. Four hours after transfection, the medium was aspirated and fresh medium was added with or without 500 μM guanine. Luciferase expression was assayed 20-24 hours after guanine treatment as described in Examples 1 and 4. HepG2, AML12, RD, and C2C12 (ATCC) were cultured using the protocol recommended by ATCC. An intron-exon-intron cassette encompassing the xpt-G17 riboswitch (SEQ ID NO: 15) was inserted into the leader peptide sequence of the anti-KDR antibody gene and into the StuI site in the mouse erythropoietin gene using the Gibson cloning strategy (NEB). Constructs containing mouse erythropoietin (Epo) or anti-KDR antibody were transfected into HEK293 cells. Four hours after transfection, the medium was aspirated and fresh medium was added with or without 500 μM guanine. The supernatants were subjected to ELISA assays (R&D Systems) for either anti-KDR antibody production or mouse Epo production.

[0124] result

[0125] The use of additional aptamers / ligands to control target gene expression by aptamer-mediated regulation of alternative splicing was tested by attaching the xpt-guanine aptamer from Bacillus subtilis from stem PI to the hairpin stem (Figure 5a, DHFR_G1). As in Example 4, 18 constructs were A series of truncations of the connecting stem (Figures 5a and 5b, DHFR-G1-G18, also called xpt-G1-G18, which included the regulatory cassette) were generated to obtain hairpin stems of optimal length for the guanine aptamer, which allowed aptamer / ligand binding liaison for 5'ss accessibility and exon splicing. As shown in Figure 5b, with constructs DHFRG1-G13, with stem lengths from 24 bp down to 12 bp, luciferase expression was not affected by the insertion of the alternative DHFR exons and xpt-guanine aptamer in the presence or absence of the aptamer ligand guanine. This suggests that the stem length is sufficient to form a stable structure both in the absence and presence of the ligand, preventing the inclusion of the alternative exon in the mRNA. However, with constructs DHFR_G14-DHFR_G18, luciferase expression was suppressed in the absence of additional guanines. Luciferase expression from these constructs was induced upon addition of μM guanine (Figure 5b).

[0126] Further rigorous validation of constructs G11-G18 again showed a clear modulation of luciferase expression by guanine treatment (Figure 5c). The DHFR_G17 construct encompassing xpt-G17 (SEQ ID NO: 15) (Figure 5a) showed a 2000-fold induction of expression, resulting in approximately 65% ​​of the luciferase level expressed by Con1 (considered as maximal expression). This high dynamic range of induction resulted from activation of a very low uninduced baseline level of expression in the absence of ligand. Construct DHFR_G16 (Figure 5a) produced an approximately 800-fold induction over uninduced baseline expression, at a level of 83% of maximal expression (Figures 5c and 5d). In addition, constructs DHFR_G14 and G15 showed approximately 100% of maximal expression at a lower fold induction due to a higher uninduced baseline expression of luciferase.

[0127] To test the general functionality and applicability of the synthetic riboswitch within the intron-exon-intron cassette, we transfected the xpt-G17 containing construct (DHFR_G17) into multiple human and mouse cell lines. In these various cell lines, guanine treatment resulted in significant induction of gene expression, with over 500-fold induction in HepG2 cells and lower fold induction in other cell lines (Figure 5e). The various fold induction in the various cell lines may reflect differences in transfection efficiency as well as cell type-specific expression profiles of splicing regulators. Furthermore, the luciferase gene with the regulatory cassette containing the xpt-G17 riboswitch (DHFR_G17) obtained the same level of induction when transferred into the AAV backbone (Figure 5f), indicating that the gene regulatory effect is independent of the vector backbone.

[0128] In addition to regulating the luciferase gene, the xpt-G17-containing regulatory cassette was also tested in regulating secreted proteins, anti-KDR antibody and erythropoietin (Epo). The xpt-G17-containing regulatory cassette was inserted within the coding sequences of anti-KDR antibody and erythropoietin. As shown in Figures 5g and 5h, guanine treatment resulted in an 80-fold induction in anti-KDR antibody production and a 140-fold induction in Epo production compared to the production of each molecule from cells in the absence of ligand.

[0129] These results demonstrate the general functionality and applicability in regulating protein expression of potential therapeutic target genes in AAV-mediated gene delivery and the application of this gene regulatory cassette.Therefore, we have created a synthetic mammalian "on"-riboswitch capable of switching on target gene protein expression in response to the presence of an aptamer-specific ligand in mammalian cells.

[0130] Example 6. Various purine aptamers can be used to regulate target gene expression through alternative splicing.

[0131] Experimental procedure

[0132] The following aptamer sequences listed in Table 3 were used to construct the riboswitches: Table 3 [Table 3]

[0133] result

[0134] To test additional aptamers in our gene regulation system, we used the same strategy and method described in the previous examples to create multiple guanine and adenine responsive riboswitches by linking various guanine and adenine aptamers to an intron-mtDHFR-intron cassette (Figure 6a). The tested guanine riboswitches efficiently regulated the expression of luciferase gene in response to guanine (Figure 6b). Furthermore, we found that these guanine riboswitches regulated the expression of target genes not only in response to guanine (Figure 6b), but also in response to guanosine (Figure 6c) and 2 deoxyguanosine (2'dG) (Figure 6d).

[0135] We created multiple adenine riboswitches (FIG. 6a) and also demonstrated gene regulatory functionality (FIG. 6e).

[0136] Differences in gene expression regulation of the various aptamer containing constructs tested may reflect differences in 5'ss accessibility, inclusion of alternative exons, and therefore aptamer / ligand binding affinity and aptamer secondary structure that may affect target gene expression. Intron-exon-intron gene regulatory cassettes can be optimized by altering the aptamer sequence to achieve the desired level of gene regulation.

[0137] Example 7. On / off aspects of target gene expression regulated by mammalian guanine riboswitches

[0138] Experimental procedure

[0139] The intron-mtDHFR-aptamer-intron cassette was PCR amplified and cloned into the pEGFP-C1 vector using the Golden Gate cloning strategy (NEB). To obtain a cell line stably expressing EGFP with the riboswitch, HEK-293 cells were electroporated with 20 ng of plasmid DNA. 48 hours after electroporation, cell cultures were selected for cells stably expressing the cassette with 800 μg / ml G418 for 2 weeks. Cells were trypsinized and the cell suspension was subjected to flow cytometric analysis of GFP fluorescence intensity using a Guava EasyCyte 8HT instrument. The data obtained were analyzed using GuavaSoft 2.2.2.

[0140] result

[0141] To further demonstrate that expression of a target gene containing our intron-exon-intron regulatory cassette can be regulated by exposure to a ligand specific for the aptamer contained within the riboswitch, an intron-mtDHFR-intron cassette containing the xpt-G17 riboswitch (SEQ ID NO: 15) was inserted into the EGFP gene and stably transfected into HEK293 cells. In the presence of guanine, EGFP expression was switched on (Figure 7a). Fluorescence was already detectable 6 hours after guanine treatment, increased throughout 3 days of guanine treatment, and reached nearly 300-fold induction compared to untreated cells (Figure 7b), indicating an "on" state of target gene expression in the presence of the aptamer ligand. When guanine was removed from the cell culture, EGFP expression decreased, indicating an "off" state of target gene expression in the absence of the aptamer-specific ligand (Figure 7b). The inventors have thereby created a gene regulatory platform comprising an intron-exon-intron cassette encompassing a synthetic riboswitch, whereby expression of a target gene in mammalian cells is regulated by the presence or absence of a specific aptamer ligand.

[0142] Example 8. Effect of multiple regulatory cassettes on the regulation of target gene expression

[0143] Experimental procedure

[0144] Constructs were generated using the Golden Gate cloning strategy (NEB). HEK293 cells were transfected with the indicated constructs and treated with 500 μM guanine or 1 mM guanosine (Sigma) 4 hours after transfection. Luciferase activity was assayed as described in Example 5.

[0145] result

[0146] The construct with xpt-G15 (SEQ ID NO: 46), which contains a regulatory cassette (DHFR_G15, Example 5), showed a 60-fold induction of luciferase expression in response to guanine treatment compared to uninduced basal expression levels, and reached approximately 100% of the level of luciferase expression by Con1 (Figure 8a), a useful feature when regulating therapeutic proteins that are required at high levels.

[0147] In contrast, the construct with xpt-G17, which contains a regulatory cassette (DHFR_G17), had a significantly higher induction fold of 2181-fold due to the low uninduced baseline expression, but the maximum expression level upon induction was significantly lower compared to Con1 (Figure 8a).

[0148] To test whether a regulatory cassette containing two copies of xpt-G15 (xpt-G15 double; SEQ ID NO: 64) could reduce the basal level of expression without reducing the maximum luciferase expression level upon induction, a regulatory cassette containing two copies of xpt-G15 was embedded within the luciferase gene, with each copy embedded at a different location within the gene sequence. When the regulatory cassette containing two copies of xpt-G15 was present, the uninduced baseline expression was reduced, resulting in a significantly higher fold induction (60-fold to 1008-fold) without reducing the maximum expression level (Figure 8a).

[0149] The EC50 of guanine for the xpt-G15 double cassette (xpt-G15 double; SEQ ID NO: 64) was 5-fold lower than that for the construct containing a single copy of the more stringent xpt-G17-containing cassette (43 μM vs. 206 μM), thereby enhancing the sensitivity of the ligand response (Figure 8a).

[0150] The strategy of using two copies of a low-stringency regulatory cassette to enhance the induction fold and the maximum induced gene expression was also applied to the EGFP gene. As shown in Figures 8b and 8c, consistent with the results of luciferase regulation (Figure 8a), a single copy of the xpt-G15 regulatory cassette in the EGFP gene (EGFP-xpt-G15) produced a higher uninduced baseline level of EGFP expression when compared to the xpt-G17 regulatory cassette containing construct (EGFP-xpt-G17). However, when two copies of the xpt-G15 regulatory cassette were inserted in the EGFP gene in a different configuration (EGFP-xpt-G15 double), the uninduced baseline expression level was reduced to that of xpt-G17, and at the same time, the induction level of EGFP was even higher than the Con1-EGFP control (Figure 8c).

[0151] Furthermore, a regulatory cassette containing one copy of xpt-G17 and one copy of the Ydhl-A5 adenine riboswitch was embedded within the luciferase gene. Luciferase expression was induced by either the addition of adenine (25-fold) or guanine (120-fold) alone, however, significantly higher levels of induction were achieved using the combination of adenine and guanine at the highest concentrations they were used (up to 2966-fold) (Figure 8d). These results demonstrate the modularity of alternative splicing-based riboswitches in regulating target gene expression.

[0152] To reduce genetic recombination and increase the ease of production of viral vectors that contain more than one regulatory cassette, regulatory cassettes with different intron and exon sequences can be used for a single target gene, which may contain the same or different gund-responsive aptamers.

[0153] Example 9. Effect of intron size and sequence on target gene expression regulation via aptamer-mediated alternative splicing

[0154] Experimental procedure

[0155] The Con1 construct was used as a template for PCR amplification of intron fragments with either upstream or downstream intron deletions. To generate constructs with single intron deletions, PCR products were cloned into constructs encompassing the xpt-G17 riboswitch using the Golden Gate cloning strategy (NEB). To generate constructs with both upstream and downstream intron deletions, a fragment excised with EcoRI and BamHI from a construct with a single deletion in the downstream intron sequence was cloned into an EcoRI and BamHI digested construct with a single deletion in the upstream intron sequence.

[0156] result

[0157] Introns contain elements that can enhance (intron splicing enhancer, ISE) or suppress (intron splicing suppressor, ISS) exon splicing. Among all the riboswitches we created, xpt-G17 demonstrated the best regulatory potential in terms of both fold induction and induced gene expression levels. Using the xpt-G17 riboswitch in an intron-exon-intron cassette, we made a series of modifications in the intron sequence and intron length, as well as the splice sites, to further optimize the system.

[0158] First, the effect of intron modification was tested by introducing single deletions within the intron sequence either upstream or downstream of the mtDHFR exon (Figures 9a, 9b). Sixteen constructs with xpt-G17 encompassing the riboswitch were generated, xpt-G17-IR-1 to xpt-G17-IR-16 (sequences of 13 of these constructs are shown in Table 5, SEQ ID NOs: 16 to 28). Next, the upstream and downstream intron deletions were combined to create larger intron deletions, as shown in Figure 9c. As shown in Figures 9d and 9e, the 16 constructs generated with two intron deletions (2IR), constructs 2IR-1 to 2IR-10 (SEQ ID NOs: 29 to 38), showed significantly higher fold induction without reducing the induced expression level of luciferase, with 2IR-3 having the greatest improvement in fold induction (4744-fold). In addition, we also made constructs with a mutated 3'ss upstream of the mtDHFR exon and also reduced the size of the downstream intron. As shown in Figures 9d and 9e (constructs DHFR_3ssC_1-5), these modifications further improved the relative fold induction, but nevertheless in this case a reduction in the level of induced expression was observed (from 64% to 32% for 3ssC_3).

[0159] These results indicate that the gene regulatory potential of intron-exon aptamer-intron cassettes can be optimized by modifying the intron sequences flanking the alternative exons to achieve the desired level of gene regulation.

[0160] Example 10. Use of multiple natural exons as well as synthetic exons in gene regulatory cassettes

[0161] Experimental procedure

[0162] The sequences of mutated human Wilms tumor 1 exon 5 (mutWT1-e5, SEQ ID NO: 61), SIRT1 exon 6 (SIRT1-e6, SEQ ID NO: 62), mouse calcium / calmodulin-dependent protein kinase II delta exon 16 or 17 (Camk2d-e16 or e17, SEQ ID NO: 59, 60), and synthetic exon ENEEE (SEQ ID NO: 63) were synthesized (IDT) and cloned into the DHFR-G17 vector in place of the DHFR exons using the Gibson cloning kit (NEB). Plasmid DNA was transfected into HEK293 cells, treated with 500 μM guanine, and luciferase assays were performed as described in Example 1. The sequence of each exon with its 5' and 3' splice sites is shown with the exon sequence in uppercase (Table 5, SEQ ID NO: 59-63).

[0163] result

[0164] To confirm that the regulatory function of our intron-exon-aptamer-intron cassette is not restricted to a specific exon sequence, we replaced the mtDHFR exon in a construct containing the guanine xpt-G17 riboswitch (DHFR-xpt-G17) with multiple different natural and mutant exons, as well as synthetic exons containing known exon splice enhancer sequences (ESEs). As shown in Figure 10, the regulatory cassette with the CamkIId-e16 exon produced almost equivalent induction folds compared to DHFR-xpt-G17, but with lower levels of both basal and induced luciferase expression. Cassettes containing other exons also showed variable levels of both basal and induced luciferase expression. This demonstrates that the aptamer-mediated alternative splicing gene regulatory cassette is not exon specific and is not restricted to the mDHFR-e2 exon.

[0165] Exons that can generate effective alternative splicing events are suitable for aptamer-mediated gene regulation cassettes. These results further indicate that the gene regulation ability of this intron-exon aptamer-intron cassette can be optimized by modifying sequences within the alternative exon as well as the surrounding intron sequences, such as the splicing strength of the 5'ss and 3'ss sequences of the alternative exon, and the ESE and ESS sequences within the alternative exon as described herein.

[0166] Example 11. Regulation of target gene expression by aptamer-mediated alternative splicing in vivo in mice

[0167] Experimental procedure

[0168] Hydrodynamic DNA delivery and drug therapy: 5 μg or 10 μg of endotoxin-free plasmid DNA containing the luciferase gene with a regulatory cassette containing two copies of xpt-G15 (xpt-G15 double, SEQ ID NO: 64, Example 8, FIG. 8a) diluted in saline (Qiagen Endofree kit) was injected into 6-7 week old CD-1 female mice through the tail vein in a volume of 10% body weight over 5-10 seconds. Guanosine (Sigma) was freshly suspended in 0.5% methylcellulose / 0.25% Tween 80 (Sigma) in water and administered orally 2 or 12 hours after DNA injection or delivered by intraperitoneal injection (IP) at 5, 12, 16, and 24 hours after DNA delivery.

[0169] Non-invasive live animal bioluminescence imaging: Prior to imaging, mice were anesthetized with 2% isoflurane, injected with 150 gm / kg body weight luciferin, and images were taken using a Bruker Xtreme system within 2-5 min after luciferin injection and at the indicated time points after DNA injection. Luciferase activity was expressed as mean photons / sec ± sd. Fold induction was calculated as the quotient of photons / sec obtained in mice treated with guanosine divided by the value obtained in mice without guanosine treatment.

[0170] result

[0171] We evaluated the gene regulatory function of the intron-exon-intron regulatory cassette in mice in vivo. Endotoxin-free plasmid DNA of a construct containing two copies of the xpt-G15 riboswitch in the luciferase gene (xpt-G15 double) was delivered to the liver of mice by hydrodynamic injection, and guanosine was administered intraperitoneally. We tested two routes of guanosine delivery. In one experiment (Fig. 11a and 11b), mice were orally administered various doses of guanosine at 2 and 12 hours after DNA delivery, and then photographed. As shown in Fig. 11a, mice treated with guanosine showed higher luciferase expression 9 hours after DNA. Luciferase expression in guanosine-treated mice gradually increased and reached a maximum level 48 hours after DNA injection, after which expression decreased.

[0172] In a separate experiment (Fig. 11c and 11d), guanosine was administered intraperitoneally. Four hours after DNA injection (PI) and before guanosine treatment, mice in each group showed similar levels of basal luciferase activity (Fig. 11). Mice were then treated with either vehicle as a control or guanosine. At 11 hours PI, luciferase activity increased in all mice, consistent with reports that luciferase gene expression peaks at 12 hours after DNA hydrostatic injection in the liver. However, mice treated with guanosine had significantly higher levels of luciferase expression compared to those in untreated mice, with 4.7- and 16.2-fold inductions seen by 100 mg / kg and 300 mg / kg guanosine, respectively, compared to uninduced baseline expression.

[0173] This demonstrated that the splicing-based gene regulatory cassette regulates gene expression in vivo in an animal in a dose-dependent manner in response to administration of a ligand specific for the aptamer contained within the regulatory cassette.

[0174] Example 12. Delivery of riboswitch constructs to mouse retina via adeno-associated virus (AAV) vectors

[0175] Experimental procedure

[0176] AAV plasmid constructs: Two riboswitch expression constructs (listed in the table below) were adapted by molecular cloning into a format that could be packaged as an AAV genome. Table 4 [Table 4]

[0177] The EGFP transgene-based expression constructs (GTX5-7) were digested with the restriction enzymes MfeI and NheI to release a ∼1400 bp DNA fragment encompassing the riboswitch inducible element and the EGFP transgene. The pD10 AAV genome plasmid was also digested with MfeI and NheI to release a 4475 bp fragment encompassing the AAV ITRs, CMV promoter, and SV40 polyadenylation signal. The two fragments were ligated using T4 DNA ligase to produce the following structure, which can be packaged as an AAV2 genome: [ITR]-[CMV]-[5'EGFP]-[riboswitch element]-[3'EGFP]-[SV40]-[ITR] This results in a plasmid containing the sequence:

[0178] All the resulting plasmid constructs were verified by DNA sequencing and named according to the following rules: pD10-GTX#

[0179] AAV vector production and titration: Adeno-associated virus (AAV) was produced in vitro by transient transfection of HEK-293T cells with the three plasmids. (i) pD10 backbone-based viral genome plasmid. (ii) AAV packaging plasmid containing the AAV2 Rep78 gene and the viral capsid gene. Although many different AAV serotypes can be generated by altering the capsid gene sequence, in this case the AAV8 capsid was used. (iii) Helper plasmid (pHGTI-Adeno1), which provides a nearly minimal set of adenoviral genes required for AAV packaging and assembly.

[0180] These plasmids were transfected into HEK-293T cells at a ratio of 1:1:3 and 150 cm 2 A total of 50 μg of plasmid DNA was transfected per 80-90% confluent plate. A typical production run consisted of 20 such plates. The transfection reagent used was polyethylenimine (PEI) with a PEI to DNA ratio of 2.25:1 (w / w). 72 hours after transfection, cells were physically detached from the plate and pelleted by centrifugation; the resulting cell pellet was resuspended in 20 mL of TRIS density buffer. The pellet was then lysed by repeated freeze / thaw / vortex cycles, and any unpackaged DNA remaining in the lysate was destroyed by Benzonase digestion. The lysate was then clarified by dead-end filtration and centrifugation before dilution to a total volume of 50 mL.

[0181] The clarified lysate was then purified via an affinity-based FPLC procedure using an AVB column on an AKTA Pure instrument (both GE Healthcare) running according to a preprogrammed protocol. The final AAV-containing eluate from the FPLC column was concentrated to a volume of ∼200 μL by centrifugation at 5000×g in a 10,000 MW exclusion Vivaspin4 centrifugal concentrator (GE Healthcare), 2 mL of PBS-MK was added (to dilute the high salt elution buffer), and the eluate was reconcentrated to ∼200 μL using the same concentrator. This material constituted the purified AAV virus and, where appropriate, was aliquoted and stored at −80°C.

[0182] Vector titers were established using qPCR (targeted against the SV40 polyadenylation signal) directly on samples of purified vector. The resulting cycle thresholds were compared to a known standard curve to calculate the number of vector genomes per mL.

[0183] The riboswitch AAV vectors were named according to the following rules: AAV2 / [capsid serotype#]-GTX#

[0184] Subretinal injections in mice: Injections of vectors into the subretinal space were performed in mice under general anesthesia using a 10 mm, 34 gauge needle as directed in the manual attached to a 5 μL Hamilton syringe. The needle tip was guided to the injection location by retinal observation through an operating microscope. In all eyes receiving vector, 2×2 μL injections were performed, with one injection placed in the superior hemisphere and the other in the inferior hemisphere of the eye. After injection, the quality of the resulting retinal detachment and any reflux of injected material were recorded.

[0185] Fluorescent fundus photography: Following subretinal injection, EGFP transgene expression was assessed periodically by Fundus photography using a slit lamp (SC16, Keeler) with an attached Leica DC500 digital camera. Animals were placed under general anesthesia and their pupils were dilated with 1% topical tropicamide. The refractive power of the cornea was neutralized by placing a cover slip over the cornea covered with couplant solution (Viscotears). The instrument was adjusted and the animal was positioned under bright white light. With the retina in sharp focus and the optic disc in the center of the field of view, bright field images were then taken using an exposure time of 200 ms. Transgene (EGFP) fluorescence was assessed by filtering the light source (475 ± 25 nm) and two further images were taken with exposure times of 10 to 30 seconds.

[0186] result

[0187] The riboswitch constructs (Table 4) were successfully cloned into a format that could be packaged as an AAV genome as shown by DNA sequencing of the ligation products. From the resulting constructs, pd10-GTX7 and pd10-GTX5 were further produced as AAV2 / 8 viral vectors. The produced vectors were shown to have the following titers by qPCR: AAV2 / 8-GTX7: 1.17×10 13 Vector genomes / mL AAV2 / 8-GTX5: 1.73x10 13 Vector genomes / mL

[0188] These two vectors were then injected subretinally and allowed to develop EGFP transgene expression for 8 days before expression was assessed by fluorescent fundus photography. Figure 12 shows that EGFP was expressed in AAV2 / 8-GTX7-injected retinas. Although transgene expression was low, substantial expression from AAV2 / 8-GTX7 was only as expected after induction via aptamer-mediated alternative splicing in response to (not added) ligand.

[0189] Example 13. Regulation of target gene expression by regulatory cassette-mediated alternative splicing in vivo in mouse retina following AAV delivery

[0190] procedure

[0191] Quantification of fluorescent fundus photographs (EGFP signal): All manipulations and analysis of images were performed using the GNU Image Manipulation Program (GIMP, open source). As described above, three images of each retina were taken at each time point of imaging: white light (200 ms), 475±25 nm (10 s), and 475±25 nm (30 s). First, these three images were layered and, using the white light image as a guide, a region of interest (ROI) was defined to encompass the entire retina as seen through the pupil. For the two 475±25 nm (EGFP fluorescence) images, a threshold tool was used to highlight only pixels with intensity values ​​above a defined threshold. The threshold was chosen on the basis of defining a clear separation of the EGFP signal from the background and to provide an adequate dynamic range for the analysis. The number of pixels above threshold within the ROI was recorded for each image. To correct for variable dilation of the pupil, which leads to variability in the visible retinal area between eyes, the number of pixels above the threshold was divided by the total number of pixels in the ROI.

[0192] Induction: Riboswitch-mediated induction of target gene expression was achieved via two routes of administration as described below:

[0193] Intraperitoneal injection (IP): A volume of 100 μL of [75 mg / ml guanosine in water + 0.5% w / v methylcellulose + 0.25% v / v Tween 80] was injected into the intraperitoneal cavity using a 13 mm, 30 gauge needle, corresponding to a 300 mg / kg guanosine dose in an adult mouse weighing 25 g.

[0194] Intravitreal injection (I-Vit.): A volume of 2 μL of [ImM guanosine in PBS-MK + 2.5% DMSO] was injected intravitreally using a 10 mm, 34 gauge needle as instructed in the manual. The needle tip position during injection was below the lens just above the optic disc and was guided to this position by retinal observation through a surgical microscope.

[0195] result

[0196] On day 00, a total of 9 eyes were injected subretinal as described in Example 12 as follows: - AAV2 / 8-GTX7 (EGFP transgene expression from the CMV promoter regulated by the G15 riboswitch element) in six eyes - AAV2 / 8-GTX5 (positive control construct, unregulated EGFP transgene expression from the CMV promoter) in three eyes

[0197] Fluorescence fundus photography as described in Example 12 was performed on days 02, 08, 09, 10 and 12.

[0198] All eyes received induction via intraperitoneal injection after fluorescent fundus photography on days 08, 09, and 10. All eyes received induction via intravitreal injection on day 11. Fluorescent signals were quantified as previously described, and illustrative images are shown in FIG.

[0199] Since gene expression from AAV2 / 8 is known to take 7 days to reach a maximum, no induction was performed for the first 8 days after vector injection. Therefore, the expression level on day 8 was considered as the baseline before induction. At day 10 after vector injection after two rounds of IP induction, transgene expression increased by ∼3.5× (P≦0.05, one-way ANOVA, Dunnetts) compared to this baseline, as shown in Fig. 13c and Fig. 13a (L vs. N).

[0200] Twelve days after vector injection, 24 hours after intravitreal induction, and 48 hours after the final IP induction, transgene expression increased 9x (P < 0.001, one-way ANOVA, Dunnetts) compared to baseline, as shown in Figure 13c and Figure 13a (L vs. O). This greater induction after intravitreal induction implies (but has not been shown to be) that this route of induction may be more effective than intraperitoneal injection.

[0201] A higher resolution image showing the difference in EGFP transgene expression before and after induction is shown in FIG. 13b.

[0202] Over the same time period and induction regimen, EGFP expression levels mediated by the unregulated control vector AAV2 / 8-GTX5 did not change significantly (one-way ANOVA, Bonferroni) and remained nearly constant, as shown in Figure 13d. Due to the large difference in expression levels mediated by GTX7 vs. GTX5, each set of images required different exposure times (30 s and 10 s, respectively) and thresholds (50 and 190, respectively).

[0203] This data clearly indicates that transgene expression from the G15 based GTX7 construct was regulated via aptamer-mediated alternative splicing in mouse retina. The maximal transgene expression level induced from GTX7 was lower than that mediated by the non-inducible positive control construct GTX5. Table 5. Description and related sequences. Exon sequences are shown in upper case and intron sequences are shown in lower case unless otherwise stated. [Table 5] [Table 6] [Table 7] [Table 8]

Table 9

Table 10

Table 11

Table 12

Table 13

Table 14

Table 15

Table 16

Claims

1. A polynucleotide construct comprising, from 5' to 3', a sequence encoding: (a) the first intron; (b) an alternatively spliced ​​exon; and (c) a second intron containing a riboswitch that contains an effector region and an aptamer; where the riboswitch comprises, in a 5' to 3' direction: a. the 5' splice site sequence of the second intron; b. the aptamer sequence; and c. a sequence complementary to the 5' splice site sequence of the second intron; Including, wherein the 5' splice site sequence of the second intron and the sequence complementary to the 5' splice site sequence of the second intron form a stem having a length of 7 to 20 base pairs; wherein the alternatively spliced ​​exon contains a stop codon in frame with a target gene when spliced ​​into the mRNA of the target gene comprising the polynucleotide construct. Polynucleotide constructs.

2. The polynucleotide construct of claim 1 , wherein the aptamer binds to a small molecule ligand.

3. The first and second introns a. derived from an endogenous intron from the target gene; b. is exogenous to the target gene; or c. derived from intron 2 of the human β-globin gene; A polynucleotide construct according to claim 1 or 2.

4. The polynucleotide construct of any one of claims 1 to 3, wherein the first intron comprises a stop codon in frame with the target gene.

5. The polynucleotide construct of any one of claims 1 to 4, wherein the first and second introns are each independently 50 to 300 nucleotides in length.

6. 6. The polynucleotide construct of claim 5, wherein the first and second introns are each independently 125 to 240 nucleotides in length.

7. 7. The polynucleotide construct of claim 1, wherein the 5' splice site sequence of the second intron and the sequence complementary to the 5' splice site sequence of the second intron form a stem 8 to 11 base pairs in length.

8. 8. The polynucleotide construct of claim 1, wherein the 5' splice site sequence of the second intron comprises the sequence: (i) GTAATG, (ii) GTRAGT (wherein R can be A or G), (iii) GTAAGC, or (iv) GTGTGG.

9. 9. The polynucleotide construct of claim 8, wherein the 5' splice site sequence of the second intron comprises the sequence GTAATG.

10. 9. The polynucleotide construct of claim 8, wherein the 5' splice site sequence of the second intron comprises the sequence: (i) GTRAGT (wherein R can be A or G), (ii) GTAAGC, or (iii) GTGTGG.

11. The polynucleotide construct of any one of claims 1 to 10, wherein the aptamer sequence TAATCGCGTGGATATGGCACGCAAGTTTCTACCGGGCACCGTAAATGTCCGAC is replaced with a different aptamer sequence in a sequence selected from the group consisting of SEQ ID NOs: 15, 16, 18, 20, 21, 22, 24-38, 45 and 46.

12. 12. The polynucleotide construct of claim 11, wherein the aptamer sequence comprising TAATCGCGTGGATATGGCACGCAAGTTTCTACCGGGCACCGTAAATGTCCGAC in the sequence of SEQ ID NO: 15 is replaced with a different aptamer sequence.

13. 12. The polynucleotide construct of claim 11, wherein the aptamer sequence comprising TAATCGCGTGGATATGGCACGCAAGTTTCTACCGGGCACCGTAAATGTCCGAC in the sequence of SEQ ID NO: 46 is replaced with a different aptamer sequence.

14. 14. The polynucleotide construct of any one of claims 1 to 13, wherein the alternatively spliced ​​exon is derived from exon 2 of the human dihydrofolate reductase gene, mutated human Wilms tumor 1 exon 5, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6.

15. The polynucleotide construct according to any one of claims 1 to 13, wherein the alternatively spliced ​​exon is modified exon 2 of the human dihydrofolate reductase gene derived from SEQ ID NO:

15.

16. The polynucleotide construct of any one of claims 1 to 15, wherein the alternatively spliced ​​exon is synthetic.

17. 14. The polynucleotide construct of any one of claims 1 to 13, wherein the alternatively spliced ​​exon has been modified by one or more of the group consisting of altering the sequence of an exon splice enhancer, altering the sequence of an exon splice silencer, adding an exon splice enhancer, and adding an exon splice silencer.

18. The polynucleotide construct of any one of claims 1 to 13, wherein the alternatively spliced ​​exon comprises an exon sequence of any of SEQ ID NOs: 47, 51, 52, 49, 59, 61, 62 or 63.

19. A vector comprising the polynucleotide construct of any one of claims 1 to 18.

20. The vector of claim 19 , wherein the vector is a viral vector.

21. 21. The vector of claim 20, wherein the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector.

22. The vector of claim 19 , wherein the vector is a non-viral vector.

23. A vector according to any one of claims 19 to 22 for use in a method for modulating expression of a target gene, the method comprising: a. exposing a cell to the vector of any one of claims 19 to 22; and b. exposing the cells to a small molecule ligand that specifically binds to the aptamer in an amount effective to induce expression of the target gene; A vector comprising:

24. 23. The vector of any one of claims 19 to 22 for use in a method for modulating expression of a target gene in a mammalian eye, the method comprising: a. introducing into the eye the vector according to any one of claims 19 to 22; and b. providing to said mammal a small molecule ligand in an amount effective to induce expression of said target gene; A vector comprising:

25. The expression of the target gene a. expression level is greater than 5-fold higher in the presence of the small molecule ligand compared to the absence of the small molecule ligand; or b. the expression level is greater than 10-fold greater in the presence of the small molecule ligand compared to the level in the absence of the small molecule ligand; 25. The vector of claim 23 or 24.

26. The vector according to any one of claims 23 to 25, wherein two or more of said polynucleotide constructs are inserted into said target gene.

27. The vector of claim 26 , wherein two or more of the polynucleotide constructs comprise different aptamers that specifically bind to different small molecule ligands.

28. The vector of claim 26 , wherein two or more of the polynucleotide constructs comprise the same aptamer.

29. The vector according to any one of claims 24 to 28, wherein the vector is intended to be introduced into the eye by intraocular injection.

30. Use of the vector according to any one of claims 19 to 22 in the manufacture of a medicament for regulating expression of a target gene.

31. Use of a small molecule ligand in the manufacture of a medicament for use with a vector according to any one of claims 19 to 22 for modulating expression of a target gene.

Images