Method for producing antibody-drug conjugate and enzyme used therein

Abstract

The purpose of the present invention is to provide a simpler ADC manufacturing method. The present invention provides a method for manufacturing an antibody-drug conjugate comprising a step for conjugating a sugar-chain homogenization antibody and a sugar-chain-bound drug, the sugar-chain-bound drug being one in which a drug is bound, via a linker, to a sugar chain in which a reducing terminal is oxazolinized. The sugar-chain homogenization antibody and the sugar-chain-bound drug can be handled using an endo-β-N-acetyl glucosaminidase mutant enzyme.

Description

[Technical field]

[0001] The present invention relates to a method for producing an antibody-drug conjugate, and also to a mutant enzyme of endo-β-N-acetylglucosaminidase used in the production method. [Background technology]

[0002] Antibody drug conjugates (hereinafter referred to as ADCs) are antibodies that specifically bind to a target and are conjugated with a drug. For example, an ADC in which a payload with a strong cell-killing effect is conjugated with an antibody that targets cancer cells can selectively deliver a drug (payload) to cancer cells, thereby significantly reducing the systemic toxicity that is a side effect, and effectively killing cancer cells, compared to the use of a single payload. A representative ADC is T-DM1 (Kadcyla (registered trademark)), which is an anti-HER2 antibody trastuzumab conjugated with a tubulin inhibitor, and has been approved as a drug (Non-Patent Documents 1, 2, and 3). Since T-DM1 randomly binds the payload to the Lys residue on the antibody, it is produced as a mixture with heterogeneous binding positions and numbers of bindings to the antibody of the payload. Similar ADCs include gemtuzumab ozogamicin (generic name: Mylotarg) (Non-Patent Document 4), brentuximab vedotin (generic name: Adcetris) (Non-Patent Document 5), etc.

[0003] In recent years, it has been reported that the homogeneity of ADCs affects pharmacokinetics, drug release rate, and efficacy (Non-Patent Document 6). From the viewpoint of ADC quality control, site-selective payload binding methods are being actively developed with the aim of producing highly homogeneous ADCs. One such method is a method of binding to antibody glycans using an enzyme. The ADC production process using this method that has been reported so far is as follows: (1) homogenization of glycans by enzymatic cleavage of heterogeneous antibody glycans (hydrolysis process), (2) enzymatic binding of a glycosyl homogenized antibody to another glycan (transglycosylation process), and (3) binding of the azide group of another glycan to a payload (chemical reaction process).

[0004] When the purpose of this method is to convert sugar chains, an enzyme family called endo-β-N-acetylglucosaminidase is used in the hydrolysis step and the sugar transfer step (Non-Patent Document 7). Endo-β-N-acetylglucosaminidase is isolated from various species and used depending on the type of antibody sugar chain. Representative endo-β-N-acetylglucosaminidases used in the hydrolysis step include EndoA, EndoD, EndoM, EndoH, EndoF2, EndoF3, EndoE, EndoS, EndoS2, etc.

[0005] Among these, it has been reported that hydrolysis ability is suppressed in EndoS D233Q, in which Asp at position 233 of EndoS is substituted with Gln (Patent Document 1, Non-Patent Document 8), EndoS2 D184M or EndoS2 D184Q, in which Asp at position 184 of EndoS2 is substituted with Met or Gln (Patent Document 2, Non-Patent Document 9), and EndoF3 D165A or EndoF3 D165Q, in which Asp at position 165 of EndoF3 is substituted with Ala or Gln (Patent Document 3, Non-Patent Document 10). It has also been reported that these mutant enzymes promote glycosylation between a glycosylated antibody (GlcNAc antibody) and a substrate in which the reducing end of the glycan is oxazolinated.

[0006] Furthermore, it has been reported that a homogeneous ADC was produced by using EndoS D233Q to transfer a GlcNAc antibody and a reducing end of a glycan having an azide group to an oxazolinated substrate, and then chemically binding the azide group of the resulting conjugate to MMAE, a type of payload (Non-Patent Documents 11 and 12). [Prior art documents] [Patent documents]

[0007] [Patent Document 1] WO2013 / 120066A1 [Patent Document 2] WO2017 / 124084A1 [Patent Document 3] US2012 / 0226024A1 [Non-patent literature]

[0008] [Non-Patent Document 1] Nat.Biotechnol,23,1073-1078(2005) [Non-Patent Document 2] Cancer Sci,100,1566-1572(2009) [Non-Patent Document 3] Nat.Biotechnol,23,1137-1146(2005) [Non-Patent Document 4] Clin Cancer Res,7,1490-1496(2001) [Non-Patent Document 5] MAbs, 4, 458-465 (2012) [Non-Patent Document 6] Nat.Biotechnol,26,952-932(2008) [Non-Patent Document 7] Chem.Soc.Rev,46,5128-5146(2017) [Non-Patent Document 8] J.Am.Chem.Soc,134,12308-12318(2012) [Non-Patent Document 9] J.Biol.Chem,291,16508-16518(2016) [Non-Patent Document 10] J.Biol.Chem,291,9356-9370(2016) [Non-Patent Document 11] Nat. Protoc., 6, 1183-1191 (2011) [Non-Patent Document 12] Bioconjug Chem,30,1343-1355(2019) Summary of the Invention [Problem to be solved by the invention]

[0009] The manufacturing process of ADC using glycosylated antibodies and enzymes that has been reported so far requires three steps: hydrolysis of the antibody glycan, glycotransfer to the glycosylated antibody, and linking of the payload to the antibody-glycan. Considering the purification of ADC at each step, it is expected that the cost of ADC production will increase and the performance and function of the antibody will decrease due to purification, so a simpler manufacturing method is desired.

[0010] In general, enzyme reactions are substrate-specific. Therefore, if a substrate glycan modified with a payload is to be conjugated to a glycosylated antibody in one step using a glycosyltransferase, the reaction efficiency of the enzyme is expected to be significantly reduced. In fact, the present inventors have attempted to conjugate a glycan modified with a peptide or drug to an antibody using various glycosyltransferases, but the reaction efficiency was significantly reduced compared to the case of linking a simple glycan to an antibody.

[0011] The present invention aims to provide an enzyme that can efficiently conjugate a glycan modified with a payload to a glycosylated antibody, and to provide a novel method for producing an ADC that uses this enzyme to conjugate an antibody and a payload in a single step, whereas the conventional method required two steps. [Means for solving the problem]

[0012] The present invention provides the following: [1] A method for producing an antibody-drug conjugate, comprising the steps of: A step of conjugating a glycosylated antibody with a glycochain-binding drug, The glyco-linked drug is a glyco-chain having an oxazolinyl group at its reducing end linked to a drug via a linker. [2] The method for producing the present invention described in 1, in which the glycosylated antibody and the glycan-binding drug are conjugated using an endo-β-N-acetylglucosaminidase mutant enzyme. [3] The method according to 2, wherein the endo-β-N-acetylglucosaminidase mutant enzyme is any one of the following proteins: (1) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 1 in which the 165th position is substituted with an amino acid other than aspartic acid (D); (2) A protein having the amino acid sequence of the protein according to (1) in which one or more amino acids have been substituted, deleted, inserted, and / or added, with the proviso that the 165th amino acid is an amino acid other than D, and having conjugation activity; (3) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (1), with the proviso that the 165th amino acid is an amino acid other than D, and having a conjugation activity; (4) a protein consisting of the amino acid sequence of SEQ ID NO: 11, or the amino acid sequence of SEQ ID NO: 11 in which the 233rd position is substituted with an amino acid other than D; (5) A protein having the amino acid sequence of the protein according to (4) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 233rd position is an amino acid other than D, and having conjugation activity; (6) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (4), with the proviso that the 233rd amino acid is an amino acid other than D, and having a conjugation activity; (7) A protein consisting of the amino acid sequence of SEQ ID NO: 24, or the amino acid sequence of SEQ ID NO: 24 in which the 165th position is replaced with an amino acid other than aspartic acid (D).

[0013] [4] A method for producing a compound according to any one of claims 1 to 3, wherein the linker comprises a structure that is cleavable in vivo. [5] A method for producing a compound according to any one of claims 1 to 4, wherein the linker is a structure containing a peptide. [6] The method according to any one of items 1 to 5, wherein the linker is a structure represented by the general formula -EDCBA-, where A binds to the glycan and E binds to the drug. [In the formula, A, B, C, and E are each independently selected from the group consisting of an alkyl group, an ester group, a carbamoyl group, an alkoxyalkyl group, an imine group, a hydrazone group, an azo group, a sulfone group, an aromatic group, and a single bond; D is a peptide consisting of 2-6 amino acid residues. [7] A is -(CH2CH2O) m1 -(CH2) m2 -, -(CH2) m2 - or a single bond; B is any one selected from the group consisting of the following: [ka] [In the formula, each R is independently a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, an alkoxy group having 1 to 4 carbon atoms, -CN, -OH, -CF3, or NRR.]; C is -C(O)-(CH2) n1 -C(O)-, -C(O)-(CH2) n1 -C(O)-NH-(CH2CH2O) n2 -(CH2) n3 -C(O)-, -C(O)-(CH2) n1 -C(O)-NH-(CH2) n3 -C(O)- or a single bond; E is -aminobenzyl alcohol -C(O)-, NH-(CH2) o - or a single bond, m1 is an integer from 1 to 12, m2 is an integer from 1 to 6; n1 is an integer from 1 to 6, n2 is an integer from 1 to 12, n3 is an integer from 1 to 6, and o is an integer from 1 to 6.]. [8] B: [ka] 8. The method for producing according to claim 7, wherein the [9] The method for producing a compound according to any one of claims 1 to 8, wherein the drug is selected from the group consisting of anthracyclines, auristatins, maytansines, camptothecins, pyrrolobenzodiazepine dimers, calicheamicins, and duocarmycins.

[10] An enzyme preparation for use in the reaction of a glycosylated antibody with a glycosylated drug, comprising any one of the following proteins: (1) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 1 in which the 165th position is substituted with an amino acid other than aspartic acid (D); (2) A protein having the amino acid sequence of the protein according to (1) in which one or more amino acids have been substituted, deleted, inserted, and / or added, with the proviso that the 165th amino acid is an amino acid other than D, and having conjugation activity; (3) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (1), with the proviso that the 165th amino acid is an amino acid other than D, and having a conjugation activity; (4) a protein consisting of the amino acid sequence of SEQ ID NO: 11, or the amino acid sequence of SEQ ID NO: 11 in which the 233rd position is substituted with an amino acid other than D; (5) A protein having the amino acid sequence of the protein according to (4) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 233rd position is an amino acid other than D, and having conjugation activity; (6) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (4), with the proviso that the 233rd amino acid is an amino acid other than D, and having a conjugation activity; (7) A protein consisting of the amino acid sequence of SEQ ID NO: 24, or the amino acid sequence of SEQ ID NO: 24 in which the 165th position is replaced with an amino acid other than aspartic acid (D).

[11] Use of a polynucleotide encoding any one of the following proteins in the production of an enzyme for use in the reaction of a glycosylated antibody with a glycosylated drug: (1) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 1 in which the 165th position is substituted with an amino acid other than aspartic acid (D); (2) A protein having the amino acid sequence of the protein according to (1) in which one or more amino acids have been substituted, deleted, inserted, and / or added, with the proviso that the 165th amino acid is an amino acid other than D, and having conjugation activity; (3) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (1), with the proviso that the 165th amino acid is an amino acid other than D, and having a conjugation activity; (4) a protein consisting of the amino acid sequence of SEQ ID NO: 11, or the amino acid sequence of SEQ ID NO: 11 in which the 233rd position is substituted with an amino acid other than D; (5) A protein having the amino acid sequence of the protein according to (4) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 233rd position is an amino acid other than D, and having conjugation activity; (6) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (4), with the proviso that the 233rd amino acid is an amino acid other than D, and having a conjugation activity; (7) A protein consisting of the amino acid sequence of SEQ ID NO: 24, or the amino acid sequence of SEQ ID NO: 24 in which the 165th position is replaced with an amino acid other than aspartic acid (D). [Brief description of the drawings]

[0014] [Figure 1] Map of pRSFDuet-1 (Novagen) [Figure 2-1] Map of pRSFDuet-1-MBP-EndoF3 D165Q [Figure 2-2] Map of pRSFDuet-1-EndoS D233Q [Diagram 3] FIG. 3 is a schematic diagram showing antibody-GlcNAc obtained by hydrolyzing the N297-linked glycan of an antibody using EndoS. [Figure 4] FIG. 4 is a schematic diagram showing conjugation using the EndoF3 mutant enzyme. [Diagram 5] FIG. 5 shows an HPLC chromatogram of the ADC obtained by conjugating antibody-GlcNAc with a daunorubicin-attached sugar chain using the EndoF3 mutant enzyme. [Figure 6] FIG. 6 shows an HPLC chromatogram of the ADC obtained by conjugating antibody-GlcNAc with an MMAE-attached sugar chain using the EndoF3 mutant enzyme. [Figure 7] FIG. 7 shows the MS chromatogram of the ADC obtained by conjugating antibody-GlcNAc with a daunorubicin-attached sugar chain using the EndoF3 mutant enzyme. [Figure 8] FIG. 8 shows the MS chromatogram of the ADC obtained by conjugating antibody-GlcNAc with an MMAE-attached glycan using the EndoF3 mutant enzyme. [Figure 9] Amino acid sequence of EndoF3D165Q (SEQ ID NO:1), optimized base sequence of EndoF3D165Q (SEQ ID NO:2), amino acid sequence of Matlose Binding protein (SEQ ID NO:5) [Figure 10] Full-length nucleotide sequence of pRSFDuet-1-MBP-EndoF3 D165Q (SEQ ID NO:10) [Figure 11] Amino acid sequence of EndoSD233Q (SEQ ID NO:11), optimized nucleotide sequence of EndoSD233Q (SEQ ID NO:12) [Figure 12] Full-length nucleotide sequence of pRSFDuet-1-EndoS D233Q (SEQ ID NO:19) [Figure 13]AP3-linked glycan conjugate (HPLC) [Figure 14] AP3-linked glycan conjugate (MS). [Figure 15] Exatecan-linked glycoconjugate (HPLC) [Figure 16] Exatecan-linked glycan conjugate (MS) [Figure 17] MMAE-PEG3-linked glycan conjugates and MMAE-PEG4-linked glycan conjugates (HPLC) [Figure 18] MMAE-PEG3 glycan conjugate (MS) [Figure 19] MMAE-PEG4 glycan conjugate (MS) [Figure 20] MMAE-GGF Glycoconjugate (HPLC) [Figure 21] MMAE-GGF Glycoconjugate (MS) [Figure 22] Map of pRSFDuet-1-MBP-WP1328 [Diagram 23] Nucleotide sequence of WP1328 (SEQ ID NO:20), amino acid sequence of WP1328 (SEQ ID NO:24) [Figure 24] Complete nucleotide sequence of pRSFDuet-1-MBP-WP1328 (SEQ ID NO:23) DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] The present invention relates to a method for producing antibody-drug conjugates (hereinafter referred to as "ADC"), comprising the steps of: The production method of the present invention comprises a step of conjugating a glycosylated antibody with a glycosylated drug. The step of conjugating a glycosylated antibody with a glycosylated drug can be carried out by a synthetic method or an enzymatic method.

[0016] [enzyme] When the conjugation step is carried out by an enzymatic method, an endo-β-N-acetylglucosaminidase mutant enzyme can be used. In the present invention, the term "endo-β-N-acetylglucosaminidase mutant enzyme" refers to an endo-β-N-acetylglucosaminidase mutant enzyme with suppressed hydrolysis ability. Representative examples of endo-β-N-acetylglucosaminidase include EndoA, EndoD, EndoM, EndoH, EndoF2, EndoF3, EndoE, EndoS, and EndoS2.

[0017] In a preferred embodiment, among the endo-β-N-acetylglucosaminidase mutant enzymes, a mutant enzyme in which asparagine (D) at position 233 of EndoS is substituted, a mutant enzyme in which asparagine (D) at position 184 of EndoS2 is substituted, or a mutant enzyme in which asparagine (D) at position 165 of EndoF3 is substituted, preferably a mutant enzyme in which asparagine (D) at position 233 of EndoS is substituted, or a mutant enzyme in which asparagine (D) at position 165 of EndoF3 is substituted.

[0018] More preferred examples of the endo-β-N-acetylglucosaminidase mutant enzymes include mutant enzymes consisting of any one of the following proteins: (1) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 1 in which the 165th position is substituted with an amino acid other than aspartic acid (D); (2) A protein having the amino acid sequence of the protein according to (1) in which one or more amino acids have been substituted, deleted, inserted, and / or added, with the proviso that the 165th amino acid is an amino acid other than D, and having conjugation activity; (3) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (1), with the proviso that the 165th amino acid is an amino acid other than D, and having a conjugation activity; (4) a protein consisting of the amino acid sequence of SEQ ID NO: 11, or the amino acid sequence of SEQ ID NO: 11 in which the 233rd position is substituted with an amino acid other than D; (5) A protein having the amino acid sequence of the protein according to (4) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 233rd position is an amino acid other than D, and having conjugation activity; (6) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (4), with the proviso that the 233rd amino acid is an amino acid other than D, and having a conjugation activity; (7) A protein consisting of the amino acid sequence of SEQ ID NO: 24, or the amino acid sequence of SEQ ID NO: 24 in which the 165th position is replaced with an amino acid other than aspartic acid (D).

[0019] Another example of an endo-β-N-acetylglucosaminidase mutant enzyme is a mutant enzyme consisting of any one of the following proteins: (1) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 1 in which the 165th glutamine (Q) is changed to alanine (A); (2) A protein having the amino acid sequence of the protein according to (1) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 165th amino acid is Q or A, and having a conjugation activity; (3) A protein consisting of an amino acid sequence having identity to the amino acid sequence of the protein according to (1), with the proviso that the 165th amino acid is Q or A, and having a conjugation activity; (4) a protein consisting of the amino acid sequence of SEQ ID NO: 11; (5) A protein having the amino acid sequence of the protein according to (4) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 233rd position is Q, and having a conjugation activity; (6) A protein consisting of an amino acid sequence having identity to the amino acid sequence of the protein according to (4), with the proviso that the 233rd position is Q, and having a conjugation activity; (7) A protein consisting of the amino acid sequence of SEQ ID NO: 24, or the amino acid sequence of SEQ ID NO: 24 in which the 165th position is replaced with an amino acid other than aspartic acid (D).

[0020] In the sequence listing, the amino acid sequence of EndoF3 D165Q, in which the 165th amino acid of EndoF3 is replaced with glutamine (Q), is shown as SEQ ID NO: 1. Also, the amino acid sequence of EndoS D233Q, in which the 233rd amino acid of EndoS is replaced with glutamine (Q), is shown as SEQ ID NO: 11. Note that, in the following, the present invention may be described using as an example the case where EndoF3 D165Q or EndoS D233Q is used as the endo-β-N-acetylglucosaminidase mutant enzyme, but those skilled in the art can understand the description by appropriately applying it to the case where other mutant enzymes are used.

[0021] The endo-β-N-acetylglucosaminidase mutant enzyme used for conjugation may be one in which a point mutation has been introduced into the above mutant enzyme. Examples of such mutant enzymes include a mutant enzyme consisting of a protein having an amino acid sequence of SEQ ID NO: 1, or an amino acid sequence in which the 165th glutamine (Q) in the amino acid sequence of SEQ ID NO: 1 is alanine (A), and having at least one mutation selected from the group consisting of K81T, M97W, Y, F, V, G, S, or Q, V129G, Q250I, N270R, L, or T, and Y282W. A particularly preferred example is EndoF3 D165Q / M97G, a protein consisting of an amino acid sequence of SEQ ID NO: 1, or an amino acid sequence in which the 165th glutamine (Q) in the amino acid sequence of SEQ ID NO: 1 is alanine (A), and in which the 97th (M) is replaced with (G).

[0022] In the present invention, the term conjugation activity in relation to an endo-β-N-acetylglucosaminidase mutant enzyme means, unless otherwise specified, that when a conjugation reaction is carried out between a glycosylated antibody and a glycosylated drug, at least 20% of the antibody (adduct) to which the drug is attached can be produced (100(%) - residual rate (%) is 20% or more). The rate (%) here can be calculated based on the peak area in the HPLC chromatogram of the conjugation reaction solution. When multiple types of adducts are produced, for example when a 1-adduct and a 2-adduct are produced, all of the adducts are taken into consideration. Specifically, it can be calculated based on the following formula.

[0023] Residual rate (%) = [peak area value of unreacted antibody] / [(peak area value of unreacted antibody) + (peak area value of adduct: if multiple types of adducts are formed, the sum of the peak areas of each adduct) × 100

[0024] 1-adduct conversion rate (%) = [peak area value of 1-adduct] / [(peak area value of unreacted antibody)+(peak area value of 1-adduct)+(peak area value of 2-adduct)]×100

[0025] 2-adduct conversion rate (%) = [peak area value of 2-adduct] / [(peak area value of unreacted antibody)+(peak area value of 1-adduct)+(peak area value of 2-adduct)]×100

[0026] The present invention also provides a polynucleotide encoding an endo-β-N-acetylglucosaminidase mutant enzyme that can be used in a method for producing an antibody-drug conjugate. A polynucleotide encoding any one of the following proteins is provided: (1) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 1 in which the 165th position is substituted with an amino acid other than aspartic acid (D); (2) A protein having the amino acid sequence of the protein according to (1) in which one or more amino acids have been substituted, deleted, inserted, and / or added, with the proviso that the 165th amino acid is an amino acid other than D, and having conjugation activity; (3) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (1), with the proviso that the 165th amino acid is an amino acid other than D, and having a conjugation activity; (4) a protein consisting of the amino acid sequence of SEQ ID NO: 11, or the amino acid sequence of SEQ ID NO: 11 in which the 233rd position is substituted with an amino acid other than D; (5) A protein having the amino acid sequence of the protein according to (4) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 233rd position is an amino acid other than D, and having conjugation activity; (6) A protein having an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (4), with the proviso that the 233rd amino acid is an amino acid other than D, and having a conjugation activity; (7) A protein consisting of the amino acid sequence of SEQ ID NO: 24, or the amino acid sequence of SEQ ID NO: 24 in which the 165th position is replaced with an amino acid other than aspartic acid (D).

[0027] Another example of a polynucleotide encoding an endo-β-N-acetylglucosaminidase mutant enzyme that can be used in the method for producing an antibody-drug conjugate is a polynucleotide encoding any one of the following proteins: (1) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 1 in which the 165th glutamine (Q) is changed to alanine (A); (2) A protein having the amino acid sequence of the protein according to (1) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 165th amino acid is Q or A, and having a conjugation activity; (3) A protein consisting of an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (1), with the proviso that the 165th amino acid is Q or A, and having a conjugation activity; (4) a protein consisting of the amino acid sequence of SEQ ID NO: 11; (5) A protein having the amino acid sequence of the protein according to (4) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 233rd position is Q, and having a conjugation activity; (6) A protein consisting of an amino acid sequence having at least 90% identity to the amino acid sequence of the protein according to (4), with the proviso that the 233rd position is Q, and having a conjugation activity; (7) A protein consisting of the amino acid sequence of SEQ ID NO: 24, or the amino acid sequence of SEQ ID NO: 24 in which the 165th position is replaced with an amino acid other than aspartic acid (D).

[0028] [antibody] The antibody used in the present invention may be any of mouse, chimeric, humanized, and human antibodies, but is preferably a humanized or human antibody. The antibody used may also be modified, and may be prepared by the Potelligent technology (removal of fucose from the Fc region of IgG).

[0029] An example of an antibody is an anti-HER2 antibody. The anti-HER2 antibody is a recombinant anti-HER2 monoclonal antibody, and includes a chimeric antibody having a human constant region, a humanized antibody (CDR-grafted antibody) in which the CDR (complementarity determining region) of a human antibody is grafted with the CDR of an anti-HER2 antibody of an animal other than human, and a human antibody which is an expression product of an antibody gene derived from a human, and the humanized antibody or human antibody is preferred. A fully human monoclonal antibody can be produced by immunizing a mouse into which most of the human immunoglobulin heavy and light chain loci have been introduced. A preferred anti-HER2 antibody is trastuzumab (Herceptin (registered trademark)), which is a humanized IgG1 antibody.

[0030] The present invention can be applied to antibodies used as antibody drugs. Specific examples include ibritumomabtiuxetan, iodine131, catumaxomab, blinatumomab, muromonab-CD3, abciximab, rituximab, basiliximab, infliximab, cetuximab, brentuximab, siltuximab, dinutuximab, obiltoxaximab, daclizumab, palivizumab, gemtuzumab, alemtuzumab, omalizumab, efalizumab, bevacizumab, natalizumab, tocilizumab, ranibizumab, eculizumab, certolizumab pegol, mogamulizumab, pertuzumab, obinutuzumab, vedolizumab, pembrolizuma, idarucizumab, mepolizumab, elotuzumab, daratumumab, ixekizumab, reslizumab, adalimumab, panitumumab, golimu Mention may be made of mab, ustekinumab, canakinumab, ofatumumab, denosumab, ipilimumab, belimumab, raxibacumab, ramucirumab, nivolumab, secukinumab, evolocumab, alirocumab, and necitumumab.

[0031] An example of the class of antibodies used in the production method of the present invention is IgG, and an example of the subclass is IgG1.

[0032] [Drugs] In the present invention, anticancer drugs can be used as drugs. Examples of anticancer drugs include known anticancer drugs such as tubulin synthesis inhibitors (anticancer plant alkaloids), topoisomerase inhibitors, alkylating agents that are inhibitors of nucleic acid synthesis, metabolic antagonists, antibiotic anticancer drugs, hormone preparations, platinum preparations, and nonspecific anticancer drugs, as well as newly developed anticancer drugs. Specific examples include tubulin synthesis inhibitors (anticancer plant alkaloids) such as auristatin, vincristine sulfate, vinblastine sulfate, vindesine sulfate, docetaxel hydrate, paclitaxel, vinorelbine tartrate, and maytansinoids; topoisomerase inhibitors such as camptothecin, topotecan, etoposide, irinotecan hydrochloride, and nogitecan hydrochloride; cyclophosphamide, ifosfamide, melphalan, thioteba, busulfan, and cambogi. Alkylating agents such as Rubocon, Dacarbazine, Nimustine hydrochloride, and Ranimustine; metabolic antagonists such as Methotrexate, Mercaptopurine, 6-Mercaptopurine riboside, Fluorouracil (5-FU), Tegafur, Tegafur uracil, Carmofur, Doxifluridine, Cytarabine ocfosfate, Hydroxycarbamide, Cytarabine, Gemcitabine Hydrochloride, Fludarabine Phosphate, Enocitabine, and Leucovorin; Doxorubicin Hydrochloride, Anticancer antibiotics such as idarubicin hydrochloride, epirubicin hydrochloride, pirarubicin hydrochloride, daunorubicin hydrochloride, aclarubicin hydrochloride, mitomycin C, actinomycin D, bleomycin, peplomycin sulfate, neocarzinostatin, and zinostatin stimalamer; estramustine phosphate, flutamide, bicalutamide, goserelin acetate, neuprorelin acetate, tamoxifen citrate, fodrozole hydrochloride hydrate, and anastomosine; Examples of such anticancer drugs include hormone preparations such as lozole, mepitiostane, epitiostanol, and medroxyprogesterone acetate; platinum preparations such as cisplatin, carboplatin, and nedaplatin; nonspecific antineoplastic agents such as krestin, lenatin, sizofiran, and ubenimex; mitoxantrone hydrochloride, procarbazine hydrochloride, pentostatin, sobuzoxane, tretinoin, L-asparaginase, aceglatone, mitotane, and porfimer sodium.

[0033] In a preferred embodiment, the drug is any one selected from the group consisting of anthracyclines, auristatins, maytansines, camptothecins, pyrrolobenzodiazepine dimers, calicheamicins, and duocarmycins.

[0034] Examples of anthracyclines include daunorubicin (daunomycin), doxorubicin (adriamycin), PNU-159682, and pirarubicin. An example of auristatins is auristatin, which is a tubulin synthesis inhibitor and a very strong antitumor agent. Auristatins include monomethyl auristatin E (MMAE), monomethyl auristatin D (MMAD), monomethyl auristatin F (MMAF), etc. Among these, monomethyl auristatin E (MMAE) is preferred. Examples of maytansines include ansamitocin P3 (AP3), DM1, and DM4. Examples of camptothecins include Exatecan, SN-38, and DXd. Other specific examples include PBD-dimer, calicheamicin, and duocarmycin.

[0035] [Linker] In the present invention, the sugar chain-binding drug is bound to the sugar chain having an oxazolinyl group at the reducing end via a linker. In a preferred embodiment, the linker includes a spacer (-CBA- as described below) and a cleavable portion (-ED-).

[0036] The spacer is a site that connects the sugar chain to the conjugate of the linker (in a narrow sense, -ED-, described later) and the drug. Examples of the binding group include amide, ester, alkoxyalkyl, carbamoyl, sulfonamide, sulfonate ester, phosphoamide, phosphonate ester, aldimine, ketoimine, oxime, and click binding sites formed from alkyne and azide, etc.

[0037] Representative examples of click binding sites are listed in the following literature information (Chem Rev.113,4905-4979(2013), Method Mol Biol.2078,83-97(2020), Chem.Soc.Rev.48,4361-4374(2019), Protein Cell.Jan;9(1),33-46(2018)). Preferred examples of such binding sites include a 1,2,3-triazole site formed from an alkyne and an azide, and a tetracyclic site containing a 1,2,3-triazole formed from DBCO and an azide. Further preferred examples include a tetracyclic site containing a 1,2,3-triazole formed from an azide.

[0038] Furthermore, in order to improve the water solubility of the linker in order to reduce the aggregation of the ADC, a common method is to introduce a PEG group. In the present production method, a PEG group is introduced into the spacer. Such PEG may be linear or branched, and is preferably linear PEG. The chain length of the PEG is not particularly limited, and examples include PEG2 (the number indicates the number of repetitions), PEG3, PEG4, and PEG5 to PEG12.

[0039] The cleavable portion is a site that can be cleaved under specific conditions that do not cause denaturation or decomposition of the protein. In other words, it includes a structure that can be cleaved in vivo. The specific conditions that do not cause denaturation or decomposition of the protein are decomposition conditions using one or more substances selected from the group consisting of acidic substances, basic substances, reducing agents, oxidizing agents, and enzymes (References: Bioorg Med Chem. 20 571-582 (2012), J. Control. Release, 99, 423-434 (2004), Bioconjugate Chem. 28, 1906-1915 (2017)). Examples of such cleavable portions include disulfide bonds, acetal bonds, ketal bonds, aldimine bonds, ketoimine bonds, oxime bonds, ester bonds, amide bonds, carbamoyl bonds, carbonate bonds, alkoxyalkyl bonds, sulfone-containing bonds, and phosphonic acid-containing bonds. Preferred examples of these cleavable portions include peptides consisting of 2-6 amino acid residues. Examples of this include Val-Cit, Gly-Gly-Phe-Gly (GGFG), Val-Ala, Lys-Phe (KF), and Gly-Gly-Val-Gly (GGVG).

[0040] In a preferred embodiment, the linker has a structure represented by the general formula -EDCBA-, where A binds to the sugar chain and E binds to the drug.

[0041] During the ceremony, A, B, C, and E are each independently selected from the group consisting of an alkyl group, an ester group, a carbamoyl group, an alkoxyalkyl group, an imine group, a hydrazone group, an azo group, a sulfone group, an aromatic group, and a single bond; D is a peptide consisting of 2-6 amino acid residues.

[0042] During the ceremony, A, B, C, and E each independently represent -(CH2) 1-12 -, -(CH2) 1-12 -0-C(O)- (CH2) 0-12 , -0-C(O)-NH-, -(CH2CH2O) 1-12 -(CH2) 1-12-, -C(=NR 1 )- or -(CH2) 1-12 - N(R 1 )- (At this time R 1 is a hydrogen atom or -(CH2) 1-6 ), -R 2 C=N-NR 3 -or-R 2 C=N-OR 3 - (At this time R 2 and R 3 Each independently represents a hydrogen atom or -(CH2) 1-6 ), -N=N-, -SO3-, a divalent aromatic hydrocarbon group (a group formed by removing two hydrogen atoms from an aromatic hydrocarbon ring, such as phenylene, indenylene, naphthylene, fluorenylene, phenanthrenylene, anthrylene, and pyrenylene), and a single bond.

[0043] A is -(CH2CH2O) m1 -(CH2) m2 -, -(CH2) m2 - or a single bond.

[0044] B may be any one selected from the group consisting of:

[0045] [ka]

[0046] In the formula, each R is independently a hydrogen atom, alkyl having 1 to 4 carbon atoms, alkoxy having 1 to 4 carbon atoms, -CN, -OH, -CF3, or NRR.

[0047] C is -C(O)-(CH2) n1 -C(O)-, -C(O)-(CH2) n1 -C(O)-NH-(CH2CH2O) n2 -(CH2) n3 -C(O)-, -C(O)-(CH2) n1 -C(O)-NH-(CH2) n3-C(O)- or a single bond; E is -aminobenzyl alcohol -C(O)-, NH-(CH2) o - or a single bond, m1 is an integer from 1 to 12, m2 is an integer from 1 to 6; n1 is an integer from 1 to 6, n2 is an integer from 1 to 12, n3 is an integer from 1 to 6, o is an integer from 1 to 6.

[0048] B may be any of the following:

[0049] [ka]

[0050] In a particularly preferred embodiment, the linker comprises the following structure:

[0051] [ka]

[0052] In a particularly preferred embodiment, the process of the present invention can be carried out as follows. (1) The glycan of an anti-HER2 antibody, which originally has a heterogeneous glycan structure, is cleaved. The glycan can be cleaved using endo-β-N-acetylglucosaminidase (EndoS). EndoS cleaves the N-type complex glycan, which is bound to asparagine (Asn) 297 located in the CH domain of the Fc region of the antibody, leaving one N-acetylglucosamine (GlcNAc) residue at the reducing end. The N-acetylglucosamine at the reducing end may or may not be bound to fucose. The antibody with the cleaved glycan may then be purified using chromatography. Examples of chromatography include gel filtration chromatography, affinity chromatography, ion exchange chromatography, and hydrophobic chromatography. (2) A glycan-binding drug is conjugated to the glycan of the antibody-GlcNAc obtained by (1). Conjugation can be performed using an endo-β-N-acetylglucosaminidase mutant enzyme. N-acetylglucosamine (GlcNAc) residue at the reducing end of the N-complex glycan bound to asparagine (Asn) at position 297 located in the CH domain of the Fc region of the antibody-GlcNAc is bound to an oxazolinyl N-acetylglucosamine at the reducing end of the glycan-binding drug. Thereafter, the antibody with the cleaved glycan can be purified by chromatography. Examples of chromatography include gel filtration chromatography, affinity chromatography, ion exchange chromatography, and hydrophobic chromatography.

[0053] [Term etc.] In the present invention, when a protein or amino acid sequence is referred to as an "amino acid sequence in which one or more amino acids have been substituted, deleted, inserted, and / or added," the number of amino acids to be substituted or otherwise modified is not particularly limited in any protein, unless otherwise specified, so long as the protein consisting of that amino acid sequence has the desired function, but is about 1-750, 1-500, 1-250, 1-200, 1-150, 1-100, 1-50, 1-40, 1-30, 1-20, 1-15, 1-9, or 1-4 amino acids, or a larger number of substitutions, etc., may be possible as long as the substitutions are with amino acids of similar properties. Means for preparing polynucleotides or proteins relating to such amino acid sequences are well known to those skilled in the art.

[0054] In the description of the present invention, with regard to amino acids or amino acid residues, unless otherwise specified, A is alanine, C is cysteine, D is aspartic acid, E is glutamic acid, F is phenylalanine, G is glycine, H is histidine, I isoleucine, K is lysine, L is leucine, M is methionine, N is asparagine, P is proline, Q is glutamine, R is arginine, S is serine, T is threonine, U is selenocysteine ​​(3), V is valine, W is tryptophan, and Y is tyrosine.

[0055] In the present invention, when the term "identity" is used with respect to a base sequence (sometimes called a nucleotide sequence) or an amino acid sequence, it means the percentage of the number of identical nucleotides or amino acids shared between two sequences when the two sequences are aligned in an optimal manner, unless otherwise specified. That is, identity can be calculated as follows: identity = (number of identical positions / total number of positions) x 100, and can be calculated using a commercially available algorithm. In addition, such an algorithm is incorporated in the NBLAST and XBLAST programs described in Altschul et al., J. Mol. Biol. 215 (1990) 403-410. More specifically, searches and analyses regarding the identity of base sequences or amino acid sequences can be performed using algorithms or programs (e.g., BLASTN, BLASTP, BLASTX, ClustalW) well known to those skilled in the art. When using a program, parameters can be appropriately set by those skilled in the art, and the default parameters of each program may be used. Specific techniques for these analysis methods are also well known to those skilled in the art. The identity may be calculated using genetic information processing software Genetyx (registered trademark) (Genetyx Corporation). If the subject sequence for which the identity percentage is to be determined has an additional sequence at the end that is not present in the sequence to be compared, such as a tag sequence, the additional sequence portion is not included in the identity percentage calculation.

[0056] In the present invention, when referring to identity with respect to a base sequence or amino acid sequence, unless otherwise specified, it refers to sequence identity of at least 50%, for example 60% or more, 70% or more, preferably 80% or more, more preferably 85% or more, even more preferably 90% or more, even more preferably 95% or more, even more preferably 97.5% or more, and even more preferably 99% or more.

[0057] The polynucleotides or genes, and proteins or enzymes used in the present invention can be prepared by those skilled in the art using conventional techniques. EXAMPLES

[0058] The present invention will be described in detail below with reference to examples, but the present invention is not limited thereto. Furthermore, reagents, solvents and starting materials not specifically described are commercially available or available from well-known sources.

[0059] The protein concentration described herein was measured by the Bradford method (measurement wavelength: 595 nm). In the following examples, the following abbreviations are used: CDMBI:2-Chloro-1,3-dimethyl-1H-benzimidazol-3-ium chloride HOAt:1-Hydroxy―7-azabenzotriazole HOBt: 1-Hydroxybenzotirazole IPTG:Isopropyl β-D-1-thiogalactopyranoside MMAE: Monomethyl Auristatin E

[0060] [Example 1: Preparation of EndoF3 mutant enzyme] (1) Preparation of pRSFDuet-1-MBP-EndoF3 D165Q Nucleotide sequence of EndoF3 (NZ CP067018, locus Tag I6H88 03475; protein sequence is WP A D165Q mutation was introduced into EndoF3 (034868774.1) (the amino acid sequence of EndoF3 D165Q is SEQ ID NO:1), and a codon-optimized sequence (SEQ ID NO:2) for expression in E. coli was artificially synthesized (ThermoFisher Scientific). This sequence was amplified by PCR using primers FEndoF3-NtermMBP and REndoF3-NtermMBP (98°C for 10 seconds, 60°C for 5 seconds, 68°C for 8 seconds, 30 cycles).

[0061] Nucleotide sequence of FEndoF3-NtermMBP (SEQ ID NO:3) ACTATCGAGGGAAGGGCAACCGCACTGGCAGGTAGC Nucleotide sequence of REndoF3-NtermMBP (SEQ ID NO:4) CCAATTGAGATCTTCAGTTTTTAACGGCATCACGAACTG

[0062] Similarly, a vector in which a maltose binding protein (amino acid sequence: SEQ ID NO: 5) and a Factor Xa cleavage sequence ATCGAGGGAAGG (SEQ ID NO: 6) (amino acid sequence: IEGR (SEQ ID NO: 7)) were cloned into the BglII site of the pRSF-MBP vector (pRSDuet-1, FIG. 2) was amplified by PCR (30 cycles of 98°C for 10 seconds, 60°C for 5 seconds, and 68°C for 8 seconds) using primers FNtermMBP and RNtermMBP.

[0063] Nucleotide sequence of FNtermMBP (SEQ ID NO:8) AGATCTCAATTGGATATCGG Nucleotide sequence of RNtermMBP (SEQ ID NO:9) CCTTCCCTCGATAGTCTGCGCGTCTTTCAGGGC

[0064] The two resulting fragments were cloned using an In-Fusion kit (TAKARA) so that the Factor Xa sequence was located at the C-terminus of MBP and the EndoF3 sequence with the N-terminal signal sequence removed was located downstream of the Factor Xa sequence. E. coli JM109 (TAKARA) was transformed using the resulting In-Fusion solution and cultured overnight at 37°C. Colony PCR was performed on the resulting colonies, and the plasmid pRSFDuet-1-MBP-EndoF3 D165Q (SEQ ID NO:10) was obtained from the positive clones.

[0065] (2) Point mutation introduction construction PCR was performed to introduce the desired point mutation into pRSFDuet-1-MBP-EndoF3 D165Q. 0.001 mL of DpnI was added to the fragment obtained by PCR, and the DNA fragment was purified by reacting at 37°C for 1 hour. The obtained fragment was introduced into E. coli JM109 by the heat shock method, and then spread on an LK plate and cultured overnight at 37°C to obtain a colony. This colony was inoculated into kanamycin-containing LB medium (3 mL) and cultured overnight, after which plasmid extraction was performed using Wizard Plus SV Minipreps DNA Purification Systems, and 0.05 mL of plasmid DNA solution was obtained from the culture.

[0066] (3) Transformation The above plasmid (0.001 mL) was added to BL21(DE3) competent cells (Novagen) (0.05 mL), and the cells were left to stand at 0°C for 20 minutes, then placed on a 42°C aluminum block for 45 seconds for heat shock treatment. SOC medium (0.45 mL) preheated to 37°C was added, and cultured at 37°C for 1 hour. The culture solution was centrifuged (room temperature, 6000g, 3 minutes) to precipitate the cells. After removing the supernatant (0.4 mL), the cells were resuspended and plated on an LB-Agar plate (containing 0.05 mg / mL kanamycin), and cultured overnight at 37°C.

[0067] (4) Expression culture One colony obtained by the above transformation was added to Superbroth (10 mL; Bacto Trypton (32 g), Bacto Yeast Extract (5 g), NaCl (5 g), 1 M sodium hydroxide aqueous solution (5 mL), pure water (950 mL), containing 0.05 mg / mL kanamycin) and cultured overnight at 37 ° C. The culture solution (2 mL) was added to Superbroth (200 mL, containing 0.05 mg / mL kanamycin) in a 500 mL baffled flask. Culture was performed at 37 ° C. for 6 hours, IPTG was added to a final concentration of 1 mM, and cultured overnight at 37 ° C. The culture solution was centrifuged (4 ° C., 10,000 rpm, 5 minutes), the supernatant was removed, and the bacterial cells were collected.

[0068] (5) Preparation of insoluble fraction and refolding BugBuster (40 mL) and Lysonase (0.04 mL) were added to the cells, and the cells were suspended by pipetting and mixed by inversion for 20 minutes. This cell suspension was centrifuged (room temperature, 10,000 rpm, 20 minutes), the supernatant was removed, and the precipitate was obtained as an insoluble fraction. 0.15% CHAPS / 20% acetic acid solution (40 mL) was added to this insoluble fraction. The mixture was mixed by inversion at 37°C for 2.5 hours, and centrifuged (room temperature, 10,000 rpm, 10 minutes) to obtain the supernatant. This supernatant was added to a Slide-A-Lyzer Dialysis Flask (20 kDa MWCO; Thermo Fischer Scientific), immersed in ultrapure water, and dialyzed at 4°C for 2 days (the dialysis solution was changed three times with an interval of 4 hours or more). The flask was further immersed in 10 mM Tris-HCl buffer (pH 8.0) and dialyzed overnight at 4°C. This solution was replaced with 50 mM pH 7.4 Tris-HCl buffer by ultrafiltration (Amicon Ultra 30 kDa) to obtain the EndoF3 mutant enzyme.

[0069] [Example 2: Preparation of EndoS mutant enzymes] (1) Plasmid construction Nucleotide sequence of EndoS (CP043530, locus Tag MGAS2221 1552; protein sequence is WP EndoS_D233Q_His_pRSF and Rendos_D233Q_His_pRSF were used as primers to synthesize EndoS_D233Q_His_pRSF and Rendos_D233Q_His_pRSF. D233Q The N-terminal side was amplified with front, and FendoS D233Q The C-terminal side was amplified by PCR (98°C for 10 seconds, 60°C for 5 seconds, 68°C for 8 seconds for 30 cycles) using back and REndoS_D233Q_His_pRSF. Similarly, pRSFDuet-1 was amplified with primer FpRSF InF His BamHI and RpRSF InF His The fragment was amplified by PCR using NcoI (30 cycles of 98°C for 10 seconds, 60°C for 5 seconds, and 68°C for 8 seconds).

[0070] Fendo SD233Q His pRSF (SEQ ID NO:13) CACCATCATCACCACGATAAACATTTGTTGGTAAAAAG RendoSD233Q front (SEQ ID NO:14) GCTAATTTTTTAAATTTATTTAGACCTTCTAAAC Fend SD233Q back (SEQ ID NO:15) GGTCTAAATAAATTTAAAAAATTAGCTCAATTAGACTTG RendoSD233Q His pRSF (SEQ ID NO:16) CTCGAATTCGGATCCTTATTTTTTTAGCAGCTGCC FpRSF InF His BamHI (SEQ ID NO:17) GGATCCGAATTCGAGCTCG RpRSF InF His NcoI (SEQ ID NO:18) GTGGTGATGATGGTGATGGCTGCTGCCCAT

[0071] The three obtained fragments were cloned using an In-Fusion kit (TAKARA) so that the Met of the initiation codon was removed and the EndoS sequence was placed downstream of the His tag. The resulting In-Fusion solution was used to transform E. coli JM109 (TAKARA), which was then cultured overnight at 37° C. Colony PCR was performed on the resulting colonies, and a plasmid, pRSFDuet-1-EndoSD233Q (SEQ ID NO: 19), was obtained from a positive clone.

[0072] (2) Transformation The above plasmid (0.001 mL) was added to BL21(DE3) competent cells (Novagen) (0.05 mL), and the cells were left to stand at 0°C for 20 minutes, then placed on a 42°C aluminum block for 45 seconds for heat shock treatment. SOC medium (0.45 mL) preheated to 37°C was added, and cultured at 37°C for 1 hour. The culture solution was centrifuged (room temperature, 6000g, 3 minutes) to precipitate the cells. After removing the supernatant (0.4 mL), the cells were resuspended and plated on an LB-Agar plate (containing 0.05 mg / mL kanamycin), and cultured overnight at 37°C.

[0073] (3) Expression culture One colony obtained by the above transformation was added to Superbroth (10 mL; Bacto Trypton (32 g), Bacto Yeast Extract (5 g), NaCl (5 g), 1 M sodium hydroxide aqueous solution (5 mL), pure water (950 mL), containing 0.05 mg / mL kanamycin) and cultured overnight at 37 ° C. The culture solution (2 mL) was added to Superbroth (200 mL, containing 0.05 mg / mL kanamycin) in a 500 mL baffled flask. Culture was performed at 37 ° C. for 6 hours, IPTG was added to a final concentration of 1 mM, and cultured overnight at 37 ° C. The culture solution was centrifuged (4 ° C., 10,000 rpm, 5 minutes), the supernatant was removed, and the bacterial cells were collected.

[0074] (4) Acquisition of EndoS D233Q BugBuster (5 mL) and Lysonase (0.5 mL) were added to the cells, and the cells were suspended by pipetting and mixed by inversion for 20 minutes. This cell suspension was centrifuged (4°C, 10000 rpm, 20 minutes) and the supernatant was collected. Streptomycin sulfate was added to this supernatant to a final concentration of 1%, and the mixture was left to stand overnight at 4°C. This suspension was centrifuged (4°C, 10000 rpm, 20 minutes) and the supernatant was collected. Ammonium sulfate was added to this supernatant to a final concentration of 40%, and the mixture was left to stand at 0°C for 1 hour. This suspension was centrifuged (4°C, 10000 rpm, 20 minutes) and the supernatant was collected. Ammonium sulfate was added to this supernatant to a final concentration of 60%, and the mixture was left to stand at 0°C for 1 hour. This suspension was centrifuged (4°C, 10000 rpm, 20 minutes) and the supernatant was collected. 1M pH 7.5 Tris-HCl buffer was added to this supernatant to a final concentration of 20%, and the mixture was applied to column chromatography (His Trap HP) for purification to obtain EndoS D233Q (SEQ ID NO: 11).

[0075] [Example 3: Preparation of antibody-GlcNAc] A schematic diagram of the preparation of antibody-GlcNAc is shown in Figure 3. In an Eppendorf tube, 0.050 g of anti-HER2 antibody (prepared with reference to US Patent No. 5,821,337. Subclass IgG1) was replaced with sodium acetate buffer (GlycoBuffer 1; NEW ENGLAND BioLabs), and this buffer was added to make the volume 0.3 mL. EndoS (0.025 mL; NEW ENGLAND BioLabs) was added to the solution, and the mixture was incubated at 37°C for 16 hours. EndoS in the reaction solution was removed using Chitin Beads (NEW ENGLAND BioLabs), and the collected fraction was purified using an affinity column (rProtein A Sepharose Fast Flow (GE Healthcare)). The antibody-GlcNAc (0.050 g) was obtained by ultrafiltration (Amicon Ultra 30 kDa) with 50 mM pH 7.4 Tris-HCl buffer.

[0076] [Example 4: Measurement of EndoF3 mutant enzyme activity and EndoS mutant enzyme activity] The antibody-GlcNAc prepared in Example 3 was conjugated with a payload-attached sugar chain (the daunorubicin-attached sugar chain in Production Example 6 below, or the MMAE-attached sugar chain in Production Example 11 below) using the EndoF3 mutant enzyme prepared in Example 1 or the EndoS mutant enzyme prepared in Example 2 (see Examples 5 and 6 below). A schematic diagram of this conjugation is shown in Figure 4. The obtained conjugate was measured by HPLC. The HPLC analysis conditions are shown below.

[0077] Column used: AdvanceBio HIC Column size: 30 x 4.6 mm Filler particle size: 3.5 μm Mobile phase A: 50 mM pH 7.4 sodium phosphate in water Mobile phase B: 2 M pH 7.0 ammonium sulfate aqueous solution Mobile phase C: 2-propanol

[0078] LC conditions: The gradient is as follows:

[0079] [Table 1]

[0080] Analysis time: 23 min Flow rate: 0.50 mL / min, column temperature: 25℃, detection wavelength: 214 nm, 280 nm, injection volume: 10 μL.

[0081] For each HPLC chromatogram, the conjugation with daunorubicin-attached glycan by the EndoF3 mutant enzyme is shown in Figure 5, and the conjugation with MMAE-attached glycan by the EndoF3 mutant enzyme is shown in Figure 6. From the obtained HPLC chromatogram, unreacted antibody-GlcNAc, a mono-adduct in which one antibody-GlcNAc molecule is conjugated with one payload-attached glycan molecule, and a di-adduct in which one antibody-GlcNAc molecule is conjugated with two payload-attached glycan molecules were confirmed as separate peaks. From the peak area ratios of antibody-GlcNAc, the mono-adduct, and the di-adduct, the antibody-GlcNAc residual rate and the conjugation conversion rate were calculated according to the following formula. The peak area at 214 nm was used to calculate the conversion rate.

[0082] Antibody-GlcNAc remaining rate (%) = [peak area value of antibody-GlcNAc] / [(peak area value of antibody-GlcNAc)+(peak area value of monoadduct)+(peak area value of diadduct)]×100

[0083] 1-adduct conversion rate (%) = [peak area value of 1-adduct] / [(peak area value of antibody-GlcNAc) + (peak area value of 1-adduct) + (peak area value of 2-adduct)] × 100

[0084] 2-adduct conversion rate (%)=[peak area value of 2-adduct] / [(peak area value of antibody-GlcNAc)+(peak area value of 1-adduct)+(peak area value of 2-adduct)]×100

[0085] In addition, intact mass analysis was performed for each conjugate. The obtained MS chromatograms were deconvoluted. The results of conjugation with daunorubicin-linked glycans using the EndoF3 mutant enzyme are shown in Figure 7, and the results of conjugation with MMAE-linked glycans using the EndoF3 mutant enzyme are shown in Figure 8.

[0086] The activity of the EndoS mutant enzyme was measured in the same manner as that of the EndoF3 mutant enzyme.

[0087] The activity of each mutant enzyme in the case of daunorubicin-linked glycan is shown in the table below.

[0088] [Table 2]

[0089] Among the EndoF3 mutant enzymes, D165Q / M97G showed the lowest survival rate. This mutant enzyme is expected to show similar high activity even when the glycan structure is different.

[0090] The activity of each mutant enzyme in the case of daunorubicin-linked glycan is shown in the table below.

[0091] [Table 3]

[0092] High conversion rates were obtained when the EndoS mutant enzyme was used.

[0093] [Table 4]

[0094] Although the EndoS2 mutant enzyme was also able to perform conversion to a certain extent, the EndoF3 mutant enzyme and the EndoS mutant enzyme had higher conversion rates under the experimental conditions. In addition, it was predicted that the conversion rate would be lower when conjugating a glycan with a payload added than when conjugating a glycan with a linker, but contrary to expectations, it was found that the conversion rate was higher when conjugating a daunorubicin- or MMAE-glycan.

[0095] [Production Example 1: Compound 3] [ka]

[0096] Compound 1 (Daunomycin) (0.72 g) and diisopropylethylamine (0.45 mL) were added to a DMF solution (50 mL) of compound 2 (Fmoc-Val-Cit-PAB-PNP) (0.99 g) synthesized by the method of WO2004 / 010957, and the mixture was stirred at room temperature for 19 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was washed with chloroform and filtered. The filtrate was dissolved in DMF, and after filtration, the solution was concentrated to obtain compound 3 (1.43 g). MS(ESI)m / z:1155(M+H) +

[0097] [Production Example 2: Compound 5] [ka]

[0098] Diethylamine (0.5 mL) was added to a DMF solution (20 mL) of compound 3 (1.43 g), and the mixture was stirred at room temperature for 1.5 hours. After the reaction solution was concentrated under reduced pressure, the residue obtained was washed with ethyl acetate and filtered to obtain a filtrate (0.90 g). Of the filtrate obtained, 0.40 g was dissolved in DMF (10 mL). Compound 4 (Fmoc-PEG2-NHS ester) (0.38 g) and diisopropylethylamine (0.15 mL) were added to this solution, and the mixture was stirred at room temperature for 17 hours. After the reaction solution was concentrated under reduced pressure, the residue obtained was purified by gel filtration chromatography (LH-20: chloroform / methanol = 1 / 1) to obtain compound 5 (0.45 g). MS(ESI)m / z:1315(M+H) +

[0099] [Production Example 3: Compound 7] [ka]

[0100] Diethylamine (1.0 mL) was added to a DMF solution (15 mL) of compound 5 (0.45 g), and the mixture was stirred at room temperature for 30 minutes. The reaction solution was concentrated under reduced pressure, and the resulting residue was washed with ethyl acetate and filtered to obtain a filtrate (0.30 g). 0.15 g of the resulting filtrate was dissolved in DMF (15 mL). Compound 6 (DBCO-NHS ester) (0.06 g) and diisopropylethylamine (0.05 mL) were added to this solution, and the mixture was stirred at room temperature for 4 hours. After the reaction solution was concentrated under reduced pressure, the resulting residue was purified by gel filtration chromatography (LH-20: chloroform / methanol = 1 / 1) to obtain compound 7 (0.05 g). MS(ESI)m / z:1380(M+H) +

[0101] [Production Example 4: Compound 10] [ka]

[0102] Compound 9 (Azido-PEG2-Amine·Tos-OH, Tokyo Chemical Industry Co., Ltd.) (0.88 g) and DMT-MM (0.72 g) were added to a DMF solution (12 mL) of compound 8 (α2,6-sialylglycan) (0.10 g), and the mixture was stirred at 37°C overnight. The reaction solution was purified by gel filtration chromatography (LH-20; methanol). The purified fraction was further purified by silica gel column chromatography (water / acetonitrile) on Wakosil C-18 to obtain compound 10 (0.11 g). MS(ESI)m / z:2333(M+H) +

[0103] [Production Example 5: Compound 11] [ka]

[0104] Compound 10 (0.02 g) was added to a DMF solution (10 mL) of compound 7 (0.05 g) and stirred overnight at room temperature. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (water / acetonitrile) to obtain compound 11 (0.03 g). MS(ESI)m / z:1698(M+3H) 3+ , 1274(M+4H) 4+

[0105] [Production Example 6: Compound 12] [ka]

[0106] CDMBI (0.02 g) and triethylamine (0.02 mL) were added to a mixed solution of compound 11 (0.02 g) in DMF / water (1.5 mL / 1.5 mL), and the mixture was stirred at 0° C. for 30 minutes. The reaction solution was purified by gel filtration column chromatography (LH-20:DMF) to obtain compound 12 (0.01 g).

[0107] [Example 5: Conjugation of antibody-GlcNAc and daunorubicin-linked sugar chain] [ka]

[0108] The mutant enzymes (EndoF3 mutant enzymes (0.003 mg) prepared in Example 1, or EndoS mutant enzymes (0.003 mg) prepared in Example 2), antibody-GlcNAc (0.03 mg) prepared in Example 3, and compound 12 / DMSO solution (40 mg / mL, 0.001 mL) were added to an Eppendorf tube, and 50 mM pH 7.4 Tris-HCl buffer was added to adjust the antibody-GlcNAc concentration to 5.0 mg / mL. The reaction solution was incubated at 37°C for 3 hours. The reaction solution was ultrafiltered (Amicon Ultra 100 kDa) and replaced with 50 mM pH 7.0 phosphate buffer, and the obtained compound 13 was analyzed (Figures 5 and 7).

[0109] [Production Example 7: Compound 15] [ka]

[0110] HOBt (0.11 g) and diisopropylethylamine (0.08 mL) were added to DMF (10 mL) to prepare solution A. Compound 14 (Asta Tech, Inc.) (0.22 g) and compound 2 (0.22 g) were dissolved in this solution A (6.3 mL). This reaction solution was stirred at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (chloroform / ethyl acetate) to obtain compound 15 (0.31 g). MS(ESI)m / z:1346(M+H) +

[0111] [Production Example 8: Compound 16] [ka] Diethylamine (1.0 mL) was added to a DMF solution (4.0 mL) of compound 15 (0.31 g), and the mixture was stirred overnight at room temperature. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (chloroform / ethyl acetate) to obtain a yellow solid (0.17 g). 0.11 g of the resulting solid was dissolved in the above-described solution A (2.5 mL), and compound 4 (0.11 g) was added and stirred at 30° C. for 3 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (DMF / ethyl acetate) to obtain compound 16 (0.11 g). MS(ESI)m / z:1505(M+H) +

[0112] [Production Example 9: Compound 17] [ka]

[0113] Solution B was prepared using DMF (10 mL), HOAt (0.11 g), and diisopropylethylamine (0.08 mL). Compound 9 (0.09 g) and compound 6 (0.03 g) were dissolved in solution B (2.5 mL). This reaction solution was stirred at 30° C. for 3 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (chloroform / methanol / ether) to obtain compound 17 (0.11 g). MS(ESI)m / z:1571(M+H) +

[0114] [Production Example 10: Compound 18] [ka]

[0115] Compound 10 (0.02 g) was added to a solution (1.5 mL) of compound 17 (0.07 g) in DMF, and the mixture was stirred for 3 hours at 30° C. The reaction solution was concentrated under reduced pressure and purified by preparative HPLC (methanol / water) to obtain compound 18 (0.01 g). MS(ESI)m / z:1822(M+H+H+Na) 3+ , 1373(M+H+H+Na+Na) 4+

[0116] [Production Example 11: Compound 19] [ka]

[0117] CDMBI (0.01 g) and triethylamine (0.1 mL) were added to a DMF / water mixed solution (2.0 mL / 2.0 mL) of compound 18 (0.004 g) and stirred for 2 hours at 0° C. This reaction solution was purified by gel filtration chromatography (LH-20:DMF) to obtain compound 19 (0.005 g).

[0118] [Example 6: Conjugation of antibody-GlcNAc and MMAE-linked glycan] [ka]

[0119] The antibody-GlcNAc (0.03 mg) obtained in Example 2, each of the EndoF3 mutant enzymes (0.003 mg) prepared in Example 1, or the EndoS mutant enzyme (0.003 mg) prepared in Example 2, and compound 19 / DMSO solution (40 mg / mL, 0.002 mL) were added to an Eppendorf tube, and 50 mM pH 7.4 Tris-HCl buffer was added so that the antibody-GlcNAc concentration became 5.0 mg / mL. The reaction solution was incubated at 37°C for 1.5 hours. The reaction solution was ultrafiltered (Amicon Ultra 100 kDa), replaced with 50 mM pH 7.0 phosphate buffer, and compound 20 was analyzed (Figures 6 and 8).

[0120] [Production Example 12: Compound 23] [ka]

[0121] Compound 22 (0.3 g) prepared according to WO2014 / 145090 and 1M aqueous sodium hydrogen carbonate solution (0.5 mL) were added to an acetonitrile / water mixed solution (6.0 mL / 2.0 mL) of compound 21 (0.1 g) prepared according to WO2014 / 145090 using maytansinol as a raw material, and the mixture was stirred at room temperature for 23 hours. This reaction solution was extracted with ethyl acetate, and the organic layer was dried over magnesium sulfate. The organic layer was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (ethyl acetate / methanol) to give compound 23 (0.08 g). Preparation method described MS(ESI)m / z:835(M+H) +

[0122] [Production Example 13: Compound 24] [ka]

[0123] Compound 23 (0.04 g) in acetonitrile / water mixed solution (3.0 mL / 1.0 mL) was added with TFA (1.0 mL) and stirred at room temperature for 30 minutes. Saturated aqueous sodium bicarbonate solution was added to this reaction solution, extracted with chloroform / methanol mixed solvent (7 / 1), and the organic layer was dried over magnesium sulfate. The organic layer was concentrated under reduced pressure to obtain compound 24 (0.04 g). MS(ESI)m / z:735(M+H) +

[0124] [Production Example 14: Compound 26] [ka]

[0125] Compound 4 (0.07 g) and diisopropylethylamine (0.04 mL) were added to a DMF solution (5.0 mL) of compound 25 (0.07 g, MedChemExpress) and stirred at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (DMF / ether) to obtain compound 26 (0.07 g). MS(ESI)m / z:761(M+H) +

[0126] [Production Example 15: Compound 27] [ka]

[0127] Diethylamine (0.5 mL) was added to a DMF solution (5.0 mL) of compound 26 (0.07 g) and stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, and the resulting residue was dissolved in DMF (5.0 mL), and DBCO-NHS (0.04 g) and diisopropylethylamine (0.04 mL) were added and stirred at room temperature overnight. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (DMF / ether) to obtain compound 27 (0.07 g). MS(ESI)m / z:826(M+H) +

[0128] [Production Example 16: Compound 28] [ka]

[0129] To a DMF solution (5.0 mL) of compound 27 (0.07 g), bis(4-nitrophenyl)carbonate (0.03 g) and diisopropylethylamine (0.04 mL) were added and stirred at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (DMF / ether) to obtain compound 28 (0.07 g). MS(ESI)m / z:991(M+H) +

[0130] [Production Example 17: Compound 29] [ka]

[0131] Compound 28 (0.01 g) and triethylamine (0.008 mL) were added to a DMF solution (0.9 mL) of compound 24 (0.008 g) and stirred at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (acetonitrile / water) to obtain compound 29 (0.011 g). MS(ESI)m / z:1587(M+H) +

[0132] [Production Example 18: Compound 30] [ka]

[0133] Compound 10 (0.002 g) was added to a DMF solution (1.6 mL) of compound 29 (0.008 g) and stirred overnight at 50° C. The reaction solution was purified by gel filtration chromatography (LH-20:DMF) to obtain compound 30 (0.004 g). MS(ESI)m / z:1837(M+3H) 3+ , 1378(M+4H) 4+

[0134] [Production Example 19: Compound 31] [ka]

[0135] CDMBI (0.04 g) and triethylamine (0.002 mL) were added to a DMF / water mixed solution (0.5 mL / 0.5 mL) of compound 30 (0.002 g) and stirred for 1 hour at 0° C. This reaction solution was purified by gel filtration chromatography (LH-20:DMF) to obtain compound 31 (0.003 g).

[0136] [Example 7: Conjugation of antibody-GlcNAc and maytansinoid-linked glycan] [ka]

[0137] The antibody-GlcNAc (0.03 mg) obtained in Example 2, the EndoF3 mutant enzyme (0.003 mg) prepared in Example 1, the EndoS mutant enzyme (0.003 mg) prepared in Example 2, or the WP1328 enzyme (0.003 mg) prepared in Example 12, and the compound 31 / DMSO solution (40 mg / mL, 0.002 mL) were added to an Eppendorf tube, and 50 mM pH 7.4 Tris-HCl buffer was added so that the antibody-GlcNAc concentration became 5.0 mg / mL. The reaction solution was incubated at 30°C or 37°C for 1.5-3.0 hours. The reaction solution was ultrafiltered (Amicon Ultra 100 kDa), replaced with 50 mM pH 7.0 phosphate buffer, and compound 32 was analyzed (Figures 13 and 14).

[0138] [Production Example 20: Compound 34] [ka]

[0139] Compound 2 (0.04 g), diisopropylethylamine (0.04 mL), and HOBt (0.02 g) were added to a DMF solution (5.0 mL) of compound 33 (0.07 g, MedChemExpress), and the mixture was stirred at 30 ° C. for 3 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (DMF / ether), and DMF (5.0 mL) and diethylamine (0.1 mL) were added to the resulting purple solid, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (DMF / ether), and further purified by gel filtration chromatography (LH-20:DMF) to obtain compound 34 (0.09 g). MS(ESI)m / z:841(M+H) +

[0140] [Production Example 21: Compound 35] [ka]

[0141] Compound 4 (0.03 g), diisopropylethylamine (0.02 mL), and HOBt (0.01 g) were added to a DMF solution (5.0 mL) of compound 34 (0.09 g), and the mixture was stirred at 30 ° C. for 3 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (DMF / ether), and DMF (5.0 mL) and diethylamine (0.1 mL) were added to the resulting purple solid, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (DMF / ether), and further purified by gel filtration chromatography (LH-20: DMF) to obtain compound 35 (0.07 g). MS(ESI)m / z:1001(M+H) +

[0142] [Production Example 22: Compound 36] [ka]

[0143] Compound 6 (DBCO-NHS ester, 0.03 g), diisopropylethylamine (0.01 mL), and HOBt (0.01 g) were added to a DMF solution (5.0 mL) of compound 35 (0.07 g), and the mixture was stirred at 30° C. for 1 hour. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by reprecipitation (DMF / ether) to obtain compound 36 (0.05 g). MS(ESI)m / z:1288(M+H) +

[0144] [Production Example 23: Compound 37] [ka]

[0145] Compound 10 (0.005 g) was added to a DMF solution (3.0 mL) of compound 36 (0.009 g), and the mixture was stirred for 2 hours at 40° C. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (acetonitrile / water) to obtain compound 37 (0.003 g). MS(ESI)m / z:1637(M+3H) 3+ , 1228(M+4H) 4+

[0146] [Production Example 24: Compound 38] [ka]

[0147] CDMBI (0.007 g) and triethylamine (0.001 mL) were added to a DMF / water mixed solution (1.0 mL / 1.0 mL) of compound 37 (0.003 g) and stirred for 30 minutes at 0° C. This reaction solution was purified by gel filtration chromatography (LH-20:DMF) to obtain compound 38 (0.003 g).

[0148] [Example 8: Conjugation of antibody-GlcNAc and exatecan-attached glycan] [ka]

[0149] The antibody-GlcNAc (0.03 mg) obtained in Example 2, each of the EndoF3 mutant enzymes (0.003 mg) prepared in Example 1, the EndoS mutant enzymes (0.003 mg) prepared in Example 2, or the WP1328 enzyme (0.003 mg) prepared in Example 12, and the compound 38 / DMSO solution (40 mg / mL, 0.002 mL) were added to an Eppendorf tube, and 50 mM pH 7.4 Tris-HCl buffer was added so that the antibody-GlcNAc concentration became 5.0 mg / mL. The reaction solution was incubated at 30°C or 37°C for 1.5-3.0 hours. The reaction solution was ultrafiltered (Amicon Ultra 100 kDa), replaced with 50 mM pH 7.0 phosphate buffer, and compound 39 was analyzed (Figures 15 and 16).

[0150] [Production Example 25: Compound 41] [ka]

[0151] Compound 40 (Azido-PEG3-Amine, Combi-Blocks) (0.25 g) and DMT-MM (0.34 g) were added to a DMF solution (6.0 mL) of compound 8 (0.05 g), and the mixture was stirred overnight at 37°C. The reaction solution was purified by gel filtration chromatography (LH-20:methanol). The purified fraction was further purified by silica gel column chromatography (water / acetonitrile) using Wakosil C-18 to obtain compound 41 (0.02 g). MS(ESI)m / z:2422(M+H) +

[0152] [Production Example 26: Compound 42] [ka]

[0153] Compound 41 (0.006 g) was added to a DMF solution (3.0 mL) of compound 17 (0.02 g) and stirred at room temperature for 22 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (acetonitrile / water) to obtain compound 42 (0.004 g). MS(ESI)m / z:1855(M+3H) 3+ , 1391(M+4H) 4+

[0154] [Production Example 27: Compound 43] [ka]

[0155] CDMBI (0.008 g) and triethylamine (0.001 mL) were added to a DMF / water mixed solution (1.0 mL / 1.0 mL) of compound 42 (0.004 g) and stirred for 30 minutes at 0° C. This reaction solution was purified by gel filtration chromatography (LH-20:DMF) to obtain compound 43 (0.004 g).

[0156] [Example 9: Conjugation of antibody-GlcNAc and MMAE-PEG3-linked glycan] [ka]

[0157] The antibody-GlcNAc (0.03 mg) obtained in Example 2, each of the EndoF3 mutant enzymes (0.003 mg) prepared in Example 1, the EndoS mutant enzymes (0.003 mg) prepared in Example 2, or the WP1328 enzyme (0.003 mg) prepared in Example 12, and the compound 43 / DMSO solution (40 mg / mL, 0.002 mL) were added to an Eppendorf tube, and 50 mM pH 7.4 Tris-HCl buffer was added so that the antibody-GlcNAc concentration became 5.0 mg / mL. The reaction solution was incubated at 30°C or 37°C for 1.5-3.0 hours. The reaction solution was ultrafiltered (Amicon Ultra 100 kDa), replaced with 50 mM pH 7.0 phosphate buffer, and compound 44 was analyzed (Figures 17, 18, and 19).

[0158] [Production Example 28: Compound 46] [ka]

[0159] Compound 45 (Azido-PEG4-Amine, Combi-Blocks) (0.30 g) and DMT-MM (0.34 g) were added to a DMF solution (6 mL) of compound 8 (0.05 g), and the mixture was stirred at 37° C. overnight. The reaction solution was purified by gel filtration chromatography (LH-20: methanol). The purified fraction was further purified by silica gel column chromatography (water / acetonitrile) using Wakosil C-18 to obtain compound 46 (0.02 g). MS(ESI)m / z:1256(M+2H) 2+ , 837(M+3H) 3+

[0160] [Production Example 29: Compound 47] [ka]

[0161] Compound 41 (0.006 g) was added to a DMF solution (3.0 mL) of compound 17 (0.02 g) and stirred at room temperature for 17 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (acetonitrile / water) to obtain compound 47 (0.007 g). MS(ESI)m / z:1884(M+3H) 3+ , 1413(M+4H) 4+

[0162] [Production Example 30: Compound 48] [ka]

[0163] CDMBI (0.008 g) and triethylamine (0.001 mL) were added to a DMF / water mixed solution (0.5 mL / 0.5 mL) of compound 47 (0.004 g) and stirred for 30 minutes at 0° C. This reaction solution was purified by gel filtration chromatography (LH-20:DMF) to obtain compound 48 (0.004 g).

[0164] [Example 10: Conjugation of antibody-GlcNAc and MMAE-PEG4-linked sugar chain] [ka]

[0165] The antibody-GlcNAc (0.03 mg) obtained in Example 2, each of the EndoF3 mutant enzymes (0.003 mg) prepared in Example 1, the EndoS mutant enzymes (0.003 mg) prepared in Example 2, or the WP1328 enzyme (0.003 mg) prepared in Example 12, and the compound 48 / DMSO solution (40 mg / mL, 0.002 mL) were added to an Eppendorf tube, and 50 mM pH 7.4 Tris-HCl buffer was added so that the antibody-GlcNAc concentration became 5.0 mg / mL. The reaction solution was incubated at 30°C or 37°C for 1.5-3.0 hours. The reaction solution was ultrafiltered (Amicon Ultra 100 kDa), replaced with 50 mM pH 7.0 phosphate buffer, and compound 49 was analyzed (Figures E and G).

[0166] [Production Example 31: Compound 52] [ka]

[0167] Compound 51 (4-aminobenzyl alcohol, 0.1 g), diisopropylethylamine (0.3 mL), and HATU (0.2 g, Watanabe Chemical) were added to a DMF solution (2.0 mL) of compound 50 (Boc-GGFG-OH, Broadpharm) (0.2 g), and the mixture was stirred at room temperature for 4 hours. 0.1 M hydrochloric acid was added to the reaction solution, and the mixture was extracted with a mixed solvent of chloroform / methanol (9 / 1). The organic layer was concentrated under reduced pressure to obtain compound 52 (0.3 g). MS(ESI)m / z:542 (M+H) +

[0168] [Production Example 32: Compound 53] [ka]

[0169] To a solution (5.0 mL) of compound 52 (0.1 g) in DMF, bis(4-nitrophenyl)carbonate (0.2 g) and diisopropylethylamine (0.5 mL) were added and stirred at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure to give compound 53 (0.1 g). MS(ESI)m / z:707 (M+H) +

[0170] [Production Example 33: Compound 54] [ka]

[0171] Compound 53 (0.1 g), diisopropylethylamine (0.1 mL), and HOBt (0.2 g) were added to a DMF solution (5.0 mL) of compound 14 (0.1 g), and the mixture was stirred at room temperature for 48 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (ODS-A, acetonitrile / water / formic acid) to obtain compound 54 (0.02 g). MS(ESI)m / z:1286 (M+H) +

[0172] [Production Example 34: Compound 55] [ka]

[0173] Compound 54 (0.02 g) in dichloromethane solution (5.0 mL) was added with TFA (0.3 mL) and stirred at room temperature for 3 hours. Diisopropylethylamine (0.6 mL) and compound 4 (0.02 g) were further added and stirred at room temperature for 18 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (acetonitrile / water / formic acid) to obtain compound 55 (0.006 mg). MS(ESI)m / z:1567 (M+H) +

[0174] [Production Example 35: Compound 56] [ka]

[0175] Diethylamine (0.1 mL) was added to a DMF solution (1.0 mL) of compound 55 (0.006 g) and stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, and DMF (1.0 mL) and compound 6 (DBCO-NHS, 0.003 mg) were added to the resulting residue and stirred at room temperature for 17 hours. The reaction solution was purified by gel filtration chromatography (LH-20:DMF) to obtain compound 56 (0.009 mg). MS(ESI)m / z:1632 (M+H) +

[0176] [Production Example 36: Compound 57] [ka]

[0177] Compound 10 (0.007 g) was added to a DMF solution (0.5 mL) of compound 56 (0.001 g) and stirred at room temperature for 24 hours. The reaction solution was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (acetonitrile / water / formic acid) to obtain compound 57 (0.003 g). MS(ESI)m / z:1867(M+3H) 3+ , 1400(M+4H) 4+

[0178] [Production Example 37: Compound 58] [ka]

[0179] CDMBI (0.006 g) and triethylamine (0.002 mL) were added to a DMF / water mixed solution (0.5 mL / 0.5 mL) of compound 57 (0.003 g) and stirred for 30 minutes at 0° C. This reaction solution was purified by gel filtration chromatography (LH-20:DMF) to obtain compound 58 (0.001 g).

[0180] [Example 11: Conjugation of antibody-GlcNAc and MMAE-GGF-linked glycan] [ka]

[0181] The antibody-GlcNAc (0.03 mg) obtained in Example 2, each of the EndoF3 mutant enzymes (0.003 mg) prepared in Example 1, the EndoS mutant enzymes (0.003 mg) prepared in Example 2, or the WP1328 enzyme (0.003 mg) prepared in Example 12, and the compound 58 / DMSO solution (40 mg / mL, 0.002 mL) were added to an Eppendorf tube, and 50 mM pH 7.4 Tris-HCl buffer was added so that the antibody-GlcNAc concentration became 5.0 mg / mL. The reaction solution was incubated at 30°C or 37°C for 1.5-3.0 hours. The reaction solution was ultrafiltered (Amicon Ultra 100 kDa), replaced with 50 mM pH 7.0 phosphate buffer, and compound 59 was analyzed (Figures 20 and 21).

[0182] [Table 5]

[0183] [Table 6]

[0184] [Table 7]

[0185] [Example 12: Preparation of WP1328 enzyme] (1) Preparation of pRSFDuet-1-MBP-WP1328 Nucleotide sequence of WP1328 (protein sequence is WP The sequence (SEQ ID NO:20) of the codon-optimized version of the 069215570.1) for expression in E. coli was artificially synthesized (Genewiz), and this sequence was used as primer WP 1328 f and WP 1328 The DNA was amplified by PCR using r (30 cycles of 98°C for 10 seconds, 60°C for 5 seconds, and 68°C for 30 seconds).

[0186] WP1328 Nucleotide sequence of f (SEQ ID NO:21) ACTATCGAGGGAAGGAGTCGCGCGCTGGCG WP1328 Nucleotide sequence of r (SEQ ID NO:22) ATCCAATTGAGATCTTCATTTCACCGCGTTCTTAACGG

[0187] Similarly, a vector in which a maltose binding protein (amino acid sequence: SEQ ID NO: 5) and a Factor Xa cleavage sequence ATCGAGGGAAGG (SEQ ID NO: 6) (amino acid sequence: IEGR (SEQ ID NO: 7)) were cloned into the BglII site of the pRSF-1-MBP vector (pRSDuet-1, FIG. 2) was amplified by PCR (30 cycles of 98°C for 10 seconds, 60°C for 5 seconds, and 68°C for 30 seconds) using primers FNtermMBP and RNtermMBP.

[0188] Nucleotide sequence of FNtermMBP (SEQ ID NO:8) AGATCTCAATTGGATATCGG Nucleotide sequence of RNtermMBP (SEQ ID NO:9) CCTTCCCTCGATAGTCTGCGCGTCTTTCAGGGC

[0189] The two resulting fragments were cloned using an In-Fusion kit (TAKARA) so that the Factor Xa sequence was located at the C-terminus of MBP and the WP1328 sequence with the N-terminal signal sequence removed was located downstream of that. E. coli JM109 (TAKARA) was transformed using the resulting In-Fusion solution and cultured overnight at 37°C. Colony PCR was performed on the resulting colonies, and the plasmid pRSFDuet-1-MBP-WP1328 (SEQ ID NO: ε) was obtained from the positive clones. [Sequence List Free Text]

[0190] SEQ ID NO:1 EndoF3 D165Q SEQ ID NO:2 EndoF3 D165Q SEQ ID NO:3 FEndoF3-IntermMBP SEQ ID NO:4 YieldF3-TermMBP SEQ ID NO:5 Extract Binding protein SEQ ID NO:6 Factor Xa SEQ ID NO:7 Factor Xa SEQ ID NO:8 FNtermMBP SEQ ID NO:9 RNtermMBP SEQ ID NO:10 pRSFDuet-1-MBP-EndoF3 D165Q SEQ ID NO:11 EndoS D233Q SEQ ID NO:12 EndoS D233Q SEQ ID NO:13 FendoS D233Q His pRSF SEQ ID NO:14 YieldS D233Q front SEQ ID NO:15 FendS D233Q back SEQ ID NO:16 YieldS D233Q His pRSF SEQ ID NO:17 FpRSF InF His BamHI SEQ ID NO:18 RpRSF InF His NcoI SEQ ID NO:19 pRSFDuet-1-EndoS D233Q SEQ ID NO:20 EndoF3 D165Q SEQ ID NO:21 WP1328f SEQ ID NO:22 WP1328r SEQ ID NO:23 pRSFDuet-1-MBP-WP1328 SEQ ID NO:24 WP1328

Claims

1. A method for producing an antibody-drug conjugate, comprising the steps of: A step of conjugating a glycosylated antibody with a glycosylated drug in the presence of an endo-β-N-acetylglucosaminidase mutant enzyme having suppressed hydrolytic activity, The glycosylated antibody has a glycochain cleaved leaving one N-acetylglucosamine (GlcNAc) residue at the reducing end, A step in which the glycan-binding drug is a drug bound via a linker to a glycan having an oxazolinated GlcNAc group at its reducing end.

2. The method of claim 1, wherein the endo-β-N-acetylglucosaminidase mutant enzyme having suppressed hydrolytic activity is any one of the following proteins: (1) a protein consisting of the amino acid sequence of SEQ ID NO:1, or the amino acid sequence of SEQ ID NO:1 in which the 165th position is substituted with an amino acid other than aspartic acid (D); (2) A protein having the amino acid sequence of the protein according to (1) in which one or more amino acids have been substituted, deleted, inserted, and / or added, with the proviso that the 165th amino acid is an amino acid other than D, and having conjugation activity; (3) A protein having an amino acid sequence having at least 90% identity with the amino acid sequence of the protein according to (1), with the proviso that the 165th amino acid is an amino acid other than D, and having a conjugation activity; (4) a protein consisting of the amino acid sequence of SEQ ID NO: 11, or the amino acid sequence of SEQ ID NO: 11 in which the 233rd position is substituted with an amino acid other than D; (5) A protein having the amino acid sequence of the protein according to (4) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 233rd amino acid is an amino acid other than D, and having a conjugation activity; (6) A protein having an amino acid sequence having at least 90% identity with the amino acid sequence of the protein according to (4), with the proviso that the 233rd amino acid is an amino acid other than D, and having a conjugation activity; (7) A protein consisting of the amino acid sequence of SEQ ID NO: 24, or the amino acid sequence of SEQ ID NO: 24 in which the 165th position is replaced with an amino acid other than D.

3. The method according to claim 1 or 2, wherein the linker comprises a structure that is cleavable in vivo.

4. The method according to any one of claims 1 to 3, wherein the linker is a structure containing a peptide.

5. The method according to any one of claims 1 to 4, wherein the linker is a structure represented by the general formula -EDCBA-, where A binds to the sugar chain and E binds to the drug. [In the formula, A, B, C, and E are each independently selected from the group consisting of an alkyl group, an ester group, a carbamoyl group, an alkoxyalkyl group, an imine group, a hydrazone group, an azo group, a sulfone group, an aromatic group, and a single bond; D is a peptide consisting of 2-6 amino acid residues.

6. A is -(CH 2 CH 2 O) m1 -(CH 2 ) m2 -, -(CH 2 ) m2 - or a single bond; B is any one selected from the group consisting of the following: 【Chemistry 1】 [In the formula, each R is independently a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, an alkoxy group having 1 to 4 carbon atoms, -CN, -OH, or -CF3.] C is -C(O)-(CH 2 ) n1 -C(O)-, -C(O)-(CH 2 ) n1 -C(O)-NH-(CH 2 CH 2 O) n2 -(CH 2 ) n3 -C(O)-, -C(O)-(CH 2 ) n1 -C(O)-NH-(CH 2 ) n3 -C(O)- or a single bond; E is 【Chemistry 2】 NH-(CH 2 ) o - or a single bond, m1 is an integer from 1 to 12; m2 is an integer from 1 to 6; n1 is an integer from 1 to 6, n2 is an integer from 1 to 12, n3 is an integer from 1 to 6, and o is an integer from 1 to 6. The method according to claim 5 .

7. B, 【Chemistry 3】 The method according to claim 6, wherein the method is any one of the following:

8. The method according to any one of claims 1 to 7, wherein the drug is selected from the group consisting of anthracyclines, auristatins, maytansines, camptothecins, pyrrolobenzodiazepine dimers, calicheamicins, and duocarmycins.

9. An enzyme preparation for use in a conjugation reaction between a glycosylated antibody in which a glycan has been cleaved leaving one N-acetylglucosamine (GlcNAc) residue at the reducing end, the antibody comprising any one of the following proteins, and a glycosylated drug in which a drug is bound via a linker to a glycan whose reducing end is an oxazolinated GlcNAc group: (1) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 1 in which the 165th position is substituted with an amino acid other than aspartic acid (D); (2) A protein having the amino acid sequence of the protein according to (1) in which one or more amino acids have been substituted, deleted, inserted, and / or added, with the proviso that the 165th amino acid is an amino acid other than D, and having conjugation activity; (3) A protein having an amino acid sequence having at least 90% identity with the amino acid sequence of the protein according to (1), with the proviso that the 165th amino acid is an amino acid other than D, and having a conjugation activity; (4) a protein consisting of the amino acid sequence of SEQ ID NO: 11, or the amino acid sequence of SEQ ID NO: 11 in which the 233rd position is substituted with an amino acid other than D; (5) A protein having the amino acid sequence of the protein according to (4) in which one or more amino acids are substituted, deleted, inserted, and / or added, with the proviso that the 233rd amino acid is an amino acid other than D, and having a conjugation activity; (6) A protein having an amino acid sequence having at least 90% identity with the amino acid sequence of the protein according to (4), with the proviso that the 233rd amino acid is an amino acid other than D, and having a conjugation activity; (7) A protein consisting of the amino acid sequence of SEQ ID NO: 24, or the amino acid sequence of SEQ ID NO: 24 in which the 165th position is replaced with an amino acid other than aspartic acid (D).

Images