Ligand Ionophore Conjugates

Abstract

Ligand-ionophore conjugates, which may further comprise an attached therapeutic or imaging agent, are provided, as well as pharmaceutical compositions containing the conjugates. [Solution] A conjugate or a pharmaceutically acceptable salt thereof is provided, comprising: a binding ligand (B) that is folic acid; one or more linkers (L) that include a chain of about 7 to about 45 atoms and that include a moiety prepared by a bi-orthogonal click reaction; and one or more therapeutic agents (TA) that include siRNA, iRNA, or microRNA, wherein (B) is covalently bonded to (L); and (TA) is covalently bonded to (L).

Description

[Technical field]

[0001] CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority under U.S. Patent Act 119(e) to U.S. Provisional Patent Application No. 62 / 422,922, filed November 16, 2016, and U.S. Provisional Patent Application No. 62 / 478,063, filed March 29, 2017, which are incorporated by reference in their entireties.

[0002] Government Rights This invention was made with government support awarded by the National Institutes of Health and the National Cancer Institute through Grant P30 CA023168. The U.S. Government has certain rights in this invention.

[0003] Technical Field The invention described herein relates to a ligand-ionophore conjugate, which may include a linked therapeutic agent or imaging agent, and a pharmaceutical composition containing the conjugate.Also described is a method of using the described conjugate to increase the endosomal accumulation and escape of a therapeutic agent or imaging agent that is internalized by endocytosis or other similar processes.Also described is the delivery of microRNA to tumor tissue by direct binding of microRNA to folate (FolamiR), which mediates the delivery of conjugated microRNA into cells that overexpress folate receptors. [Background technology]

[0004] background Many diseases can be treated with drugs or biological agents (examples of biological agents include nucleotides, e.g., siRNA, miRNA, etc.; amino acids, including synthetic amino acids that do not occur in nature; proteins, including enzymes, peptides, aptamers, antigens, etc.; and antibodies, e.g., glycoproteins, immunoglobulins, etc.). These drugs or biological agents can be delivered to their target cells using their targeting ligands (e.g., folate receptor binding ligands), but their efficacy can be hindered by the failure of the drug to be released from the endosome, e.g., after folate-mediated endocytosis. Thus, the discovery of new methods for "endosomal release" of trapped cargo into the cytoplasm would be useful to achieve increased efficacy of targeted drugs or biological agents. It has been found that endosomal release can be promoted by the use of ligand-ionophore conjugates to create an osmotic pressure to rupture endosomes containing this cargo, using known ionophores that are less toxic to healthy tissue. Without being bound by theory, H + Ion efflux and K + Nigericin, an ion influx-coupled ionophore and antiporter, is thought to induce an osmotic imbalance inside endosomes that leads to endosomal swelling and / or rupture, releasing the endosomal contents into the cytoplasm. Other K ion transporters, such as salinomycin, transport potassium ions. + Inonophores may also be used for endosomal release. [ka]

[0005] To induce endosomal swelling, osmotically active ions can enter endosomes and promote a concomitant osmotically induced influx of water. This influx of water causes the endosome to swell and ultimately burst. However, if the influx of an osmotically active ion is accompanied by the outflow of another osmotically active ion, there will be no net change in water flow and the endosome will not swell. Thus, for endosomal swelling to occur, an osmotically active ion (e.g., Na + , K + , Li + , Ca ++ , Mg ++ ) is essentially the only osmotically inactive cation, H + Furthermore, the only osmotically active ion that spontaneously flows into endosomes down its concentration gradient is K + Therefore, a useful inophore for inducing endosomal swelling is H + Ion and K + It is an inophore capable of exchanging ions.

[0006] Na + / H + Antiporters are natural endosomal transporters whose function is to change the pH of the endosome. + By transferring sodium ions out of the endosome in exchange for K, causing endosome shrinkage. + It may act against inophore-induced endosomal swelling. + The action of Innophore is to inhibit the naturally occurring Na + / H + Antiporters may be used to alleviate the effects of Na + / H + This is enhanced by the simultaneous addition of an exchange transporter inhibitor.

[0007] Folate receptors are overexpressed on the cell membranes of many human cancers, including ovarian, lung, breast, endometrial, brain, kidney and colon cancers, as well as in activated macrophages involved in inflammatory diseases, such as rheumatoid arthritis, atherosclerosis, osteoarthritis, diabetes and psoriasis. Folate has a high binding affinity (Kd=10 -10 M) and can deliver releasable cargo to folate receptors in a selective manner that avoids off-site toxicity. Ligands bound to these receptors become part of endosomes after membrane entry into caveolae, internalization, and detachment from the surface.

[0008] Drug cargo delivered to receptors capable of endocytosis or similar processes is selectively delivered to diseased cells, but the pathway of cargo delivered to the cytoplasm or nucleus may be completely or partially blocked by invaginated plasma membranes called "endosomes". High molecular weight drugs such as peptides, siRNAs, antisense oligonucleotides, proteins, aptamers, oligosaccharides, and polysaccharides cannot escape from endosomes once they are internalized via ligand-targeted endocytic pathways. Thus, the trapped cargo remains in endosomes and is eventually degraded into smaller fragments by the action of acids and enzymes present in endosomes before being released in an inactive form. The conjugates of the present invention increase both endosomal accumulation and escape of therapeutic or imaging agents in target cells. Summary of the Invention [Problem to be solved by the invention]

[0009] overview In some embodiments, the present disclosure provides a targeted microRNA delivery system comprising a covalently linked folate and microRNA conjugate or a mimetic thereof, and a pharmacologically acceptable carrier, diluent, or excipient. [Means for solving the problem]

[0010] Some embodiments of the present invention are described below: 1. Ligands targeted to cell surface receptors (B); one or more linkers (L); Proton (H + ion) and potassium ion (K + one or more ionophores (A) to which the influx of ions (ions) is coupled; and / or Therapeutic Agents (TA) Comprising siRNA, iRNA or MicroRNA comprising (L) optionally comprises at least one releasable linker; (B) is covalently bonded to (L); and (A) and / or (TA) are each covalently bonded to (L); A conjugate or a pharma- ceutically acceptable salt thereof. 1a. Ligand targeted to cell surface receptors (B); one or more linkers (L); Proton (H + ion) and potassium ion (K + one or more ionophores (A) to which the influx of ions (ions) is coupled; and A therapeutic agent comprising an siRNA, an iRNA, or a microRNA; comprising (L) comprises at least one releasable linker; (B) is covalently bonded to (L); and (A) is covalently bonded to (L), A conjugate or a pharma- ceutically acceptable salt thereof.

[0011] 2. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein (L) comprises at least one releasable linker.

[0012] 3. A conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein a therapeutic agent (TA) is covalently bound to (L).

[0013] 4. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein the therapeutic agent (TA) comprises an siRNA.

[0014] 5. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein the therapeutic agent (TA) comprises an iRNA.

[0015] 6. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein the therapeutic agent (TA) comprises a microRNA.

[0016] 7. The conjugate according to any of the preceding items, or a pharma- ceutically acceptable salt thereof, wherein (B) is folic acid.

[0017] 8. The conjugate or a pharma- ceutically acceptable salt thereof according to any one of 1 to 6 above, wherein (B) is a PSMA-binding ligand.

[0018] 9.(A) is Na + / H + The conjugate or a pharma- ceutically acceptable salt thereof according to any of the preceding items, which is an inhibitor of an exchange transporter.

[0019] 10. The conjugate according to claim 9, or a pharma- ceutically acceptable salt thereof, wherein the ionophore (A) comprises nigericin or salinomycin.

[0020] 11. The conjugate according to any of the preceding items, or a pharma- ceutically acceptable salt thereof, wherein (L) comprises a chain of about 7 to about 45 atoms.

[0021] 12. The group consisting of the following: [ka] [ka] [ka] [ka] [ka] [ka] [ka] and [ka] or a pharma- ceutically acceptable salt thereof.

[0022] 13.The following formula [ka] [ka] [ka] or [ka] or a pharma- ceutically acceptable salt thereof.

[0023] 14. A pharmaceutical composition comprising at least one conjugate or a pharma- ceutically acceptable salt thereof according to any one of 1 to 13 above, and at least one pharma- ceutically acceptable carrier or excipient.

[0024] 15. A pharmaceutical composition comprising at least one conjugate or a pharma- ceutically acceptable salt thereof according to any one of 1 to 13 above, and a further therapeutic agent.

[0025] 16. A method for increasing endosomal accumulation and escape of a therapeutic agent or an imaging agent, comprising the step of administering together with the therapeutic agent or the imaging agent an effective amount of a conjugate according to any one of 1 to 13 above, or a pharma- ceutical acceptable salt thereof.

[0026] 17. The method according to claim 16, wherein the therapeutic agent or imaging agent is targeted to the cancer.

[0027] 18. The method according to claim 17, wherein the cancer is selected from the group consisting of ovarian cancer, lung cancer, breast cancer, endometrial cancer, brain cancer, kidney cancer, prostate cancer and colon cancer.

[0028] 19. The method according to claim 16, wherein the therapeutic agent is targeted to the site of inflammation.

[0029] 20. The method according to claim 19, wherein the inflammatory site is caused by an inflammatory disease selected from the group consisting of rheumatoid arthritis, osteoarthritis, atherosclerosis, diabetes, graft-versus-host disease, multiple sclerosis, osteomyelitis, psoriasis, Crohn's disease, Sjogren's syndrome, lupus erythematosus, and ulcerative colitis.

[0030] 21. Ligands targeted to cell surface receptors (B); one or more linkers (L); Proton (H + ion) and potassium ion (K + one or more ionophores (A) to which the influx of ions (ions) is coupled; RNA selected from siRNA, iRNA, and microRNA; or one or more imaging agents (IA). comprising (L) comprises at least one releasable linker; (B) is covalently bonded to (L); and (A), the RNA and / or (IA) are each covalently linked to (L); A conjugate or a pharma- ceutically acceptable salt thereof.

[0031] 22. Ligands targeted to cell surface receptors (B); one or more linkers (L); Proton (H + ion) and potassium ion (K + one or more ionophores (A) to which the influx of ions (ions) is coupled; and Fluorescent dye comprising Cy5 comprising (L) comprises at least one releasable linker; (B) is covalently bonded to (L); and (A) is covalently bonded to (L), A conjugate or a pharma- ceutically acceptable salt thereof.

[0032] 23.The following formula [ka] 23. The conjugate according to claim 21 or 22, wherein

[0033] 23.The following formula [ka] or [ka] 22. The conjugate according to claim 21, having the formula: [Brief description of the drawings]

[0034] [Figure 1]Figure 1 shows targeted silencing of miR-34a Renilla sensor with folate conjugates in vivo. Data points were normalized to folate-NC (negative control: scrambled miRNA) at each time point. (Fol-DB-miR-34a: folate-DBCO-miR-34a; Fol-SS-Nig miR-34a: folate-ss-DBCO-nigericin-miR-34a; Fol-DB-Nig miR-34a: folate-DBCO-nigericin-miR-34a)

[0035] [Diagram 2] Figure 2 shows a plot of luciferase relative light units normalized to the negative control versus time (h). Data show that Fol-Nig-siLuc induces early luciferase knockdown in MDA-MB-231 cells. Luciferase activity levels from MDA-MB-231 sensor cells normalized to Fol-negative controls (Fol-NC: folate-DBCO-negative control (scrambled RNA) or Fol-Nig-NC: folate-nigericin-DBCO-negative control (scrambled RNA)). Mean ± SD, technical replicates = 3, n = 3, ** P < 0.01. Arrows indicate replacement of medium with a new dose (50 nM) of folate conjugate. Fol-siLuc2: folate-DBCO-siLuc2; Fol-Nig-siLuc2: folate-nigericin-DBCO-siLuc2.

[0036] [Diagram 3] Figure 3A-B show live-cell images of MDA-MB-231 cells stably expressing Rab5B-GFP treated with folate-Cy5 (50 nM) 3 h after treatment.

[0037] [Figure 4]Figure 4A-B show live-cell images of MDA-MB-231 cells stably expressing Rab5B-GFP treated with folate-nigericin-Cy5 (50 nM) 3 h after treatment.

[0038] [Diagram 5] Figure 5A-F shows the specificity of FolamiR uptake in cells in culture. Figure 5A shows the proposed mechanism of action of FolamiR. Figure 5B shows the structures of FolamiR-34a conjugate-FolamiR-34a bearing a non-releasable ligand, FolamiR-34a conjugate-FolamiR-SS-34a bearing a releasable ligand (disulfide bond shown in red), and miR-34a conjugate-NIR-FolamiR-34a bearing a non-releasable folate ligand and NIR moiety (shown in green). The folate moiety is shown in blue and the miRNA in red. Figure 5C shows the identification of folate receptor alpha (FRα) in FR-positive MDA-MB-231 breast cancer cells and FR-negative A549 lung cancer cells. Histograms represent overlaid flow cytometry data as percentage of unstained (A), FRα (C) and isotype control (B) stained cells. Figure 5D shows NIR-FolamiR-34a uptake in FR-positive MDA-MB-231 breast cancer cells compared to FR-negative A549 lung cancer cells. Histograms represent overlaid flow cytometry data as percentage of unstained (A) and NIR-FolamiR-34a (50 nM) stained (B) cells. Figure 5E shows folate-fluorescein isothiocyanate (Fol-FITC) uptake in FR-positive MDA-MB-231 breast cancer cells compared to FR-negative A549 lung cancer cells. Scale bar: 50 μm. Figure 5F shows targeted silencing of miR-34a Renilla sensor using FolamiR in vitro.

[0039] [Figure 6]Figures 6A-E show cellular responses to FolamiR. Figure 6A shows targeted silencing of miR-34a Renilla sensor with FolamiR in vitro. For each time point, data points were normalized to FolamiR-NC (negative control role: scrambled miRNA). Figure 6B shows MDA-MB-231 cancer cell proliferation and survival in response to FolamiR treatment (50 nM). For each time point, data points were normalized to FolamiR-NC. Error bars represent mean ± sd. Each experiment has n = 3, with at least 4 replicates per treatment. Figure 6C shows dose response of MDA-MB-231 to FolamiR-34a. Renilla values ​​were measured 96 hours after treatment. Data points were normalized to FolamiR-NC. Error bars represent mean ± sd. Each experiment has n = 3, with at least 4 replicates per treatment. Statistical analysis was performed by one-way ANOVA with post-hoc Bonferroni test (**, P<0.01; ****, P<0.0001). Figure 6D shows the displacement of NIR-FolamiR-34a binding from human MDA-MB-231 cells (50 nM, 4°C) with increasing concentrations of folate glucosamine conjugates. Histograms represent overlay flow cytometry data as percentage of unstained and NIR-FolamiR-34a stained cells. Figure 6E shows the in vitro FolamiR-34a competition assay.

[0040] [Figure 7]Figure 7A-G demonstrate that FolamiR-34a inhibits MDA-MB-231 tumor growth. Figure 7A shows representative live imaging of female Nu / Nu congenic mice implanted with MDA-MB-231 sensor xenografts after intravenous injection of 5 nmol of NIR-FolamiR-34a, NIR-FolamiR-SS-34a or NIR-FolamiR-NC. The left side shows the fluorescence distribution, and the right side shows the miR-34a Renilla sensor signal. Figure 7B shows the effect of NIR-FolamiR-34a delivery on MDA-MB-231 Renilla sensor activity; all data are normalized to Renilla signal on day 0 and shown as mean ± sem (n=3). Statistical analysis was performed by one-way ANOVA with post-hoc Bonferroni test (**, P<0.01). Figure 7C shows macroscopic images of MB-231 breast cancer and systemic organs visualized for fluorescence (T, tumor; Int, intestine; S, spleen; K, kidney; Lv, liver; HLu, heart-lung;). Figure 7D shows miR-34a levels from resected MDA-MB-231 tumors measured by qRT-PCR 72 hours after NIR-FolamiR conjugate injection (n=3, error bars represent mean ± sd. Statistical analysis was performed by one-way ANOVA with post hoc Bonferroni test, **, P<0.01). Figure 7E shows NIR epifluorescence quantification from live animals. Female Nu / Nu congenic mice were implanted with A549 cells in the left shoulder and MDA-MB-231 sensor xenografts in the right shoulder and live imaging was performed after intravenous injection of 5 nmol NIR-FolamiR-34a in the presence (right) or absence (left) of 100-fold molar excess or more of folate-glucosamine (n=3 per group). Error bars represent mean ± sd. Statistical analysis was performed by one-way ANOVA, **, P<0.01; ***, P<0.001; ****, P<0.0001). Figure 7F shows the fluorescence distribution of organs and tumors from Figure 7E: A549: FR-negative tumor; MB231 (MDA-MB-231): FR-positive tumor; Int, intestine; S, spleen; K, kidney; Lv, liver; HLu, heart-lung.Figure 7G shows tumor size after FolamiR-34a treatment (n=5, error bars represent mean ± sem, statistical analysis was performed by two-way ANOVA, **, P<0.01; ***, P<0.001). Arrows indicate the time of treatment (1 nmol, intravenous injection). Tumors were measured with calipers and tumor volumes were calculated by volume (mm3) = width × (length2) × 2-1.

[0041] [Figure 8] Figures 8A-D show that mouse KrasLSL-G12D / +;p53flx / flx lung adenocarcinoma expresses FR (folate receptor). Figure 8A shows that the fluorescent imaging ligand OTL38 (On Target Laboratories, LLC, West Lafayette, IN; a folate receptor alpha (FRα) targeting ligand conjugated to a fluorescent near-infrared (NIR) dye) is preferentially retained in lung tumors and excreted from normal healthy tissues. KrasLSL-G12D / +;p53Flox / Flox mice were injected with 5 nmol of OTL38 8 weeks after tumor induction and sacrificed 24 h after injection. Non-induced healthy mice were used as controls. RC, right posterior lobe; RM, medial right lobe; RA, right accessory lobe; RCr, right anterior lobe; L, left lobe. Figure 8B shows a histology of the right lobe of the lung from a mouse treated with OTL38. Left: Near-infrared imaging of whole organs with matching H&E stained slides. Right: High magnification images of tumor and healthy tissues. H&E images represent the types of tissues shown in the bright field and near-infrared images. Scale bar: 50 μm; inset: 20 μm. Numbered boxes shown in the low magnification images correspond to the numbers in the high magnification images. Figure 8C shows a whole lung lobe from a mouse treated with OTL38 (5 nmole) in the presence or absence of 100-fold molar excess or more of folate-glucosamine (n=3 per group). Figure 8D shows a representative histology of the tissue in Figure 8C. Figure 8B,D shows low magnification H&E stained tissues along with high magnification images of the corresponding tumor tissues. Left: High magnification near-infrared images and corresponding whole organ near-infrared images. H&E images represent the types of tissues shown in the near-infrared images. Boxes in the low magnification H&E images correspond to the images shown at high magnification. 10 Scale bar: 20 μm.

[0042] [Figure 9] Figures 9A-F demonstrate that targeted replacement of miR-34a by FolamiR has beneficial effects in a mouse model of lung adenocarcinoma. Figure 9A shows MRI-measured tumor burden after FolamiR-34a treatment (n=4 or 5, error bars indicate mean ± s.e.m. Statistical analysis was performed by two-way ANOVA and post-hoc Bonferroni test, **, P<0.01). Arrows represent time points of treatment (1 nmol i.v. injection; 10 total). Figure 9B shows representative MRI images and 3D renderings of mice treated with FolamiR during the treatment period (day 8) and at the end of the treatment period (day 29). Figure 9C shows tumor / whole lung ratios at the indicated times, indicating the percentage of lung volume occupied by tumor. Error bars represent mean ± s.d. Statistical analysis was performed by one-way ANOVA, * P<0.05. Figure 9D shows representative H&E stained tissues of the left lobe of animals from each treatment group. Scale bar = 1 mm. Figure 9E shows that total tumor burden was calculated from the total tumor area averaged from the three sections obtained from each treated animal relative to the total area of ​​the lung (bars indicate median, FolamiR-NC: n = 4, FolamiR-34a: n = 5; unpaired t-test). Figure 9F shows that miR-34 target genes, Met, Myc, and Bcl-2, were assessed by qRT-PCR, normalized to actin, and graphed relative to FolamiR-NC treated tumors (bars indicate median, unpaired t-test: * P < 0.05).

[0043] [Figure 10]Figure 10 shows the response of miR-34a Renilla sensor to miRNA mimic transfection. MDA-MB-231 breast cancer cells and A549 lung cancer cells transiently expressing miR-34a Renilla sensor were used to monitor the delivery and activity of miR-34a. MDA-MB-231 and A549 cells were transfected with 50 nM miR-34a mimic using Lipofectamine RNAimax (Life Technologies), and Renilla signals were measured 96 hours after treatment.

[0044] [Figure 11] Figure 11A-B shows the evaluation of MDA-MB-231 miR-34a sensor cells. Figure 11A shows the miR-34a sensor specificity and silencing activity of endogenous miR-34a in MDA-MB-231 cells. Error bars represent the mean ± sd, and experiments were performed in triplicate. Figure 11B shows the selection of MB-231 clones based on renilla activity. Renilla readout was performed using 1 × 104 cells per clone, and Renilla levels were measured using the Renilla Glulesferase Kit (Promega).

[0045] [Figure 12] Figure 12 shows the response of tumor growth to increasing doses of FolamiR-34a. Tumor size after FolamiR-34a treatment (n=5, error bars represent mean±sem, statistical analysis was performed by two-way ANOVA, ***P<0.001). Arrows indicate the time of treatment (intravenous injection). Tumors were measured with calipers and tumor volumes were calculated by volume (mm3)=width×(length2)×2-1.

[0046] [Figure 13]Figures 13A-B show the copy number of miR-34a in tumors treated with FolamiR. MiR-34a levels measured by qRT-PCR from breast cancer xenograft tumors (Figure 13A) and lung adenocarcinoma KrasLSL-G12D / +;p53flx / flx tumors (Figure 13B) 24 hours after the last injection (n=5, error bars represent mean ± sd. Statistical analysis was performed by one-way ANOVA or Student's t-test).

[0047] [Figure 14] Figures 14A-B show serum cytokines and maximum tolerated dose studies. Figure 14A shows serum obtained from FolamiR-treated Nu / Nu mice bearing MDA-MB-231 tumors was evaluated for relevant cytokines: tumor necrosis factor (TNF) alpha, and interleukin (IL)-6 (n=5). Serum from lipopolysaccharide (LPS)-treated mice was included as a positive detection control (n=2; statistical analysis was performed by one-way ANOVA with post-hoc Bonferroni test). Figure 14B shows body weight before and after intravenous administration of increasing doses of FolamiR-34a. Statistical analysis was performed by two-way ANOVA with post-hoc Bonferroni correction. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0048] Detailed Description For the purposes of promoting an understanding of the principles of the present disclosure, reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe them, it being understood that no limitation of the disclosure is thereby intended.

[0049] In this disclosure, the term "about" may allow for some variation in a numerical value or range, for example, within 20%, within 10%, within 5%, or within 1% with respect to a stated value or a stated range limit.

[0050] In this disclosure, the term "substantially" may allow for some variation in a value or range, e.g., within 70%, within 80%, within 90%, within 95%, or within 99% of a stated value or a stated range limit.

[0051] Some embodiments of the present invention are described in the following enumerated clauses, and any combination of these embodiments and the embodiments described in this Detailed Description section is contemplated.

[0052] 1. Ligands targeted to cell surface receptors (B); one or more linkers (L); Proton (H + ion) and potassium ion (K + one or more ionophores (A) to which the influx of ions (ions) is coupled; and / or Therapeutic Agents (TA) Comprising siRNA, iRNA or MicroRNA comprising (L) optionally comprises at least one releasable linker; (B) is covalently bonded to (L); and (A) and / or (TA) are each covalently bonded to (L); A conjugate or a pharma- ceutically acceptable salt thereof.

[0053] 1a. Ligand targeted to cell surface receptors (B); one or more linkers (L); Proton (H + ion) and potassium ion (K + one or more ionophores (A) to which the influx of ions (ions) is coupled; and A therapeutic agent comprising an siRNA, an iRNA, or a microRNA; comprising (L) comprises at least one releasable linker; (B) is covalently bonded to (L); and (A) is covalently bonded to (L), A conjugate or a pharma- ceutically acceptable salt thereof.

[0054] 2. (L) A conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, comprising at least one releasable linker.

[0055] 3. A conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein a therapeutic agent (TA) is covalently bound to (L).

[0056] 4. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein the therapeutic agent (TA) comprises an siRNA.

[0057] 5. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein the therapeutic agent (TA) comprises an iRNA.

[0058] 6. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein the therapeutic agent (TA) comprises a microRNA.

[0059] 7. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein (B) is folic acid.

[0060] 8. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein (B) is a PSMA-binding ligand.

[0061] 9.(A) is Na + / H + A conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, which is an inhibitor of exchange transporter.

[0062] 10. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein the ionophore (A) comprises nigericin or salinomycin.

[0063] 11. The conjugate of 1 or 1a above, or a pharma- ceutically acceptable salt thereof, wherein (L) comprises a chain of about 7 to about 45 atoms.

[0064] 12. The group consisting of: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] or a pharma- ceutically acceptable salt thereof.

[0065] 13.The following formula [ka] [ka] [ka] or [ka] or a pharma- ceutically acceptable salt thereof.

[0066] 14. A pharmaceutical composition comprising at least one conjugate or a pharma- ceutically acceptable salt thereof according to any one of 1 to 13 above, and at least one pharma- ceutically acceptable carrier or excipient.

[0067] 15. A pharmaceutical composition comprising at least one conjugate or a pharma- ceutically acceptable salt thereof according to any one of 1 to 13 above, and a further therapeutic agent.

[0068] 16. A method for increasing endosomal accumulation and escape of a therapeutic agent or an imaging agent, comprising the step of administering together with the therapeutic agent or the imaging agent an effective amount of a conjugate according to any one of 1 to 13 above, or a pharma- ceutical acceptable salt thereof.

[0069] 17. The method according to claim 16, wherein the therapeutic agent or imaging agent is targeted to the cancer.

[0070] 18. The method according to claim 17, wherein the cancer is selected from the group consisting of ovarian cancer, lung cancer, breast cancer, endometrial cancer, brain cancer, kidney cancer, prostate cancer and colon cancer.

[0071] 19. The method according to claim 16, wherein the therapeutic agent is targeted to the site of inflammation.

[0072] 20. The method according to claim 19, wherein the inflammatory site is caused by an inflammatory disease selected from the group consisting of rheumatoid arthritis, osteoarthritis, atherosclerosis, diabetes, graft-versus-host disease, multiple sclerosis, osteomyelitis, psoriasis, Crohn's disease, Sjogren's syndrome, lupus erythematosus, and ulcerative colitis.

[0073] 21. Ligands targeted to cell surface receptors (B); one or more linkers (L); Proton (H + ion) and potassium ion (K + one or more ionophores (A) to which an influx of ions (ions) is coupled; an RNA selected from siRNA, iRNA, and microRNA; or one or more imaging agents (IA); comprising (L) comprises at least one releasable linker; (B) is covalently bonded to (L); and (A), the RNA and / or (IA) are each covalently linked to (L); A conjugate or a pharma- ceutically acceptable salt thereof.

[0074] 22. Ligands targeted to cell surface receptors (B); one or more linkers (L); Proton (H + ion) and potassium ion (K + one or more ionophores (A) to which the influx of ions (ions) is coupled; and Fluorescent dye comprising Cy5 comprising (L) comprises at least one releasable linker; (B) is covalently bonded to (L); and (A) is covalently bonded to (L), A conjugate or a pharma- ceutically acceptable salt thereof.

[0075] 23.The following formula [ka] 23. The conjugate according to claim 21 or 22, wherein

[0076] 23.The following formula [ka] or [ka] 22. The conjugate according to claim 21, having the formula:

[0077] The term "nucleotide" as used herein has its normal and customary meaning and may include ribonucleotides. Ribonucleotide abbreviations (e.g., A, G, C, U) have their normal and customary meaning. In some embodiments, the conjugates described herein may include RNA sequences (i.e., microRNA or "miRNA"). In some embodiments, ribonucleotides are represented by their normal single-letter abbreviations immediately preceding the letter "r" in the sequence (e.g., rA, rG, rC). In some embodiments, the RNA sequence may include modified ribonucleotides. In such embodiments, ribonucleotides are represented by single-letter abbreviations immediately preceding the sequence by a letter to indicate the modification. Common modifications include, but are not limited to, methyl (m), ethyl (e), amino (a), deamino (o), and the like. For example, a methylated cytidine may be represented by mC in the sequences described herein. It will be understood that other modifications known in the art are also contemplated by the present disclosure.

[0078] The term "conjugate" as used herein means a ligand-ionophore (ligand-ionophore meaning with or without a linker between the ligand and the ionophore) conjugate, or a ligand-ionophore (ligand-ionophore meaning with or without a linker between the ligand and the ionophore) conjugate attached to a therapeutic or imaging agent, or a pharma- ceutically acceptable salt or solvate of the conjugate; the conjugate may exist in solution or suspension in an ionized form, such as a protonated form.

[0079] The term "ionophore" as used herein also refers to a cluster of ionophores (e.g., a dendritic structure). Similarly, a therapeutic or imaging agent conjugated to a ligand-ionophore conjugate may be a cluster of that agent (e.g., a dendritic structure).

[0080] As used herein, the term "releasable" means that the specified moiety is covalently attached to the linker (L) by a releasable linker.

[0081] As used herein, the terms drug, therapeutic agent, chemotherapeutic agent, and the like include analogs thereof that can be incorporated into a conjugate or administered separately in a targeted form.

[0082] The term "endocytosis" as used herein has its art-recognized meaning and includes several similar processes, such as the process of PSMA internalization.

[0083] The therapeutic or imaging agent may be an agent prepared by synthetic chemistry, an agent isolated from a natural product, an agent synthesized biologically, or a polymeric structure such as a liposome or dendrimer comprising the therapeutic or imaging agent.

[0084] In some embodiments, the therapeutic agent is a biologic such as a polypeptide, peptide, oligonucleotide, nucleotide, siRNA, iRNA, microRNA, ribozyme, antisense oligonucleotide, protein, glycoprotein, antibody, antigen, synthetic amino acid, aptamer, oligosaccharide, or polysaccharide. In some embodiments, the therapeutic agent comprises an siRNA, iRNA, or microRNA.

[0085] Where the agent is an imaging agent (IA), the agent may comprise a fluorescent agent, an X-ray contrast agent (such as iobitridol), a PET imaging agent, a near-infrared dye (NIR dye) or a radionuclide (such as an isotope of gallium, indium, copper, technetium, or rhenium), or the like. Fluorescent agents include, but are not limited to, fluorescein, 5-amino-fluorescein, 6-amino-fluorescein, fluorescein isocyanate (FITC), NHS-fluorescein, Oregon Green fluorescent agents (including but not limited to Oregon Green 488, Oregon Green 514, etc.), AlexaFluor fluorescent agents (including but not limited to AlexaFluor 488, AlexaFluor 647, etc.), fluorescein and related analogs, BODIPY fluorescent agents (including but not limited to BODIPY F1, BODIPY 505), rhodamine fluorescent agents (including but not limited to 5-carboxytetramethylrhodamine (5-TAMRA), rhodamine B, rhodamine 6G, TRITC, Texas Red, rhodamine 123, sulforhodamine 101, tetramethylrhodamine), DyLight fluorescent agents (including but not limited to DyLight 647, DyLight 680, DyLight 800, etc.), CW 800, phycoerythrin, etc. Representative near infrared dyes that can be used in accordance with the present teachings include, but are not limited to, LS288, IR800, SP054, S0121, KODAK, IRD28, S2076, S0456, and derivatives thereof.

[0086] Certain isotopically labeled conjugates, for example those incorporating a radioactive isotope, may be useful in drug and / or substrate tissue distribution studies. 3 H), and carbon-14 (i.e. 14 C) are particularly useful for this purpose given their ease of incorporation and ready means of detection.

[0087] 11 C. 18 F and13 Substitution with positron emitting isotopes, such as N, may be useful in positron emission tomography (PET) studies to examine substrate receptor occupancy. Isotopically labeled conjugates can generally be prepared by conventional techniques known to those skilled in the art, or by methods similar to those described in the Examples, substituting the appropriate isotopically labeled reagent for the non-labeled reagent previously used.

[0088] The preparation and use of releasable linkers to release "payloads" is well documented. The conjugation of ligands and ionophores can utilize procedures similar to those used for single or double conjugation of drugs with releasable linkers, as described, for example, in WO 2003 / 097647, WO 2004 / 069159, WO 2006 / 012527, WO 2007 / 022493, WO 2007 / 022494, WO 2009 / 002993, WO 2010 / 033733 and WO 2010 / 045584. The disclosures of each of the above patent applications are incorporated herein by reference. These same references also describe methods that can be used to attach therapeutic agents or imaging agents to ligand-ionophore conjugates or to prepare ligand-therapeutic agent or ligand-imaging agent compounds separately.

[0089] For example, nigericin, an ionophore and hydrogen / potassium ion antiporter containing free hydroxyl and carboxylic acid functional groups, is chemically linked to a ligand via a releasable linker attached to the hydroxyl or carboxylic acid group, as shown in the examples. In one example, in the folate-nigericin ester conjugate, the folate ligand is conjugated to the carboxylic acid functional group of nigericin via a disulfide-containing linker. A similar conjugation method is used for the folate-S,S-nigericin-S,S-rhodamine double conjugate. In another example, the folate ligand forms a folate-nigericin conjugate via a disulfide bond to the hydroxyl group.

[0090] The miRNA duplex can be constructed using two RNA oligonucleotides, referred to as the miR-34a-5p guide strand and the miR-34a-3p passenger strand. In some embodiments, the miR-34a-3p passenger strand comprises a 20nt RNA oligo duplex modified with an azido linker at the 5' end and 2'-O-methyl RNA bases (labeled m) at positions 1, 2, 4, 6, 8, 10, 12, 14, 16 and 18, and the miR-34a-5p guide strand comprises a 22nt RNA oligo with a phosphate group at the 5' end and 2'-O-methyl RNA bases at positions 20 and 21 of the 3'.

[0091] It will be appreciated that lentiviral- and liposome-mediated delivery of tumor-suppressing miRNA, i.e., miR-34a, reduces tumor burden in various non-small cell lung cancer (NSCLC) mouse models. In addition to vehicle- and virus-mediated miRNA delivery, it will also be appreciated that systemic injection of oligonucleotides as such has been tested and can be problematic. Without being bound by theory, pharmacokinetic and stability limitations associated with intravenous delivery may require localized delivery or achieving high oligonucleotide concentrations that are often only found in the kidney or liver. In some embodiments, localized delivery may be an option. In some embodiments, the conjugates of the present disclosure can be used to achieve delivery beyond sites accessible to localized delivery, such as micrometastases.

[0092] In some embodiments, overcoming the challenge of non-targeted delivery can be achieved by applying conjugates of cell surface receptors that are specifically overexpressed on tumor cells. In some embodiments, the conjugates of the present disclosure can be applied to deliver miRNA mimics beyond sites accessible for localized delivery. In some embodiments, a ligand that binds to a cell surface receptor can be conjugated to a functionally active miRNA, and the resulting molecule can be used to specifically target the miRNA to tumor cells. In some embodiments, the target receptor can be a folate receptor (FR). Folate receptors are known to be overexpressed on cancer cells compared to normal cells, and the expression level of the receptor must be sufficient to allow delivery of therapeutic amounts of miRNA to cancer cells. Folate receptors (FRs) are known to be overexpressed in many epithelial cancers, including breast, lung, ovarian, renal, and colon cancers, as well as various hematological malignancies, such as acute myeloid leukemia. In contrast, the presence of FRs on normal tissues is limited in amount and appears to be negligible in targeted drug applications, or inaccessible to blood-borne folate.

[0093] In some embodiments, the binding ligand may be vitamin B9 (folic acid), a FR ligand that binds with high binding affinity to FRs, is selective for FRs, and contains a functional group that can be derivatized to facilitate conjugation with imaging or therapeutic agents that do not interfere with receptor binding. In some embodiments, FR / folic acid-conjugate therapy is described herein for the delivery of small RNAs, such as miRNAs or siRNAs.

[0094] Successful folate-targeted delivery with various payloads, from small radiopharmaceuticals to large DNA-containing formulations, has been demonstrated at both preclinical and clinical levels. However, folate-mediated delivery of small RNAs has been delayed due to the hypothesis that small RNAs need to be protected during circulation. Various strategies investigated in the field of small RNA delivery to achieve this level of protection have incorporated folate onto carrier vehicles (dendrimers, copolymers, liposomes). These complexes can have very large sizes and are often hindered from entering target tissues by the dense extracellular matrix found in most solid tumors. Herein, we present evidence for a conjugate of a miRNA mimic, named FolamiR, directly linked to a folate ligand. Without being bound by theory, the FolamiR described herein can perfuse solid tumors more easily than larger miRNA-encapsulated vehicles. One possible problem is that small RNAs in their native form are relatively unstable in the blood. In some embodiments, the conjugates of the present disclosure comprise a passenger strand of a miRNA mimic minimally modified with 2'-O-methyl RNA bases, which can stabilize the RNA and increase nuclease resistance without compromising Argonaute loading.

[0095] Rhodamine-linked folate appears to be saturated in solid tumors within 5 minutes of intravenous administration. The rapidity with which the folate-conjugated molecules penetrate tumors indicates that the FolamiRs described herein only need to persist in the circulation for a short period of time.

[0096] In some embodiments, the present disclosure provides a method for specifically and rapidly delivering functional and virtually unprotected miRNA to tumor tissue.It is demonstrated herein that miRNA-34a (miR-34a) can selectively target tumors, enter tumorigenic cells, downregulate target genes, and suppress tumor growth in vivo.In some embodiments, the rapid tumor uptake mediated by directly conjugating miR-34a to folic acid (FolamiR-34a) can be beneficial.

[0097] The invention described herein further includes pharmaceutical compositions containing the ligand-ionophore conjugates described herein and at least one further pharma- ceutically acceptable carrier or excipient. The ligand-ionophore conjugates are preferably administered parenterally (e.g., intradermally, subcutaneously, intramuscularly, intraperitoneally, intravenously or intrathecally) to a patient (i.e., a subject in need thereof). Alternatively, the ligand-ionophore conjugates can be administered to a patient (e.g., a human or animal) by other medically useful methods (e.g., inhalation, nasal administration, buccal absorption, transdermal, rectal or vaginal suppository, oral, etc., and in effective doses and suitable dosage forms (including sustained release formulations), etc.).

[0098] Examples of parenteral dosage forms include aqueous solutions of the ligand-ionophore conjugate in isotonic saline, glucose solution or other known pharmacologically acceptable liquid carriers (e.g., liquid alcohols, glycols, esters, and amides), or suspensions of liposomes. The parenteral dosage form of the present invention may be in the form of a reconstitutable lyophilizate containing a dose of the ligand-ionophore conjugate. In one embodiment, a number of sustained release formulations known in the art can be administered, such as biodegradable carbohydrate matrices described in, for example, U.S. Pat. Nos. 4,713,249; 5,266,333; and 5,417,982, which are incorporated herein by reference, or a slow-release pump (e.g., an osmotic pump) can be used.

[0099] As determined by the relevant medical professional, administration of the ligand-ionophore conjugate can occur before, after, or simultaneously with administration of a therapeutic or imaging agent that is internalized by endocytosis. EXAMPLES

[0100] The following examples further illustrate certain embodiments of the present invention, but should not be construed as limiting the present invention. Abbreviations used herein include: DCC, dicyclohexylcarbodiimide; Py, 2-pyridyl; RT, room temperature.

[0101] Manufacturing Example material Amino acids for peptide synthesis were purchased from Aapptec, USA. N-hydroxybenzotriazole (HOBt), 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU) and benzotriazol-1-yloxytris(pyrrolidino)phosphonium hexafluorophosphate (PyBOP) were obtained from Sigma-Aldrich. Solid-phase peptide synthesis (SPPS) was performed using a standard peptide synthesizer (Chemglass, Vineland, NJ). All other chemicals were purchased from Sigma-Aldrich unless otherwise stated. All folate conjugates were purified by preparative reversed-phase (RP)-HPLC (Agilent) and LC / MS analysis was performed using an Agilent mass spectrometer coupled with a UV diode array detector.

[0102] Synthesis of folate-EDA conjugate [ka] A peptide synthesis vessel was charged with ethylenediamine, polymer-bound (200-400 mesh) resin (1.000 g, 0.17 mmol, 1 equiv.) and swollen in dichloromethane (3 mL) followed by dimethylformamide (3 mL) for 1 h. To this vessel was then added a solution of Fmoc-Glu-OtBu in DMF (0.1808 g, 0.425 mmol, 2.5 equiv.), N,N-diisopropylethylamine (DIPEA-i-Pr2Net, 0.2202 g, 1.7 mmol, 10 equiv.) and (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PyBOP, 0.2212 g, 0.43 mmol, 2.5 equiv.). Argon was bubbled in for 4 h, the coupling solution was evacuated, and the resin was washed with DMF (3 × 10 mL) and isopropanol (i-PrOH) (3 × 10 mL). A Kaiser test was performed to confirm the completion of the reaction. Before each amino acid coupling, Fmoc deprotection was performed with 20% piperidine in DMF (3 × 10 mL). The above sequence was repeated to complete the reaction with Tfa.pteroic acid. Finally, the resin was washed with 50% ammonium hydroxide in DMF (3 × 10 mL) for 5 min to cleave the trifluoro-acetyl protecting group on pteroic acid, followed by i-PrOH (3 × 10 mL) and then DMF (3 × 10 mL). The resin was dried under argon for 30 min. The folate-EDA peptide was cleaved from the resin using a cleavage mixture consisting of 95% CF3COOH, 2.5% H2O, and 2.5% triisopropylsilane. 10 ml of the cleavage mixture was charged and argon bubbled in for 1.5 h. The cleavage mixture was drained into a clean flask. The resin was washed three times with additional cleavage mixture. The combined mixture was concentrated under reduced pressure to a small volume (approximately 5 mL) and precipitated by adding cold ethyl ether. The precipitate was collected by centrifugation, washed with ethyl ether (three times) and dried under high vacuum. The crude reaction mixture was purified by RP-HPLC (mobile phase A = 10 mM ammonium acetate, pH = 7; organic phase B = acetonitrile; method: 0% B to 30% B in 35 min at 13 ml / min) to give folate-EDA in 65% yield. LC-MS (A = 10 mM ammonium bicarbonate, pH = 7; organic phase B = acetonitrile; method: 0% B to 30% B in 12 min) RT =3.26 minutes(M+H + =484.0).

[0103] Synthesis of folate-DBCO conjugate [ka] To a stirred solution of folate-EDA (0.0100 g, 0.0206 mmol, 1 eq.) and NHS-DBCO (0.0091 g, 0.0227 mmol, 1.1 eq.) in DMSO, DIPEA (0.0039 g, 0.0309 mmol, 1.5 eq.) was added dropwise. The reaction mixture was kept stirring at room temperature. The progress of the reaction was monitored by LCMS. Upon complete conversion of folate-EDA, the crude reaction mixture was purified by RP-HPLC (mobile phase A=10 mM ammonium acetate, pH=7; organic phase B=acetonitrile; method: 0% B to 50% B in 35 min at 13 ml / min) to give folate-DBCO in 85% yield. LC-MS (A=10 mM ammonium bicarbonate, pH=7; organic phase B=acetonitrile; method: 0% B to 50% B in 12 min) R T =4.62 minutes(M+H + =771.0).

[0104] Synthesis of folate-SS-DBCO conjugate [ka] To a stirred solution of folate-EDA (0.0100 g, 0.0206 mmol, 1 eq.) and NHS-SS-DBCO (0.0128 g, 0.0227 mmol, 1.1 eq.) in DMSO, DIPEA (0.0039 g, 0.0309 mmol, 1.5 eq.) was added dropwise. The reaction mixture was kept stirring at room temperature. The progress of the reaction was monitored by LCMS. After complete conversion of folate-EDA, the crude reaction mixture was purified by RP-HPLC (mobile phase A=10 mM ammonium acetate, pH=7; organic phase B=acetonitrile; method: 0% B to 50% B in 35 min at 13 ml / min) to give folate-SS-DBCO in 82% yield. LC-MS (A=10 mM ammonium bicarbonate, pH=7; organic phase B=acetonitrile; method: 0% B to 50% B in 12 min)RT =5.4 points (M+H + =934.0)

[0105] Synthesis of folate-Cys conjugates

change

[0106] Preparation of pyridyl disulfide amide derivatives of nigericin. [ka] Nigericin free acid (0.035 mmol), Py-SS-(CH2)2NH2 (0.052 mmol), HATU (0.052 mmol), and DIPEA (0.069 mmol) were dissolved in anhydrous CHCl2 (2.0 mL) and stirred at room temperature overnight under argon. The progress of the reaction was monitored by LC-MS. After complete conversion of nigericin free acid, the crude reaction mixture was purified by R-HPLC (mobile phase A = 10 mM ammonium acetate, pH = 7; organic phase B = acetonitrile; method: 0% B to 100% B in 35 min at 13 ml / min) to give the nigericin-SS-amide derivative in 55% yield. LC-MS (A = 10 mM ammonium bicarbonate, pH = 7; organic phase B = acetonitrile; method: 0% B to 100% B in 12 min) R T = 7.53 min (M+Na + =910.5)

[0107] Preparation of folic acid-pyridyl disulfide amide derivatives of nigericin. [ka] DIPEA was added dropwise to a stirred solution of folate-Cys (0.004 g, 0.007 mmol, 1.5 eq.) and pyridyl disulfide amide derivative of nigericin (0.004 g, 0.005 mmol, 1.0 eq.) in DMSO. The reaction mixture was kept stirred at room temperature. The progress of the reaction was monitored by LC-MS. After complete conversion of folate-Cys, the crude reaction mixture was purified by RP-HPLC (mobile phase A=10 mM ammonium acetate, pH=7; organic phase B=acetonitrile; method: 0% B to 40% B in 35 min at 13 ml / min) to give the folate-pyridyl disulfide amide derivative of nigericin in 65% yield. LC-MS (A=10 mM ammonium bicarbonate, pH=7; organic phase B=acetonitrile; method: 0% B to 100% B in 12 min) R T =4.2 minutes(M+H + =1441.0)

[0108] Preparation of the folate-DBCO-pyridyl disulfide amide derivative of nigericin (non-releasable conjugate) [ka] To a stirred solution of folate-pyridyl disulfide amide derivative of nigericin (0.010 g, 0.0069 mmol, 1 eq.) and NHS-DBCO (0.003 g, 0.0076 mmol, 1.5 eq.) in DMSO, DIPEA (0.0013 g, 0.010 mmol, 1.5 eq.) was added dropwise. The reaction mixture was kept stirred at room temperature. The progress of the reaction was monitored by LC-MS. After complete conversion of folate-SS-nigericin, the crude reaction mixture was purified by RP-HPLC (mobile phase A=10 mM ammonium acetate, pH=7; organic phase B=acetonitrile; method: 0% B to 50% B in 35 min at 13 ml / min) to give folate-DBCO-nigericin in 65% yield. LC-MS (A = 10 mM ammonium bicarbonate, pH = 7; organic phase B = acetonitrile; method: 0% B to 100% B in 12 min) T =5.38 minutes(M+H + =1728.4)

[0109] Preparation of the folate-SS-DBCO-pyridyl disulfide amide derivative of nigericin (releasable conjugate) [ka] To a stirred solution of folate-pyridyl disulfide amide derivative of nigericin (0.010 g, 0.0069 mmol, 1 eq.) and NHS-SS-DBCO (0.005 g, 0.010 mmol, 1.5 eq.) in DMSO, DIPEA (0.0013 g, 0.010 mmol, 1.5 eq.) was added dropwise. The reaction mixture was kept stirred at room temperature. The progress of the reaction was monitored by LC-MS. After complete conversion of folate-SS-nig, the crude reaction mixture was purified by RP-HPLC (mobile phase A = 10 mM ammonium acetate, pH = 7; organic phase B = acetonitrile; method: 0% B to 50% B in 35 min at 13 ml / min) to give folate-SS-DBCO-nigericin in 65% yield. LC-MS (A = 10 mM ammonium bicarbonate, pH = 7; organic phase B = acetonitrile; method: 0% B to 100% B in 12 min) T =6.52 minutes(M / 2+H + =945.4)

[0110] Preparation of folate-nigericin-miR-34a conjugate Folate-Nigericin DBCO miR-34a Conjugate: [ka] Folate-Nigericin-SS-DBCO miR-34a conjugate: [ka] Two RNA oligonucleotides, designated miR-34a-5p guide strand and miR-34a-3p passenger strand (both prepared by Integrated DNA Technologies), were used to construct the miRNA duplex. The miR-34a-3p passenger strand comprises a 20 nt RNA oligo duplex (mCmArAmCrCmArGmCrUmArAmGrAmCrAmCrUmGrCC) modified with an azido linker at the 5' end and a 2'-O-methyl RNA base at the 3' end, and the miR-34a-5p guide strand comprises a 22 nt RNA oligo with minimal modification on the 3' end with a 2'-O-methyl RNA base (rUmGmUrUrGrGrUrCrGrArUrUrCrUrGrUrGrArCrGrGrU / 5Phos). A control duplex was formed using a scrambled miRNA (negative control) synthesized with the same modifications. Bi-orthogonal click reactions were performed between folate-DBCO-nigericin or folate-SS-DBCO-nigericin conjugates and azide-modified antisense miR-34a (or scrambled). Click reactions were performed in water at room temperature for 8 h at a molar ratio of 1:10 (azide oligo:folate conjugate), followed by cooling at 4°C for 4 h. Unconjugated folate was removed from the reaction using Oligo Clean and Concentrator (Zymo Research) according to the manufacturer's instructions. Conjugation was confirmed using 15% TAE native PAGE and MALDI spectroscopy. After conjugation, miR-34a-5p guide strand was annealed to the folate conjugate. Briefly, folate-miR-34a-3p and miR-34a-5p were mixed in an equimolar ratio (1:1, final concentration 5 μM each) in annealing buffer: 10 mM Tris buffer pH 7 (Sigma) supplemented with 50 mM NaCl (Sigma) and 1 mM EDTA (Sigma), incubated at 95°C for 5 min, cooled to room temperature over 1 h, and then stored at -80°C.

[0111] Preparation of folate-nigericin-DBCO-siRNA conjugate Folate-nigericin DBCO-siLuc2 conjugate: [ka] Folate-Nigericin-SS-DBCO-siLuc2 conjugate: [ka] Two RNA oligonucleotides (Integrated DNA Technologies) designated as siLuc2 sense strand (GGACGAGGACGAGCACUUCUU) and siLuc2 antisense strand (GAAGUGCUCGUCCUCGUCCUU) were used to construct siRNA duplexes. Bi-orthogonal click reactions were performed between folate-nigericin-DBCO or folate-nigericin-ss-DBCO and azide-modified antisense siRNA (or scramble). Click reactions were performed in water at room temperature with a 1:10 molar ratio (azide oligo:folate-nigericin-DBCO) for 8 h, followed by cooling at 4°C for 4 h. Unconjugated folate was removed from the reaction using Oligo Clean and Concentrator (Zymo Research) according to the manufacturer's instructions. Conjugation was confirmed using 15% TAE native PAGE and MALDI spectroscopy. After conjugation, siLuc2 sense strand was annealed to folate-nigericin-DBCO-siRNA antisense conjugate. Briefly, folate-siLuc2 antisense and siLuc2 sense were mixed in equimolar ratio (1:1, final concentration 5 μM each) in annealing buffer: 10 mM Tris buffer pH 7 (Sigma) supplemented with 50 mM NaCl (Sigma) and 1 mM EDTA (Sigma), incubated at 95°C for 5 min, then slowly cooled to room temperature and stored at -80°C.

[0112] Preparation of folate-Cy5 dye conjugate [ka] To a stirred solution of folate-EDA (0.0008 g, 0.0016 mmol, 1 eq.) and NHS-Cy5 (0.001 g, 0.001 mmol, 1.1 eq.) in DMSO, DIPEA (0.0004 g, 0.0032 mmol, 2 eq.) was added dropwise. The reaction mixture was kept stirred at room temperature. The progress of the reaction was monitored by LC-MS. After complete conversion of folate-EDA, the crude reaction mixture was purified by RP-HPLC (mobile phase A=10 mM ammonium acetate, pH=7; organic phase B=acetonitrile; method: 0% B to 50% B in 35 min at 13 ml / min) to give the folate-Cy5 dye conjugate in 85% yield. LC-MS (A=10 mM ammonium bicarbonate, pH=7; organic phase B=acetonitrile; method: 0% B to 50% B in 12 min) R T =2.40 minutes(M+H + =949.2)

[0113] Preparation of folate-Cy 5-pyridyl disulfide amide derivative dye conjugates of nigericin [ka] To a stirred solution of folate-pyridyl disulfide amide derivative of nigericin (0.0023 g, 0.0016 mmol, 1 eq.) and NHS-Cy5 (0.001 g, 0.0016 mmol, 1 eq.) in DMSO, DIPEA (0.0004 g, 0.0032 mmol, 2 eq.) was added dropwise. The reaction mixture was kept stirred at room temperature. The progress of the reaction was monitored by LC-MS. After complete conversion of folate-ss-nig, the crude reaction mixture was purified by RP-HPLC (mobile phase A=10 mM ammonium acetate, pH=7; organic phase B=acetonitrile; method: 0% B to 50% B in 35 min at 13 ml / min) to give folate-nigericin-Cy5 in 65% yield. LC-MS (A = 10 mM ammonium bicarbonate, pH = 7; organic phase B = acetonitrile; method: 0% B to 100% B in 12 min) T =7.05 minutes(M+H + =1906.0)

[0114] Synthesis of folic acid-NIR dye conjugates: To a stirred solution of folate-Cys (0.010 g, 0.015 mmol, 1 eq.) and maleimide-NIR dye (0.019 g, mmol, 1.1 eq.) in DMSO, DIPEA (0.0029 g, 0.0228 mmol, 1.5 eq.) was added dropwise. The reaction mixture was kept stirring at room temperature. The progress of the reaction was monitored by LC-MS. After complete conversion of folate-Cys, the crude reaction mixture was purified by RP-HPLC (mobile phase A=10 mM ammonium acetate, pH=7; organic phase B=acetonitrile; method: 0% B to 30% B in 35 min at 13 ml / min) to give folate-NIR in 85% yield. LC-MS (A=10 mM ammonium bicarbonate, pH=7; organic phase B=acetonitrile; method: 0% B to 30% B in 12 min) R T =3.30 minutes(M+H + =1179.0).

[0115] Synthesis of folate-DBCO-NIR dye conjugates: To a stirred solution of folate-NIR dye (0.0050 g, 0.0027 mmol, 1 eq.) and NHS-DBCO (0.0016 g, 0.0041 mmol, 1.5 eq.) in DMSO, DIPEA (0.0054 g, 0.0041 mmol, 1.5 eq.) was added dropwise. The reaction mixture was kept stirred at room temperature. The progress of the reaction was monitored by LC-MS. After complete conversion of the folate-NIR dye, the crude reaction mixture was purified by RP-HPLC (mobile phase A = 10 mM ammonium acetate, pH = 7; organic phase B = acetonitrile; method: 0% B to 50% B in 35 min at 13 ml / min) to give folate-DBCO-NIR in 86% yield. LC-MS (A = 10 mM ammonium bicarbonate, pH = 7; organic phase B = acetonitrile; method: 0% B to 50% B in 12 min) R T =4.75 minutes(M / 2+H + =1043.0).

[0116] Synthesis of Folate-SS-DBCO-NIR Conjugate: To a stirred solution of folate-NIR dye (0.0050 g, 0.0027 mmol, 1 eq.) and NHS-SS-DBCO (0.0023 g, 0.0041 mmol, 1.5 eq.) in DMSO, DIPEA (0.0054 g, 0.0041 mmol, 1.5 eq.) was added dropwise. The reaction mixture was kept stirred at room temperature. The reaction progress was monitored by LC-MS. After complete conversion of folate-NIR dye, the crude reaction mixture was purified by R-HPLC (mobile phase A=10 mM ammonium acetate, pH=7; organic phase B=acetonitrile; method: 0% B to 50% B in 35 min at 13 ml / min) to give folate-SS-DBCO-NIR in 84% yield. LC-MS (A = 10 mM ammonium bicarbonate, pH = 7; organic phase B = acetonitrile; method: 0% B to 50% B in 12 min) T =4.991 minutes(M / 2+H + =1125.0).

[0117] Preparation of folate-miRNAs (FolamiRs) A miRNA duplex was constructed using two RNA oligonucleotides, denoted as miR-34a-5p guide strand and miR-34a-3p passenger strand (both prepared by Integrated DNA Technologies). The miR-34a-3p passenger strand comprises a 20 nt RNA oligo duplex (mCmArAmCrCmArGmCrUmArAmGrAmCrAmCrUmGrCC) modified with an azido linker at the 5' end and a 2'-O-methyl RNA base at the 3' end, and the miR-34a-5p guide strand comprises a 22 nt RNA oligo with minimal modification on the 3' end with a 2'-O-methyl RNA base (rUmGmUrUrGrGrUrCrGrArUrUrCrUrGrUrGrArCrGrGrU / 5Phos). A control duplex was formed using a scrambled miRNA (negative control) synthesized with the same modifications. Bi-orthogonal click reactions were performed between folate-DBCO-nigericin or folate-SS-DBCO-nigericin conjugates and azide-modified antisense miR-34a (or scrambled). Click reactions were performed in water at room temperature for 8 h at a molar ratio of 1:10 (azide oligo:folate-DBCO or folate-SS-DBCO) and then cooled at 4°C for 4 h. Unconjugated folate was removed from the reaction using Oligo Clean and Concentrator (Zymo Research) according to the manufacturer's instructions. Conjugation was confirmed using 15% TAE native PAGE and MALDI spectroscopy. Conjugation of folate-NIR compounds was further confirmed using Licor Odyssey CLX (Licor). After conjugation, miR-34a-5p guide strand was annealed to folate and NIR-folate conjugates. Briefly, folate-miR-34a-3p and miR-34a-5p were mixed in an equimolar ratio (1:1, final concentration 5 μM each) in annealing buffer: 10 mM Tris buffer pH 7 (Sigma) supplemented with 50 mM NaCl (Sigma) and 1 mM EDTA (Sigma), incubated at 95°C for 5 min, cooled to room temperature over 1 h, and then stored at -80°C.

[0118] Serum stability assay Double-stranded RNA oligonucleotides and FolamiR conjugates were incubated for the indicated times in 50% fetal bovine serum (Sigma) in water at 37° C. RNA samples were harvested and analyzed using 15% TAE polyacrylamide gel electrophoresis (PAGE). [Table 1] [Table 2]

[0119] Method Example cell line To monitor FolamiR-34a conjugate activity in cells, MDA-MB-231 cells expressing miR-34a Renilla sensor (MB-231 sensor) were generated. First, the specificity of the miRNA sensor was monitored by transiently expressing the miR-34a sensor or mutant sensor together with miR-34a mimic or negative control (scrambled RNA) in MDA-MB-231 breast cancer cells. For that purpose, 1 × 10 4The cells were seeded in 96-well plates and co-transfected with 25 ng of plasmid and 6 nM of miRNA mimic using Lipofectamine 2000 (Life Technologies). Renilla activity was measured 48 hours after transfection using the Renilla Glo luciferase kit (Promega). The results suggest that miR-34a is endogenously active in MB-231 cells and that delivery of exogenous miR-34a promotes further silencing of the Renilla sensor. These results suggest that the miR-34a sensor is specific for miR-34a and that endogenous levels of miR-34a in MB-231 cells are not sufficient to completely silence the miR-34a sensor, leaving room for increased knockdown with exogenous miR-34a. Stable clones were generated and tested for Renilla activity. Among the 15 stable clones, clone 5 was selected for further experiments due to its high Renilla levels and its ability to monitor miR-34a activity (Figure 1).

[0120] In vitro Renilla luciferase activity MDA-MB-231 triple-negative breast cancer cells (HTB-26, confirmed to be free of mycoplasma by mycoplasma contamination testing using the MycoAlert Mycoplasma Detection Kit-Lonza) were cultured in 10% fetal bovine serum (Sigma), 100 U / ml -1The cells were cultured in RPMI 1640 medium (folate-free, Life Technologies) supplemented with 100 μg / ml penicillin and 100 μg / ml streptomycin (Hyclone, GE Healthcare Life Sciences) and maintained at 37 °C in 5% CO2. For luciferase reporter experiments, miR-34a sensor plasmids were generated by inserting an antisense sequence against miR-34a into the 3' untranslated region of Renilla luciferase in a vector (psiCHECK, Promega). miR-34a-specific silencing was confirmed by transiently transfecting the miR-34a sensor or mutant miR-34a sensor in MDA-MB-231 cells. The miR-34a sensor-expressing cells were transfected with miR-34a mimics using Lipofectamine RNAimax (Life Technologies) to confirm silencing mediated by exogenous miRNAs. To generate stable clones, MDA-MB-231 cells were cultured in 6-well plates at 1 × 10 6The cells were seeded at a density of 1000 cells / well and transfected with 2 μg of miR-34a sensor plasmid using Lipofectamine 2000 (Life Technologies). Stable clones were selected using hygromycin B (500 μg / mL; Hyclone, GE Healthcare Life Sciences) as a selection marker. Single clones were evaluated for Renilla expression, and the clone with the highest Renilla expression was selected. MB-231 sensor cells were seeded in 96-well plates (final concentration 50 nM) containing folate-DBCO-miR-34a, folate-nigericin-DBCO-miR-34a, folate-nigericin-SS-DBCO-miR-34a, and FolamiR-NC (negative control) in folate- and serum-free RPMI medium. As controls, untreated and unconjugated double-stranded miRNA were included. Renilla luciferase values ​​were obtained between 12 and 48 h post-incubation using the Renilla Glo luciferase kit (Promega) according to the manufacturer's instructions. For each time point, Renilla levels were normalized to FolamiR-NC. Experiments were performed three times in triplicate for each condition.

[0121] miR-34a-Renilla luciferase gene knockdown activity MB-231 sensor cells treated with folate-nigericin-DBCO-miR-34a or folate-nigericin-SS-DBCO-miR-34a (in the absence of transfection reagent) show a decrease in Renilla activity of up to 80% 48 hours after treatment (Figure 1). However, folate-DBCO-miR-34a lacking nigericin showed only 30% gene knockdown activity by 48 hours, confirming that nigericin aids in the release of miR-34a from endosomes. Based on the data, unexpectedly, both releasable and non-releasable folate-nigericin-miR-34a efficiently entered cells and retained activity, suggesting that conjugated folate does not prevent the loading of miR-34a-5p into Argonaute.

[0122] siRNA gene knockdown assay For siRNA targeting assays, MDA-MB-231 cells were cultured at 1 × 10 6 Cells were seeded in 6-well plates at a density of 1000 cells / well and transfected with 2 μg of pmiRGlo plasmid (Promega) using Lipofectamine 2000 (Life Technologies). After 24 h, cells were reseeded in 96-well plates with Fol-DBCO-siLuc2, Fol-nigericin-DBCO-siLuc2, Fol-DBCO-NC (negative control), Fol-nigericin-DBCO-NC (final concentration 50 nM) in folic acid and serum-free RPMI medium. Untreated and unconjugated double-stranded miRNA were included as controls. For each time point, Renilla and firefly luciferase values ​​were obtained using a dual luciferase reporter kit (Promega) according to the manufacturer's instructions. Firefly / Renilla ratios were normalized to Fol-DBCO-NC or Fol-nigericin-DBCO-NC for each time point. Experiments were performed three times in triplicate for each condition. Statistical significance was tested using two-way analysis of variance (ANOVA) and Bonferroni post-hoc tests.

[0123] siRNA gene knockdown assay results and discussion Luciferase targeting assays were performed by incubating MDA-MB-231 cells with siRNA for luciferase conjugated with folic acid (siLuc2) (Fol-DBCO-siLuc) or luciferase conjugated with a modified folic acid ligand bearing a molecule of nigericin (Fol-nigericin-DBCO-siLuc). These cell-based experiments showed that cells treated with Fol-nigericin-DBCO-siLuc showed a rapid decrease in luciferase activity 18 hours after treatment, reaching 40% after 24 hours (Figure 2). However, Fol-DBCO-siLuc showed no decrease in luciferase activity even at 32 hours. Interestingly, this decrease in luciferase activity was not observed in Fol-NC (negative control)-treated cells or in Fol-siLuc-treated cells, suggesting that it is specific to the presence of nigericin. The difference in luciferase reduction between Fol-siLuc2 and its nigericin counterpart demonstrates the promotion of nigericin in the escape of folate-siLuc2 conjugates from endosomes to the cytoplasm.

[0124] Endosomal escape assay: live cell confocal experiments Live cell imaging For live cell imaging, cells were plated onto glass-bottom 2-well chamber slides (Lab-Tek TM The cells were plated on Chambered Coverglass (Thermo Fisher Scientific, Denmark). Briefly, the chamber slides were pretreated with poly-D-lysine (0.1 mg / mL; Sigma-Aldrich) for 5 min, washed with PBS, and air-dried for 5 min. MDA-MB-231 cells stably expressing Rab5B-GFP were plated at 3 × 10 4Cells / well were plated and maintained in folate-free RPMI 1640 medium (Life Technologies) supplemented with 10% fetal bovine serum (Sigma), 100 U / ml penicillin and 100 μg / ml streptomycin (Hyclone, GE Healthcare Life Sciences) at 5% CO2 and 37°C. On the day of the experiment, the medium was replaced with medium supplemented with 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Sigma-Aldrich) and the slides were mounted on a Nikon A1Rsi confocal microscope (temperature set at 37°C) equipped with a resonant scanner and a piezo Z-drive (Nikon Instruments) attached to a Tokai Hit Live Imaging Chamber (INU-TIZ-F1; Tokai Hit, Japan). Image acquisition was performed at a single focal plane and was initiated after addition of folate-Cy5 conjugate (50 nM) using NIS-elements software 4.5 (Nikon Instruments Inc., Japan). Images were further analyzed using ImageJ 2.0.0 (NIH).

[0125] Live cell imaging Initial endosomal escape experiments were performed in MDA-MB-231 cells stably expressing Rab5B-GFP using 50 nM folate-cy5 dye conjugate or folate-nigericin-Cy5 dye conjugate. Observations were made every hour for up to 24 hours. Representative images of cells at 3 hours are shown in Figures 3 and 4. A significant difference in the results for the folate-cy5 conjugate was seen within 3 hours of internalization, when significantly larger endosomes were observed in cells treated with the folate-nigericin-cy5 dye conjugate. After 3 hours, endosomes treated with folate-nigericin-cy5 became larger than those treated with the folate-cy5 dye conjugate and began to aggregate and form a plume. After 3 hours, the swollen endosomes aggregated into larger structures, whereas those treated with folate-cy5 dye 3 alone remained relatively unchanged throughout the course of the experiment. Figure 3 shows that MDA-MB-231 cells treated with folate-Cy5 produced punctate Cy5 fluorescent signals mainly from the plasma membrane and endosomes 3 h after treatment, however, folate-nigericin-Cy5-treated cells showed the formation of large endosomes and a blurred dispersion of Cy5 fluorescent signals in the cytoplasm (Figure 4).

[0126] Experimental Design: An a priori power analysis was used to estimate the sample size required for statistical significance of 0.05, α<0.5, and power of 80%. Based on the power calculation, the recommended number of animals to include in each treatment group was six. Next, the expected effect size was determined from a small pilot study. Due to the strong and significant reduction in Renilla reporter activity observed after treating three animals with FolamiR-34a (Figure 7A,B), the remaining three animals were not treated. In this case, a power of 0.5 would accurately predict significance using three animals at α<0.5. All other studies used the six animals initially calculated.

[0127] Flow cytometry FR-positive human MDA-MB-231 cells and FR-negative human A549 cells cultured as described above were detached by trypsinization, washed twice in ice-cold phosphate-buffered saline (PBS; pH 7.4), and cultured at 1 × 10 7 Cells were resuspended at 1 × 10 cells / density. Cell viability was measured by trypan blue exclusion and cells were used only if their viability was >80%. Flow cytometry analysis was then performed according to standard protocols. Briefly, 1 × 10 cells / density were resuspended at 1 × 10 cells / density. Cell viability was measured by trypan blue exclusion and cells were used only if their viability was >80%. Flow cytometry analysis was then performed according to standard protocols. 6 Cells were incubated with PE anti-FOLR1 antibody (cat. no. 908303, Biolegend) or matched isotype antibody (cat. no. 400213, Biolegend) as a control and analyzed by flow cytometric analysis using an LSR Fortessa flow cytometer (BD Biosciences, San Jose, CA, USA). Data were analyzed using FlowJo software v10 (Tree Star, Inc, OR, USA). Functionality of the FR was firstly confirmed by flow cytometric analysis as described above after incubation of MDA-MB-231 and A549 cells with FolamiR-34a-NIR (50 nM) and secondly confirmed by microscopic analysis of cells incubated with folate-fluorescein isothiocyanate (FITC) at a final concentration of 50 nM. Cells were assessed at various time points using an Olympus IX73 microscope equipped with a 1.25x objective and an Olympus DP80 camera and CellSens 1.11.

[0128] In vitro FolamiR delivery MDA-MB-231 triple-negative breast cancer cells (HTB-26) and A549 non-small cell lung cancer cells (CCL-185) (both confirmed to be free of mycoplasma by mycoplasma contamination testing using the MycoAlert Mycoplasma Detection Kit-Lonza) were incubated at 5% CO2, 37°C in 10% fetal bovine serum (Sigma), 100 UmL -1 Penicillin and 100 μg mL -1Cells were cultured and maintained in RPMI 1640 medium (folic acid-free (Life Technologies)) supplemented with streptomycin (Hyclone, GE Healthcare Life Sciences). MDA-MB-231 and A549 cells were transfected with 500 ng of miR-34a Renilla sensor and incubated with FolamiR. Renilla signal was measured 96 h after treatment. For each time point, data points were normalized to FolamiR-NC (negative control role: scrambled miRNA). Error bars represent the mean ± sd. Each experiment had at least four technical replicates, n = 3 for each treatment, and statistical analysis was performed by one-way ANOVA with post-hoc Bonferroni test ( ** , P<0.01). For luciferase reporter experiments, miR-34a sensor plasmids were generated by inserting antisense sequences against miR-34a into the 3' untranslated region of Renilla luciferase in a vector (psiCHECK, Promega). miR-34a-specific silencing was confirmed in MDA-MB-231 cells by transiently transfecting miR-34a sensor or mutant miR-34a sensor. miR-34a sensor-expressing cells were transfected with miR-34a mimics using Lipofectamine RNAimax (Life Technologies) to confirm exogenous miRNA-mediated silencing. To generate stable clones, MDA-MB-231 cells were cultured at 1 × 10 6 Cells were seeded into 6-well plates at a density of 100 cells / well and transfected with 2 μg of miR-34a sensor plasmid using Lipofectamine 2000 (Life Technologies). Stable clones were selected using hygromycin B (500 μg / mL; Hyclone, GE Healthcare Life Sciences) as a selection marker. Single clones were assessed for Renilla expression, and the clone with the highest Renilla expression was selected. MB-231 sensor cells were seeded in 96-well plates containing FolamiR-34a, Fol-SS-34a and FolamiR-NC (negative control) at a final concentration of 50 nM in folic acid and serum-free RPMI medium. Untreated and unconjugated double-stranded miRNA were included as controls. Renilla luciferase values ​​were obtained after 24, 48, 72, 96 and 120 hours of incubation using the Renilla Glossiferase kit (Promega) according to the manufacturer's instructions. Renilla levels were normalized to FolamiR-NC for each time point. Experiments were performed three times in triplicate for each condition. MDA-MB-231 breast cancer cells have been reported to express detectable levels of FR on the plasma membrane, making this cell line a valid model for assessing FolamiR activity. To confirm FR expression, we performed flow cytometry analysis comparing MDA-MB-231 cells with A549 cells (FR negative control). MDA-MB-231 cells were confirmed to express detectable levels of FRα (Figure 5c). These results were corroborated by analyzing the cellular uptake of NIR-FolamiR-34a using flow cytometry (Figure 5d) and by analyzing folate fluorescein isothiocyanate (Fol-FITC) conjugate uptake using fluorescence microscopy (Figure 5E). Both folate conjugates were taken up by the FR-positive cell line MDA-MB-231 but not the FR-negative A549 cell line. This observation was functionally confirmed after treatment with FolamiR of MDA-MB-231 and A549 cell lines transiently expressing the miR-34a Renilla sensor. This sensor is the Renilla gene followed by one miR-34a complementary binding site, allowing monitoring of the post-transcriptional regulation of Renilla by miR-34a. In both cell lines, the sensor responded to transfected miR-34a mimics (Figure 10); however, the sensor was only downregulated in MDA-MB231 cells after FolamiR-34a exposure (Figure 5F), suggesting that FolamiR targeting is dependent on FR-expressing cells. Taken together, these results suggest that MDA-MB-231 is a FR-positive cell line and provide preliminary evidence for specific uptake of FolamiR conjugates via FR interactions. To monitor FolamiR-34a activity, MDA-MB-231 cells were generated to stably express the miR-34a Renilla luciferase sensor (MB-231 sensor) or a mutant variant of this sensor that does not respond to miR-34a. Multiple clones were generated and the clone with the highest level of Renilla (Figure 11) was used to assess FolamiR-34a activity. When FolamiR-34a or FolamiR-SS-34a was added to MB-231 sensor cells (in the absence of transfection reagent), a decrease in Renilla activity was observed after 72 hours of exposure (Figure 6a). Renilla activity recovered 120 hours after exposure, likely due to replication-induced dilution of FolamiR-34a in the cells or a decrease in FolamiR-34a. Proliferation of MB-231 sensor cells was reduced after a single FolamiR-34a treatment (Figure 6B), which correlated with a decrease in Renilla activity. Surprisingly, both releasable and non-releasable FolamiRs efficiently entered cells and retained data-based activity, suggesting that conjugated folate does not prevent miR-34a-5p loading into Argonaute.

[0129] FR-dependent responses FR-positive human MDA-MB-231 cells and FR-negative human A549 cells were transfected with 500 ng of miR-34a sensor plasmid using Lipofectamine 2000 (Life Technologies). After 24 h, cells (4000 cells / well) were seeded into 96-well plates containing FolamiR-34a and FolamiR-NC (negative control) at a final concentration of 50 nM or 100 nM in folic acid and serum-free RPMI medium. Cells transfected with Lipofectamine RNAimax (Life Technologies) were used as controls to monitor the miR-34a Renilla sensor response to miR-34a mimics. Untreated and unconjugated double-stranded miRNA were included as controls. Renilla luciferase values ​​were obtained after 96 h of incubation using the Renilla Glossiferase kit (Promega) according to the manufacturer's instructions. Renilla levels in FolamiR-34a-treated cells were normalized to FolamiR-NC for each time point, and non-conjugated double-stranded miRNA-treated cells were normalized to untreated. Experiments were performed three times in triplicate for each condition. A dose-dependent decrease in Renilla activity was observed only in cells treated with FolamiR-34a (Figure 6c).

[0130] In vitro FR binding competition assay In vitro FR binding competition assays were performed as described by Van Der Heijden, JW et al. (“Folate receptor β as a potential delivery route for novel folate antagonists to macrophages in the synovial tissue of rheumatoid arthritis patients,” Arthritis Rheum. 60, 12-21 (2009)) and Gent, YY et al. (“Evaluation of the novel folate receptor ligand [18F]fluoro-PEG-folate for macrophage targeting in a rat model of arthritis,” Arthritis Res. Ther. 15, R37 (2013)). Briefly, FR-positive human MDA-MB-231 cells and FR-negative human A549 cells were cultured as described above, detached by trypsinization, washed twice with ice-cold phosphate-buffered saline (PBS; pH 7.4), and cultured at 1 × 10 7 Cells were then resuspended to a density of 1000 cells / mL. 100 μL of this cell suspension was then incubated with FolamiR-34a-NIR (in the presence or absence of a 1- to 100-fold molar excess of folate glucosamine conjugate) to a final concentration of 50 nM. Cells were incubated for 20 min at 4 °C, washed twice with ice-cold PBS, and analyzed for displacement of FolamiR-34a-NIR binding by flow cytometric analysis using an LSR Fortessa flow cytometer (BD Biosciences, San Jose, CA, USA). Data were analyzed using FlowJo software v10 (Tree Star, Inc, Ashland, Ore.). Functional competition was verified using MDA-MB-231 sensor cells incubated with FolamiR-34a or FolamiR-NC at a final concentration of 50 nM in the presence of 1- to 100-fold molar excess of folate glucosamine conjugates. Untreated and unconjugated double-stranded miRNA were included as controls. Renilla luciferase values ​​were obtained after 96 h of incubation using the Renilla Glossiferase kit (Promega) according to the manufacturer's instructions. Renilla levels in FolamiR-34a-treated cells were normalized to FolamiR-NC for each time point, and unconjugated double-stranded miRNA-treated cells were normalized to untreated. Experiments were performed three times in triplicate for each condition. With increasing amounts of folate-glucosamine conjugate (folate-glucosamine), the cell-specific NIR-FolamiR-34a signal was dose-dependently decreased, indicating that folate-glucosamine competes with NIR-FolamiR-34a (Figure 6D). More importantly, folate-glucosamine treatment dose-dependently abolished the silencing effect of NIR-FolamiR-34a on the miR-34a Renilla sensor (Figure 6E). These results support that FolamiR can deliver functional miRNAs to cells overexpressing FRs and that delivery is dependent on FR expression. Figure 6D,E shows the miR-34a Renilla sensor response to FolamiR-34a (50 nM, 96 h) in the presence of increasing concentrations of folate glucosamine conjugate. For each experimental condition, data points were normalized to FolamiR-NC (negative control role: scrambled miRNA). Experiments were performed in at least four replicates for each treatment (n=3), and statistical analysis was performed by one-way ANOVA with post-hoc Bonferroni tests ( * P<0.05).

[0131] Cell proliferation assay Sulforhodamine B (SRB, Sigma) assay was used as a surrogate for cell proliferation in 96-well plates. Briefly, after FolamiR treatment, cells were fixed with 10% trichloroacetic acid in complete medium and stained with 0.4% (wt / vol) SRB in 1% acetic acid for 1 h. Unbound dye was removed by washing four times with 1% acetic acid. Finally, protein-bound dye was extracted with 10 mm unbuffered Tris base and absorbance was measured at 510 nm using a GloMax Multi+ spectrophotometer (Promega). Absorbance (a surrogate for cell volume) was normalized to the absorbance of cells cultured in the presence of FolamiR-NC for each time point.

[0132] Establishment of flank tumors For single-dose testing, 5 × 10 cells suspended in 200 μL of Matrigel (Corning) were 6 Subcutaneous tumors were induced in female Nu / Nu (NU-Foxn1nu; Charles River) congenic mice (6 weeks old, n=5) by subcutaneous injection of MDA-MB-231 sensor cells. For longitudinal studies, parental MDA-MB-231 cells were used. Because observations show that rodents exhibit high plasma and tissue levels of 5-methyl-tetrahydrofolate, a naturally occurring form of folate (approximately 10-fold higher than in humans), mice were placed on a folate-deficient diet (Envigo, TD 95247) for 2 weeks prior to tumor implantation and throughout the course of the experiment. A folate-deficient diet was shown to reduce folate levels to physiological levels seen in humans. To measure tumor growth, individual tumors were measured using calipers, and tumor volume was calculated by the following formula: tumor volume (mm 3 )=Width x (Length 2 )×2 -1 By the time of treatment, the tumor had grown to 150 cm 3 Animals were excluded if a tumor volume of 0.01 mm was not reached. For single-dose experiments, animals were intravenously (iv) injected with 5 nmol of FolamiR after acquisition of luminescence and fluorescence signals (day 0). For multiple-dose experiments, animals were randomized into experimental groups by minimizing the difference in the mean tumor size of the animals. Tumor volume is approximately 200 mm 3Once the IL-16 expression level was reached, animals were administered the indicated molar concentrations of FolamiR via intravenous injection every 3 days. All experimental protocols were approved by the Purdue Animal Care and Use Committee and conformed to the NIH guidelines for animal use.

[0133] Bioluminescence and infrared imaging To monitor tumor bioluminescence in vivo using IVIS Lumina II (Caliper) or Spectral AMI (Spectral Instruments), RediJect Coelenterazine h bioluminescent substrate (PerkinElmer) was administered according to the manufacturer's protocol. Luminescence values ​​were acquired at multiple time points (starting at 20 min) after substrate injection, and only maximum mean radiance values ​​were reported. Infrared imaging was performed using IVIS Lumina II (Caliper) with 745 nm excitation and an ICG emission filter. Noninvasive longitudinal monitoring of tumor luminescence and fluorescence was performed by whole animal imaging at the following time points: 0 h, 24 h, 48 h, and 72 h (n = 3 animals per experimental group). Whole organ images were acquired using the 800 nm channel of a Licor Odyssey CLX (Licor).

[0134] Serum cytokines Serum samples from multiple-dose experiments (24 hours after the last injection) were tested for IL-6 and tumor necrosis factor (TNFα) concentrations using a Mouse Specific Cytokine Multi-Analyte ELISA Array Kit (Qiagen) according to the manufacturer's instructions. Briefly, serum samples were thawed on ice and precipitates were removed by centrifugation at 1000 × g for 10 min at 4 °C before analysis. All samples or standards were added to a 96-well plate with assay buffer. Plates were gently shaken and incubated at room temperature for 2 h. The supernatant was removed and the wells were washed. Detection antibody was added and the plate was incubated for 1 h at room temperature. The plate was rinsed and incubated with avidin-HRP solution for 30 min at room temperature. The wells were washed and developer was added for data acquisition using a GloMax plate reader (Promega). Absorbance was measured at 450 nm and 570 nm. The 570 nm value was subtracted from the 450 nm value. Cytokine concentrations (pg / ml) in serum samples were calculated using cytokine standard curves. Detection limits were as follows: IL-6 58.8 pg / mL, and TNFα 30.5 pg / mL. LPS-treated Nu / Nu mice (NU-Foxn1nu; Charles River) were used as positive controls. Mice were injected intraperitoneally with 500 ng / kg lipopolysaccharide (LPS, L6529, Sigma) and serum was collected 2 h after injection.

[0135] Maximum tolerated dose (MTD) study Balb / c mice (8 weeks old) were intravenously injected once with 33.3 nmol, 10 nmol or 1 nmol of FolamiR-34a. Animals were observed for 2 weeks after administration. Mice were observed for changes in body weight and clinical signs (rapid weight loss, diarrhea, unkempt hair, hunched posture, lethargy, labored breathing, neurological signs, etc.). Mice were provided with food and water ad libitum. Necropsy was performed at the end of the experiment. Whole blood, serum, and organ tissues were collected for further analysis.

[0136] In vivo activity of FolamiR in xenograft models of breast cancer A single dose (5 nmol) of each NIR-Fol-tagged miRNA (NIR-FolamiR) was administered by tail vein injection to animals bearing palpable MB-231 sensor cell xenografts. Fluorescence distribution and luciferase activity were measured to monitor tumor cell targeting specificity and as a surrogate for uptake and inhibition of intracellular targets, respectively. 24 hours after injection, NIR-FolamiR was mainly retained in tumor tissue and, importantly, was cleared from other parts of the organism, including the liver (Fig. 7C, Lv) (Fig. 7A, left - NIR). However, only non-releasable NIR-FolamiR-34a induced Renilla knockdown in vivo (Fig. 7A, right luciferase, quantified in Fig. 7B). Importantly, after only one injection, Renilla levels were reduced by approximately 50% after NIR-FolamiR-34a treatment, which was even greater than the reduction in sensor activity observed in cultured cells (Fig. 6A, C, E). NIR-FolamiR-34a-treated tumors contained approximately 3.5 × 10 β-lactams per nanogram of total RNA. 6 copies of miR-34a were present ( Fig. 7D ). In contrast, the copy number of miR-34a in tumors from mice treated with NIR-FolamiR-SS-34a was similar to that of negative control animals, suggesting that the releasable folate conjugate may be degraded or rapidly depleted in the circulation. To examine this possibility, FolamiR conjugates were exposed to 50% serum. FolamiR-SS-34a was highly unstable in the presence of serum, whereas FolamiR-34a remained intact for more than 6 hours. FolamiR-34a appears to be more stable than unconjugated miR-34a, suggesting that folate protects miRNAs from serum nucleases. To determine whether FolamiR specifically binds to FR in vivo, 5 nmol of NIR-FolamiR-34a was intravenously injected into nude mice implanted with FR-positive human MDA-MB-231 sensor cells in the right shoulder and FR-negative human A549 cells in the left shoulder in the presence or absence of a 100-fold molar excess of folate-glucosamine. Results show that FR-positive MDA-MB-231 tumors accumulate FolamiR conjugates, whereas FR-negative A549 tumors do not (Figure 7E,F), and this FR-dependent accumulation can be blocked by excess folate-glucosamine (Figure 7E,F). Next, a multiple-dose study was performed to evaluate the efficacy of FolamiR-34a. MB-231 xenograft animals were treated with reduced doses of FolamiR-NC or FolamiR-34a (0.1 nmol, 0.5 nmol, and 1 nmol) every 3 days for a total of 7 doses. During the 20-day treatment period, tumors in animals treated with the control folate-conjugate grew approximately 3.5-fold, while tumor size in animals treated with FolamiR-34a grew more slowly (approximately 1.5-fold) (Figure 7G and Figure 12). Even at doses as low as 0.1 nmol, the inhibition of tumor growth was significant. The copy number of miR-34a in the excised tumor tissue was approximately 1.5-fold higher than tumors excised from mice treated with the control (Figure 13A). Importantly, animals treated with FolamiR-34a showed no signs of whole organ toxicity or elevation of serum cytokines IL-6 or TNF-α (Figure 14A). These results were supported by a maximum tolerated dose (MTD) study performed in immunocompetent mice, where mice administered FolamiR-34a showed no pathological signs of toxicity or significant body weight changes up to the highest dose tested, 33.3 nmol (Figure 14B), indicating an MTD > 33.3 nmol.

[0137] Induction of tumor formation in Kras;p53 mice Kras LSL-G12D / + Induction of tumor formation in Trp53 flx / fl (FVB.129 background) double mutant mice (6-10 weeks old) were used and were performed based on the method of DuPage, et al. (DuPage M, Dooley AL, Jacks T. Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase. Nat. Protoc. 2009; 4: 064-1072). Briefly, lung-specific transgene activation was achieved by injecting adenoviral particles (10 6 Tumors were allowed to preform for 8 weeks prior to the experiment.

[0138] Monitoring Tumor Progression with Magnetic Resonance Imaging (MRI) MRI scans of induced and uninduced animals (scans of normal tissues) were obtained at the Purdue MRI facility using a 7.0 Tesla Bruker Biospec 70 / 30 USR scanner (Billerica, MA) and a 40 mm mouse volume coil. Animals were anesthetized with 2.5% v / v isoflurane in O2 for 5 min, then transferred to a heated animal bed and anesthesia set to 2%. Respiratory rate was monitored with a pressure sensor. Low-resolution multiplane scout scans were performed with the following parameters: TR=4s, TE=1.5ms, FOV=30×30mm. 2 , slice thickness = 1 mm, data matrix = 256 × 256, 7 slices / plane (axial, coronal and sagittal), approximate time of scanning per mouse = 1 min. A scout scan was used to align the mouse spine and collect high-resolution images of the lungs using the following parameters: TR = 4 s, TE = 1.5 ms, FOV = 30 × 30 mm 2 , slice thickness = 0.5 mm, data matrix = 256 x 256, 30 slices / plane (axial and coronal), approximate scan time per mouse = 5 min. Tumor burden quantification was performed following the manual segmentation protocol described by Krupnick et al. ("Quantitative monitoring of mouse lung tumors by magnetic resonance imaging," Nat. Protoc., 2012, 7, 128-142). This analysis of tumor burden by MRI takes advantage of the large difference in MR image intensity between tumor tissue (bright) and normal lung tissue (dark), using the mean lung image intensity as a surrogate for tumor burden. Briefly, lung MR images were manually segmented using ImageJ 2.0.0, and the mean lung image intensity normalized to that of the liver within the same animal was calculated. To determine tumor progression within an animal, the mean lung image intensity was normalized to the first day ± s.d. Furthermore, tumor and total lung volumes per animal were calculated using a three-dimensional reconstruction method using ITK-Snap and Paraview 5.2 software (Kitware, NY, USA). Tumor / total lung ratios were calculated at the indicated times to indicate the percentage of lung volume occupied by tumor.

[0139] Folate uptake study in Kras;p53 mice For folate uptake studies, 5 nmol of OTL38 (a fluorescent imaging conjugate consisting of folic acid bound to a fluorescent near-infrared (NIR) dye provided by On Target Laboratories, LLC, West Lafayette, IN, currently undergoing clinical trials (Clinical Trial ID: NCT02769533)) was systematically delivered via the tail vein to healthy and tumor-bearing mice (n=3; 8 weeks after transgene activation). 24 hours after injection, animals were killed and perfused with saline. Whole-organ images were acquired using the 800 nm channel of a Licor Odyssey CLX (Licor). Lungs were fixed in 10% buffered formalin and paraffin embedded according to standard procedures. Sections were stained with hematoxylin and eosin (H&E) and evaluated using an Olympus IX73 microscope equipped with a 1.25x objective and an Olympus DP80 camera and CellSens 1.11. Tumor burden was calculated using ImageJ 2.0.0 and expressed as tumor area relative to the total lung area obtained from three independent sections for each animal. Unstained sections were mounted and evaluated in the 800 nm channel of a Licor Odyssey CLX (Licor) using a Nikon TiS microscope equipped with a 20x objective, ICG bandpass filters (Ex:780-800; Ex:810-860; Semrock, Brightline), a xenon / mercury light source (Nikon, Japan), a Photometrics QuantEM EMCCD camera, and NIS-Elements (Nikon, Japan). Because this model has not yet been validated for FR expression, we first assessed lung adenocarcinoma in this model for folate receptor expression, as well as tumor-specific uptake and retention of folate conjugates.The fluorescent imaging ligand OTL38, a ligand that targets folate receptor-α (FRα) conjugated to a near-infrared fluorescent (NIR) dye, was administered intravenously to lung tumor-bearing or healthy mice. As observed at the whole organ level (Figure 8A) and at the histological level (Figure 8B), the folate conjugate was preferentially retained in lung tumors and excluded from normal healthy tissues. Higher magnification images show that the near-infrared signal is not due to cell density differences between healthy and malignant tissues; clear punctate signaling is observed in tumors after OTL38 administration (see inset in Figure 8B), as previously observed due to receptor-mediated endocytosis of OTL-38. To confirm whether OTL38 retention in lung adenocarcinoma is mediated by its interaction with FR, an in vivo blocking assay was performed. OTL38 (5 nmol) was intravenously injected in the presence or absence of a 100-fold molar excess of folate-glucosamine in lung tumor-bearing mice. The preferential retention of OTL38 in lung tumors was reduced by excess folate-glucosamine (Figure 8C,D), suggesting that OTL-38 accumulation in tumors is FR-dependent. These data confirm that KrasLSL-G12D / +;Trp53flx / flx tumors specifically uptake and retain OTL-38, suggesting that FolamiR-34a similarly accumulates in tumor tissue.

[0140] FolamiR treatment in Kras;p53 mice For the multiple-dose experiment with FolamiR-34a, tumor-bearing animals (8 weeks old) were randomized into experimental groups by minimizing the difference in their MRI-measured tumor burden. Animals were treated with 1 nmol of FolamiR by intravenous injection every 3 days (total of 10 injections) and tumor progression was monitored weekly for 4 weeks using a 7.0 Tesla Bruker Biospec 70 / 30 USR scanner (Billerica, MA) as described above. 24 hours after the last injection, animals were sacrificed and perfused with saline. Lungs were removed, fixed in 10% buffered formalin, and embedded in paraffin according to standard procedures. Sections were stained with hematoxylin and eosin (H&E) and evaluated as previously described. Mice were maintained on a folate-deficient diet (Envigo, TD 95247) throughout the course of the experiment, starting 6 weeks after tumor induction. All experimental protocols were approved by the Purdue Animal Care and Use Committee and conformed to the NIH guidelines for animal use.

[0141] In vivo blocking of FR Female Nu / Nu (NU-Foxn1nu; Charles River) congenic mice (6 weeks old, n = 3) were injected with 5 × 10 6FR-positive human MDA-MB-231 sensor cells (right) and FR-negative human A549 cells (left) were injected to induce subcutaneous tumors. Tumors were allowed to form, and mice bearing similarly sized A549 and MDA-MB-231 tumors were included in the experiments. For the Kras;p53 mouse model, tumors were allowed to form for 8 weeks after transgene activation (n=3). Tumor formation was monitored using MRI. Competition studies were performed by co-administration via the tail vein of 5 nmol FolamiR-34a-NIR for the xenograft model and 5 nmol OTL38 for the Kras;p53 mouse model in the presence or absence of 5 nmol (≧100-fold molar excess) of folate glucosamine conjugate (n=3). The folate glucosamine conjugate was used to prevent precipitation in the kidney due to its higher solubility at low pH compared to folic acid. In vivo whole animal imaging and ex vivo tissue distribution experiments were performed as described above.

[0142] RNA isolation and miRNA expression analysis using quantitative PCR (qPCR) MDA-MB-231-derived tumors and Kras LSL-G12D / + ;Trp53 flx / flx Lung tumors from mice were harvested into RNA Later (Life Technologies) and stored at -80 °C. Tumor tissue (50 mg) was placed in a 2 mL collection tube containing 700 μL of QIAzol lysis reagent (Qiagen) and 1.4 mm ceramic beads. Samples were milled for 4 m s using a bead mill (Fisher Scientific). -1The cells were ground at 37 °C for 3 min. Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. Then, 1 μg of total RNA was used to generate cDNA using the miScript II RT Kit (Qiagen) and miScript HiFlex Buffer. For the generation of miR-34a standard, miR-34a mimic (Life Technologies) was used for cDNA synthesis. qRT-PCR was performed using miRNA primer assays (Qiagen). Reactions were performed using a QuantStudio 6 Flex real-time PCR machine (Life Technologies) using the miScript SYBR Green PCR Kit (Qiagen) under the following cycling steps: 95 °C for 15 min; 40 cycles of 95 °C for 15 s, 55 °C for 30 s, and 70 °C for 30 s; melting curve from 95 °C to 60 °C at 1.6 °C / s. Technical repeats (at least three times) were performed for each biological replicate. 1 × 10 8 Copy 1×10 3 miR-34a copy numbers were determined using a copy-covering standard curve.

[0143] statistics For two-group analyses, differences between groups were examined using two-tailed Student's t-test. For multiple group comparisons, two-way or one-way analysis of variance (ANOVA) with post-hoc Bonferroni tests was used using the Prism statistical package (version 7, GraphPad Software). Error bars represent either mean ± sd or mean ± sem, as indicated in the figure legends. Statistically significant P values ​​are indicated in the figures and / or legends. *** , P < 0.005; ** , P < 0.01; * , P<0.05. To investigate whether KrasLSL-G12D / +;Trp53flx / flx tumors are responsive to FolamiR-34a, tumor-bearing animals were administered 1 nmole of FolamiR-34a every 3 days for a total of 10 doses. Tumor growth was monitored by MRI throughout the experimental period, and volume measurements made from MRI data show that FolamiR-34a reduces tumor growth compared to animals administered the control folate-conjugate (Figure 9A,B,C). Tumor size was not statistically altered in animals administered FolamiR-34a, whereas tumor size in mice treated with FolamiR-NC increased 1.5-fold compared to the first day of administration. A similar response was observed at the histological level at the end of the study (Figure 9D,E). Quantification of tumor burden showed statistical significance, with a 1.8-fold reduction in tumor volume in lungs harvested from mice treated with FolamiR-34a compared to mice treated with FolamiR-NC. Similar to the increase in miR-34a copy number observed in MD-MBA-231 xenografts, the copy number of miR-34a in resected lung tumor tissues was approximately 3-fold higher than that in tumors extracted from control-treated mice (Figure 13B). To verify that miR-34a acts to suppress the transcriptional levels of endogenous target genes of miR-34a targets, BCL-2, MET, and MYC were quantified. Both BCL-2 and MYC were statistically downregulated in tumors from FolamiR-34a-treated mice, confirming miR-34a activity against endogenous target genes (Figure 9G).

Claims

1. The group consisting of 【Chemistry 1】 【Chemistry 2】 【Chemistry 3】 or 【Chemistry 4】 or a pharma- ceutically acceptable salt thereof.

2. 10. A pharmaceutical composition comprising at least one conjugate according to claim 1 or a pharma- ceutically acceptable salt thereof and at least one pharma- ceutically acceptable carrier or excipient.

3. A group consisting of the following: 【Chemistry 5】 or 【Chemistry 6】 or a pharma- ceutically acceptable salt thereof.

4. A pharmaceutical composition comprising at least one conjugate according to claim 3 or a pharma- ceutically acceptable salt thereof and at least one pharma- ceutically acceptable carrier or excipient.

Images