O-Methyl-rich fully stabilized oligonucleotides

Abstract

Novel oligonucleotides are provided that are fully chemically stabilized. Methods of using the fully chemically stabilized oligonucleotides are also provided.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62 / 721,993, filed Aug. 23, 2018, which is incorporated herein by reference in its entirety.

[0002] STATEMENT REGARDING FEDERALLY FUNDED RESEARCH This invention was made with Government support under Grant Nos. NS104022, HD086111 and OD020012 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] The present disclosure relates to novel oligonucleotides useful for RNA silencing, such as RNA interference (RNAi), that are composed entirely of chemically modified nucleotides. The chemically modified nucleotides and linkers are patterned to achieve unexpectedly high efficacy, absorption and tissue distribution. [Background technology]

[0004] It is known that oligonucleotides containing chemically modified ribonucleotides (e.g., 2'-fluoro and 2'-methoxy modifications) and / or chemically modified linkers (e.g., phosphorothioate modifications) exhibit increased nuclease resistance compared to the corresponding unmodified oligonucleotides while maintaining the ability to promote RNAi. See, for example, Fosnaugh, et al. (US Patent Publication No. 2003 / 0143732). Oligonucleotides containing alternating chemically modified nucleotides are known. See, for example, Bhat et al. (US Patent Publication No. 2008 / 0119427). Hydrophobic modifications of therapeutic RNAs (e.g., siRNAs) are known. See, for example, Khvorova, et al. (International Application PCT / US Patent Publication No. 2009 / 005247). Summary of the Invention [Problem to be solved by the invention]

[0005] There is a need for self-delivered oligonucleotides that are characterized by efficient RNA-induced silencing complex (RISC) entry, minimal immune response and off-target effects, efficient cellular uptake without formulation, and efficient and specific tissue distribution. [Means for solving the problem]

[0006] The present invention is based on the discovery of chemically modified oligonucleotides that can serve as a new class of oligonucleotide therapeutics.Surprisingly, it has been discovered that nearly completely 2'-O-methyl modified asymmetric siRNAs, with non-2'-O-methyl modifications (such as 2'-fluoro, 2'-H or 2'-OH moieties) at positions 2 and 14 from the 5' end of the antisense strand, provide unexpectedly improved efficacy properties.This modification pattern can be used to increase the efficacy of various oligonucleotide therapeutics, including but not limited to asymmetric siRNAs, symmetric siRNAs, antisense oligonucleotides (ASOs), microRNAs (miRNAs), miRNA inhibitors, splice switching, phosphorodiamidate morpholino oligomers (PMOs) and peptide nucleic acids (PNAs).

[0007] Thus, in one aspect, the present invention provides an oligonucleotide comprising at least 14 contiguous nucleotides, a 5' end and a 3' end; and at least 85% 2'-O-methyl nucleotide modifications, wherein nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide comprise non-2'-O-methyl modifications.

[0008] In certain embodiments, the oligonucleotide comprises an antisense oligonucleotide (ASO).

[0009] In certain embodiments, the oligonucleotide comprises perfect or less than perfect complementarity to the target.

[0010] In certain embodiments, the target comprises a mammalian or viral mRNA.

[0011] In certain embodiments, the nucleotide at position 20 from the 5' end of the oligonucleotide comprises a non-2'-O-methyl modification.

[0012] In certain embodiments, one or more of the nucleotides at positions 1-7 from the 3' end of the oligonucleotide are linked to an adjacent nucleotide via a phosphorothioate bond.

[0013] In certain embodiments, nucleotides at positions 1-6 from the 3' end or positions 1-7 from the 3' end of the oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds.

[0014] In certain embodiments, the nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide comprise a 2'-F or 2'-H modification or a 2'-OH moiety.

[0015] In certain embodiments, the nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide contain a 2'-F modification.

[0016] In certain embodiments, the nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide comprise a 2'-H modification.

[0017] In certain embodiments, the nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide comprise a 2'-OH moiety.

[0018] In certain embodiments, the oligonucleotide comprises at least 90% 2'-O-methyl modified nucleotides.

[0019] In certain embodiments, the oligonucleotide further comprises a complementary second oligonucleotide comprising at least 13 contiguous nucleotides and a 5' end and a 3' end.

[0020] In certain embodiments, the second oligonucleotide comprises at least 80% 2'-O-methyl modified nucleotides. In certain embodiments, the second oligonucleotide comprises at least 90% 2'-O-methyl modified nucleotides. In certain embodiments, the second oligonucleotide comprises 100% 2'-O-methyl modified nucleotides.

[0021] In certain embodiments, one or more of the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide comprise a non-2'-O-methyl modification.

[0022] In certain embodiments, one or more of the nucleotides at positions 7, 10, and 11 from the 3' end of the second oligonucleotide comprise a non-2'-O-methyl modification.

[0023] In certain embodiments, the nucleotides at positions 7, 10, and 11 from the 3' end of the second oligonucleotide comprise non-2'-O-methyl modifications.

[0024] In certain embodiments, the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds.

[0025] In certain embodiments, the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide and the nucleotides at positions 1 and 2 from the 5' end of the second oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds.

[0026] In certain embodiments, the second oligonucleotide comprises a hydrophobic molecule at the 3' end of the second oligonucleotide.

[0027] In certain embodiments, the oligonucleotide comprises 15-22 contiguous nucleotides. In certain embodiments, the oligonucleotide comprises 20 contiguous nucleotides. In certain embodiments, the oligonucleotide comprises 22 contiguous nucleotides.

[0028] In certain embodiments, the second oligonucleotide comprises 15-20 contiguous nucleotides. In certain embodiments, the second oligonucleotide comprises 15 contiguous nucleotides. In certain embodiments, the second oligonucleotide comprises 18 contiguous nucleotides. In certain embodiments, the second oligonucleotide comprises 20 contiguous nucleotides.

[0029] In certain embodiments, the second oligonucleotide comprises one or more nucleotide mismatches between the first and second oligonucleotides. In certain embodiments, the one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the second oligonucleotide. In certain embodiments, the nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the second oligonucleotide.

[0030] In one aspect, the invention provides oligonucleotide pharmaceutical compositions comprising one or more oligonucleotides as described above and a pharma- ceutically acceptable carrier.

[0031] In one aspect, the present invention provides a method of treating or managing a disease or disorder comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition above.

[0032] In one aspect, the invention provides a double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein the antisense strand comprises at least 14 contiguous nucleotides, a 5' end and a 3' end; the sense strand comprises at least 13 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to the antisense strand; the antisense strand comprises at least 85% 2'-O-methyl modifications; and nucleotides at positions 2 and 14 from the 5' end of the antisense strand comprise non-2'-O-methyl modifications.

[0033] In certain embodiments, the antisense strand comprises perfect or less than perfect complementarity to the target.

[0034] In certain embodiments, the target comprises a mammalian or viral mRNA.

[0035] In certain embodiments, the nucleotide at position 20 from the 5' end of the antisense strand comprises a non-2'-O-methyl modification.

[0036] In certain embodiments, one or more of the nucleotides at positions 1-7 from the 3' end of the antisense strand are linked to an adjacent nucleotide via a phosphorothioate bond.

[0037] In certain embodiments, nucleotides at positions 1-6 from the 3' end or positions 1-7 from the 3' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds.

[0038] In certain embodiments, nucleotides at positions 2 and 14 from the 5' end of the antisense strand contain a 2'-F or 2'-H modification or a 2'-OH moiety.

[0039] In certain embodiments, the nucleotides at positions 2 and 14 from the 5' end of the antisense strand comprise a 2'-F modification. In certain embodiments, the nucleotides at positions 2 and 14 from the 5' end of the antisense strand comprise a 2'-H modification. In certain embodiments, the nucleotides at positions 2 and 14 from the 5' end of the antisense strand comprise a 2'-OH moiety.

[0040] In certain embodiments, the antisense strand comprises at least 90% 2'-O-methyl modified nucleotides.

[0041] In certain embodiments, the sense strand comprises at least 80% 2'-O-methyl modified nucleotides. In certain embodiments, the sense strand comprises at least 90% 2'-O-methyl modified nucleotides. In certain embodiments, the sense strand comprises 100% 2'-O-methyl modified nucleotides.

[0042] In certain embodiments, one or more of nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand comprise a non-2'-O-methyl modification or moiety. In certain embodiments, nucleotides at positions 7, 10, and 11 from the 3' end of the sense strand comprise a non-2'-O-methyl modification or moiety. In certain embodiments, nucleotides at positions 7, 10, and 11 from the 3' end of the sense strand comprise a non-2'-O-methyl modification.

[0043] In certain embodiments, the nucleotides at positions 1 and 2 from the 3' end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the nucleotides at positions 1 and 2 from the 3' end of the sense strand and the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the sense strand comprises a hydrophobic molecule at the 3' end of the sense strand.

[0044] In certain embodiments, the antisense strand comprises 15-22 contiguous nucleotides. In certain embodiments, the antisense strand comprises 20 contiguous nucleotides. In certain embodiments, the antisense strand comprises 22 contiguous nucleotides.

[0045] In certain embodiments, the sense strand comprises 15-20 contiguous nucleotides. In certain embodiments, the sense strand comprises 15 contiguous nucleotides. In certain embodiments, the sense strand comprises 18 contiguous nucleotides. In certain embodiments, the sense strand comprises 20 contiguous nucleotides.

[0046] In certain embodiments, the sense strand comprises one or more nucleotide mismatches between the antisense strand and the sense strand. In certain embodiments, the one or more nucleotide mismatches are at positions 2, 6, and 12 from the 5' end of the sense strand. In certain embodiments, the nucleotide mismatches are at positions 2, 6, and 12 from the 5' end of the sense strand. In certain embodiments, the antisense strand comprises a 5' phosphate, a 5'-alkyl phosphonate, or a 5' alkylene phosphonate. In certain embodiments, the antisense strand comprises a 5' vinyl phosphonate.

[0047] In certain embodiments, the double-stranded nucleic acid contains 4 to 16 phosphorothioate bonds. In certain embodiments, the double-stranded nucleic acid contains 8 to 13 phosphorothioate bonds.

[0048] In certain embodiments, the double-stranded nucleic acid comprises a double-stranded region of 15 to 20 base pairs. In certain embodiments, the double-stranded nucleic acid comprises a double-stranded region of 15 base pairs. In certain embodiments, the double-stranded nucleic acid comprises a double-stranded region of 18 base pairs. In certain embodiments, the double-stranded nucleic acid comprises a double-stranded region of 20 base pairs.

[0049] In another aspect, the invention provides a double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein the antisense strand comprises at least 14 contiguous nucleotides and a 5'-end and a 3'-end; the sense strand comprises at least 13 contiguous nucleotides, a 5'-end and a 3'-end and has complementarity to the antisense strand; the antisense strand comprises at least 85% 2'-O-methyl modifications; nucleotides at positions 2 and 14 from the 5'-end of the first oligonucleotide are modified with 2'-F; the sense strand comprises 100% 2'-O-methyl modifications; and nucleotides at positions 1-6 from the 3'-end or positions 1-7 from the 3'-end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds.

[0050] In another aspect, the present invention provides pharmaceutical compositions comprising one or more chemically modified double-stranded nucleic acids as described above and a pharma- ceutically acceptable carrier.

[0051] In another aspect, the present invention provides a method of treating or managing a disease or disorder comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the above pharmaceutical composition.

[0052] In another aspect, the present invention provides a branched oligonucleotide compound capable of mediating RNA silencing in a cell, comprising two or more double-stranded nucleic acids, wherein the nucleic acids (N) are linked to each other by one or more moieties selected from a linker (L), a spacer (S) and optionally a branch point (B), each double-stranded nucleic acid comprising an antisense strand and a sense strand, each antisense strand comprising at least 14 contiguous nucleotides, a 5'-terminus and a 3'-terminus, and at least one antisense strand comprises at least 85% 2'-O-methyl modification; nucleotides at positions 2 and 14 from the 5'-terminus of at least one antisense strand comprise non-2'-O-methyl modification; and one or more nucleotides at positions 1-7 from the 3'-terminus of at least one antisense strand are linked to adjacent nucleotides via phosphorothioate bonds.

[0053] In certain embodiments, each antisense strand contains at least 85% 2'-O-methyl modifications; nucleotides at positions 2 and 14 from the 5' end of each antisense strand contain non-2'-O-methyl modifications; and / or one or more nucleotides at positions 1-7 from the 3' end of each antisense strand are linked to adjacent nucleotides via phosphorothioate linkages.

[0054] In certain embodiments, nucleotides at positions 1 and 2 from the 5' end of the sense and antisense strands are linked to adjacent nucleotides via phosphorothioate linkages.

[0055] In certain embodiments, each double-stranded nucleic acid is independently linked to a linker, spacer, or branch point at the 3' or 5' end of the sense or antisense strand.

[0056] In certain embodiments, the compound further comprises a hydrophobic moiety attached at the 5' position of the terminus of the branched oligonucleotide compound.

[0057] In certain embodiments, the hydrophobic moiety comprises an alkyl, alkenyl, or aryl moiety; a vitamin or cholesterol derivative; a lipophilic amino acid; or a combination thereof.

[0058] In certain embodiments, each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; any carbon or oxygen atom of the linker is optionally substituted with a nitrogen atom, has a hydroxyl substituent, or has an oxo substituent.

[0059] In certain embodiments, the nucleotide at position 20 from the 5' end of the antisense strand comprises a non-2'-O-methyl modification.

[0060] In certain embodiments, nucleotides at positions 7, 10, and 11 from the 3' end of the sense strand comprise non-2'-O-methyl modifications or moieties.

[0061] In certain embodiments, the non-2'-O-methyl modification comprises a 2'-F modification or a 2'-H modification or a 2'-OH moiety. In certain embodiments, the non-2'-O-methyl modification comprises a 2'-F modification. In certain embodiments, the non-2'-O-methyl modification comprises a 2'-H modification. In certain embodiments, the non-2'-O-methyl modification comprises a 2'-OH moiety.

[0062] In certain embodiments, the antisense strand comprises at least 90% 2'-O-methyl modified nucleotides.

[0063] In certain embodiments, the sense strand comprises at least 80% 2'-O-methyl modified nucleotides. In certain embodiments, the sense strand comprises at least 90% 2'-O-methyl modified nucleotides. In certain embodiments, the sense strand comprises 100% 2'-O-methyl modified nucleotides. In certain embodiments, the antisense strand comprises 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides. In certain embodiments, the sense strand comprises 15, 16, 17, 18, 19, or 20 consecutive nucleotides.

[0064] The foregoing and other features and advantages of the present invention will become more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0065] [Figure 1]FIG. 1 shows a schematic of a fully chemically stabilized siRNA pattern (Pattern 1) containing two 2'-fluoro modifications at positions 2 and 14 of the guide (antisense) strand (top), according to certain exemplary embodiments. It also shows a 2'-fluoro-free configuration in which positions 2 and 14 are modified with ribose (middle) and DNA (bottom). FIG. 1 shows schematics of Patterns 1A to 1F, each lacking a 2'-OMe modification at positions 2 and 14 of the guide (antisense) strand. Patterns 1B, 1D, and 1F also lack a 2'-OMe modification at the 3'-terminal nucleotide of the guide strand. Patterns 1A and 1B show siRNAs with a 20 nucleotide guide strand and a 15 nucleotide passenger (sense) strand. Patterns 1C and 1D show siRNAs with a 20 nucleotide guide strand and an 18 nucleotide passenger (sense) strand. Patterns 1E and 1F show siRNAs with a 22 nucleotide guide strand and a 20 nucleotide passenger (sense) strand. [Diagram 2] FIG. 2 depicts sugar modifications according to certain exemplary embodiments. [Diagram 3] FIG. 3 illustrates an oligonucleotide backbone linkage according to certain exemplary embodiments. [Figure 4-1] Figures 4A-4C show increasing efficacy of sFLT1i13 mRNA silencing with increasing 2'-O' methyl content. Figure 4A shows HeLa cells and Figure 4B shows melanoma cells treated with O-methyl-rich siRNA and control siRNA at the indicated concentrations for 72 hours. Figure 4C shows schematics of F2, 14 siRNA (circles), F2, 4, 5, 6, 8, 14 siRNA (squares) and control siRNA (triangles). mRNA was measured using Promega Dual-Glo® Luciferase (Figure 4A) or Affymetrix Quantigene 2.0 (Figure 4B) assay systems. Data were normalized to the control reporter (Figure 4A), housekeeping gene (HPRT) (Figure 4B) and graphed as % of untreated control. [Figure 4-2]Figures 4A-4C show increasing efficacy of sFLT1i13 mRNA silencing with increasing 2'-O' methyl content. Figure 4A shows HeLa cells and Figure 4B shows melanoma cells treated with O-methyl-rich siRNA and control siRNA at the indicated concentrations for 72 hours. Figure 4C shows schematics of F2, 14 siRNA (circles), F2, 4, 5, 6, 8, 14 siRNA (squares) and control siRNA (triangles). mRNA was measured using Promega Dual-Glo® Luciferase (Figure 4A) or Affymetrix Quantigene 2.0 (Figure 4B) assay systems. Data were normalized to the control reporter (Figure 4A), housekeeping gene (HPRT) (Figure 4B) and graphed as % of untreated control. [Diagram 5] Figures 5A-5B show increasing efficacy of sFLTe15a mRNA silencing with increasing 2'-O' methyl content. Figure 5A shows HeLa cells and Figure 5B shows melanoma cells treated with O-methyl-rich siRNA and control siRNA at the concentrations shown for 72 hours. mRNA was measured using Promega Dual-Glo® Luciferase (Figure 5A) or Affymetrix Quantigene 2.0 (Figure 5B) assay systems. Data were normalized to the control reporter (Figure 5A), housekeeping gene (HPRT) (Figure 5B), and graphed as % of untreated control. [Figure 6]6A-6C show that O-methyl-rich DCA compounds and PC DCA compounds show increased or similar AS accumulation in liver (A), kidney (B) and placenta (C) compared to P2 cholesterol, despite half the dosing. CD1 pregnant mice were treated with O-methyl-rich siRNA and P2 siRNA at the indicated concentrations and tissues were collected at the indicated time points. siRNA guide strands were measured in tissues using peptide nucleic acid (PNA) hybridization assay. sFLT1-2283 O-methyl-rich: 20 mg / kg*, 120 h dose; sFLT1-2519 O-methyl-rich: 20 mg / kg*, 120 h dose. sFLT1-2283 P2: 20 mg / kg**, 120 h dose. *40mg / kg was the total dose of sFLT1-X siRNA (20mg / kg sFLT1-2283 + 20mg / kg sFLT1-2519a on E14). **20mg / kg was the total dose of sFLT1-2283 siRNA (10mg / kg sFLT1-2283 on E14 + 10mg / kg sFLT1-2283 on E15). [Figure 7] Figure 7 shows that O-methyl-rich DCA compounds and PC DCA compounds showed increased or similar AS accumulation in placenta compared to P2 Chol. CD1 pregnant mice were treated with O-methyl-rich siRNA and P2 siRNA at the indicated concentrations and tissues were collected at the indicated time points. siRNA guide strands were measured in tissues using peptide nucleic acid (PNA) hybridization assay. sFLT1-2283 O-methyl-rich: 20mg / kg*, 120h dose; sFLT1-2519 O-methyl-rich: 20mg / kg*, 120h dose; sFLT1-2283 P2: 10mg / kg**, 120h dose; sFLT1-2519 P2: 10mg / kg**, 120h dose. *40mg / kg was the total dose of sFLT1-X siRNA (20mg / kg sFLT1-2283 + 20mg / kg sFLT1-2519a in E14). **20mg / kg was the total dose of sFLT1-X siRNA (10mg / kg sFLT1-2283 + 10mg / kg sFLT1-2519). [Figure 8] 8A-8C show O-methyl-rich compounds showing increased AS accumulation in liver and placenta compared to PPIB P2, despite the extended time to collection. CD1 pregnant mice were treated with O-methyl-rich sFLT1 siRNA and P2 PPIB siRNA at the concentrations shown and tissues were collected at the indicated time points. siRNA guide strands were measured in tissues using a peptide nucleic acid (PNA) hybridization assay. PPIB P2: 20 mg / kg, 48 hour dose; sFLT1-X O-methyl-rich: 20 mg / kg*, 120 hour dose. *40 mg / kg was the total dose of sFLT1-X siRNA (20 mg / kg sFLT1-2283 + 20 mg / kg sFLT1-2519 at E14). [Figure 9A] Figures 9A-9B show the in vitro efficacy of sFLT1i13 mRNA silencing by Pattern 1A. Figure 9A shows HeLa cells, and Figure 9B shows WM-115 cells treated with Pattern 1A and control siRNA at the concentrations shown for 72 hours. mRNA was measured using the Promega Dual-Glo® Luciferase Assay System (Figure 9A) or the Affymetrix Quantigene 2.0 Assay System (Figure 9B). Data was normalized to a control reporter (fLuc) (Figure 9A) or a housekeeping gene (HPRT) (Figure 9B) and graphed as % of untreated control. [Figure 9B] Figures 9A-9B show the in vitro efficacy of sFLT1i13 mRNA silencing by Pattern 1A. Figure 9A shows HeLa cells, and Figure 9B shows WM-115 cells treated with Pattern 1A and control siRNA at the concentrations shown for 72 hours. mRNA was measured using the Promega Dual-Glo® Luciferase Assay System (Figure 9A) or the Affymetrix Quantigene 2.0 Assay System (Figure 9B). Data was normalized to a control reporter (fLuc) (Figure 9A) or a housekeeping gene (HPRT) (Figure 9B) and graphed as % of untreated control. [Figure 10A] Figures 10A-10B show the in vitro efficacy of sFLTe15a mRNA silencing by Pattern 1A. Figure 10A shows HeLa cells, and Figure 10B shows WM-115 cells treated with Pattern 1A and control siRNA at the concentrations shown for 72 hours. mRNA was measured using the Promega Dual-Glo® Luciferase Assay System (Figure 10A) or the Affymetrix Quantigene 2.0 Assay System (Figure 10B). Data were normalized to a control reporter (fLuc) (Figure 10A) or a housekeeping gene (HPRT) (Figure 10B) and graphed as % of untreated control. [Figure 10B] Figures 10A-10B show the in vitro efficacy of sFLTe15a mRNA silencing by Pattern 1A. Figure 10A shows HeLa cells, and Figure 10B shows WM-115 cells treated with Pattern 1A and control siRNA at the concentrations shown for 72 hours. mRNA was measured using the Promega Dual-Glo® Luciferase Assay System (Figure 10A) or the Affymetrix Quantigene 2.0 Assay System (Figure 10B). Data were normalized to a control reporter (fLuc) (Figure 10A) or a housekeeping gene (HPRT) (Figure 10B) and graphed as % of untreated control. [Figure 11A] Figure 11A shows that Pattern 1A DCA compounds and PC DCA compounds show increased guide strand accumulation in liver, kidney and placenta, despite half the dosing, compared to the control pattern with cholesterol conjugate. Schematic diagram of Pattern 1A and control is shown. [Figure 11B]FIG. 11B shows that Pattern 1A DCA compounds and PC DCA compounds show increased guide strand accumulation in liver, kidney and placenta, despite half the dosing, compared to the control pattern with cholesterol conjugate. Shows increased guide strand accumulation in liver, kidney and placenta compared to control. CD1 pregnant mice were treated with Pattern 1A or control siRNA at the concentrations shown, and tissues were collected at the time points shown. siRNA guide strand was measured in tissues using peptide nucleic acid (PNA) hybridization assay. sFLT1-2283 O-methyl rich: 20mg / kg*, 120 hour dose; sFLT1-2283 control: 20mg / kg**, 120 hour dose. *40mg / kg was the total dose of sFLT1-X siRNA (20mg / kg sFLT1-2283+20mg / kg sFLT1-2519a in E14). **20mg / kg was the total dose of sFLT1-2283 siRNA (10mg / kg sFLT1-2283 on E14 + 10mg / kg sFLT1-2283 on E15). [Figure 11C] Figure 11C shows that Pattern 1A DCA compounds and PC DCA compounds show increased guide strand accumulation in liver, kidney and placenta, despite half the dosing, compared to the control pattern with cholesterol conjugate. Increased guide strand accumulation in placenta compared to control. Conditions are the same as Figure 11B, except sFLT1-2283 control was dosed at 10 mg / kg** (120 hour dose). [Figure 11D] Figure 11D shows that Pattern 1A DCA compounds and PC DCA compounds show increased guide strand accumulation in liver, kidney and placenta, despite half the dosing, compared to the control pattern with cholesterol conjugate. Increased guide strand accumulation in liver and similar guide strand accumulation in placenta compared to the control. Conditions are the same as Figure 11B, except that HTT-10150 DCA and PC-DCA control were used (20 mg / kg**, 48 hour dose). [Figure 12A]Figure 12A shows that Pattern 1B PC DCA siRNA shows increased guide strand accumulation in the placenta, despite half the dosing, compared to control patterns with cholesterol or PC DCA conjugates. Schematic diagrams of Pattern 1B and controls are shown. [Figure 12B] FIG. 12B shows that Pattern 1B PC DCA siRNA shows increased guide strand accumulation in the placenta, despite half the dosing, compared to control patterns with cholesterol or PC DCA conjugates. Shows increased guide strand accumulation in the placenta compared to controls. CD1 pregnant mice were treated with Pattern 1B or control siRNA and tissues were collected. siRNA guide strands were measured in tissues using a peptide nucleic acid (PNA) hybridization assay. sFLT1-2519 O-methyl rich: 20mg / kg*, 120 hour dose; sFLT1-2283 control: 20mg / kg**, 120 hour dose; HTT-10150 control PC DCA: 20mg / kg, 48 hour dose. *40mg / kg was the total dose of sFLT1-X siRNA (20mg / kg sFLT1-2283 + 20mg / kg sFLT1-2519a in E14). **20mg / kg was the total dose of sFLT1-2283 siRNA (10mg / kg sFLT1-2283 on E14 + 10mg / kg sFLT1-2283 on E15). [Figure 13A]Figures 13A-13D show the in vitro efficacy of sFLT1i13, sFLT1e15a and HTT mRNA silencing by siRNAs with or without 2'-OMe at position 20 of the guide strand. Figures 13A, 13C and 13D show HeLa cells and Figure 13B shows WM-115 cells treated for 72 hours with siRNAs with 50-55% 2'-OMe content in the guide strand at the indicated concentrations. Figure 13D compares siRNAs with 20 nucleotide antisense strands to siRNAs with 21 nucleotide antisense strands. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as % of untreated control. [Figure 13B] Figures 13A-13D show the in vitro efficacy of sFLT1i13, sFLT1e15a and HTT mRNA silencing by siRNAs with or without 2'-OMe at position 20 of the guide strand. Figures 13A, 13C and 13D show HeLa cells and Figure 13B shows WM-115 cells treated for 72 hours with siRNAs with 50-55% 2'-OMe content in the guide strand at the indicated concentrations. Figure 13D compares siRNAs with 20 nucleotide antisense strands to siRNAs with 21 nucleotide antisense strands. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as % of untreated control. [Figure 13C]Figures 13A-13D show the in vitro efficacy of sFLT1i13, sFLT1e15a and HTT mRNA silencing by siRNAs with or without 2'-OMe at position 20 of the guide strand. Figures 13A, 13C and 13D show HeLa cells and Figure 13B shows WM-115 cells treated for 72 hours with siRNAs with 50-55% 2'-OMe content in the guide strand at the indicated concentrations. Figure 13D compares siRNAs with 20 nucleotide antisense strands to siRNAs with 21 nucleotide antisense strands. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as % of untreated control. [Figure 13D] Figures 13A-13D show the in vitro efficacy of sFLT1i13, sFLT1e15a and HTT mRNA silencing by siRNAs with or without 2'-OMe at position 20 of the guide strand. Figures 13A, 13C and 13D show HeLa cells and Figure 13B shows WM-115 cells treated for 72 hours with siRNAs with 50-55% 2'-OMe content in the guide strand at the indicated concentrations. Figure 13D compares siRNAs with 20 nucleotide antisense strands to siRNAs with 21 nucleotide antisense strands. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as % of untreated control. [Figure 14] 1 shows exemplary modified intersubunit linkers. [Figure 15] 1 shows examples of biantennary siRNA chemical scaffolds. [Figure 16]1 shows an oligonucleotide branching motif according to certain exemplary embodiments. The double helix represents the oligonucleotide. The combination of different linkers, spacers and branching points allows for the generation of a variety of branched hsiRNA structures. [Figure 17] 1 shows a branched oligonucleotide of the invention having a conjugated biologically active moiety. [Figure 18] Exemplary amidite linkers, spacers and branching moieties are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0066] Provided herein are oligonucleotides that are fully chemically stabilized and contain a novel chemical configuration that contains only two non-2'-O-methyl modifications (e.g., 2'-fluoro modifications) at positions 2 and 14 of the antisense strand (Figure 1). Without intending to be bound by scientific theory, positions 2 and 14 of the antisense strand form direct contacts with AGO2. Unexpectedly, this chemical configuration has been found to be fully functional in the context of mRNA silencing. Also, 2'-fluoro-free configurations have been found in which positions 2 and 14 are modified with ribose and / or DNA. The use of the novel oligonucleotides described herein not only extends the duration of efficacy in vivo, but also reduces concerns about the toxicity of oligonucleotides that contain a high percentage of 2'-fluoro modifications.

[0067] definition Unless otherwise defined herein, scientific and technical terms used herein shall have the meanings commonly understood by those of ordinary skill in the art. In case of any potential ambiguity, the definitions provided herein shall take precedence over any dictionary or extrinsic definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless otherwise indicated. The use of the term "comprising" and other forms such as "comprises" and "includes" is not limiting. Unless otherwise indicated, the singular forms "a," "an," and "the" as used herein include plural references. Thus, for example, a reference to a "protein" includes a plurality of protein molecules.

[0068] In general, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, bacteriology, genetics, protein and nucleic acid chemistry, and hybridization described herein is that which is well known and commonly used in the art. The methods and techniques provided herein are generally carried out according to conventional methods well known in the art and as described in the various general and more specific references cited and discussed throughout this specification, unless otherwise indicated. Enzymatic reactions and purification techniques are carried out according to manufacturer's specifications, as commonly accomplished in the art, or as described herein. The nomenclature used in connection with analytical chemistry, synthetic organic chemistry, pharmaceuticals and medicinal chemistry, and the laboratory procedures and techniques thereof described herein are that which is well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation and delivery, and treatment of patients.

[0069] In order that this disclosure may be more readily understood, selected terms are defined below.

[0070] The term "complementary" refers to an oligonucleotide that hybridizes to form a double-stranded nucleic acid via Watson-Crick base pairing or nucleotide-nucleotide relationships. The term "complementary" refers to the state of an oligonucleotide (e.g., a sense strand or an antisense strand) that is partially or completely complementary to another oligonucleotide. An oligonucleotide described herein as being complementary to a second oligonucleotide can be 100% (full complementarity), >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% complementary to the second oligonucleotide. Thus, an oligonucleotide described herein as being less than 100% complementary to a second oligonucleotide does not have full complementarity.

[0071] As used herein in connection with oligonucleotide sequences, "A" represents a nucleoside that contains the base adenine (e.g., adenosine or a chemically modified derivative thereof), "G" represents a nucleoside that contains the base guanine (e.g., guanosine or a chemically modified derivative thereof), "U" represents a nucleoside that contains the base uracil (e.g., uridine or a chemically modified derivative thereof), and "C" represents a nucleoside that contains the base cytosine (e.g., cytidine or a chemically modified derivative thereof).

[0072] The term "3' end" as used herein refers to the end of a nucleic acid that contains an unmodified hydroxyl group at the 3' carbon of its ribose ring. The 3' end can be covalently attached (e.g., via a linker) to another molecule, such as a hydrophobic molecule or another nucleic acid.

[0073] The term "5' end" as used herein refers to the end of a nucleic acid having a phosphate group attached to the 5' carbon of its ribose ring. The 5' end may be further modified by a hydrophobic moiety, a phosphonate moiety, a linker moiety, an alkylene moiety, or an alkenyl moiety.

[0074] The term "nucleoside" as used herein refers to a molecule composed of a heterocyclic base and its sugar.

[0075] The term "nucleotide" as used herein refers to a nucleoside that typically has a phosphate or phosphorothioate group on its 3' or 5' sugar hydroxyl group.

[0076] An RNAi agent, e.g., an siRNA, having a strand that is "sufficiently complementary to a target mRNA sequence to induce target-specific RNA interference (RNAi)" means that the strand has sufficient sequence to cause destruction of the target mRNA by RNAi.

[0077] As used herein, the term "isolated RNA" (e.g., "isolated siRNA," "isolated siRNA," or "isolated siRNA precursor") refers to an RNA molecule that is substantially free of other cellular material or culture when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

[0078] The term "discriminatory RNA silencing" refers to the ability of an RNA molecule to substantially inhibit the expression of a "first" or "target" polynucleotide sequence while not substantially inhibiting the expression of a "second" or "non-target" polynucleotide sequence (e.g., when both polynucleotide sequences are present in the same cell). In certain embodiments, the target polynucleotide sequence corresponds to a target gene, while the non-target polynucleotide sequence corresponds to a non-target gene. In other embodiments, the target polynucleotide sequence corresponds to a target allele, while the non-target polynucleotide sequence corresponds to a non-target allele. In certain embodiments, the target polynucleotide sequence is a DNA sequence that encodes a regulatory region (e.g., a promoter or enhancer element) of a target gene. In other embodiments, the target polynucleotide sequence is a target mRNA encoded by a target gene.

[0079] The term "siRNA" as used herein refers to a small interfering RNA that induces the RNA interference (RNAi) pathway. siRNA molecules can vary in length (usually 15-30 base pairs) and can have different degrees of complementarity to the target mRNA. The term "siRNA" includes single strands that can form duplexes of two separate strands and hairpin structures that include a duplex region.

[0080] The term "antisense strand" as used herein refers to the strand of siRNA duplex that has a degree of complementarity to target gene or mRNA and has complementarity to the sense strand of siRNA duplex.The nucleotide position of antisense strand can be based on the 5' end of antisense strand or the 3' end of antisense strand.For example, the positions 2 and 14 from the 5' end of antisense strand correspond to the 2nd and 14th nucleotides counting from the 5' end of antisense strand.

[0081] The term "sense strand" as used herein refers to the strand of an siRNA duplex that has complementarity with the antisense strand of the siRNA duplex. The nucleotide position of the sense strand can be based on the 5' end of the sense strand or the 3' end of the sense strand. For example, positions 7, 10 and 11 from the 3' end of the sense strand correspond to the 7th, 10th and 11th nucleotides counted from the 3' end of the sense strand. Optionally, when the sense strand comprises a 3' single-stranded overhang region, the positions described herein based on the 3' end are based on the 3' end of the double-stranded region of the sense strand.

[0082] As used herein, the term "overhang" or "tail" refers to 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more contiguous nucleotides at the 3'-end of one or both of the sense and antisense strands that are single-stranded, i.e., not base-paired to (i.e., not duplexed with) the other strand of the siRNA duplex.

[0083] As used herein, the term "antisense oligonucleotide" or "ASO" refers to a nucleic acid (e.g., RNA) having sufficient sequence complementarity to target an RNA (e.g., an SNP-containing mRNA or an SNP-containing pre-mRNA) to block a region of the target RNA in an effective manner, such as to inhibit translation of the target mRNA and / or splicing of the target pre-mRNA. An antisense oligonucleotide having a "sequence sufficiently complementary to the target RNA" means that the antisense agent has a sufficient sequence to mask a binding site for a protein that would otherwise regulate splicing, and / or that the antisense agent has a sufficient sequence to mask a binding site for the ribosome, and / or that the antisense agent has a sufficient sequence to alter the three-dimensional structure of the targeted RNA to prevent splicing and / or translation.

[0084] In certain exemplary embodiments, the siRNA of the invention is asymmetric.In certain exemplary embodiments, the siRNA of the invention is symmetric.

[0085] In certain exemplary embodiments, the siRNA of the invention comprises a duplex region of about 8-20 nucleotides or nucleotide analogues, about 10-18 nucleotides or nucleotide analogues, about 12-16 nucleotides or nucleotide analogues, or about 13-15 nucleotides or nucleotide analogues in length (e.g., a duplex region of about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs). In certain exemplary embodiments, the siRNA of the invention comprises a duplex region of 13-25 base pairs. In certain exemplary embodiments, the siRNA of the invention comprises a duplex region of 15-20 base pairs. In certain exemplary embodiments, the siRNA of the invention comprises a duplex region of 15 base pairs.

[0086] In certain exemplary embodiments, the siRNA of the present invention comprises one or two overhangs. In certain embodiments, each overhang of the siRNA comprises at least about 3, about 4, about 5, about 6, about 7, about 8, about 9 or about 10 consecutive nucleotides. In certain embodiments, each overhang of the siRNA of the present invention is about 4, about 5, about 6 or about 7 nucleotides long. In certain embodiments, the sense strand overhang is the same number of nucleotides long as the antisense strand overhang. In other embodiments, the sense strand overhang has fewer nucleotides than the antisense strand overhang. In other embodiments, the antisense strand overhang has fewer nucleotides than the sense strand overhang. In certain embodiments, each nucleotide in the overhang region is conjugated to its adjacent nucleotide via phosphorothioate bond.

[0087] In certain exemplary embodiments, the siRNA of the present invention comprises a sense strand and / or an antisense strand, each of which is independently 10 or about 10; 15 or about 15; 20 or about 20; 25 or about 25; or 30 or about 30 nucleotides in length. In certain embodiments, the siRNA of the present invention comprises a sense strand and / or an antisense strand, each of which is independently 15-25 or about 15-25 or about 25 nucleotides in length. In certain embodiments, the siRNA of the present invention comprises a sense strand and an antisense strand, each of which is independently 20 or about 20 nucleotides in length. In certain embodiments, the sense strand and the antisense strand of the siRNA are the same in length. In other embodiments, the sense strand and the antisense strand of the siRNA are different in length.

[0088] In certain exemplary embodiments, the siRNA of the present invention comprises an antisense strand that is greater than 15 nucleotides in length and comprises or consists of at least 85% 2'-O-methyl modified nucleotides, and a sense strand that is shorter in length than the antisense strand, and the length of the sense strand is at least about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In certain embodiments, the siRNA of the present invention comprises an antisense strand that is about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In certain embodiments, the siRNA of the present invention comprises an antisense strand that has at least 85% 2'-O-methyl modified nucleotides and is about 18 to about 25 nucleotides in length, and a sense strand that is about 13 to about 20 nucleotides in length. In certain embodiments, the siRNA of the present invention comprises an antisense strand that is about 20 nucleotides in length and a sense strand that is about 15 nucleotides in length. In certain embodiments, the siRNA of the invention comprises an antisense strand about 20 nucleotides in length and a sense strand about 18 nucleotides in length.

[0089] In certain embodiments, the siRNA of the invention comprises an antisense strand about 22 nucleotides in length and a sense strand about 20 nucleotides in length.

[0090] The term "chemically modified nucleotide", "nucleotide analog", "altered nucleotide" or "modified nucleotide" as used herein refers to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides. Exemplary nucleotide analogs are modified at any position to alter certain chemical properties of the nucleotide, while retaining the ability of the nucleotide analog to perform its intended function. Examples of nucleotide positions that can be derivatized include the 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine, 5-propyneuridine, 5-propenyluridine, etc.; the 6-position, such as 6-(2-amino)propyluridine; the 8-position (for adenosine and / or guanosine), such as 8-bromoguanosine, 8-chloroguanosine, 8-fluoroguanosine, etc. Nucleotide analogs also include deazanucleotides, such as 7-deaza-adenosine; O- and N-modified (e.g., alkylated, such as N6-methyladenosine or otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs, such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.

[0091] Nucleotide analogs may also contain modifications to the sugar portion of the nucleotide. For example, the 2'OH-group (2'-hydroxy) may be replaced by a group selected from H (2'-deoxy), OR, R, F (2'-fluoro), Cl, Br, I, SH, SR, NH2, NHR, NR2, COOR, or OR, where R is a substituted or unsubstituted C1-C6 alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications include those described in U.S. Pat. Nos. 5,858,988 and 6,291,438.

[0092] The term "metabolically stabilized" as used herein refers to an RNA molecule that contains a 2'-ribose modification that replaces the natural 2'-hydroxyl group with a 2'-O-methyl group or a 2'-fluoro group. Similarly, the term "stabilized" refers to an RNA molecule that contains a 2'-ribose modification that replaces the 2'-hydroxyl group with a 2'-O-methyl group or a group that is not 2'-O-methyl and is not 2-hydroxyl. The term "fully stabilized" or "fully modified" refers to an RNA molecule that contains a 2'-modification at each position, and typically at least 85% are 2'-O-methyl modified. In certain embodiments, a fully stabilized RNA molecule may contain one, two or three non-2'-O-methyl modified nucleotides, such as 2'-F or 2'-H modified nucleotides. The terms "nearly fully stabilized" or "nearly fully modified" refer to an RNA molecule that contains one, two or three positions that have no 2'-modifications and that is typically at least 85% 2'-O-methyl modified. The oligonucleotides described herein can be stabilized, metabolically stabilized, near fully stabilized, and / or fully stabilized.

[0093] In certain embodiments, the duplex region of the siRNA comprises one or two 2'-fluoro modifications and / or at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, or at least about 94% 2'-methoxy (2'-O-methyl) modifications. In certain exemplary embodiments, the antisense strand comprises two 2'-fluoro modifications and at least about 90%, at least about 91%, at least about 92%, at least about 93%, or at least about 94% 2'-methoxy modifications. In certain exemplary embodiments, the sense strand comprises two 2'-fluoro modifications and at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% 2'-methoxy modifications. In certain exemplary embodiments, single-stranded oligonucleotides are provided that contain at least about 90%, at least about 91%, at least about 92%, at least about 93%, or at least about 94% 2'-methoxy modifications.

[0094] In particular exemplary embodiments, oligonucleotides are provided that contain 2'-fluoro modifications of each nucleotide at positions 2 and 14 from the 5' end and 2'-methoxy modifications at every other nucleotide position. In certain exemplary embodiments, antisense strands are provided that contain three 2'-fluoro modifications and at least about 85% non-2'-fluoro modifications (e.g., at least about 85% 2'-methoxy modifications). In certain exemplary embodiments, antisense strands are provided that contain two or three non-2'-O-methyl modifications (2'-F, 2'-H, or 2'-OH) and at least about 85% 2'-methoxy modifications.

[0095] The term "phosphorothioate" as used herein refers to a phosphate group of a nucleotide that is modified by replacing one or more oxygens of the phosphate group with sulfur. Phosphorothioates further include a cationic counterion (e.g., sodium, potassium, calcium, or magnesium, etc.). The term "phosphorothioated nucleotide" refers to a nucleotide that has one or two phosphorothioate bonds to another nucleotide. In certain embodiments, the single-stranded tail of the siRNA of the present invention comprises or consists of phosphorothioated nucleotides. In certain embodiments, the double-stranded oligonucleotides described herein comprise 1, 2, 3, 4, or 5 phosphorothioated nucleotides in the double-stranded region. In certain embodiments, the double-stranded oligonucleotides described herein comprise 1, 2, 3, 4, or 5 phosphorothioated nucleotides in the double-stranded region and one or more single-stranded tails that comprise or consist of phosphorothioated nucleotides.

[0096] In some embodiments, the compounds, oligonucleotides, and nucleic acids described herein may be modified to include one or more internucleotide linkages as shown in Figure 3. In certain embodiments, the compounds, oligonucleotides, and nucleic acids described herein include one or more internucleotide linkages selected from phosphodiester and phosphorothioate.

[0097] It is understood that certain internucleotide linkages provided herein, including, for example, phosphodiesters and phosphorothioates, contain a formal charge of -1 at physiological pH and that the formal charge will be balanced by a cationic moiety, such as an alkali metal, e.g., sodium or potassium, an alkaline earth metal, e.g., calcium or magnesium, or an ammonium ion or a guanidinium ion.

[0098] The term "lipid formulation" used herein can refer to liposome formulation, for example, liposome is used to form an aggregate with nucleic acid, which facilitates the entry of nucleic acid into cells.Without being bound by theory, liposome is useful for entry into cells, because the phospholipid bilayer can easily merge with the phospholipid bilayer of cell membrane, allowing nucleic acid to enter cells.

[0099] siRNA pattern 1 Pattern 1 and exemplary Pattern 1A through Pattern 1F embodiments are reproduced below, where "mN" is a 2'-O-methyl modified nucleotide, "xN" is a non-2'-O-methyl modified nucleotide, such as a 2'-fluoro modified nucleotide or a 2'-deoxy modified nucleotide, "#" is a phosphorothioate backbone modification, and "N" is a nucleotide selected from A, U, G, or C. Pattern 1 Antisense 5'-3' (mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN) Sense 5'~3' (mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)

[0100] In certain embodiments, the above-mentioned pattern 1 may comprise an antisense strand of 20-22 nucleotides, the antisense strand being extended from the 3' end by 2'-O-methyl modified nucleotides. A 20 nucleotide antisense strand is shown above. In certain embodiments, the above-mentioned pattern 1 may comprise a sense strand of 15-20 nucleotides, the sense strand being extended from the 3' end by 2'-O-methyl modified nucleotides. A 15 nucleotide sense strand is shown above. In certain embodiments, the above-mentioned antisense strand may comprise one or more phosphorothioate bonds # at the 5' end and / or 3' end. In certain embodiments, the above-mentioned sense strand may comprise one or more phosphorothioate bonds # at the 5' end and / or 3' end. In certain embodiments, the 5' terminal nucleotide of the antisense strand may comprise 5' vinyl phosphonate, 5' OH or 5' phosphorothioate (5' PS). In certain embodiments, the 3' terminal nucleotide of the antisense strand may comprise a non-2'-O-methyl modified nucleotide. In further embodiments, the Pattern 1 siRNA may be a branched siRNA structure comprising two or more linked Pattern 1 siRNAs. In certain embodiments, the Pattern 1 siRNA is a bi-branched Pattern 1 siRNA comprising two Pattern 1 siRNAs, with a linker linking the two siRNAs via the 3'-ends of the sense strands.

[0101] Exemplary Pattern 1 embodiments (Patterns 1A, 1B, 1C, 1D, 1E and 1F) are shown below. Pattern 1A Antisense 5'~3' (20 nucleotides) (mN)#(xN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'~3'(15 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1B Antisense 5'~3' (20 nucleotides) (mN)#(xN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) Sense 5'~3'(15 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1C Antisense 5'~3' (20 nucleotides) (mN)#(xN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'~3'(18 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1D Antisense 5'~3' (20 nucleotides) (mN)#(xN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) Sense 5'~3'(18 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1E Antisense 5'~3' (22 nucleotides) (mN)#(xN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'~3'(20 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1F Antisense 5'~3' (22 nucleotides) (mN)#(xN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) Sense 5'~3'(20 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN)

[0102] siRNA design In some embodiments, the oligonucleotide molecules of the invention are siRNA duplexes consisting of a sense strand and a complementary antisense strand, where the antisense strand has sufficient complementarity with the mRNA to mediate RNAi. In certain exemplary embodiments, each strand of the siRNA molecule is independently about 10-50 or more nucleotides in length, i.e., each strand independently comprises 10-50 nucleotides (or nucleotide analogs or a combination of nucleotides and nucleotide analogs). In other exemplary embodiments, the siRNA molecule is about 16-30 nucleotides in length, e.g., independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length on each strand, where one of the strands is sufficiently complementary to the target region to mediate RNAi.

[0103] In certain exemplary embodiments, the strands are aligned such that when the strands are annealed, there are at least 4, 5, 6, 7, 8, 9, 10 or more bases at one or both ends where the strands do not align (i.e., so that no complementary bases occur in the opposing strand), such that an overhang of 4, 5, 6, 7, 8, 910 or more residues occurs at one or both ends of the duplex. In certain exemplary embodiments, the siRNA molecule has a length of about 10-50 or more nucleotides, i.e., each strand, independently, comprises 10-50 nucleotides (or nucleotide analogs or a combination of nucleotides and nucleotide analogs). In particularly exemplary embodiments, the siRNA molecules have, independently, each strand about 16 to 30, e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, one of the strands is substantially complementary to the target sequence, and the other strand is identical or substantially identical to the first strand.

[0104] In other exemplary embodiments, the siRNA molecules are about 15 to about 25 or about 16 to about 25 in length, or have, for example, independently, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in each strand, one of the strands being sufficiently complementary to the target region to mediate RNAi. In certain exemplary embodiments, the strands are aligned such that there are at least 4, 5, 6, 7, 8, 9, 10 or more bases at one or both ends where the strands do not align (i.e., such that complementary bases do not occur in the opposing strand), such that when the strands are annealed, an overhang of 4, 5, 6, 7, 8, 9, 10 or more residues occurs at one or both ends of the duplex.

[0105] Generally, siRNAs can be designed by using any method known in the art, for example by using the following protocol.

[0106] 1. siRNA should be specific for the target sequence. The first strand should be complementary to the target sequence, and the other strand is substantially complementary to the first strand. Exemplary target sequences are selected from the 5' untranslated region (5'-UTR) or intron region of the target gene, for example the target gene containing a mutation. Cleavage of the mRNA at these sites should abolish translation of the corresponding mutant protein. Target sequences from other regions of the target gene are also suitable for targeting. The sense strand is designed based on the target sequence. Furthermore, siRNAs with lower G / C content (35-55%) may be more active than those with a G / C content higher than 55%. Thus, in one embodiment, the present invention includes a nucleic acid molecule with a G / C content of 35-55%.

[0107] 2. The sense strand of the siRNA is designed based on the sequence of the selected target site. In certain exemplary embodiments, the sense strand comprises about 13 to about 20, about 13 to about 18, about 13 to about 15, about 15 to about 20, or about 15 to about 18 nucleotides, such as 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In certain embodiments, the sense strand comprises about 19 to 25 nucleotides, such as 19, 20, 21, 22, 23, 24, or 25 nucleotides. In certain embodiments, the sense strand comprises 19, 20, or 21 nucleotides. However, one of skill in the art will recognize that siRNAs less than 19 nucleotides in length, such as 13, 14, 15, 16, 17, or 18 nucleotides in length, or more than 25 nucleotides in length, may also function to mediate RNAi. Thus, siRNAs of such lengths are within the scope of the present invention, provided they retain the ability to mediate RNAi. It has been demonstrated that longer RNA silencing agents induce interferon or protein kinase R (PKR) response in certain mammalian cells, which may be undesirable.In certain exemplary embodiments, the RNA silencing agents of the present invention do not induce PKR response (i.e., are of sufficiently short length).However, longer RNA silencing agents may be useful, for example, in cell types that cannot generate PRK response, or in situations where PKR response is downregulated or reduced by alternative means.

[0108] The siRNA molecule of the present invention has sufficient complementarity with the target sequence so that the siRNA can mediate RNAi. In general, siRNA containing identical nucleotide sequence to the target sequence portion of the target gene is particularly suitable, which is sufficient to cause RISC-mediated cleavage of the target gene. Thus, in an exemplary embodiment, the sense strand of the siRNA is designed to have a sufficiently identical sequence to a portion of the target. For example, the sense strand can have 100% identity to the target site. However, 100% identity is not required. More than 80% identity between the sense strand and the target RNA sequence, such as 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, is particularly suitable. The present invention has the advantage of being able to tolerate certain sequence mutations that enhance the efficiency and specificity of RNAi. In one embodiment, the sense strand has 4, 3, 2, 1 or 0 mismatched nucleotides with the target region, for example, the target region with at least one base pair difference between wild-type allele and mutant allele, for example, the target region with gain-of-function mutation, and the other strand is identical or substantially identical to the first strand.In addition, the siRNA sequence with small insertion or deletion of 1 or 2 nucleotides can also be effective for mediating RNAi.Alternatively, the siRNA sequence with nucleotide analogue substitution or insertion can be effective for inhibition.

[0109] Sequence identity can be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or two amino acid sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced into the first sequence or the second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., percent (%) homology = number of identical positions / total number of positions x 100), optionally penalizing the score for the number of gaps introduced and / or the length of the gap introduced.

[0110] Comparison of sequences and determination of percent identity between two sequences can be accomplished using mathematical algorithms. In one embodiment, alignment occurs to a specific portion of the sequence that is aligned with sufficient identity, rather than to a portion with a lower degree of identity (i.e., local alignment). An illustrative, non-limiting example of a local alignment algorithm utilized for sequence comparison is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST program (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.

[0111] In another embodiment, the alignment is optimized by introducing appropriate gaps and the percent identity is determined over the length of the aligned sequences (i.e., gapped alignment). To obtain a gapped alignment for comparison purposes, Gapped BLAST can be used as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps and the percent identity is determined over the entire length of the aligned sequences (i.e., global alignment). An illustrative, non-limiting example of a mathematical algorithm used for global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program to compare amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0112] 3. The antisense or guide strand of the siRNA is routinely the same length as the sense strand and contains complementary nucleotides. In one embodiment, the strands of the siRNA are paired to have a 3' overhang of 4-15, for example 4, 5, 6 or 7 nucleotides. In certain embodiments, the antisense or guide strand of the siRNA is longer than the sense strand.

[0113] 4. Compare potential targets against the appropriate genome database (human, mouse, rat, etc.) using any method known in the art, and eliminate from consideration any target sequences that have significant homology to other coding sequences. One such method for such sequence homology searches is known as BLAST, available at the National Center for Biotechnology Information website.

[0114] 5. Select one or more sequences that meet the criteria for evaluation.

[0115] Further general information about the design and use of siRNAs can be found in "The siRNA User Guide" available at the Max-Plank-Institut fur Biophysikalishe Chemie website.

[0116] Alternatively, siRNA may be functionally defined as a nucleotide sequence (or oligonucleotide sequence) capable of hybridizing to a target sequence (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, hybridization at 50° C. or 70° C. for 12-16 hours, followed by washing). Additional exemplary hybridization conditions include hybridization at 70° C. in 1×SSC or at 50° C. in 1×SSC, 50% formamide followed by washing at 70° C. in 0.3×SSC or at 70° C. in 4×SSC or at 50° C. in 4×SSC, 50% formamide followed by washing at 67° C. in 1×SSC. Hybridization temperatures for hybrids predicted to be less than 50 base pairs in length should be 5-10° C. lower than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following formula: For hybrids less than 18 base pairs long, Tm(°C)=2(number of A+T bases)+4(number of G+C bases). For hybrids 18-49 base pairs long, Tm(°C)=81.5+16.6(log10[Na+])+0.41(%G+C)-(600 / N), where N is the number of bases in the hybrid and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] for 1xSSC=0.165M). Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, Chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, FMAusubel et al., eds., John Wiley & Sons, Inc., Sections 2.10 and 6.3-6.4, which are incorporated herein by reference.

[0117] Negative control siRNA has the same nucleotide composition as selected siRNA, but should not have significant sequence complementarity to appropriate genome.Such negative control can be designed by randomly mixing the nucleotide sequence of selected siRNA.Homology search can be performed to ensure that negative control lacks homology to any other gene in appropriate genome.In addition, negative control siRNA can be designed by introducing one or more base mismatches into sequence.

[0118] 6. To verify the effectiveness of siRNA in destroying a target mRNA (eg, a wild-type or mutant target mRNA), the siRNA can be incubated with a target cDNA in an in vitro mRNA expression system using Drosophila. 32 Newly synthesized target mRNA radiolabeled with P is detected by autoradiography on an agarose gel. The presence of cleaved target mRNA indicates mRNA nuclease activity. Suitable controls include omitting siRNA and using non-targeting cDNA. Alternatively, a control siRNA is selected that has the same nucleotide composition as the selected siRNA but does not have significant sequence complementarity to the appropriate target gene. Such a negative control can be designed by randomly shuffling the nucleotide sequences of the selected siRNA. A homology search can be performed to ensure that the negative control lacks homology to any other genes in the appropriate genome. In addition, a negative control siRNA can be designed by introducing one or more base mismatches into the sequence.

[0119] Modified Nucleotides In one embodiment, the oligonucleotide, for example siRNA, comprises one or more chemically modified nucleotides. In one embodiment, the oligonucleotide consists of chemically modified nucleotides. In certain exemplary embodiments, >90%, >98%, >97%, >96%, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% of the oligonucleotide comprises chemically modified nucleotides. In certain exemplary embodiments, 100% of the oligonucleotide comprises chemically modified nucleotides.

[0120] In one embodiment, the sense strand and the antisense strand of the siRNA each contain one or more chemically modified nucleotides. In one embodiment, each nucleotide of the sense strand and the antisense strand is chemically modified. In one embodiment, the antisense strand contains 2'-methoxy nucleotides and 2'-fluoro nucleotides. In one embodiment, the sense strand contains 2'-methoxy nucleotides. In one embodiment, the nucleotides at positions 1 and 2 from the 5' end of the sense strand and the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. In one embodiment, the nucleotides at the 5' end and the 3' end are linked to adjacent nucleotides via phosphorothioate bonds.

[0121] Delivery and Distribution In another aspect, provided herein is a method of selectively delivering a nucleic acid described herein to a specific organ in a patient, comprising administering to the patient an oligonucleotide described herein such that the oligonucleotide is selectively delivered. In one embodiment, the organ is the liver. In another embodiment, the organ is the kidney. In another embodiment, the organ is the spleen. In another embodiment, the organ is the heart. In another embodiment, the organ is the brain. In another embodiment, the organ is the placenta.

[0122] The compositions described herein facilitate simple, efficient, non-toxic delivery of metabolically stabilized oligonucleotides and potent silencing of therapeutic targets in a wide range of tissues in vivo.

[0123] In another aspect, provided herein is a method for selective in vivo delivery of a compound described herein to a target organ, tissue or cell, comprising administering the compound to a subject.

[0124] In one embodiment, the method is at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 99% selective for the target organ, i.e. at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 99% of the oligonucleotides administered to the subject are localized to the target organ.

[0125] In certain exemplary embodiments, the compound or pharmaceutical composition is administered by intravenous, intraperitoneal, intracranial, intrathecal, intrastriatal or intraventricular injection. In certain embodiments, the compound or pharmaceutical composition is administered by intraventricular injection.

[0126] Synthetic oligonucleotides can be delivered into cells by methods known in the art, including cationic liposome transfection and electroporation. To obtain longer-term suppression of target genes and to facilitate delivery under certain circumstances, one or more oligonucleotides can be expressed from recombinant DNA constructs in cells. Such methods of expressing oligonucleotide duplexes, such as siRNA duplexes, from recombinant DNA constructs in cells that allow longer-term suppression of target genes in cells are known in the art and include mammalian Pol III promoter systems (e.g., H1 or U6 / snRNA promoter systems capable of expressing functional double-stranded siRNAs (Tuschl, T., 2002, supra); (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002), supra; Sui et al., 2002, supra). Transcription termination by RNA Pol III occurs at runs of four consecutive T residues within the DNA template, providing a mechanism for terminating siRNA transcripts at specific sequences. siRNAs are complementary to the sequence of the target gene in both 5'-3' and 3'-5' orientations, and the two strands of the siRNA can be expressed in the same or separate constructs. Hairpin siRNAs expressed intracellularly, driven by H1 or U6 snRNA promoters, can inhibit target gene expression (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002, supra; Sui et al., 2002, supra). Furthermore, constructs containing siRNA sequences under the control of a T7 promoter form functional siRNAs when co-transfected into cells with a vector expressing T7 RNA polymerase (Jacque et al., 2002, supra).A single construct can contain multiple siRNA-encoding sequences to target the same gene or multiple genes, such as multiple regions of a gene encoding a target, and can be driven, for example, by separate Pol III promoter sites.

[0127] Viral-mediated delivery mechanisms can also be used to induce specific silencing of target genes by expression of oligonucleotides, for example by generating recombinant adenoviruses with oligonucleotides under the transcriptional control of an RNA Pol II promoter (Xia et al., 2002, supra). Infection of HeLa cells with these recombinant adenoviruses can attenuate endogenous target gene expression. Injection of recombinant adenovirus vectors into transgenic mice expressing the oligonucleotide target gene reduces target gene expression in vivo. Ibid. In animal models, synthetic siRNA can be efficiently delivered into postimplantation mouse embryos by whole embryo electroporation (Calegari et al., 2002). In adult mice, efficient delivery of siRNA can be achieved by "high pressure" delivery techniques (rapid injection (within 5 seconds) of a large volume of oligonucleotide-containing solution into the animal via the tail vein) (Liu et al., 1999, supra; McCaffrey et al., 2002, supra; Lewis et al., 2002). Nanoparticles and liposomes can also be used to deliver oligonucleotides into animals.In certain exemplary embodiments, recombinant adeno-associated virus (rAAV) and its related vectors can be used to deliver one or more siRNAs into cells, for example, into neural cells (e.g., brain cells) (US Patent Application Publication No. 2014 / 0296486, US Patent Application Publication No. 2010 / 0186103, US Patent Application Publication No. 2008 / 0269149, US Patent Application Publication No. 2006 / 0078542 and US Patent Application Publication No. 2005 / 0220766).

[0128] In one embodiment, the oligonucleotide provided herein is a double-stranded RNA comprising one, two or three non-2'-O-methyl modified nucleotides and an antisense strand that is at least 85% 2'-O-methyl modified. In certain embodiments, the double-stranded RNA comprises 2'-methoxy-nucleotides and 2'-fluoro-nucleotides. In certain embodiments, the double-stranded RNA comprises 2'-methoxy-nucleotides and 2'-deoxy-nucleotides. In certain embodiments, the double-stranded RNA comprises 2'-methoxy-nucleotides and 2'-OH nucleotides. In certain embodiments, the double-stranded RNA is fully chemically modified and comprises 2'-methoxy-nucleotides at all positions except positions 2 and 14 and optionally position 20 from the 5' end of the antisense strand. In certain embodiments, the double-stranded RNA is fully chemically modified and comprises 2'-methoxy-nucleotides at all positions except positions 2, 14 and optionally position 20 from the 5' end of the antisense strand in the antisense strand, and 2'-methoxy nucleotides at all positions in the sense strand. Optionally, positions 2 and 14, and optionally position 20, of the antisense strand are 2'-fluoro modified.

[0129] In one embodiment, the oligonucleotides provided herein are double-stranded RNAs comprising one or more nucleotides linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, nucleotides at positions 1 and 2 from the 5' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, nucleotides at positions 1-7 from the 3' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, nucleotides at positions 1-8 from the 3' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, nucleotides at positions 1, 2 and 3 from the 5' end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, nucleotides at positions 1, 2 and 3 from the 3' end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, nucleotides at positions 1 and 2 from the 3' end of the sense strand are linked to adjacent nucleotides via phosphorothioate linkages.

[0130] In one embodiment of the double stranded RNA provided herein, (1) the first oligonucleotide is fully chemically modified and contains 2'-methoxy-nucleotides at all positions except positions 2 and 14 and optionally position 20 from the 5' end of the antisense strand; (2) the second oligonucleotide is fully chemically modified and contains 2'-methoxy-nucleotides at all positions in the sense strand; (3) the nucleotides of the first oligonucleotide are linked to adjacent nucleotides via phosphodiester or phosphorothioate bonds, and the nucleotides at positions 1-2 from the 5' end and / or positions 1-8 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds; and (4) The nucleotides of the second oligonucleotide are linked to adjacent nucleotides via phosphodiester or phosphorothioate bonds, and the nucleotides at positions 1, 2, and 3 from the 3' end and / or positions 1, 2, and 3 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds.

[0131] In one embodiment of the double-stranded RNA, the first oligonucleotide has 3 to 7 more ribonucleotides than the second oligonucleotide.

[0132] In one embodiment, the first oligonucleotide is the antisense strand and the second oligonucleotide is the sense strand.

[0133] Modified Oligonucleotides In certain aspects of the present invention, the RNA silencing agent of the present invention described herein (or any part thereof), such as siRNA, can be modified to further improve the activity of the RNA silencing agent.For example, the above RNA silencing agent can be modified with any of the modifications described herein.Modifications can be useful, in part, to further improve target discrimination, increase the stability of the agent (e.g., prevent degradation), promote intracellular uptake, increase targeting efficiency, improve the efficacy of binding (e.g., to target), improve patient tolerance to the agent, and / or reduce toxicity.

[0134] 1) Modifications that enhance target discrimination In certain embodiments, the oligonucleotides of the invention may be substituted with destabilizing nucleotides that enhance single-nucleotide target discrimination (see U.S. Patent Application Publication No. 11 / 698,689, filed January 25, 2007; U.S. Provisional Patent Application No. 60 / 762,225, filed January 25, 2006; and PCT / U.S. Patent Application Publication No. 19 / 46013, filed August 9, 2019, each of which is incorporated herein by reference). Such modifications may be sufficient to eliminate the specificity of the oligonucleotide for non-target mRNAs (e.g., wild-type mRNAs), but do not appreciably affect the specificity of the oligonucleotide for target mRNAs (e.g., gain-of-function mutant mRNAs).

[0135] In certain exemplary embodiments, the oligonucleotide of the present invention is modified by the introduction of at least one universal nucleotide in its antisense strand. A universal nucleotide comprises a base moiety that can indiscriminately base pair with any of the four common nucleotide bases (e.g., A, G, C, U). A universal nucleotide is particularly suitable because it usually has a relatively low effect on the stability of the RNA duplex or the duplex formed by the RNA silencing agent and the guide strand of the target mRNA. Exemplary universal nucleotides include those having an inosine base moiety or an inosine analog base moiety selected from the group consisting of deoxyinosine (e.g., 2'-deoxyinosine), 7-deaza-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In certain exemplary embodiments, the universal nucleotide is an inosine residue or a naturally occurring analog thereof.

[0136] In certain embodiments, the oligonucleotide of the present invention is modified by introducing at least one destabilizing nucleotide within 5 nucleotides from the specificity-determining nucleotide (i.e., the nucleotide that recognizes the disease-associated polymorphism). For example, the destabilizing nucleotide can be introduced within 5, 4, 3, 2 or 1 nucleotide position from the specificity-determining nucleotide. In an exemplary embodiment, the destabilizing nucleotide is introduced within 3 nucleotides from the specificity-determining nucleotide (i.e., there are two stabilizing nucleotides between the destabilizing nucleotide and the specificity-determining nucleotide). In an RNA silencing agent having two strands or strand portions (e.g., siRNA and shRNA), the destabilizing nucleotide can be introduced within the strand or strand portion that does not contain the specificity-determining nucleotide. In certain exemplary embodiments, the destabilizing nucleotide is introduced within the same strand or strand portion that contains the specificity-determining nucleotide.

[0137] In certain embodiments, the RNA silencing agent of the present invention is modified by the introduction of at least one destabilizing nucleotide within 11 nucleotides of the specificity-determining nucleotide (e.g., within 11 nucleotides of the nucleotide that recognizes the disease-associated polymorphism (e.g., SNP position nucleotide)). For example, the destabilizing nucleotide can be introduced at a position that is within 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides of the specificity-determining nucleotide. In an exemplary embodiment, the destabilizing nucleotide is introduced at a position that is 3 nucleotides from the specificity-determining nucleotide (i.e., such that there are two stabilizing nucleotides between the destabilizing nucleotide and the specificity-determining nucleotide). In an RNA silencing agent having two strands or strand portions (e.g., siRNA and shRNA), the destabilizing nucleotide can be introduced in the strand or strand portion that does not contain the specificity-determining nucleotide. In certain exemplary embodiments, the destabilizing nucleotide is introduced in the same strand or strand portion that contains the specificity-determining nucleotide.

[0138] In certain embodiments, an RNA silencing agent of the invention has Formula 1: [ka] (In the formula, D is selected from the group consisting of O, OCH2, OCH, CH2, and CH; C is O - , O.H., O.R. 1 , N.H. - , NH2, S - and SH; A is selected from the group consisting of O and CH2; R 1 is a protecting group; [ka] is an optional double bond; and The subunits bridge two optionally modified nucleosides. is modified by the introduction of modified intersubunit linkages.

[0139] In one embodiment, C is O - and either A or D is not O.

[0140] In certain embodiments, D is CH2.

[0141] In one embodiment, D is O.

[0142] In one embodiment, D is OCH2.

[0143] In another embodiment, the modified intersubunit linkage of formula VIII is represented by formula 2: [ka] is a modified intersubunit bond.

[0144] In another embodiment, the modified intersubunit linkage of formula VIII is represented by formula 3: [ka] is a modified intersubunit bond.

[0145] In another embodiment, the modified intersubunit linkage of formula VIII is represented by formula 4: [ka] is a modified intersubunit bond.

[0146] In another embodiment, the modified intersubunit linkage has formula 5: [ka] is a modified intersubunit bond.

[0147] In another embodiment, the modified intersubunit linkage has formula 6: [ka] is a modified intersubunit bond.

[0148] In another embodiment, the modified intersubunit linkage of formula VII is represented by formula 7: [ka] is a modified intersubunit bond.

[0149] In certain embodiments, the RNA silencing agents of the invention are modified by the introduction of one or more of the intersubunit linkers of Figure 14. In an exemplary embodiment, the intersubunit linkers of Figure 14 are inserted between the SNP position nucleotide and the nucleotides immediately adjacent to and on either side of the SNP position nucleotide of the antisense strand.

[0150] In certain embodiments, the RNA silencing agent of the present invention has the following formula: [ka] The amino acid sequence is modified by the introduction of one or more vinylphosphonate (VP) motifs in the intersubunit linker having the formula:

[0151] In certain embodiments, the VP motif is inserted at any position of the oligonucleotide, e.g., RNA. For example, for an oligonucleotide having a length of 20 nucleotides, the VP motif can be inserted at positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, or 19-20, and any combination thereof.

[0152] In certain exemplary embodiments, VP motifs are inserted at one or more of positions 1-2, 5-6, 6-7, 10-11, 18-19, and / or 19-20 of the antisense strand.

[0153] In other exemplary embodiments, VP motifs are inserted at one or more of positions 1-2, 6-7, 10-11, and / or 19-20 of the antisense strand.

[0154] In an exemplary embodiment, the VP motif is inserted next to the SNP position nucleotide in the antisense strand (i.e., between the SNP position nucleotide and the nucleotides immediately adjacent to and on either side of it). In another exemplary embodiment, the VP motif is inserted next to the MM position nucleotide in the antisense strand (i.e., between the MM position nucleotide and the nucleotides immediately adjacent to and on either side of it).

[0155] 2) Modifications to increase potency and specificity In certain embodiments, the siRNA of the present invention can be modified according to asymmetric design rules to promote the enhancement of the efficacy and specificity of mediating RNAi (see U.S. Patent Nos. 8,309,704, 7,750,144, 8,304,530, 8,329,892 and 8,309,705). Such modifications promote the entry of the antisense strand of siRNA (e.g., the siRNA designed using the method of the present invention or the siRNA generated from shRNA) into RISC in favor of the sense strand, so that the antisense strand preferentially induces the cleavage or translational suppression of target mRNA, thus increasing or improving the efficiency of target cleavage and silencing. In certain embodiments, the asymmetry of an RNA silencing agent is increased by decreasing the base pair strength between the 5' end of the antisense strand (AS5') and the 3' end of the sense strand (S3') of the RNA silencing agent relative to the binding strength or base pair strength between the 3' end of the antisense strand (AS3') and the 5' end of the sense strand (S'5) of the silencing agent.

[0156] In one embodiment, the asymmetry of the siRNA of the invention can be increased such that there are fewer G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the sense strand portion than between the 3' end of the first or antisense strand and the 5' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the invention can be increased such that there is at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. In certain exemplary embodiments, the mismatched base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C and U:U. In other embodiments, the asymmetry of the siRNA of the invention can be increased such that there is at least one wobble base pair, e.g., G:U, between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. In other embodiments, the asymmetry of the RNA silencing agent of the invention can be increased such that there is at least one base pair that includes a rare nucleotide, e.g., inosine (I). In some exemplary embodiments, the base pair is selected from the group consisting of I:A, I:U and I:C. In yet another embodiment, the asymmetry of the siRNA of the present invention can be increased such that there is at least one base pair that comprises a modified nucleotide. In some embodiments, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G and 2,6-diamino-A.

[0157] In certain embodiments, the RNA silencing agent of the present invention has the following formula: [ka] The oligonucleotide is modified at one or more intersubunit linkages by the introduction of a VP motif having the following structure:

[0158] 3) RNA silencing agents with enhanced stability The RNA silencing agent (e.g., siRNA) described herein can be further modified to improve stability in serum or growth medium for cell culture.To enhance stability, 3' residues can be stabilized against degradation, for example, they can be selected to be composed of purine nucleotides, particularly adenosine or guanosine nucleotides.Alternatively, the substitution of pyrimidine nucleotides with modified analogs, for example, the substitution of uridine with 2'-deoxythymidine, is tolerated and does not affect the efficiency of RNA interference.

[0159] In an exemplary aspect, the invention features an RNA silencing agent (e.g., an siRNA) comprising a first and a second strand, in which the second strand and / or the first strand are modified by substitution of an internal nucleotide with a modified nucleotide, such that the stability in vivo is enhanced compared to the corresponding unmodified RNA silencing agent. As defined herein, an "internal" nucleotide is one that is present at any position other than the 5' or 3' end of a nucleic acid molecule, polynucleotide, or oligonucleotide. An internal nucleotide may be present within a single-stranded molecule or within a strand of a double-stranded or duplex molecule. In one embodiment, the sense strand and / or the antisense strand are modified by substitution of at least one internal nucleotide. In another embodiment, the sense strand and / or the antisense strand are modified by substitution of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more internal nucleotides. In another embodiment, the sense and / or antisense strand is modified by substitution of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the internal nucleotides. In yet another embodiment, the sense and / or antisense strand is modified by substitution of all of the internal nucleotides.

[0160] In an exemplary embodiment of the present invention, RNA silencing agent (e.g., siRNA) can contain at least one modified nucleotide analogue.Nucleotide analogue can be located at a position where target-specific silencing activity, such as RNAi-mediated activity or translation suppression activity, does not occur substantially, for example, in the region of 5'-end and / or 3'-end of RNA silencing agent (e.g., siRNA).In particular, end can be stabilized by incorporating modified nucleotide analogue.

[0161] In certain embodiments, the RNA silencing agent of the present invention has the following formula: [ka] The oligonucleotide is modified at one or more intersubunit linkages by the introduction of a VP motif having the following structure:

[0162] Various oligonucleotide types (e.g., gapmers, mixmers, miRNA inhibitors, splice switching oligonucleotides ("SSOs"), phosphorodiamidate morpholino oligonucleotides ("PMOs"), peptide nucleic acids ("PNAs"), etc.) may be used in the oligonucleotides described herein, optionally utilizing various combinations of modifications (e.g., chemical modifications) and / or conjugates as described herein and in, for example, U.S. Patent Application Publication Nos. 15 / 089,423; 15 / 236,051; 15 / 419,593; 15 / 697,120 and U.S. Patent No. 9,809,817; and 15 / 814,350 and U.S. Patent No. 9,862,350, each of which is incorporated by reference in its entirety for all purposes.

[0163] Exemplary nucleotide analogs include sugar- and / or backbone-modified ribonucleotides (i.e., containing modifications to the phosphate-sugar backbone). For example, the phosphodiester linkage of natural RNA can be modified to include at least one of a nitrogen or sulfur heteroatom. In exemplary backbone-modified ribonucleotides, the phosphodiester group linking an adjacent ribonucleotide is replaced by a modified group, such as a phosphothioate group. In exemplary sugar-modified ribonucleotides, the 2'-OH group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2, or ON, where R is C1-C6 alkyl, alkenyl, or alkynyl, and halo is F, Cl, Br, or I. Examples of suitable sugar modifications according to certain exemplary embodiments are shown in FIG. 2.

[0164] In certain embodiments, the modifications are 2'-fluoro, 2'-amino and / or 2'-thio modifications. Certain exemplary modifications include 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine and / or 5-amino-allyl-uridine. In certain embodiments, the 2'-fluoro ribonucleotides are all uridines and cytidines. Additional exemplary modifications include 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine and 5-fluoro-uridine. 2'-deoxy-nucleotides and 2'-Ome nucleotides can also be used in the modified RNA silencing agent of the present invention.Additional modified residues include deoxy-abasic, inosine, N3-methyl-uridine, N6,N6-dimethyl-adenosine, pseudouridine, purine ribonucleoside and ribavirin.In some exemplary embodiments, the 2' portion is a methyl group, so that the linking portion is a 2'-O-methyl oligonucleotide.

[0165] In an exemplary embodiment, the RNA silencing agent described herein comprises locked nucleic acid (LNA). LNA comprises sugar-modified nucleotides that resist nuclease activity (highly stable) and have single nucleotide discrimination for mRNA (Elmen et al., Nucleic Acids Res., (2005), 33(1): 439-447; Braasch et al. (2003) Biochemistry 42: 7967-7975, Petersen et al. (2003) Trends Biotechnol 21: 74-81). These molecules have 2'-O, 4'-C-ethylene bridged nucleic acid with possible modifications such as 2'-deoxy-2''-fluorouridine. Furthermore, LNA increases the specificity of oligonucleotides by restricting the sugar moiety to a 3'-endo conformation, thereby pre-structuring the nucleotide for base pairing and increasing the melting temperature of oligonucleotides by 10°C per base.

[0166] In another exemplary embodiment, the RNA silencing agent described herein comprises peptide nucleic acid (PNA). PNA comprises modified nucleotides in which the sugar-phosphate moiety of the nucleotide is replaced with a neutral 2-aminoethylglycine moiety that can form a polyamide backbone that is highly resistant to nuclease digestion and provides improved binding specificity to molecules (Nielsen, et al., Science, (2001), 254: 1497-1500).

[0167] Also exemplified are nucleobase-modified ribonucleotides, i.e., ribonucleotides that contain at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase. The base can be modified to block the activity of adenosine deaminase. Exemplary modified nucleobases include, but are not limited to, uridine and / or cytidine modified at 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine; adenosine and / or guanosine modified at 8-position, such as 8-bromoguanosine; deazanucleotides, such as 7-deaza-adenosine; O- and N-alkylated nucleotides, such as N6-methyladenosine, which are preferred. It should be noted that the above modifications can be combined.

[0168] In other embodiments, crosslinking can be used to modify the pharmacokinetics of RNA silencing agents, for example to increase their half-life in the body.Thus, the present invention includes RNA silencing agents with two complementary strands of nucleic acid, and the two strands are crosslinked.The present invention also includes RNA silencing agents that are conjugated (e.g., at their 3' ends) or not conjugated to another moiety (e.g., a non-nucleic acid moiety such as a peptide), an organic compound (e.g., a dye), etc.Modifying siRNA derivatives in this way may improve the cellular uptake or enhance the targeting activity of the resulting siRNA derivatives in cells compared to the corresponding siRNAs, be useful for tracking the siRNA derivatives in cells, or improve the stability of the siRNA derivatives compared to the corresponding siRNAs.

[0169] Other exemplary modifications include: (a) 2' modifications, such as providing a 2'OMe moiety on the sense or antisense strand, particularly on a U on the sense strand, or providing a 2'OMe moiety on a 3' overhang, such as at the 3' end (3' end means the 3' atom or the 3'-most part of the molecule, such as the 3'-most P or 2' position as indicated by the context); (b) backbone modifications, such as providing phosphorothioate modifications at U or A or both, such as having a substitution of O with S in the phosphate backbone, particularly on the antisense strand; such as having a substitution of P with S; (c) substitution of U with a C5 amino linker; (d) substitution of A with G (in certain embodiments, the sequence change is located on the sense strand but not the antisense strand); and (d) modifications at the 2', 6', 7' or 8' positions. Exemplary embodiments are those in which one or more of these modifications are present on the sense strand but not the antisense strand, or in which the antisense strand has fewer such modifications. Further exemplary modifications include the use of a 3' overhang, e.g., a methylated P at the 3' end; a combination of 2' modifications, e.g., providing a 2'OMe moiety and a backbone modification, e.g., having a substitution of P with S, e.g., providing a phosphorothioate modification or using a 3' overhang, e.g., a methylated P at the 3' end; modifications with 3' alkyls; modifications with 3' overhangs, e.g., abasic pyrrolidone at the 3' end; modifications with naproxen, ibuprofen or other moieties that inhibit degradation at the 3' end.

[0170] 4) Modifications to enhance cellular uptake In other embodiments, the RNA silencing agents (e.g., siRNAs) described herein can be modified with chemical moieties, for example, to enhance cellular uptake by target cells (e.g., neuronal cells). Thus, the invention includes siRNAs that are conjugated (e.g., at their 3' ends) or not to another moiety (e.g., a non-nucleic acid moiety such as a peptide), an organic compound (e.g., a dye), or the like. Conjugation can be carried out by methods known in the art, for example, using the methods of Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describing nucleic acids loaded onto polyalkylcyanoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53(1-3): 137-43 (1998) (describing nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4: 55-8 (1994) (describing nucleic acids linked to intercalating agents, hydrophobic groups, polycations or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2): 404-10 (1995) (describing nucleic acids linked to nanoparticles).

[0171] In certain embodiments, a modification to an RNA silencing agent of the invention comprises a VP motif in one or more intersubunit linkers of the oligonucleotide, the VP motif having the following formula: [ka] has.

[0172] In certain embodiments, the siRNA is conjugated to a lipophilic moiety. In one embodiment, the lipophilic moiety is a ligand that includes a cationic group. In another embodiment, the lipophilic moiety is attached to one or both strands of the siRNA. In an exemplary embodiment, the lipophilic moiety is attached to one end of the sense strand of the siRNA. In another exemplary embodiment, the lipophilic moiety is attached to the 3' end of the sense strand. In certain embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin D, DHA, DHAg2 (PC DHA), DCA, DCAg2 (PC DCA), EPA, vitamin E, vitamin K, vitamin A, folic acid, or a cationic dye (e.g., Cy3).

[0173] 5) Tethered Ligand Other elements can be tethered to the RNA silencing agent of the present invention. For example, a ligand tethered to the RNA silencing agent to improve stability, hybridization thermodynamics with the target nucleic acid, targeting to a specific tissue or cell type, or cell permeability, for example, by endocytosis-dependent or -independent mechanisms. The ligand and associated modifications can also increase sequence specificity, resulting in reduced off-site targeting. The tethered ligand can include one or more modified bases or sugars that can function as interferences. In certain exemplary embodiments, these are located in internal regions, such as bulges, of the RNA silencing agent / target duplex. The interferences can be aromatic, such as polycyclic aromatic or heterocyclic aromatic compounds. Polycyclic interferences can have stacking capabilities and can include systems with two, three, or four fused rings. A universal base as described herein can be included on the ligand. In one embodiment, the ligand can include a cleavage group that contributes to target gene inhibition by cleavage of the target nucleic acid. The cleavage group can be, for example, bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), polyamine, tripeptide (e.g., lys-tyr-lys tripeptide), or a metal ion chelating group. The metal ion chelating group can include, for example, Lu(III) or EU(III) macrocyclic complexes, Zn(II) 2,9-dimethylphenanthroline derivatives, Cu(II) terpyridine, or acridine, which can promote selective cleavage of the target RNA at the site of the bulge by a free metal ion such as Lu(III). In some embodiments, the peptide ligand can be tethered to an RNA silencing agent that promotes cleavage of the target RNA, for example, at the bulge region. For example, 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (cyclam) can be conjugated (e.g., by an amino acid derivative) to a peptide that promotes target RNA cleavage. The tethered ligand can be an aminoglycoside ligand, which can result in an RNA silencing agent with improved hybridization properties or improved sequence specificity.Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as neo-N-acridine, neo-S-acridine, neo-C-acridine, tobra-N-acridine, and kanaAN-acridine. The use of acridine analogs can increase sequence specificity. For example, neomycin B has a high affinity for RNA compared to DNA, but low sequence specificity. The acridine analog neo-5-acridine has an increased affinity for the HIV Rev response element (RRE). In some embodiments, the guanidine analog (guanidinoglycoside) of the aminoglycoside ligand is tethered to the RNA silencing agent. In guanidinoglycosides, the amine group on the amino acid is replaced with a guanidine group. The attachment of the guanidine analog can enhance the cell permeability of the RNA silencing agent. The tethered ligand can be a poly-arginine peptide, peptoid, or peptidomimetic that can enhance cellular uptake of an oligonucleotide agent.

[0174] Exemplary ligands are directly or indirectly bound to the ligand-conjugated carrier, typically covalently, via an intervening tether. In exemplary embodiments, the ligands are bound to the carrier via an intervening tether. In exemplary embodiments, the ligands modify the distribution, targeting or life span of the RNA silencing agent incorporated therein. In exemplary embodiments, the ligands provide enhanced affinity to selected targets, such as molecules, cells or cell types, compartments, such as cell or organ compartments, tissues, organs or body regions, for example, compared to species lacking such ligands.

[0175] Exemplary ligands can improve the transport, hybridization and specificity properties, and can also improve the nuclease resistance of the resulting natural or modified RNA silencing agent or polymer molecule comprising any combination of monomers and / or natural or modified ribonucleotides described herein. Ligands can generally include therapeutic modifiers, for example, for enhancing uptake; diagnostic compounds or reporter groups, for example, for monitoring distribution; cross-linking agents; nuclease resistance-conferring moieties; and natural or unconventional nucleobases. Common examples include lipophilic substances, lipids, steroids (e.g., uvaol, hesigenin, diosgenin), terpenes (e.g., triterpenes, such as sarsasapogenin, friedelin, epifriederanol-derivatized lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binding agents, integrin targeting molecules, polycationic substances, peptides, polyamines, and peptidomimetics. Ligands may include naturally occurring substances (e.g., human serum albumin (HSA), low density lipoprotein (LDL) or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); amino acids or lipids. Ligands may also be recombinant or synthetic molecules such as synthetic polymers, e.g., synthetic polyamino acids. Examples of polyamino acids include polyamino acids that are polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic anhydride copolymers, poly(L-lactide-co-glycolide) copolymers, divinyl ether-maleic anhydride copolymers, N-(2-hydroxypropyl) methacrylamide copolymers (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethanes, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers or polyphosphazines.Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidines, protamines, cationic lipids, cationic porphyrins, quaternary salts of polyamines or alpha-helical peptides.

[0176] Ligands may also include targeting groups, such as cell or tissue targeting agents, such as lectins, glycoproteins, lipids or proteins, such as antibodies that bind to specific cell types, such as kidney cells. The targeting group may be thyrotropin, melanocyte stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamates, polyaspartates, lipids, cholesterol, steroids, bile acids, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic. Other examples of ligands include dyes, intercalating agents (e.g., acridine and substituted acridines), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lys-tyr-lys tripeptides, aminoglycosides, guanidinium aminoglycosides, artificial endonucleases (e.g., EDTA), lipophilic molecules such as cholesterol (and its thio analogues), cholic acid, cholanic acid, lithocholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, bis or tris fatty acid esters, e.g., C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 Or C 20fatty acids) and their ethers, e.g. C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 Or C 20 alkyl; e.g., 1,3-bis-O(hexadecyl)glycerol, 1,3-bis-O(octadecyl)glycerol), geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (e.g., antennape di-peptides, Tat peptides), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraaza macrocycles of Eu 3+ complex), dinitrophenyl, HRP or AP.

[0177] Ligands can be proteins, e.g., glycoproteins or peptides, e.g., molecules with specific affinity for co-ligands or antibodies, e.g., antibodies that bind to specific cell types, e.g., cancer cells, endothelial cells, or bone cells. Ligands can also include hormones and hormone receptors. They can also include lipids, lectins, carbohydrates, vitamins, cofactors, non-peptidic species, such as multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. Ligands can be, for example, lipopolysaccharides, activators of p38 MAP kinase, or activators of NF-κB.

[0178] The ligand can be a substance, such as a drug, that can increase the uptake of the RNA silencing agent into cells, for example by disrupting the cytoskeleton of cells, for example by disrupting the microtubules, microfilaments and / or intermediate filaments of cells.The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine or myoservin.The ligand can increase the uptake of the RNA silencing agent into cells, for example, by activating inflammatory response.Exemplary ligands that will have such an effect include tumor necrosis factor (TNFα), interleukin-1 beta or gamma interferon.

[0179] In one aspect, the ligand is a lipid or lipid-based molecule. Such lipid or lipid-based molecules usually bind to serum proteins, such as human serum albumin (HSA). HSA binding to the ligand allows the distribution of the conjugate to target tissues, such as non-renal target tissues of the body. For example, the target tissue can be the liver, including liver parenchymal cells. Other molecules that can bind to HSA can also be used as ligands. For example, neproxin or aspirin can be used. The lipid or lipid-based ligand can (a) increase the resistance of the conjugate to degradation, (b) increase targeting or transport to target cells or cell membranes, and / or (c) be used to regulate binding to serum proteins, such as HSA. The lipid-based ligand can be used to regulate, e.g., control, the binding of the conjugate to the target tissue. In certain embodiments, the lipid-based ligand binds to HSA. However, it is desired that the affinity is not so strong that the HSA ligand binding cannot be reversed. In another exemplary embodiment, the lipid-based ligand binds weakly or never to HSA.

[0180] In another embodiment, the ligand is a moiety, such as a vitamin, that is taken up by target cells, such as proliferating cells. These are particularly useful for treating disorders characterized by unwanted cell proliferation, such as malignant or non-malignant types, such as cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low density lipoprotein (LDL).

[0181] In another aspect, the ligand is a cell-penetrating agent, typically a helical cell-penetrating agent. In certain exemplary embodiments, the agent is amphipathic. An exemplary agent is a peptide, such as tat or antennapedia. If the agent is a peptide, it can be modified, including peptidomimetics, invertomers, non-peptide or pseudopeptide bonds, and the use of D-amino acids. Helical agents are usually alpha-helical agents, typically having a lipophilic face and a lipophobic face.

[0182] The ligand can be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules that can fold into a defined three-dimensional structure similar to natural peptides. Attachment of peptides and peptidomimetics to oligonucleotide agents can affect the pharmacokinetic distribution of RNA silencing agents, such as by enhancing cellular recognition and uptake. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. The peptide or peptidomimetic can be, for example, a cell penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimeric peptide, a regulated peptide, or a cross-linked peptide. The peptide moiety can be an L-peptide or a D-peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocating sequence (MTS). The peptide or peptidomimetic may be encoded by a random sequence of DNA, such as a peptide identified from a phage display library or a one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature 354:82-84, 1991). In an exemplary embodiment, the peptide or peptidomimetic tethered to the RNA silencing agent via an incorporated monomeric unit is a cell targeting peptide, such as an arginine-glycine-aspartic acid (RGD)-peptide or RGD mimic. The peptide portion may range in length from about 5 amino acids to about 40 amino acids. The peptide portion may have structural modifications, for example, to increase stability or induce conformational properties. Any of the structural modifications described below may be utilized.

[0183] 6) Hydrophobic part In certain embodiments of the RNA silencing agent (e.g., siRNA) provided herein, the RNA silencing agent is conjugated to one or more hydrophobic moieties (see International Publication No. WO 2018 / 031933, which is incorporated herein by reference). In some embodiments, the hydrophobic moiety has affinity for low density lipoprotein and / or intermediate density lipoprotein. In related embodiments, the hydrophobic moiety is a saturated or unsaturated moiety with less than three double bonds.

[0184] In another embodiment, the hydrophobic moiety has an affinity for high density lipoprotein. In a related embodiment, the hydrophobic moiety is a polyunsaturated moiety having three or more double bonds (e.g., having 3, 4, 5, 6, 7, 8, 9, or 10 double bonds). In a particular embodiment, the hydrophobic moiety is a polyunsaturated moiety having three double bonds. In a particular embodiment, the hydrophobic moiety is a polyunsaturated moiety having four double bonds. In a particular embodiment, the hydrophobic moiety is a polyunsaturated moiety having five double bonds. In a particular embodiment, the hydrophobic moiety is a polyunsaturated moiety having six double bonds.

[0185] In another embodiment, the hydrophobic moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides and nucleoside analogs, and endocannabinoids.

[0186] In another embodiment, the hydrophobic moiety is a neuromodulatory lipid, such as an endocannabinoid. Non-limiting examples of endocannabinoids include anandamide, arachidonoylethanolamine, 2-arachidonoylglyceryl ether (nolazine ether), 2-arachidonoylglycerol, and N-arachidonoyldopamine.

[0187] In another embodiment, the hydrophobic moiety is an omega-3 fatty acid.Non-limiting examples of omega-3 fatty acids include, but are not limited to, hexadecatrienoic acid (HTA), alpha-linolenic acid (ALA), stearidonic acid (SDA), eicosatrienoic acid (ETE), eicosatetraenoic acid (ETA), eicosapentaenoic acid (EPA, timnodonic acid), heneicosapentaenoic acid (HPA), docosapentaenoic acid (DPA, sardine acid), docosahexaenoic acid (DHA, cervonic acid), tetracosapentaenoic acid and tetracosahexaenoic acid (heric acid).

[0188] In another embodiment, the hydrophobic moiety is an omega-6 fatty acid.Non-limiting examples of omega-6 fatty acids include, but are not limited to, linoleic acid, gamma-linoleic acid (GLA), eicosadienoic acid, dihomo-gamma-linoleic acid (DGLA), arachidonic acid (AA), docosadienoic acid, adrenic acid, docosapentaenoic acid (osbondoic acid), tetracosatetraenoic acid, and tetracosapentaenoic acid.

[0189] In another embodiment, the hydrophobic moiety is an omega-9 fatty acid. Non-limiting examples of omega-9 fatty acids include, but are not limited to, oleic acid, eicosenoic acid, mead acid, erucic acid, and nervonic acid.

[0190] In another embodiment, the hydrophobic moiety is a conjugated linoleic acid. Non-limiting examples of conjugated linoleic acid include, but are not limited to, α-calendic acid, β-calendic acid, jacaric acid, α-eleostearic acid, β-eleostearic acid, catarpic acid, and punicic acid.

[0191] In another embodiment, the hydrophobic moiety is a saturated fatty acid. Non-limiting examples of saturated fatty acids include, but are not limited to, caprylic acid, capric acid, docosanoic acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, behenic acid, lignoceric acid, and cerotic acid.

[0192] In another embodiment, the hydrophobic moiety is an acid selected from the group consisting of lumellenic acid, α-parinaric acid, β-parinaric acid, boseopentaenoic acid, pinolenic acid, and podocarpic acid.

[0193] In another embodiment, the hydrophobic moiety is selected from the group consisting of docosanoic acid (DCA), docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA). In a particular embodiment, the hydrophobic moiety is docosanoic acid (DCA). In another particular embodiment, the hydrophobic moiety is DHA. In another particular embodiment, the hydrophobic moiety is EPA.

[0194] In another embodiment, the hydrophobic moiety is a secosteroid. In a particular embodiment, the hydrophobic moiety is calciferol. In another embodiment, the hydrophobic moiety is a steroid other than cholesterol.

[0195] In certain embodiments, the hydrophobic moiety is not cholesterol.

[0196] In another embodiment, the hydrophobic moiety is an alkyl chain, a vitamin, a peptide, or a bioactive conjugate, including but not limited to, a glycosphingolipid, a polyunsaturated fatty acid, a secosteroid, a steroid hormone, or a sterol lipid.

[0197] In one embodiment, the oligonucleotide provided herein is a double-stranded RNA that comprises one or more chemically modified nucleotides. In certain embodiments, the double-stranded RNA comprises 2'-methoxy-nucleotides and 2'-fluoro-nucleotides. In certain embodiments, the double-stranded RNA comprises 2'-methoxy-nucleotides and 2'-deoxynucleotides. In certain embodiments, the double-stranded RNA comprises 2'-methoxy-nucleotides and 2'-ribose. In certain embodiments, the double-stranded RNA is completely chemically modified and comprises 2'-methoxy-nucleotides at all positions except positions 2 and 14 from the 5' end of the antisense strand.

[0198] In one embodiment, the oligonucleotide provided herein is a double-stranded RNA comprising one or more nucleotides linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the nucleotides at positions 1 and 2 from the 5' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the nucleotides at positions 1-8 from the 3' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the nucleotides at positions 1, 2 and 3 from the 5' end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the nucleotides at positions 1, 2 and 3 from the 3' end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds.

[0199] In one embodiment of the double stranded RNA provided herein, (1) the first oligonucleotide is fully chemically modified and contains 2'-methoxy-nucleotides at all positions except positions 2 and 14 from the 5' end of the antisense strand; (2) is fully chemically modified and contains 2'-methoxy-nucleotides at all positions; (3) the nucleotides of the first oligonucleotide are linked to adjacent nucleotides via phosphodiester or phosphorothioate bonds, and the nucleotides at positions 1-2 from the 5' end and / or positions 1-8 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds; and (4) The nucleotides of the second oligonucleotide are linked to adjacent nucleotides via phosphodiester or phosphorothioate bonds, and the nucleotides at positions 1, 2, and 3 from the 3' end and / or positions 1, 2, and 3 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds.

[0200] In one embodiment of the double-stranded RNA, the first oligonucleotide has 3 to 7 more ribonucleotides than the second oligonucleotide.

[0201] In one embodiment, the first oligonucleotide is the antisense strand and the second oligonucleotide is the sense strand.

[0202] 7) Branched oligonucleotides Two or more RNA silencing agents, such as oligonucleotide constructs, such as siRNAs, as disclosed above, can be linked together by one or more moieties independently selected from linkers, spacers, and branching points, thereby forming a branched oligonucleotide containing two or more RNA silencing agents. Figure 15 shows an exemplary di-siRNA bibranched backbone for delivering two siRNAs. In a representative embodiment, the nucleic acids of the branched oligonucleotide each comprise an antisense strand (or a portion thereof), and the antisense strand has sufficient complementarity to a heterozygous single nucleotide polymorphism to mediate an RNA-mediated silencing mechanism (e.g., RNAi). In another embodiment, a second type of branched oligonucleotide is provided, characterized by a nucleic acid comprising a sense strand (or a portion thereof) for silencing an antisense transcript, and the sense strand has sufficient complementarity to an antisense transcript to mediate an RNA-mediated silencing mechanism. In a further embodiment, a third type of branched oligonucleotide is provided, comprising a nucleic acid comprising both types of nucleic acids, i.e., an oligonucleotide comprising an antisense strand (or a portion thereof) and a sense strand (or a portion thereof).

[0203] In exemplary embodiments, the branched oligonucleotides may have 2-8 RNA silencing agents attached through a linker. The linker may be hydrophobic. In certain embodiments, the branched oligonucleotides of the present application have 2-3 oligonucleotides. In one embodiment, the oligonucleotides have substantial chemical stabilization, independently (e.g., at least 40% of the component bases are chemically modified). In certain embodiments, the oligonucleotides have complete chemical stabilization (i.e., all of the component bases are chemically modified). In some embodiments, the branched oligonucleotides include one or more single-stranded phosphorothioate tails, each independently having 2-20 nucleotides. In certain embodiments, each single-stranded tail has 8-10 nucleotides.

[0204] In certain embodiments, branched oligonucleotides are characterized by three properties: (1) branched structure, (2) complete metabolic stabilization, and (3) the presence of a single-stranded tail that includes a phosphorothioate linker. In certain embodiments, branched oligonucleotides have two or three branches. It is believed that the increase in overall size of the branched structure promotes increased uptake. Also, without being bound to a particular theory of activity, it is believed that multiple adjacent branches (e.g., two or three) can allow each branch to act cooperatively, thus dramatically increasing the rate of internalization, transport, and release.

[0205] Branched oligonucleotides are provided in a variety of structurally diverse embodiments. For example, in some embodiments, the nucleic acid attached at the branch point is single-stranded and consists of miRNA inhibitors, gapmers, mixmers, SSOs, PMOs, or PNAs, as shown in Figure 36. These single strands can be attached at their 3' or 5' ends. A combination of siRNA and single-stranded oligonucleotides can also be used for dual functions. In another embodiment, short nucleic acids complementary to gapmers, mixmers, miRNA inhibitors, SSOs, PMOs, and PNAs are used to carry these active single-stranded nucleic acids and enhance distribution and cellular internalization. The short double-stranded region has a low melting temperature (Tm approx. 37°C) for rapid dissociation upon internalization of the branched structure into cells.

[0206] As shown in Figure 17, di-siRNA branched oligonucleotides can contain chemically diverse conjugates. Conjugated bioactive ligands can be used to enhance cell specificity and promote membrane association, internalization and serum protein binding. Examples of bioactive moieties that will be used for conjugation include DHAg2, DHA, GalNAc and cholesterol. These moieties can be attached to di-siRNA either through a linker or spacer, or can be added via an additional linker or spacer attached to another free siRNA end.

[0207] The presence of branched structure improves the level of tissue retention in the brain by more than 100 times compared with the unbranched compound of the same chemical composition, suggesting a new mechanism of cell retention and distribution.Unexpectedly, branched oligonucleotides have uniform distribution throughout the spinal cord and brain.In addition, unexpectedly, branched oligonucleotides show efficient systemic delivery to various tissues and very high levels of tissue accumulation.

[0208] Branched oligonucleotides include a variety of therapeutic nucleic acids, including ASO, miRNA, miRNA inhibitors, splice switching, PMO, PNA. In some embodiments, the branched oligonucleotides further comprise a conjugated hydrophobic moiety and exhibit unprecedented silencing and efficacy in vitro and in vivo.

[0209] Linker In certain embodiments of the branched oligonucleotide, each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, has a hydroxyl substituent, or has an oxo substituent. In one embodiment, each linker is an ethylene glycol chain. In another embodiment, each linker is an alkyl chain. In another embodiment, each linker is a peptide. In another embodiment, each linker is RNA. In another embodiment, each linker is DNA. In another embodiment, each linker is a phosphate. In another embodiment, each linker is a phosphonate. In another embodiment, each linker is a phosphoramidate. In another embodiment, each linker is an ester. In another embodiment, each linker is an amide. In another embodiment, each linker is a triazole. In another embodiment, each linker is a structure selected from the formulas of FIG. 17.

[0210] In another aspect, the present invention provides a compound of formula (I): L-(N) n (I) wherein L is selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, and formula (I) optionally further comprises one or more branch points B and one or more spacers S; B, independently for each occurrence, is a polyvalent organic species or a derivative thereof; S, independently for each occurrence, is selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; N is an RNA duplex comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity substantially complementary to a region of a gene comprising an allelic polymorphism, the antisense strand comprising a single nucleotide polymorphism (SNP) position nucleotide located 2-7 from the 5' end that is complementary to the allelic polymorphism; and a mismatch (MM) position nucleotide located 2-11 nucleotides from the SNP position nucleotide that is mismatched to a nucleotide in the gene. In an exemplary embodiment, the SNP position nucleotide is at position 2, 4 or 6 from the 5' end, and the mismatch (MM) position nucleotide is located 2-6 nucleotides from the SNP position nucleotide.

[0211] The sense strand and the antisense strand each independently comprise one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8.

[0212] In certain embodiments, the compound of formula (I) has a structure selected from formulas (I-1) to (I-9) in Table 1.

[0213] [Table 1]

[0214] In one embodiment, the compound of formula (I) is formula (I-1). In another embodiment, the compound of formula (I) is formula (I-2). In another embodiment, the compound of formula (I) is formula (I-3). In another embodiment, the compound of formula (I) is formula (I-4). In another embodiment, the compound of formula (I) is formula (I-5). In another embodiment, the compound of formula (I) is formula (I-6). In another embodiment, the compound of formula (I) is formula (I-7). In another embodiment, the compound of formula (I) is formula (I-8). In another embodiment, the compound of formula (I) is formula (I-9).

[0215] In some embodiments of the compound of formula (I), each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, has a hydroxyl substituent, or has an oxo substituent. In one embodiment of the compound of formula (I), each linker is an ethylene glycol chain. In another embodiment, each linker is an alkyl chain. In another embodiment of the compound of formula (I), each linker is a peptide. In another embodiment of the compound of formula (I), each linker is an RNA. In another embodiment of the compound of formula (I), each linker is a DNA. In another embodiment of the compound of formula (I), each linker is a phosphate. In another embodiment, each linker is a phosphonate. In another embodiment of the compound of formula (I), each linker is a phosphoramidate. In another embodiment of the compound of formula (I), each linker is an ester. In another embodiment of the compound of formula (I), each linker is an amide. In another embodiment of the compound of formula (I), each linker is a triazole. In another embodiment of the compound of formula (I), each linker is a structure selected from the formulas in Figure 36.

[0216] In one embodiment of the compound of formula (I), B is a polyvalent organic species. In another embodiment of the compound of formula (I), B is a derivative of a polyvalent organic species. In one embodiment of the compound of formula (I), B is a triol or tetraol derivative. In another embodiment, B is a tri- or tetra-carboxylic acid derivative. In another embodiment, B is an amine derivative. In another embodiment, B is a tri- or tetra-amine derivative. In another embodiment, B is an amino acid derivative. In another embodiment of the compound of formula (I), B is selected from the formulae of FIG. 18.

[0217] Polyvalent organic species are moieties that contain carbon and three or more valencies (i.e., points of attachment to moieties such as S, L, or N as defined above). Non-limiting examples of polyvalent organic species include triols (e.g., glycerol, phloroglucinol, etc.), tetraols (e.g., ribose, pentaerythritol, 1,2,3,5-tetrahydroxybenzene, etc.), tri-carboxylic acids (e.g., citric acid, 1,3,5-cyclohexanetricarboxylic acid, trimesic acid, etc.), tetra-carboxylic acids (e.g., ethylenediaminetetraacetic acid, pyromellitic acid, etc.), tertiary amines (e.g., tripropargylamine, triethanolamine, etc.), triamines (e.g., diethylenetriamine, etc.), tetramines, and species that contain combinations of hydroxyl, thiol, amino, and / or carboxyl moieties (e.g., amino acids such as lysine, serine, cysteine, etc.).

[0218] In some embodiments of the compound of formula (I), each nucleic acid comprises one or more chemically modified nucleotides. In some embodiments of the compound of formula (I), each nucleic acid consists of chemically modified nucleotides. In certain embodiments of the compound of formula (I), >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of each nucleic acid comprises chemically modified nucleotides.

[0219] In certain embodiments of the compound of formula (I), at least one oligonucleotide (e.g., antisense strand) is fully stabilized or nearly fully stabilized. In certain embodiments of the compound of formula (I), at least one oligonucleotide (e.g., antisense strand) is fully stabilized or nearly fully stabilized. In certain embodiments of the compound of formula (I), at least one oligonucleotide (e.g., antisense strand) comprises at least 85% 2'-O-methyl. In certain embodiments of the compound of formula (I), each nucleic acid comprises at least 85% 2'-O-methyl. In certain embodiments of the compound of formula (I), each nucleic acid comprises at least 90% 2'-O-methyl. In certain embodiments of the compound of formula (I), each nucleic acid comprises at least 85% 2'-O-methyl, and at least one or each antisense strand comprises non-2'-O-methyl at positions 2 and 14 from the 5' end of the antisense strand and optionally at position 20. In certain embodiments of compounds of Formula (I), each nucleic acid comprises at least 85%, 90% or 95% 2'-O-methyl, at least one or each antisense strand comprises non-2'-O-methyl at positions 2 and 14 and optionally position 20 from the 5' end of the antisense strand, and the sense strand is fully 2'-O-methyl modified.

[0220] In one embodiment, each antisense strand independently comprises a 5'-terminal group R selected from the groups in Table 2.

[0221] [Table 2]

[0222] In one embodiment, R is R1. In another embodiment, R is R2. In another embodiment, R is R3. In another embodiment, R is R4. In another embodiment, R is R5. In another embodiment, R is R6. In another embodiment, R is R7. In another embodiment, R is R8.

[0223] Structure of Formula (II) In an embodiment, the compound of formula (I) has the formula (II): [ka] wherein X, independently for each occurrence, is selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; Y, independently for each occurrence, is selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - represents a phosphodiester internucleoside linkage; = represents a phosphorothioate internucleoside linkage; and ---, independently for each occurrence, represents a base pairing interaction or a mismatch. This is the structure.

[0224] In certain embodiments, the structure of formula (II) contains no mismatches. In one embodiment, the structure of formula (II) contains one mismatch. In another embodiment, the compound of formula (II) contains two mismatches. In another embodiment, the compound of formula (II) contains three mismatches. In another embodiment, the compound of formula (II) contains four mismatches. In an embodiment, each nucleic acid is comprised of chemically modified nucleotides.

[0225] In certain embodiments, 100%, >95%, >90% or >85% of the X's in the structure of formula (II) are chemically modified nucleotides.

[0226] Structure of formula (III) In an embodiment, the compound of formula (I) has formula (III): [ka] (In the formula, [ka] is, independently for each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; X is, independently for each occurrence, a nucleotide that includes a 2'-O-methyl modification; [ka] is, independently for each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y is, independently for each occurrence, a nucleotide that includes a 2'-O-methyl modification. It has the structure:

[0227] In certain embodiments, X is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In certain embodiments, X is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine. In certain embodiments, Y is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In certain embodiments, Y is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine.

[0228] In certain embodiments, the structure of formula (III) contains no mismatches. In one embodiment, the structure of formula (III) contains one mismatch. In another embodiment, the compound of formula (III) contains two mismatches. In another embodiment, the compound of formula (III) contains three mismatches. In another embodiment, the compound of formula (III) contains four mismatches.

[0229] Structure of formula (IV) In an embodiment, the compound of formula (I) has formula (IV): [ka] wherein X, independently for each occurrence, is selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; Y, independently for each occurrence, is selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - represents a phosphodiester internucleoside linkage; = represents a phosphorothioate internucleoside linkage; and ---, independently for each occurrence, represents a base pairing interaction or a mismatch. It has the structure:

[0230] In certain embodiments, the structure of formula (IV) contains no mismatches. In one embodiment, the structure of formula (IV) contains one mismatch. In another embodiment, the compound of formula (IV) contains two mismatches. In another embodiment, the compound of formula (IV) contains three mismatches. In another embodiment, the compound of formula (IV) contains four mismatches. In an embodiment, each nucleic acid is comprised of chemically modified nucleotides.

[0231] In certain embodiments, the structure of formula (IV) does not contain a mismatch. In one embodiment, the structure of formula (IV) contains one mismatch. In another embodiment, the compound of formula (IV) contains two mismatches. In another embodiment, the compound of formula (IV) contains three mismatches. In another embodiment, the compound of formula (IV) contains four mismatches.

[0232] In certain embodiments, 100%, >95%, >90% or >85% of the X's in the structure of formula (IV) are chemically modified nucleotides.

[0233] Structure of formula (V) In an embodiment, the compound of formula (I) has the formula (V): [ka] (In the formula, [ka] is, independently for each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; X is, independently for each occurrence, a nucleotide that includes a 2'-O-methyl modification; [ka] is, independently for each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y is, independently for each occurrence, a nucleotide that includes a 2'-O-methyl modification. It has the structure:

[0234] In certain embodiments, X is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, X is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine.

[0235] In one embodiment, the compound of formula (I) has the structure of formula (Va), which is L-[siRNA]n, and the siRNA comprises any one or more of patterns 1A-F described herein. In certain embodiments, each siRNA of formula (Va) is identical. In certain embodiments, each siRNA of formula (Va) is not identical.

[0236] Flexible Linker In certain embodiments of a compound of Formula (I), L is L1: [ka] It has the structure:

[0237] In certain embodiments of L, R is R 3 and n is 2.

[0238] In some embodiments of the structure of formula (II), L has the structure of L1. In some embodiments of the structure of formula (III), L has the structure of L1. In some embodiments of the structure of formula (IV), L has the structure of L1. In some embodiments of the structure of formula (V) or (Va), L has the structure of L1. In some embodiments of the structure of formula (VI), L has the structure of L1. In some embodiments of the structure of formula (VI), L has the structure of L1.

[0239] In certain embodiments of a compound of Formula (I), L is L2: [ka] It has the structure:

[0240] In certain embodiments of L2, R is R 3 and n is 2. In some embodiments of the structure of Formula (II), L has the structure of L2. In some embodiments of the structure of Formula (III), L has the structure of L2. In some embodiments of the structure of Formula (IV), L has the structure of L2. In some embodiments of the structure of Formula (V) or (Va), L has the structure of L2. In some embodiments of the structure of Formula (VI), L has the structure of L2. In some embodiments of the structure of Formula (VI), L has the structure of L2.

[0241] 10) Delivery system In a further aspect, the present specification provides a compound of formula (VI): L-(cNA) n (VI) wherein L is selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, and formula (VI) optionally further comprises one or more branch points B and one or more spacers S; B is, independently for each occurrence, a polyvalent organic species or a derivative thereof; S is, independently for each occurrence, selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; each cNA is independently a carrier nucleic acid comprising one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8. A delivery system for therapeutic nucleic acids is provided having the structure:

[0242] In one embodiment of the delivery system, L is an ethylene glycol chain. In another embodiment of the delivery system, L is an alkyl chain. In another embodiment of the delivery system, L is a peptide. In another embodiment of the delivery system, L is RNA. In another embodiment of the delivery system, L is DNA. In another embodiment of the delivery system, L is a phosphate. In another embodiment of the delivery system, L is a phosphonate. In another embodiment of the delivery system, L is a phosphoramidate. In another embodiment of the delivery system, L is an ester. In another embodiment of the delivery system, L is an amide. In another embodiment of the delivery system, L is a triazole.

[0243] In one embodiment of the delivery system, S is an ethylene glycol chain. In another embodiment, S is an alkyl chain. In another embodiment of the delivery system, S is a peptide. In another embodiment, S is RNA. In another embodiment of the delivery system, S is DNA. In another embodiment of the delivery system, S is a phosphate. In another embodiment of the delivery system, S is a phosphonate. In another embodiment of the delivery system, S is a phosphoramidate. In another embodiment of the delivery system, S is an ester. In another embodiment, S is an amide. In another embodiment, S is a triazole.

[0244] In one embodiment of the delivery system, n is 2. In another embodiment of the delivery system, n is 3. In another embodiment of the delivery system, n is 4. In another embodiment of the delivery system, n is 5. In another embodiment of the delivery system, n is 6. In another embodiment of the delivery system, n is 7. In another embodiment of the delivery system, n is 8.

[0245] In certain embodiments, each cNA comprises >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% chemically modified nucleotides. In certain embodiments, each cNA is completely or nearly completely chemically modified at the 2' position and at least 85% are 2'-O-methyl modified.

[0246] In one embodiment, the compound of formula (VI) has a structure selected from formulas (VI-1) to (VI-9) in Table 3.

[0247] [Table 3]

[0248] In certain embodiments, the compound of formula (VI) has a structure of formula (VI-1). In certain embodiments, the compound of formula (VI) has a structure of formula (VI-2). In certain embodiments, the compound of formula (VI) has a structure of formula (VI-3). In certain embodiments, the compound of formula (VI) has a structure of formula (VI-4). In certain embodiments, the compound of formula (VI) has a structure of formula (VI-5). In certain embodiments, the compound of formula (VI) has a structure of formula (VI-6). In certain embodiments, the compound of formula (VI) has a structure of formula (VI-7). In certain embodiments, the compound of formula (VI) has a structure of formula (VI-8). In certain embodiments, the compound of formula (VI) has a structure of formula (VI-9).

[0249] In some embodiments, the compound of formula (VI) (e.g., including formulas (VI-1) to (VI-9)), each cNA independently comprises at least 15 consecutive nucleotides. In some embodiments, each cNA independently comprises chemically modified nucleotides.

[0250] In an embodiment, the delivery system further comprises n therapeutic nucleic acids (NAs), each NA comprising a region of complementarity substantially complementary to a region of the target gene. Also, each NA is hybridized to at least one cNA. In one embodiment, the delivery system is comprised of 2 NAs. In another embodiment, the delivery system is comprised of 3 NAs. In another embodiment, the delivery system is comprised of 4 NAs. In another embodiment, the delivery system is comprised of 5 NAs. In another embodiment, the delivery system is comprised of 6 NAs. In another embodiment, the delivery system is comprised of 7 NAs. In another embodiment, the delivery system is comprised of 8 NAs.

[0251] In some embodiments, each NA independently comprises at least 16 consecutive nucleotides. In some embodiments, each NA independently comprises 16 to 20 consecutive nucleotides. In some embodiments, each NA independently comprises 16 consecutive nucleotides. In another embodiment, each NA independently comprises 17 consecutive nucleotides. In another embodiment, each NA independently comprises 18 consecutive nucleotides. In another embodiment, each NA independently comprises 19 consecutive nucleotides. In another embodiment, each NA independently comprises 20 consecutive nucleotides.

[0252] In some embodiments, each NA comprises an unpaired overhang of at least 2 nucleotides. In another embodiment, each NA comprises an unpaired overhang of at least 3 nucleotides. In another embodiment, each NA comprises an unpaired overhang of at least 4 nucleotides. In another embodiment, each NA comprises an unpaired overhang of at least 5 nucleotides. In another embodiment, each NA comprises an unpaired overhang of at least 6 nucleotides. In some embodiments, the nucleotides of the overhang are linked via phosphorothioate bonds.

[0253] In some embodiments, each NA is independently selected from the group consisting of DNA, siRNA, antagomir, miRNA, gapmer, mixmer, or guide RNA. In one embodiment, each NA is independently DNA. In another embodiment, each NA is independently antagomir. In another embodiment, each NA is independently miRNA. In another embodiment, each NA is independently gapmer. In another embodiment, each NA is independently mixmer. In another embodiment, each NA is independently guide RNA. In some embodiments, each NA is the same. In some embodiments, each NA is not the same.

[0254] In some embodiments, the delivery system further comprising n therapeutic nucleic acids (NA) has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) and embodiments thereof as described herein. In one embodiment, the delivery system further comprises two therapeutic nucleic acids (NA), and has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) and embodiments thereof as described herein. In another embodiment, the delivery system further comprises three therapeutic nucleic acids (NA), and has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) and embodiments thereof as described herein. In one embodiment, the delivery system further comprises four therapeutic nucleic acids (NA), and has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) and embodiments thereof as described herein. In one embodiment, the delivery system has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) and embodiments thereof described herein further comprising five therapeutic nucleic acids (NAs). In one embodiment, the delivery system has a structure selected from formula (I), (II), (III), (IV), (V), (VI) and embodiments thereof described herein further comprising six therapeutic nucleic acids (NAs). In one embodiment, the delivery system has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) and embodiments thereof described herein further comprising seven therapeutic nucleic acids (NAs). In one embodiment, the delivery system has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) and embodiments thereof described herein further comprising eight therapeutic nucleic acids (NAs).

[0255] In one embodiment, the delivery system has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) further comprising a linker of structure L1 or L2, where R is R3, and n is 2. In another embodiment, the delivery system has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) further comprising a linker of structure L1, where R is R3, and n is 2. In another embodiment, the delivery system has a structure selected from formula (I), (II), (III), (IV), (V), (Va), (VI) further comprising a linker of structure L2, where R is R3, and n is 2.

[0256] Pharmaceutical Compositions and Methods of Administration In one aspect, provided herein is a pharmaceutical composition comprising a therapeutically effective amount of one or more RNA silencing agents (e.g., siRNA) as described herein and a pharma- ceutically acceptable carrier. In another particular embodiment, the pharmaceutical composition comprises a compound of Formula I-VI as described herein and a pharma- ceutically acceptable carrier.

[0257] The present invention relates to the use of the above-mentioned agents for preventive and / or therapeutic treatment as described herein. Therefore, the modulators (e.g., siRNA agents) of the present invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically include nucleic acid molecules, proteins, antibodies or modulatory compounds and pharmaceutically acceptable carriers. The phrase "pharmaceutically acceptable carriers" as used herein is intended to include any solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional media or agent is incompatible with the active compound, its use in the composition is intended. Supplementary active compounds can also be incorporated into the composition.

[0258] The pharmaceutical composition of the present invention is formulated to suit its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous (IV), intradermal, subcutaneous (SC or SQ), intraperitoneal, intramuscular, oral (e.g., inhalation), transdermal (topical) and transmucosal administration. Solutions or suspensions used for parenteral, intradermal or subcutaneous application may contain the following components: a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates, phosphates and agents for adjusting osmolality such as sodium chloride or glucose. The pH may be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Parenteral formulations may be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

[0259] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Suitable carriers for intravenous administration include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0260] Sterile solution for injection can be prepared by incorporating the active compound in the required amount in a suitable solvent with one or combination of the components listed above as necessary, and then carrying out sterilization filtration.Generally, dispersion is prepared by incorporating active compound in a sterile solvent that contains a basic dispersion medium and other necessary components from those listed above.In the case of sterile powder for preparing sterile solution for injection, exemplary preparation methods are vacuum drying and freeze-drying, which produce powder of active ingredient and any additional desired ingredients from their solution that has been previously sterilized and filtered.

[0261] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example to determine the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50 / ED50. Compounds that exhibit large therapeutic indices are particularly suitable. Compounds that exhibit toxic side effects may be used, but care should be taken to design a delivery system that targets such compounds to the site of the affected tissue and reduces side effects by minimizing potential damage to non-infected cells.

[0262] Data obtained from cell culture assays and animal studies can be used in formulating a range of dosages for use in humans. The dosage of such compounds is usually within a range of circulating concentrations that includes the ED50 with little or no toxicity. Dosages can vary within this range depending on the dosage form used and the route of administration utilized. For any compound used in the methods of the present invention, a therapeutically effective dose can be estimated initially from cell culture assays. Doses can be formulated in animal models to achieve a circulating plasma concentration range that includes the EC50 (i.e., the concentration of the test compound that achieves a half-maximal response) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Plasma levels can be measured, for example, by high performance liquid chromatography.

[0263] Treatment method In one aspect, both prophylactic and therapeutic methods of treating a subject at risk for (or susceptible to) a disease or disorder are provided.

[0264] As used herein, "treatment" or "treating" is defined as the application or administration of a therapeutic agent (e.g., an RNA agent or vector or transgene encoding same) to a patient or to an isolated tissue or cell line derived from a patient having a disease or disorder, a symptom of a disease or disorder, or a predisposition to a disease or disorder, to cure, remedy, alleviate, alter, correct, ameliorate, improve or affect the disease or disorder, a symptom of a disease or disorder, or a predisposition to a disease or disorder.

[0265] In certain embodiments, the present invention provides a method for treating a disease or disorder of the central nervous system with the oligonucleotide of the present disclosure. The oligonucleotide, for example the antisense strand of the double-stranded nucleic acid, can have sufficient complementarity to a target gene related to a disease or disorder of the central nervous system. In certain embodiments, the target gene is Htt, ApoE or C9ORF72. In certain embodiments, the disease or disorder of the central nervous system is Huntington's disease, amyotrophic lateral sclerosis (ALS) or Alzheimer's disease.

[0266] In one aspect, the present invention provides a method for preventing a disease or disorder in a subject, as described above, by administering a therapeutic agent (e.g., an RNAi agent or vector or a transgene encoding the same) to the subject. Subjects at risk of the disease can be identified, for example, by any or a combination of diagnostic or prognostic assays as described herein. Administration of the prophylactic agent can occur prior to the manifestation of symptoms characteristic of the disease or disorder, such that the disease or disorder is prevented, or alternatively, its progression is delayed.

[0267] Another aspect of the invention relates to a method of therapeutically treating a subject, i.e., altering the onset of symptoms of a disease or disorder. In an exemplary embodiment, the regulatory method of the invention comprises contacting cells expressing a gain-of-function mutant with a therapeutic agent (e.g., an siRNA or a vector or transgene encoding the same) specific for one or more target sequences in the gene, thereby achieving sequence-specific interference with the gene. These methods can be performed in vitro (e.g., by culturing the cells with the agent) or alternatively in vivo (e.g., by administering the agent to a subject).

[0268] Oligonucleotides modified for enhanced neuronal uptake may be administered at less than about 1.4 mg / kg body weight, or less than 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005, or 0.00001 mg / kg body weight and less than 200 nmol of RNA agent (e.g., about 4.4×10 16 The unit dose of the RNA silencing agent may be administered at less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmoles per kg of body weight. The unit dose may be administered, for example, by injection (e.g., intravenously or intramuscularly, intrathecally or directly into the brain), inhalation administration or topical application. Particularly suitable dosages are less than 2, 1 or 0.1 mg / kg of body weight.

[0269] Direct delivery of oligonucleotides to organs can be at doses of about 0.00001 mg to about 3 mg per organ, or about 0.0001 to 0.001 mg per organ, about 0.03 to 3.0 mg per organ, about 0.1 to 3.0 mg per eye, or about 0.3 to 3.0 mg per organ. The dose can be an amount effective to treat or prevent a neurological disease or disorder. In one embodiment, the unit dose is administered less frequently than once a day, for example, less than every 2, 4, 8, or 30 days. In another embodiment, the unit dose is not administered at a certain frequency (e.g., not at a regular frequency). For example, the unit dose can be administered once. In one embodiment, the effective dose is administered in conjunction with other conventional therapeutic modalities.

[0270] In one embodiment, the subject is administered an initial dose and one or more maintenance doses of the oligonucleotide. The maintenance dose is generally less than the initial dose, for example less than half the initial dose. The maintenance regimen may include treating the subject with a dose ranging from 0.01 μg to 1.4 mg / kg of body weight per day, for example 10, 1, 0.1, 0.01, 0.001 or 0.00001 mg / kg of body weight per day. The maintenance dose is usually administered no more than once every 5, 10 or 30 days. Furthermore, the treatment regimen may continue for a period that will vary depending on the nature of the particular disease, its severity and the overall condition of the patient. In certain exemplary embodiments, the dosage may be delivered no more than once per day, for example no more than once per 24, 36 or 48 hours or more, for example no more than once every 5 or 8 days. After treatment, the patient may be monitored for changes in the patient's condition and relief of symptoms of the condition. The dosage of the compound may be increased if the patient does not respond significantly to the current dosage level, or the dosage may be decreased if relief of symptoms of the disease state is observed, the disease state is ablated, or undesirable side effects are observed.

[0271] An effective amount can be administered in a single dose or two or more doses as desired or deemed appropriate under a particular situation. If it is desired to facilitate repeated or frequent infusion, implantation of a delivery device, such as a pump, semi-permanent stent (e.g., intravenous, intraperitoneal, intracapsular or intracapsular) or reservoir may be advisable. In one embodiment, the pharmaceutical composition comprises multiple RNA silencing agent species. In another embodiment, the RNA silencing agent species has a sequence that is not overlapping and not adjacent to another species with respect to the naturally occurring target sequence. In another embodiment, the multiple RNA silencing agent species are specific for different naturally occurring target genes. In another embodiment, the RNA silencing agent is allele specific. In another embodiment, the multiple RNA silencing agent species targets two or more target sequences (e.g., 2, 3, 4, 5, 6 or more target sequences).

[0272] Following successful treatment, it may be desirable for the patient to undergo maintenance therapy to prevent recurrence of the condition, with the compounds of the invention being administered at maintenance doses ranging from 0.01 μg to 100 g per kg of body weight (see U.S. Pat. No. 6,107,094).

[0273] In another aspect, provided herein is a method of treating or managing a disease or disorder comprising administering to a patient in need of such treatment or management a therapeutically effective amount of a compound, oligonucleotide or nucleic acid described herein, or a pharmaceutical composition comprising said compound, oligonucleotide or nucleic acid.

[0274] In certain exemplary embodiments, the composition comprising the RNA silencing agent of the present invention can be delivered to the nervous system of a subject by various routes. Exemplary routes include intrathecal, parenchymal (e.g., intracerebral), nasal and ocular delivery. The composition can also be delivered systemically, for example, by intravenous, subcutaneous or intramuscular injection, which is particularly useful for delivering the RNA silencing agent to peripheral neurons. Exemplary routes of delivery are directly to the brain, for example, the ventricles or hypothalamus of the brain, or to the lateral or dorsal regions of the brain. The RNA silencing agent for neuronal delivery can be incorporated into a pharmaceutical composition suitable for administration.

[0275] For example, the composition may include one or more species of RNA silencing agent and a pharma- ceutically acceptable carrier. The pharmaceutical composition of the present invention may be administered in several ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration may be topical (including ophthalmic, intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip injection, subcutaneous, intraperitoneal or intramuscular injection, intrathecal or intraventricular (e.g., intraventricular) administration. In certain exemplary embodiments, the RNA silencing agent of the present invention is delivered through the blood-brain barrier (BBB) ​​using various suitable compositions and methods described herein.

[0276] The route of delivery may depend on the disorder of the patient.In addition to the siRNA of the present invention, the patient may be administered a second therapy, such as a symptomatic therapy and / or a disease-specific therapy.The second therapy may be, for example, symptomatic (e.g., to reduce symptoms), protective (e.g., to slow or stop disease progression) or restorative (e.g., to reverse disease process).

[0277] The RNA silencing agent can be delivered to the neuronal cells of the brain. A delivery method that does not require the passage of the composition across the blood-brain barrier can be utilized. For example, the pharmaceutical composition containing the RNA silencing agent can be delivered to the patient by direct injection into the area containing the disease-affected cells. For example, the pharmaceutical composition can be delivered by direct injection into the brain. The injection can be by stereotactic injection into a specific area of ​​the brain (e.g., substantia nigra, cortex, hippocampus, striatum or globus pallidus). The RNA silencing agent can be delivered to multiple areas of the central nervous system (e.g., multiple areas of the brain and / or spinal cord). The RNA silencing agent can be delivered to diffuse areas of the brain (e.g., diffuse delivery to the cortex of the brain).

[0278] In one embodiment, the RNA silencing agent can be delivered by means of a cannula or other delivery device with one end implanted in a tissue, for example, the brain, for example, the substantia nigra, cortex, hippocampus, striatum or globus pallidus of the brain. The cannula can be connected to a reservoir of the RNA silencing agent. The flow or delivery can be mediated by a pump, for example, an osmotic pump or a minipump, such as an Alzet pump (Durect, Cupertino, CA). In one embodiment, the pump and reservoir are implanted in an area remote from the tissue, for example, the abdomen, and delivery is performed by a conduit leading from the pump or reservoir to the release site. Devices for delivery to the brain are described, for example, in U.S. Pat. Nos. 6,093,180 and 5,814,014.

[0279] The siRNA of the present invention can be further modified so that it can cross the blood-brain barrier (BBB).For example, the RNA silencing agent can be conjugated to a molecule that allows the agent to cross the barrier.Such modified RNA silencing agent can be administered by any desired method, such as intracerebroventricular or intramuscular injection or pulmonary delivery.

[0280] In certain embodiments, exosomes are used to deliver the RNA silencing agents of the present invention. Exosomes can cross the BBB and can specifically deliver siRNA, antisense oligonucleotides, chemotherapeutic agents and proteins to neurons after systemic injection (Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJ. (2011). Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat Biotechnol. 2011 Apr; 29(4): 341-5. doi: 10.1038 / nbt.1807; El-Andaloussi S, Lee Y, Lakhal-Littleton S, Li J, Seow Y, Gardiner C, Alvarez-Erviti L, Sargent IL, Wood MJ. (2011). Exosome-mediated delivery of siRNA in vitro and in vivo. Nat Protoc. 2012 Dec;7(12):2112-26.doi:10.1038 / nprot.2012.131;EL Andaloussi S,Maeger I,Breakefield XO,Wood MJ.(2013).Extracellular vesicles: biology and emerging therapeutic opportunities.Nat Rev Drug Discov.2013 May;12(5):347-57.doi:10.1038 / nrd3978;El Andaloussi S,Lakhal S,Maeger I,Wood MJ.(2013).Exosomes for targeted siRNA delivery across biological barriers.Adv.Drug Deliv Rev.2013 Mar;65(3):391-7.doi:10.1016 / j.addr.2012.08.008).

[0281] In certain embodiments, one or more lipophilic molecules are used to enable delivery of the RNA silencing agent of the present invention across the BBB (Alvarez-Ervit (2011)). The RNA silencing agent will then be activated, for example by enzymatic degradation of the lipophilic mimic, releasing the drug in its active form.

[0282] In certain embodiments, one or more receptor-mediated permeability compounds can be used to increase the permeability of the BBB to allow the delivery of the RNA silencing agent of the present invention.These drugs temporarily increase the permeability of the BBB by increasing the osmotic pressure in blood, which loosens the tight junctions between endothelial cells (El-Andaloussi (2012)).By loosening the tight junctions, normal intravenous injection of the RNA silencing agent can be performed.

[0283] In certain embodiments, the RNA silencing agent of the present invention is delivered across the BBB using a nanoparticle-based delivery system. As used herein, "nanoparticle" refers to polymeric nanoparticles that are typically solid, biodegradable, colloidal, and have been widely studied as drug or gene carriers (SP Egusquiaguirre, M. Igartua, RM Hernandez, and JL Pedraz, "Nanoparticle delivery systems for cancer therapy: advances in clinical and preclinical research," Clinical and Translational Oncology, vol. 14, no. 2, pp. 83-93, 2012). Polymeric nanoparticles are classified into two main categories: natural polymers and synthetic polymers. Natural polymers for siRNA delivery include, but are not limited to, cyclodextrin, chitosan and atelocollagen (Y. Wang, Z. Li, Y. Han, LH Liang, and A. Ji, “Nanoparticle-based delivery system for application of siRNA in vivo,” Current Drug Metabolism, vol. 11, no. 2, pp. 182-196, 2010). Synthetic polymers include, but are not limited to, polyethyleneimine (PEI), poly(dl-lactide-co-glycolide) (PLGA) and dendrimers, which have been intensively studied (X. Yuan, S. Naguib, and Z. Wu, “Recent advances of siRNA delivery by nanoparticles,” Expert Opinion on Drug Delivery, vol. 8, no. 4, pp. 521-536, 2011).For a review of nanoparticles and other suitable delivery systems, see Jong-Min Lee, Tae-Jong Yoon, and Young-Seok Cho, “Recent Developments in Nanoparticle-Based siRNA Delivery for Cancer Therapy,” BioMed Research International, vol. 2013, Article ID 782041, 10 pages, 2013. doi:10.1155 / 2013 / 782041 (incorporated by reference in its entirety).

[0284] The RNA silencing agent of the present invention can be administered to the eye to treat, for example, retinal disorders, such as retinopathy. For example, the pharmaceutical composition can be applied to the surface of the eye or nearby tissues, such as the inside of the eyelid. They can be applied topically, for example, by spraying, in drops, as an eyewash or ointment. Ointments or droppable liquids can be delivered by ocular delivery systems known in the art, such as applicators or eye droppers. Such compositions can include mucus mimetics, such as hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose or poly(vinyl alcohol), preservatives, such as sorbic acid, EDTA or benzyl chromium chloride, and conventional amounts of diluents and / or carriers. The pharmaceutical composition can also be administered inside the eye and introduced by needles or other delivery devices that can introduce it to selected areas or structures. The composition containing the RNA silencing agent can also be applied via an eye patch.

[0285] In general, the RNA silencing agent of the present invention can be administered by any suitable method. As used herein, local delivery can refer to the direct application of the RNA silencing agent to any surface or any internal surface of the body, including the surface of the eye, mucous membrane, and body cavity. Formulations for local administration can include transdermal patches, ointments, lotions, creams, gels, drops, sprays, and liquids. Conventional pharmaceutical carriers, aqueous, powder or oil bases, thickeners, and the like may be necessary or desirable. Local administration can also be used as a means to selectively deliver the RNA silencing agent to the epidermis or dermis of a subject or specific layers thereof or underlying tissues.

[0286] Compositions for intrathecal or intraventricular (e.g., intracerebroventricular) administration may include sterile aqueous solutions that may contain buffers, diluents, and other suitable additives. Compositions for intrathecal or intraventricular administration typically do not include transfection reagents or additional lipophilic moieties, such as lipophilic moieties attached to the RNA silencing agent.

[0287] Formulations for parenteral administration may include sterile aqueous solutions which may contain buffers, diluents and other suitable additives. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir. For intravenous use, the total concentration of solutes should be controlled to render the preparation isotonic.

[0288] The oligonucleotide of the present invention can be administered to a subject by pulmonary delivery.Pulmonary delivery composition can be delivered by inhalation of dispersion so that the composition in dispersion can reach the lungs, where it can be easily absorbed directly into blood circulation through alveolar region.Pulmonary delivery can be effective for both systemic delivery and local delivery to treat lung diseases.In one embodiment, the RNA silencing agent administered by pulmonary delivery is modified so that it can cross the blood-brain barrier.

[0289] Pulmonary delivery can be achieved by a variety of techniques, including the use of nebulization, aerosolization, micelles, and dry powder-based formulations. Delivery can be achieved by liquid nebulizers, aerosol-based inhalers, and dry powder dispersion devices. Metered dose devices are particularly suitable. One advantage of using a nebulizer or inhaler is that the device is self-contained, minimizing the possibility of contamination. Dry powder dispersion devices deliver drugs that can be easily formulated as dry powders, for example. RNA silencing agent compositions can be stably stored as lyophilized or spray-dried powders, alone or in combination with suitable powder carriers. Delivery of the composition for inhalation can be mediated by a dosing timing element, which can include a timer, dose counter, time measurement device, or time indicator, which allows tracking of doses, monitoring compliance, and / or triggering of doses to patients during administration of aerosolized drugs, when incorporated into the device.

[0290] Types of pharmaceutical excipients useful as carriers include stabilizers such as human serum albumin (HSA), bulking agents such as carbohydrates, amino acids and polypeptides, pH adjusters or buffers, salts such as sodium chloride, etc. These carriers may be in crystalline or amorphous form, or may be a mixture of the two.

[0291] Particularly useful bulking agents include compatible carbohydrates, polypeptides, amino acids or combinations thereof. Suitable carbohydrates include monosaccharides such as galactose, D-mannose, sorbose, etc.; disaccharides such as lactose, trehalose, etc.; cyclodextrins such as 2-hydroxypropyl-beta-cyclodextrin; and polysaccharides such as raffinose, maltodextrin, dextran, etc.; alditols such as mannitol, xylitol, etc. Particularly suitable groups of carbohydrates include lactose, trehalose, raffinose, maltodextrin and mannitol. Suitable polypeptides include aspartame. Amino acids include alanine and glycine, with glycine being preferred.

[0292] Examples of pH adjusters or buffer solutions include organic acid salts prepared from organic acids and bases, such as sodium citrate and sodium ascorbate, with sodium citrate being preferred.

[0293] The RNA silencing agent of the present invention can be administered by oral and nasal delivery. For example, drugs administered through these membranes have a rapid onset of action, provide therapeutic plasma levels, avoid the first-pass effect of hepatic metabolism, and avoid exposure of the drug to an unsuitable gastrointestinal (GI) environment. Additional advantages include easy access to the membrane site, so that the drug can be easily applied, localized, and removed. In one embodiment, the RNA silencing agent administered by oral or nasal delivery is modified to be able to cross the blood-brain barrier. It should be understood that the method described in this disclosure is not limited to the specific method and experimental conditions disclosed herein. Thus, the method and conditions may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only, and is not intended to be limiting.

[0294] Furthermore, the experiments described herein use conventional molecular cell biology and immunological techniques within the scope of the art, unless otherwise specified. Such techniques are well known to those skilled in the art and are described in detail in the literature. For example, see Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley&Sons, Inc., NY, NY (1987-2008) (including all supplements), Molecular Cloning: A Laboratory Manual (Fourth Edition) by MR Green and J. Sambrook, and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd edition).

[0295] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein may be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. Although certain embodiments have been described in detail, they will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting. EXAMPLES

[0296] Example 1. Efficacy of 2'-O-methyl-rich hsiRNAs with reduced 2'-fluoro modifications O-methyl-rich asymmetric hsiRNAs with reduced 2'-fluoro modifications (2'-fluoro modifications at positions 2 and 14 (circles) or 2'-fluoro modifications at positions 2, 4, 6, 8, and 14 (squares)) (Figure 4C) were analyzed for silencing efficacy compared to a control hsiRNA with an alternating 2'-O-methyl / 2'-fluoro modification pattern (triangles) (Figure 4C).

[0297] The efficacy of individual hsiRNAs to silence sFTL1 i13 mRNA was determined (Figure 4A, Figure 4B). The efficacy of individual hsiRNAs to silence sFTL1 e15a mRNA was also determined (Figure 5A, Figure 5B). These data demonstrate that O-methyl-rich asymmetric fully modified siRNAs with minimal 2'-fluoro modifications obtained unexpected improvements in in vitro efficacy profile across two different cell lines and using two different assays.

[0298] sFLT1 i13_2283_ O-methyl-rich antisense strand: VP(mU)#(fA)#(mA)(fA)(fU)(fU)(mU)(mG)(mG)(mA)(mG)(mA)(mU)#(fC)#(mC)#(mG)#(mA)#(mG)#(mA)#(mG).

[0299] sFLT1 i13_2283 O-methyl-rich sense strand: (mG)#(mG)#(mA)(mU)(mC)(mU)(mC)(mC)(mA)(mA)(mA)(mU)(mU)#(mU)#(mA).

[0300] sFLT1 e15a_2519_OME antisense strand: VP(mU)#(fA)#(mU)(mA)(mA)(mA)(mU)(mG)(mG)(mU)(mA)(mG)(mC)#(fU)#(mA)#(mU)#(mG)#(mA)#(mU)#(mG).

[0301] sFLT1 e15a_2519_OME sense strand: (mU)#(mA)#(mG)(mC)(mU)(mA)(mC)(mC)(mA)(mU)(mU)(mU)(mA)#(mU)#(mA).

[0302] Example 2. Tissue distribution of 2'-O-methyl-rich hsiRNAs with reduced 2'-fluoro modifications O-methyl-rich asymmetric hsiRNAs containing DCA or PC-DCA modifications were administered to pregnant CD1 mice to assess their tissue distribution. O-methyl-rich DCA hsiRNAs and O-methyl-rich-PC-DCA hsiRNAs demonstrated increased or similar guide strand accumulation in liver, kidney, and placenta compared to non-methyl-rich control hsiRNAs, despite half the dosing (Figure 6A, Figure 6B, Figure 6C).

[0303] Pregnant CD1 mice were treated with O-methyl-rich siRNA and P2 siRNA to assess their placental distribution. O-methyl-rich-DCA compounds and O-methyl-rich E-PC DCA compounds demonstrated increased or similar guide strand accumulation in the placenta compared to P2-Chol hsiRNA (Figure 7).

[0304] Pregnant CD1 mice were treated with O-methyl-rich sFLT1 siRNA and P2 PPIB siRNA to assess their tissue distribution. The O-methyl-rich compound demonstrated increased guide strand accumulation in the liver and placenta compared to PPIB P2 (Figure 8A, Figure 8B, Figure 8C).

[0305] Example 3. Efficacy of 2'-O-methyl-rich hsiRNAs with reduced 2'-fluoro modifications - Pattern 1 The O-methyl-rich asymmetric hsiRNA pattern of Example 1 was designed with "A", "B", "C", "D", "E" and "F" mutants (Figure 1).

[0306] Pattern 1: Pattern 1A - siRNA with a 20 nucleotide guide (antisense) strand and a 15 nucleotide passenger (sense) strand. No 2'-O-methyl (2'-OMe) modifications at positions 2 and 14 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0307] Pattern 1B - siRNA with a 20 nucleotide guide (antisense) strand and a 15 nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 14 and 20 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0308] Pattern 1C - siRNA with a 20 nucleotide guide (antisense) strand and an 18 nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2 and 14 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0309] Pattern 1D - siRNA with a 20 nucleotide guide (antisense) strand and an 18 nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 14 and 20 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0310] Pattern 1 is reproduced below, where "mN" is a 2'-O-methyl modified nucleotide, "fN" is a 2'-fluoro modified nucleotide, "#" is a phosphorothioate backbone modification, and "N" is a nucleotide selected from A, U, G or C. Pattern 1A Antisense 5'~3' (20 nucleotides) (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'~3'(15 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1B Antisense 5'~3' (20 nucleotides) (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) Sense 5'~3'(15 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1C Antisense 5'~3' (20 nucleotides) (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'~3'(18 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1D Antisense 5'~3' (20 nucleotides) (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) Sense 5'~3'(18 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1E Antisense 5'~3' (22 nucleotides) (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'~3'(20 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) Pattern 1F Antisense 5'~3' (22 nucleotides) (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) Sense 5'~3'(20 nucleotides) (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN)

[0311] In vitro silencing - Pattern 1A: The in vitro efficacy of pattern 1A hsiRNA silencing sFTL1 i13 mRNA and sFTL1 e15a mRNA was determined (Figure 9A, Figure 9B, Figure 10A, Figure 10B). Pattern 1A (90% 2'O-Me content in the guide strand) has similar silencing efficacy to the control siRNA with 50% in the guide strand. These data demonstrate that O-methyl-rich asymmetric fully modified siRNA with minimal 2'-fluoro modifications obtained unexpected improvements in in vitro efficacy profile targeting two different mRNA target sequences across two different cell lines and using two different assays.

[0312] In vivo tissue accumulation - Patterns 1A and 1B: The in vivo tissue accumulation of Pattern 1A hsiRNA targeting sFTL1 i13 mRNA was determined (Figure 11A-D). Pattern 1A hsiRNA (sFlt1-2283 2'-OMe) containing DCA or PC-DCA modification and 5' vinyl phosphonate was administered to CD1 pregnant mice to assess its tissue distribution. O-methyl-rich DCA hsiRNA and O-methyl-rich-PC-DCA hsiRNA demonstrated increased or similar guide strand accumulation in liver, kidney and placenta compared to non-methyl-rich control hsiRNA, despite half the dosing. An additional control siRNA (HTT-10150) targeting Htt mRNA was included. The sequence is shown below. HTT-10150 antisense strand: UUAAUCUCUUUACUGAUAUA HTT-10150 mRNA target sequence: UAUAUCAGUAAAGAGAUUA

[0313] We also determined the in vivo tissue accumulation of Pattern 1B hsiRNAs targeting sFTL1 e15a mRNA (FIG. 12A, FIG. 12B). Pattern 1B O-methyl-rich-PC-DCA hsiRNA (sFlt1-2519 2'-OMe) demonstrated increased or similar guide strand accumulation in the placenta compared to non-methyl-rich control hsiRNA. Various variants of hsiRNAs were tested. As shown in FIG. 12B, "20 / 15mer" represents a 20 nucleotide antisense / 15 nucleotide sense siRNA, "20 / 18mer" represents a 20 nucleotide antisense / 18 nucleotide sense siRNA, "5'VP" represents an siRNA having a 5' terminal vinylphosphonate modification, "5'OH" represents an siRNA having a 5' terminal 2'-OH, "5'PS" represents an siRNA having a 5' terminal phosphorothioate, and "low PS" represents an siRNA having phosphorothioate modifications at positions 1 and 2 from the 5' and 3' ends of the antisense and sense strands.

[0314] Example 4. Efficacy of 2'-O-Methyl-rich hsiRNAs with reduced 2'-fluoro modifications - Role of guide strand position 20 The in vitro efficacy of hsiRNAs with and without a 2'-O-Me modification at position 20 from the 5' end of the guide strand was determined (Figures 13A-D).

[0315] hsiRNAs with 50-55% 2'-O-Me content in the guide strand to silence sFTL1 i13, sFTL1 e15a and Htt mRNA were used in Hela cells (Figure 13A, Figure 13C and Figure 13D) and WM-115 cells (Figure 13B). These data demonstrate that the absence of 2'-O-Me at position 20 from the 5' end of the guide strand increases silencing efficacy when the 2'-O-Me content is 50-55%. This was demonstrated with a 2'-fluoro modification at position 20, but may also apply to other types of nucleotide modifications, including but not limited to unmodified ribose with 2'-H or 2'-OH. This increased silencing efficacy was demonstrated with two different chemical modification patterns with 50-55% 2'-OMe content, respectively. FIG. 13D demonstrates the role of the 2'-fluoro at position 20 in the context of an siRNA with a 21 nucleotide antisense strand, showing similar results as the 20 nucleotide antisense strand.

[0316] The contents of all references (including literature references, patents, patent applications, and websites) that may be cited throughout this application, as well as the references cited therein, are hereby expressly incorporated by reference in their entirety for all purposes. This disclosure will employ, unless otherwise indicated, conventional techniques of immunology, molecular biology, and cell biology that are well known in the art.

[0317] The present disclosure may be embodied in other specific forms without departing from its spirit or essential characteristics. Accordingly, the above-described embodiments are to be considered in all respects as illustrative and not limiting of the present disclosure. Accordingly, the scope of the present disclosure is indicated by the appended claims, rather than the foregoing description, and therefore, all modifications that come within the spirit and scope of the claims are intended to be embraced herein. The present invention includes the following aspects. [Item 1] at least 14 consecutive nucleotides at the 5' and 3' ends; At least 85% 2'-O-methyl nucleotide modifications wherein the nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide comprise a non-2'-O-methyl modification. [Item 2] The oligonucleotide according to Item 1, which comprises an antisense oligonucleotide (ASO). [Item 3] The oligonucleotide of item 1, which has perfect or imperfect complementarity to a target. [Item 4] The oligonucleotide of item 3, wherein the target comprises mammalian or viral mRNA. [Item 5] The oligonucleotide of item 1, wherein the nucleotide at position 20 from the 5' end of the oligonucleotide comprises a non-2'-O-methyl modification. [Item 6] The oligonucleotide according to Item 1, wherein one or more nucleotides at positions 1 to 7 from the 3' end of the oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds. [Item 7] The oligonucleotide according to Item 1, wherein the nucleotides at positions 1 to 6 or positions 1 to 7 from the 3' end of the oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds. [Item 8] The oligonucleotide of item 1, wherein the nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide comprise a 2'-F modification or a 2'-H modification or a 2'-OH moiety. [Item 9] The oligonucleotide of item 8, wherein the nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide comprise 2'-F modifications. [Item 10] The oligonucleotide of item 8, wherein the nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide comprise 2'-H modifications. [Item 11] The oligonucleotide of item 8, wherein the nucleotides at positions 2 and 14 from the 5' end of the oligonucleotide comprise a 2'-OH moiety. [Item 12] The oligonucleotide according to item 1, comprising at least 90% 2'-O-methyl modified nucleotides. [Item 13] The oligonucleotide of item 1, further comprising a complementary second oligonucleotide comprising at least 13 consecutive nucleotides and a 5' end and a 3' end. [Item 14] The oligonucleotide according to Item 13, wherein the second oligonucleotide contains at least 80% 2'-O-methyl modified nucleotides. [Item 15] The oligonucleotide according to Item 13, wherein the second oligonucleotide contains at least 90% 2'-O-methyl modified nucleotides. [Item 16] The oligonucleotide according to Item 15, wherein the second oligonucleotide contains 100% 2'-O-methyl modified nucleotides. [Item 17] The oligonucleotide of item 13, wherein one or more of the nucleotides at positions 7, 9, 10 and 11 from the 3' end of the second oligonucleotide contain a non-2'-O-methyl modification. [Item 18] The oligonucleotide of item 13, wherein one or more of the nucleotides at positions 7, 10 and 11 from the 3' end of the second oligonucleotide contain a non-2'-O-methyl modification. [Item 19] The oligonucleotide of item 13, wherein the nucleotides at positions 7, 10, and 11 from the 3' end of the second oligonucleotide contain non-2'-O-methyl modifications. [Item 20] The oligonucleotide of item 13, wherein the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds. [Item 21] The oligonucleotide described in Item 13, wherein the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide and the nucleotides at positions 1 and 2 from the 5' end of the second oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds. [Item 22] The oligonucleotide according to Item 13, wherein the second oligonucleotide comprises a hydrophobic molecule at the 3' end of the second oligonucleotide. [Item 23] The oligonucleotide according to Item 1, comprising 15 to 22 consecutive nucleotides. [Item 24] The oligonucleotide according to Item 23, comprising 20 consecutive nucleotides. [Item 25] The oligonucleotide according to Item 23, comprising 22 consecutive nucleotides. [Item 26] The oligonucleotide according to Item 13, wherein the second oligonucleotide comprises 15 to 20 consecutive nucleotides. [Item 27] ​​The oligonucleotide according to Item 26, wherein the second oligonucleotide comprises 15 consecutive nucleotides. [Item 28] The oligonucleotide according to Item 26, wherein the second oligonucleotide comprises 18 consecutive nucleotides. [Item 29] The oligonucleotide according to Item 26, wherein the second oligonucleotide comprises 20 consecutive nucleotides. [Item 30] The oligonucleotide of item 13, wherein the second oligonucleotide comprises one or more nucleotide mismatches between the first oligonucleotide and the second oligonucleotide. [Item 31] The oligonucleotide of Item 30, wherein the one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the second oligonucleotide. [Item 32] The oligonucleotide of item 30, wherein the nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the second oligonucleotide. [Item 33] A pharmaceutical composition comprising one or more oligonucleotides according to any one of items 1 to 32 and a pharma- ceutically acceptable carrier. [Item 34] A method for treating or managing a disease or disorder, comprising administering to a subject in need of said treatment or management a therapeutically effective amount of the pharmaceutical composition described in Item 33. [Item 35] A double-stranded nucleic acid structure comprising an antisense strand and a sense strand, the antisense strand comprises at least 14 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to a target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to the antisense strand; the antisense strand comprises at least 85% 2'-O-methyl modifications; and A double-stranded nucleic acid structure, wherein the nucleotides at positions 2 and 14 from the 5' end of the antisense strand comprise a non-2'-O-methyl modification. [Item 36] The double-stranded nucleic acid of Item 35, wherein the antisense strand has perfect or imperfect complementarity to the target. [Item 37] The double-stranded nucleic acid of Item 35, wherein the target comprises mammalian or viral mRNA. [Item 38] The double-stranded nucleic acid of Item 35, wherein the nucleotide at position 20 from the 5' end of the antisense strand comprises a non-2'-O-methyl modification. [Item 39] The double-stranded nucleic acid according to Item 35, wherein one or more nucleotides at positions 1 to 7 from the 3' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. [Item 40] The double-stranded nucleic acid according to Item 35, wherein the nucleotides at positions 1 to 6 from the 3' end or positions 1 to 7 from the 3' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. [Item 41] The double-stranded nucleic acid of Item 35, wherein the nucleotides at positions 2 and 14 from the 5' end of the antisense strand include a 2'-F modification or a 2'-H modification, or a 2'-OH moiety. [Item 42] The double-stranded nucleic acid of Item 41, wherein the nucleotides at positions 2 and 14 from the 5' end of the antisense strand contain 2'-F modifications. [Item 43] The double-stranded nucleic acid of Item 41, wherein the nucleotides at positions 2 and 14 from the 5' end of the antisense strand contain 2'-H modifications. [Item 44] The double-stranded nucleic acid of Item 41, wherein the nucleotides at positions 2 and 14 from the 5' end of the antisense strand comprise a 2'-OH moiety. [Item 45] The double-stranded nucleic acid according to Item 35, wherein the antisense strand contains at least 90% 2'-O-methyl modified nucleotides. [Item 46] The double-stranded nucleic acid according to Item 35, wherein the sense strand contains at least 80% 2'-O-methyl modified nucleotides. [Item 47] The double-stranded nucleic acid according to Item 35, wherein the sense strand contains at least 90% 2'-O-methyl modified nucleotides. [Item 48] The double-stranded nucleic acid according to Item 35, wherein the sense strand contains 100% 2'-O-methyl modified nucleotides. [Item 49] The double-stranded nucleic acid of Item 35, wherein one or more nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand contain a non-2'-O-methyl modification. [Item 50] The double-stranded nucleic acid of Item 35, wherein the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand contain non-2'-O-methyl modifications. [Item 51] The double-stranded nucleic acid of Item 35, wherein the nucleotides at positions 7, 10, and 11 from the 3' end of the sense strand contain non-2'-O-methyl modifications. [Item 52] The double-stranded nucleic acid of Item 35, wherein the nucleotides at positions 1 and 2 from the 3' end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds. [Item 53] The double-stranded nucleic acid according to Item 35, wherein the nucleotides at positions 1 and 2 from the 3' end of the sense strand and the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds. [Item 54] The double-stranded nucleic acid according to Item 35, wherein the sense strand comprises a hydrophobic molecule at the 3' end of the sense strand. [Item 55] The double-stranded nucleic acid according to Item 35, wherein the antisense strand comprises 15 to 22 consecutive nucleotides. [Item 56] The double-stranded nucleic acid according to Item 55, wherein the antisense strand comprises 20 consecutive nucleotides. [Item 57] The double-stranded nucleic acid according to Item 55, wherein the antisense strand comprises 22 consecutive nucleotides. [Item 58] The double-stranded nucleic acid according to Item 35, wherein the sense strand comprises 15 to 20 consecutive nucleotides. [Item 59] The double-stranded nucleic acid according to Item 58, wherein the sense strand comprises 15 consecutive nucleotides. [Item 60] The double-stranded nucleic acid according to Item 58, wherein the sense strand comprises 18 consecutive nucleotides. [Item 61] The double-stranded nucleic acid according to Item 58, wherein the sense strand comprises 20 consecutive nucleotides. [Item 62] The double-stranded nucleic acid of Item 35, wherein the sense strand contains one or more nucleotide mismatches between the antisense strand and the sense strand. [Item 63] The double-stranded nucleic acid described in Item 62, wherein the one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the sense strand. [Item 64] The double-stranded nucleic acid of Item 62, wherein the nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the sense strand. [Item 65] The double-stranded nucleic acid according to Item 35, wherein the antisense strand comprises a 5' phosphate, a 5'-alkyl phosphonate, a 5' alkylene phosphonate, or a 5' alkenyl phosphonate. [Item 66] The double-stranded nucleic acid according to Item 65, wherein the antisense strand comprises a 5' vinyl phosphonate. [Item 67] The double-stranded nucleic acid according to any one of Items 35 to 66, comprising 4 to 16 phosphorothioate bonds. [Item 68] The double-stranded nucleic acid according to any one of Items 35 to 66, comprising 8 to 13 phosphorothioate bonds. [Item 69] The double-stranded nucleic acid according to any one of Items 35 to 68, which comprises a double-stranded region of 15 to 20 base pairs. [Item 70] The double-stranded nucleic acid according to any one of Items 35 to 68, which comprises a double-stranded region of 15 base pairs. [Item 71] The double-stranded nucleic acid according to any one of Items 35 to 68, which comprises a double-stranded region of 18 base pairs. [Item 72] The double-stranded nucleic acid according to any one of Items 35 to 68, which comprises a double-stranded region of 20 base pairs. [Item 73] A double-stranded nucleic acid structure comprising an antisense strand and a sense strand, the antisense strand comprises at least 14 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to a target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to the antisense strand; the antisense strand comprises at least 85% 2'-O-methyl modifications; the nucleotides at positions 2 and 14 from the 5' end of the first oligonucleotide are modified with 2'-F; the sense strand comprises 100% 2'-O-methyl modifications; and A double-stranded nucleic acid structure, wherein the nucleotides at positions 1 to 6 from the 3' end or positions 1 to 7 from the 3' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. [Item 74] A pharmaceutical composition comprising one or more chemically modified double-stranded nucleic acids according to any one of items 35 to 73 and a pharma- ceutically acceptable carrier. [Item 75] A method for treating or managing a disease or disorder, comprising administering to a subject in need of said treatment or management a therapeutically effective amount of the pharmaceutical composition described in Item 74. [Item 76] A branched oligonucleotide compound capable of mediating RNA silencing in a cell, comprising two or more double-stranded nucleic acids, wherein the nucleic acids (N) are linked to each other by one or more moieties selected from a linker (L), a spacer (S), and optionally a branch point (B); each double-stranded nucleic acid comprises an antisense strand and a sense strand, each antisense strand comprises at least 14 contiguous nucleotides, a 5' end and a 3' end, and at least one antisense strand comprises at least 85% 2'-O-methyl modifications; the nucleotides at positions 2 and 14 from the 5' end of the at least one antisense strand comprise a non-2'-O-methyl modification; A branched oligonucleotide compound, wherein one or more of the nucleotides at positions 1-7 from the 3' end of at least one of the antisense strands are linked to adjacent nucleotides via phosphorothioate linkages. [Item 77] each antisense strand contains at least 85% 2'-O-methyl modifications; the nucleotides at positions 2 and 14 from the 5' end of each antisense strand comprise a non-2'-O-methyl modification; and / or 77. The branched oligonucleotide compound according to claim 76, wherein one or more of the nucleotides at positions 1 to 7 from the 3' end of each antisense strand are linked to an adjacent nucleotide via a phosphorothioate bond. [Item 78] The branched oligonucleotide compound of item 76, wherein the nucleotides at positions 1 and 2 from the 5' end of the sense and antisense strands are linked to adjacent nucleotides via phosphorothioate linkages. [Item 79] The branched oligonucleotide compound of item 76, wherein each double-stranded nucleic acid is independently linked to a linker, spacer or branch point at the 3' end or the 5' end of the sense strand or the antisense strand. [Item 80] The branched oligonucleotide compound of Item 76, further comprising a hydrophobic moiety attached at the 5' position of a terminus of the branched oligonucleotide compound. [Item 81] The branched oligonucleotide compound of item 80, wherein the hydrophobic moiety comprises an alkyl, alkenyl, or aryl moiety; a vitamin or cholesterol derivative; a lipophilic amino acid; or a combination thereof. [Item 82] Each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; 82. The branched oligonucleotide compound according to any one of claims 76 to 81, wherein any carbon or oxygen atom of the linker is optionally substituted with a nitrogen atom, has a hydroxyl substituent, or has an oxo substituent. [Item 83] The branched oligonucleotide compound of any one of Items 76 to 82, wherein the nucleotide at position 20 from the 5' end of the antisense strand comprises a non-2'-O-methyl modification. [Item 84] The branched oligonucleotide compound according to any one of Items 76 to 83, wherein the nucleotides at positions 7, 10 and 11 from the 3' end of the sense strand comprise a non-2'-O-methyl modification. [Item 85] The branched oligonucleotide compound according to any one of Items 76 to 83, wherein the non-2'-O-methyl modification comprises a 2'-F modification or a 2'-H modification or a 2'-OH moiety. [Item 86] The branched oligonucleotide compound of item 85, wherein the non-2'-O-methyl modification comprises a 2'-F modification. [Item 87] The branched oligonucleotide compound of item 85, wherein the non-2'-O-methyl modification comprises a 2'-H modification. [Item 88] The branched oligonucleotide compound of item 85, comprising a 2'-OH moiety. [Item 89] The branched oligonucleotide compound according to any one of Items 76 to 88, wherein the antisense strand comprises at least 90% 2'-O-methyl modified nucleotides. [Item 90] The branched oligonucleotide compound according to any one of Items 76 to 89, wherein the sense strand comprises at least 80% 2'-O-methyl modified nucleotides. [Item 91] The branched oligonucleotide compound according to any one of Items 76 to 89, wherein the sense strand comprises at least 90% 2'-O-methyl modified nucleotides. [Item 92] The branched oligonucleotide compound according to any one of Items 76 to 89, wherein the sense strand comprises 100% 2'-O-methyl modified nucleotides. [Item 93] The branched oligonucleotide compound according to any one of Items 76 to 92, wherein the antisense strand comprises 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides. [Item 94] The branched oligonucleotide compound according to any one of Items 76 to 93, wherein the sense strand comprises 15, 16, 17, 18, 19 or 20 consecutive nucleotides.

Claims

1. A double-stranded nucleic acid comprising an antisense strand and a sense strand, the antisense strand comprises at least 14 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to a target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to the antisense strand; the antisense strand comprises at least 85% 2'-O-methyl modifications; and the nucleotides at positions 2 and 14 from the 5' end of the antisense strand comprise a non-2'-O-methyl modification; A double-stranded nucleic acid, wherein the nucleotides at positions 7, 10, and 11 from the 3' end of the sense strand comprise a non-2'-O-methyl modification, or the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand comprise a non-2'-O-methyl modification.

2. 2. The double-stranded nucleic acid of claim 1, wherein the nucleotides at positions 2 and 14 from the 5' end of the antisense strand comprise a 2'-F modification, a 2'-H modification, or a 2'-OH moiety.

3. The double-stranded nucleic acid of claim 1, wherein the antisense strand comprises at least 90% 2'-O-methyl modified nucleotides.

4. The double-stranded nucleic acid of claim 2 , wherein the sense strand comprises one or more nucleotide mismatches between the antisense strand and the sense strand.

5. 2. The double-stranded nucleic acid of claim 1, comprising 4 to 16 phosphorothioate bonds or 8 to 13 phosphorothioate bonds.

6. A double-stranded nucleic acid comprising an antisense strand and a sense strand, the antisense strand comprises at least 14 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to a target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to the antisense strand; the antisense strand comprises at least 85% 2'-O-methyl modifications; the nucleotides at positions 2 and 14 from the 5' end of the antisense strand are modified with 2'-F; the sense strand contains 100% 2'-O-methyl modifications; and A double-stranded nucleic acid, wherein the nucleotides at positions 1-6 from the 3' end or positions 1-7 from the 3' end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds.

7. A pharmaceutical for treating or managing a disease or disorder, comprising the double-stranded nucleic acid of claim 6.

8. The double-stranded nucleic acid of claim 1 , wherein the antisense strand comprises 20 consecutive nucleotides or 22 consecutive nucleotides.

9. The double-stranded nucleic acid of claim 1 , wherein the antisense strand comprises perfect or less than perfect complementarity to the target.

10. The double-stranded nucleic acid of claim 1 , wherein the sense strand comprises a hydrophobic molecule at the 3′ end of the sense strand.

11. 5. The double-stranded nucleic acid of claim 4, wherein the one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the sense strand.

Images