Methods for Treating Cells Containing Fusion Genes by Genome Targeting - Patent application

Abstract

The present invention relates to a method for treating patients with cancer or precancerous or neoplastic conditions.It is based, at least in part, on the discovery that genome editing technology that specifically targets fusion genes can induce cell death of cancer cells other than prostate cancer cells, such as hepatocellular carcinoma cells, that have fusion genes.The present invention provides a method for treating cancer patients, comprising: carrying out genome editing technology that targets fusion genes present in one or more cells of a subject, thereby producing anti-cancer effects. [Selection diagram] Figure 1-1

Description

[Technical field]

[0001] Priority information

[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 433,608, filed December 13, 2016, and U.S. Provisional Patent Application No. 62 / 572,960, filed October 16, 2017, the contents of both of which are incorporated by reference in their entireties herein.

[0003] Approval Information This invention was made with government support under Grant Nos. CA098249 and CA190766 awarded by the National Institutes of Health and Grant Nos. W81XWH-16-1-0541 and W81XWH-16-1-0364 awarded by the U.S. Army Medical Research and Munitions Command. The Government has certain rights in this invention.

[0004] 1. Introduction The present invention relates to a method of treating patients carrying one or more specific fusion genes by implementing genome targeting techniques. [Background technology]

[0005] 2. Background of the Invention Clustered Regulatory Intervening Short Palindromic Repeats (CRISPR) / CRISPR-associated (Cas) were originally discovered to act as an immune defense mechanism against foreign pathogens in prokaryotic cells (Mojica et al. (2005) J. of Molecular Evolution 60:174-182). Cas9, a protein for the type II CRISPR / Cas system, was found to exhibit DNA cleavage activity. The nuclease activity of Cas9 can be induced by trans-acting CRISPR RNA complementary to CRISPR RNA and DNA target sequences in the genome (Jinek et al. (2012) Science 337:816-821). Because trans-acting CRISPR RNA and CRISPR RNA can be made in chimeric RNAs that contain the full functionality of both RNA species, artificial fusion RNA sequences, also called guide RNAs (gRNAs), were generated to target the activity of Cas9 to target DNA sequences (Esvelt et al. (2014) eLife:e03401). The D10A mutation present in the catalytic domain of Cas9 converts it into a nickase that results in a single nucleotide cleavage in the target DNA (Jinek et al. (2012) Science 337:816-821). Double nicking of the target DNA can increase the specificity of genome editing by 50-100 fold (Ran et al. (2013) Cell 154:1380-1389) and reduce the off-target rate to 1 / 10,000. Such specificity can make somatic cell genome targeting a feasible approach in the treatment of human diseases.

[0006] In the United States, prostate cancer is one of the most frequent malignancies observed in male cancer. Prostate cancer mortality reached 27,540 in 2014, making it the second most lethal male cancer (Siegel et al. (2015) A Cancer Journal For Clinicians 65:5-29). As disclosed in WO 2015 / 103057 and WO 2016 / 011428, a number of fusion genes generated by chromosomal rearrangements were identified in prostate cancers that were shown to be recurrent and lethal. The expression of these fusion genes is widespread among aggressive prostate cancers, but is absent in normal tissues. WO 2016 / 011428 discloses genomic targeting of the chromosomal breakpoints of the fusion gene TMEM135-CCDC67, which resulted in cell death and remission of xenografted prostate cancer in mice.

[0007] Cancer is generally the number one cause of death in the United States. Cancer mortality reached 595,690 in 2015 in the United States alone, making it the second most lethal cause of death after cardiovascular disease (Siegel et al. (2016) A Cancer Journal For Clinicians 66(1):7-30). Treatment of cancer, especially those that become metastatic, remains problematic, and a cure for cancer remains elusive. Thus, there remains a need in the industry for methods of treating cancer. Summary of the Invention

[0008] 3. Summary of the Invention The present invention relates to a method for treating patients suffering from cancer or precancerous or neoplastic conditions, which is based, at least in part, on the discovery that genome editing techniques that specifically target fusion genes can induce cell death in cancer cells, such as cancer cells other than prostate cancer, such as hepatocellular carcinoma cells, that have fusion genes.

[0009] In various non-limiting embodiments, the present invention provides a method of treating a subject carrying a fusion gene. For example, but not limited to, the subject may have cancer, a precancerous condition, or a neoplastic condition. In certain embodiments, the method of the present invention includes performing a genome editing technique that targets a fusion gene present in one or more cells of the subject. Non-limiting examples of such fusion genes include TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, and PCMTD1-SNTG1. In certain embodiments, the fusion gene is PTEN-NOLC1. In certain embodiments, the fusion gene is MAN2A1-FER. In certain embodiments, the cancer is not prostate cancer. In certain embodiments, the cancer is not lung adenocarcinoma, glioblastoma multiforme, or hepatocellular carcinoma.

[0010] In certain non-limiting embodiments, the present invention further provides a kit for carrying out a method of treating a subject carrying a fusion gene. For example, but not limited to, the subject may have cancer, a precancerous condition, or a neoplastic condition. In certain embodiments, the kit of the present invention includes a Cas9 protein, e.g., Cas9 D10A In certain embodiments, the one or more vectors may further comprise one or more gRNAs specific to the fusion gene, e.g., specific to the breakpoint of the fusion gene and / or to a sequence adjacent to the breakpoint of the fusion gene.

[0011] In certain embodiments, the kit of the present invention may further comprise one or more vectors or plasmids that contain a nucleic acid that causes cell death when expressed. In certain embodiments, the nucleic acid encodes HSV-1 thymidine kinase. In certain embodiments, the vector may further comprise one or more targeting sequences that are complementary to sequences in the fusion gene to facilitate homologous recombination and insertion of the nucleic acid. In certain embodiments, when the nucleic acid encodes HSV-1 thymidine kinase, the kit may further comprise ganciclovir and / or valganciclovir.

[0012] In certain embodiments, the kit may include nucleic acid primers for PCR analysis or nucleic acid probes for RNA in situ analysis to detect the presence of one or more fusion genes in a sample from a subject.In certain non-limiting embodiments, the one or more fusion genes may be selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, PTEN-NOLC1, CCNH-C5orf30, TRMT11-GRIK2, SLC45A2-AMACR, KDM4B-AC011523.2, MAN2A1-FER, MTOR-TP53BP, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG11, and combinations thereof. [Brief description of the drawings]

[0013] [Figure 1-1] Diagram of a unique fusion gene event. Left panel: Miniature diagram of the genome of the fusion gene, transcription direction, distance between linked genes and orientation of the fusion. Center panel: Representative sequencing chromogram of the fusion gene. Linked gene sequences are shown (SEQ ID NOs: 45-52). Right panel: Diagram of translation products of the fusion gene. Blue - driver gene translation product; Red - passenger gene translation product; Orange - novel translation product due to frameshift or translation product from non-genic region. [Figure 1-2] This is a continuation of Figure 1-1. [Figure 1-3] This is a continuation of Figure 1-1. [Diagram 2] Genomic breakpoint analysis of fusion genes. Top panel: Miniature diagram of the genome, transcription direction, distance between linked genes and chromosomal linkage direction of the fusion gene. Center panel: Miniature of the fusion genome and transcription direction. Bottom panel: Representative sequencing chromogram (SEQ ID NOs: 53-55) encompassing the chromosomal linkage breakpoints. [Figure 3A] Diagram of the PTEN-NOLC1 fusion gene. (A) PTEN-NOLC1 fusion transcript. Top panel: Miniature diagram of the genome, transcriptional direction, distance between linked genes and orientation of the fusion of PTEN and NOLC1 genes. Middle panel: Representative sequencing chromogram of PTEN-NOLC1 transcript. Translocated gene sequence is shown. Bottom panel: Diagram of translation products of the fusion transcript. Blue - head gene translation product; red - tail gene translation product. (B) Schematic diagram of PTEN and NOLC1 genomic recombination and FISH probe location. [Figure 3B] This is a continuation of Figure 3A. [Figure 4] MAN2A1-FER motif analysis. MAN2A1, FER and MAN2A1-FER fusion protein functional domains and chromosomal breakpoints observed for MAN2A1-FER fusion gene in various cell lines. In the fusion gene MAN2A1-FER, the N-terminal SH2 and FHC domains of FER are lost. These domains are replaced by the glycoside hydrolase and α-mannosidase central domains from MAN2A1. [Diagram 5]Schematic diagram of genome editing targeting at the fusion gene breakpoint in cancer cells positive for CCNH-C5orf30. Genomic recombination in prostate cancer case 3T resulted in a breakpoint in chromosome 5 connecting intron 6 of CCNH and intron 1 of C5orf30. A 23 bp guide RNA (gRNA) containing a protospacer adjacent motif (PAM) specific to the breakpoint region is designed. A DNA sequence corresponding to this target sequence is artificially ligated into a vector containing the remainder of the gRNA and Cas9. This sequence is recombined and packaged into a recombinant virus (adenovirus or lentivirus). A promoterless herpes simplex virus type 1 (HSV-1) thymidine kinase is constructed in a shuttle vector for adenovirus with a splice tag sequence derived from the intron / exon junction of CCNH exon 7. 500 bp of sequences surrounding the CCNH-C5orf30 breakpoint from each side are also ligated into the shuttle vector to provide efficient homologous recombination to complete the donor DNA construction. The vector is recombined and packaged in AdEasy to generate recombinant virus. These viruses can be administered to patients or animals with cancers that are positive for CCNH-C5orf30 fusion transcripts. This results in the insertion of donor DNA into the target site (fusion breakpoint). Since the HSV-1 TK in the recombinant virus does not contain a promoter, if the HSV-1 TK cDNA is not integrated into a transcriptionally active genome, no transcription will occur. However, when HSV-1 TK is integrated into the target site of CCNH-C5orf30 in a patient, the transcription of HSV-1 TK is active, and when ganciclovir or its oral homologue valganciclovir is administered to the patient, the homologue is easily converted by HSV-1 TK into a guanine triphosphate analogue and integrated into the genome of cancer cells. This results in the cessation of DNA elongation in cells that are positive for CCNH-C5orf30. [Figure 6-1]Schematic diagram of fusion genes. Left panel: Schematic diagram of the genome of the fusion partners. The locus, distance between partners, transcription direction and orientation of the fusion are shown. Center panel: Histogram of Sanger sequencing around the fusion point of each fusion gene (SEQ ID NOs: 40-44). Right panel: Predicted protein products of the fusion genes. Blue: head gene protein; Yellow: frameshift translation; Red: tail. [Figure 6-2] This is a continuation of Figure 6-1. [Figure 7] Schematic diagram of ZMPSTE24-ZMYM5 fusion formation. Functional domains are shown. The fusion formation between ZMPSTE24 and ZMYM4 involves a truncation of 159 amino acids from the C-terminus of ZMPSTE24 and 1315 amino acids from the N-terminus of ZMYM4. Motif analysis suggests that the ZMPSTE24-ZMYM5 fusion deletes approximately 50% of the peptidase domain from ZMPSTE24 and removes all zinc fingers from ZMYM4, but leaves the ZUF3504 (domain of unknown function) and apoptosis inhibitor domains intact. [Figure 8] Schematic diagram of CLTC-ETV1 fusion formation. Functional domains are shown. The CLTC-ETV1 fusion keeps the transcription domain in ETV1 mostly intact and deletes the three clathrin domains from CLTC. Truncation at the N-terminus of ETV1 removes all these regulatory elements from ETV1. [Figure 9] FIG. 1 is a schematic diagram of ACPP-SEC13 fusion formation. Functional domains are shown. In the ACPP-SEC13 fusion, only the N-terminal 72 amino acids of ACPP are retained and more than two-thirds of the phosphatase domain is truncated, whereas SEC13 loses 196 amino acids from its N-terminus and has three WD repeat domains deleted. [Figure 10]Schematic diagram of DOCK7-OLR1 fusion formation. Functional domains are shown. DOCK7-OLR1 does not produce a chimeric protein. Separate translation of DOCK7 and OLR1 occurs from the fusion transcript. The fusion gene deletes a significant portion of the cytokinesis domain of DOCK, and the fusion transcript produces an intact OLR1 protein. [Figure 11] Schematic diagram of PCMTD1-SNTG1 fusion formation. Functional domains are shown. PCMTD1-SNTG1 fusion does not produce a chimeric protein. PCMTD1-SNTG1 fusion produces a truncated PCMTD1 that removes half of the methyl-transferase domain of PCMTD1, leaving SNTG1 intact. [Figure 12] Schematic diagram of SLC45A2-AMACR chimeric protein. Fusion of SLC45A2 with AMACR results in truncation of 2 / 3 of the domain (MFS) in SLC45A2, but retains most of the CoA-transferase domain of AMACR. SLC45A2-AMACR produces a chimeric protein with the N-terminal 187 amino acids of SLC45A2 and the C-terminal 311 amino acids of AMACR. SLC45A2-AMACR replaces the five transmembrane and cytoplasmic domains of SLC45A2 with an intact racemase domain from AMACR, but leaves the extracellular and N-terminal transmembrane domains intact. [Figure 13A]Scheme of the strategy for introducing EGFP-tk into the breakpoint of the TMEM135-CCDC67 fusion gene. (A) Schematic diagram and Sanger sequencing of the TMEM135-CCDC67 chromosomal breakpoint. The direction of transcription is indicated by an arrow. (B and C) Schematic diagram of the strategy for introducing EGFP-tk into the breakpoint of TMEM135-CCDC67. The positions of gRNA- and gRNA+ are boxed. These gRNAs were ligated with Cas9D10A in the VQAd5-CMB shuttle vector and recombined into pAd5 virus. Separately, 584 bp of TMEM135 intron 13 sequence and 561 bp of CCDC67 intron 9 sequence were designed to sandwich the promoterless EGFP-tk cDNA, ligated into the PAdlox shuttle vector, and recombined into adenovirus. The splice acceptor and splice donor from exon 14 of TMEM135 were inserted between TMEM intron 13 and EGFP-tk, and between EGFP-tk and CCDC67 intron 9, respectively, to allow proper EGFP-tk RNA splicing. These recombinant viruses were infected into cells containing the TMEM135-CCDC67 chromosomal breakpoints. The integrated EGFP-tk was transcribed, spliced, and translated into the protein product of EGFP-tk by the fusion head gene promoter in these cells, which then blocks DNA synthesis by converting ganciclovir to ganciclovir triphosphate. [Figure 13B] This is a continuation of Figure 13A. [Figure 13C] This is a continuation of Figure 13A. [Figure 14]FIG. 11. qPCR to quantify the relative copy number of TMEM135-CCDC67 breakpoint and pCMV vector sequences in the genome of transformed prostate cancer cells. One microgram of genomic DNA of PC3 BP (PC3 cells transformed with pCMV-TMEM135int13-CCDC67int9), or DU145 BP (DU145 cells transformed with pCMV-TMEM135int13-CCDC67int9), or PC3 CMV (PC3 cells transformed with pCMVscript) or DU145 CMV (DU145 cells transformed with pCMVscript) was quantified for β-actin or TMEM135-CCDC67 breakpoint by qPCR using the primers listed in Table 2. BP and β-actin copy numbers were fitted using standard curves generated using serial titrations of known copy numbers of BP and β-actin, respectively. BP / β-actin ratios were plotted. [Figure 15-1] Diagram of genome therapy targeting at MAN2A1-FER breakpoint. (A) Design of gRNA and recombinant donor adenovirus for MAN2A1-FER fusion gene. Top panel: Schematic of Sanger sequencing of MAN2A1-FER chromosomal breakpoint in HUH7 cells; Middle panel: Design of gRNA for pAD5-Cas9D10A-gRNAMAN2A1int13-gRNAFERint14; Bottom panel: Design of homologous DNA sequence and EGFP-tk for pAD-MAN2A1int13-EGFP-tk-FERint14. Splicing acceptor and donor sequences correspond to the junction sequence of intron 13-exon 14 of MAN2A1 and exon 15-intron 15 of FER. [Figure 15-2](B) Expression of MAN2A1-FER in HUH7 cells. Lanes 1 and 2: Immunoblots of protein extracts from HUH7 and HEP3B cells with antibodies specific for FER or GAPDH. MAN2A1-FER(MF) and FER proteins are shown. Lanes 3 and 4: RT-PCR of RNA from HUH7 and HEP3B cells with primers specific for MAN2A1-FER(MF) or β-actin. (C) In vitro cleavage assays were performed on BamH1-linearized pTAMAN2A1int13-FERint14 vector with recombinant Cas9, S. pyogenes and in vitro transcribed gRNA- or gRNA+ as indicated. Cleavage generated 2446 and 1944 bp fragments of pTAMAN2A1int13-FERint14 vector for gRNA- and 2484 and 1906 bp fragments for gRNA+. (D) Infection of HUH7 and HEP3B cells resulted in expression of EGFP-tk in HUH7 but not in HEP3B cells. HUH7 and HEP3B cells were infected with pAD5-Cas9D10A-gRNAMAN2A1int13-gRNAFERint14 (Ad-MF) and pAD-MAN2A1int13-EGFP-tk-FERint14 (Ad-MF-EGFP-tk). Expression of Cas9D10A-RFP is indicated by red fluorescence, whereas expression of FGFP-tk is indicated by green. HUH7 cells infected with pAD5-Cas9D10A-gRNATMEM135int13-gRNACCDC67int9 (Ad-gTC) and pADTMEM135int13-EGFP-tk-CCDC67int9 (Ad-TC-EGFP-tk) were used as a specificity control. (E) Quantification of EGFP-tk incorporation / expression by flow cytometry. [Figure 15-3](F) Killing of HUH7 cells by ganciclovir. HUH7 or HEP3B cells were infected with pAD5-Cas9D10A-gRNAMAN2A1int13-gRNAFERint14 / pAD-MAN2A1int13-EGFP-tk-FERint14 (Ad-MF). These cells were then incubated with various concentrations of ganciclovir for 24 hours. Cell death was then quantified using phycoerythrin-labeled Annexin V by flow cytometry. HUH7 cells infected with pAD5-Cas9D10A-gRNATMEM135int13-gRNACCDC67int9 / pAD-TMEM135int13-EGFP-tk-CCDC67int9 (Ad-TC) were used as a specificity control. (G) HUH7 and HEP3B cells were xenografted into the subcutaneous region of SCID mice. These tumors were allowed to grow for 2 weeks before treatment. The mice were treated with the indicated viruses and ganciclovir (G, 80 mg / kg) or PBS (P). The indicated drugs were applied by intraperitoneal injection three times a week until all mice from the control treatment died. Tumor volumes were measured weekly. [Figure 15-4] (H) Mice treated with MAN2A1-FER breakpoint therapy did not contain cancer metastases. (I) Mice treated with MAN2A1-FER breakpoint therapy did not die. [Figure 16A] (A) Expression of Cas9D10A and HSV1-tk in HUH7 or HEP3B tumors treated with Ad-TC or pAD5-Cas9D10A-gRNAMAN2A1int13-gRNAFERint14 / pAD-MAN2A1int13-EGFP-tk-FERint14 (Ad-MF). Green arrows indicate unstained mouse stromal cells. [Figure 16B](B) Genomic therapy induced apoptosis in xenografted cancers containing fusion gene breakpoints. Terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling (TUNEL) assays were performed on PC3 BP, DU145 BP, PC3 CMV, DU145 CMV, or HUH7 xenografted cancers treated with Ad-TC or Ad-MF. [Figure 17-1] Diagram of Pten-NOLC1 fusion. (A) Schematic diagram of Pten-NOLC1 fusion. Top panel: Miniature diagram of the genome of the fusion gene, transcriptional direction, distance between linked genes and orientation of the fusion. Middle panel: Representative sequencing chromogram of the fusion transcript. Linked gene sequences are shown. Bottom panel: Diagram of the translation product of the Pten-NOLC1 fusion transcript. Blue - head gene translation product; red - tail gene translation product. (B) Fluorescence in situ hybridization shows genomic recombination in prostate cancer cells. Schematic diagram of Pten and NOLC1 genomic recombination and FISH probe location. Representative FISH images are shown for normal prostate epithelial cells and cancer cells positive for Pten-NOLC1 fusion. Orange indicates probe 1; green indicates probe 2. Fusion signal is indicated by green arrow. [Figure 17-2] (C) Genomic breakpoint analysis of Pten-NOLC1 fusion. Top panel: Miniature representation of the fusion gene genome, transcriptional direction, distance between linked genes and chromosomal linkage direction. Middle panel: Miniature representation of the fusion genome and transcriptional direction. Bottom panel: Representative sequencing chromogram encompassing the chromosomal linkage breakpoints. Intron 11 of Pten (blue) and intron 1 of NOLC1 (red) are indicated. [Figure 18-1] Diagram of a unique fusion gene event. Left panel: Miniature diagram of the fusion gene genome, transcription direction, distance between linked genes and orientation of the fusion. Center panel: Representative sequencing chromogram of the fusion transcript. Linked gene sequences are shown. Right panel: Diagram of the translation products of the fusion transcript. Blue - head gene translation product; red - tail gene translation product; orange - novel translation products due to frameshift or translation products from non-genic regions. [Figure 18-2] This is a continuation of Figure 18-1. [Figure 19-1] Fluorescence in situ hybridization suggests genomic recombination in prostate cancer cells. (A) Schematic diagram of DOCK7 and OLR1 genomic recombination and FISH probe location. Representative FISH images are shown for normal prostate epithelial cells and cancer cells positive for DOCK7-OLR1 fusion. Orange indicates probe 1; green indicates probe 2. Fusion ligation signals are indicated by green arrows. (B) Schematic diagram of SNTG1 and PCMTD1 genomic recombination and FISH probe location. Representative FISH images are shown for normal prostate epithelial cells and cancer cells positive for SNTG1-PCMTD1 fusion. Orange indicates probe 1; green indicates probe 2. Fusion ligation signals are indicated by green arrows. [Figure 19-2] (C) Schematic of ACPP and SEC13 genomic recombination and FISH probe location. Representative FISH images are shown for normal prostate epithelial cells and cancer cells positive for ACPP-SEC13 fusion. Orange indicates probe 1; green indicates probe 2. Fusion ligation signals are indicated by green arrows. (D) Schematic of ZMPSTE24 and ZMYM4 genomic recombination and FISH probe location. Representative FISH images are shown for normal prostate epithelial cells and cancer cells positive for ZMPSTE24-ZMYM4 fusion. Orange indicates probe 1; green indicates probe 2. Fusion ligation signals are indicated by green arrows. [Figure 19-3] (E) Schematic diagram of CLTC and ETV1 genomic recombination and FISH probe location. Representative FISH images are shown for normal prostate epithelial cells and cancer cells positive for CLTC-ETV1 fusion. Orange indicates probe 1; green indicates probe 2. Fusion ligation signals are indicated by green arrows. [Figure 20-1]Figure 1: Pten-NOLC1 in human cancers (A) Taqman qRT-PCR for detection of Pten-NOLC1 in human cancer cell lines and healthy organ donor prostate samples. [Figure 20-2] (B) Frequency of Pten-NOLC1 in primary human cancers. (C) Expression of Pten-NOLC1 protein. Top panel: Schematic representation of the functional domains of Pten and NOLC1 proteins and Pten-NOLC1 fusion protein. Truncation sites are indicated by arrows. NLS indicates nuclear localization signal; SRP40 indicates homology domain to the C-terminus of S. cerevisiae SRP40 protein; snoRNA binding indicates binding site for small nuclear RNA; T indicates serine-rich sequence homologous to HSV1 transcription factor ICP4. Bottom panel: Immunoblotting of Pten and Pten-NOLC1 proteins from primary prostate cancer samples (PCa638T, PCa207T, PCa624T, PCa099T and PCa090T) or healthy organ donor prostate samples (DO12 and DO17), or the indicated cell lines (lanes 8-12). [Figure 21A] Figure 1. Pten-NOLC1 in human cancer metastases and multiple loci. (A) Pten-NOLC1 in a primary cancer (P) and its matched lymph node metastasis (LN). Red - positive; grey - negative; blank - no sample. [Figure 21B] (B) Pten-NOLC1 is present in many prostate cancer loci. Red-positive; grey-negative; blank-no sample. [Figure 22-1]Figure 1 shows that Pten-NOLC1 translocates to the nucleus and lacks lipid phosphatase activity. (A) Immunofluorescence analysis of Pten, NOLC1 and Pten-NOLC1 in NIH3T3 and PC3 cells. Top panel: Immunostaining of Pten (left), NOLC1 (middle) and Pten-NOLC1-FLAG (right) in NIH3T3 cells with antibodies specific for Pten, NOLC1 or FLAG, respectively. Bottom panel: PC3 was transfected with pPten-EGFP (left), pNOLC1-mCherry (middle) and pPten-NOLC1-EGFP (right). [Figure 22-2] (B) Immunoblotting of Pten and Pten-NOLC1 in nuclear and cytoplasmic fractions of DU145 or NIH3T3 cells transfected with Pten-NOLC1-FLAG (PNOL-FLAG). Immunoblotting with antibodies specific for GAPDH and histone 3 was used as a control for fraction purity. (C) Pten-NOLC1 lacks PIP3 phosphatase activity in vitro. GST-glutamate-S-transferase; PNOL-Pten-NOLC1; IP-immunoprecipitation; T+-tetracycline induction; Ab-antibody. [Figure 23-1] FIG. 13: Pten-NOLC1 promotes cancer cell proliferation and invasion. (A) Schematic diagram of Pten-NOLC1 knockout strategy. The sequence of intron 11 of Pten is shown in blue, whereas the sequence of intron 1 of NOLC1 is shown in red. pCas9D10A-EGFP and Pten donor-Zeocin-mCherry-NOLC1 donor vectors were co-transfected into DU145 cells. The image shows the co-expression of Cas9D10A-EGFP and integrated Zeocin-mCherry, and knockout of Pten-NOLC1 in DU145KO1 cells. [Figure 23-2] (B) Taqman quantitative RT-PCR on Pten-NOLC1 knockout DU145 and MCF7 cells. Taqman RT-PCR for β-actin was used to control for RNA quantity. [Figure 23-3](C) Pten-NOLC1 expression promotes cell entry into S phase. Insets are representative images of BrdU labeling of 10,000 cells of DU145, DU145KO1, MCF7 and MCF7KO1. Triplicate experiments were performed. Standard deviations are shown. (D) Pten-NOLC1 promotes colony formation. Insets are representative images of crystal violet staining of colonies of DU145 / DU145KO1 and MCF7 / MCF7KO1 cells. Triplicate experiments were performed. Standard deviations are shown. [Figure 23-4] (E) Pten-NOLC1 promotes resistance to UV-induced cell death. Insets are representative images of Annexin V and PI staining of cells after exposure to 175 mj of UV irradiation. Triplicate experiments were performed. Standard deviations are shown. [Figure 23-5] (F) Depletion of Pten-NOLC1 reduced cancer cell invasion. Matrigel cross-section analysis was performed on DU145, DU145KO1 and DU145KO2 cells. Triplicate experiments were performed. Standard deviations are shown. MCF7 cells are unable to migrate through Matrigel. (G) Depletion of Pten-NOLC1 reduced the tumor volume of xenografted DU145 cells. [Figure 23-6] (H) Ablation of Pten-NOLC1 reduced the occurrence of metastases in xenografted DU145 cancer. (I) Ablation of Pten-NOLC1 improves survival of animals xenografted with DU145 cancer. [Figure 24] Figure 1: Pten-NOLC1 promotes the expression of pro-growth genes. (A) Ablation of Pten-NOLC1 induced downregulation of EGFR, VEGFA, GAB1 EREG, AXL and c-MET based on microarray analysis of DU145, DU145KO1 and DU145KO2. (B) Taqman quantitative RT-PCR of EGFR, AXL, EREG, VEGFA, c-MET and GAB1. Relative fold changes to parental DU145 cells are shown. Triplicate experiments were performed. Standard deviations are shown. (C) Ablation of Pten-NOLC1 reduced c-MET and GAB1 protein expression. [Figure 25-1]Figure 2: Creation of Pten-NOLC1 generates spontaneous liver cancer. (A) Schematic diagram of the process for somatic deletion of Pten and hydrodynamic tail vein injection of pT3-Pten-NOLC1-mCherry / pSB. Inset is a representative image of PC3 cells transfected with pT3-Pten-NOLC1-mCherry / pSB. (B) Representative images of livers from mice treated with AAV8-cre and pT3-Pten-NOLC1-mCherry / pSB (right) or AAV8-cre and pT3 / pSB (left). (C) Representative histology images of liver cancers from mice treated with AAV8-cre and pT3-Pten-NOLC1-mCherry / pSB (right) and mice treated with AAV8-cre and pT3 / pSB (left). [Figure 25-2] (D) High frequency of Ki-67 expression in liver cancer cells. Results are the average number of cells positive for Ki-67 per higher power field. Seven fields were counted per sample. (E) Pten-NOLC1 promotes the expression of c-MET and GAB1 in liver cancer cells. [Figure 26] Figure 1 shows transcriptome sequencing read distribution of Pten and NOLC1 genes. Graphs represent the distribution of individual samples for the ratio of first exon reads to all exon reads for Pten (top left) or NOLC1 (bottom left) or the ratio of last exon reads to all exon reads for Pten (top right) or NOLC1 (bottom right). Orange - samples from TCGA dataset (550 samples); Blue - Luo et al. dataset (86 samples). P-values ​​are indicated. [Figure 27-1] Spanning deletion between Pten exon 11 and NOLC1 exon 2 in 17 human malignancies. (A) Schematic of detection of spanning deletion between the two genes (red line) by copy number analysis of Pten and NOLC1 minigenomes and TCGA Affymetrix SNP6.0 data. The number of samples considered positive for the deletion is indicated. [Figure 27-2] (B) Frequency of spanning deletions between Pten and NOLC1 in 17 different human malignancies. (C) Frequency of Pten deletions in samples containing suggestive Pten-NOLC1 fusions. The total number of samples containing suggestive Pten-NOLC1 fusions is shown. [Figure 28-1] Figure 1: Pten-NOLC1 interacts with genomic DNA and activates the expression of proliferation-promoting genes. (A) Distribution of mapped DNA fragments derived from ChIP-sequencing of DU145 and DU145KO1 / KO2 (upper panel), and MCF7 and MCF7KO1 / KO2 (lower panel) using a NOLC1-specific antibody. The distribution of DNA fragments in DU145 or MCF7 cells after subtraction from their knockout counterparts is shown on the right. [Figure 28-2] This is a continuation of Figure 28-1. [Figure 28-3] (B) Taqman Q-PCR quantification of Pten-NOLC1 binding to the promoter / enhancer regions of MET, EGFR, RAF1, AXL, GAB1, and VEGFA. [Figure 28-4] (C) Ablation of Pten-NOLC1 reduced c-MET, EGFR, RAF1, and GAB1 protein expression, as well as phosphorylation of STAT3 and RAF1. [Figure 28-5] (D) MET, EGF and ECM signaling pathways are affected by the presence of Pten-NOLC1. Red icons indicate genes interacted by Pten-NOLC1 but not by NOLC1 protein. [Figure 29-1] Figure 1 shows Pten-NOLC1 binding to the promoter regions of MET, EGFR, RAF1, AXL and VEGFA. Peaks mapped by ChIP-sequencing from Pten-NOLC1 positive samples to the promoter regions of these genes are shown in red. The genomic location of the mapped DNA (using HG19 as reference) is indicated. The transcription start site is indicated by an arrow. Boxes indicate regions enriched for Pten-NOLC1 binding fragments. [Figure 29-2] This is a continuation of Figure 29-1. [Figure 29-3] This is a continuation of Figure 29-1. [Figure 29-4] This is a continuation of Figure 29-1. [Figure 29-5] This is a continuation of Figure 29-1. [Figure 30-1] Figure 1 shows cell death induced by genomic disruption of Pten-NOLC1. PC3 (prostate cancer), DU145 (prostate cancer), MCF7 (breast cancer), H1299 (lung cancer), SNU449 (liver cancer), SNU475 (liver cancer), HEP3B (liver cancer), T98G (glioblastoma multiforme), MB231 (breast cancer) and NIH3T3 (mouse immortalized fibroblast) cells were treated with Cas9D10A, or Cas9D10A + Pten-NOLC1-specific gRNA or Cas9D10A + Pten-NOLC1-specific gRNA + Pten-NOLC1 knockout cassette. Cell death was then analyzed 2 days after treatment using Annexin V and propidium iodide staining. [Figure 30-2] This is a continuation of Figure 30-1. [Figure 30-3] This is a continuation of Figure 30-1. [Figure 30-4] This is a continuation of Figure 30-1. [Figure 30-5] This is a continuation of Figure 30-1. [Diagram 31] Schematic diagram for detection of integration of TMEM135int13-EGFP-tk-CCDC67int9 into the TMEM135-CCDC67 breakpoint in the PC3 cell genome. Arrows indicate primer positions for PCR. Putative integration sites that generated mutations are indicated with yellow stars. PCR products obtained from xenografted PC3 cells containing the TMEM135-CCDC67 breakpoint before virus treatment were used as reference controls. PCR products obtained after virus (Ad-TC) infection were sequenced. The positions of mutations resulting from DNA integration were detected by Sanger sequencing. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] 5. Detailed Description of the Invention For purposes of clarity, and not by way of limitation, the detailed description of the invention is divided into the following subsections: (i) Fusion genes; (ii) fusion gene detection; (iii) cancer targets; (iv) the method of treatment; (v) genome editing technologies; and (vi) Kits.

[0015] 5.1 Fusion genes The term "fusion gene" as used herein refers to a nucleic acid or protein sequence that combines elements of the described genes or their RNA transcripts in a manner not found in the wild-type / normal nucleic acid or protein sequence. For example, but not limited to, in a fusion gene in the form of genomic DNA, the relative position of the portion of the genomic sequence of the described gene is changed compared to the wild-type / normal sequence (e.g., as reflected in the NCBI chromosomal location or the sequence described herein). In a fusion gene in the form of mRNA, portions of the RNA transcripts arising from both component genes are present (not necessarily in the same register as the wild-type transcript, and possibly including portions that are not normally present in the normal mature transcript). In non-limiting embodiments, such portions of genomic DNA or mRNA may include at least about 10 contiguous nucleotides, or at least about 20 contiguous nucleotides, or at least about 30 contiguous nucleotides, or at least about 40 contiguous nucleotides. In certain embodiments, such a portion of genomic DNA or mRNA may comprise up to about 10 contiguous nucleotides, up to about 50 contiguous nucleotides, up to about 100 contiguous nucleotides, up to about 200 contiguous nucleotides, up to about 300 contiguous nucleotides, up to about 400 contiguous nucleotides, up to about 500 contiguous nucleotides, up to about 600 contiguous nucleotides, up to about 700 contiguous nucleotides, up to about 800 contiguous nucleotides, up to about 900 contiguous nucleotides, up to about 1,000 contiguous nucleotides, up to about 1,500 contiguous nucleotides, or up to about 2,000 contiguous nucleotides of the nucleotide sequence of the gene present in the fusion gene.In certain embodiments, such a portion of the genomic DNA or mRNA may comprise about 10 or less contiguous nucleotides, about 50 or less contiguous nucleotides, about 100 or less contiguous nucleotides, about 200 or less contiguous nucleotides, about 300 or less contiguous nucleotides, about 400 or less contiguous nucleotides, about 500 or less contiguous nucleotides, about 600 or less contiguous nucleotides, about 700 or less contiguous nucleotides, about 800 or less contiguous nucleotides, about 900 or less contiguous nucleotides, about 1,000 or less contiguous nucleotides, about 1,500 or less contiguous nucleotides, or about 2,000 or less contiguous nucleotides of the nucleotide sequence of the gene present in the fusion gene. In certain embodiments, such a portion of the genomic DNA or mRNA does not comprise the complete wild type / normal nucleotide sequence of the gene present in the fusion gene. In the protein form of the fusion gene, there is a portion of the amino acid sequence that originates from both component genes (including but not limited to at least about 5 contiguous amino acids, or at least about 10 contiguous amino acids, or at least about 20 contiguous amino acids, or at least about 30 contiguous amino acids). In certain embodiments, such portions of the fusion gene protein may comprise up to about 10 contiguous amino acids, up to about 20 contiguous amino acids, up to about 30 contiguous amino acids, up to about 40 contiguous amino acids, up to about 50 contiguous amino acids, up to about 60 contiguous amino acids, up to about 70 contiguous amino acids, up to about 80 contiguous amino acids, up to about 90 contiguous amino acids, up to about 100 contiguous amino acids, up to about 120 contiguous amino acids, up to about 140 contiguous amino acids, up to about 160 contiguous amino acids, up to about 180 contiguous amino acids, up to about 200 contiguous amino acids, up to about 220 contiguous amino acids, up to about 240 contiguous amino acids, up to about 260 contiguous amino acids, up to about 280 contiguous amino acids, or up to about 300 contiguous amino acids of the amino acid sequences encoded by the genes present in the fusion gene.In certain embodiments, such a portion of the fusion gene protein may comprise about 10 or less contiguous amino acids, about 20 or less contiguous amino acids, about 30 or less contiguous amino acids, about 40 or less contiguous amino acids, about 50 or less contiguous amino acids, about 60 or less contiguous amino acids, about 70 or less contiguous amino acids, about 80 or less contiguous amino acids, about 90 or less contiguous amino acids, about 100 or less contiguous amino acids, about 120 or less contiguous amino acids, about 140 or less contiguous amino acids, about 160 or less contiguous amino acids, about 180 or less contiguous amino acids, about 200 or less contiguous amino acids, about 220 or less contiguous amino acids, about 240 or less contiguous amino acids, about 260 or less contiguous amino acids, about 280 or less contiguous amino acids, or about 300 or less contiguous amino acids of the amino acid sequence encoded by the genes present in the fusion gene. In certain embodiments, such a portion of the fusion gene protein does not include the entire wild-type / normal amino acid sequence encoded by the genes present in the fusion gene. In this paragraph, the part originating from both genes, transcripts or proteins does not refer to sequences that may coincidentally be identical in the wild-type form of both genes (i.e., the part is "non-shared").As such, a fusion gene is, generally speaking, a fusion of genomic elements that are not normally spliced ​​together or linked together.For further information regarding the disclosed fusion genes, please refer to WO2015 / 103057 and WO2016 / 011428, the contents of which are incorporated herein by reference.

[0016] The fusion gene TRMT11-GRIK2 is a fusion of the tRNA methyltransferase 11 homolog ("TRMT11") and glutamate receptor, ionotropic, kainate 2 ("GRIK") genes. The human TRMT11 gene is typically located on chromosome 6q11.1, and the human GRIK2 gene is typically located on chromosome 6q16.3. In certain embodiments, the TRMT11 gene is a human gene with NCBI Gene ID number 60487, sequence chromosome 6;NC_000006.11 (126307576..126360422), and / or the GRIK2 gene is a human gene with NCBI Gene ID number 2898, sequence chromosome 6;NC_000006.11 (101841584..102517958). In certain embodiments, the junction of the TRMT11-GRIK2 fusion gene (also referred to herein as the chromosomal breakpoint and / or junction fragment) comprises the sequence shown in FIG.

[0017] The fusion gene SLC45A2-AMACR is a fusion of the solute transport family 45, member 2 ("SLC45A2") and the alpha-methylacyl-CoA racemase ("AMACR") gene. The human SLC45A2 gene is typically located on human chromosome 5p13.2, and the human AMACR gene is typically located on chromosome 5p13. In certain embodiments, the SLC45A2 gene is a human gene having NCBI Gene ID number 51151, sequence chromosome 5; NC_000005.9 (33944721..33984780, complement), and / or the AMACR gene is a human gene having NCBI Gene ID number 23600, sequence chromosome 5; NC_000005.9 (33987091..34008220, complement). In certain embodiments, the junction and / or junction fragment of the SLC45A2-AMACR fusion gene comprises the sequence shown in FIG.

[0018] The fusion gene MTOR-TP53BP1 is a fusion of the mechanistic target of rapamycin ("MTOR") and tumor protein p53 binding protein 1 ("TP53BP1") genes. The human MTOR gene is typically located on chromosome 1p36.2, and the human TP53BP1 gene is typically located on chromosome 15q15-q21. In certain embodiments, the MTOR gene is a human gene with NCBI Gene ID number 2475, sequence chromosome 1 NC_000001.10 (11166588..11322614, complement), and / or the TP53BP1 gene is a human gene with NCBI Gene ID number 7158, sequence chromosome 15; NC_000015.9 (43695262..43802707, complement). In certain embodiments, the junction and / or junction fragment of the MTOR-TP53BP1 fusion gene comprises a sequence shown in FIG.

[0019] The fusion gene LRRC59-FLJ60017 is a fusion of the leucine-rich repeat containing 59 ("LRRC59") gene and the "FLJ60017" nucleic acid. The human LRRC59 gene is typically located on chromosome 17q21.33, and the nucleic acid encoding human FLJ60017 is typically located on chromosome 11q12.3. In certain embodiments, the LRRC59 gene is a human gene having NCBI Gene ID number 55379, sequence chromosome 17; NC_000017.10 (48458594..48474914, complement), and / or FLJ60017 has the nucleic acid sequence set forth in GeneBank AK_296299. In certain embodiments, the junction and / or junction fragment of the LRRC59-FLJ60017 fusion gene comprises the sequence shown in FIG. 1, FIG. 2, and / or Table 1.

[0020] The fusion gene TMEM135-CCDC67 is a fusion of the transmembrane protein 135 ("TMEM135") and the coiled-coil domain containing 67 ("CCDC67") genes. The human TMEM135 gene is typically located on chromosome 11q14.2, and the human CCDC67 gene is typically located on chromosome 11q21. In certain embodiments, the TMEM135 gene is a human gene with NCBI Gene ID number 65084, sequence chromosome 11; NC_000011.9 (86748886..87039876), and / or the CCDC67 gene is a human gene with NCBI Gene ID number 159989, sequence chromosome 11; NC_000011.9 (93063156..93171636). In certain embodiments, the junctions and / or junction fragments of the TMEM135-CCDC67 fusion gene comprise the sequences shown in FIG.

[0021] The fusion gene CCNH-C5orf30 is a fusion of cyclin H ("CCNH") and chromosome 5 open reading frame 30 ("C5orf30") genes. The human CCNH gene is typically located on chromosome 5q13.3-q14, and the human C5orf30 gene is typically located on chromosome 5q21.1. In certain embodiments, the CCNH gene is a human gene with NCBI Gene ID number 902, sequence chromosome 5; NC_000005.9 (86687310..86708850, complement), and / or the C5orf30 gene is a human gene with NCBI Gene ID number 90355, sequence chromosome 5; NC_000005.9 (102594442..102614361). In certain embodiments, the junctions and / or junction fragments of the CCNH-C5orf30 fusion gene comprise the sequences shown in FIG.

[0022] The fusion gene KDM4B-AC011523.2 is a fusion of lysine (K)-specific demethylase-4B ("KDM4B") and the chromosomal region "AC011523.2". The human KDM4B gene is typically located on chromosome 19p13.3, and the human AC011523.2 region is typically located on chromosome 19q13.4. In certain embodiments, the KDM4B gene is a human gene having NCBI Gene ID number 23030, sequence chromosome 19; NC_000019.9 (4969123..5153609); and / or the AC011523.2 region comprises the sequence shown in FIG. 1. In certain embodiments, the junction and / or junction fragment of the KDM4B-AC011523.2 fusion gene comprises the sequence shown in FIG. 1 and / or Table 1.

[0023] The fusion gene MAN2A1-FER is a fusion of mannosidase, alpha, class 2A, member 1 ("MAN2A1") and (fps / fes-related) tyrosine kinase ("FER"). The human MAN2A1 gene is typically located on chromosome 5q21.3, and the human FER gene is typically located on chromosome 5q21. In certain embodiments, the MAN2A1 gene is a human gene having NCBI Gene ID number 4124, sequence chromosome 5; NC_000005.9 (109025156..109203429) or NC_000005.9 (109034137..109035578); and / or the FER gene is a human gene having NCBI Gene ID number 2241, sequence chromosome 5: NC_000005.9 (108083523..108523373). In certain embodiments, the junction and / or junction fragment of the MAN2A1-FER fusion gene comprises the sequence shown in FIG. 1, FIG. 4, FIG. 15, and / or Table 1.

[0024] The fusion gene PTEN-NOLC1 is a fusion of phosphatase and tensin homolog ("PTEN") and nuclear and coiled-body phosphoprotein 1 ("NOLC1"). The human PTEN gene is typically located on chromosome 10q23.3, and the human NOLC1 gene is typically located on chromosome 10q24.32. In certain embodiments, the PTEN gene is a human gene with NCBI Gene ID number 5728, sequence chromosome 10; NC_000010.11 (87863438..87970345), and / or the NOLC1 gene is a human gene with NCBI Gene ID number 9221, sequence chromosome 10; NC_000010.11 (102152176..102163871). In certain embodiments, the junction and / or junction fragment of the PTEN-NOLC1 fusion gene comprises the sequence shown in FIG.

[0025] The fusion gene ZMPSTE24-ZMYM4 is a fusion of zinc metallopeptidase STE24 ("ZMPSTE24") and zinc finger MYM-4 type ("ZMYM4"). Human ZMPSTE24 is typically located on chromosome 1p34, and human ZMYM4 gene is typically located on chromosome 1p32-p34. In certain embodiments, the ZMPSTE24 gene is a human gene with NCBI Gene ID number 10269, sequence chromosome 1; NC_000001.11 (40258050..40294184), and / or the ZMYM4 gene is a human gene with NCBI Gene ID number 9202, sequence chromosome 1; NC_000001.11 (35268850..35421944). In certain embodiments, the junctions and / or junction fragments of the ZMPSTE24-ZMYM4 fusion gene comprise the sequences shown in FIG. 6 and / or FIG.

[0026] The fusion gene CLTC-ETV1 is a fusion of clathrin, heavy chain (Hc) ("CLTC") and ets variant 1 ("ETV1"). Human CLTC is typically located on chromosome 17q23.1, and human ETV1 gene is typically located on chromosome 7p21.3. In certain embodiments, the CLTC gene is a human gene with NCBI Gene ID number 1213, sequence chromosome 17; NC_000017.11 (59619689..59696956), and / or the ETV1 gene is a human gene with NCBI Gene ID number 2115, sequence chromosome 7; NC_000007.14 (13891229..13991425, complement). In certain embodiments, the junction and / or junction fragment of the CLTC-ETV1 fusion gene comprises the sequence shown in FIG. 6 and / or FIG. 18, or a fragment thereof.

[0027] The fusion gene ACPP-SEC13 is a fusion of acid phosphatase, prostate ("ACPP") and SEC13 homolog ("SEC13"). Human ACPP is typically located on chromosome 3q22.1, and human SEC13 gene is typically located on chromosome 3p25-p24. In certain embodiments, the ACPP gene is a human gene having NCBI Gene ID number 55, sequence chromosome 3; NC_000003.12 (132317367..132368302), and / or the SEC13 gene is a human gene having NCBI Gene ID number 6396, sequence chromosome 3; NC_000003.12 (10300929..10321188, complement). In certain embodiments, the junction and / or junction fragment of the ACPP-SEC13 fusion gene comprises the sequence shown in FIG. 6 and / or FIG. 18.

[0028] The fusion gene DOCK7-OLR1 is a fusion of dedicator of cytokinesis 7 ("DOCK7") and oxidized low density lipoprotein (lectin-like) receptor 1 ("OLR1"). Human DOCK7 is typically located on chromosome 1p31.3, and human OLR1 gene is typically located on chromosome 12p13.2-p12.3. In certain embodiments, the DOCK7 gene is a human gene with NCBI Gene ID number 85440, sequence chromosome 1; NC_000001.11 (62454726..62688368, complement), and / or the OLR1 gene is a human gene with NCBI Gene ID number 4973, sequence chromosome 12; NC_000012.12 (10158300..10172191, complement). In certain embodiments, the junction and / or junction fragment of the DOCK7-OLR1 fusion gene comprises the sequence shown in FIG. 6 and / or FIG.

[0029] The fusion gene PCMTD1-SNTG1 is a fusion of protein-L-isoaspartic acid (D-aspartic acid) O-methyltransferase domain-containing 1 ("PCMTD1") and syntrophin, gamma 1 ("SNTG1"). Human PCMTD1 is typically located on chromosome 8q11.23, and human SNTG1 gene is typically located on chromosome 8q11.21. In certain embodiments, the PCMTD1 gene is a human gene with NCBI Gene ID number 115294, sequence chromosome 8; NC_000008.11 (51817575..51899186, complement), and / or the SNTG1 gene is a human gene with NCBI Gene ID number 54212, sequence chromosome 8; NC_000008.11 (49909789..50794118). In certain embodiments, the junction and / or junction fragment of the PCMTD1-SNTG1 fusion gene comprises the sequence shown in FIG. 6 and / or FIG.

[0030] 5.2 Fusion gene detection Any of the fusion genes described above in Section 5.1 can be identified and / or detected by methods known in the art. The fusion gene can be detected by detecting the fusion gene present in a DNA molecule, an RNA molecule, or a protein. In certain embodiments, the fusion gene can be detected by determining the presence of a DNA molecule, an RNA molecule, or a protein encoded by the fusion gene. For example, but not limited to, the presence of a fusion gene can be detected by determining the presence of a protein encoded by the fusion gene.

[0031] The fusion gene can be detected in a sample of a subject. "Patient" or "subject", used interchangeably herein, refers to a human or non-human subject. Non-limiting examples of non-human subjects include non-human primates, dogs, cats, mice, etc. The subject may or may not have been previously diagnosed with cancer.

[0032] In certain non-limiting embodiments, samples include, but are not limited to, cells in culture, cell supernatants, cell lysates, serum, plasma, biological fluids (e.g., blood, plasma, serum, feces, urine, lymph, peritoneal fluid, intraductal lavage, saliva, and cerebrospinal fluid) and tissue samples. The source of the sample may be solid tissue (e.g., from fresh, frozen, and / or preserved organs, tissue samples, biopsies, or aspirates), blood or any blood components, bodily fluids (e.g., urine, lymph, cerebrospinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid), or cells from an individual, including circulating cancer cells. In certain non-limiting embodiments, the sample is obtained from a cancer. In certain embodiments, the sample may be a "biopsy sample" or a "clinical sample," which is a sample from a subject. In certain embodiments, the sample includes one or more cancer cells from a subject. In certain embodiments, one or more fusion genes can be detected in one or more samples obtained from a subject, such as one or more cancer cell samples. In certain embodiments, the sample is not a prostate cancer sample or one or more prostate cancer cells. In certain embodiments, the sample is not a lung adenocarcinoma, glioblastoma multiforme, or hepatocellular carcinoma sample.

[0033] In certain non-limiting embodiments, the fusion gene is detected by nucleic acid hybridization analysis.

[0034] In certain non-limiting embodiments, fusion genes are detected by fluorescence in situ hybridization (FISH) analysis. FISH is a technique that can directly identify specific sequences of DNA or RNA in cells or biological samples, allowing visual determination of the presence and / or expression of fusion genes in tissue samples. In certain non-limiting embodiments, where fusion genes combine genes that are not typically present on the same chromosome, FISH analysis can show probes that bind to the same chromosome. For example, but not limited to, analysis can focus on the chromosome where one gene is normally present, and then hybridization analysis can be performed to determine whether other genes are present on that chromosome as well.

[0035] In certain non-limiting embodiments, the fusion gene is detected by DNA hybridization, including but not limited to Southern blot analysis.

[0036] In certain non-limiting embodiments, fusion gene is detected by RNA hybridization, such as, but not limited to, Northern blot analysis.In certain embodiments, Northern blot analysis can be used to detect fusion gene, in which isolated RNA sample is run on denaturing agarose gel and transferred to suitable support, such as activated cellulose, nitrocellulose or glass or nylon membrane.Radiolabeled cDNA or RNA is then hybridized to the preparation, washed, and analyzed by autoradiography to detect the presence of fusion gene in RNA sample.

[0037] In certain non-limiting embodiments, the fusion gene is detected by nucleic acid sequencing analysis.

[0038] In certain non-limiting embodiments, fusion genes are detected by the probe present on DNA array, chip or microarray.For example, but not limited to, the oligonucleotides corresponding to one or more fusion genes can be immobilized on chip and then hybridized with the labeled nucleic acid of the sample obtained from the subject.Positive hybridization signal is obtained for the sample that contains fusion gene transcript.

[0039] In certain non-limiting embodiments, the fusion gene is detected by a method comprising reverse transcription polymerase chain reaction ("RT-PCR"). In certain embodiments, the fusion gene is detected by a method comprising RT-PCR using one or more primer pairs disclosed herein (see, for example, Table 5).

[0040] In certain non-limiting embodiments, the fusion gene is detected by antibody binding assays, including but not limited to, Western blot analysis and immunohistochemistry.

[0041] [Table 1] TIFF0007627085000002.tif85158

[0042] 5.3 Cancer Targeting Non-limiting examples of cancers that may be the subject of the invention disclosed herein include prostate cancer, breast cancer, liver cancer, hepatocellular carcinoma, liver cancer, lung cancer, non-small cell lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, ovarian cancer, gastric cancer, thyroid cancer, glioblastoma multiforme (glioblastoma multiforme), colorectal cancer, diffuse large B-cell lymphoma, sarcoma, acute and chronic lymphocytic leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, and adenocarcinoma, such as esophageal adenocarcinoma.In certain embodiments, the target of treatment is a precancerous or neoplastic condition, including lung, cervical, endometrial, pancreatic, ovarian, stomach, thyroid, glial, intestinal, esophageal, muscle, or B-cell.In certain embodiments, the cancer is not prostate cancer.In certain embodiments, the cancer is not lung adenocarcinoma, glioblastoma multiforme, or hepatocellular carcinoma. In certain embodiments, the target of treatment is a cell carrying at least one fusion gene, eg, PTEN-NOLC1 or MAN2A1-FER.

[0043] 5.4 Treatment Method The present invention provides a method of treating a subject having one or more cells carrying a fusion gene. In certain embodiments, the subject has or is suspected of having a cancer or neoplasm or precancerous condition (precancerous condition is characterized by the presence of precancerous or neoplastic cells) carrying one or more fusion genes. Non-limiting examples of fusion genes are disclosed herein and in Section 5.1. In certain embodiments, the method of treatment includes performing targeted genome editing techniques on one or more cancer cells in the subject to produce an anti-cancer or anti-neoplastic or anti-proliferative effect. Non-limiting examples of cancers that can be treated using the disclosed methods are provided in Section 5.3. Non-limiting examples of genome editing techniques are disclosed in Section 5.5.

[0044] An "anti-cancer effect" refers to one or more of the following: a reduction in aggregated cancer cell mass, a decrease in the rate of cancer cell proliferation, a reduction in cancer progression, a reduction in cancer cell proliferation, a reduction in tumor mass, a reduction in tumor volume, a reduction in tumor cell proliferation, a reduction in tumor growth rate, and / or a reduction in tumor metastasis. In certain embodiments, an anti-cancer effect may refer to complete remission, partial remission, stable disease (no progression or recurrence), a remission showing slower recurrence, or progression-free survival in a patient diagnosed with cancer. In certain embodiments, an anti-cancer effect may refer to, for example, induction of cell death in one or more cells of the cancer and / or an increase in cell death within the tumor mass. Similarly, an "anti-neoplastic effect" refers to a reduction in aggregated neoplastic cell mass, a reduction in the rate of neoplastic cell proliferation, a reduction in neoplastic progression (e.g., progressive dedifferentiation or epithelial-mesenchymal transition), a reduction in neoplastic cell proliferation, a reduction in neoplastic mass, a reduction in neoplastic volume, and / or a reduction in neoplastic growth rate.

[0045] In certain embodiments, the method of treating a subject includes determining the presence of one or more fusion genes in a sample from the subject, and performing a targeted genome editing technique on one or more cells in the subject if one or more fusion genes are present in the sample. In certain embodiments, the genome editing technique results in a reduction and / or elimination of expression of the fusion gene and / or the expression of the protein encoded by the fusion gene in one or more cells of the subject. In certain embodiments, the genome editing technique specifically targets cells carrying the fusion gene, for example, by specifically targeting the nucleic acid sequence of the fusion gene. For example, but not limited to, the method of the present invention specifically targets the chromosomal breakpoint of one or more fusion genes. In certain embodiments, the method of the present invention includes targeting the sequence adjacent to the breakpoint. In certain embodiments, the method of the present invention includes targeting the sequence adjacent to and partially overlapping with the breakpoint. Non-limiting examples of techniques for identifying and / or detecting fusion genes are disclosed in Section 5.2.

[0046] In certain embodiments, a method of treating cancer in a subject includes determining the presence of one or more fusion genes in a cancer cell-containing sample from the subject, and if the one or more fusion genes are present in the sample, performing a targeted genome editing technique on one or more cancer cells in the subject to provide an anti-cancer or anti-neoplastic effect.

[0047] In certain embodiments, the method may include determining the presence or absence of fusion genes.For example, but not limited to, the method may include determining 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, or all 14 of the fusion genes disclosed herein. In certain embodiments, the one or more fusion genes may be TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1, or a combination thereof.

[0048] In a particular embodiment, the fusion gene may be TMEM135-CCDC67.

[0049] In a particular embodiment, the fusion gene may be CCNH-C5orf30.

[0050] In a particular embodiment, the fusion gene may be MAN2A1-FER.

[0051] In a particular embodiment, the fusion gene may be PTEN-NOLC1.

[0052] In certain embodiments, the fusion gene is not TMEM135-CCDC67 or CCNH-C5orf30.

[0053] In certain embodiments, the method of treating a subject includes determining the presence of one or more fusion genes (e.g., selected from the group consisting of MAN2A1-FER, TMEM135-CCDC67, TRMT11-GRIK2, CCNH-C5orf30, LRRC59-FLJ60017, SLC45A2-AMACR, KDM4B-AC011523.2, PTEN-NOLC1, MTOR-TP53BP1 or a combination thereof) in a sample from the subject, and if one or more fusion genes are detected in the sample, performing a targeted genome editing technique on the fusion genes in one or more cancer cells in the subject to provide an anti-cancer effect.

[0054] In certain embodiments, a method of treating a subject having cancer includes determining the presence of one or more fusion genes selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1 or combinations thereof in one or more cancer cells of the subject, and if the one or more fusion genes are detected in the cancer cells, performing a genome editing technique to target the fusion genes present in the one or more cancer cells of the subject to provide an anti-cancer effect. In certain embodiments, normal or non-cancerous cells adjacent to the cancer cells are not subjected to the genome editing technique because the gRNA is specific to the sequence of the fusion gene, e.g., specific to the sequence of the breakpoint.

[0055] In certain embodiments, a method of treating a subject having cancer includes determining the presence of one or more fusion genes selected from the group consisting of ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1, or combinations thereof, in one or more cancer cells of the subject, and if the one or more fusion genes are detected in the cancer cells, performing a targeted genome editing technique on one or more cancer cells in the subject to provide an anti-cancer effect.

[0056] In certain embodiments, a method of treating a subject includes determining the presence of one or more fusion genes selected from the group consisting of CCNH-C5orf30, TMEM135-CCDC67, PTEN-NOLC1, MAN2A1-FER and combinations thereof in one or more cells of the subject, and if one or more fusion genes are detected in the cells, performing a targeted genome editing technique on one or more cancer cells in the subject, for example, to reduce and / or eliminate expression of the fusion gene(s) and / or reduce and / or eliminate expression of a protein encoded by the fusion gene(s) in one or more cells of the subject.

[0057] In certain embodiments, a method of treating a subject having cancer includes determining the presence of one or more fusion genes selected from the group consisting of CCNH-C5orf30, TMEM135-CCDC67, PTEN-NOLC1, MAN2A1-FER and combinations thereof in one or more cells of the subject, and if the one or more fusion genes are detected in the cancer cells, performing a targeted genome editing technique on one or more cancer cells in the subject to provide an anti-cancer effect.

[0058] In certain embodiments, the present invention provides a method of producing an anti-cancer effect in a subject having cancer, comprising performing a targeted genome editing technique on one or more cancer cells containing a fusion gene in the subject, e.g., by targeting the fusion gene, to produce an anti-cancer effect.

[0059] The present invention further provides a method of preventing, minimizing, and / or reducing tumor growth comprising determining the presence of one or more fusion genes in a sample from a subject, and if the one or more fusion genes are present in the sample, performing a genome editing technique to target the fusion genes present in the subject's tumor to prevent, minimize, and / or reduce tumor growth.

[0060] The present invention provides a method for preventing, minimizing, and / or reducing the growth and / or proliferation of cancer cells, comprising determining the presence of one or more fusion genes in a sample of a subject, and if one or more fusion genes are present in the sample, performing genome editing technology to target the fusion genes, for example, by targeting chromosomal breakpoints present in the cancer cells of the subject, to prevent, minimizing, and / or reducing the growth and / or proliferation of cancer cells.In certain embodiments, the sequence adjacent to the breakpoints can be targeted by genome editing technology.

[0061] In certain non-limiting embodiments, the present invention provides methods of treating and / or inhibiting the progression of cancer and / or tumor and / or neoplastic growth in a subject, comprising determining the presence of one or more fusion genes in a sample from the subject, and if the one or more fusion genes are present in the sample, performing targeted genome editing techniques on one or more cells derived from the cancer and / or tumor of the subject to treat and / or inhibit the progression of the cancer and / or tumor.

[0062] In certain embodiments, the present invention provides a method for extending the survival time of a subject with cancer.In certain embodiments, the method includes determining the presence of one or more fusion genes in a sample of the subject, and if the one or more fusion genes are present in the sample, performing targeted genome editing technology on one or more cancer cells in the subject to produce an anti-cancer effect.In certain embodiments, the survival time of a subject with cancer can be extended by about 1 month, about 2 months, about 4 months, about 6 months, about 8 months, about 10 months, about 12 months, about 14 months, about 18 months, about 20 months, about 2 years, about 3 years, about 5 years or more using the disclosed method.

[0063] In certain embodiments, the present invention provides a method for treating a subject comprising determining that at least one fusion gene is present in a sample obtained from the subject, and then performing a genome editing technique to target the fusion gene in one or more cells of the subject to achieve an anti-neoplastic effect, wherein the subject does not have prostate cancer.

[0064] In certain embodiments, the present invention provides a drug capable of performing targeted genome editing for use in a method for treating a subject, or a composition comprising the drug. For example, but not limited to, the present invention provides a drug capable of performing targeted genome editing for use in a method for treating or preventing cancer in a subject, the method comprising performing a targeted genome editing procedure with the drug on one or more cells, e.g., cancer cells, that contain a fusion gene in the subject. In certain embodiments, the present invention provides a drug capable of performing targeted genome editing for use in a method for treating or preventing cancer in a subject, or a composition thereof, the method comprising (i) determining the presence of one or more fusion genes in a cancer sample of the subject, and (ii) performing a targeted genome editing procedure with the drug on one or more cancer cells in the subject if the sample contains a fusion gene. In certain embodiments, the drug targets a specific chromosomal breakpoint of one or more fusion genes. In certain embodiments, the method of the present invention comprises targeting the sequence adjacent to the breakpoint. In certain embodiments, the drug is an endonuclease. For example, but not limited to, the endonuclease is a Cas9 protein. In certain embodiments, the endonuclease is a mutant form of Cas9, e.g., Cas9 D10A In certain embodiments, the agent is an endonuclease, e.g., Cas9, in a complex with one or more gRNAs (e.g., ribonucleoproteins). In certain embodiments, the agent is a siRNA molecule.

[0065] In certain embodiments, the invention provides methods of determining a treatment for a subject having one or more cells that contain one or more fusion genes. In certain embodiments, the method may include: i) providing a sample from a subject; ii) determining whether one or more cells of the subject contain one or more fusion genes selected from the group consisting of TMEM135-CCDC67, TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1, and combinations thereof; and iii) directing the performance of a genome editing technique if the one or more fusion genes are detected in the one or more cells, wherein the genome editing technique targets the one or more fusion genes detected in the one or more cells, and the subject does not have prostate cancer. In certain embodiments, the genome editing technique is performed using the CRISPR / Cas9 system.

[0066] In certain embodiments, the sample in which one or more fusion genes are detected is prostate cancer, breast cancer, liver cancer, hepatocellular carcinoma, adenocarcinoma, liver cancer, lung cancer, non-small cell lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, ovarian cancer, gastric cancer, thyroid cancer, glioblastoma multiforme, colorectal cancer, sarcoma, diffuse large B-cell lymphoma, acute lymphocytic leukemia, chronic lymphocytic leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, and esophageal adenocarcinoma.

[0067] In certain embodiments, the sample is a glioblastoma sample, a breast cancer sample, a lung cancer sample, a liver cancer sample, an ovarian cancer sample, an adenocarcinoma sample, or a colon cancer sample.

[0068] In certain embodiments, the sample in which one or more fusion genes are detected is a breast cancer sample, a lung cancer sample, or a colon cancer sample.

[0069] In certain embodiments, the sample in which the one or more fusion genes are detected is not a prostate cancer sample.

[0070] In certain embodiments, the sample is not a lung adenocarcinoma, glioblastoma multiforme, or hepatocellular carcinoma sample.

[0071] In certain embodiments, the fusion gene in the sample is detected by genome sequencing.In certain embodiments, the fusion gene in the sample is detected by RNA sequencing.For example, but not limited to, RNA sequencing can be carried out using the primers disclosed in Table 5.In certain embodiments, the fusion gene in the sample is detected by FISH.

[0072] In certain embodiments, the method of treating a subject, for example a subject with a cancer carrying a fusion gene disclosed herein, may further include administering a therapeutically effective amount of an anti-cancer agent or an agent that produces an anti-neoplastic effect. A "therapeutically effective amount" refers to an amount that can achieve one or more of the following: anti-cancer effect, anti-neoplastic effect, prolonged survival, and / or prolonged time to recurrence. The anti-cancer agent may be any molecule, compound, or composition that has an anti-cancer effect. Anti-cancer agents include, but are not limited to, chemotherapeutic agents, radiotherapeutic agents, cytokines, anti-angiogenic agents, apoptosis inducers, or anti-cancer antitoxins. In certain non-limiting embodiments, the genome editing technology disclosed herein can be used in combination with one or more anti-cancer agents. As used herein, "in combination" means that the genome editing technology and one or more anti-cancer agents (or agents that produce an anti-neoplastic effect) are part of a treatment regimen or plan for the subject.

[0073] 5.5 Genome targeting / editing technologies Genome editing is a technique that can use targeting endonucleases and single-stranded nucleic acids to edit, e.g., modify, endogenous chromosomal sequences present in one or more cells in a subject. Genome editing methods can result in the insertion of a nucleic acid sequence at a specific region in a genome, the excision of a specific sequence from a genome, and / or the replacement of a specific genomic sequence with a new nucleic acid sequence. In certain embodiments, genome editing techniques can result in the suppression of the expression of a gene, e.g., a fusion gene. For example, but not limited to, a nucleic acid sequence can be inserted into the chromosomal breakpoint of a fusion gene. A non-limiting example of genome editing techniques for use in the disclosed method is the CRISPR system, e.g., the CRISPR / Cas9 system. Non-limiting examples of such genome editing techniques are disclosed in PCT Application Nos. WO2014 / 093701 and WO2014 / 165825, the contents of which are incorporated herein by reference in their entirety.

[0074] In certain embodiments, genome editing techniques may include the use of one or more guide RNAs (gRNAs) that are complementary to a specific sequence within a genome, e.g., a chromosomal breakpoint associated with a fusion gene, including a protospacer adjacent motif (PAM), to guide a nuclease, e.g., an endonuclease, to a specific genomic sequence. In certain embodiments, genome editing techniques may include the use of one or more guide RNAs (gRNAs) that are complementary to a sequence adjacent to and / or overlapping with a chromosomal breakpoint (see, e.g., Figures 13, 15, and 23) to guide one or more nucleases.

[0075] In certain embodiments, one or more gRNAs may comprise a targeting sequence that is complementary to a sequence present in the fusion gene, e.g., complementary to a sequence adjacent to and / or overlapping with a chromosomal breakpoint. In certain embodiments, one or more gRNAs used to target the fusion gene may comprise a sequence that is at least partially complementary to the breakpoint sequence of the fusion gene and at least partially complementary to a sequence of one of the genes that comprise the fusion gene. In certain embodiments, the targeting sequence is about 10 to about 50 nucleotides in length, e.g., about 10 to about 45 nucleotides in length, about 10 to about 40 nucleotides in length, about 10 to about 35 nucleotides in length, about 10 to about 30 nucleotides in length, about 10 to about 25 nucleotides in length, about 10 to about 20 nucleotides in length, about 10 to about 15 nucleotides in length, about 15 to about 50 nucleotides in length, about 20 to about 50 nucleotides in length, about 25 to about 50 nucleotides in length, about 30 to about 50 nucleotides in length, about 35 to about 50 nucleotides in length, about 40 to about 50 nucleotides in length, or about 45 to about 50 nucleotides in length. In certain embodiments, the targeting sequence is greater than about 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more nucleotides in length.

[0076] In certain embodiments, one or more gRNAs comprise a pair of offset gRNAs complementary to opposite strands of the target site. In certain embodiments, one or more gRNAs comprise a pair of offset gRNAs complementary to opposite strands of the target site for generating an offset nick by an endonuclease. In certain embodiments, the offset nick is generated by a nickase, e.g., Cas9. D10AIn certain embodiments, the offset gRNA pair is derived using a pair of offset gRNAs comprising a Cas9 nickase, such as at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or at least 100 nucleotides. In certain embodiments, the offset sgRNA pair is offset by about 5 to about 100 nucleotides, about 10 to about 50 nucleotides, about 10 to about 40 nucleotides, about 10 to about 30 nucleotides, about 10 to about 20 nucleotides, or about 10 to about 30 nucleotides.

[0077] In certain non-limiting embodiments, the PAM can be recognized by a CRISPR endonuclease, such as a Cas protein. Non-limiting examples of Cas proteins include, but are not limited to, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl or Csxl2), CaslO, Csyl, Csy2, Csy3, Cse, Csyl ... l, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, CsxlS, Csfl, Csf2, CsO, Csf4, Cpfl, c2cl, c2c3, Cas9HiFi, homologs thereof or modified forms thereof.

[0078] In certain embodiments, the endonuclease may be a clustered randomized controlled short palindromic repeat (CRISPR) associated protein 9 (Cas9) endonuclease. In certain embodiments, the Cas9 endonuclease is obtained from Streptococcus pyogenes. In certain embodiments, the Cas9 endonuclease is obtained from Staphylococcus aureus. In certain embodiments, the endonuclease can effect cleavage of the target genomic sequence, allowing modification of the genome at the cleavage site by non-homologous end joining (NHEJ) or homologous recombination. In certain embodiments, the Cas9 endonuclease may be a mutant form of Cas9, e.g., that generates a single-strand break or "nick." For example, but not limited to, the Cas9 protein may be a Cas9 protein that contains a D10A mutation, i.e., Cas9 D10A (See Cong et al., Science. 339:819-823 (2013); Gasiunas et al., PNAS 109:E2579-2586 (2012); and Jinek et al., Science. 337:816-821 (2012), the contents of which are incorporated herein by reference).

[0079] In certain embodiments, genome editing methods and / or technologies can be used to target one or more sequences of fusion genes present in cells, such as cancer cells, to promote homologous recombination to insert nucleic acid into the genome of cells.For example, but not limited to, genome editing technologies can be used to target the region where two genes of fusion genes are joined together (i.e., junction and / or chromosomal breakpoint).

[0080] In certain embodiments, genome editing methods and / or techniques can be used to knock out fusion gene, for example, by cutting out at least a part of fusion gene, and destroying fusion gene sequence.For example, but not limited to, endonuclease, for example, wild-type Cas9 endonuclease, can be used to specifically cut the double-stranded DNA sequence of fusion gene, and in the absence of homologous template repair, non-homologous end joining can result in indel that destroys fusion gene sequence.

[0081] In certain embodiments, genome editing methods and / or techniques can be used to suppress the expression of fusion genes, for example, by using nuclease-deficient Cas9.For example, but not limited to, mutations in the catalytic domain of Cas9, such as H840A in the HNH domain and D10A in the RuvC domain, inactivate the cleavage activity of Cas9 but do not prevent DNA binding.In certain embodiments, Cas9 D10AH840A (referred to herein as dCas9) can be used to target the region of a fusion gene where two genes are joined together without cleavage, and by fusing it to various effector domains, dCas9 can be used to silence the fusion gene.

[0082] This genome editing technology can be used to specifically target cells, because normal non-cancerous cells do not contain fusion genes, and therefore do not contain the chromosomal breakpoints associated with fusion genes.In certain embodiments, genome editing technology can be used to target the junction (i.e., breakpoint) of fusion genes, including but not limited to TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1 and PCMTD1-SNTG1.

[0083] In certain embodiments, one or more gRNAs that can be used in the disclosed methods can target a breakpoint comprising a nucleotide sequence set forth in SEQ ID NOs: 40-56, 106, and 113, and / or a breakpoint comprising a nucleotide sequence disclosed in Figures 4, 15, 17, and 18, e.g., SEQ ID NOs: 143-145 and 148-154. In certain embodiments, one or more gRNAs used in the disclosed methods can be about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous and / or complementary to a chromosomal breakpoint disclosed herein.

[0084] In certain embodiments, the gRNA is ligated to an endonuclease, such as Cas9. D10A gRNAs can be designed to target (e.g., be complementary to) sequences adjacent to a chromosomal breakpoint region (see, e.g., Figures 13, 15, 23, and 31) for directing the gRNA to the chromosomal breakpoint region or the region surrounding the breakpoint. Non-limiting examples of sequences of gRNAs that can be used in the disclosed methods are detailed in Figures 13B, 15A, and 23A (e.g., SEQ ID NOs: 107, 112, 146, 147, 272, and 274). In certain embodiments, one or more gRNAs used in the disclosed methods may be about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous to a gRNA disclosed herein. In certain embodiments, the disclosed gRNAs may include about 1, about 2, about 3, about 4, or about 5 nucleotide substitutions and / or mutations.

[0085] In certain embodiments, one or more gRNAs can target intron 13 of TMEM135 and intron 9 of CCDC67 adjacent to the breakpoint of the TMEM135-CCDC67 fusion gene, for example, one gRNA can target intron 13 of TMEM135 and a second gRNA can target intron 9 of CCDC67. In certain embodiments, one or more gRNAs used to target the TMEM135-CCDC67 fusion gene may have a nucleotide sequence that includes one or more nucleotide sequences set forth in Figure 13B or 13C. In certain embodiments, one or more gRNAs for targeting TMEM135-CCDC67 may be about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% homologous to the gRNAs disclosed in Figure 13.

[0086] In certain embodiments, one or more gRNAs can target intron 13 and / or exon 14 of MAN2A1 (or the splice acceptor site of intron 13 and exon 14) and intron 14 of FER adjacent to the breakpoint of the MAN2A1-FER fusion gene. In certain embodiments, one or more gRNAs used to target the MAN2A1-FER fusion gene may have a nucleotide sequence that includes one or more nucleotide sequences set forth in FIG. 15A. In certain embodiments, one or more gRNAs for targeting MAN2A1-FER may be about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% homologous to the gRNAs disclosed in FIG. 15.

[0087] In certain embodiments, one or more gRNAs can target intron 11 of PTEN and intron 1 of NOLC1 adjacent to the breakpoint of the PTEN-NOLC1 fusion gene. In certain embodiments, one or more gRNAs used to target the PTEN-NOLC1 fusion gene may have a nucleotide sequence that includes one or more nucleotide sequences set forth in FIG. 17A or FIG. 23A. In certain embodiments, one or more gRNAs can target intron 11 of PTEN and intron 1 of NOLC1 adjacent to the breakpoint of the PTEN-NOLC1 fusion gene. In certain embodiments, one or more gRNAs for targeting PTEN-NOLC1 may be about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% homologous to the gRNAs disclosed in FIG. 17 and FIG. 23.

[0088] In a particular embodiment, the fusion gene is CCNH-C5orf3.

[0089] In a specific embodiment, the fusion gene is TMEM135-CCDC67.

[0090] In a specific embodiment, the fusion gene is MAN2A1-FER.

[0091] In certain embodiments, the fusion gene may be PTEN-NOLC1.

[0092] In certain embodiments, the fusion gene is not CCNH-C5orf30 or TMEM135-CCDC67.

[0093] In certain embodiments, the disclosed genome editing technology can be used to facilitate homologous recombination with the sequence of the fusion gene at the chromosomal breakpoint (junction) of the fusion gene in one or more cells of a subject, allowing the insertion of a nucleic acid sequence that, when expressed, causes the death, e.g., apoptosis, of one or more cells.For example, but not limited to, the nucleic acid sequence (also referred to herein as donor nucleic acid) can code for Herpes Simplex Virus 1 (HSV-1) thymidine kinase, exotoxin A from Pseudomonas aeruginosa, diphtheria toxin from Corynebacterium diphtheri, ricin or abrin from Ricinus communis (castor oil plant), cytosine deaminase, carboxylesterase, or varicella zoster virus (VZV) thymidine kinase from bacteria or yeast. Further non-limiting examples of nucleic acids and / or genes that can be inserted into the genome of a cell carrying a fusion gene to induce cell death are disclosed in Rajab et al. (2013) (J. of Genetics Syndromes and Gene Therapy, 4(9):187) and Zarogoulidis et al. (2013) (J. of Genetics Syndromes and Gene Therapy, 4(9):pii: 16849). In certain non-limiting embodiments, the nucleic acid sequence, e.g., the HSV-1 thymidine kinase nucleic acid sequence, is not operably linked to a regulatory sequence promoter (e.g., a promoter) and requires integration into the genome for expression. For example, but not limited to, a promoter of the head gene of the fusion gene can drive expression of the donor nucleic acid sequence.

[0094] In certain embodiments in which the nucleic acid encoding HSV-1 thymidine kinase is inserted into the genome of one or more cells of a subject, a therapeutically effective amount of the guanine derivative, ganciclovir, or its oral homologue, valganciclovir, can be administered to the subject. HSV-1 thymidine kinase can phosphorylate and convert ganciclovir and / or valganciclovir to the triphosphate form of ganciclovir and / or valganciclovir in one or more cells of the subject. The triphosphate form of ganciclovir and / or valganciclovir acts as a competitive inhibitor of deoxyguanosine triphosphate (dGTP) and is a weak substrate for DNA elongation, which can result in the inhibition of DNA synthesis. The inhibition of DNA synthesis can, in turn, result in the reduction and / or inhibition of the proliferation and / or survival and / or cell death of cancer cells containing the targeted chromosomal breakpoint and the integrated HSV-1 thymidine kinase nucleic acid sequence. This genome editing method can be used to produce anti-cancer effects in subjects determined to have a fusion gene.

[0095] In certain embodiments, the genome editing techniques of the present disclosure involve the use of a Cas protein or a variant thereof, such as Cas9. D10A The method may include introducing an expression vector comprising a nucleic acid sequence encoding the fusion gene into one or more cells, such as cancer cells, of the subject carrying the fusion gene. In certain embodiments, the cell is not a prostate cancer cell. In certain embodiments, the vector may further comprise one or more gRNAs for targeting Cas9 protein to a specific nucleic acid sequence in the genome. In certain embodiments, the expression vector may be a viral vector.

[0096] In certain embodiments, one or more gRNAs can hybridize with a target sequence in the fusion gene. For example, but not limited to, one or more gRNAs can target the chromosomal breakpoint of the fusion gene and / or target one or more sequences adjacent to the chromosomal breakpoint region. Non-limiting examples of sequences of fusion gene chromosomal breakpoints are disclosed in the present specification and figures (see, for example, Table 1). In certain embodiments, one gRNA can be complementary to a region in one gene of the fusion gene, and another gRNA can be complementary to a region in the other gene of the fusion gene. For example, but not limited to, one gRNA can be complementary to a region in the TMEM135 gene of the TMEM135-CCDC67 fusion gene, and another gRNA can be complementary to a region in the CCDC67 gene. In certain embodiments, one gRNA may be complementary to a region in the MAN2A1 gene of the MAN2A1-FER fusion gene, and another gRNA may be complementary to a region in the FER gene. In certain embodiments, one gRNA may be complementary to a region in the PTEN gene of the PTEN-NOLC1 fusion gene, and another gRNA may be complementary to a region in the NOLC1 gene. In certain embodiments, one gRNA may be complementary to a region upstream of the chromosomal breakpoint of the fusion gene, and another gRNA may be complementary to a region downstream of the chromosomal breakpoint. In certain embodiments, genomic sequencing may be performed to determine the region of the fusion gene that may be targeted by the gRNA. In certain embodiments, the region of the gene targeted by the gRNA may be an intron and / or an exon.

[0097] In certain embodiments, a nucleic acid sequence encoding a Cas protein, e.g., Cas9, can be operably linked to a regulatory element, and when transcribed, one or more gRNAs can direct the Cas protein to a target sequence in the genome and induce cleavage of the genomic locus by the Cas protein. In certain embodiments, the Cas9 protein cleaves about 3-4 nucleotides upstream of a PAM sequence that is adjacent to the target sequence. In certain embodiments, the regulatory element operably linked to the nucleic acid sequence encoding the Cas protein can be a promoter, e.g., an inducible promoter, e.g., a doxycycline-inducible promoter. When applied to DNA sequences, e.g., in an expression vector, the term "operably linked" indicates that the sequences are positioned to function cooperatively to achieve their intended purpose, i.e., the promoter sequence allows initiation of transcription proceeding from the linked coding sequence to a termination signal.

[0098] In certain embodiments, the Cas9 enzyme encoded by the vector of the present invention may contain one or more mutations. The mutations may be artificially introduced mutations or gain-of-function or loss-of-function mutations. Non-limiting examples of such mutations include mutations in the catalytic domains of the Cas9 protein, such as the RuvC and HNH catalytic domains, such as the D10 mutation in the RuvC catalytic domain and the H840 in the HNH catalytic domain. In certain embodiments, a mutation in one of the catalytic domains of the Cas9 protein results in the Cas9 protein functioning as a "nickase," where the mutated Cas9 protein cuts only one strand of the target DNA, creating a single-strand break or "nick." In certain embodiments, the mutated Cas9 protein, such as the Cas9 D10AThe use of allows the use of two gRNAs to promote cleavage of both strands of target DNA. Additional non-limiting examples of Cas9 mutations include VP64, KRAB and SID4X, FLAG, EGFP and RFP. In certain embodiments, the genome editing technique of the present disclosure may further include introducing into one or more cells an additional vector comprising a nucleic acid that, when expressed, results in the death, e.g., apoptosis, of one or more cells. In certain embodiments, the vector may further comprise one or more targeting sequences that are complementary (e.g., capable of hybridizing) to and / or adjacent to the genomic sequence targeted by the gRNA, allowing homologous recombination to occur and insertion of the nucleic acid sequence (i.e., the donor nucleic acid sequence) into the genome. In certain embodiments, the additional vector may further comprise one or more splice tag sequences of the exon / intron junctions of the genes that make up the fusion gene. In certain embodiments, the targeting sequences may be complementary to introns, exon sequences and / or intron / exon splicing sequences within the genes of the fusion gene. In certain embodiments, one targeting sequence may be complementary to a region in one gene of the fusion gene targeted by gRNA, and a second targeting sequence may be complementary to a region in the other gene of the fusion gene, allowing the vector containing the donor nucleic acid to undergo homologous recombination with the genomic sequence cleaved by Cas9 protein. For example, but not limited to, one targeting sequence may be complementary to a region in the TMEM135 gene of the TMEM135-CCDC67 fusion gene, and another targeting sequence may be complementary to a region in the CCDC67 gene. In certain embodiments, one targeting sequence may be complementary to a region in the MAN2A1 gene of the MAN2A1-FER fusion gene, and another targeting sequence may be complementary to a region in the FER gene. In certain embodiments, one targeting sequence may be complementary to a region in the PTEN gene of the PTEN-NOLC1 fusion gene, and another targeting sequence may be complementary to a region in the NOLC1 gene.In certain embodiments, one targeting sequence may be complementary to the region upstream of the cleavage site generated by the Cas9 protein, and another targeting sequence may be complementary to the region downstream of the chromosomal breakpoint.Non-limiting examples of the type of nucleic acid sequence that can be inserted into the genome are disclosed above.In certain embodiments, the nucleic acid that is inserted into the genome encodes HSV-1 thymidine kinase.Further non-limiting examples of nucleic acids and / or genes that can be inserted into the genome of the cell carrying the fusion gene to induce cell death are described above.

[0099] The vector for use in the present disclosure may be any vector known in the art. For example, but not limited to, the vector may be derived from a plasmid, a cosmid, a viral vector, and a yeast artificial chromosome. In certain embodiments, the vector may be a recombinant molecule that contains a DNA sequence derived from several sources. In certain embodiments, the vector may include additional fragments, such as, but not limited to, a promoter, a transcription terminator, an enhancer, an internal ribosome entry site, a non-translated region, a polyadenylation signal, a selection marker, an origin of replication, and the like. In certain embodiments, the vector may be introduced into one or more cells by any technique known in the art, such as electroporation, transfection, and transduction. In certain embodiments, the vector may be introduced by adenoviral transduction.

[0100] [Table 2] JPEG0007627085000004.jpg226167JPEG0007627085000005.jpg185170

[0101] 5.5.1 Specific Non-Limiting Examples In certain embodiments, the genome editing technology of the present invention comprises introducing into one or more cells of a subject, for example, a cancer cell: (i) a vector comprising a nucleic acid sequence encoding Cas9 protein or its variant; (ii) a vector comprising one or more gRNAs that are complementary to one or more target sequences of the fusion gene, and induce Cas9-mediated DNA cleavage in the fusion gene when expressed; and (iii) a vector comprising a donor nucleic acid sequence that causes cell death when expressed, and one or more target sequences that are complementary to one or more sequences of the fusion gene to promote homologous recombination and insertion of the donor nucleic acid sequence into the fusion gene.In certain embodiments, the cancer cell is not a prostate cancer cell.

[0102] In certain embodiments, the genome editing techniques of the invention involve the introduction into one or more cells of a subject (i) a Cas9 protein, or a variant thereof (e.g., Cas9 D10A (ii) a vector comprising a nucleic acid sequence encoding one or more Cas9 proteins that are complementary to one or more target sequences of the fusion gene, where the one or more gRNAs, when transcribed, direct sequence-specific binding of one or more Cas9 proteins to one or more target sequences of the fusion gene to facilitate cleavage of the fusion gene; and (ii) a vector comprising a donor nucleic acid sequence that, when expressed, results in cell death, and one or more target sequences that are complementary to one or more sequences of the fusion gene to facilitate homologous recombination and insertion of the donor nucleic acid sequence into the fusion gene. In certain embodiments, the one or more targeting sequences may include one or more sequences adjacent to the chromosomal breakpoint and / or chromosomal breakpoint region of the fusion gene, or a combination thereof. For example, but not limited to, the targeting sequence may include at least a portion of the breakpoint sequence of the fusion gene and at least a portion of the sequence of one of the genes comprising the fusion gene.

[0103] In certain embodiments, the genome editing technique of the present invention comprises introducing into one or more cells of a subject (i) a vector comprising a nucleic acid sequence encoding a Cas9 protein or a variant thereof and one or more gRNAs that are complementary to one or more target sequences of the fusion gene, where the one or more gRNAs, when transcribed, direct the sequence-specific binding of the Cas9 protein to one or more target sequences of the fusion gene to promote the cleavage of the fusion gene; and (ii) a vector comprising a donor nucleic acid sequence encoding HSV-1 thymidine kinase and one or more target sequences that are complementary to one or more sequences of the fusion gene to promote homologous recombination and insertion of the donor nucleic acid sequence encoding HSV-1 thymidine kinase into the fusion gene. In certain embodiments, the genome editing technique further comprises administration of a therapeutically effective amount of ganciclovir and / or valganciclovir.

[0104] 5.6 Kits The present invention further provides a kit for treating the subject that carries one or more fusion genes disclosed herein and / or performing any one of the detection and treatment methods listed above.In certain embodiments, the present disclosure provides a kit for carrying out targeted genome editing technology on one or more cancer cells in a subject that carries one or more fusion genes disclosed herein.In certain embodiments, the one or more cancer cells are not prostate cancer cells.

[0105] Types of kits include, but are not limited to, packaged fusion gene-specific probe and primer sets (e.g., TaqMan probe / primer sets), arrays / microarrays, antibodies, which may further contain one or more probes, primers, or other reagents for detecting one or more fusion genes, and / or include means for performing genome editing techniques.

[0106] In certain embodiments, the kit may include means for carrying out the genome editing techniques disclosed herein. For example, but not limited to, the kits of the present disclosure may include a Cas protein or a variant thereof, such as Cas9. D10A The container may include one or more vectors or plasmids containing a nucleic acid encoding a Cas protein. In certain embodiments, the nucleic acid encoding the Cas protein may be operably linked to a regulatory element, such as a promoter. In certain embodiments, the one or more vectors may further include one or more gRNAs specific to the fusion gene, e.g., specific to the breakpoint of the fusion gene and / or to a sequence adjacent to the breakpoint of the fusion gene.

[0107] In certain embodiments, the kit of the present invention may optionally contain, in the same container as the vector containing the nucleic acid encoding the Cas protein, or in a separate container, one or more vectors or plasmids containing a nucleic acid that, when expressed, results in cell death (in the presence or absence of a compound). For example, but not limited to, the nucleic acid sequence may code for Herpes Simplex Virus 1 (HSV-1) thymidine kinase, exotoxin A from Pseudomonas aeruginosa, diphtheria toxin from Corynebacterium diphtheri, ricin or abrin from Ricinus communis (castor oil plant), cytosine deaminase from bacteria or yeast, carboxylesterase, or Varicella Zoster Virus (VZV) thymidine kinase. In certain embodiments, the vector may further contain one or more targeting sequences that are complementary to sequences within the fusion gene to facilitate homologous recombination and insertion of the donor nucleic acid.

[0108] In certain embodiments in which the donor nucleic acid encodes HSV-1 thymidine kinase, the kit may further comprise ganciclovir and / or valganciclovir.

[0109] In certain non-limiting embodiments, the kit of the present disclosure may further comprise one or more nucleic acid primers or probes and / or antibody probes for use in carrying out any of the methods listed above. The probes can be detectably labeled, for example, with biotin, colorimetric, fluorescent or radioactive markers. The nucleic acid primers can be provided as part of a pair, for example, for use in polymerase chain reaction. In certain non-limiting embodiments, the nucleic acid primers can be at least about 10 nucleotides long, or at least about 15 nucleotides long, or at least about 20 nucleotides long, and / or up to about 200 nucleotides long, or up to about 150 nucleotides long, or up to about 100 nucleotides long, or up to about 75 nucleotides long, or up to about 50 nucleotides long. The nucleic acid probes can be oligonucleotide probes and / or probes suitable for FISH analysis. In certain non-limiting embodiments, the kit comprises primers and / or probes for the analysis of at least two, at least three, at least four, at least five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, and PCMTD1-SNTG1. In certain embodiments, the kit comprises primers for the analysis of TMEM135-CCDC67, MAN2A1-FER, PTEN-NOLC1 and CCNH-C5orf30.

[0110] In certain non-limiting embodiments, the nucleic acid primers and / or probes can be immobilized on a solid surface, substrate or support, such as a nucleic acid microarray, where the position of each primer and / or probe bound to the solid surface or support is known and identifiable.The nucleic acid primers and / or probes can be immobilized on a substrate, such as glass, plastic, paper, nylon or other types of membranes, filters, chips, beads, or any other suitable solid support.The nucleic acid primers and / or probes can be directly synthesized on the substrate, or synthesized separately from the substrate and then immobilized on the substrate.The array can be prepared using known methods.

[0111] In a non-limiting embodiment, the kit provides a nucleic acid probe for FISH analysis to determine the presence of one or more fusion genes in a sample obtained from a subject. In a specific embodiment, the one or more fusion genes are selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, CCNH-C5orf30, TRMT11-GRIK2, SLC45A2-AMACR, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, MTOR-TP53BP1, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1 and combinations thereof. In a non-limiting embodiment, the kit provides a nucleic acid probe for FISH analysis of one or more fusion genes. In certain embodiments, the one or more fusion genes may include TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, PTEN-NOLC1 and CCNH-C5orf30, and TRMT11-GRIK2, SLC45A2-AMACR, KDM4B-AC011523.2, MAN2A1-FER, MTOR-TP53BP1, or combinations thereof. In certain non-limiting embodiments, probes for detecting fusion genes can be provided such that separate probes each bind to two components of the fusion gene, or the probes can bind to the "junction" that encompasses the boundary between the genes where they are spliced. For example, but not limited to, a junction is the region where two genes are joined together. In certain non-limiting embodiments, the kit comprises said probes for the analysis of at least two, at least three, at least four or all five of ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1 or PCMTD1-SNTG1.

[0112] In a non-limiting embodiment, the kit provides nucleic acid primers for PCR analysis to determine the presence of one or more fusion genes in a sample obtained from a subject. In a specific embodiment, the one or more fusion genes are selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, PTEN-NOLC1, CCNH-C5orf30, TRMT11-GRIK2, SLC45A2-AMACR, KDM4B-AC011523.2, MAN2A1-FER, MTOR-TP53BP1 and combinations thereof. In a non-limiting embodiment, the kit provides nucleic acid primers for PCR analysis of one or more fusion genes selected from the group consisting of ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1 or PCMTD1-SNTG1. In certain non-limiting embodiments, the kit comprises said primers for the analysis of at least 2, at least 3, at least 4, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1 and PCMTD1-SNTG1.

[0113] The following examples are provided to more fully illustrate the present disclosure, but should not be construed as limiting its scope. (Example) EXAMPLES

[0114] 6. Example 1: Genomic therapy targeting of fusion genes at chromosomal breakpoints results in remission of xenografted human cancers 6.1 Introduction In this example, a genomic intervention approach was developed to kill cancer cells based on the unique sequences resulting from genomic rearrangements. Chromosomal breakpoints derived from the MAN2A1-FER and TMEM135-CCDC67 fusion genes were exploited as therapeutic targets. The MAN2A1-FER and TMEM135-CCDC67 fusion genes have previously been determined to be present in prostate cancer (see WO2016 / 011428, the contents of which are incorporated herein by reference in their entirety). Furthermore, the MAN2A1-FER fusion gene has been shown to be present in glioblastoma multiforme, non-small cell lung cancer, ovarian cancer, esophageal adenocarcinoma and liver cancer at percentages ranging from 2 to 25.9%. The MAN2A1-FER fusion gene has been shown to be present in 16.8% of non-small cell lung cancer, 15.7% of liver cancer, 7.1% of GBM, 25.9% of esophageal adenocarcinoma, 5.2% of prostate cancer and 1.7% of ovarian cancer.

[0115] Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) were originally discovered as one of the immune defense mechanisms against foreign pathogens in prokaryotic cells. 2 Cas9, a key protein in the type II CRISPR / Cas system, was found to contain DNA cleavage activity. The nuclease activity of Cas9 was induced by CRISPR RNA and the 20-base complementary sequence from the transactivating CRISPR RNA to the target DNA. 3 Because transactivating CRISPR RNA and CRISPR RNA can be engineered into chimeric RNAs that contain the full functionality of both RNA species, guide RNAs (gRNAs) were engineered into artificial fusion RNAs. 4 The D10A mutation in the catalytic domain of Cas9 converts it into a nickase that generates a single nucleotide cleavage in the target DNA. 4Nicking of genomic DNA can be used to precisely introduce sequences into specific genomic loci by using the cellular homology-directed repair (HDR) pathway. By introducing two nicks close to the target DNA (double nicking), the efficiency of sequence introduction is increased by 50-1,500-fold over the natural homologous recombination rate. 5 , with an off-target rate of 1 in 10,000. Such specificity makes somatic cell genome targeting a viable approach in the treatment of human diseases, particularly neoplasms that carry fusion genes that are not present in normal cells.

[0116] Herpes simplex virus 1 thymidine kinase (HSV1-tk) phosphorylates thymidine to form thymidine monophosphate, a building block for DNA synthesis. However, the substrate specificity of HSV1-tk is limited to the synthetic nucleoside analog ganciclovir (prodrug), which is not recognized by mammalian thymidine kinases. 7 HSV1-tk differs from its mammalian counterpart in that it phosphorylates ganciclovir monophosphate, which results in the accumulation of ganciclovir monophosphate in mammalian cells expressing HSV1-tk after treatment with ganciclovir. Ganciclovir monophosphate is converted to its triphosphate form by two other kinases. 8 Ganciclovir triphosphate blocks DNA synthesis via elongation termination. In contrast, mammalian cells negative for HSV1-tk are immune from this effect due to their inability to phosphorylate ganciclovir.

[0117] In this example, the present inventors D10A By using mediated genome editing, we show that HSV1-tk was successfully inserted into the chromosomal breakpoint of the fusion gene MAN2A1-FER. Treatment of tumors carrying this chromosomal breakpoint with ganciclovir resulted in cell death in cell culture and remission of xenografted prostate and liver cancer in severe combined immunodeficiency (SCID) mice.

[0118] 6.2 Materials and Methods Materials and Vector Construction. PC3 (prostate cancer), Du145 (prostate cancer) and hepatocellular carcinoma cell lines, HUH7 and HEP3B cells were purchased from American Type Cell Culture (Manassas, VA). PC3 cells were cultured using F12K medium supplemented with 10% fetal bovine serum (InVitrogen, Carlsbad, CA). Du145 cells were cultured using modified Eagle medium supplemented with 10% fetal bovine serum (Invitrogen). HEP3B cells were cultured using modified Eagle medium supplemented with 10% fetal bovine serum (Invitrogen). HUH7 cells were cultured using Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum. The genomes of these cell lines were amplified using the following primer sets: CSF1PO: AACCTGAGTCTGCCAAGGACTAGC (SEQ ID NO:78) / TTCCACACACCACTGG CCATCTTC (SEQ ID NO:79); D13S317: ACAGAAGTCTGGGATGTGGA (SEQ ID NO: 80) / GCCCAAAAAGACAGACAGAA (SEQ ID NO: 81), D16S539: GATCCCAAGCTCTTCCTCTT (SEQ ID NO: 82) / ACGTTTGTGTGTGCATCTGT (SEQ ID NO: 83); D5S818: GGGTGATTTTCCTCTTTGGT (SEQ ID NO: 84) / TGATTCCAATCATAGCCACA (SEQ ID NO: 85); D7S820: TGTCATAGTTTAGAACGAACTAACG (SEQ ID NO:86) / CTGAGGTATCAAAAACTC AGAGG (SEQ ID NO:87); TH01: GTGGGCTGAAAAGCTCCCGATTAT (SEQ ID NO: 88) / ATTCAAAGGGTATCTGGGCTCTGG (SEQ ID NO: 89); TPOX: ACTGGCACAGAACAGGCACTTAGG (SEQ ID NO: 90) / GGAGGAACTGGGAACCACACAGGT (SEQ ID NO: 91); vWA: CCCTAGTGGATGATAAGAATAATCAGTATG (SEQ ID NO: 92) / GGACAGATGATAAATACATAGGATGGATGG (SEQ ID NO: 93) The genome was examined for short tandem repeat (STR) DNA profiles on eight different loci (CSF1PO, D13S317, D16S539, D5S818, D7S820, THO1, TPOX, and vWA) by PCR using

[0119] The STR profiles of these cell lines were fully consistent with those published by ATCC, proving that these cell lines were authentic. Rabbit polyclonal anti-Cas9 antibody was purchased from Clontech Inc., CA. Rabbit anti-HSV-1 TK polyclonal antibody was purchased from Sigma Inc., OH.

[0120] Vector construction. To construct the gRNA expression vector, the sequences flanking the breakpoint region of TMEM135-CCDC67 were analyzed and gRNAs were designed using the DNA 2.0 tool: https: / / www.dna20.com / eCommerce / cas9 / input. Both gRNA- and gRNA+ were designed using the Cas9 D10A The insert was then released by restriction with XbaI and ligated into a similarly restricted VQAd5 shuttle vector to produce the VQAd5-Cas9 D10A -gRNA TMEM135int13 -gRNA CCDC67int9 The recombinant shuttle vector was then recombined with the pAD5 virus to generate pAD5-Cas9 using a method previously described (14). D10A -gRNA TMEM135int13 -gRNA CCDC67int9 was generated.

[0121] To construct the donor DNA recombinant virus, the following primers were used: GTACTCACGTAAGCTTTCGCCACCATGGTGAGCAAGG (SEQ ID NO: 94); and GACTCAGATGGGCGCCCTTGTACAGCTCGTCCATGCC (SEQ ID NO: 95). PCR was performed on pEGFP-N1 using the following primers: The PCR product was restricted with KasI and HindIII and ligated into a similarly restricted pSELECT-zeo-HSV1tk vector to generate pEGFP-HSV1-tk.

[0122] The following primers: GACTCAGATGGCGGCCGCCTGTATTCTTTGTTTTACAGATTTGCTGTCAGGGGTTAGATAGCTTGCCAG (SEQ ID NO: 96) / GTACTCACGTAAGCTTGAGCTAACATTACCAATGAGGC (SEQ ID NO: 97) PCR was performed on genomic DNA from samples in which the TMEM135-CCDC67 fusion was found to yield intron 13 sequences of TMEM135 using the PCR product, which was then restricted with NotI and HindIII and ligated into a similarly restricted pEGFPtk vector to yield pTMEM135. int13 PCR was then performed on genomic DNA from the sample in which the TMEM135-CCDC67 fusion was found to yield the intron 9 sequence of CCDC67 using the following primers: GACTCAGATGGCTAGCAGTTCACTGAGTGTGCCATGC (SEQ ID NO: 98) / GTACTCACGTGAATTCCTATTCTGCCTGCTTGCATACCTTTTGTTTTGGTTGCA GTATAGTGGGCTGAG (SEQ ID NO: 99). The PCR was then restricted with NheI and EcoRI and amplified with similarly restricted pTMEM135 int13 -EGFP-tk vector and ligated into pTMEM135 int13 -EGFP-tk-CCDC67 int9The vector was then restricted with EcoRI and NotI and ligated into similarly restricted pAdlox to generate pAdlox-pTMEM135. int13 -EGFP-tk-CCDC67 int9 The recombinant shuttle vector was then recombined with adenovirus to produce pAd-TMEM135. int13 -EGFP-tk-CCDC67 int9 To construct the pCMV-TMEM135-CCDC67bp vector, PCR was performed on genomic DNA from a prostate cancer sample positive for the TMEM135-CCDC67 fusion using the following primers: GACTCAGATGAAGCTTAAGAGCATGGGCTTTGGAGTC (SEQ ID NO: 100) / GTACTCACGTTCTAGACTGGAATCTAGGACTCTTGGC (SEQ ID NO: 101). The PCR product was then sequenced to confirm the presence of the TMEM135-CCDC67 breakpoint. The PCR product was digested with HindIII and XbaI and ligated into a similarly digested pCMVscript vector. The construct was then transfected into PC3 and DU145 cells using lipofectamine 3000. Cells stably expressing the TMEM135-CCDC67 breakpoint transcript were selected by incubation of the transfected cells in medium containing G418 (200 μg / ml).

[0123] pAD5-Cas9 D10A -gRNAMAN2A1 int13 -gRNAFER int14 The construction of pAdlox-MAN2A1 was followed by a similar procedure to construct gRNA for targeting the TMEM135-CCDC67 fusion gene described above. int13 -EGFP-tk-FER int14For the construction of pMAN2A1, an extended long PCR was performed on 1 μg of genomic DNA from HUH7 cells using the following primers: GACTCAGATGGCGGCCGCGAACATCAGAACTGGGAGAGG (SEQ ID NO: 102) / GTACTCACGTAAGCTTCAGGAGAATCACTTGAACCCG (SEQ ID NO: 103). The PCR product was then digested with HindIII and NotI and ligated into a similarly digested pEGFP-tk vector to form pMAN2A1. int13 A synthetic sequence corresponding to the splice acceptor site of MAN2A1 intron 13 / exon 14 (TAATGTTGGTTTTACCAAAATATAAATGGTTTGCCTCTCAGTAGATAACATTTATCTTTAATAAATTCCCTTCCCTATCTTTTAAAGATCTCTTTTCGAGCACATAT (SEQ ID NO: 104) / TAATATGTGCTCGAAAAGAGATCTTTAAAAGATAGGGAAGGGAATTTATTAAAGATAAATGTTATCTACTGAGAGGCAAACCATTTATATTTTTGGTAAAACCAACAT (SEQ ID NO: 105)) was inserted into pMAN2A1 restricted with ASE1. int13 Separately, PCR was performed on HUH7 genomic DNA with primers GACTCAGATGGAATTCAAGGTGGAACACAGAAGGAGG (SEQ ID NO: 121) / GTACTCACGTGAATTCGATTACTTTAAATAACTCACTTGGCTTCTTGCAGAGGTAGAGCTGAGAGAAG (SEQ ID NO: 122) to generate a 1984 bp sequence corresponding to intron 14 of FER including a 31 bp splice donor site sequence corresponding to exon 15 / intron 15 of FER. The PCR was then restricted with EcoRI and ligated into similarly restricted pMAN2A1int13-EGFP-tk-FERint14 to generate pMAN2A1 int13 -EGFP-tk-FER int14The vector was then restricted with NotI and blunt-ended with T4 DNA polymerase. The product was then restricted with XmaI. Separately, the pAdlox vector was restricted with HindIII and blunt-ended with T4 DNA polymerase. The product was restricted with XmaI to create pMAN2A1. int13 -EGFP-tk-FER int14 The recombinant shuttle vector was then recombined with adenovirus to form pAd-MAN2A1. int13 -EGFP-tk-FER int14 was produced.

[0124] In vitro Cas9 target cleavage assay. gRNA DNA sequences and scaffold DNA sequences for + or - DNA strand were amplified from the all-in-one vector using the following primers: GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGTAGCATTAAGGGCCCCCTAAGTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO: 108) for gRNA+ template of MAN2A1-FER, and GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGATAGCTAGAAGGTGGATCACGTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO: 109) for gRNA- template of MAN2A1-FER. PCR products were in vitro transcribed using an in vitro transcription kit from Ambion, CA to obtain gRNA+ and gRNA- products. Cleavage assays were performed at 25° C. for 10 min, followed by 1 h at 37° C. under the following conditions: 1× Cas9 nuclease reaction buffer, 30 nM gRNA, 3 nM DNA template, and 30 nM Cas9 nuclease, S. pyogenes. Cleaved DNA was visualized in 1% agarose gel electrophoresis.

[0125] Fluorescence-activated cell sorting (FACS) analysis of apoptotic cells. This assay has been previously described (8, 9). Briefly, pAD5-Cas9 D10A -gRNAMAN2A1 int13 -gRNAFERint14 / pAD-MAN2A1 int13 -EGFP-tk-FER int14 Cells treated with 100 μl annexin binding buffer (Invitrogen) and various concentrations of ganciclovir were trypsinized and washed twice with cold PBS. Cells were then resuspended in 100 μl annexin binding buffer (Invitrogen) and incubated with 5 μl phycoerythrin (PE)-conjugated annexin V and 1 μl 100 μg / ml propidium iodide in the dark at room temperature for 15 min. The binding assay was terminated by the addition of 400 μl cold annexin binding buffer. FACS analysis was performed using a BD-LSR-II flow cytometer (BD Science, San Jose, CA). Fluorescently stained cells were analyzed for fluorescence emission at 533 nm (FL2). As a negative control, cells without PE or PI in the incubation medium were used to set the background for acquisition. UV-treated cells were used as a positive control for apoptosis. For each acquisition, 10,000 to 20,000 cells were analyzed and sorted based on the fluorescent color of the cells. For FACS analysis of HUH7 and HEP3B, a similar procedure was performed, except that these cells were treated with 1 μM scr-7 along with viral infection to improve genome editing efficiency ( 10 ).

[0126] Tumor growth and spontaneous metastasis. Xenograft procedures were previously described (11, 12). For HUH7 and HEP3B xenograft tumor treatment, a similar procedure was applied as previously described in Example 7 of WO2016 / 011428, except that due to the rapid growth of the cancer, treatment was started 2 weeks after tumor xenografting. The treatment groups are outlined as follows: 5 mice xenografted with HUH7 cells were treated with pAD5-Cas9 D10A -gRNAMAN2A1 int13 -gRNAFER int14 / pAD-MAN2A1 int13 -EGFP-tk-FER int14 and ganciclovir; 5 mice xenografted with HUH7 cells were treated with pAD5-Cas9 D10A -gRNATMEM135int13 -gRNACCDC67 int9 / pAD-TMEM135int13-EGFP-tk-CCDC67 int9 and ganciclovir (control); 5 mice xenografted with HUH7 cells were treated with pAD5-Cas9 D10A -gRNAMAN2A1 int13 -gRNAFER int14 / pAD-MAN2A1 int13 -EGFP-tk-FER int14 and PBS (control); 5 mice xenografted with HEP3B cells were treated with pAD5-Cas9 D10A gRNAMAN2A1 int13 -gRNAFER int14 / pAD-MAN2A1 int13 -EGFP-tk-FER int14 and ganciclovir (control). All animals were treated with scr-7 (10 mg / kg) along with the virus. All animal procedures were approved by the University of Pittsburgh Institutional Animal Care and Use Committee.

[0127] Immunohistochemistry. Immunohistochemistry was performed as previously described (6) using antibodies specific for HSV-1 TK (1:100 dilution) or Cas9 (1:100 dilution). Antibodies were omitted in negative controls. Sections were then incubated with horseradish peroxidase-conjugated anti-rabbit IgG for 30 min at room temperature (ABC kit from Vector Labs, Inc). Immunostaining was then visualized by exposing slides to 3,3'-diaminobenzidine solution. Counterstaining was performed by incubating slides in 1% hematoxylin solution for 2 min at room temperature. Slides were then briefly washed in distilled water to remove excess dye. The procedure for the TUNEL assay was similar to that previously described (13).

[0128] 6.3 Results One frequent fusion gene found in prostate cancer is located between the gene encoding transmembrane protein 135 (TMEM135) and coiled-coil domain containing 67 (CCDC67), i.e., TMEM135-CCDC67. 6、16 The fusion gene is created by a 6 Mb deletion in the chromosome 11q14.2-21 region. This deletion links intron 13 of TMEM135 and intron 9 of CCDC67 in chromosome 11 (Figure 13A), creating a unique sequence breakpoint that is not present in normal tissues, thus providing a unique target in cancer cells for therapeutic intervention.

[0129] To target this junction sequence, two sgRNAs were designed, each complementary to one of the regions adjacent to the chromosomal breakpoint on the opposite strand (Figure 13B). These guide RNAs (gRNAs) and Cas9 D10A The sequence was ligated into the VQAd5-CMV shuttle vector and recombined into the pAD5 adenovirus to produce pAD5-Cas9. D10A -gRNA TMEM135int13 -gRNA CCDC67int9To provide a potential lethal gene for target cancer cells, the cDNA of HSV-1 tk was ligated in frame with EGFP cDNA, thus obtaining the chimeric gene EGFP-tk. The chimeric cDNA did not contain a promoter, but contained a complete open reading frame and a ribosome binding site for independent translation initiation. To provide homologous sequences that engage the HDR pathway, the construct was then ligated with 584 bp of intron 13 sequence of TMEM135 at the 5' end and 561 bp of intron 9 sequence of CCDC67 at the 3' end. These sequences were then ligated into the PAdlox shuttle vector and recombined in adenovirus, thus obtaining pAD-TMEM135int13-EGFP-tk-CCDC67int9 (Figure 13C). Integration of TMEM135int13-EGFP-tk-CCDC67int9, expression of EGFP-tk and apoptosis were detected in PC3 or DU145 cells containing TMEM135-CCDC67 breakpoints and treated with recombinant virus (Figure 31). Gene targeting of TMEM135-CCDC67 in prostate cancer is disclosed in WO2016 / 011428, the contents of which are incorporated herein by reference in their entirety (see Figures 30, 31 and 32 of WO2016 / 011428 and accompanying text).

[0130] Further cancers were analyzed for fusion gene expression. Screening of the human hepatocellular carcinoma cell line HUH7 showed that it expressed one of the fusion genes, MAN2A1-FER (Figure 15A and B). Both MAN2A1-FER mRNA and protein were detected in this cell line (Figure 15A and B). A genomic breakpoint was identified between intron 13 of MAN2A1 and intron 14 of FER in HUH7 cells. The chimeric protein retains an intact tyrosine kinase domain from FER but loses the SH2 domain that regulates kinase activity. To evaluate the applicability of genomic therapy targeting cancer cells with natural fusion gene breakpoints, we designed a pair of gRNAs specific to intron 13 of MAN2A1 and intron 14 of FER (Figure 15A). This gRNA and Cas9 D10A is packaged into an adenovirus to produce pAD5-Cas9 D10A gRNAMAN2A1 int13 -gRNAFER int14 The recombinant virus was generated by inserting the sequence adjacent to the nicked site (pAD-MAN2A1 int13 -EGFP-tk-FER int14 ) was co-infected with a "donor" recombinant adenovirus containing the MAN2A1-FER fusion gene. This "donor" virus also contains splicing sequences corresponding to the acceptor in intron 14 of MAN2A1 and the donor in intron 15 of FER, respectively, so that EGFP-tk is interrupted in the MAN2A1-FER mRNA. The results showed that up to 27% of HUH7 cells infected with these viruses express EGFP-tk (Fig. 15D and E; Fig. 16A), whereas similar infection of HEP3B cells, which are negative for the MAN2A1-FER fusion, with these viruses induces minimal fluorescent protein expression. When HUH7 cells, which are negative for the TMEM135-CCDC67 fusion, are infected with an adenovirus specific for the TMEM135-CCDC67 breakpoint, there is little expression of EGFP-tk (Fig. 15D and E; Fig. 16A). These results confirm the specificity of this genome targeting technique.

[0131] [Table 3]

[0132] Transfection of HUH7 cells with pAD5-Cas9 D10A -gRNAMAN2A1 int13 -gRNAFER int14 / pADMAN2A1 int13 -EGFP-tk-FER int14 When HUH7 cells were infected with Ad-TC and treated with various concentrations of ganciclovir, up to 27% of the cells were killed by 10 μg / ml of ganciclovir, whereas HEP3B cells infected with the same virus showed minimal cell death even at high concentrations of ganciclovir (Table 3). When HUH7 cells were infected with Ad-TC and treated with ganciclovir, there was no appreciable increase in cell death, clearly demonstrating that ganciclovir-induced cell death is MAN2A1-FER breakpoint dependent compared to PC3 BP and DU145 BP clones containing the TMEM135-CCDC67 breakpoint (Table 3; Figure 16B). As shown in Figure 14, clones of transformed PC3 cells were selected to be quantified for the copy number of the TMEM135-CCDC67 breakpoint relative to that of β-actin in the genome. The PC3 BP clone was estimated to contain one copy of the TMEM135-CCDC67 breakpoint per genome and was selected based on its ratio to β-actin (approximately 1:4; PC3 cells are hyperploid for the chromosomal region containing β-actin) (Figure 14). 15 We also applied a similar selection to DU145 cells containing the TMEM135-CCDC67 breakpoint (DU145 BP). PC3 BP and DU145 BP clones treated with ganciclovir showed significant cell death as observed by Tunel staining (Figure 16B).

[0133] To test the efficacy of genomic therapy targeting MAN2A1-FER in vivo, SCID mice were xenografted with HUH7 and HEP3B cells and treated with recombinant virus and ganciclovir 2 weeks after xenografting (average of ∼400 mm 3 ). Mice xenografted with HUH7 cells and treated with Ad-MF and ganciclovir experienced a maximum 29% reduction in tumor size from peak and showed no significant metastasis or mortality during the treatment period. In contrast, mice xenografted with HUH7 cells treated with ganciclovir and Ad-TC, an adenovirus specific for the TMEM135-CCDC67 breakpoint that is not carried by HUH7 cells, experienced a 73-fold increase in tumor size. Four of five of these mice had metastases in the lungs and liver. All five mice died 40 days after xenografting. Similar mortality, metastasis, and increased tumor volume occurred in mice treated with AD-MF and PBS. Treatment of mice xenografted with HEP3B, a hepatocellular carcinoma cell line negative for the MAN2A1-FER fusion, with Ad-MF and ganciclovir was similarly ineffective. These results indicate that cancer genome-targeted therapy is highly specific and effective.

[0134] Moreover, our approach was highly specific, with average functional off-target rates of 100% in HEP3B and HUH7 cells (EGFP-tk+ cells treated with adeno-MF / Cas9 D10A -RFP+ cells (Table 4). These off-target rates were roughly confirmed by quantitative sequencing: off-target rates ranged from less than 0.1% to 2.5% among 100 million reads, including samples from in vitro tissue culture experiments, xenografted cancer and liver samples from mice treated with recombinant virus (Tables 18-21). On-target integration rates in vitro, based on sequencing, ranged from 15.9% to 25.5%, while rates for xenografted tumors ranged from 21.1% to 33.5%. The higher integration rates in xenografted tumors likely reflect repeated application of recombinant adenovirus.

[0135] [Table 4]

[0136] [Table 5]

[0137] 6.4 Discussion The effect of fusion genes on the function of the genes involved can be dramatic, due to the creation of new proteins or large truncations of protein domains. For example, without being limited to a particular theory, it is believed that the removal of the SH2 domain of FER in the MAN2A1-FER fusion gene can result in constitutive activation of the FER tyrosine kinase.

[0138] Our gRNA targeting design results in two nicks on different strands, 37 bp apart for the MAN2A1-FER breakpoint. These nicks are unlikely to generate complete breaks in the double-stranded DNA. As a result, these DNA lesions are more likely to be repaired by a homologous recombination process, rather than by non-homologous end joining. Our results are consistent with several other studies in which CRISPR / Cas-mediated homologous recombination rates can reach 20-30%. 7 .

[0139] To our knowledge, this is the first report showing that such a system can be applied to specifically target cancer genomes and has a sufficient recombination rate to achieve remission of xenografted cancers. The precise specificity and integration rate of EGFP-tk in genome therapy makes this approach applicable to clinical settings. Future developments that enhance the integration rate of targeting cassettes into genome target sites may help in enhancing the efficiency of genome therapy. Of note, the donor sequence of the adenoviral GFP-tk genome is outside the gRNA target site, and thus the virus does not contain a target sequence recognizable by gRNA-Cas9 activity. The recombination rate between the two viruses is likely low. In over 300,000 sequencing reads of integrated EGFP-tk (Tables 20-22), we did not find any reads that showed recombination between EGFP-tk and Cas9.

[0140] Current therapeutic approaches to human cancers rely heavily on blocking signaling pathways that drive cancer growth. However, such approaches inevitably induce drug resistance and resistance to drug treatment, as the cancer genome modulates its gene expression patterns and generates new pathways to support growth through new mutations that circumvent the signaling blockade. Subsequent application of second-line chemotherapy may affect both cancer and normal tissues, thus generally resulting in poor treatment outcomes. Genomic approaches may have substantial advantages over chemotherapy, as they are specific for the cancer genome sequence and kill cancer cells regardless of whether the mutation drives the cancer. Under the pressure of cancer therapy, additional new mutations and fusion genes may be generated. In principle, additional vectors could be designed to target these genomic lesions, which may even increase the integration rate due to multiple integrations per cell (Table 22). Whether such an adaptation strategy is feasible in the clinic remains to be determined. For cancers that contain multiple populations of cancer cells with several different fusion gene targets, these targets can be targeted simultaneously by genomic targeting schemes. Furthermore, our approach is not limited to the use of HSV-tk in the therapeutic cassette, but rather a wide range of genetic devices can be used, such as immunogens derived from viruses or toxins derived from plants or bacteria. The well-documented "bystander" effect of some prodrugs on tumor cell killing can enhance the therapeutic efficacy of this genome targeting strategy. 17 If necessary, genome targeting can be combined with other cancer therapeutic treatments, such as tumor immunotherapy or signal transduction molecule targeting, to achieve better therapeutic results.

[0141] [Table 6]

[0142] [Table 7]

[0143]

Table 8

[0144]

Table 9

[0145]

Table 10

[0146] 6.5 References 1. R. L. Siegel, K. D. Miller, and A. Jemal, CA: a cancer journal for clinicians 66 (1), 7 (2016). 2. F. J. Mojica, C. Diez-Villasenor, J. Garcia-Martinez et al., Journal of molecular evolution 60 (2), 174 (2005). 3. M. Jinek, K. Chylinski, I. Fonfara et al., Science (New York, N.Y 337 (6096), 816 (2012). 4. K. M. Esvelt, A. L. Smidler, F. Catteruccia et al., eLife, e03401 (2014). 5. F. A. Ran, P. D. Hsu, C. Y. Lin et al., Cell 154 (6), 1380 (2013). 6. Y. P. Yu, S. Liu, Z. Huo et al., PloS one 10 (8), e0135982 (2015). 7. C. Yu, Y. Liu, T. Ma et al., Stem cell 16 (2), 142 (2015); PD Hsu, DA Scott, JA Weinstein et al., Nature biotechnology 31 (9), 827; L. Cong, FA Ran, D. Cox et al., Science (New York, NY 339 (6121), 819. 13 KF Kozarsky and JM Wilson, Current opinion in genetics & development 3 (3), 499 (1993). 8. H. Wang, K. Luo, LZ Tan et al., The Journal of biological chemistry 287 (20), 16890 (2012); ZH Zhu, YP Yu, ZL Zheng et al., The American journal of pathology 177 (3), 1176 (2010); KL Luo, JH Luo, and YP Yu, Cancer science 101 (3), 707 (2010); YC Han, YP Yu, J. Nelson et al., Cancer research 70 (11), 4375 (2010); ZH Zhu, YP Yu, YK Shi et al., Oncogene 28 (1), 41 (2009). 9. YK Shi, YP Yu, GC Tseng et al., Cancer gene therapy 17 (10), 694 (2010); YP Yu, G. Yu, G. Tseng et al., Cancer research 67 (17), 8043 (2007); B. Ren, YP Yu, GC Tseng et al., Journal of the National Cancer Institute 99 (11), 868 (2007); G. Yu, GC Tseng, YP Yu et al., American Journal of Pathology 168 (2), 597 (2006). 10. T. Maruyama, SK Dougan, MC Truttmann et al., Nature biotechnology 33 (5), 538 (2015). 11. YC Han, ZL Zheng, ZH Zuo et al., The Journal of pathology 230 (2), 184 (2013); B. Ren, G. Yu, GC Tseng et al., Oncogene 25 (7), 1090 (2006). 12. L. Jing, L. Liu, YP Yu et al., The American journal of pathology 164 (5), 1799 (2004). 13. AJ Demetris, EC Seaberg, A. Wennerberg et al., The American journal of pathology 149 (2), 439 (1996). 14. Anderson, RD, Haskell, RE, Xia, H., Roessler, BJ, & Davidson, BL (2000) A simple method for the rapid generation of recombinant adenovirus vectors. Gene therapy 7: 1034-1038. 15. Y. Ohnuki, MM Marnell, MS Babcock et al., Cancer research 40 (3), 524 (1980); J. Bernardino, CA Bourgeois, M. Muleris et al., Cancer genetics and cytogenetics 96 (2), 123 (1997). 16. Yu, YP et al. Novel fusion transcripts associated with progressive prostate cancer. Am. J. Pathol. 184, 2840-2849 (2014); Luo, JH et al. Discovery and classification of fusion transcripts in prostate cancer and normal prostate tissue. Am. J. Pathol. 185, 1834-1845 (2015). 17. Hanahan, D. & Weinberg, RA Hallmarks of cancer: the next generation. Cell 144, 646-674 (2011). EXAMPLES

[0147] 7. Example 2: Nuclear PTEN-NOLC1 fusions are tumorigenic in human cancers 7.1 Introduction In this embodiment, a genomic intervention approach is developed to kill cancer cells based on the unique sequence resulting from genomic rearrangement.The chromosomal breakpoint derived from the Pten-NOLC1 fusion gene is utilized as a therapeutic target.The Pten-NOLC1 fusion gene has been previously determined to exist in prostate cancer (see WO2016 / 011428, the entire contents of which are incorporated herein by reference).

[0148] Phosphatase and tensin homolog (Pten) (1, 2), a phosphatase for PIP3 (3, 4), maintains homeostatic Akt / PI3K signaling and is a key regulator of cell survival and proliferation (5, 6). Polyubiquitination of Pten leads to inactivation of Pten in the cytosol, whereas monoubiquitination of Pten translocates the protein to the nucleus (7, 8). Nuclear Pten regulates the DNA repair activity of Rad51 and maintains chromosomal stability (9). Pten deletion can be associated with genomic rearrangements (10). Pten deletion or mutation has been reported in various human malignancies and is considered to be one of the most important inductive events for human cancer development (11). However, it remains unclear whether the only unexplored Akt / PI3K signaling or nuclear function of Pten is sufficient for cancer development.

[0149] Here, we characterized novel Pten-associated fusion proteins on 87 prostate samples, including 20 organ donor prostate samples from healthy individuals, 3 benign prostate tissues adjacent to cancer, and 64 prostate cancers, and identified them by high magnification (600–1500x) transcriptome sequencing analysis. Fusion-catcher screening and multifiltering identified 96 cancer-specific fusion transcripts (Table 6). Six of these fusion genes were validated by Sanger sequencing and fluorescence in situ hybridization (FISH, Figures 17–19). One of these fusion genes involves Pten and NOLC1. Pten (1), a tumor suppressor gene, is fused in frame with NOLC1 (12, 13), a nucleolar and coiled body phosphoprotein for nucleolar organogenesis (13), to produce a chimeric protein of Pten-NOLC1.

[0150] Detection or mutation of PTEN is frequent in various human cancers and is one of the causative mechanisms of human cancer development.Here, we report a fusion protein between Pten and the nucleolus organelle protein NOLC1 in human malignancies.

[0151] Pten-NOLC1 fusions are highly frequent (66–85%) in eight types of human malignancies. Gene fusion between Pten-NOLC1 induces the loss of the C2 domain of the Pten protein and the translocation of the fusion gene product to the nucleus. Targeted disruption of the Pten-NOLC1 genomic breakpoint in DU145 and MCF7 cells inhibited tumor cell proliferation, delayed entry into S phase, retarded cell migration and invasion, and predisposed to UV-induced apoptosis. Knockout of Pten-NOLC1 blocked xenografted DU145 tumor growth in SCID mice, whereas forced expression of Pten-NOLC1 by hydrodynamic injection into mice led to the development of hepatocellular carcinoma. Upregulation of C-Met / HGFR signaling was detected in Pten-NOLC1-induced tumors. These results indicate that Pten-NOLC1 fusions result in a gain of function, converting a tumor suppressor gene into an oncogene.

[0152] 7.2 Materials and Methods Tissue samples: A total of 815 tissue specimens used in the study consisted of 268 prostate cancers, 10 matched blood samples, 20 donor prostates, 102 non-small cell lung cancers, 61 ovarian cancers, 60 colon cancers, 70 liver cancers, 156 glioblastomas, 60 breast cancers, and 34 esophageal adenocarcinomas, and were obtained from the University of Pittsburgh Tissue Bank in compliance with regulatory guidelines (Tables 7 and 12). The procedures for microdissection and DNA extraction of PCa samples have been described previously (21-23). ​​The tissue procurement protocols and procedures were approved by the Institution Board of Review of University of Pittsburgh. All cell lines were purchased from American Type Cell Culture, Inc (ATCC). Cell culture procedures followed the manual from the manufacturer.

[0153] Cancer tissues were also obtained from other institutions: 16 non-small cell lung cancer samples were obtained from the University of Kansas; 28 non-small cell lung cancer samples were obtained from the University of Iowa; 3 prostate cancer samples were obtained from Stanford University; and 163 samples were obtained from the University of Wisconsin Madison; all protocols were approved by the Institution Review Board. The cell lines used in the study were purchased from American Type Cell Culture (ATCC) and cultured and maintained according to the manufacturer's recommendations.

[0154] Vector Construction: To construct the Pten-NOLC1 cDNA, PCR was performed on the Pten cDNA template with primers: AGGGGCATCAGCTACCCTTAAGTCCAGAGCCATTTC (SEQ ID NO: 127) / GGCATTGGCATCCTGCTGTGT CTTAAAATTTGGAGAAAAGTA (SEQ ID NO: 128) to obtain cDNA corresponding to the 5' end of Pten under the following conditions: 94°C for 2 min, followed by 35 cycles of 95°C for 30 sec, 61°C for 30 sec, and 72°C for 30 sec. Separately, PCR was performed on the NOLC1 cDNA template with primers: TACTTTTCTCCAAATTTTAAGACACAGCAGGATGCCAATGCC (SEQ ID NO: 129) / ACCGAAGATGGCCTCTCTAGACTCGCTGTCAAACTT (SEQ ID NO: 130) to obtain the 3' end of NOLC1 under the same conditions. The PCR products of the two reactions were pooled. PCR was performed under the same conditions using AGGGGCATCAGCTACCCTTAAGTCCAGAGCCATTTC (SEQ ID NO: 131) / ACCGAAGATGGCCTCTCTAGACTCGCTGTCAAACTT (SEQ ID NO: 132) to obtain full-length Pten-NOLC1 cDNA. The PCR product was then restricted with AflII and XbaI and ligated into a similarly digested pCDNA4-FLAG vector to generate the pPten-NOLC1-FLAG vector.

[0155] To construct the Pten-EGFP vector, PCR was performed on a Pten cDNA template with the primers: CTTAAAATTTGGAGATCTAGATCGGTTGGCTTTGTC (SEQ ID NO: 133) / ACCGAAGATGGCCTCTCTAGAGACTTTTGTAATTTGTGTATGCTGATC (SEQ ID NO: 134). The PCR product was restricted with NdeI and XbaI and ligated into a similarly restricted pEGFP vector to generate pPten-EGFP. To construct pNOLC1-cherry, PCR was performed on a NOLC1 cDNA template with the primers: TCAGCTACCCTTAAGCGGTAGTGACGCGTATTGC (SEQ ID NO: 135) / ACCGAAGATGGCCTCTCTAGACTCGCTGTCAAACTT (SEQ ID NO: 136). The PCR product was restricted with AflII and XbaI and ligated into a similarly restricted pCDNA4-Cherry vector.

[0156] To construct the pGST-Pten vector, PCR was performed using the primers: GTGGGATCCACATGACAGCCATCATCAAAGAG (SEQ ID NO: 137) / CATACACAAATTACAAAAGTCTGAGGATCCCCAGGAATTCCCGGGTCGACTC (SEQ ID NO: 138) under the following conditions: 94° C. for 2 min, followed by 35 cycles of 94° C. for 30 sec, 60° C. for 30 sec, and 72° C. for 30 sec. The PCR product was restricted with BamH1 and ligated into a similarly restricted pGEX5T vector to generate pGST-Pten.

[0157] To construct the pGST-Pten-NOLC1 vector, PCR was performed on Pten-NOLC1 cDNA using the primers: GTGGGATCCACATGACAGCCATCATCAAAGAG (SEQ ID NO: 139) / CGAGTCGACCCGGGAATTCCTGGGGATCCTCACTCGCTGTCAAACTTAATAG (SEQ ID NO: 140), restricted with BamH1, and ligated into a similarly restricted pGEX5T vector to generate pGST-Pten-NOLC1.

[0158] To construct pPT3-EF1α-Pten-NOLC1, PCR was performed on pcDNA4-Pten-NOLC1-Cherry as template using primers: 5'CTCCGGACTCTAGCGTCGACACTTAAGTCCAGAGCC (SEQ ID NO:224) / 5'ATGGTGATGGTGATGGCGGCCGCTTAACTAGATCCGG (SEQ ID NO:225) to obtain full-length Pten-NOLC1-cherry containing Sal1 and Not1 restriction sites. The PCR product was then restricted with Sal1 and Not1 and ligated into a similarly restricted pENTR 1A dual vector (Invitrogen) to generate pENTR-attL1-Pten-NOLC1-attL2. pENTR-attL1-Pten-NOLC1-attL2 was then recombined with the destination vector pPT3-EF1α using Gateway® LR Clonase™ II enzyme mix (Invitrogen) to generate the Pten-NOLC1-cherry expression vector.

[0159] Genomic and transcriptome sequencing library preparation and screening: Prostate samples were freshly frozen and stored at -80°C. They were obtained from the University of Pittsburgh Tissue Bank. The protocol was approved by the University of Pittsburgh Institutional Review Board. For transcriptome sequencing, total RNA was extracted from 20 organ donor prostate samples, 3 benign prostate tissues adjacent to cancer, and 64 prostate samples from individuals without urological disease using Trizol and treated with DNAse1. Ribosomal RNA was then removed from the samples using the RIBO-Zero™ Magnetic kit (Epicentre, Madison, WI). RNA was reverse transcribed into cDNA and amplified using the TruSeq™ RNA Sample Prep Kit v2 from Illumina, Inc (San Diego, CA). Library preparation processes such as adenylation, ligation, and amplification were performed according to the manual provided by the manufacturer. The quality of the transcriptome libraries was then analyzed using qPCR with Illumina sequencing primers and quantified using an Agilent 2000 Bioanalyzer. The procedure for 200 cycles of paired-end sequencing on an Illumina HiSeq2500 followed the manufacturer's manual.

[0160] Detection of the genomic breakpoint of the Pten-NOLC1 genomic rearrangement: To detect the genomic breakpoint between Pten and NOLC1, multiple primers were designed. A forward primer was designed to anneal to the exon 11 and intron 11 regions of Pten, and a reverse primer was designed to anneal to the intron 1 and exon 2 regions of NOLC1 (Table 16). Multiple nested PCRs were performed using various primer combinations using AccuPrime™ Pfx DNA polymerase (Invitrogen) with 35 thermal cycles of 95°C for 15 seconds, 65°C for 30 seconds, and 72°C for 10 minutes. The intron primer pair, 5'ATTCACCACACTCGTTTCTTTCTC (SEQ ID NO: 226) / 5'CCTGCCTGCCAATCTATATTGATC (SEQ ID NO: 227), was demonstrated to produce a PCR product. The genomic intron breakpoint sequence of Pten-NOLC1 was confirmed by direct sequencing of the purified PCR product.

[0161] Knockout of Pten-NOLC1 using CRISPR / Cas9 genome editing: The vector pSPCAS9N(BB)-2A-GFP was obtained from Addgene, inc (Addgene #PX461). The target sequence of gRNA was analyzed using CRISPR gRNA design tool DNA2.0TM software and selected as CGGTTATACCGCTTTGGGATcaaa (Pten) (SEQ ID NO: 228) / caccGAGATGGGGTTTCACCATGT (NOLC1) (SEQ ID NO: 229) adjacent to the cleavage junction between Pten and NOLC1. Synthetic oligonucleotides corresponding to gRNA(Pten) and gRNA(NOLC1) were constructed in the Bbs1 site of modified pSPCAS9N(BB)-2A-GFP and pX330s-2 vectors, respectively. Then, after both vectors were restricted with Bsa1, gRNA(NOLC1) released from pX330s-2 vector using Bsa1 cleavage was inserted into the Bsa1 site of gRNA(Pten)-pSPCAS9n (BB)-2A-GFP. T7 ligase was used in cloning. For homologous recombination of the inserted gene at the cleavage point, a donor vector was constructed: mCherry vector (Clontech inc, CA) was used as a backbone to construct Zeocin cDNA upstream of the mCherry coding region. The promoter sequence of the mCherry vector was removed; a homologous arm sequence identical to a fragment of 952 bp of the Pten intron 11 sequence upstream of the gRNA(Pten) sequence and 55 bp of the splice acceptor sequence was inserted upstream of the ribosomal RNA binding Kozak sequence for Zeocin. The second homology arm sequence of the 845 bp fragment of NOLC1 intron 1 downstream from gRNA(NOLC1) was inserted into the region downstream of SV40 polyA for the mcherry coding sequence. The donor vector was co-transfected with the gRNA-Cas9D10A vector into DU145 and MCF7 cell lines using lipofectamine 3000 (Invitrogen). The integration of the inserted gene was recognized by mCherry expression and Zeocin resistance.Loss of Pten-NOLC1 expression was confirmed by Taqman qRT-PCR using primers for Pten-NOLC1 fusion detection and immunoblotting on dKO1 and dKO2, mKO1 and mKO2 clones using antibodies against the N-terminus of Pten or the C-terminus of NOLC1.

[0162] Fusion transcript detection: To identify fusion transcription events, the Fusioncatcher (v0.97) algorithm (24) was applied to the RNA sequencing samples. Sequences were aligned to the reference genome using BOWTIE and BLAT, which are integrated into fusioncatcher. A preliminary list of candidate fusion transcripts is filtered in Fusioncatcher based on existing biological knowledge from the literature, such as: (1) if the gene is known to be a paralog of the other in Ensembl; (2) if one of the fusion transcripts is a pseudogene of the partner; (3) if one of the fusion transcripts is a micro / transposition / small nuclear RNA; (4) if the fusion transcript is known to be a false positive event (e.g., Conjoin gene database (25)); (5) if it was found in a healthy sample (Illumina Body Map 2.0 [http: / / www.ebi.ac.uk / arrayexpress / experiments / E-MTAB-513 / ]); (6) if the head and tail genes overlap each other on the same strand. Fusion genes were visualized using CIRCOS software (26).

[0163] TCGA SNP 6.0 data analysis: CNV fragmentation data was downloaded from TCGA level 3 data (http: / / cancergenome.nih.gov / ). CNVs with less than 10 markers were filtered out. Only fragments overlapping between exon 11 of Pten and exon 2 of NOLC1 region (89728532-89728532 / hg19) were selected. CNVs with a mean fragment value smaller than -0.23 are defined as deletions. For each sample, spanning deletions between Pten and NOLC1 are defined as the length of the deletion fragment over the entire length of the region between Pten and NOLC1 equal to or greater than 0.8 (shown in Figure 23). Seventeen cancer types were analyzed for spanning deletions between Pten and NOLC1: bladder cancer (BLCA), breast cancer (BRCA), colon cancer (COAD), diffuse large B-cell lymphoma (DLBC), esophageal cancer (ESCA), glioblastoma multiforme (GBM), head and neck squamous cell carcinoma (HNSC), liver cancer (LIHC), lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), ovarian cancer (OV), pancreatic adenocarcinoma (PAAD), prostate cancer (PRAD), rectal adenocarcinoma (READ), sarcoma (SARC), thyroid cancer (THCA) and endometrial cancer (UCEC).

[0164] Fluorescence in situ hybridization: A similar procedure was described previously (12-14). Briefly, tissue slides (4 μm) were placed in 0.2 N HCl for 20 min, followed by pretreatment solution (32-801200, Vysis) at 80°C for 30 min. The tissues were then digested in protease solution at 37°C for 36 min and air-dried. FISH probes were prepared by mixing 50% formamide containing 7 ml of bacterial artificial chromosome (BAC) sequence containing the 5' end of Pten labeled with SpectrumOrange (RP11-124B18, InVitrogen, Inc, Grand Island, NY) / 1 ml of BAC sequence containing the 3' end of NOLC1 labeled with SpectrumGreen (CTD-3082D22). The probes were denatured at 75°C for 5 min. Sections of formalin-fixed tissues were denatured in 70% formamide for 3 min and dehydrated in 70%, 85%, and 100% ethanol for 2 min each at room temperature. The denatured probes were placed on slides, coverslipped, sealed with rubber cement, placed in a humidified chamber, and hybridized overnight at 37°C. The coverslips were removed and slides were washed in 2XSSC / 0.3% Igepal (Sigma) for 2 min at 72°C. Slides were air-dried in the dark. Slides were counterstained with DAPI. Analysis was performed using an Olympus BX61 with CytoVision equipped with a Chroma Technology 83000 filter set with single-band exciton for SpectrumOrange, SpectrumGreen, and DAPI (uv 360nm). Only individuals and well-delineated cells with two hybridization signals were scored. Duplicate cells were excluded from the analysis. 50-100 cells per sample were scored to obtain an average of the signals. The cutoff for gain of MCM8 was an average of at least 2.5 copies per genome. Samples containing more than 10% of cells showing integrated Pten and NOLC1 signals were considered positive for the Pten-NOLC1 fusion.

[0165] RNA extraction, cDNA synthesis and Taqman RT-PCR: Microdissection was performed on slides of FFPE samples to obtain at least 50% cancer cells. Total RNA was extracted from epithelial cells using the Trizol method (InVitrogen, CA). The extraction procedure was performed according to the manufacturer's recommendations. Random hexamers were used in first strand cDNA synthesis using 1 μg of total RNA and Superscript II™ (InVitrogen, Inc, CA). This was followed by Taqman PCR (2 min at 94°C, followed by 50 cycles of 30 sec at 94°C, 30 sec at 61°C, 30 sec at 72°C) in an Eppendorf Realplex™ cycler using primers: GAGCGTGCAGATAATGACAAGG (SEQ ID NO: 141) / GCCAGAAGCTATAGATGTCTAAGAG (SEQ ID NO: 142) and Taqman probe: 5'- / 56-FAM / CAG GAT GCC / ZEN / AAT GCC TCT TCC C / 3IABkFQ / -3'. Ct threshold for Pten-NOLC1 detection: 38 5 cycles for formalin-fixed paraffin-embedded tissues and 35 cycles for frozen tissues. A no template negative control and a Pten-NOLC1 cDNA template were used as negative and positive controls in each batch, respectively.

[0166] Immunoblot analysis and immunoprecipitation: Pten-NOLC1 expression was examined in H522, H358, PC3 DU145 and A-172 cells. First, cells were washed with PBS and lysed with RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 μg / mL aprotinin, 1 μg / mL leupeptin, 1 μg / mL pepstatin, and 1 mM Na3VO4). Lysates were sonicated and centrifuged at 12,000 g for 30 min at 4°C to remove insoluble material. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in 8.5% polyacrylamide gels, and bands were blotted onto polyvinylidene difluoride (PVDF) membranes. Membranes were blocked with 5% powdered skim milk in Tris-Tween 20 buffer (0.1 M Tris-HCl and 0.1% Tween-20, pH 7.4) for 1 h at room temperature, and then incubated with primary anti-Pten (1:1000 dilution, Santa Cruz), anti-NOLC1 (1:1000 dilution; Santa Cruz, CA), anti-FLAG (Santa Cruz), anti-β-actin (1:500 dilution; Santa Cruz), or c-MET, GAB1, C-RAF, Akt, MAPK, p-MAPK, Stat3, and pStat3 antibodies (Cell Signaling) for 2 h. Membranes were then washed three times with Tris-Tween 20 buffer and incubated with horseradish peroxidase-conjugated secondary antibodies specific for rabbit (anti-β-actin, 1:1000 dilution), mouse (anti-Pten, 1:1000 dilution), or goat (anti-NOLC1, 1:1000 dilution) for 1 h at room temperature. Protein expression was detected using the ECL system (Amersham Life Science) according to the manufacturer's protocol.Similar immunoblotting was also performed on protein extracts from prostate cancer samples PCa638T, PCa207T, PCa624T, PCa099T, and PCa090T, as well as prostates DO12 and DO17 from organ donors derived from individuals without urological disease. For immunoprecipitation, cell lysates were incubated with A / G magnetic beads (Millipore) for 20 min to remove nonspecific binding. The supernatant was incubated with 4-6 μg of primary antibody overnight at 4 °C, A / G magnetic beads were added to the immune complex, and the reaction was kept rocking for 2 h at 4 °C. The magnetic beads were collected on a magnetic stand and washed three times with 1xPBS containing proteinase inhibitors. Proteins were resuspended and eluted from the beads directly using SDS-PAGE loading buffer.

[0167] Phosphatidylinositol 3,4,5-triphosphate (PI(3,4,5)P3) phosphatase assay of Pten and Pten-NOLC1: To quantify the phosphatase activity of purified GST-Pten, Pten-NOLC1-FLAG or GST-Pten-NOLC1 against PI(3,4,5)P3, Pten-NOLC1-FLAG was immunopurified using FLAG antibody and GST-Pten-NOLC1 was purified using a GST column. The phosphatase of purified Pten-NOLC1 was subjected to a competitive ELISA assay: 2–10 pmol of purified protein was incubated with 8 μM PI(3,4,5)P3 for 1 h at 37°C. The reaction was then stopped by heating to 95°C for 3 min. The reaction was then transferred to a “Detection Plate” (Echelon, Inc, UT) and incubated at 37°C for 60 min. After this, the "Detection Plate" was washed three times with PBS-tween 20. 100 μl of secondary detector provided by Echelon, Inc. was added to the plate and incubated at room temperature for 30 min, followed by washing three times with PBS-tween 20. Color was then developed by adding 100 μl of TMB solution provided by Echelon for 15 min. The absorbance was read at 450 nm in a spectrophotometer and the amount of PI(3,4)P2 was quantified by fitting with a standard curve of known amounts of PI(3,4)P2. Purified Pten protein (Echelon) in the reaction was used as a positive control, and GST-only protein or Flag-only or IgG-only were used as negative controls.

[0168] Cell proliferation and cell cycle analysis: DU145 or its Pten-NOLC1 knockout counterpart were used in colony formation analysis, with 1000 cells of each clone seeded in triplicate on each well. Individual single cells were allowed to grow and form colonies for 7-10 days. Colonies were then fixed with ice-cold methanol for 10 min and stained with 0.025% crystal violet for 15 min. The number of colonies was counted and imaged. In cell cycle analysis, a FITC BrdU flow kit (BD Biosciences) was used. After removing FBS in the culture for 48 h, DU145, or DU145 KO1 or KO2 were synchronized by feeding back 10% FBS and BrdU for 4 h. Cells were then harvested for analysis using FITC-BrdU antibody and propidium iodide nuclear staining (BD bioscience). Cells in different cell cycle stages were analyzed by flow cytometry (BD Facscalibur). Similar analyses were also performed for MCF7 cells and mKO1 or mKO2, PC3-PNOL(T+) and PC3-PNOL(T-), and NIH3T3-PNOL(T+) and NIH3T3-PNOL(T-).

[0169] UV-induced cell death: 60-70% confluent cultures of Du145, dKO1, dKO2, MCF7 or mKO1 were irradiated with UV ranging from 50mj to 200mj. After 17 hours, the cells were harvested for apoptosis analysis. Apoptotic cells were quantified by flow cytometry (BD Facscalibur) using an Alexa Fluor 488-Annexin V Apoptosis Assay Kit (BD Biosciences). The same apoptosis analysis was also applied to PC3-PNOL(T+), PC3-PNOL (T-), NIH3T3-PNOL(T+) and NIH3T3-PNOL (T-) clones.

[0170] Pten-NOLC1 knockout cell death analysis: A cancer cell line carrying the Pten-NOLC1 breakpoint was used. The cells were transfected with Cas9 along with gRNAs for Pten and mCherry-knockout cassettes.D10A Recombinant adenovirus containing the Cas9 along with gRNA for the Pten donor cassette D10A or Cas9 as a control. D10A Cells were treated with viruses containing only . These viruses were applied to the cell cultures when they reached 70-80% confluence for 18-24 hours. The culture medium was then replaced. The cells were incubated for 3 days to allow Pten-NOLC1 disruption to occur. The cells were then harvested for cell death analysis. A PE-Annexin V Apoptosis Assay Kit (BD Biosciences) was used: cells were resuspended in 100 μl of Annexin Binding Buffer (Invitrogen) and incubated with 5 μl of PE-conjugated Annexin V and 5 μl of propidium iodide for 20 min at room temperature in the dark. The binding assay was terminated by adding 400 μl of Annexin Binding Buffer. FACS analysis was performed using a BD Facscalibur (BD Sciences, San Jose, CA). 10,000 cells were acquired and sorted. Data were analyzed using WinMDI2.9 software (freeware from Joseph Trotter).

[0171] Cell migration and invasion assay: Estimated 5x10 4 Cells were placed in each matrix gel chamber (24 wells) and in control wells without Matrigel membrane. After 22 hours, cells on top of the membrane were wiped off and cells were allowed to migrate through the chamber membrane or control divisions were stained with H&E and counted. The number of cells invading through the membrane was normalized with the cells that migrated through the divisions in the control. Triplicates of each clone were included and comparisons were made between the following clones: DU145 and DU145KO1 or DU145KO2; MCF7 or MCF7KO1 or KO2; PC3-PNOL(T+) and PC3-PNOL (T-); NIH3T3-PNOL(T+) and NIH3T3- PNOL (T-).

[0172] Sleeping Beauty / Transposon-Mediated Hydrodynamic Transfection of Pten-NOLC1: pPt3-EF1α-Pten-NOLC1-Cherry was transfected into PC3 cells, and expression of Pten-NOLC1-Cherry protein was confirmed by expression of mCherry fluorescent tag. Then, pT3-EF1α-Pten-NOLC1-Cherry (20 μg) and SB (1 μg) were pooled in 2 ml saline. Hydrodynamic injection of pooled plasmids was performed for transfection of Pten-NOLC1-mCherry in liver (Chen et al., 2017a; Liu et al., 1999). Four to six week old loxP-Pten mice were used for intraperitoneal injection of 1010 AAV8-Cre (Penn Vector Core, University of Pennsylvania) before transfection.

[0173] Chromatin immunoprecipitation (ChIP): Pten-NOLC1 knockout clones, dKO1, dKO2, mKO1, mKO2 and their parental cells, Du145 and MCF7, were used for ChIP analysis. The MagnaChiIP A / G kit (Millipore, USA) was used, following the manufacturer's protocol. Briefly, 2-3x10 6 cells were cultured at 80% confluency. 5Cells were incubated in cold 4% formaldehyde for 10 min at room temperature to crosslink proteins and DNA, followed by quenching with glycine for 5 min at room temperature, washing three times with ice-cold 1xPBS, and spinning down the cell pellet. Cells were then lysed in lysis buffer containing protease inhibitors for 15 min on ice and centrifuged at 800g for 5 min at 4°C. The pellet was further lysed in nuclear lysis buffer. Nuclear lysates (protein / DNA) were then sheared by sonication into DNA fragments of 100-800bp in size. A Focused ultrasonicator M220 (COVARIS) was used with settings of power 7.5, 200 bursts / cycle and coefficient 10%. The fragmented and crosslinked chromatin was immunoprecipitated with antibodies against the C-terminus of NOLC1 or the N-terminus of Pten. Immune complexes containing DNA fragments were collected using A / G magnetic beads. DNA was then eluted and purified for library preparation (Illumina, CA). Similar assays were also performed on lysates derived from PC3-PNOL-Flag, RWPE1-PNOL-Flag and its controls PC3-Flag and RWPE1-Flag; and PC3 by using an antibody specific for the FLAG tag.

[0174] ChIP sequencing: The procedure recommended by the manufacturer was followed (Illumina): DNA fragment quantity and size were analyzed in a Bio-analyzer (Agilent); DNA was first blunt-ended using end-repair reagents, then 3'-end adenylated and ligated with index adapters; modified DNA was purified using Ampure XP magnetic beads and resolved in 2% agarose containing SYBR Gold gel. DNA sizes between 250-300 bp were excised, purified using MinElute Gel Extraction Kit, and enriched using 17 thermal cycles of PCR with TruSeq™ reagents (Illumina). Each library was quantified again in an Agilent Bioanalyzer and normalized to 2 nM for each sample for loading. The sequencing process was performed in an Illumina Highseq 2500 following the manufacturer's standard protocol. Two lanes of 70G sequencing capacity were used to sequence 15 Chip samples. Identification of ChIP-enriched read peaks. Chip-Seq data were aligned against the human genome reference by Burrows-Wheeler Aligner (BWA) (Li and Durbin, 2009). Peaks were called from each individual sample by Model-based Analysis of ChIP-Seq (MACS) tool (Zhang et al., 2008). Significant peaks are defined as DNA regions with enriched reads compared to partial background alignments. Significance was defined by adjusting p-values ​​by the Benjamini-Hochberg procedure for multiple hypothesis testing and setting FDR to 0.05 (Benjamini and Hochberg, 1995). Significant peaks were further compared between pairwise samples to detect peak differences (Supplementary Table 1). Reads aligned to a given peak region were extracted by SAM tool for further analysis (Li et al., 2009).

[0175] All programming for plotting and statistical analysis is implemented in the R package. Both global Manhattan plots and partial plots of reads around the upstream transcription start sites (TSS) of specific genes (Supplementary Figure 4) were generated. The R package “qqman” (biorXiv DOI: 10.1101 / 005165) was used to generate the global Manhattan plot. The subtraction results were obtained by subtracting overlapping peaks in the knockout samples from the wild-type samples (extending the peaks in a range of + / - 2 kb while matching). The peaks derived from the subtraction results (specifically, “DU145-(DKOR1+DKOR2)” + “MCF7-(MKO1+MKO2)”) were annotated to genes and analyzed by Ingenuity Pathway Analysis (IPA®, QIAGEN Redwood City, www.qiagen.com / ingenuity), and the top enriched pathways were reported. Having arrived at and annotated the differentially enriched reads in wild-type Du145, we further analyzed the reads in the promoter regions of several identified genes, MET, EGFR, AXL, VGEFA, RAF1 and GAB1. All reads of each gene, such as MET, identified in eight wild-type samples and seven knockout or other negative controls, were plotted along the promoter candidate region, -4kb to +500bp of the tss site. Reads from different wild-type samples were often mapped to close genomic locations. Two or more reads that were mapped to close locations within a distance of 100bp were combined as 2-3 or more reads at the same location in the plot. Read sequences in the densely distributed regions for wild-type group samples were used to design Taqman PCR primers and probes, listed in Table 17. Enriched DNA elements were verified by Taqman PCR using ChIP samples and resolved on a 3% agarose gel.

[0176] 7.3 Results Pten-NOLC1 fusion is the result of a chromosome 10 rearrangement To investigate the mechanism underlying the formation of Pten-NOLC1 fusion transcripts, we performed fluorescence in situ hybridization (FISH) analysis on prostate cancer samples in which Pten-NOLC1 fusion transcripts were detected, using two probes corresponding to the 5' end of the Pten genome (spectrum red) and the 3' end of NOLC1 (spectrum green). The results showed that the Pten and NOLC1 signals overlapped to form a single hybridization signal (yellowish) in the cancer cells. An unrelated NOLC1 signal (green) was also identified, whereas wild-type Pten signals (red) were absent in this prostate cancer case. This is in contrast to the two distinct pairs of separate signals of Pten (red) and NOLC1 (green) visualized in the prostate tissues of normal organ donors. The simultaneous presence of Pten-NOLC1 genomic recombination and hemizygous Pten deletion in the cancer genome suggests a complete functional loss of the Pten allele in this cancer.

[0177] To identify the location of the Pten-NOLC1 chromosomal breakpoints, a series of nested long extension PCRs were performed on the genomic DNA of this prostate cancer sample using primers corresponding to genomic sequences flanking the exons adjacent to the breakpoint junctions.

[0178] The PCR products were purified and subjected to Sanger sequencing. The results of sequencing these PCR products (Figure 17C) showed that the genomic breakpoint of Pten-NOLC1 was located in the sequence between intron 11 of Pten and intron 1 of NOLC1, and 8bp (TAGCTGGG) overlapped with the sequence shared by both Pten and NOLC1 introns. In subsequent Pten-NOLC1 breakpoint analysis, we found that the genomes of cancer cell lines LNCaP, DU145, VCaP, HEP3B, MCF7 and PC3 contained the same breakpoint sequence, even though they were derived from different types of malignant tumors with diverse biological characteristics. These results suggest a common recombination mechanism responsible for the formation of Pten-NOLC1 fusions in human cancer genomes.

[0179] Pten-NOLC1 is highly recurrent in human malignancies To investigate whether Pten-NOLC1 fusions are frequent in human cancers, TaqMan PCR was performed on 26 cancer cell lines from six different human cancers using the primers and probes shown in FIG. RT-PCR analysis was performed and found that Pten-NOLC1 fusion transcripts were present in many of the tumor cell lines tested, including four prostate cancer cell lines (PC3, DU145, LNCaP and VCaP), lung cancer cell lines (H358, H1299, H522 and H23), breast cancer cell lines (MDAMB231, VACC3133, MDA-MB330, MCF7), liver cancer cell lines (HUH7, HEP3B, SNU449, SNU475, SNU375, SNU182 and HEPG2), as well as glioblastoma cell lines (A-172, LN229, T98G, U138 and U118), and colon cancer cell lines (HCT8 and HCT15). Pten-NOLC1 fusions were not detected in 20 normal organ donor prostate samples and 10 blood samples from prostate cancer patients. To investigate whether Pten-NOLC1 is present in primary human cancer samples, Taqman RT-PCR analysis was performed on 1030 cancer samples derived from eight different types of human malignancies. The results showed that Pten-NOLC1 was widely present in these cancers: 70.1% (337 of 481) PCa, 83% (50 of 60) breast cancer, 75% (45 of 60) colon cancer, 83% (127 of 153) GBM, 82.9% (58 of 70) liver cancer, 75.2% (109 of 145) NSCLC, 70.5% (43 of 61) ovarian cancer, and 85% (29 of 34) esophageal adenocarcinoma (Figures 20B, 18 and 19 and Tables 7-12).

[0180] To investigate whether this widely present transcript of Pten-NOLC1 was translated into protein in cancer cells or tissues, Western blots were performed on tumor samples with an antibody specific for Pten. The Pten-NOLC1 fusion has an estimated molecular weight of approximately 120 Kd, a size significantly larger than that of Pten (48.3 Kd). In blotting of protein extracts from cell lines H522, H538, PC3, DU145 and A-172, a 110 kDa band was readily detected in cancer cell line samples by an antibody against Pten (Figure 20C, lines 8-12). Pten-NOLC1 protein was also detected in primary cancer tissue samples positive for Pten-NOLC1 mRNA, but negative in healthy donor prostate samples in which the Pten-NOLC1 fusion was absent (Figure 20C, lines 1-7). Taken together, Pten-NOLC1 is a product of somatic genomic rearrangements and is frequently detected as fusion transcripts and chimeric proteins in human cancers of different origins.

[0181] Only Pten-NOLC1 is located in the nucleus and does not contain phosphatase function Cytoplasmic PIP3 is a specific marker for Pten phosphatase, whereas NOLC1 is exclusively a nucleolar protein. Thus, it is of interest to identify the subcellular location of Pten-NOLC1 fusion protein, since the subcellular location has a significant bearing on the function of the fusion protein. The cDNA of Pten-NOLC1 was generated and constructed in a mammalian expression vector to generate pCDNA4-Pten-NOLC1-Flag, and transfected into NIH3T3 cell line to analyze the location of Pten-NOLC1 using immunostaining. As shown in FIG. 22, using an antibody specific for the FLAG tag to analyze NIH3T3 cells transfected with pCDNA4-Pten-NOLC1-FLAG, the signal of Pten-NOLC1 was localized only to the nucleus, similar to the cell nucleus stained with NOLC1 antibody, whereas the Pten antibody showed a widespread distribution of Pten in NIH3T3 cells, including both the cytoplasm and nucleus. Similar results were also observed in PC3 cells transfected with pCDNA4-Pten-NOLC1-FLAG (data not shown). Furthermore, pCDNA4 expressing a fluorescently tagged protein was created to confirm the expression of the chimeric Pten-NOLC1-EGFP, truncated Pten in PC3 cells. del343-403 -EGFP and truncated NOLC1 del1-40 The expression of NOLC1-mCherry was followed. When the vectors were transfected separately into PC3 cells, both Pten-NOLC1-EGFP and NOLC1-mCherry proteins were localized exclusively in the nucleus, whereas Pten-EGFP was mostly in the cytoplasm and was rarely in the nucleus during division (except in one cell). Furthermore, when nuclear or cytoplasmic fractions of Du145 lysates were blotted with Pten antibody, the band of Pten (48 kDa) was found exclusively in the cytoplasmic fraction, whereas Pten-NOLC protein was detected in the nuclear fraction, as shown by the detection of the same protein band with antibodies against Pten and FLAG, respectively, during Western blot analysis (Figure 22B).

[0182] The phosphatase domain of Pten is intact in the Pten-NOLC1 fusion protein, but the lipid-binding C2 domain of Pten is truncated, so it is unclear whether Pten-NOLC1 has phospholipid phosphatase activity. An ELISA assay (Echelon Pten Activity Elisa kit) was performed to test the ability of purified recombinant GST-Pten or GST-Pten-NOLC1 to convert PI(3,4,5)P3 to PI(4,5)P2. The results showed that GST-Pten produced 28 pmol of PIP2 (per ng of GST-Pten). In contrast, GST-Pten-NOLC1 failed to produce measurable PIP2 (Figure 22C). Similar results were found for Pten or Pten-NOLC1 produced by cells: Pten-NOLC1 or NOLC1- or FLAG-specific antibodies were used in immunoprecipitation to purify Pten-NOLC1 or Pten-related proteins in PC3 clones expressing Pten-NOLC1, but none of these immunopurified proteins showed any phosphatase activity. The inability of endogenous Pten in PC3 cells to show PIP3 phosphatase activity likely reflects a mutated enzyme in the cancer cell line (14). In conclusion, Pten-NOLC1, although present exclusively in the nucleus, does not have wild-type Pten lipid phosphatase function.

[0183] Pten-NOLC1 promotes tumor growth and increases tumor survival Below, we performed a test to see whether the expression of Pten-NOLC1 has an effect on tumor growth. We tested many cancer cell lines of different organ origins that contain weak to moderate expression of Pten-NOLC1 (Figure 20A). Specific knockdown of Pten-NOLC1 fusions by siRNA can be used to investigate the effect of Pten-NOLC1 on cell growth. However, such an approach may not be feasible due to the shared sequence between Pten-NOLC1 and Pten, or between Pten-NOLC1 and NOLC1.

[0184] First, CRISPR-Cas9 D10A Using this method, Pten-NOLC1 genome knockout was prepared in DU145 cells and MCF7 cells. As shown in Figure 23A, the genome breakpoint of Pten-NOLC1 was targeted by two gRNAs flanking the breakpoint. Then, gRNA-specific Cas9 D10A Nickase nicks the target site (gRNA-Cas9 D10A A promoterless but ribosome-binding site-containing Zeocin-mCherry cDNA (donor vector) was inserted at the breakpoint by homologous recombination. When both of these vectors were transfected into DU145 (prostate cancer cells), MCF7 (breast cancer cells) and other cancer cell lines, successful interruption of the Pten-NOLC1 fusion was indicated by the display of Zeocin resistance and mCherry fluorescence. Clones of Pten-NOLC1 knockout were obtained by Zeocin resistance selection. As shown in Figure 23B, clones of DU145 and MCF7 showing knockout of Pten-NOLC1 expression were obtained.

[0185] These clones were then analyzed for cell cycle characteristics. As shown in FIG. 23C, the population of cells in S phase was reduced from 23.3% to 13% (p<0.05) and 8% (p<0.05) in Pten-NOLC1 knockout clones DU145KO1 and DU145KO2, respectively, and from 23% to 15% (p<0.05) in MCF7KO1 cells, compared to their parental DU145 cells, while the G0 / G1 phase of these Pten-NOLC1 knockout cells was moderately increased. In contrast, forced expression of Pten-NOLC1 in NIH3T3 and PC3 cells increased the entry into S phase for these cells (from 7% to 26% for NIH3T3, p<0.05; and from 9% to 32% for PC3, p<0.05). Knockout of Pten-NOLC1 resulted in an 8-13-fold decrease in colony formation in Du145 cells (p<0.05) and a 2.4-fold decrease in MCF7 cells (p<0.05) (Figure S23D). This finding was reversed when Pten-NOLC1 was forcibly expressed in NIH3T3 (2.83-fold increase, p<0.05) and PC3 (2.8-fold increase, p<0.05) cells. Separately, we performed UV-induced cell death analysis of these DU145 and MCF7KO cells, as shown in the example of FACS analysis of Alexa Fluor 488 Annexin V binding assay, and found that 36% of parental DU145 cells treated with 175 mj of UV died, compared with 56% of its knockout counterpart (DU145-KO1; p<0.05), suggesting that the presence of Pten-NOLC1 increases the resistance of cancer cells to UV irradiation. Indeed, the removal of Pten-NOLC1 made the cells more sensitive, with the ED50 of DU145 cells increasing from 174 mj to 135 mj and that of MCF7 increasing from 175 to 127 mj (Figure 23E). To investigate the effect of Pten-NOLC1 on cancer invasion, a Matrigel cross-section analysis was performed. As shown in Figure 23F, ablation of Pten-NOLC1 in DU145 tumor cells reduced the invasion index by 3.8-4 fold. To test the invasiveness of these cells in vivo, 5x10 6These cells were subcutaneously implanted into the left flank region of SCID mice. DU145 tumors grew rapidly and began to show visible masses in the flank region at week 2 after implantation, and by the end of observation, the masses were nearly 35 times their original size at week 2, whereas only the implants of the two Pten-NOLC1KO clones of DU145 became visible at week 4 after xenografting (Figure 23G). Many of the mice bearing DU145 tumors had metastatic lesions and ascites, whereas only one animal from the knockout group showed such signs (Figure 23H). All animals xenografted with DU145 cells not containing Pten-NOLC1 survived 6 weeks of xenografting, whereas 42% (3 / 7) of SCID mice xenografted with DU145 cell tumors died during the same period. MCF7 cells could not migrate into Matrigel, and their xenografts did not grow in SCID mice. Taken together, these results indicate that the Pten-NOLC1 fusion significantly contributes to tumor growth and invasion.

[0186] Overexpression of c-met, GAB1 and EGFR is dependent on Pten-NOLC1 NOLC1 is a cofactor of RNA polymerase I12 and is involved as a co-transcription factor (15, 16). To test whether fusion of NOLC1 with Pten could change its transcription spectrum, we sequenced DNA fragments of DU145 and MCD7 as well as their knockout counterparts derived from chromatin immunoprecipitation with NOLC1 antibody (ChIPseq). As shown in Figure 28A, 6179 DNA fragment peaks were detected in DU145 cells. The peak events were reduced to 2868 in the two Pten-NOLC1 knockout clones. Similar results were also identified in MCF7 cells: a total of 4347 peaks in MCF7 and 1196 peaks in MKO1 and MKO2. The presence of the Pten domain in NOLC1 resulted in 2.2-3.6-fold more genomic binding regions, significantly broadening NOLC1 DNA binding activity. To verify whether these DNA binding activities were a direct result of the Pten-NOLC1 fusion, Pten-NOLC1-FLAG was forcedly expressed in PC3 and RWPE1 cells, and numerous DNA peaks were identified in FLAG antibody-ChIPseq. Many peaks overlapped with those found in DU145 and MCF7 cells. Pathway analysis of these Pten-NOLC1-associated DNA fragments showed that the "HGF signaling" and "cancer mechanism" pathways were the most affected signals (Table 15). Enrichment included DNA fragments derived from the promoter / enhancer regions of MET, EGFR, RAF1, AXL, GAB1 and VEGFA (Figure 29 and Figure 28B).

[0187] To investigate the impact of removing Pten-NOLC1 from DU145 cells, gene expression microarray assays were performed on DU145 cells and their knockout counterparts. The results showed that over 500 genes and transcripts were downregulated in both Du145KO1 and Du145KO2 clones compared to parental DU145 cells. Among these genes, c-MET was downregulated 2.8-6 fold, EGFR was downregulated 1.4-1.41 fold, GAB1 was downregulated 1.8-1.9 fold, AXL was downregulated 1.8-2.3 fold, and VEGFA was downregulated 1.5-1.6 fold (Figure 24A). Similar downregulation of these gene expression was also identified using quantitative RT-PCR assays (Figure 24B). Interestingly, these findings were also identified in MCF7 cells in which Pten-NOLC1 was knocked out (Figure 24B). Dramatic downregulation of MET, EGFR, RAF1, and GAB1 protein expression in DU145KO1, DU145KO2, and MCF7KO1 was identified (Figure 24C and Figure 28C). Both RAF1 and STAT3 showed very little phosphorylation. These results suggest that the activation of these signaling pathways is highly dependent on the presence of Pten-NOLC1. When combined with ChIPseq / microarray and immunoblot analysis, we found that the expression of many molecules in the ECM, EGF, and HGF signaling pathways was dependent on Pten-NOLC1 (Figure 28D). Indeed, disruption of Pten-NOLC1 expression in nine different cancer cell lines, including PC3, DU145, SNU479, SNU449, HEP3B, T98G, MCF7, MB231 and H1299 cells, by knock-in of the Zeocin-cherry cassette resulted in numerous cell deaths, in contrast to Pten-NOLC1-negative NIH3T3 cells, which were minimally affected (Figure 30 and Table 18). These results suggest that many cancer cells may depend on Pten-NOLC1 for survival.

[0188] [Table 11]

[0189] Pten-NOLC1 induced liver cancer in mice The conversion of Pten to Pten-NOLC1 is the loss of wild-type Pten and the creation of an oncogene in a single event. The hypothesis was that this single event could be sufficient to generate cancer in mammals. To test this hypothesis, C57Bl loxPten+ / + Pten was somatically knocked out from the liver of mice. This was followed by hydrodynamic tail vein injection of pT3-Pten-NOLC1-mCherry and pSB to transfect approximately 1-5% of hepatocytes with the Pten-NOLC1-mCherry gene (Figure 25A). Within 18 weeks, six of seven mice developed hepatocellular carcinoma and showed characteristic tumor nodules in the liver (Figure 25B). One mouse developed cancer metastases in the peritoneal cavity. Two animals had ascites. In contrast, neither somatic Pten knockout nor pT3 / pSB-injected control mice developed signs of tumors over the same period. These tumor cells have large nucleoli and contain significant fat accumulation in the cytoplasm, likely due to the Pten gene knockout. The tumor cells also showed a high frequency of Ki-67 staining, 4.6 times more frequent than that of non-cancerous cells (Figure 25D). Immunoblot analysis showed Pten-NOLC1-mCherry protein expression in all cancer samples, detected by antibodies specific for Pten or NOLC1, but such proteins were absent in pT3 / pSB-transfected and AAV8-cre-treated mouse liver tissues (Figure 25E). Dramatic upregulation of c-MET and GAB1 was detected in all tumor tissues, including metastatic cancer samples. Thus, these results indicate that a single event of Pten-NOLC1 fusion generation is sufficient to induce the development of spontaneous liver cancer and that the tumorigenic activity of Pten-NOLC1 is largely contributed by the overactivation of the c-MET signaling pathway.

[0190] 7.4 Discussion This example shows that there is a wide presence of Pten-NOLC1 fusions in human cancers, suggesting a fundamental role of Pten-NOLC1 fusions in cancer development. The positivity rate of Pten-NOLC1 in cancer metastasis is even higher, reaching 90% in some types of cancer (Figure 21). Despite the high frequency of Pten-NOLC1 fusions, to our knowledge, this is the first report describing such fusions in human cancer. In screening a transcriptome sequencing dataset of 2586 cancer samples encompassing 17 different cancer types derived from TCGA, we were unable to detect the presence of Pten-NOLC1 fusion transcripts. Intrigued by the difference, we investigated possible differences between the two datasets by comparing the alignment of normalized number reads with respect to the head or tail exons of the Pten or NOLC1 genes. The analysis showed that a significantly smaller percentage of mapped reads aligned with the first exon of either the Pten or NOLC1 genes derived from the TCGA prostate cancer dataset compared to our data (Figure 26). Because detection of Pten-NOLC1 requires a large number of exon 1-mapped reads for NOLC1, 3'-end bias and relatively low sequencing coverage may hinder detection of Pten-NOLC1 fusion transcripts.

[0191] The creation of the Pten-NOLC1 fusion is the result of a large deletion (14.2MB) of chromosome 10 sequence that spans between exon 11 of Pten and exon 1 of NOLC1. Such deletions are easily detectable by copy number analysis. Indeed, among the 12 Pten-NOLC1 fusion-positive prostate cancer samples that were also analyzed by Affymetrix SNP6.0 array, all showed a similar 14.2MB spanning deletion between exon 11 of Pten and exon 1 of NOLC1 (Figure 27). Conversely, the 10 prostate cancer samples that are negative for the Pten-NOLC1 fusion are found to be negative for such a spanning deletion. Thus, the spanning deletion between exon 11 of Pten and exon 1 of NOLC1 can serve as a surrogate indicator for the presence of the Pten-NOLC1 fusion. We then applied this analysis to SNP6.0 data from the TCGA database. A large number of cancer samples were found to contain such spanning deletions, ranging from 2% for the thyroid cancer dataset to 79% for the glioblastoma multiforme dataset (Figure 27A-C). The widespread presence of Pten-NOLC1 spanning deletions in cancer genomes suggests the presence of Pten-NOLC1 fusion genes in these cancer samples.

[0192] Pten deletions and mutations occur in many human cancers. These mutations result in loss of lipid phosphatase activity, resulting in genomic stability. Here, we identified that Pten-derived fusion molecules functionally promote cancer cell proliferation through the MET signaling system. Elevated MET is known to facilitate MET-FAS interaction on the membrane, which increases survival (17). Pten-NOLC1 can increase cancer cell survival by increasing the expression level of c-MET, such that it neutralizes the effects of FAS cell death signaling. This can explain the effect of Pten-NOLC1-induced cell death resistance to UV irradiation. Interestingly, many cancer samples containing hemizygous Pten deletions are also positive for Pten-NOLC1 (Figure 27C). As a result, these cancers do not contain functional Pten protein, since Pten-NOLC1 is negative for phospholipid phosphatase activity and translocates to the nucleus. These cancers may also have hyperactivation of PI3K / Akt signaling due to lack of deactivation of PIP3(1,4,5). Analysis showed that the single event of creating Pten-NOLC1 was sufficient to produce spontaneous liver cancer in animals within a short period of time.

[0193] Pten-NOLC1 fusions may have significant clinical implications. Clinical trials with drugs targeting the Pten signaling pathway have been initiated (18, 19). Recently, a genomic therapy strategy was developed that targets the chromosomal breakpoints of the fusion gene by the CRISPR-cas9 system (20). Using this approach, partial remissions were achieved on animals xenografted with cancers positive for the fusion gene breakpoints. Unlike other fusion genes, the breakpoints of Pten-NOLC1 derived from primary cancer samples or cancer cell lines of different organ origins appear to be identical, possibly due to the use of the same anchor sequence in the chromosomal recombination process. This can greatly facilitate designing targeting strategies for the chromosomal breakpoints of this fusion gene for all cancers containing Pten-NOLC1. Thus, the discovery of the Pten-NOLC1 fusion gene can lay an important foundation for future cancer treatment.

[0194] [Table 12] TIFF0007627085000016.tif249153TIFF0007627085000017.tif253153TIFF0007627085000018.tif252154TIFF0007627085000019.tif169154

[0195] [Table 13] TIFF0007627085000021.tif250166TIFF0007627085000022.tif252166JPEG0007627085000023.jpg193166

[0196] [Table 14] JPEG0007627085000025.jpg255163JPEG0007627085000026.jpg22840

[0197]

Table 15

[0198]

Table 16

[0199]

Table 17

[0200]

Table 18

[0201]

Table 19

[0202]

Table 20

[0203]

Table 21

[0204]

Table 22

[0205]

Table 23

[0206]

Table 24

[0207]

Table 25

[0208]

Table 26

[0209]

Table 27

[0210]

Table 28

[0211]

Table 29

[0212] 7.5 References 1. Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B, Hibshoosh H, Wigler MH, Parsons R: PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science (New York, NY 1997, 275:1943-7. 2. Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swedlund B, Teng DH, Tavtigian SV: Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nature genetics 1997, 15:356-62. 3. Myers MP, Pass I, Batty IH, Van der Kaay J, Stolarov JP, Hemmings BA, Wigler MH, Downes CP, Tonks NK: The lipid phosphatase activity of PTEN is critical for its tumor supressor function. Proceedings of the National Academy of Sciences of the United States of America 1998, 95:13513-8. 4. Maehama T, Dixon JE: The tumor suppressor, PTEN / MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. The Journal of biological chemistry 1998, 273:13375-8. 5. Sansal I, Sellers WR: The biology and clinical relevance of the PTEN tumor suppressor pathway. J Clin Oncol 2004, 22:2954-63. 6. McCubrey JA, Steelman LS, Abrams SL, Lee JT, Chang F, Bertrand FE, Navolanic PM, Terrian DM, Franklin RA, D'Assoro AB, Salisbury JL, Mazzarino MC, Stivala F, Libra M: Roles of the RAF / MEK / ERK and PI3K / PTEN / AKT pathways in malignant transformation and drug resistance. Adv Enzyme Regul 2006, 46:249-79. 7. Baker SJ: PTEN enters the nuclear age. Cell 2007, 128:25-8. 8. Trotman LC, Wang X, Alimonti A, Chen Z, Teruya-Feldstein J, Yang H, Pavletich NP, Carver BS, Cordon-Cardo C, Erdjument-Bromage H, Tempst P, Chi SG, Kim HJ, Misteli T, Jiang X, Pandolfi PP: Ubiquitination regulates PTEN nuclear import and tumor suppression. Cell 2007, 128:141-56. 9. Shen WH, Balajee AS, Wang J, Wu H, Eng C, Pandolfi PP, Yin Y: Essentialrole for nuclear PTEN in maintaining chromosomal integrity. Cell 2007, 128:157-70. 10. Han B, Mehra R, Lonigro RJ, Wang L, Suleman K, Menon A, Palanisamy N, Tomlins SA, Chinnaiyan AM, Shah RB: Fluorescence in situ hybridization study shows association of PTEN deletion with ERG rearrangement during prostate cancer progression. Mod Pathol 2009, 22:1083-93. 11. Yin Y, Shen WH: PTEN: a new guardian of the genome. Oncogene 2008, 27:5443-53. 12. Chen HK, Pai CY, Huang JY, Yeh NH: Human Nopp140, which interacts with RNA polymerase I: implications for rRNA gene transcription and nucleolar structural organization. Molecular and cellular biology 1999, 19:8536-46. 13. Pai CY, Chen HK, Sheu HL, Yeh NH: Cell-cycle-dependent alterations of a highly phosphorylated nucleolar protein p130 are associated with nucleologenesis. Journal of cell science 1995, 108 ( Pt 5):1911-20. 14. Vlietstra RJ, van Alewijk DC, Hermans KG, van Steenbrugge GJ, Trapman J: Frequent inactivation of PTEN in prostate cancer cell lines and xenografts. Cancer research 1998, 58:2720-3. 15. Lee YM, Miau LH, Chang CJ, Lee SC: Transcriptional induction of the alpha-1 acid glycoprotein (AGP) gene by synergistic interaction of two alternative activator forms of AGP / enhancer-binding protein (C / EBP beta) and NF-kappaB or Nopp140. Molecular and cellular biology 1996, 16:4257-63. 16. Hwang YC, Lu TY, Huang DY, Kuo YS, Kao CF, Yeh NH, Wu HC, Lin CT: NOLC1, an enhancer of nasopharyngeal carcinoma progression, is essential for TP53 to regulate MDM2 expression. The American journal of pathology 2009, 175:342-54. 17. Wang X, DeFrances MC, Dai Y, Pediaditakis P, Johnson C, Bell A, Michalopoulos GK, Zarnegar R: A mechanism of cell survival: sequestration of Fas by the HGF receptor Met. Mol Cell 2002, 9:411-21. 18. Cloughesy TF, Yoshimoto K, Nghiemphu P, Brown K, Dang J, Zhu S, Hsueh T, Chen Y, Wang W, Youngkin D, Liau L, Martin N, Becker D, Bergsneider M, Lai A, Green R, Oglesby T, Koleto M, Trent J, Horvath S, Mischel PS, Mellinghoff IK, Sawyers CL: Antitumor activity of rapamycin in a Phase I trial for patients with recurrent PTEN-deficient glioblastoma. PLoS medicine 2008, 5:e8. 19. Courtney KD, Corcoran RB, Engelman JA: The PI3K pathway as drug target in human cancer. J Clin Oncol 2010, 28:1075-83. 20. Zhang-Hui Chen, Yan P. Yu, Ze-Hua Zuo, Joel B. Nelson, George K. Michalopoulos, Satdatshan Monga, Silvia Liu, Tseng G, Luo J-H: Targeting genomic rearrangements in tumor cells using Cas9-mediated insertion of a suicide gene Nature biotechnology 2017, in press. 21. Y.P. Yu et al., Am J Pathol (Oct 7, 2013). 22. J.H. Luo et al., Am J Pathol 182, 2028 (Jun, 2013). 23. Y.P. Yu et al., Am J Pathol 180, 2240 (Jun, 2012). 24. H. Edgren et al., Genome Biol 12, R6. 25. T. Prakash et al., PLoS One 5, e13284 (2010). 26. C.-WF Wei Zeng, Stefan Muller Arisona, Huamin Qu, Computer Graphics Forum, 271 (2013).

[0213] Various references are cited herein, each of which is incorporated by reference in its entirety. The present disclosure includes the following embodiments. [1] A method of treating a subject, wherein the subject does not have prostate cancer, comprising determining the presence of at least one fusion gene in a sample obtained from the subject, and then performing a genome editing technique to target the fusion gene in one or more cells of the subject to achieve an antineoplastic effect. [2] A method of treating a subject having cancer, comprising determining the presence of at least one fusion gene in a sample obtained from the subject, and then performing a genome editing technique to target the fusion gene in one or more cells of the subject's cancer to achieve an anti-cancer effect, wherein the subject does not have prostate cancer. [3] The method of embodiment 1 or 2, wherein the fusion gene is selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1, and combinations thereof. [4] The method of embodiment 1, wherein the subject has a precancerous or neoplastic condition. [5] The method of embodiment 1, wherein the subject has cancer. [6] The method of embodiment 2 or 5, wherein the cancer is breast cancer, liver cancer, lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, ovarian cancer, gastric cancer, thyroid cancer, glioblastoma multiforme, colorectal cancer, diffuse large B-cell lymphoma, sarcoma, acute and chronic lymphocytic leukemia, Hodgkin lymphoma, non-Hodgkin lymphoma, or esophageal adenocarcinoma. [7] The method of embodiment 1 or 2, wherein the fusion gene is detected by FISH analysis. [8] The method of embodiment 1 or 2, wherein the fusion gene is detected by reverse transcription polymerase chain reaction. [9] The method of embodiment 1 or 2, wherein the fusion gene is MAN2A1-FER.

[10] The method of embodiment 1 or 2, wherein the fusion gene is TMEM135-CCDC67.

[11] The method of embodiment 1 or 2, wherein the fusion gene is PTEN-NOLC1.

[12] The method described in embodiment 1 or 2, wherein the genome editing technology uses the CRISPR / Cas system.

[13] The method of embodiment 12, wherein the CRISPR / Cas system cleaves a sequence within the fusion gene genomic sequence and inserts a nucleic acid into the fusion gene to induce cell death.

[14] The CRISPR / Cas system encodes Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl or Csxl2), CaslO, and Csyl 13. The method of embodiment 12, wherein the Cas endonuclease is selected from the group consisting of: Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, CsxlS, Csfl, Csf2, CsO, Csf4, Cpfl, c2cl, c2c3, Cas9HiFi, and combinations thereof.

[15] The method of embodiment 14, wherein the Cas endonuclease is Cas9.

[16] The method of embodiment 1 or 2, wherein the genome editing technique comprises transducing one or more cells or cancer cells with (i) a vector comprising a nucleic acid encoding a Cas protein and two guide RNAs (gRNAs) and (ii) a vector comprising a donor nucleic acid and one or more targeting sequences.

[17] The method of embodiment 16, wherein one gRNA is complementary to a region in one gene of the fusion gene and the other gRNA is complementary to a region in a second gene of the fusion gene.

[18] The method of embodiment 16, wherein the donor nucleic acid encodes HSV-1 thymidine kinase.

[19] The method of embodiment 16 or 18, wherein the method further comprises administering to the subject a therapeutically effective amount of ganciclovir or valganciclovir.

[20] The method of embodiment 16, wherein one gRNA may be complementary to a region in the MAN2A1 gene of the MAN2A1-FER fusion gene, and the other gRNA may be complementary to a region in the FER gene.

[21] The method of embodiment 16, wherein one gRNA may be complementary to a region in the TMEM135 gene of the TMEM135-CCDC67 fusion gene, and the other gRNA may be complementary to a region in the CCDC67 gene.

[22] A method of treating a subject, wherein the subject does not have prostate cancer, comprising determining whether one or more cells of the subject contain a fusion gene selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1, and combinations thereof, and if one or more cells contain the fusion gene, performing a genome editing technique that targets the fusion gene present in one or more cells of the subject, wherein the subject does not have prostate cancer.

[23] A method of treating a subject having a precancerous or neoplastic condition, wherein the subject does not have prostate cancer, comprising determining whether one or more cells of the subject contain a fusion gene selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1, and combinations thereof, and if one or more cells contain the fusion gene, performing a genome editing technique that targets the fusion gene present in one or more cells of the subject, wherein the subject does not have prostate cancer.

[24] The method of embodiment 21, wherein one or more cells of the subject are cancer cells.

[25] The method of embodiment 24, wherein the cancer cells are cells of breast cancer, liver cancer, lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, ovarian cancer, gastric cancer, thyroid cancer, glioblastoma multiforme, colorectal cancer, diffuse large B-cell lymphoma, sarcoma, acute and chronic lymphocytic leukemia, Hodgkin lymphoma, non-Hodgkin lymphoma, or esophageal adenocarcinoma.

[26] The method of any one of embodiments 2-3, 5-21 and 24-25, wherein the cancer is not lung adenocarcinoma, glioblastoma multiforme or hepatocellular carcinoma.

[27] A kit for performing a genome editing technique targeting a fusion gene present in a cell, wherein the cell is not a prostate cancer cell, the kit comprising: (i) a vector comprising a nucleic acid encoding a Cas protein and one or more guide RNAs (gRNAs); and (ii) a vector comprising a donor nucleic acid and one or more targeting sequences.

[28] The kit of embodiment 27, wherein one gRNA is complementary to a region in one gene of the fusion gene and the other gRNA is complementary to a region in a second gene of the fusion gene.

[29] The kit of embodiment 27, wherein the donor nucleic acid encodes HSV-1 thymidine kinase.

[30] The kit of any one of embodiments 27, 28, or 29, wherein the kit further comprises ganciclovir and / or valganciclovir.

[31] The kit of embodiment 27, wherein the fusion gene is selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1, and combinations thereof.

[32] The kit of embodiment 27, further comprising nucleic acid primers for PCR analysis of one or more fusion genes selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, PTEN-NOLC1, CCNH-C5orf30, TRMT11-GRIK2, SLC45A2-AMACR, KDM4B-AC011523.2, MAN2A1-FER, MTOR-TP53BP, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, or PCMTD1-SNTG11.

[33] The kit of embodiment 27, further comprising a nucleic acid probe for FISH analysis of one or more fusion genes selected from the group consisting of TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67, PTEN-NOLC1, CCNH-C5orf30, TRMT11-GRIK2, SLC45A2-AMACR, KDM4B-AC011523.2, MAN2A1-FER, MTOR-TP53BP1, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, and PCMTD1-SNTG1.

[34] The kit of embodiment 27, wherein the cells are derived from breast cancer, liver cancer, lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, ovarian cancer, gastric cancer, thyroid cancer, glioblastoma multiforme, colorectal cancer, diffuse large B-cell lymphoma, sarcoma, acute and chronic lymphocytic leukemia, Hodgkin lymphoma, non-Hodgkin lymphoma, or esophageal adenocarcinoma.

[35] The kit of embodiment 27, wherein the cells are neoplastic and / or precancerous cells.

[36] The kit of embodiment 27, wherein the Cas protein is Cas9 or Cas9D10A.

[37] The kit of embodiment 27, wherein the cells are not cells derived from lung adenocarcinoma, glioblastoma multiforme, or hepatocellular carcinoma.

[38] An agent enabling targeted genome editing for use in a method for treating or preventing cancer in a subject, the method comprising: (i) determining whether a sample from the subject contains a fusion gene; and (ii) if the sample contains one or more fusion genes, performing a genome editing procedure with the agent to target the fusion genes in one or more cancer cells in the subject, wherein the cancer is not prostate cancer.

[39] An agent enabling targeted genome editing for use in a method for treating a subject, the method comprising: (i) determining whether a sample from the subject contains a fusion gene; and (ii) if the sample contains one or more fusion genes, performing a genome editing procedure with the agent to target the fusion genes in one or more cells within the subject, wherein the subject does not have prostate cancer.

[40] An agent enabling targeted genome editing for use in a method for treating a subject having a precancerous or neoplastic condition, the method comprising: (i) determining whether a sample from the subject contains a fusion gene; and (ii) if the sample contains one or more fusion genes, performing a genome editing procedure with the agent to target the fusion genes in one or more cells within the subject, wherein the subject does not have prostate cancer.

[41] The agent of any one of embodiments 38, 39, or 40, wherein the agent is a Cas9 protein.

[42] The agent of embodiment 41, wherein the Cas9 protein is Cas9D10A.

[43] The agent of embodiment 38, wherein the cancer is breast cancer, liver cancer, lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, ovarian cancer, gastric cancer, thyroid cancer, glioblastoma multiforme, colorectal cancer, diffuse large B-cell lymphoma, sarcoma, acute and chronic lymphocytic leukemia, Hodgkin lymphoma, non-Hodgkin lymphoma, or esophageal adenocarcinoma.

[44] The agent of embodiment 38, wherein the cancer is not lung adenocarcinoma, glioblastoma multiforme, or hepatocellular carcinoma.

[45] A composition for use in treating a subject having one or more cells containing one or more fusion genes selected from the group consisting of TMEM135-CCDC67, TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1, and combinations thereof, comprising one or more agents for use in genome editing techniques targeting the one or more fusion genes present in the one or more cells, wherein the subject does not have prostate cancer.

[46] The composition of embodiment 45, wherein the one or more agents for use in genome editing technology include one or more gRNAs and an endonuclease.

[47] The composition of embodiment 46, wherein the endonuclease is Cas9.

[48] ​​The composition of any of embodiments 45 to 47, wherein the one or more guide RNAs comprise one gRNA complementary to a region in one gene of the fusion gene and a second gRNA complementary to a region in a second gene of the fusion gene.

[49] A composition described in any of embodiments 45 to 47, wherein the one or more guide RNAs include one gRNA that is complementary to a specific sequence within the chromosomal breakpoint of the one or more fusion genes.

[50] A method for determining a treatment for a subject having one or more cells that contain one or more fusion genes, comprising: i) providing a sample derived from a subject; ii) determining whether one or more cells of the subject contain one or more fusion genes selected from the group consisting of TMEM135-CCDC67, TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, KDM4B-AC011523.2, MAN2A1-FER, PTEN-NOLC1, CCNH-C5orf30, ZMPSTE24-ZMYM4, CLTC-ETV1, ACPP-SEC13, DOCK7-OLR1, PCMTD1-SNTG1, and combinations thereof; and iii) if one or more fusion genes are detected in one or more cells, instructing to perform a genome editing technique that targets the one or more fusion genes detected in the one or more cells. wherein the subject does not have prostate cancer.

[51] The method of embodiment 50, wherein the genome editing technique is performed using the CRISPR / Cas9 system.

Claims

1. Use of a CRISPR / Cas system in the manufacture of a medicament for treating a subject, comprising determining the presence of at least one fusion gene in a sample obtained from the subject, and then performing a CRISPR / Cas genome editing technique to target the fusion gene in one or more cells of the subject to achieve an anti-neoplastic effect, wherein the subject has breast cancer, liver cancer, lung cancer, or glioblastoma multiforme, and does not have prostate cancer, and the CRISPR / Cas system cleaves a sequence within the fusion gene genomic sequence to insert a nucleic acid into the fusion gene and induce cell death; The CRISPR / Cas system (i) comprises one or more guide RNAs (gRNAs) and a Cas9 protein; or (ii) comprises a vector comprising a nucleic acid encoding one or more guide RNAs (gRNAs) and a Cas9 protein; The fusion gene is PTEN-NOLC1; The above uses.

2. Use of a CRISPR / Cas system in the manufacture of a medicament for treating a subject having cancer, comprising determining the presence of at least one fusion gene in a sample obtained from the subject, and then performing a CRISPR / Cas genome editing technique to target the fusion gene in one or more cells of the subject's cancer to achieve an anti-cancer effect, wherein the subject has breast cancer, liver cancer, lung cancer, or glioblastoma multiforme, and does not have prostate cancer, and the CRISPR / Cas system cleaves a sequence within the fusion gene genomic sequence to insert a nucleic acid into the fusion gene and induce cell death; The CRISPR / Cas system (i) comprises one or more guide RNAs (gRNAs) and a Cas9 protein; or (ii) comprises a vector comprising a nucleic acid encoding one or more guide RNAs (gRNAs) and a Cas9 protein; The fusion gene is PTEN-NOLC1; The above uses.

3. The use according to claim 1 or 2, wherein the fusion gene is detected by FISH analysis.

4. The use according to claim 1 or 2, wherein the fusion gene is detected by reverse transcription polymerase chain reaction.

5. The use of claim 1 or 2, wherein the CRISPR / Cas genome editing technology comprises transducing one or more cells or cancer cells with (i) a vector comprising a nucleic acid encoding a Cas protein and two guide RNAs (gRNAs) and (ii) a vector comprising a donor nucleic acid and one or more targeting sequences.

6. The use according to claim 5, wherein one gRNA is complementary to a region within one gene of the fusion gene and the other gRNA is complementary to a region within a second gene of the fusion gene.

7. The use according to claim 5, wherein the donor nucleic acid encodes HSV-1 thymidine kinase.

8. 8. The use of claim 5 or 7, wherein the method further comprises administering to the subject a therapeutically effective amount of ganciclovir or valganciclovir.

9. Use of a CRISPR / Cas system in the manufacture of a medicament for treating a subject, comprising determining whether one or more cells of the subject contain a PTEN-NOLC1 fusion gene, and if one or more cells contain the fusion gene, performing a CRISPR / Cas genome editing technique to target the fusion gene present in one or more cells of the subject, wherein the subject has breast cancer, liver cancer, lung cancer, or glioblastoma multiforme, and does not have prostate cancer, and the CRISPR / Cas system cleaves a sequence within the fusion gene genomic sequence to insert a nucleic acid into the fusion gene and induce cell death; The CRISPR / Cas system (i) comprises one or more guide RNAs (gRNAs) and a Cas9 protein; or (ii) comprises a vector comprising a nucleic acid encoding one or more guide RNAs (gRNAs) and a Cas9 protein; The above uses.

10. Use of a CRISPR / Cas system in the manufacture of a medicament for treating a subject having a precancerous or neoplastic condition, comprising determining whether one or more cells of the subject contain a PTEN-NOLC1 fusion gene, and if one or more cells contain the fusion gene, performing a CRISPR / Cas genome editing technique to target the fusion gene present in one or more cells of the subject, wherein the subject does not have prostate cancer, and the CRISPR / Cas system cleaves a sequence within the fusion gene genomic sequence to insert a nucleic acid into the fusion gene and induce cell death; The CRISPR / Cas system (i) comprises one or more guide RNAs (gRNAs) and a Cas9 protein; or (ii) comprises a vector comprising a nucleic acid encoding one or more guide RNAs (gRNAs) and a Cas9 protein; The subject has a precancerous or neoplastic condition selected from the group consisting of breast cancer, liver cancer, lung cancer, and glioblastoma multiforme. The above uses.

11. The use according to any one of claims 2 to 8, wherein the cancer is not lung adenocarcinoma, glioblastoma multiforme or hepatocellular carcinoma.

12. A kit for carrying out the use according to claim 1, the kit comprising a means for determining the presence of the fusion gene in a sample obtained from a subject, and a means for carrying out a CRISPR / Cas genome editing technique targeting the fusion gene present in a cell, the cell being not a prostate cancer cell, the kit comprising (i) a vector comprising a nucleic acid encoding a Cas9 protein and one or more guide RNAs (gRNAs), and (ii) a vector comprising one or more targeting sequences and a donor nucleic acid targeting the fusion gene as a means for carrying out the genome editing technique, the fusion gene is PTEN-NOLC1, The cells are selected from the group consisting of breast cancer cells, liver cancer cells, lung cancer cells, and glioblastoma multiforme cells. The kit.

13. The kit of claim 12, wherein one gRNA is complementary to a region in one gene of the fusion gene and the other gRNA is complementary to a region in a second gene of the fusion gene.

14. The kit of claim 12 , wherein the donor nucleic acid encodes HSV-1 thymidine kinase.

15. The kit of claim 12, 13 or 14, wherein the kit further comprises ganciclovir and / or valganciclovir.

16. The kit of claim 12, further comprising nucleic acid primers for PCR analysis of the PTEN-NOLC1 fusion gene.

17. The kit of claim 12, further comprising a nucleic acid probe for FISH analysis of the PTEN-NOLC1 fusion gene.

18. Cas9 protein is Cas9 D10A The kit of claim 12,

19. The kit of claim 12, wherein the cells are not cells derived from lung adenocarcinoma, glioblastoma multiforme, or hepatocellular carcinoma.

20. 1. An agent enabling CRISPR / Cas targeted genome editing for use in a method for treating or preventing cancer in a subject, the method comprising: (i) determining whether a sample from the subject contains a fusion gene; and (ii) if the sample contains the fusion gene, performing a CRISPR / Cas genome editing procedure with the agent to target the fusion gene in one or more cancer cells in the subject, wherein the cancer is breast cancer, liver cancer, lung cancer, or glioblastoma multiforme, and is not prostate cancer, wherein the CRISPR / Cas genome editing procedure cleaves a sequence within the fusion gene genomic sequence to insert a nucleic acid into the fusion gene to induce cell death; The agent (I) comprises one or more guide RNAs (gRNAs) and a Cas9 protein, or (II) comprises a vector comprising a nucleic acid encoding one or more guide RNAs (gRNAs) and a Cas9 protein; The fusion gene is PTEN-NOLC1; The drug.

21. 1. An agent enabling CRISPR / Cas targeted genome editing for use in a method for treating a subject, the method comprising: (i) determining whether a sample from the subject contains a fusion gene; and (ii) if the sample contains the fusion gene, performing a CRISPR / Cas genome editing procedure with the agent to target the fusion gene in one or more cells in the subject, wherein the subject has breast cancer, liver cancer, lung cancer, or glioblastoma multiforme, and does not have prostate cancer, wherein the CRISPR / Cas genome editing procedure cleaves a sequence within the fusion gene genomic sequence to insert a nucleic acid within the fusion gene to induce cell death; The agent (I) comprises one or more guide RNAs (gRNAs) and a Cas9 protein, or (II) comprises a vector comprising a nucleic acid encoding one or more guide RNAs (gRNAs) and a Cas9 protein; The fusion gene is PTEN-NOLC1; The drug.

22. 1. An agent enabling CRISPR / Cas targeted genome editing for use in a method for treating a subject having a precancerous or neoplastic condition, the method comprising: (i) determining whether a sample from the subject contains a fusion gene; and (ii) if the sample contains one or more fusion genes, performing a CRISPR / Cas genome editing procedure with the agent to target the fusion genes in one or more cells in the subject, wherein the subject does not have prostate cancer, wherein the CRISPR / Cas genome editing procedure cuts a sequence within the fusion gene genomic sequence to insert a nucleic acid within the fusion gene to induce cell death; The agent (I) comprises one or more guide RNAs (gRNAs) and a Cas9 protein, or (II) comprises a vector comprising a nucleic acid encoding one or more guide RNAs (gRNAs) and a Cas9 protein; the fusion gene is PTEN-NOLC1, The subject has a precancerous or neoplastic condition selected from the group consisting of breast cancer, liver cancer, lung cancer, and glioblastoma multiforme. The drug.

23. The Cas9 protein is D10A The method of claim 20, 21 or 22,

24. The method of claim 20, wherein the cancer is not lung adenocarcinoma, glioblastoma multiforme, or hepatocellular carcinoma.

25. A composition for use in treating a subject having one or more cells containing a PTEN-NOLC1 fusion gene, the composition comprising one or more agents for use in CRISPR / Cas genome editing technology that targets the fusion gene present in one or more cells, the subject having breast cancer, liver cancer, lung cancer, or glioblastoma multiforme, and not having prostate cancer; The one or more agents include (i) one or more guide RNAs (gRNAs) and a Cas9 protein, or (ii) a vector comprising a nucleic acid encoding one or more guide RNAs (gRNAs) and a Cas9 protein; The composition.

26. 26. The composition of claim 25, wherein the one or more guide RNAs comprise one gRNA complementary to a region within one gene of the fusion gene and a second gRNA complementary to a region within a second gene of the fusion gene.

27. 26. The composition of claim 25, wherein the one or more guide RNAs comprise a gRNA complementary to a specific sequence within a chromosomal breakpoint of the one or more fusion genes.

Images