Elimination of CD19-positive lymphoid malignancies by NK cells expressing a CD19-CAR

Abstract

NK cells for use in the treatment of cancer and methods for producing the cells are provided. [Solution] Provided is an NK-92 cell that expresses a CD19 CAR and an Fc receptor, the NK-92 cell comprising a multicistronic DNA construct, wherein the multicistronic construct encodes the CD19 CAR and the Fc receptor, and the multicistronic construct further comprises a sequence encoding IL-2 or a variant thereof, or IL-15 or a variant thereof.

Description

[Technical field]

[0001] This application is a joint venture of the present inventors and is a jointly owned US Provisional Patent Application No. 2016 / 013366 filed on October 31, 2018. Priority is claimed from Application No. 62 / 753,719.

[0002] Sequence Listing A sequence named 104077.0008PCT Seq_ST25 with a size of 38kb The contents of the ASCII text file in the table were created on July 15, 2019, and are consistent with the present application and Both were submitted electronically via EFS-Web and are incorporated by reference in their entireties. can be.

[0003] The field of the invention is genetically engineered cells for cancer therapy. [Background technology]

[0004] The Background Description contains information that may be useful in understanding the present invention. None of the information provided is prior art or relevant to the presently claimed invention. Without limitation, there is no admission that any publication specifically or implicitly referenced is prior art. There is none.

[0005] All publications and patent applications herein are hereby incorporated by reference in their entirety. Each claim is incorporated by reference to the same extent as if each claim was specifically and individually indicated to be incorporated by reference. Any definitions or usage of terms in the incorporated references are incorporated herein by reference. In the event of any conflict or contradiction with a definition of a term, the definition of that term provided herein shall apply. The definition of that term in the reference does not apply.

[0006] Natural killer (NK) cells are cytotoxic lymphocytes that constitute a major component of the innate immune system. Natural killer (NK) cells generally account for approximately 10-15% of circulating lymphocytes. , non-specifically with respect to an antigen and without prior immunization with a target cell, e.g., a virus infection It binds to and kills cells and many malignant tumor cells. Herberman et al. l., Science 214:24 (1981). Target cell killing is induced by induction of cell lysis. The NK cells used in autologous NK cell transplantation are generated by peripheral blood lysates of blood from the subject. ("PBL") fraction and expanded in cell culture to obtain sufficient numbers of cells, and then These autologous NK cells are then reinfused into the subject. These autologous NK cells have shown some efficacy in in vivo therapy. However, such treatment is limited to the autologous setting and is not available in all Further complications are caused by the fact that not all NK cells are cytolytic.

[0007] NK-92® is found in the blood of subjects with non-Hodgkin's lymphoma, It is then a cytolytic cancer cell line immortalized in vitro. NK-92® Cells are derived from NK cells but lack the major inhibitory receptor displayed by normal NK cells. However, NK-92® cells retain the majority of activating receptors. They do not attack normal cells, and they do not elicit an intolerable immune rejection response in humans. The NK-92® cell line was characterized in WO 1998 / 023664. / 049268 Brochure and U.S. Patent Application Publication No. 2002-0068044 Details The NK-92® cells have been disclosed as a therapeutic agent in the treatment of certain cancers. It has been highly evaluated. Summary of the Invention [Means for solving the problem]

[0008] In some embodiments, the present disclosure provides a method for the treatment of NK cells expressing a CD19 CAR and an Fc receptor. In some embodiments, NK-92® cells are provided. The cells contain a multicistronic construct encoding a CD19 CAR and an Fc receptor. In some embodiments, the Fc receptor is CD16. The Fc receptor comprises SEQ ID NO: 2. In some embodiments, the multicistronic transfer gene The gene further comprises a sequence encoding IL-2 or a variant thereof. In some embodiments, the IL-2 variant is erIL-2. 9 The coding sequence for one or more of CAR, Fc receptor, or erIL-2 has been shown to be expressed in a human system. It has been codon-optimized for expression.

[0009] In some embodiments, the NK-92® cells are CD19 expressing cells, e.g. In some embodiments, the tumor cells are SUP-B15 cells. In some embodiments, the CD19 CAR comprises an scFv antibody fragment. In an embodiment, the scFv antibody fragment has the amino acid sequence of SEQ ID NO: 10. In an embodiment, the multicistronic construct comprises the sequence of SEQ ID NO: 9, In some embodiments, the NK-92® cell line encodes an scFv antibody fragment. The cells contain a sequence encoding a self-cleaving peptide, which sequence encodes the CD19 CAR and the CD 16, the sequence of which allows equimolar expression of CD19 CAR and FcR. In some embodiments, the NK-92® cells express a sequence encoding CD16. and an internal ribosome entry between the sequence encoding IL-2 or a variant thereof. Contains an IRES sequence.

[0010] In some embodiments, direct administration of NK-92® cells to CD19-expressing cells. The cytotoxicity is 70-100% when the effector to target ratio is 10. In some embodiments, the ADCC activity of NK-92® cells is determined by binding to effectors When the ratio to the target is 10, it is 30% to 90%. 9 The CAR comprises a sequence that shares at least 90% identity with SEQ ID NO:10.

[0011] In some embodiments, the present disclosure provides a pharmaceutical comprising the NK-92® cells of the present disclosure. Kits containing the compositions are provided.

[0012] In some embodiments, the present disclosure provides a method of generating NK-92® cells. Thus, providing a vector encoding CD19 CAR and CD16, and Introduction of a marker into NK-92® cells to generate NK-92® cells In some embodiments, the vector encodes IL-2. In some embodiments, the vector further comprises a sequence encoding a self-cleaving peptide. The sequence is located between CAR and CD16, and the sequence is In some embodiments, the vector allows for equimolar expression of CD16 and CD16. An internal ribosome entry sequence (IRES) between the coding sequence and the IL-2 coding sequence Includes.

[0013] In some embodiments, the present disclosure provides a method of treating cancer in a subject, comprising administering to the subject and administering to a subject a therapeutically effective amount of the composition, the composition comprising: Not Found ~ Error! Reference source not found for any of multiple NK-92 (registered In some embodiments, the method comprises administering to a subject a body surface area of ​​1 m 2 Hit Approx. 1×10 8 ~Approx. 1×10 11 The modified cells are administered to a subject.

[0014] In some embodiments, the cancer is leukemia or lymphoma.

[0015] In some embodiments, the cancer is B cell malignancy, B cell malignancy after HSCT, CL L, B-ALL, acute lymphoblastic leukemia (ALL), B-cell lineage lymphoma after UCBT Cancer, chronic lymphocytic leukemia (CLL), B-non-Hodgkin's lymphoma (B-NHL), HS ALL after CT; lymphoma, refractory follicular lymphoma, or lymphoblastic leukemia In some embodiments, the B cell malignancy is mantle cell lymphoma. In some embodiments, the plurality of NK-92® cells are administered intravenously. In one embodiment, the NK-92® cells are administered intratumorally.

[0016] The foregoing general description and the following detailed description are exemplary and explanatory only and are not intended to limit the present disclosure. Further objects, advantages and novel features will readily occur to those skilled in the art. It is clear in

[0017] Objects, features and advantages of the present invention are best understood upon reference to the following disclosure when considered in conjunction with the accompanying drawings. More easily recognized. [Brief description of the drawings]

[0018] [Figure 1] Schematic representation of the structural domains of first, second, and third generation CARs. [Diagram 2] The components of a tricistronic plasmid containing the CAR coding sequence, the P2A sequence, the CD16 coding sequence, and the erIL-2 coding sequence are shown. [Figure 3A-B] 1 shows the results of flow cytometry analysis showing expression of CD16 and CD19-CAR on the surface of CD19 t-haNK™ cells. The peaks on the right side of each plot represent the population of cells expressing CD16 or CD19. [Figure 4A-B] Figure 4A shows the cytotoxic effect of CD19 t-haNK™ cells against K562 cells. 16B1 and 18B1 are two CD19 t-haNK™ populations obtained from two electroporation events performed on two different days. Figure 4B shows the cytotoxic effect of selected CD19 t-haNK™ clones against K562 in a cytotoxicity assay. [Figure 5A-B] Figure 5A shows the cytotoxic effect of CD19 t-haNK™ cells against SUP-B15 cells. 16B1 and 18B1 are two CD19 t-haNK™ populations obtained from two electroporation events performed on two different days. Figure 5B shows the cytotoxic effect of selected CD19 t-haNK™ clones against SUP-B15 in a cytotoxicity assay. [Figure 6A-B] Figure 6A shows the ADCC activity of CD19 t-haNK™ cells against SKBr3 cells in combination with Herceptin (anti-Her2 antibody). The anti-CD20 antibody Rituxan was used as a control. Figure 6B shows the ADCC activity of selected CD19 t-haNK™ clones against CD19KO / CD20+ SUP-B15 cells in combination with the anti-CD20 antibody Rituximab. [Figure 7] The doubling times of selected CD19 t-haNK™ clones are shown. [Figure 8] IL-2 release from selected CD19 t-haNK™ clones in culture conditions. [Figure 9] Survival curves of IV Raji tumor-bearing animals are shown. Statistical analysis was performed by the log-rank (Mantel-Cox) test, ****, P<0.0001. [Figure 10] Figure 1 shows animal weight changes in the IV Raji tumor model. Data are mean ± SEM. SEM was calculated as the standard deviation divided by the square root of N. [Figure 11] Tumor growth curves for the SC Raji model are shown. Data are mean ± SEM. Statistical analysis was performed using two-way ANOVA followed by multiple comparisons with Tukey's test; ***, P<0.001; ****, P<0.0001. [Figure 12] Figure 1 shows that CD19 t-haNK™ reduced metastatic disease burden in the liver of SC Raji tumor-bearing mice. (a) Whole liver images of animals from the indicated treatment groups on day 13. Yellow arrows indicate metastatic lesions. Livers were fixed in 10% formalin for at least 24 hours before photography. (b) Quantification of tumor cell spread in the liver (assessed by HE staining) on ​​the indicated days. Day 13: *, P=0.0257 by unpaired two-tailed t-test. Statistical analysis for days 11 and 15 could not be performed due to limited sample size. See Table 4 for raw data. [Figure 13] Figure 1 shows animal weight changes in the SC Raji tumor model. Data are means ± SEM. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] overview The present disclosure provides a method for the production of NK-92® cells expressing a CD19 CAR and an Fc receptor. In some embodiments, the cells further express IL-2. In one embodiment, NK-92® cells are composed of CD19 CAR and Fc, and IL2 The present invention also includes a tricistronic construct comprising a nucleic acid sequence encoding

[0020] term Unless otherwise defined, all technical and scientific terms used herein are understood to be of ordinary skill in the art. has the same meaning as commonly understood by

[0021] As used herein and in the claims that follow, the following meanings are defined: Reference will be made to a number of terms which are defined as follows.

[0022] The terminology used herein is for the purpose of describing particular embodiments. As used herein, the singular forms "a," "an," " and "the" shall include the plural unless the context clearly indicates otherwise. For example, reference to "natural killer cells" includes a plurality of natural killer cells. do.

[0023] All numerical designations, e.g., pH, temperature, time, concentration, amount, and molecular weight, including ranges, are expressly intended to be included. It is an approximation that varies (+) or (-) by increments of 0.1 or 1.0 as appropriate. It should be understood, but not limited to, that all numerical designations may be preceded by the term "about." be.

[0024] As used herein, "+" is used to indicate the presence of a particular cell marker. If the cell marker is detected in a marker-specific manner, it is possible to detect it against an isotype control in fluorescence-activated cell sorting. or background in quantitative or semi-quantitative RT-PCR. This means that it is detectable beyond

[0025] As used herein, "-" is used to indicate the presence of a particular cell marker. If the cell marker is detected in a marker-specific manner, it is possible to detect it against an isotype control in fluorescence-activated cell sorting. or background in quantitative or semi-quantitative RT-PCR This means that it is not detectable beyond

[0026] As will be appreciated by those skilled in the art, for any and all purposes, the present invention may be modified in accordance with the principles of the present invention, particularly as set forth in the written description. As provided, all ranges disclosed herein include any and all possible subranges. Any recited range is intended to include at least one subrange and subcombination thereof. It is important to remember that the number of units can be divided into halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, the present invention Each range disclosed in the specification is a lower third, a middle third and an upper third, etc. As will also be appreciated by those skilled in the art, all languages, e.g. For example, "up to," "at least," "greater than," "less than," etc. are inclusive of the number cited. Finally, the ranges that can be divided into the subranges above are understood by those of skill in the art. As defined herein, a range includes each individual member. Thus, for example, 1 to 3 A group having cells refers to a group having 1, 2, or 3 cells. Similarly, a group having 1 to 5 cells A population having cells refers to a population having 1, 2, 3, 4, or 5 cells, etc. .

[0027] As used herein, the term "substantially the same" means a combination of the terms "equivalent" or "substantially Similar to NK-92® cells, which are used interchangeably with “similar” to describe a certain quantifiable characteristic of NK-92® cells, e.g. When referring to properties such as cytotoxicity, viability, or cell doubling time, the two measurements of those properties are mutually exclusive. This means that the difference is less than 15%, less than 10%, less than 8%, or less than 5%.

[0028] Although not always expressly stated, the reagents described herein are merely exemplary and should not be construed as limiting the scope of the invention. It should also be understood that equivalents of such are known in the art.

[0029] For purposes of this invention, and unless otherwise indicated, the term "NK-92®" )" refers to the original NK-92® cell line as well as the NK-92® cell line, NK Clones of .ALPHA.-92® cells and those modified (e.g., by the introduction of an exogenous gene) NK-92® Cells and All of the exemplary embodiments and non-limiting variations thereof are incorporated herein by reference in their entirety. U.S. Patent Nos. 7,618,817; 8,034,332; 8,3 Specification No. 13,943; Specification No. 9,181,322; Specification No. 9,150,636 and U.S. Patent Application Publication No. 10 / 008,955, The following are examples of NK-92 (registered trademark), wild-type NK-92 (registered trademark), NK-92 (registered trademark)-CD16, and NK-9 2®-CD16-γ, NK-92®-CD16-ζ, NK-92( NK-92® MI, and NK-92® NK-92® cells are known to those skilled in the art and are Such cells are readily available from NantKwest®, Inc.

[0030] As used herein, the term "NK-92® cells" refers to the NK-92 cells described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)) The term refers to natural killer cells derived from a unique cell line that is highly potent and whose rights are held by Nant (hereinafter "NK-92® cells") owned by Kwest®.

[0031] The term "aNK cells" as used herein refers to the NK cells described by Gong et al. Kemia, Apr;8(4):652-8(1994) Natural Killer Cells refers to unmodified natural killer cells derived from a human cell line, the rights of which are owned by NantKwest (registered trademark) (hereinafter, "aNK cells").

[0032] The term "haNK cells" as used herein refers to the human NK cells described in Gong et al. A highly potent unicellular plasminogen activator described in Ukemia, Apr;8(4):652-8(1994) The term refers to natural killer cells derived from a line of human natural killer cells, the rights of which are held by NantKwest (registered trademark). The antibody has been modified to express CD16 on the cell surface (hereafter referred to as CD16). , "CD16+NK-92® cells" or "haNK cells").

[0033] The term "taNK cells®" as used herein refers to the NK cells described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)) The term refers to natural killer cells derived from a unique cell line that is highly potent and whose rights are held by the NantK West® and has been modified to express a chimeric antigen receptor. (hereinafter referred to as "CAR-modified NK-92® cells" or "taNK® cells ").

[0034] As used herein, the term "t-haNK™" cells refers to the human NK cells described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)) Natural killer cells are derived from a unique cell line that is highly potent. st®, expresses CD16 on the cell surface and carries a chimeric antigen receptor (hereinafter, "CAR-modified CD16+NK-92 (registered trademark)") In some embodiments, the tumor-specific antigen is CD19, and those NK-92® cells are CD-19 t-haNK (trademark) cells.

[0035] As used herein, the term "multicistronic construct" refers to a single mRNA molecule refers to a recombinant DNA construct that can be transcribed into a single mRNA molecule containing two or more transgenes. A multicistronic construct is a construct that encodes two transgenes. A construct is called a bicistronic construct, whereas a tricistronic construct is called a bicistronic construct if it encodes three genes. If it encodes four genes, it is called a quadrocistronic construct. These are called buildings, and the same applies below.

[0036] As used herein, the term "chimeric antigen receptor" (CAR) refers to an intracellular signaling receptor. CAR refers to an extracellular antigen-binding domain fused to a targeting domain that binds to T cells or NK cells. It can be expressed in cells to increase cytotoxicity. Generally, the extracellular antigen-binding domain The CAR is an scFv specific for an antigen found on the target cell. The scFv cells express a certain antigen on the cell surface based on the specificity of the scFv domain. The scFv domain can be targeted to any antigen, including tumor-specific antigens and They can be genetically engineered to recognize specific antigens, such as CD19 and virus-specific antigens. CAR recognizes CD19, a cell surface marker expressed by some cancers.

[0037] As used herein, the term "tumor-specific antigen" refers to a tumor-specific antigen present on a cancer or neoplastic cell. Refers to an antigen that is detectable on normal cells derived from the same tissue or lineage as the cancer cells, but is not detectable on normal cells derived from the same tissue or lineage as the cancer cells. As used herein, a tumor-specific antigen refers to a tumor-associated antigen, i.e., an antigen that is associated with a cancer cell. is expressed at higher levels on cancer cells compared to normal cells derived from a single tissue or lineage It also refers to antigens that

[0038] As used herein, the term "target" when referring to targeting a tumor means targeting a tumor cell (including This refers to the ability of NK-92® cells to recognize and kill target cells. The term "targeted" in this context refers to a method for targeting a cell surface antigen expressed, for example, by a tumor. Refers to the ability of a CAR expressed by an NK-92® cell to recognize and bind to .

[0039] The term "antibody" refers to an intact immunoglobulin of any isotype or to a target antigen. The term "antibody fragments" refers to fragments of an antibody that can compete with an intact antibody for specific binding to the antibody. Intact antibodies include human, humanized, fully human, and bispecific antibodies. Intact antibodies are generally At least two full-length heavy chains and two full-length light chains, but in some instances fewer For example, naturally occurring antibodies in camels may contain only heavy chains. may be derived exclusively from a single source, or different portions of the antibody may be derived from two different antibodies. The antigen-binding protein, antibody, or binding fragment may be a hybrid. by recombinant DNA techniques in cultured antibodies, or by enzymatic or chemical cleavage of intact antibodies. Unless otherwise indicated, the term "antibody" refers to a polypeptide that is composed of two full-length heavy chains and two The antibodies include antibodies containing one full-length light chain, as well as derivatives, variants, fragments, and muteins thereof. In addition, unless expressly excluded, antibodies include monoclonal antibodies, bispecific antibodies, Antibodies include specific antibodies, minibodies, domain antibodies, synthetic antibodies (referred to herein as "antibody mimetics"). chimeric antibodies, humanized antibodies, human antibodies, antibody fusions (as used herein) and fragments thereof, respectively. In some embodiments, the term also includes peptibodies.

[0040] The term "subject" refers to a non-human animal, e.g., a mammal, e.g., a cat, a dog, a cow, a horse, The term subject refers to animals, including, but not limited to, cattle, pigs, sheep, and goats, as well as humans. It also refers to a patient who requires treatment for a disease.

[0041] "Optionally" or "possibly" means that the term will not apply even if the subsequently described event or circumstance occurs. that the description may or may not include instances in which an event or circumstance will occur. This means:

[0042] The term "comprising" means that the compositions and methods include the recited elements but exclude other elements. "Consisting essentially of" defines compositions and methods. When used for the purpose of combining, it is not necessary to exclude any other element that is essentially significant to the combination. For example, a composition consisting essentially of the elements defined herein is and shall not exclude other elements that do not materially affect the basic and novel characteristics of the claims. "Consisting of" means excluding more than trace amounts of other ingredients and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure. It is.

[0043] As used herein, the terms "cytotoxicity" and "cytolytic" refer to the inhibition of effector cells. When used to describe the activity of a specific cell, such as a NK cell, they are intended to be synonymous. Generally, cytotoxic activity can occur via any of a variety of biological, biochemical, or biophysical mechanisms. Cytolysis more specifically refers to the killing of a target cell by an effector. This refers to the activity of dissolving the plasma membrane of a target Without wishing to be bound by theory, the cytotoxic effect of NK cells is believed to be due to cell lysis.

[0044] The term "kill" with respect to a cell / cell population refers to any action that results in the death of that cell / cell population. This includes any type of operation.

[0045] The term "cytokine" refers to a general class of biological molecules that affect cells of the immune system. Exemplary cytokines include, but are not limited to, FLT3 ligand, insulin terferon and interleukin (IL), especially IL-2, IL-12, IL-15, These include IL-18 and IL-21.

[0046] The terms "patient," "subject," "individual," and the like are used interchangeably herein and are used herein Any animal suitable for the method described in, or whether in vitro or in situ In one non-limiting embodiment, the patient, subject, or individual is a human. .

[0047] The terms "treat" or "treatment" refer to the treatment of a disease described herein in a subject, e.g., a human. or the treatment of a disorder, including (i) inhibiting a disease or disorder, i.e., preventing its occurrence (ii) alleviating the disease or disorder, i.e., causing regression of the disorder. (iii) slowing the progression of the disorder; and / or (iv) preventing or reducing the severity of the disease or or inhibiting, alleviating, or slowing the progression of one or more symptoms of the disorder. "Administering" a monoclonal antibody or natural killer cell to a subject The term "administration" refers to the introduction or delivery of an antibody or cell to perform a desired function. Administration can be by any route suitable for delivery of cells or monoclonal antibodies. Thus, the delivery route can be intravenous, intramuscular, intraperitoneal, or In some embodiments, modified NK-92 (registered trademark) is used. ) The cells are administered directly to the tumor, for example, by injection into the tumor. In some embodiments, The modified NK-92® cells described herein can be administered, for example, by injection, infusion, or transplantation (subcutaneous administration). The drug is administered parenterally (intravenously, intramuscularly, intravesically, intratumorally or intraperitoneally).

[0048] The term "expression" refers to the production of a gene product.

[0049] As used herein, the term "cytotoxicity" refers to the inhibition of effector cells, e.g., NK cells. Various biological, biochemical, or biophysical methods are used to describe the activity of cells. The present invention relates to the killing of target cells by any of a number of mechanisms.

[0050] The terms "reduce," "reduced," "reduction," and "decrease" all refer to a level relative to a reference level. A decrease of at least 10% compared to, for example, at least about 20%, or at least About 30%, or at least about 40%, or at least about 50%, or less At least about 60%, or at least about 70%, or at least about 80%, or At least about a 90% reduction or up to and including a 100% reduction (i.e., (a level of absence compared to a control sample) or a random level between 10 and 100% compared to a reference level It is used herein to refer to a reduction in intent.

[0051] The term "cancer" refers to any type of cancer, neoplasm, or malignant tumor found in a mammal, e.g. As such, it refers to leukemia, carcinoma and sarcoma. Exemplary cancers include brain, breast, cervical, colon , head and neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus and spinal cord Additional examples include Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, and osteoporosis. Myeloma, neuroblastoma, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia disease, primary brain tumor, cancer, malignant pancreatic insulinoma, malignant carcinoid, bladder cancer, precancerous skin disease Cancer, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary cancer, malignant hypercalcemia uterine cancer, endometrial cancer, adrenal cortical carcinoma, neoplasms of the endocrine and exocrine pancreas, and prostate cancer. Some examples include:

[0052] The term "therapeutically effective amount" or "effective amount" refers to an amount sufficient to ameliorate symptoms of a disease relative to an untreated patient. The term "antibody" refers to the amount of anti-inflammatory drug used to carry out the present disclosure for the therapeutic treatment of a disease. The effective amount of the active compound varies depending on the mode of administration, the age, weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amounts are referred to as "effective" amounts.

[0053] Headings or subheadings may be used herein for the convenience of the reader; It does not affect the scope of the present disclosure. The terms are more specifically defined below.

[0054] NK-92® Cells NK-92® is found in the blood of subjects with non-Hodgkin's lymphoma, It is then a cytolytic cancer cell line immortalized in vitro. NK-92® Cells are derived from NK cells but lack the major inhibitory receptors displayed by normal NK cells. However, NK-92® cells retain the majority of activating receptors. do not attack normal cells, and they induce an unacceptable immune rejection response in humans. The characterization of the NK-92® cell line was carried out in WO 1998 / 023666. No. 049268 and U.S. Patent Application Publication No. 2002-0068044 NK-92® cells have been disclosed as a therapeutic agent in the treatment of certain cancers. It is highly rated.

[0055] vector Vectors for transfecting cells to produce the modified cells described herein are provided herein. In one embodiment, the vectors described herein are transient expression vectors. The exogenous transgene introduced using such a vector is expressed in the nuclear genome of the cell. therefore, in the absence of vector replication, the foreign transgene will decompose or dilute over time.

[0056] In one embodiment, the vectors described herein allow for stable transfection of cells. In one embodiment, the vector allows for the integration of a transgene into the genome of a cell. In one embodiment, the vector comprises a positive selection marker. As an example, it allows cells to grow under conditions that would kill cells that do not express the given gene. Non-limiting examples include any gene that confer resistance to antibiotics, e.g., Neticin (the Neo gene from Tn5) is an example.

[0057] In one embodiment, the vector is a plasmid vector. The vector is a viral vector. As will be appreciated by those skilled in the art, any suitable vector may be used. Suitable vectors are well known in the art.

[0058] In some embodiments, the cells are transformed with a gene encoding a protein of interest (e.g., a CAR). Transfected with RNA. Transfection with mRNA results in transient expression of protein. In one embodiment, transfection of mRNA into NK-92® cells In one embodiment, "just before" administration of the cells is performed about 15 minutes prior to administration. Preferably, the mRNA transfection is performed about 5 hours to about 24 hours before administration. This will be carried out shortly.

[0059] CD19 CD19 is a transmembrane glycoprotein that belongs to the immunoglobulin superfamily. It has a single transmembrane domain, a cytoplasmic C-terminus, and an extracellular N-terminus. Biomarkers for normal and neoplastic B cells, and follicular dendritic cells, and for B cells Intrinsic B cell signaling through modulation of both receptor-dependent and -independent signaling It is crucially involved in establishing the nulling threshold.

[0060] CD19 is a marker for most acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), and leukemias. CD19 is expressed in lymphomas of the IL-1 and B-cell lymphomas. The majority of B-cell malignancies express CD19. Expressed at normal to high levels (80% of ALL, 88% of B-cell lymphomas, and CD19 is a hallmark of B cells, but in cases of myeloid malignancies For example, it has been observed in as little as 2% of AML cases. Wang et al., xp.Hematol.Oncol.Nov.29,2012;1:36. Non-limiting examples of associated malignancies are shown in Table 1.

[0061] [Table 1]

[0062] CAR The phenotypic changes that distinguish tumor cells from normal cells derived from the same tissue are determined by specific gene One or more changes in the expression of a product, e.g., loss of a normal cell surface component or other cell surface Associated with the acquisition of components (i.e., antigens that are not detectable in corresponding normal, noncancerous tissues) They are often expressed in neoplastic or tumor cells but not in normal cells. The antigen is expressed in neoplastic cells at levels substantially above those found in normal cells. Antigens expressed in tumors are called "tumor-specific antigens" or "tumor-associated antigens." Specific antigens are used as targets for cancer immunotherapy. One such therapy is a chimeric antigen receptor (CAAR) expressed on the surface of immune cells, e.g., T cells and NK cells. The aim of this study is to improve cytotoxicity against cancer cells by using CARs, which are a type of antibody that binds at least one cell. It contains a single chain variable fragment (scFv) linked to an intracellular signaling domain. , recognize and bind to antigens on target cells (e.g., cancer cells), and activate effector cell activity The signaling domain is important for intracellular signaling by the receptor. Certain immunoreceptors contain tyrosine-based activation domains (ITAMs).

[0063] The present disclosure provides a method for the production of a chimeric antigen receptor (CAR)-derived polypeptide comprising: The present invention provides engineered NK-92® cells. CARs are molecules that recognize extracellular antigens ( They are usually derived from the variable domains of specific antibodies and induce cytolytic responses upon recognition of specific antigens. Intracellular signaling domains (containing single or additional costimulatory elements) that can trigger responses There are several types of CARs, all of which are referred to in this application. First generation CARs contain a single cytoplasmic signaling domain. The signaling domain may be, for example, an Fc epsilon receptor domain containing one ITAM. It can be derived from CD3 gamma (FcεRIγ) or from CD3ζ, which contains three ITAMs. D3ζ CAR appears to be more efficient at eradicating tumors than FcεRIγ CAR. For example, Haynes, et al. 2001, J. Immunology 166:182-187;Cartellieri,et al.2010,J.Bio med and Biotech,Vol.2010,Article ID 9563 See, e.g., 04. Second and third generation CARs contain multiple signaling domains, e.g. , the cytoplasmic signaling domain and the costimulatory signaling domain of CD3ζ, e.g., C D28 / CD134 / CD137 / ICOS and CD28 / CD134, and single CAR In combination, these promote the activation and proliferation of NK-92® cells. In some embodiments, CD1 expressed by CD19 t-haNK™ cells 9 CAR contains the hinge region from CD8 and / or the transmembrane domain of CD28. In some embodiments, the CD19 CAR binds to the cytoplasmic signaling domain of FcεRIγ. In some embodiments, the CD19 CAR comprises a cytoplasmic signaling receptor for CD3ζ. The hinge region, the transmembrane domain of CD28 and the FcεRIγ or CD Examples of cytoplasmic signaling domains of 3ζ are described in, for example, This is disclosed in U.S. Provisional Patent Application No. 62 / 674,936.

[0064] Previous publications, such as Haynes, et al. 2001, J. Immunolo gy 166:182-187 and Cartellieri, et al. 2010, J .Biomed and Biotech,Vol.2010,Article ID 956304 shows that CD3ζ CAR is more effective than FcεRIγ CAR in eradicating tumors While the present inventors have disclosed that it may be possible to None of this applies to the cells, compositions, and methods disclosed herein. Indeed, the inventors have found that the NK-92® cells disclosed herein If the cell has an FcεRIγ CAR domain, it will is as effective as, or in some embodiments, more effective than, And found that.

[0065] Optionally, the CAR is specific for CD19. In some embodiments, CD19 is human CD19. In some embodiments, the CD19 CAR is SEQ ID NO: 10 In some embodiments, the CD19 CAR comprises an scFv fragment comprising the amino acid sequence of comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the CD19 t-ha The NK™ cells comprise the nucleic acid sequence of SEQ ID NO:9, which encodes SEQ ID NO:10. In an embodiment, the CD19 t-haNK™ cells are derived from a sequence encoding SEQ ID NO:12. In some embodiments, the nucleic acid sequence of CD19 t-haNK (trademark) ) The cells contain a tricistronic construct of SEQ ID NO:13.

[0066] In some embodiments, the CD19 CAR polypeptide has at least the sequence set forth in SEQ ID NO: 10. also share 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity In some embodiments, an epitope tag peptide, such as FLAG, , myc, polyhistidine, or V5 may be added to the amino-terminal domain of the polypeptide to generate an antibody. Cell surface detection using monoclonal or polyclonal antibodies against epitope tag peptides This will help support the exit of these companies.

[0067] In some embodiments, the method may be any method known in the art, such as oligonucleotide-mediated We used position-directed mutagenesis, alanine scanning, and PCR mutagenesis to identify variants of the ribozyme. To generate mutant polypeptides, use site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restriction selection mutation Mutagenesis (Wells et al., 1985) or other known techniques may be used to clone This is performed on the DNA to generate CD16 variants (Ausubel, 2002 ; Sambrook and Russell, 2001).

[0068] In some embodiments, the polynucleotide encoding the CD19 CAR is mutated. For example, by modifying the amino acid sequence encoding the CAR without altering the function of the CAR. Polynucleotide substitutions resulting in amino acid substitutions at "non-essential" amino acid residues are It can be made in SEQ ID NO:9 or SEQ ID NO:11.

[0069] SEQ ID NO: 10 or SEQ ID NO: 20, which replaces one class of amino acid with another amino acid of the same class Conservative substitutions in the amino acid sequence of any one of the amino acids 12 to 16 are acceptable as long as the substitution does not substantially alter the activity of the polypeptide. Conservative substitutions fall within the scope of the variants shown. Conservative substitutions are well known to those of skill in the art. (2) the structure of the peptide backbone, e.g., β-sheet or α-helical conformation; (3) the charge; ) hydrophobicity, or (4) non-conservative substitutions that affect the side chain bulk at the target site are Non-conservative substitutions may alter peptide function or immunological identity. Substitutions involve the exchange of a member of one class for another. Substitutions may be made at conservative substitution sites or, more preferably, at Preferably, it can be introduced into a non-conserved site.

[0070] In some embodiments, the method may be any method known in the art, such as oligonucleotide-mediated Barrier cleavage using site-directed mutagenesis, alanine scanning, and PCR mutagenesis Site-directed mutagenesis (Carter, 1986; Zo ller and Smith, 1987), cassette mutagenesis, restriction-selection mutagenesis (Wells et al., 1985) or other known techniques. It can be performed on DNA to generate variants (Ausubel, 2002 ; Sambrook and Russell, 2001).

[0071] Optionally, CD19 t-haNK Cells™ are used to treat cancer, particularly CD19-expressing In some cases, the cancer can be leukemia (e.g., acute leukemia ( For example, acute lymphocytic leukemia, acute myeloid leukemia (e.g., myeloblastic, promyelocytic, Myelomonocytic, monocytic, and erythroleukemias) and chronic leukemias (e.g., chronic myeloid (granulocytic) ) leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, solid tumors tumors, including but not limited to sarcomas and carcinomas, e.g., fibrosarcomas, myxomas Sarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endothelial sarcoma, lymphangiosarcoma, lymphoma Pancreatic cancer, pancreatic sarcoma, synovium, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic Visceral cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma Carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, liver cancer, bile duct carcinoma, choriocarcinoma, semi-cystic carcinoma Breast cancer, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, Skin cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, auditory nerve tumors, oligodendroglioma, meningioma, melanoma, neuroblastoma and retinoblastoma The tumor is selected from the group consisting of cysts.

[0072] Fc receptors In some embodiments, the NK-92® cells are and wherein the at least one Fc receptor is engineered to express NK- Fc receptors are displayed on the cell surface of 92® cells. Several Fc receptors are known and their preferred ligands, affinity , expression, and effect after binding to antibody.

[0073] [Table 2]

[0074] [Table 3]

[0075] In some embodiments, the NK-92® cells have Fc receptor tRNAs on the cell surface. The vector has been modified to express a protein.

[0076] In some embodiments, the Fc receptor is CD16. For purposes of this disclosure, CD The 16 specific amino acid residues are SEQ ID NO:2 or SEQ ID NO:1 at one position The different sequences are designated with reference to SEQ ID NO: 1. Thus, the "158 The amino acid residues at positions 1 and 2 of the CD16 polypeptide and SEQ ID NO:2 are aligned at the maximum. In the latter case, it is the amino acid residue corresponding to position 158 of SEQ ID NO:2 (or SEQ ID NO:1). In some embodiments, the NK-92® cells express the mature form of a protein, e.g. and expressing human CD16 having a phenylalanine at position 158 of SEQ ID NO:1. In an exemplary embodiment, the NK-92® cells are modified to express the protein The mature form of the protein, e.g., human CD16 having a valine at position 158 of SEQ ID NO:2. The mature protein has been engineered to express a high affinity form. Position 158 of the mature protein is the native sigma In some embodiments, the CD16 sequence corresponds to position 176 of the CD16 sequence, including the null peptide. 16 polypeptide is a precursor of SEQ ID NO:3 or SEQ ID NO:4 (i.e., the native signal peptide The polypeptide sequence is encoded by a polynucleotide that encodes a polypeptide sequence having a sequence. Thus, in one embodiment, the Fc receptor comprises FcγRIII-A (CD16). In some embodiments, the NK-92® cells are encoded by SEQ ID NO:1 (FcγRII IA or CD16 with phenylalanine at position 158 (F-158) or SEQ ID NO:2 (having a valine at position 158 (F158V) Fc receptor complex with at least 90% identity to CD16 (a higher affinity form of CD16) The vector has been genetically modified to express a polypeptide.

[0077] In some embodiments, the polynucleotide encoding the CD16 polypeptide is The phenylalanine residues at position 176 of long CD16 (corresponding to position 158 of the mature CD16 protein) A polynucleotide encoding the full-length naturally occurring CD16 containing a signal peptide with alpha-amino acid In some embodiments, the polynucleotide sequence has at least about 70% polynucleotide sequence identity with the nucleic acid sequence of the nucleic acid fragment. In one embodiment, the polynucleotide encoding the CD16 polypeptide is The full length nucleotide sequence including the signal peptide with valine at position 158 of the protein The polynucleotide sequence encoding naturally occurring CD16 and at least about 70% of the polynucleotide sequence In some embodiments, the polynucleotide encoding CD16 has a sequence identity with the target polypeptide. The octide has at least 70%, 80%, 90%, or 95% identity to SEQ ID NO:13. and a polynucleotide encoding position 176 of the full-length CD16 polypeptide including the signal peptide. In some embodiments, the codon encodes a valine at position C. The polynucleotide encoding D16 comprises SEQ ID NO: 13, but is shorter than 176 of full-length CD16. It has a codon encoding a valine at position 2.

[0078] In some embodiments, the CD16 polynucleotide has the sequence identical to SEQ ID NO:1 or SEQ ID NO:2. Encoding a polypeptide having at least 70%, 80%, 90%, or 95% identity to In some embodiments, the polynucleotide has a sequence similar to SEQ ID NO:2, but is at least 70% identical to SEQ ID NO:2. 80%, 90%, or 95% identity to a polypeptide having the sequence shown in SEQ ID NO:2. In some embodiments, the polynucleotide comprises a valine at position 158 as determined by a standard deviation. The oligonucleotide encodes SEQ ID NO: 2. The domain may be the extracellular domain of CD16 with or without a signal sequence, or the full-length CD1 any other fragment of CD16, or a small fragment of CD16 fused to the amino acid sequence of another protein. In another embodiment, the chimeric receptor encodes a chimeric receptor that includes at least a partial sequence of the epitope. A tag peptide, such as FLAG, myc, polyhistidine, or V5, may be added to the mature polypeptide. Anti-epitope tag peptide monoclonal or polyclonal antibodies are added to the amino-terminal domain of the peptide. Cell surface detection can be aided by the use of clonal antibodies.

[0079] In some embodiments, the homologous CD16 polynucleotide comprises an amino acid sequence of about 150 to about 700, The length of the polynucleotide may be about 750 or about 800, but may be more than 700 to 800. CD16 variant bearing polynucleotides are within the scope of this disclosure.

[0080] Homologous polynucleotide sequences include polypeptides encoding variants of CD16. Homologous polynucleotide sequences include those encoding the sequence of SEQ ID NO: Also included are naturally occurring allelic variations of SEQ ID NO:1 or SEQ ID NO:2. A polypeptide having an amino acid sequence as set forth in any one of the following, a naturally occurring variant thereof, or is at least 70% identical to SEQ ID NO: 1 or SEQ ID NO: 2, or at least 80%, NK with any polynucleotide encoding a sequence that is 90% or 95% identical Transfection of -92® cells is within the scope of this disclosure. A homologous polynucleotide sequence may have conservative amino acid substitutions in SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, the NK-92® cells encode natural polynucleotides. Degenerate homologous CD16 polynucleotides that differ in nucleotide sequence but encode the same polypeptide The vector is transfected using the optide sequence.

[0081] In another embodiment, a cDNA sequence having a polymorphism that alters the CD16 amino acid sequence, e.g. For example, using allele variations between individuals that show genetic polymorphisms in the CD16 gene, In another example, the NK-92® cells are modified with a sequence different from that of SEQ ID NO:1. Using CD16 genes from other species with polynucleotide sequences, NK-92 (registered Trademark) to modify cells.

[0082] The variant polypeptides can be prepared by methods known in the art, for example, by oligonucleotide synthesis. Otide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis Mutagenesis can be performed using site-directed mutagenesis (Carter, 1986 Zoller and Smith, 1987), cassette mutagenesis, restriction selection and knock-in The cloning method is carried out by spontaneous mutagenesis (Wells et al., 1985) or other known techniques. can be performed on the DNA to produce CD16 variants (Ausub el, 2002; Sambrook and Russell, 2001).

[0083] In some embodiments, the polynucleotide encoding CD16 is mutated to The amino acid sequence encoding CD16 is altered without altering the function of CD16. For example, For example, polynucleotide substitutions resulting in amino acid substitutions at "non-essential" amino acid residues can be It can be made in SEQ ID NO:1 or SEQ ID NO:2.

[0084] SEQ ID NO: 1, which replaces one class of amino acid with another amino acid of the same class; or Conservative substitutions in SEQ ID NO:2 are acceptable as long as the substitution does not substantially alter the activity of the polypeptide. , fall within the scope of the disclosed CD16 variants. Conservative substitutions are well known to those of skill in the art. (1) The structure of the polypeptide backbone, e.g., β-sheet or α-helical conformation, (2) (3) non-conserved positions that affect the charge, (4) hydrophobicity, or (5) bulk of the side chain at the target site. The substitutions may alter the function or immunological identity of the CD16 polypeptide. Substitution involves exchanging members of one of the classes for another. Substitution is a non-conserving The amino acid sequence can be introduced into a targeted substitution site or, more preferably, into a non-conserved site.

[0085] In some embodiments, the CD16 polypeptide variant comprises at least 200 amino acid length and has at least 70% amino acid sequence identity with SEQ ID NO:1 or SEQ ID NO:2 In some embodiments, the nucleic acid has at least 80% or at least 90% identity to the nucleic acid. In the present invention, the CD16 polypeptide variant is at least 225 amino acids in length. , at least 70% amino acid sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, or at least In some embodiments, the CD16 polypeptide has 80% or at least 90% identity. The polypeptide variant has a valine at position 158 as determined with reference to SEQ ID NO:2. do.

[0086] In some embodiments, the nucleic acid encoding a CD16 polypeptide is a CD16 fusion tag. The CD16 fusion polypeptide may encode a non-CD16 polypeptide. The fusion polypeptides include any portion of CD16 fused to the entire CD16. is conveniently produced using recombinant methods. For example, a CD16 polypeptide, e.g., A polynucleotide encoding SEQ ID NO:1 or SEQ ID NO:2 is a non-CD16-encoding polynucleotide. A polynucleotide sequence encoding a signal peptide of a heterologous protein. In some embodiments, the heterologous polypeptide sequence is fused in frame to C A fusion polypeptide fused to the C-terminus of CD16 or located internally in CD16. Typically, up to about 30% of the CD16 cytoplasmic domain is replaced. Such modifications can improve expression or reduce cytotoxicity (e.g., ADCC). In another example, the chimeric protein may enhance other lymphocyte activity (e.g., responsiveness). Activating receptors, including but not limited to Ig-a, Ig-B, CD3-e, Domains from CD3-d, DAP-12 and DAP-10 are involved in the CD16 cytoplasmic domain It replaces part of.

[0087] The fusion gene can be synthesized by conventional techniques, e.g., an automated DNA synthesizer and the synthesis of two consecutive genes. The child fragments, which can then be annealed and reamplified to generate the chimeric gene sequence. PCR amplification using anchor primers that generate complementary overhangs between the primers (Ausubel, 2002) A number of vectors that facilitate subcloning of CD16 are commercially available.

[0088] Cytokines The cytotoxicity of NK-92® cells is mediated by the expression of cytokines (e.g., interleukins Maintaining NK-92 cells in commercial scale cultures is dependent on the presence of interleukin-2 (IL-2). The cost of using exogenously added IL-2 required for expansion is considerable. A sufficient amount of IL-2 to sustain the activation of NK92® cells. Administration of to human subjects causes adverse side effects.

[0089] In one embodiment, the NK-92® cells are In particular, the at least one cytokine is IL-2 ( SEQ ID NO:6), IL-12, IL-15, IL-18, IL-21, or variants thereof In some embodiments, the cytokine is IL-2, IL-15, or a combination thereof. In one embodiment, IL-2 is a variant that is targeted to the endoplasmic reticulum. and IL-15 is a variant that is targeted to the endoplasmic reticulum.

[0090] In one embodiment, IL-2 is administered in conjunction with a signal sequence that directs the IL-2 to the endoplasmic reticulum. Cloned and expressed (erIL-2) (SEQ ID NO: 7). This is a recombinant human IL-2-producing Allows expression of IL-2 at levels sufficient for autocrine activation without releasing it into the outside world Ru. Konstantinidis et al “Targeting IL-2 to the endoplasmic reticulum confines auto crine growth stimulation to NK-92 (R) cell Exp Hematol. 2005 Feb;33(2):159-64 Continuous activation of FcR-expressing NK-92® cells may be a signaling pathway that may be mediated by, for example, the transcription of a suicide gene. The presence of this can be prevented.

[0091] Suicide Gene The term "suicide gene" refers to a transgene that allows for the negative selection of cells that express the suicide gene. A suicide gene is a gene that is capable of killing cells expressing that gene by the introduction of a selective agent. This is used as a safety system to prevent recombinant genes from causing uncontrolled cell growth. It is desirable to induce mutations or if the cells themselves are capable of such growth. Several suicide gene systems, such as the herpes simplex virus thymidine kinase (TK) gene, Cytosine deaminase gene, varicella zoster virus thymidine kinase gene, nitroreceptor ductase gene, Escherichia coli gpt gene, and The E. coli Deo gene has been identified. Typically, suicide genes are The protein has no adverse effect on the cell, but kills the cell in the presence of a defined compound. Thus, a suicide gene is typically part of a system.

[0092] In one embodiment, the suicide gene is active in NK-92® cells. In an embodiment, the suicide gene is the thymidine kinase (TK) gene. is a wild-type or mutant TK gene (e.g., tk30, tk75, sr39tk). Cells expressing the TK protein can be killed using ganciclovir. Cut.

[0093] In another embodiment, the suicide gene is toxic to cells in the presence of 5-fluorocytosine. Garcia-Sanchez et al. tosine deaminase adenoviral vector and 5 -fluorocytosine selectively reduces breasing t cancer cells 1 million-fold when they contaminate hematopoietic cells: a potent ial purging method for autologous transp lantation.”Blood.1998 Jul 15;92(2):672-8 2.

[0094] In another embodiment, the suicide gene is the presence of ifosfamide or cyclophosphamide. For example, Touati et al. suicide gene therapy combining the impro vector of cyclophosphamide tumor cytotox icity and the development of an anti-tumor or immune response.”Curr Gene Ther.2014; See 14(3):236-46.

[0095] In another embodiment, the suicide gene is iCasp9. 011)“Inducible apoptosis as a safety swi tch for adoptive cell therapy.”N Engl J Med 365:1673-1683. Morgan,“Live and Let D ie:A New Suicide Gene Therapy Moves to t he Clinic”Molecular Therapy(2012);20:11- See also 13. iCasp9 induces apoptosis in the presence of the small molecule AP1903. AP1903 is a biologically inactive small molecule that has been well tolerated in clinical trials. It has been shown to be effective and is used in the context of adoptive cell therapy.

[0096] Codon Optimization In some embodiments, the sequence of the construct used to transform the aNK cells is , maximizing the efficiency of expression of CD19 CAR, CD16, and / or erIL-2 in the human system. Codon optimization is typically achieved by optimizing the codons of the native sequence. At least one, two or more, or a significant number of, are more frequent in genes of the expression system. or modifying a nucleic acid sequence by replacing it with the most frequently used codon. Codon optimization is used to improve translation rate or to improve the desired properties, For example, a recombinant transcript that has a longer half-life compared to a transcript produced using a non-optimized sequence. Methods for codon optimization are readily available and can be used to produce RNA transcripts. For example, Thermo Fisher Scientific (Waltham, MA) ) from GeneArt (trademark); http: / / genomes.urv.es / OP Freely accessible Optimizer in TIMIZER and DNA 2.0 GeneGPS Expression from (Newark, California) In certain embodiments, The coding sequence of the CD19 CAR is codon optimized and contains the sequence set forth in SEQ ID NO:9. nothing.

[0097] Transgene expression The transgene may be engineered into an expression vector by any mechanism known to those of skill in the art. If multiple transgenes are to be inserted into a cell, the transgenes can be expressed on the same expression vector. The gene can be engineered into a target or a different expression vector.

[0098] In some embodiments, the cells are adapted to encode the transgenic protein to be expressed. The cells are transfected with mRNA encoding the

[0099] The transgene and mRNA can be transfected using any transfection method known in the art, e.g. Non-limiting examples include infection, electroporation, lipofection, nucleofection, NK-92® cells using transfection or a “gene gun” can be done.

[0100] NK-92® cells expressing CD19 CAR The present disclosure provides modified NK-92® cells expressing a CD19 CAR and an FcR. Optionally, the modified NK-92® cells further express IL-2. .

[0101] In some embodiments, the engineered NK-92® cells comprise a multicistronic transduction The multicistronic transgene includes a chimeric antigen receptor and an Fc receptor, and optionally encoding IL-2.

[0102] In some embodiments, the FcR is CD16. 16 is a high affinity CD16 comprising or consisting of SEQ ID NO:2. wherein the IL-2 is erIL-2 comprising or consisting of SEQ ID NO:7.

[0103] In some embodiments, the CD19 CAR coding sequence and the CD16 coding sequence are To generate equimolar expression of CD19 CAR and CD16 encoded from a single mRNA The self-cleaving peptide and its corresponding sequence are separated by a sequence encoding the self-cleaving peptide. Coding sequences are well known and are described, for example, in Wa ng et al.,Scientific Reports 5,Article n Non-limiting examples of self-cleaving peptides are disclosed in Umber 16273 (2015). Examples include porcine teschovirus-1 2A (P2A), Tosea asigna (tho sea ​​asigna virus 2A (T2A), equine rhinitis A virus 2A (E2A), Cytoplasmic polyhedrosis virus (BmCPV 2A) of the silkworm (B. mori) and flacherie disease virus In some embodiments, the self-cleaving peptide SEQ ID NO: 8: ggaagcggagctactaacttcagcctgctgaa Code by gcaggctggagacgtggaggagaaccctggacct The P2A peptide is

[0104] In some embodiments, the CD16 coding sequence and the erIL-2 coding sequence are Internal ribosomal endonucleases that allow initiation of translation from internal regions of mRNA transcribed from a sequence The ribosome is separated by an IRES sequence.

[0105] In some embodiments, the modified NK-92® cells are generated by CA from a single mRNA. It contains a tricistronic construct expressing R, high affinity CD16, and erIL-2. In some embodiments, the tricistronic construct comprises the sequence set forth in SEQ ID NO:11. CAR integration allows effector cells to express targets recognized by the CAR. It specifically engages and kills target cells that express CD16; Tegumentation allows ADCC when combined with a therapeutic monoclonal antibody; erIL2 allows cell expansion in the absence of exogenous IL-2 and inhibits transgene expression One illustrative tricistronic construct is shown in FIG.

[0106] Modified to express CAR and CD16 (e.g., high affinity CD16), and erIL-2 To generate mutant NK-92® cells, multicistronic plasmids, e.g. For example, it can be introduced into aNK cells by electroporation. NK-T cells were grown in medium without IL-2 and individual clones were transformed with NK- From 92® cells, select by limited dilution cloning and obtain a standard, e.g. For example, high levels of CAR and CD16 expression, cytotoxicity, ADCC, growth rate, and / or I Suitable clones can be characterized based on L-2 secretion. For example, CD3, CD16, CD54, CD56, NKG2D, and / or NKp30 may also be involved. Optionally, the whole genome sequence may be expressed at a level substantially similar to that of NK cells. DNA sequencing (WGS) is performed to determine the transgene integration site. Clones that meet one or more of these criteria are selected for further development and used to The patient can be treated at the clinic.

[0107] Expression Expression of IL-2 is a predictor of the performance of modified NK-92® cells in IL-2-free conditions. The expression of CAR and CD16 can be confirmed by flow cytometry. CD19 CAR, CD16, and IL-2 (e.g., erI NK-92 ( For IL-2-free cells, typically, a small number of transformed cells that can grow in the absence of IL-2 are used. At least 70%, at least 80%, at least 85% express both CAR and CD16 It also shows high expression levels.

[0108] In some cases, the IL-2 secretion levels of transformed NK-92® cells are measured at various times. At this point, the amount of the protein can be measured using methods well known in the art, for example, by ELISA. It is possible.

[0109] In some embodiments, IL-2 levels in the culture supernatant are measured and released into the cell culture medium. In some embodiments, the level of IL-2 in the cell pellet is determined. In some embodiments, the total intracellular level of IL-2 is assessed by measuring the IL-2 level. The amount of IL-2 in both the supernatant and the cell pellet was measured to confirm the expression of IL-2 in transformed NK-92 cells. The total amount of IL-2 produced by the .RTM. cells is determined.

[0110] Optionally, other surface markers of transformed NK-92® cells are identified using flow cytometry. These markers can be measured by endothelial growth factor spectrometry. Examples of specific antigens that may be involved include, but are not limited to, CD54, CD56, NKG2D, NKp30, and CD3. Suitable clones will have substantially similar expression of their markers to aNK cells under identical growth conditions. The expression levels were demonstrated.

[0111] cytotoxicity Optionally, NK-92 (registered trademark) transformed with a tricistronic plasmid ) Cellular cytotoxicity can be assessed using a flow-based cytotoxicity assay. Effector cells (NK-92® cells) and fluorophore-labeled target cells, e.g. For example, tumor cells are mixed at different effector to target ratios. PI (protein immobilized protein) can be added to the cells and the samples analyzed by flow cytometer. Preferably, the fluorophores used to label the target cells are detected by flow cytometry. In some embodiments, the fluorophore can be used to distinguish the PI from the PI. In some embodiments, the fluorophore is PKHGL67. Cytotoxicity is determined by the % of PI-positive cells within the fluorophore-positive target population. can be done.

[0112] Optionally, NK-92 (registered trademark) transformed with a tricistronic plasmid The cytotoxicity of NK cells can also be tested using methods well known in the art. The cytotoxicity of IL-92 cells was countered by their direct cytotoxicity or ADCC activity. Direct cytotoxicity of the produced NK-92® cells, abnormal cells The ability to target and kill, for example, tumor cells, can be determined by methods well known in the art, e.g. For example, Klingemann et al. Using the procedure described by Northern. 33:395-397 (1991) 5 1 Cr release assay (Gong et al. (Leukemia, Apr;8(4): In some embodiments, the target The cells are capable of expressing an antigen that can be recognized by a CAR expressed on the surface of the t-haNK™ cells. In short, 51 Cr-labeled target cells were mixed with NK-92® cells. The proportion of specific cytotoxicity released is 51 Calculate based on the amount of Cr See U.S. Patent Application Publication No. 20020068044.

[0113] Alternatively, the direct cytotoxicity of the generated NK-92® cells can be determined by calcein release assay. For example, NK-92 (registered trademark) cells (assay) can be used to evaluate the expression of NK-92 (registered trademark) cells. (referred to as effector in B) was added to calcein-loaded target cells (referred to as target cells in the assay). (referred to as "incubation time") in a certain ratio. Calcein released from the target cells is then evaluated, for example, by a fluorescent plate reader. It is possible.

[0114] The effector to target ratio used in each assay may vary, and in some cases The effector:target ratio can be 20:1, 15:1, 10:1, 8:1, or 5:1; Preferably, the effector:target ratio is 10:1. The target cells are NK-92 (registered trademark The CAR expresses an antigen molecule that can be recognized by CAR on t-haNK™ cells (t-haNK™ cells). For example, SUP-B15 cells can be recognized by CD19 CAR. and are target cells for CD19 t-haNK™ cells. The cytotoxicity values ​​of target cells depend on the type of target cell used and the effector:target Generally, the NK-92 produced using the methods described herein (registered trademark) cells are 60 to 100%, for example, 70 to 100% or 80 to 100% of cells. In some cases, NK-92® cells may be cytotoxic. When using an effector:target ratio of 1:10, the effector:target ratio is 80-100%, e.g., 8 2~100%, 85~100%, 87~100%, 88~100%, or 89~100% It may have a cytotoxic effect.

[0115] Optionally, the NK-92® cells being evaluated are, for example, t-haNK™ The cytotoxicity of the cells is antibody-dependent cellular cytotoxicity (ADCC). The method for measuring the ADCC activity of cells is the same as above, except that an antibody capable of recognizing the target cells is also added. This method is similar to the direct cytotoxicity measurement described above. The Fc receptors on NK cells recognize cell-bound antibodies. In one illustrative example, t -haNK™ cells are expressed using Herceptin (anti-Her2 antibody) and SKBr3 (target The killing of SKBr3 cells was observed in the same manner as in the above target cells. Internal components, e.g. 51 Cr or calcein release, or by PI of target cells It can be measured by staining.

[0116] Doubling Time The growth rate of NK-92® cells, e.g., t-haNK™ cells, is Doubling time, i.e. the time it takes for cells to multiply to reach twice the initial cell number Doubling time can be evaluated using the following method: the longer the doubling time, the slower the growth rate.

[0117] WGS Optionally, whole genome sequencing (WGS) of the transformed NK-92® cells ) is performed to identify the insertion site of the multicistronic construct.

[0118] therapeutic use The present disclosure also provides a method for treating any type of cancer in a subject at any stage of the disease. Non-limiting examples of suitable cancers include carcinoma, melanoma, or sarcoma. In some embodiments, the present invention can be used to treat cancers of hematopoietic origin, such as leukemia or lymphoma. In some embodiments, the cancer is a solid tumor.

[0119] In some embodiments, the methods of treating any type of cancer in a subject include administering to the patient a therapeutic and administering a therapeutically effective amount of the NK-92® cells described above, thereby treating cancer. In some embodiments, the NK-92® cells bind to Fc receptors, e.g., The antibody expresses a high affinity Fc receptor having the sequence set forth in SEQ ID NO:2. NK-92® cells express the CD19 CAR, Fc receptor and IL-2. In some embodiments, the engineered NK-92® cells are multicistronic. The multicistronic construct includes a chimeric antigen receptor and an Fc receptor. Do it.

[0120] A subject in need of treatment is treated with the modified NK-92® cells described herein. Methods of treating are also provided. In some embodiments, the subject or patient is suffering from cancer or an infectious disease. The patient may suffer from a disease, for example a viral infection.

[0121] The modified NK-92® cells can be administered to an individual in absolute numbers, e.g. For example, the individual may be administered from about 1000 cells / injection up to about 10 billion cells / injection, e.g. , about, at least about, or at most about 1 x 10 per injection 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1×10 4 , 5×10 4 , 1×1 0 3 , 5×10 3 (etc.) NK-92® cells, or between any two numbers Any range (including endpoints) of the above can be administered. Thus, the present disclosure also provides NK-92® cells, wherein the number of cells is 1×10 8 , 1×1 0 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1×10 4 , 5 ×10 4 , 1×10 3 , or 5 × 10 3 A composition comprising:

[0122] In another embodiment, the individual is administered about 1000 cells / injection / ml. 2 ~Up to about 100 100 million cells / injection / m 2 , e.g., about, at least about, or at most about 1× per injection 10 8 pieces / m 2 , 1×10 7 pieces / m 2 , 5×10 7 pieces / m 2 , 1×10 6 pieces / m 2 , 5× 10 6 pieces / m 2 , 1×10 5 pieces / m 2 , 5×10 5 pieces / m 2 , 1×10 4 pieces / m 2 , 5× 10 4 pieces / m 2 , 1×10 3 pieces / m 2 , 5×10 3 pieces / m 2 (etc.) NK-92 (Registered (trademark) cells, or any range between any two numbers (including the endpoints). Cut.

[0123] In other embodiments, NK-92® cells are administered to such individuals in relative numbers. Only the cells can be administered to the individual, for example at about 1000 cells per kilogram of the individual. up to about 10 billion cells per kilogram of an individual, e.g., at least about Or at most about 1 × 10 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×1 0 5 , 5×10 5 , 1×10 4 , 5×104 , 1×10 3 , or 5 × 10 3 Pieces (etc.) NK-92® cells, or any range between any two numbers (including the endpoints) It can be administered.

[0124] In another embodiment, the total dose is m 2 It can be calculated as follows: 1m 2 Approximately 1 x 10 11 , 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 or any range between any two numbers (including the endpoints). The gap is about 1.6m. 2 ~ approx. 1.8m 2 In a preferred embodiment, about 1 billion to about 3 10 billion NK-92® cells are administered to the patient. The amount of NK-92® cells injected per m2 of body surface area 2 Calculate by As an example, 2 1x10 11 , 1×10 10 , 1×10 9 , 1× 10 8 , 1×10 7 The average body surface area for humans is 1.6 to 1.8 m 2 It is.

[0125] In other embodiments, NK-92® cells are administered to such individuals in relative numbers. Only the cells can be administered to the individual, for example at about 1000 cells per kilogram of the individual. up to about 10 billion cells, e.g., about, at least about, or at most about 1×10 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1× 10 4 , 5×10 4 , 1×10 3 , or 5 × 10 3 Pieces (etc.) of NK-92 (registered trademark) Cells, or any range between any two numbers, including the endpoints, can be administered.

[0126] NK-92® cells can be administered once to a patient with cancer, or They may be administered multiple times, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 1 2, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 hours or once every 1, 2, 3, 4, 5, 6, or 7 days, or once every 1, 2, 3, 4, Once every 5, 6, 7, 8, 9, 10 or more weeks, or any two of these It may be administered once for any range between the characters (including the endpoints).

[0127] In some embodiments, the NK-92® cells are The antibody is administered in a composition comprising cells and a vehicle, such as human serum or an equivalent thereof. In some embodiments, the medium comprises human serum albumin. In some embodiments, the medium comprises about 1% to about 15% human serum or human serum. In some embodiments, the medium comprises about 1% to about 10% human serum or human equivalents. In some embodiments, the medium contains about 1% to about 5% human serum or human serum equivalent. In a preferred embodiment, the medium contains about 2.5% human serum or human serum equivalent. In some embodiments, the serum is human AB serum. In an embodiment, a serum substitute acceptable for use in human therapy is used in place of human serum. Such serum substitutes are known in the art or may be developed in the future. Concentrations of human serum greater than 15% can be used, but concentrations greater than about 5% are preferred. It is contemplated that the cost of NK-92® is too high. The cells are administered in a composition comprising NK-92® cells and an isotonic solution that supports cell survival. In some embodiments, the NK-92® cells are administered from a cryopreserved sample. It is administered in the reconstituted composition.

[0128] Pharmaceutically acceptable compositions comprising NK-92® cells can be formulated with a variety of carriers and excipients. A variety of aqueous carriers can be used, such as buffered saline and the like. These solutions are sterile and generally free of undesirable matter. These compounds are listed in Remington: The Science and Prac tice of Pharmacy,21st Edition,David B.Tr oy, ed., Lippicott Williams & Wilkins (2005 A pharma- ceutically acceptable carrier is one that is neither biologically nor otherwise undesirable. "materials" refers to materials that do not cause undesirable biological effects, It does not adversely interact with other components of the pharmaceutical composition in which it is contained, and When administered to a subject, the carrier optionally has properties that minimize degradation of the active ingredient. The therapeutically effective amount of the compound is selected to minimize adverse side effects in the subject. As used herein, the term pharma- ceutically acceptable means physiologically acceptable and pharmacologically acceptable. Pharmaceutical compositions generally contain agents for buffering and preservation during storage. and may include buffers and carriers for appropriate delivery depending on the route of administration.

[0129] These compositions for in vivo or in vitro use are compatible with the sterilization techniques used on cells. The composition may be sterilized by surgical techniques. Auxiliary substances, such as pH adjusters and buffers, and toxicity adjusters, such as sodium acetate. Contains sodium chloride, potassium chloride, calcium chloride, and sodium lactate. The concentrations of cells and / or other agents in these formulations may vary, primarily depending on the selected The dosage form is selected based on the specific administration method and the subject's needs, such as fluid volume, viscosity, and body weight. .

[0130] In one embodiment, the NK-92® cells are administered in one or more In some embodiments, the treatment is administered to the patient in combination with other treatments or agents. One or more other treatments for cancer, such as antibodies, radiation, chemotherapy, stem cells, transplantation, or hormone therapy.

[0131] In some embodiments, the NK-92® cells and the other cancer drug / treatment are administered simultaneously. at or about the same time (e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other) In some embodiments, the NK-92® cells and other cancer drugs / treatments are In some embodiments, the other cancer treatment / agent is NK-92 (registered trademark). The antibody is administered 1, 2, or 3 days after administration of the CD4+ (Registered Trademark) cells.

[0132] In one embodiment, the other cancer agent is an antibody. The cells are administered in combination with an antibody that targets the diseased cells. Thus, the NK-92® cells and the antibody may be administered to a patient together, e.g., in the same compartment. in a mixture; separately, e.g., in separate formulations, in combination; or separately, e.g., in different The doses can be administered on a dosing schedule or at different times during the day. If administered, the antibody may be administered via any suitable route, for example, intravenous or intratumoral injection. It is possible.

[0133] In some embodiments, the NK-92® cells of the present disclosure are administered with therapeutic antibodies and / or Therapeutic antibodies are used to detect cancer-associated or tumor-associated markers. Examples of cancer therapeutic monoclonal antibodies are shown in Table 4. In some embodiments, NK-92® cells bind to Fc receptors, e.g., In some embodiments, the antibody expresses a high affinity Fc receptor having the sequence set forth in sequence number 2. In one embodiment, the NK-92® cells are haNK® cells. and the therapeutic antibody is avelumab.

[0134] [Table 4]

[0135] [Table 5]

[0136] Such administration of NK-92® cells may be performed simultaneously with administration of the monoclonal antibody. In some embodiments, NK-92 (registered trademark) can be used in a single step or continuous mode. The target cells are administered to the subject after the subject has been treated with a monoclonal antibody; or NK-92® cells may be simultaneously, e.g., within 24 hours of the monoclonal antibody. can be administered.

[0137] In some embodiments, the NK-92® cells are administered intravenously. In an embodiment, NK-92® cells are injected directly into the bone marrow.

[0138] Thus, the present disclosure provides a method for treating cancer or a viral infection in a patient in need of treatment. A method of treating a viral infection comprising administering to a patient a therapeutically effective amount of NK-92 as disclosed herein. (R) cells, thereby treating the cancer.

[0139] kit Compositions comprising a plurality of NK-92® cells as described herein are used to treat cancer or rheumatoid arthritis. Also disclosed are kits for the treatment of infectious diseases. In some embodiments, the kits of the present disclosure The kit may also include at least one monoclonal antibody. In some embodiments, NK- 92® cells can be used to express IL-2, e.g., erIL-2, or IL-15, e.g., In some embodiments, the NK-92® cells further express erIL-15. The cell comprises a multicistronic construct, the multicistronic construct comprising a chimeric antigen receptor The antibody encodes an Fc receptor, an Fc receptor, and optionally IL-2 or IL-15.

[0140] In one embodiment, the kit includes a method for administering NK-92® cells prior to or concurrently with administration of the cells. or may contain additional compounds, such as therapeutically active compounds or drugs, to be administered after administration. Examples of such compounds include antibodies, vitamins, minerals, fludrocortisone, ibuprofen, and erythropoietin. These include buprofen, lidocaine, quinidine, and chemotherapy drugs.

[0141] In various embodiments, the instructions for use of the kit include a method for the treatment of cancer or an infectious disease. The instructions include instructions for using the kit components. The instructions may further include information on how to handle the product (e.g., thawing and / or culturing). It may further include guidelines regarding dosage and frequency of administration.

[0142] In certain embodiments, the kit includes one or more compositions described herein, e.g., The present invention also provides a method for treating a patient having a disease comprising administering to said patient one or more containers filled with a composition comprising NK-92® cells as described herein. Optionally, the kit includes a method for treating cancer, such as those described herein. Such containers may be accompanied by a label stating that they are , or notifications in the form prescribed by authorities regulating the manufacture, use, or sale of pharmaceutical or biological products. The notification reflects approval by a regulatory authority for manufacture, use, or sale for human administration. .

[0143] can be used in conjunction with the methods and compositions of the present disclosure. , materials, compositions, and methods that can be used in the preparation thereof, or which are products thereof These and other materials are disclosed herein, and these materials and components are disclosed herein. When compound combinations, subsets, interactions, groups, etc. are described, No specific reference is made to each of the various individual and collective combinations and permutations. It is understood that each is specifically contemplated and described herein. For example, methods are disclosed and discussed that can be performed on a number of molecules that include Where numerous variations are contemplated, each and every combination and permutation of the methods, as well as All possible modifications are specifically contemplated unless specifically indicated otherwise. Likewise, any subset or combination of these is also specifically contemplated and disclosed. The present disclosure relates to all aspects, including but not limited to, the use of the disclosed compositions. Thus, various additional steps that can be implemented If steps are present, each of those additional steps shall be treated as a separate step from any prescribed method steps. that the method of the present invention can be carried out by any combination of steps or method steps of the disclosed methods, and Each such combination or subset of combinations is specifically contemplated and disclosed. It is understood that this should be the case. EXAMPLES

[0144] The following examples are for illustrative purposes only and should not be construed as limiting. Various alternatives available to those skilled in the art that would also enable the following examples to be successfully carried out. Replacement techniques and procedures exist.

[0145] Example 1: Generation of PD-1 CAR-modified NK-92® cells The CD19 CAR is expressed as a tricistrone that also contains the CD16 and erIL-2 transgenes. The recombinant plasmid pNEUKv1 FcR_IL-2 was cloned into the vector. The stron- ic plasmid was electroporated into aNK cells. IL-2 dependent Non-transformed aNK cells, which are CD19 CAR-expressing NK-92® cells were selected by IL-2 depletion medium.

[0146] Limiting dilution cloning Aliquots of the polyclonal CD19 t-haNK™ pooled cultures were incubated with IL- The cell suspension was diluted to a density of 3 cells / ml in growth medium without supplements. The wells were aliquoted in a volume of 200 μl per well in a well plate, which The plates were incubated at 37° C. for 10 days. A total of 2 clones were then cultured and then visually inspected for cell growth. 0 cultures were picked, transferred to large vessels and numbered according to their initial growth rate, Clones #1-10 could be passaged initially.

[0147] Example 2: Biological Assays Cell culture: Polyclonal and clonal CD19 t-haNK™ cells were cultured in 5% heat inactivated culture medium. Growth medium supplemented with neutralized human AB serum (from a CMV-negative test donor) and lacking IL-2 It was cultivated underground.

[0148] aNK cells were cultured in 5% heat-inactivated human AB serum (from a CMV-negative test donor) and 50 The cells were cultured in growth medium supplemented with 0 IU / ml recombinant human IL-2.

[0149] haNK cells were supplemented with 5% heat-inactivated human AB serum (from a CMV-negative tested donor). and cultured in growth medium without IL-2.

[0150] K562 cells were cultured in 10% heat-inactivated fetal bovine serum and an antibiotic / antimycotic cocktail. K562 cells were cultured in RPMI-1640 supplemented with 100% DMSO. The cells were subcultured whenever the culture medium turned yellow.

[0151] SUP-B15 and SUP-B15 CD19KO / CD20+ Cells were heat inactivated by 20% Normalized fetal bovine serum, 55uM beta-mercaptoethanol, and antibiotic / antimycotic Cells were cultured in RPMI-1640 supplemented with a cocktail of The cells were passaged in the same manner as K562 cells.

[0152] Antibody staining for flow cytometry analysis: Cells were harvested by centrifugation and cultured in FACS buffer (5% FBS in 1x D-PBS). The cells were washed twice and resuspended in 1 ml of FACS buffer. For oligophore-conjugated antibody staining, cells were incubated with the appropriate conjugated antibody (or antibody Isotype control) for 20 min at 4°C in the dark, then FACS buffer For detection of CAR protein, the cells were incubated with biotinylated anti-F(ab')2 Incubate with fragment antibody, then incubate with streptavidin-APC antibody Samples were analyzed on a MACSQuant flow cytometer.

[0153] Growth assay: 1 × 10 resuspended in growth medium supplemented with 5% heat-inactivated human AB serum 5 pcs From an initial concentration of cells / mL (day 1), the cultures were cultured on days 3, 5, and 7 for auto-cell counting. The growth rate was calculated using a counting device according to the following formula: Doubling time (hours) = [Duration (hours) × log(2)] / [log(final cell density)-log(initial cell density) degrees)] It was calculated by:

[0154] Cytotoxicity: Suspension-grown cell lines were resuspended by pipetting the cell culture up and down. Viability was determined by automated counting (trypan blue exclusion method). Target cells were stained with CFSE dye. Dilution of target and effector cells to the required cell concentration was performed using 10% heat-inactivated The cultures were carried out in RPMI-1640 supplemented with activated FBS and antibiotic / antimycotic. Vector and target cells were cultured at different effector-to-target ratios (20:1, 10:1, 5:1 , 2.5:1, 1.25:1, 0.62:1, 0.31:1, and 0.15:1 E:T ) in a 96-well plate and incubate at 37°C in a 5% CO2 atmosphere. The cells were co-cultured in a 30-well plate for 4 hours. PI was then added to fluorescently label dead cells, and the cells were assayed. The cells were analyzed on a MACSquant flow cytometry instrument.

[0155] ADCC: Suspension-grown cell lines were resuspended by pipetting the cell culture up and down. Viability was determined by automated counting (trypan blue exclusion method). Label with L dye and dilute target and effector cells to the required cell concentration at 10 The experiments were performed in RPMI-1640 supplemented with 100% heat-inactivated FBS and antibiotic / antimycotic. Target cells were treated with the monoclonal antibodies trastuzumab, rituximab, or without antibodies. The cells were pre-incubated at room temperature for 30 minutes. Then, antibody-labeled target cells (and antibody-free control) were cultured with effector cells at different effector-to-target ratios (20:1, 10:1, 5: E:1, 2.5:1, 1.25:1, 0.62:1, 0.31:1, and 0.15:1 The mixture was mixed in a 96-well plate at 100°C (T) and incubated at 37°C in a 5% CO2 atmosphere. The cells were then co-cultured in a centrifuge for 4 hours. PI was then added to fluorescently label dead cells, and the cells were incubated in a centrifuge for 4 hours. The assay was analyzed on a MACSquant flow cytometry instrument.

[0156] Quantification of IL-2 Cells for analysis were washed in D-PBS 1x to remove residual medium and resuspended in fresh growth medium. and place 10 ml of each suspension in two 96-well plates. 5 cells / well (=200 μl The plates were incubated at 37°C for 5 min at 4°C for 1 h and aliquoted in triplicate at a density of 100 µg / well. One set of plates was incubated in a humidified O2 incubator for 24 hours. One was removed for analysis after 1 h of incubation and the other after 48 h. Analysis Sample supernatant for a first centrifugation step of 5 min at 500 x g to remove cells. followed by a second centrifugation at 2,000 x g for 5 min to remove cellular debris. Sample supernatants were frozen at -80°C until analysis. The cell pellets from each step were resuspended, triplicates pooled, and cell densities recorded. The concentration of IL-2 in the supernatant was measured using a ThermoFisher Scientific (Wa A human IL-2 ELISA detection kit available from St. Ham, MA was used according to the manufacturer's instructions. The assay was performed according to the manufacturer's instructions and compared to the standard provided. and normalized to cell counts at 48 hours, pg / ml / 10 5 Expressed as individual cells.

[0157] Example 3: Phenotype of Modified NK-92® Cells Expression of CD19 CAR in CD19 t-haNK™ cells was analyzed by flow cytometry. The results showed that CD19 t-haNK™ cells were and over 80% of the cells expressed high levels of both CD16 (Figure 3A) and CAR (Figure 3B). B).

[0158] In a separate experiment, 20 selected clones were cloned using CD19CAR (biotinylated F(ab ') Detection with 2 fragment-specific primary antibodies and streptavidin-APC secondary antibodies) and C Flow cytometry for surface expression of D16 (detected by 3G8 monoclonal antibody) Multiple positive populations, low staining intensity for CD16, or Clones that showed high background were discarded.

[0159] [Table 6]

[0160] Six NK cell markers in selected CD19 t-haNK™ clones The expression profile of aNK was determined by antibody staining and flow cytometry and compared with that of aNK. All clones and aNK were negative for CD3 expression, whereas only aNK expressed CD3. All clones were negative for CD54, CD56, NKp30, and D16 expression. and NKG2D expression, and their expression levels were similar to those of the aNK control. I did.

[0161] [Table 7]

[0162] Example 4: Cytotoxicity of CD19 t-haNK™ cells against target cell lines The cytotoxicity of CD19 t-haNK™ cells was evaluated using target cells, K562 cells, SUP The results were analyzed by incubating the cells with IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-31, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12, IL-13, IL-14, IL-15 ... CD19 t-haNK™ cells outperform parental aNK in killing K562 cells (target cells). The results show that 16B1 and 18B1 maintained the same cytotoxicity as K cells. Two CD19 t-ha clones were obtained from two electroporation events. NK™ population.

[0163] In a separate experiment, selected CD19 t-haNK™ clones were cultured in K56 Flow cytometry-based in vitro assay for two target cell lines (CD19-, NK-sensitive) All clones were used as effectors in the cytotoxicity assay for 4 h. It showed efficient cytolytic activity against K562 in a cytotoxicity assay. The average maximum killing efficiency for t-haNK™ clones was a 70.9±10.1% to 84.4±0.05% compared with 84.1±2.4% for NK controls. .6% (n=2-5). See Figure 4B.

[0164] FIG. 5A shows that CD19 t-haNK™ cells are aNK™-resistant, CD19-positive We demonstrated enhanced specific killing of the resistant SUP-B15 cell line and compared the binding of 10 effectors to targets. In the NK cell-induced NK cell death, only about 10-20% of the cells were killed by aNK cells. Approximately 80-90% of the cells were killed by CD19 t-haNK™ cells.

[0165] In a separate experiment, selected CD19 t-haNK™ clones were cultured using SUP -Flow cytometry-based assay for B15 target cell line (CD19+, NK resistant) All clones were used as effectors in the in vitro cytotoxicity assay. The antibody was able to efficiently target and kill resistant SUP-B15 in a cytotoxicity assay. The average maximum killing efficiency for the D19 t-haNK™ clone was 10:1. The mean age-related mortality rate was 85.7±0.1% to 92.2%, compared with 10.8±7.4% for aNK controls. 2±1.2% (n=2-5). See Figure 5B.

[0166] FIG. 6A shows the CD19 t - The ADCC activity of haNK™ cells was enhanced by the anti-Her2 / neu antibody Herceptin haNK®, which expresses only the CD16(158V) receptor, The results show that the results were equivalent to those of cells.

[0167] In a separate experiment, selected CD19 t-haNK™ clones were cultured with modified SU Against P-B15 target cell line (CD19-, CD20+, Her2-neu-, NK resistant) As an effector in a flow cytometry-based in vitro ADCC assay In combination with anti-CD20 rituximab monoclonal antibody or anti-Her2-neu trastuzumab, In a 4-hour cytotoxicity assay, All clones were resistant to SUP-B1 when combined with the anti-CD20 antibody rituximab. 5CD19KO / CD20+ could be efficiently targeted and killed. CD19 t-haNK The maximum killing efficiency for the clone was achieved with haNK(R) at a ratio of 10:1. ) 63.7%-77.8% compared with 67.1% for controls (n=1-2) Both haNK® and CD19 t-haNK™ clones were When combined with the neu control antibody trastuzumab, the target SUP-B15CD19KO / Failed to kill CD20+ cells (CD19 t-haNK™ clone The maximum killing efficiency of haNK (registered trademark) was 7.7% to 21.9% at a ratio of 10:1. For the CD19 t-haNK™ clone, the rate was 4.1%. The ADCC-mediated killing of all cells was 6:1 relative to the haNK® control at a ratio of 10:1. 46.4%-65.2% compared to 2.7%. See Figure 6B.

[0168] Example 5: Further characteristics of CD19 t-haNK™ cells Population doubling time of selected CD19 t-haNK™ clones without medium exchange The cell growth was determined by a 7-day cell growth assay, and the average doubling time was calculated. The aNK control showed a range of 33.1 to 54.5 hours of aggregation compared with 34.5 hours for the aNK control. The population doubling time was 10 min. See FIG.

[0169] CD19 t-haNK™ clones were cultured in 6-well plates at 10e5 The cells were plated at a density of 100 cells / ml without IL-2, and the culture supernatant was harvested after 24 and 48 hours. The supernatants were analyzed by ELISA to determine the expression of CD19 t-haNK™ cells. After 24 hours in culture, CD19 t cells were stained with ELISA and the potential release of ERIL-2 was detected and measured. -haNK™ clones release 16.1-1278.5 pg / ml / 105 cells See Figure 8.

[0170] Example 6: CD19 t-haNK™: Raji human Burkitt cells in NSG mice CD19-targeted t-haNK™ cells in intravenous and subcutaneous models of mouse lymphoma Evaluation of antitumor activity of CD19 t-haNK™ expresses a chimeric antigen receptor (CAR) against CD19. It is a natural killer cell that is expressed to treat hematological cancers of the B-cell lineage. The antitumor effect of repeated intravenous (IV) administration of CD19 t-haNK™ was evaluated in NSG mice. The study was evaluated in both IV and subcutaneous (SC) Raji xenograft models. In both models, CD19 t-haNK™ cells demonstrated significant therapeutic efficacy. Specifically, in the IV tumor model, CD19 t-haNK™ cells inhibited Animal survival was significantly improved compared to vehicle controls. 9 t-haNK™ significantly inhibited tumor growth and reduced the number of animal morbidity / mortality events. This could reduce the metastatic disease burden in the liver significantly.

[0171] Targeting aNK cells expressing chimeric antigen receptors (CARs) against CD19 was performed using Raji Showed efficacy in tumor-bearing NSG mice, reflecting target specificity of CAR-expressing cells It has already been shown that the most likely cause is allergic cytotoxicity (e.g., Oelsn (See er et al, Cytotherapy, 2017.) The efficacy of CD19 t-haNK™ cells was evaluated in the Raji xenograft model. Two different variations: 1) intravenously (IV) inoculated Raji cells; and 2) subcutaneously (SC) ) inoculated Raji tumors, and both models were Additional groups of animals (groups B and E) were also included in the original study protocol. For the first time, they were evaluated in this model as CD19 t-haNK™ potency determination Note that these studies were not included in this report because they were unrelated to the (See Table 6 for more information).

[0172] Example 7: Materials for CD19 t-haNK™ Testing CD19 t-haNK™ cells (clone 19.6): CD19 t-haNK (TM) cells were cultured in growth medium supplemented with 5% heat-inactivated human AB serum, and then Process Development, NantKwest®, Inc. Therefore, we followed the protocol provided by Torrey Pines.

[0173] Test animals: The test animals used were 9 to 10 weeks old at the start of the test (after being kept in isolation) and Female NOD.Cg-Prkdc mice weighing 20-27 grams at initiation scid Il2r g tm1Wjl Twenty animals were used for the IV tumor model. The animals were provided by The Jackso n Laboratory(610 Main Street Bar Harbor, The 2011 WHO International Conference on Medical Devices (ME 04609 US) included a 10-item, ... Each mouse was then administered a dose of 100 mg ... The animals had cage cards containing item number information.

[0174] Raji cancer cell line: Raji cells were first obtained from ATCC (catalog #CCL-86™) ; Lot #61723871) and then Preclinical Development The cells were expanded and prepared by Opment, NantKwest®, Inc. was certified by IDEXX on March 18, 2018 (Appendix to the Certification Report) 2). The cell culture medium was supplemented with 10% fetal bovine serum, penicillin (100 U / mL), ATCC-formulated RPMI-1 supplemented with streptomycin (100 μg / mL) The medium was 1640. Exponentially growing Raji cells (passage 12) were centrifugally separated. The cells were washed and diluted to 5 × 10 for IV inoculation. 5 Ineffective at a concentration of 100 viable cells / mL in serum medium, and 2.5 x 10 for SC transplantation 6 Culture at a concentration of viable cells / mL The cells were then resuspended in culture medium / Matrigel (1:1 v / v). The cells were then stored on ice prior to animal injection. The cells used in the in vivo studies had a viability of 96%.

[0175] Raji IV model: 20 animals were administered 0.2 mL of Raji IV fluid via the lateral tail vein. The cell suspension was injected IV through a 27-gauge needle (1 × 10 5 cell inoculum).

[0176] Raji SC model: 12 animals received 0.1 mL of Raji cell suspension on both flanks. The cells were then transplanted SC using a 25-gauge needle (2.5 × 10 5 cell inoculum).

[0177] Example 8: Experimental Procedure for CD19 t-haNK™ Test IV Raji model: Within 24 hours after cancer cell inoculation, defined as day 1, 20 animals were Animals were pseudo-randomized according to body weight into two groups of 10 to achieve similar mean body weights between groups. On days 2, 5, 8, 10, 12, and 17, exponentially grown CD19 t-haN K™ cells were harvested by centrifugation and administered at 1× per mouse with an injection volume of 200 μL. 10 7 For IV administration at a dose of 5 x 10 cells 7 At a concentration of cells / mL As shown in Table 6, animals in Group A received the vehicle control. Meanwhile, animals in group C received CD19 t-haNK™ cells.

[0178] Animals were weighed prior to tumor cell injection and twice weekly. Animals were assessed for mortality / morbidity (G0-G4) and toxicity. Patients were observed daily for clinical signs of paralysis or morbidity (T1-T12; see Table 6). Dead animals were euthanized. Animals were euthanized by CO2 inhalation followed by cervical dislocation. Mortality events (euthanasia or natural death) were recorded in the Death Log. The data were collected and survival curves were calculated.

[0179] SC Raji model: After SC tumor implantation, animals were examined at least twice weekly for tumor establishment. When tumors became palpable, tumor volumes (TVs) were measured weekly using a digital handheld caliper. Measure once or twice and use this formula: TV = length x width 2 / 2[Length is the maximum diameter of the tumor, width is The time when the mean tumor volume reached an injectable size (the shortest diameter) was calculated. In the case of 195 mm 3 24 days after implantation), 12 tumor-bearing animals were divided into 6 groups Groups were sham-randomized to achieve similar tumor volumes between groups, which was defined as day 0. 1, 4 On days 7, 9, 11, and 13, exponentially grown CD19 t-haNK (Trademark) ) Cells were harvested by centrifugation, subjected to 1000 cGy gamma irradiation, and injected in 200 μL 1 x 10 per mouse by volume 7 For IV administration at a dose of 5 x 10 cells 7 The cells were formulated in growth medium at a concentration of 100 cells / mL. Animals in group F received vehicle solution, while animals in group F were transfected with CD19 t-haNK™ cells. Animals were weighed prior to tumor cell injection and then twice weekly.

[0180] Animals were examined daily for mortality / morbidity (G0-G4) and clinical signs of toxicity (T1-T12). Animals were observed for 1 day. Paralyzed or moribund animals were euthanized. Moribund animals were euthanized as soon as they showed signs of morbidity. All animals were euthanized immediately, while surviving animals were subjected to scheduled euthanasia for tissue collection. Half of the surviving animals (maximum 3 mice / group) were randomly assigned to receive the test article on day 13, 6 hours after the last dose. The remaining animals were euthanized on day 15, 48 hours after the last dose. Euthanasia was performed by cervical dislocation while the animals were under deep anesthesia after the final intracardiac bleeding. Blood / serum samples were not analyzed in this part of the study and therefore not included in this report. I did not include it.

[0181] At termination, a dissection was performed and organs with visible gross lesions were removed and resected in 10% formalin. and transferred to an affiliated pathology laboratory (Seve) for histological assessment of tumor / metastatic disease burden. The data were submitted to the National Institute of Informatics (NII) at 100th Avenue, Nth Wave Laboratories.

[0182] [Table 8]

[0183] Example 9: Data analysis for the CD19 t-haNK™ study The formula is: tumor volume = length x width 2 / 2 (length and width are the longest and shortest lines of the tumor, respectively) Tumor volume was calculated using the CT scan (diameter).

[0184] Tumor growth inhibition (TGI) calculation was performed as follows: TGI = (T C -T t ) / ΔT C × 100% (where Tc and Tt are the average values ​​for the control and treated groups at the end of the study, respectively). where Tc is the mean tumor volume in the control group and ΔTc is the change in mean tumor volume in the control group).

[0185] Tumor growth curves were analyzed by two-way ANOVA followed by multiple comparisons with Tukey's test. Survival curves were analyzed by the log-rank (Mantel-Cox) test. Differences in hepatic metastatic disease burden were analyzed by unpaired two-tailed t-test. P<0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism version 7. The study was carried out using

[0186] Example 10: IV Raji model results for CD19 t-haNK™ testing The primary readout in the IV tumor model was animal survival. or when animals are euthanized due to disease-related morbidity and / or paralysis; Mortality events were counted. As shown in FIG. 9, compared to vehicle control, t-haNK™ cell treatment was able to significantly improve the survival rate of animals, with no significant improvement in the vehicle control group. The combination therapy resulted in a median survival of 27 days compared with 21.5 days in the control group (P<0.0001). Animal weight changes were also monitored throughout the study. As shown in FIG. t-haNK™ treated animals had moderate (<10%) and demonstrated short-term weight loss, a rare phenomenon in animals receiving IV NK infusions. These weights are not specific to CD19 t-haNK™ cells. It was possible for the phenotype to recover after the first week of treatment before declining again due to the initiation of treatment.

[0187] Example 11: SC Raji model results for CD19 t-haNK™ testing The primary readout in the SC tumor model was tumor growth. As shown in Figure 11 CD19 t-haNK™ cells were significantly more potent than the vehicle control group from day 7 onwards. Demonstrated clear and statistically significant tumor growth inhibition, with a TGI of 0.01 at the end of the study (day 13). The rate was 49%.

[0188] Furthermore, because Raji is an aggressive lymphoma model, even when inoculated SC, Cancer cells can disseminate and develop multiple metastatic sites, which ultimately lead to animal morbidity and / or mortality. In the vehicle group, the animals were moribund on days 11-13 and therefore had to be euthanized. In contrast, there were a total of 3 animals (50%) that were positive for CD19 t-haNK™. There were no unscheduled mortality events in the cell population (Table 7).

[0189] Furthermore, a qualitative reduction in liver metastases was observed in CD19 t-haNK™ treated animals during necropsy. A semiquantitative estimate of disease burden was obtained from representatively sampled The HE-stained liver sections were examined by the affiliated pathology laboratory (Seventh Wave Laboratories). As summarized in Figure 12b and Table 8, the study progressed. There was a clear trend of increasing disease burden with increasing age. The livers of treated animals showed a significantly lower percentage of carcinoma infiltrated area compared to vehicle controls. Due to the small sample size and unplanned early deaths in the control group, statistical analysis was limited to data from day 13. This analysis showed a significant difference in disease burden, with infiltration in CD19 t-haNK™ treated animals was 30% compared with 10% in CD19 t-haNK™ treated animals. The mean infiltration rate was 10%. Body weight changes were monitored throughout the study, and IV Ra Similar to the ji model, CD19 t-haNK™ treated animals showed moderate (<10%) ) and transient weight loss was demonstrated at the beginning of the treatment regimen (Figure 13).

[0190] [Table 9]

[0191] [Table 10]

[0192] Example 12: Conclusions of the CD19 t-haNK™ Study To evaluate the antitumor efficacy of CD19 t-haNK™ cells in a repeated IV dosing regimen To evaluate the efficacy and safety of IV and SC tumor inoculation, two Raji xenograft models were used. A variation of the above was utilized in this study. -haNK™ cells were able to significantly improve animal survival time, compared to the vehicle control group Median survival was increased by 5.5 days (an increase of 26%) in the SC tumor model. CD19 t-haNK™ cells were able to significantly suppress tumor growth, with 49% of tumors at the end of the study. Furthermore, CD19 t-haNK™ treatment reduced animal morbidity and mortality. / Reduced the number of death events (CD19 th in aNK™-treated animals), in the liver of SC Raji tumor-bearing animals In summary, CD19 t-haNK™ cells were able to significantly reduce metastatic disease burden. Cells were compared to vehicle controls in both variations of the Raji xenograft model. The results showed significant therapeutic efficacy.

[0193] Further embodiments in addition to those already described herein may be used without departing from the inventive concepts herein. It should be apparent to one of ordinary skill in the art that many variations are possible. The subject matter should not be limited except as provided in the appended claims. In interpreting both the scope of the present invention and the claims, all terms should be interpreted in the broadest possible light consistent with the context. In particular, the words "comprise" and "include "Comprising" refers non-exclusively to an element, component, or step. and the referenced element, component, or step may be present or They may be used or may include other elements, components, or It indicates that the present specification and claims can be combined with A, If the sentence refers to at least one of the group consisting of B, C... and N, A chapter requires only one element from the group, not A and N, B and N, etc. should be interpreted as:

Claims

1. 1. An NK-92 cell expressing a CD19 chimeric antigen receptor (CAR) and an Fc receptor, wherein said Fc receptor is CD16, said NK-92 cell comprising a multicistronic DNA construct, said multicistronic construct encoding said CD19 CAR comprising a first domain comprising a CD19-specific single chain variable fragment (scFv) fused to a second domain comprising a transmembrane domain having an amino acid sequence of amino acids 274-407 of SEQ ID NO:12 and a cytoplasmic signaling domain, said cytoplasmic signaling domain being Fc epsilon receptor gamma (FcεRIγ).

2. The NK-92 cell of claim 1, wherein the Fc receptor comprises SEQ ID NO:

2.

3. The NK-92 cell of claim 1, wherein the multicistronic construct further encodes IL-2, erIL-2, IL-15 or erIL-15.

4. 4. The NK-92 cell of claim 3, wherein the nucleic acids encoding one or more of the CD19 CAR, the Fc receptor and the erIL-15 or erIL-2 are codon-optimized for expression in a human system.

5. The NK-92 cell according to any one of claims 1 to 4, which is capable of killing CD19-expressing cells.

6. The NK-92 cell of claim 5, wherein the CD19-expressing cell is a tumor cell.

7. The NK-92 cell of claim 6, wherein the tumor cell is a SUP-B15 cell.

8. The NK-92 cell of claim 1, wherein the CD19 CAR comprises an scFv antibody fragment.

9. The NK-92 cell of claim 8, wherein the scFv antibody fragment has the amino acid sequence of SEQ ID NO:

10.

10. 2. The NK-92 cell of claim 1, comprising a sequence encoding a self-cleaving peptide, said sequence being located between said CD19 CAR and CD16, said sequence allowing equimolar expression of said CD19 CAR and said FcR.

11. 2. The NK-92 cell of claim 1, comprising an internal ribosome entry sequence (IRES) between the sequence encoding CD16 and the sequence encoding IL-2 or a variant thereof or the sequence encoding IL-15 or a variant thereof.

12. 2. The NK-92 cells of claim 1, wherein the direct cytotoxicity of said NK-92 cells against CD19 expressing cells is 70-100% at an effector to target ratio of 10.

13. 2. The NK-92 cell of claim 1, wherein the ADCC activity of the NK-92 cell is 30-90% when the effector to target ratio is 10.

14. A kit comprising a pharmaceutical composition comprising the NK-92 cells of claim 1.

15. 1. A method of generating an NK-92 cell, the method comprising providing a multicistronic vector encoding a CD19 CAR, and CD16, and IL-2 or IL-15, and introducing said vector into said NK-92 cell to generate said NK-92 cell.

16. 16. The method of claim 15, wherein the vector comprises a sequence encoding a self-cleaving peptide, said sequence being located between CAR and CD16, said sequence allowing equimolar expression of CAR and CD16.

17. The method of claim 15, wherein the vector comprises an internal ribosome entry sequence (IRES) between the CD16 coding sequence and the IL-2 or IL-15 coding sequence.

18. A pharmaceutical composition for treating cancer, comprising a plurality of NK-92 cells according to claim 1.

19. Subject's body surface area 1m ２ Approximately 1 x 10 per ８ ~Approx. 1×10 １１ The pharmaceutical composition of claim 18 , wherein the modified cells are administered to the subject.

20. The pharmaceutical composition of claim 18, wherein the cancer is leukemia or lymphoma.

21. 19. The pharmaceutical composition of claim 18, wherein the cancer is one or more of B-cell malignancies, B-cell malignancies post-HSCT, CLL, B-ALL, acute lymphoblastic leukemia (ALL), B-cell lineage lymphoid malignancies post-UCBT, chronic lymphocytic leukemia (CLL), B-non-Hodgkin's lymphoma (B-NHL), ALL post-HSCT; lymphoma, refractory follicular lymphoma, or lymphoblastic leukemia.

22. 22. The pharmaceutical composition of claim 21, wherein the B cell malignancy is mantle cell lymphoma.

23. The pharmaceutical composition of claim 18, wherein the plurality of NK-92 cells is administered intravenously.

24. The pharmaceutical composition of claim 18, wherein the plurality of NK-92 cells are administered intratumorally.

Images