Method for determining titer of RNA viral vector

Abstract

The present disclosure provides a method for rapidly assaying the titer of an RNA viral vector, such as a lentiviral vector. This method can be used to rapidly evaluate the titer of intermediate products in various steps of the lentiviral vector production process.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to Chinese Patent Application No. 2020109229562, filed on September 4, 2020, the entire contents of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. Said ASCII copy, created on September 2, 2021, is named 11299-009941-WO0_ST25.txt and is 2KB in size.

[0003] The present disclosure relates to a method for rapidly determining the titer of an RNA viral vector, such as a lentiviral vector. [Background technology]

[0004] Gene therapy refers to the introduction of an exogenous therapeutic gene into a target cell to correct or rectify a disease caused by a genetic defect or abnormality. Alternatively, the product expressed by the exogenous gene can act therapeutically on the therapeutic target.

[0005] Exogenous genes can be transduced or delivered via viral or non-viral vectors. Commonly used non-viral vectors include liposomes, dendrimers, non-natural cationic polymers, natural polysaccharides, etc. Although non-viral gene delivery vectors are relatively safe and stable, their transfection efficiency is usually low. Viral vectors can package foreign genes into the capsid of natural viruses and use the infectivity of the virus to introduce foreign genes into cells. Common viral vectors include retroviruses (recombinant retroviruses, rRV), recombinant lentiviruses (rLV), adenoviruses (recombinant adenoviruses, rAd), and adeno-associated viruses (recombinant adeno-associated viruses, rAAV). The transduction efficiency of viral vectors is much higher than that of non-viral vectors. Therefore, viral vectors are particularly suitable for infecting hard-to-infect target cells such as lymphocytes.

[0006] Recombinant lentiviral vectors can be based on HIV-1 (human immunodeficiency virus type I). Unlike other retroviral vectors, lentiviral vectors have the ability to infect both dividing and non-dividing cells. Recombinant lentiviral vectors have high biological titers and low immunogenicity in vivo and in vitro, making them the first-choice transgenic vectors for CAR-T cell and gene therapy.

[0007] Currently, the most common assays for determining the titer of recombinant lentiviral vectors include p24 Elisa and functional titer assays. The p24 Elisa takes one day to obtain results, while the latter requires at least seven days and can be non-specific. Summary of the Invention [Problem to be solved by the invention]

[0008] Therefore, there is an urgent need to develop methods for rapidly assessing the titer of lentiviral vectors. [Means for solving the problem]

[0009] The present disclosure provides a method for determining the titer of an RNA viral vector in a sample. The method includes the steps of: (a) providing a sample containing an RNA viral vector and a DNA molecule, or adding a DNA molecule to a sample containing an RNA viral vector, where both the RNA viral vector and the DNA molecule contain sequence elements; (b) obtaining a first part and a second part from the sample; and (c) performing a polymerase chain reaction (PCR) on the first part to determine the copy number (n1) of the sequence element in the first part, and performing a reverse transcription PCR (RT-PCR) on the second part to determine the copy number (n2) of the sequence element in the second part, where the RNA copy number of the RNA viral vector in the sample is determined by the difference between n1 and n2, i.e., n2-n1.

[0010] The method may further include a step (d) of determining the infectious titer of the RNA viral vector based on the RNA copy number of the RNA viral vector in the sample.

[0011] The method may further include a step (d) of determining the titer of the RNA viral vector based on the RNA copy number in the sample.

[0012] The RNA viral vector may be a retroviral vector, such as a lentiviral vector.

[0013] The sequence element may be a regulatory element, such as the Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (WPRE).

[0014] The sequence element may be a long terminal repeat (LTR) or a promoter.

[0015] PCR can use primer pairs to amplify regions of sequence elements.RT-PCR can use primer pairs to amplify regions of sequence elements.

[0016] PCR and RT-PCR can each use primer pairs to amplify a region of a sequence element.

[0017] The primer pair may comprise two primers comprising the nucleotide sequences set forth in: (i) SEQ ID NO:1 and SEQ ID NO:2, respectively; (ii) SEQ ID NO:3 and SEQ ID NO:4, respectively; or (iii) SEQ ID NO:5 and SEQ ID NO:6, respectively.

[0018] The PCR may be quantitative PCR (qPCR). The RT-PCR may be RT-qPCR (real-time quantitative reverse transcription PCR).

[0019] The DNA molecule may be a DNA plasmid. In one embodiment, the DNA plasmid is a packaging plasmid, an envelope plasmid, and / or a transfer plasmid.

[0020] In certain embodiments, the infectious titer of an RNA viral vector is determined by (RNA copy number of the RNA viral vector × infectious titer of the positive control) / RNA copy number of the positive control, where the positive control is an RNA viral vector with a known infectious titer.

[0021] The titer of the RNA viral vector can be determined within 2 hours.

[0022] The titer can be a physical titer or an infectious titer.

[0023] The present disclosure provides a method for rapidly determining the titer of an RNA viral vector (eg, a lentiviral vector).

[0024] A first aspect of the present disclosure provides a method for rapidly determining the titer (e.g., infectious titer or physical titer) of an RNA viral vector (e.g., lentiviral vector), the method comprising: (a) providing a sample to be tested, the sample comprising an RNA viral vector (e.g., lentiviral vector) and a DNA molecule (e.g., a DNA plasmid); (b) performing RT-PCR and PCR reactions on the sample to obtain the copy number of the sequence element (e.g., WPRE element) in the sample, including the RNA copy number of an RNA viral vector (e.g., lentiviral vector) containing the sequence element (e.g., WPRE element) and the copy number of a DNA molecule (e.g., DNA plasmid) containing the sequence element (e.g., WPRE element); and (c) determining the titer of an RNA viral vector (e.g., a lentiviral vector) based on the RNA copy number of an RNA viral vector (e.g., a lentiviral vector) containing a sequence element (e.g., a WPRE element) in the sample.

[0025] In one embodiment, the RNA copy number of the RNA virus vector (e.g., lentiviral vector) containing the sequence element (e.g., WPRE element) in the sample can be calculated using the following formula: the total copy number of the RNA virus vector (e.g., lentiviral vector) containing the sequence element (e.g., WPRE element) and the copy number of the DNA molecule (e.g., DNA plasmid) containing the sequence element (e.g., WPRE element) minus the copy number of the DNA molecule (e.g., DNA plasmid) containing the sequence element (e.g., WPRE element). The total copy number is obtained using RT-PCR, while the copy number of the DNA molecule is obtained using PCR.

[0026] The symbol "-" refers to subtraction to get the difference.

[0027] In one embodiment, "based on the RNA copy number of the RNA viral vector" in step (c) includes performing a calculation using formula Q1 to obtain the titer of the RNA viral vector (e.g., a lentiviral vector).

[0028] Q1 = (copy number of viral vector RNA in sample * titer of positive control) / copy number of viral vector RNA in positive control The positive control refers to an RNA virus vector (e.g., lentivirus vector) with a known titer (e.g., infectious titer or physical titer). The method of assaying the titer of the positive control and the RNA copy number of the positive control can be the same as the method of assaying those of the sample to be tested.

[0029] The RNA copy number of the RNA virus vector (e.g., lentivirus vector) in the sample to be tested can be obtained using the following formula: the total copy number of the RNA virus vector (e.g., lentivirus vector) containing sequence element (e.g., WPRE element) and the copy number of the DNA molecule (e.g., DNA plasmid) containing sequence element (e.g., WPRE element) minus the copy number of the DNA molecule (e.g., DNA plasmid) containing sequence element (e.g., WPRE element). The total copy number is obtained using RT-PCR, while the copy number of the DNA molecule is obtained using PCR.

[0030] In one embodiment, the titer is an infectious titer or a functional titer, hi another embodiment, the titer is a physical titer.

[0031] In certain embodiments, the sample tested is from or derived from an RNA viral vector (e.g., lentiviral vector) packaging supernatant, a purified intermediate product, or an end product in the research, development, and manufacturing process of an RNA viral vector (e.g., lentiviral vector).

[0032] In one embodiment, the PCR comprises real-time PCR, quantitative PCR, quantitative real-time PCR or qPCR. Quantitative PCR, for example, uses SYBR green dye (Thermo Fisher Scientific). qPCR can be real-time PCR using double-stranded DNA binding dye as reporter (non-specific detection). In one embodiment, the PCR is quantitative PCR using SYBR green dye. qPCR can be real-time PCR using fluorescent reporter probe method (specific detection). In one embodiment, the PCR is TaqMan real-time PCR.

[0033] In certain embodiments, the RT-PCR can be similar to the RT-qPCR described herein.

[0034] In one embodiment, a primer pair (e.g., an upstream primer and a downstream primer) is used in an RT-PCR reaction to specifically amplify a sequence element (e.g., a WPRE element) on an RNA viral vector (e.g., a lentiviral vector) and a DNA molecule (e.g., a DNA plasmid), thereby obtaining a cycle threshold (Ct) value for specifically amplifying a sequence element (e.g., a WPRE element) on an RNA viral vector (e.g., a lentiviral vector) and a DNA molecule (e.g., a DNA plasmid).

[0035] In one embodiment, an upstream primer and a downstream primer are used to amplify a sequence element (eg, a WPRE element) in a PCR or RT-PCR.

[0036] In certain embodiments, the upstream and downstream primers are as shown below.

[0037] Primer pair 1: Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO: 1); Downstream primer: acaacaccacggaattgtca (SEQ ID NO:2).

[0038] Primer pair 2: Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO:3); Downstream primer: gatgatttccccgacaacac (SEQ ID NO: 4).

[0039] Primer pair 3: Upstream primer: gtgttgtcggggaaatcatc (SEQ ID NO:5); Downstream primer: gagatccgactcgtctgagg (SEQ ID NO: 6).

[0040] In one embodiment, a primer pair (e.g., an upstream primer and a downstream primer) is used in a PCR reaction to specifically amplify a sequence element (e.g., a WPRE element) on a DNA molecule (e.g., a plasmid DNA), thereby obtaining a Ct value for specifically amplifying a sequence element (e.g., a WPRE element) on a DNA molecule (e.g., a plasmid DNA).

[0041] In certain embodiments, the upstream and downstream primers are as shown below.

[0042] Primer pair 1: Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO: 1); Downstream primer: acaacaccacggaattgtca (SEQ ID NO:2).

[0043] Primer pair 2: Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO:3); Downstream primer: gatgatttccccgacaacac (SEQ ID NO: 4).

[0044] Primer pair 3: Upstream primer: gtgttgtcggggaaatcatc (SEQ ID NO:5); Downstream primer: gagatccgactcgtctgagg (SEQ ID NO: 6).

[0045] In one embodiment, the copy number of a DNA molecule (eg, plasmid DNA) is obtained based on the Ct value of the specific amplification of a sequence element (eg, a WPRE element) of the DNA molecule (eg, plasmid DNA).

[0046] In certain embodiments, the copy number of the sequence element (eg, WPRE element) obtained after PCR is the same (or substantially the same) as the copy number of the DNA molecule (eg, plasmid DNA).

[0047] In certain embodiments, the copy number of the sequence element (e.g., the WPRE element) obtained after RT-PCR is identical (or substantially identical) to the sum of the RNA copy number of the RNA viral vector (e.g., lentiviral vector) and the copy number of the DNA molecule (e.g., plasmid DNA).

[0048] In one embodiment, the Ct values ​​of specific amplification of a sequence element (e.g., a WPRE element) on an RNA viral vector (e.g., a lentiviral vector) and a DNA molecule (e.g., a plasmid DNA) are used to calculate the total copy number of the RNA viral vector (e.g., a lentiviral vector) RNA and DNA molecule (e.g., a plasmid DNA) using formula Q2.

[0049] Q2=copy number of RNA and / or DNA=(copy number of nucleic acid of sample in each reaction well×1000×dilution factor) / amount of sample added to each reaction well.

[0050] Number of copies of sample nucleic acid in each reaction well = 10^ (aX+b) where X is the average of the Ct values ​​of the samples, a is the coefficient obtained by standard curve fitting, and b is the intercept obtained by standard curve fitting.

[0051] In one embodiment, the copy number of the RNA viral vector (e.g., lentiviral vector) RNA in the sample being tested is calculated using formula Q3 based on (i) the total copy number of the RNA viral vector (e.g., lentiviral vector) RNA and DNA molecules (e.g., plasmid DNA), and (ii) the copy number of the DNA molecule (e.g., plasmid DNA).

[0052] Q3 = total copy number of RNA viral vector (e.g., lentiviral vector) RNA and DNA molecules (e.g., plasmid DNA) - copy number of DNA molecules (e.g., plasmid DNA).

[0053] In one embodiment, the upstream and downstream primers used to specifically amplify a sequence element (eg, a WPRE element) are from the detection kit Lenti-X™ qRT-PCR Titration Kit (Takara).

[0054] In one embodiment, the DNA plasmid is or is derived from a packaging plasmid. In one embodiment, the DNA plasmid is or is derived from an envelope plasmid. In one embodiment, the DNA plasmid is or is derived from a transfer plasmid.

[0055] In one embodiment, the method also uses a positive control.

[0056] In one embodiment, the method is a non-diagnostic and non-therapeutic method.

[0057] In one embodiment, the method is an in vitro method.

[0058] In one embodiment, the concentration of an RNA viral vector (e.g., a lentiviral vector) in a sample to be tested is 5×10 5 ~5×10 9 Transducing units / ml (TU / ml), 1 x 10 6 ~8×10 8TU / ml, or 5 × 10 6 ~5×10 8 It is in TU / ml.

[0059] It should be understood that within the scope of the present disclosure, the above technical features and the technical features specifically described below (such as embodiments) can be combined with each other to form new or preferred technical solutions. [Brief description of the drawings]

[0060] [Figure 1] The preparation process of serial dilutions of lentivirus standards (with known copy numbers; left panel) and samples (right panel) is shown. In the left panel, the lentivirus standard provided by the kit had a concentration of 5×108 copies / μl. First, 2 μl of 5×108 copies / μl lentivirus standard was transferred to a clean EP tube, then 18 μl of EASY dilution buffer was added and mixed thoroughly. Then, 3 μl of the mixed solution (with a concentration of 5×107 copies / μl) was added to 27 μl of EASY dilution buffer and mixed thoroughly. Five lentivirus standard concentrations were prepared according to the above procedure. NTC was only EASY dilution buffer. The right panel shows the dilution process of the samples to be tested. [Diagram 2] qPCR parameters, showing temperature and time settings. [Diagram 3] The standard curve is plotted on the x-axis of the average Ct value obtained from the serial dilution samples of the lentivirus standard and on the y-axis of the logarithm (base 10) of the corresponding copy number of the lentivirus standard. The calculation formula was: y=-0.5883x+10.97, and R2=0.9999 was obtained. From this formula, it can be seen that in this detection method, the logarithm of the lentivirus RNA copy number had a good linear correlation with the corresponding Ct value. The test method was stable and reliable. The standard curve can be used to calculate the copy number of the lentivirus sample. [Figure 4]1 shows the dissociation curves of the products obtained by specific amplification of the WPRE element and plasmid DNA using the upstream and downstream primers described herein. The dissociation curves have a single sharp peak, indicating that the primers have good specificity. [Diagram 5] Amplification curves of real-time quantitative PCR reactions. The amplification curves were essentially parallel with similar / identical slopes, indicating consistent efficiency of the primers. There was no PCR-inhibiting contamination in the reaction wells (except for the NTC curve). [Figure 6] A reaction tube (RT-PCR) and a control tube (PCR) are set up, in which RT-PCR and PCR reactions are performed, respectively. The copy number of nucleic acid can be calculated by absolute quantification. The copy number of nucleic acid (RNA+DNA) of the sample in the reaction tube (RT-PCR) is denoted as n2 (total copy number of nucleic acid). The copy number of nucleic acid (DNA, e.g., plasmid DNA) in the control tube is denoted as n1 (copy number of DNA), and n2-n1=RNA copy number of RNA virus vector (e.g., lentivirus vector). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0061] The present disclosure provides a method for determining the titer of an RNA viral vector in a sample. The method includes the steps of: (a) providing a sample containing an RNA viral vector and a DNA molecule, or adding a DNA molecule to a sample containing an RNA viral vector, where both the RNA viral vector and the DNA molecule contain sequence elements; (b) obtaining a first part and a second part from the sample; and (c) performing a polymerase chain reaction (PCR) on the first part to determine the copy number (n1) of the sequence element in the first part, and performing a reverse transcription PCR (RT-PCR) on the second part to determine the copy number (n2) of the sequence element in the second part, where the RNA copy number of the RNA viral vector in the sample is determined by the difference between n1 and n2, i.e., n2-n1.

[0062] The method may further include a step (d) of determining the infectious titer of the RNA viral vector based on the RNA copy number of the RNA viral vector in the sample.

[0063] The method may further include a step (d) of determining the titer of the RNA viral vector based on the RNA copy number in the sample.

[0064] The RNA viral vector may be a retroviral vector, such as a lentiviral vector.

[0065] The sequence element may be a regulatory element, such as the Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (WPRE).

[0066] The sequence element may be a long terminal repeat (LTR) or a promoter.

[0067] PCR can use primer pairs to amplify regions of sequence elements.RT-PCR can use primer pairs to amplify regions of sequence elements.

[0068] PCR and RT-PCR can each use a primer pair to amplify a region of a sequence element.

[0069] The primer pair may comprise two primers comprising the nucleotide sequences set forth in: (i) SEQ ID NO:1 and SEQ ID NO:2, respectively; (ii) SEQ ID NO:3 and SEQ ID NO:4, respectively; or (iii) SEQ ID NO:5 and SEQ ID NO:6, respectively.

[0070] The PCR may be quantitative PCR (qPCR). The RT-PCR may be RT-qPCR.

[0071] The DNA molecule may be a DNA plasmid. In one embodiment, the DNA plasmid is a packaging plasmid, an envelope plasmid, and / or a transfer plasmid.

[0072] In certain embodiments, the infectious titer of an RNA viral vector is determined by (RNA copy number of the RNA viral vector × infectious titer of the positive control) / RNA copy number of the positive control, where the positive control is an RNA viral vector with a known infectious titer.

[0073] The titer of the RNA viral vector can be determined within 2 hours.

[0074] The titer can be a physical titer or an infectious titer.

[0075] Physical titer measures the amount of virus particles in a sample and may be based on the presence of viral nucleic acid or viral proteins, such as p24. Functional titer or infectious titer measures how many of the viral particles produced can actually infect cells. Assays for infectious titer may include infecting a target cell line with the virus and assaying for gene expression or quantifying the number of viral copies integrated into the genome of the target cell.

[0076] In certain embodiments, physical titer can be evaluated based on viral RNA copy number.In one embodiment, physical titer is viral RNA copy number per ml or per μl.Physical titer can be determined by quantitative PCR, for example, by using SYBR green dye or by TaqMan PCR.The viral genome copy number in 1 ml sample can be calculated from a standard curve generated from serial dilutions of standard nucleic acid (for example, RNA virus standard such as RNA standard, lentivirus standard, etc.) with known copy number.

[0077] In certain embodiments, the infectious titer can be determined based on the infectious unit determined by proviral integration titer assay.For example, the infectious titer can be determined through the transduction of cells with serial dilutions of RNA virus vector and the calculation of the copy of integrated vector per cell by quantitative PCR (e.g., TaqMan PCR).

[0078] In certain embodiments, for biosafety reasons, the RNA viral genome (e.g., lentiviral genome) is modified such that the cis- and trans-acting viral sequences are separated across three to four different plasmids. For example, viral structural and functional proteins may be provided in trans and encoded by one or two packaging plasmids, while an envelope plasmid encodes the glycoprotein of the vesicular stomatitis virus envelope (VSV-G) and a transfer plasmid encodes the transgene of interest flanked by all the cis-acting viral sequences required for packaging of the RNA genome. Creation of lentiviral vectors may be achieved by transient transfection of cells, e.g., human embryonic kidney (293T) cells, using high concentrations of various plasmids, meaning that even after concentration, there is residual plasmid DNA in the vector preparation.

[0079] In certain embodiments, the RNA virus vector (e.g., lentivirus vector) sample may also contain DNA molecules (e.g., plasmid DNA). In certain embodiments, the RNA virus vector (e.g., lentivirus vector) sample does not contain DNA molecules (e.g., plasmid DNA).

[0080] In certain embodiments, the method may include adding a DNA molecule to a sample containing an RNA viral vector. When added to the sample, the DNA molecule is about 10 2 Copies / μl ~ approx. 10 8 Copies / μl, approximately 10 3 Copies / μl ~ approx. 10 8 Copies / μl, approximately 10 4 Copies / μl ~ approx. 10 8 Copies / μl, approximately 10 5 Copies / μl ~ approx. 10 8 Copies / μl, approximately 10 6 Copies / μl ~ approx. 10 8 Copies / μl, approximately 10 3 Copies / μl ~ approx. 10 7 Copies / μl, approximately 10 4Copies / μl ~ approx. 10 7 Copies / μl, approximately 10 5 Copies / μl ~ approx. 10 7 Copies / μl, approximately 10 6 Copies / μl ~ approx. 10 7 Copies / μl, approximately 10 3 Copies / μl ~ approx. 10 6 Copies / μl, approximately 10 4 Copies / μl ~ approx. 10 6 Copies / μl, approximately 10 5 Copies / μl ~ approx. 10 6 Copies / μl, approximately 10 2 Copies / μl ~ approx. 10 3 Copies / μl, approximately 10 2 Copies / μl ~ approx. 10 4 Copies / μl, approximately 10 2 Copies / μl ~ approx. 10 5 Copies / μl, approximately 10 2 Copies / μl ~ approx. 10 6 Copies / μl, approximately 10 3 Copies / μl ~ approx. 10 4 Copies / μl, approximately 10 3 Copies / μl ~ approx. 10 5 Copies / μl, approximately 10 3 Copies / μl ~ approx. 10 6 Copies / μl, approximately 10 4 Copies / μl ~ approx. 10 7 Copies / μl, approximately 10 4 Copies / μl ~ approx. 10 6 Copies / μl, approximately 10 4 Copies / μl ~ approx. 10 5 It may have a concentration in the range of copies / μl.

[0081] In certain embodiments, the titer (infectious titer or physical titer) of the RNA viral vector is equal to (the number of RNA copies in the sample * the titer of the positive control) / the number of RNA copies of the positive control, where the positive control is an RNA viral vector with a known titer (infectious titer or physical titer). The symbol "*" refers to multiplication. The symbol " / " refers to division.

[0082] The present disclosure provides a method for determining the titer of RNA virus vector (for example, lentivirus vector) in sample.This method can include: (a) providing a sample that comprises RNA virus vector (for example, lentivirus vector) and free plasmid DNA; (b) carrying out RT-PCR and PCR reaction on the sample to obtain the copy number of WPRE element in sample, including the copy number of lentivirus vector RNA that contains WPRE element and the copy number of free plasmid DNA that contains WPRE element; and (c) determining the titer of lentivirus vector based on the copy number of lentivirus vector RNA.

[0083] The method offers several advantages: The method can rapidly determine the titer of an RNA viral vector (e.g., a lentiviral vector), for example, within 2 hours.

[0084] It can be used to rapidly and quantitatively evaluate the titer of intermediate products in the RNA viral vector (e.g., lentiviral vector) production process, and can help control the amount of the final product of the viral vector. The sequence elements (e.g., WPRE elements) can be amplified by quantitative methods, such as RT-PCR. The copy number of DNA molecules (e.g., plasmid DNA) and the copy number of RNA viral vector (e.g., lentiviral vector) RNA in the sample can be determined. By subtracting the copy number of DNA molecules (e.g., plasmid DNA) from the total copy number of DNA molecules (e.g., plasmid DNA) and RNA viral vector (e.g., lentiviral vector) RNA, the titer of the RNA viral vector (e.g., lentiviral vector) can be rapidly and specifically determined. In addition, the experimental design and operation of this method are simple, so the assay of the titer of the RNA viral vector (e.g., lentiviral vector) can be performed quickly, efficiently and specifically within 2 hours. This method can calculate the titer of the sample using the titer of the positive control, which is helpful for quickly adjusting the amount of the viral vector. This method provides simple operation steps, short detection time, fast feedback of the detection result, and reliable results. It is highly suitable for determining the titer of an RNA viral vector (eg, a lentiviral vector) at various stages of the development or production process of the RNA viral vector (eg, a lentiviral vector).

[0085] In a specific embodiment, RT-PCR and PCR are performed on the sample containing RNA viral vector, respectively. RT-PCR amplifies both vector RNA and DNA, while PCR (without reverse transcriptase) amplifies only DNA. The copy number of viral vector (RNA) can be calculated by (i) the total copy number of viral vector (RNA) and DNA (e.g., plasmid DNA) containing sequence element (e.g., WPRE element) obtained by RT-PCR, and (ii) the copy number of DNA (e.g., plasmid DNA) containing sequence element (e.g., WPRE element) obtained by PCR.

[0086] Based on the RNA copy number of an RNA viral vector (e.g., a lentiviral vector) in a sample, the titer (e.g., an infectious titer) of the RNA viral vector (e.g., a lentiviral vector) can be determined.

[0087] In addition, the method can substantially reduce non-specific interference from plasmid or other nucleic acid, and can achieve rapid quantification.In addition, the method can provide specific quantification results within 2 hours, which can be used to rapidly and quantitatively evaluate the titer of intermediate products in the lentiviral vector production process.In addition, in practice, the physical titer or functional titer of final products can be controlled.

[0088] The term "vector" is used herein to refer to a nucleic acid molecule that can transfer or transport another nucleic acid molecule. The transferred nucleic acid is generally linked, e.g., inserted, into the vector nucleic acid molecule. The vector may contain sequences that direct autonomous replication in the cell, or may contain sequences sufficient to allow integration into the host cell DNA. Useful vectors include, for example, plasmids (e.g., DNA or RNA plasmids), transposons, cosmids, bacterial artificial chromosomes, and viral vectors. Useful viral vectors include, for example, retroviruses and lentiviruses.

[0089] The term "viral vector" is used broadly to refer to either a nucleic acid molecule (e.g., transfer plasmid) that typically contains a virus-derived nucleic acid element that facilitates the transfer or integration of the nucleic acid molecule into the genome of a cell, or a viral particle that mediates nucleic acid transfer. In addition to the nucleic acid, the viral particle may also contain various viral and sometimes host cell components. The term "viral vector" may refer to either a virus or viral particle that can transfer a nucleic acid into a cell, or the transferred nucleic acid itself. Viral vectors and transfer plasmids contain structural and / or functional genetic elements that are primarily derived from viruses.

[0090] Cycle threshold (Ct) can refer to the cycle number at which a significant increase in fluorescence above a baseline signal is detected.

[0091] The term "about" in reference to a numerical value refers to ±10% of the stated numerical value. In other words, the numerical value may range from 90% of the stated value to 110% of the stated value.

[0092] RNA viruses and retroviruses An RNA virus is a virus that has RNA (ribonucleic acid) as its genetic material.

[0093] The nucleic acid can be single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA).

[0094] RNA viruses include, but are not limited to, Astroviridae, Caliciviridae, Picornaviridae, Coronaviridae, Retroviridae, Togaviridae, Alphatetraviridae, Birnaviridae, Cystoviridae, Nodaviridae, and Permtretolaviridae and Flaviviridae. As examples, the Astroviridae family includes human Astrovirus, the Caliciviridae family includes Norwalk virus, the Picornaviridae family includes Coxsackieviruses, Hepatitis A virus, polioviruses, rhinoviruses, bymoviruses, comoviruses, nepoviruses, nodaviruses, picornaviruses, potyviruses, sobemoviruses, and a subset of Luteoviruses (such as Beet Western Yellows Virus and Potato Leaf Curl Virus), the Coronaviridae family includes coronaviruses and SAR viruses, the Retroviridae family includes alpharetroviruses, betaretroviruses, deltaretroviruses, lentiviruses, and spumaviruses, the Togaviridae family includes rubella virus and alphaviruses, and the Flaviviridae family includes Hepatitis C virus, flaviviruses, carmoviruses, dianthoviruses, pestiviruses, statoviruses, tombusviruses, single-stranded RNA bacteriophages, and a subset of Luteoviruses (Barley yellow dwarf virus).

[0095] In certain embodiments, the RNA virus can be a Coronaviridae virus, a Pneumoviridae virus, a Paramyxoviridae virus, a Picornaviridae virus, or an Orthomyxoviridae virus. In certain embodiments, the Coronaviridae virus is a coronavirus or SARS, the Pneumoviridae virus is a human respiratory syncytial virus (HRSV), the Paramyxoviridae virus is a human parainfluenza virus, a measles virus, or a mumps virus, the Picornaviridae virus is a rhinovirus, and the Orthomyxoviridae virus is an influenza virus. In certain embodiments, the RNA virus is a Pneumoviridae virus. In one embodiment, the RNA virus is an HRSV.

[0096] Non-limiting examples of RNA viruses include human respiratory syncytial virus, Ebola virus, coronavirus, rhinovirus, parainfluenza virus, human immunodeficiency virus, rotavirus, picobirnavirus, bluetongue virus, alphavirus, caravirus, furovirus, hordeivirus, potexvirus, rubivirus, tobravirus, tricornavirus, tymovirus, apple chlorotic leaf spot virus, beet yellows virus, hepatitis E virus, selyvirus, deltavirus, emaravirus, higrevirus, idaevirus, urmiavirus, polemovirus, sobemovirus, tenuivirus, umbravirus, varicosavirus, etc. RNA viruses can be from viral orders such as Mononegavirales, Nidovirales, Picornavirales, and Tymovirales.

[0097] Retroviruses Retroviruses are RNA viruses that reverse transcribe their genomic RNA into a DNA copy and then integrate the DNA into the host genome. Once the virus is integrated into the host genome, it is called a provirus. The provirus serves as a template for RNA polymerase to direct the expression of RNA molecules that code for the structural proteins and enzymes required to make new virus particles.

[0098] The family Retroviridae can be divided into two subfamilies, Orthoretrovirinae and Spumaretrovirinae. The Orthoretrovirinae includes the following genera: Alpharetroviruses (such as Avian Leukosis Virus and Rous Sarcoma Virus); Betaretroviruses (such as Mouse Mammary Tumor Virus); Gammaretroviruses (such as Murine Leukemia Virus and Feline Leukemia Virus); Deltaretroviruses (such as Bovine Leukemia Virus and Cancer-causing Human T-Lymphotropic Virus); Epsilonretroviruses; and Lentiviruses (such as Human Immunodeficiency Virus Type 1 and Simian and Feline Immunodeficiency Viruses). The Spumaretrovirinae includes the following genera: Bovispumavirus; Equispumavirus; Felispumavirus; Prosimiispumavirus; and Simiispumavirus.

[0099] Non-limiting examples of retroviruses include Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), mouse mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, murine stem cell virus (MSCV) and Rous sarcoma virus (RSV) and lentiviruses.

[0100] The term "retroviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or portions thereof, primarily derived from a retrovirus. The terms "retroviral vector" and "retrovirus" may be used interchangeably.

[0101] As used herein, the term "retrovirus" or "retroviral vector" is meant to include "lentivirus" and "lentiviral vector."

[0102] Lentivirus Lentiviruses include, but are not limited to, HIV (human immunodeficiency virus; including HIV types 1 and 2); visnamaedivirus (VMV); caprine arthritis-encephalitis virus (CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immunodeficiency virus (BIV); and simian immunodeficiency virus (SIV). The term "lentiviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or parts thereof that are primarily derived from lentiviruses, including long terminal repeats (LTRs). In certain embodiments, the term "lentiviral vector" can be used to refer to lentiviral transfer plasmids and / or infectious lentiviral particles.

[0103] The terms "lentiviral vector" and "lentivirus" may be used interchangeably.

[0104] Array elements PCR or RT-PCR may use primers targeted to sequence elements to amplify sequence elements, including specific viral components, cloning sites, promoters, control elements, regulatory elements, heterologous nucleic acids (e.g., the transgene itself), and the like.

[0105] Non-limiting examples of sequence elements include LTR, WPRE, promoters, etc. Promoters include CMV promoter, U6 promoter, PGK promoter, etc.

[0106] When sequence elements are referred to herein, it is to be understood that the sequences of these elements are present in RNA form in an RNA viral vector or RNA virus (e.g., a lentiviral vector or lentivirus) and in DNA form in a DNA molecule (e.g., a plasmid).

[0107] "Control elements" or "regulatory elements" can be untranslated regions of a vector, such as origins of replication, selection cassettes, promoters, enhancers, translation initiation signals (e.g., Shine-Dalgarno sequences, Kozak sequences), introns, polyadenylation sequences, 5' and 3' untranslated regions, which interact with host cell proteins to effect transcription and / or translation.

[0108] In certain embodiments, the sequence element may be a regulatory element, such as a post-transcriptional regulatory element, a polyadenylation site, a transcription termination signal, etc. In certain embodiments, the sequence element may be a Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (WPRE). In certain embodiments, the sequence element may be a post-transcriptional regulatory element present in Hepatitis B virus (HPRE). In certain embodiments, expression of a heterologous sequence in a viral vector is increased by incorporating a post-transcriptional regulatory element, an efficient polyadenylation site, and optionally a transcription termination signal into the vector. Various post-transcriptional regulatory elements, such as the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE; Zufferey et al., 1999, J. Virol., 73:2886); the post-transcriptional regulatory element present in the Hepatitis B virus (HPRE) (Huang et al., Mol. Cell. Biol., 5:3864); and others (Liu et al., 1995, Genes Dev., 9:1766), can increase the expression of heterologous nucleic acids in proteins. In certain embodiments, the vectors of the invention comprise a post-transcriptional regulatory element, such as a WPRE or HPRE.

[0109] For example, WPRE can refer to a region similar to the human hepatitis B virus posttranscriptional regulatory element (HBVPRE) present in the woodchuck hepatitis virus genome sequence (GenBank accession number J04514), and the 592 nucleotides from positions 1093 to 1684 of this genome sequence correspond to the posttranscriptional regulatory region (Journal of Virology, Vol. 72, p. 5085-5092, 1998). Analysis using retroviral vectors revealed that WPRE inserted into the 3'-end untranslated region of a gene of interest increases the amount of protein produced. It has also been reported that introduction of WPRE suppresses mRNA degradation (Journal of Virology, Vol. 73, p. 2886-2892, 1999).

[0110] In certain embodiments, the sequence element may be a regulatory element, such as an intron, an enhancer element, etc. Regulatory sequences useful herein may also include introns, such as those located between the promoter / enhancer sequence and the coding sequence. One exemplary intron sequence is derived from SV40 and is referred to as the SV40 intron.

[0111] Other enhancer elements that can be used in the vector include, for example, ubiquitin enhancers and CMB enhancers. Additional regulatory elements that can be used include, for example, aptazymes, miRNAs and miRNA-binding elements.

[0112] In certain embodiments, the sequence element can be an LTR. At each end of the provirus is a structure called "long terminal repeat" or "LTR". The term "long terminal repeat (LTR)" refers to a domain of base pairs located at the end of retroviral DNA that is a direct repeat in the context of their natural sequence and includes the U3, R and U5 regions. LTRs generally provide essential functions for retroviral gene expression (e.g., promotion, initiation and polyadenylation of gene transcripts) and viral replication. LTRs contain a number of regulatory signals, including transcriptional control elements, polyadenylation signals, and sequences required for viral genome replication and integration. Viral LTRs are divided into three regions called U3, R and U5. The U3 region contains enhancer and promoter elements.

[0113] The U5 region is the sequence between the primer binding site and the R region, and contains the polyadenylation sequence. The R (repeat) region is adjacent to the U3 and U5 regions. The LTR is composed of the U3, R and U5 regions, and appears at both the 5' and 3' ends of the viral genome. Adjacent to the 5'LTR are sequences required for reverse transcription of the genome (tRNA primer binding site) and efficient packaging of viral RNA into particles (Psi site). In various embodiments, the vector comprises a modified 5'LTR and / or 3'LTR. Either or both of the LTRs may contain one or more modifications, including, but not limited to, one or more deletions, insertions or substitutions. Modifications of the 3'LTR are often made to improve the safety of lentiviral or retroviral systems by rendering the virus replication-defective. "Self-inactivating" (SIN) vector refers to a replication-deficient vector, e.g., a retroviral or lentiviral vector, in which the right (3') LTR enhancer promoter region, known as the U3 region, is modified (e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication. This is because the right (3') LTR U3 region is used as a template for the left (5') LTR U3 region during viral replication, and thus viral transcripts cannot be made without the U3 enhancer promoter. In a further embodiment, the 3'LTR is modified such that the U5 region is replaced, e.g., with an ideal poly(A) sequence. It should be noted that modifications to the LTR, e.g., modifications to the 3'LTR, 5'LTR, or both the 3' and 5'LTR, are also included in the present disclosure.

[0114] Safety is further enhanced by replacing the U3 region of 5'LTR with a heterologous promoter to drive the transcription of viral genome during the production of viral particles.Examples of heterologous promoters that can be used include, for example, viral Simian Virus 40 (SV40) (e.g., early or late), cytomegalovirus (e.g., immediate early), Moloney-murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus (HSV) (thymidine kinase) promoters.Typical promoters can drive high-level transcription in a Tat-independent manner.Since the complete U3 sequence does not exist in the virus production system, this replacement reduces the possibility of recombination to generate replication-competent virus.

[0115] In certain embodiments, the sequence element may be a packaging sequence. As used herein, the term "packaging signal" or "packaging sequence" refers to a sequence located in a retroviral genome that is necessary for inserting viral RNA into a viral capsid or particle, see, for example, Clever et al., 1995.J.of Virology, Vol.69, No.4; pp.2101-2109. Some retroviral vectors use a minimal packaging signal (also called psi [ψ] sequence) that is necessary for encapsidation of the viral genome. Thus, as used herein, the terms "packaging sequence", "packaging signal", "psi" and the symbol "ψ" are used in reference to the non-coding sequence that is necessary for encapsidation of retroviral RNA strands during viral particle formation.

[0116] In certain embodiments, the sequence element can be a TAR element. In certain embodiments, the viral vector comprises a TAR element, which can be a sequence element. The term "TAR" refers to the "transactivation response" genetic element located in the R region of lentivirus (e.g., HIV) LTR. This element interacts with the lentivirus transactivator (tat) genetic element to enhance viral replication.

[0117] In certain embodiments, the sequence element can be an R region. "R region" refers to the region in retroviral LTR that begins at the beginning of the capping group (i.e., the beginning of transcription) and ends just before the beginning of polyA tract. R region is also defined as adjacent to U3 and U5 regions. R region plays a role in moving nascent DNA from one end of genome to the other during reverse transcription.

[0118] In certain embodiments, the sequence element may be a FLAP element. As used herein, the term "FLAP element" refers to a nucleic acid, the sequence of which comprises the central polypurine tract and central termination sequence (cPPT and CTS) of a retrovirus, such as HIV-1 or HIV-2. Suitable FLAP elements are described in U.S. Patent No. 6,682,907, and Zennou, et al., 2000, Cell, 101:173. During reverse transcription of HIV-1, the central initiation of the positive strand DNA at the central polypurine tract (cPPT) and the central termination at the central termination sequence (CTS) result in the formation of a triple-stranded DNA structure: the HIV-1 central DNA flap. In certain embodiments, the retroviral or lentiviral vector backbone comprises one or more FLAP elements upstream or downstream of the heterologous gene of interest in the vector. For example, in certain embodiments, the transfer plasmid comprises a FLAP element. In one embodiment, the vector of the present disclosure comprises a FLAP element isolated from HIV-1.

[0119] In certain embodiments, the sequence element can be an export element. In one embodiment, the retroviral or lentiviral transfer vector comprises one or more export elements. The term "export element" refers to a cis-acting post-transcriptional regulatory element that regulates the transport of RNA transcripts from the nucleus to the cytoplasm of a cell. Examples of RNA export elements include, but are not limited to, the human immunodeficiency virus (HIV) rev response element (RRE) (see, for example, Cullen et al., 1991. J. Virol. 65:1053; and Cullen et al., 1991. Cell 58:423) and the hepatitis B virus post-transcriptional regulatory element (HPRE). In general, the RNA export element is located in the 3'UTR of a gene and can be inserted as one or more copies.

[0120] In certain embodiments, the sequence element can be a transcription termination signal or a polyadenylation sequence. Elements that direct efficient termination and polyadenylation of heterologous nucleic acid transcripts increase heterologous gene expression. Transcription termination signals are generally found downstream of polyadenylation signals. In certain embodiments, the vector comprises a polyadenylation sequence 3' of the polynucleotide that encodes the polypeptide to be expressed. The term "poly A site" or "poly A sequence" as used herein refers to a DNA sequence that directs both the termination and polyadenylation of nascent RNA transcripts by RNA polymerase II. Polyadenylation sequences can promote mRNA stability by adding a poly A tail to the 3' end of the coding sequence, thus contributing to improved translation efficiency. Illustrative examples of poly A signals include ideal poly A sequences (e.g., AATAAA, ATTAAA, AGTAAA), bovine growth hormone poly A sequence (BGHpA), rabbit beta globin poly A sequence (rβgpA), or another suitable heterologous or endogenous poly A sequence known in the art. Polyadenylation sequences also include SV40 poly A, bGH poly A, and synthetic poly A tails.

[0121] In certain embodiments, the sequence element can be an insulator element. In certain embodiments, the retroviral or lentiviral vector further comprises one or more insulator elements. The insulator element can contribute to protect the lentiviral expression sequence, e.g., therapeutic polypeptide, from integration site effects (i.e., position effects; see, e.g., Burgess-Beusse et al., 2002, Proc. Natl. Acad. Sci., USA, 99:16433; and Zhan et al., 2001, Hum. Genet., 109:471), which are mediated by cis-acting elements present in genomic DNA and can result in deregulation of the expression of the transferred sequence. In some embodiments, the transfer vector comprises one or more insulator elements in the 3'LTR, and when the provirus is integrated into the host genome, the provirus comprises one or more insulators in both the 5'LTR or 3'LTR by duplicating the 3'LTR. Insulators suitable for use in the present invention include, but are not limited to, chicken beta globin insulator (see Chung et al., 1993.Cell 74:505; Chung et al., 1997.PNAS 94:575; and Bell et al., 1999.Cell 98:387, which are incorporated herein by reference).Examples of insulator elements include, but are not limited to, the insulator from beta globin locus, such as chicken HS4.

[0122] In certain embodiments, the sequence element may be a heterologous nucleic acid, such as an antibiotic resistance gene, GFP (green fluorescent protein), a transgene, etc.

[0123] It should be understood that various sources of retroviral and / or lentiviral sequences can be used or combined, and many substitutions and changes in a certain lentiviral sequence can be accommodated without impairing the ability of transfer vector to perform the functions described herein.In addition, various lentiviral vectors are known in the art, and many of them can be adapted to make the viral vector or transfer plasmid of the present disclosure.See Naldini et al., (1996a, 1996b, and 1998); Zufferey et al., (1997); Dull et al., 1998, U.S. Patent No. 6,013,516; and 5,994,136.

[0124] RT-PCR RT-PCR (reverse transcription-polymerase chain reaction) is a technique that combines reverse transcription (RT) of RNA and polymerase chain amplification (PCR) of cDNA. First, cDNA is synthesized from RNA by reverse transcriptase, and then the target fragment is amplified and synthesized by DNA polymerase using the cDNA as a template. RT-PCR technology is highly sensitive and versatile, and can be used to detect gene expression levels in cells and the content of RNA viruses in cells or culture supernatants. In certain embodiments, the RT-PCR reaction system may include primers, reverse transcriptase, PCR enzyme, buffer, dNTPs and other components.

[0125] In RT-PCR, viral RNA is first converted to cDNA and then quantified using PCR (e.g., real-time PCR, quantitative PCR or qPCR).

[0126] In the present disclosure, RT-PCR can be used to detect both DNA and RNA in the same sample.

[0127] In one embodiment, a reaction tube and a control tube are provided. The reaction tube contains the sample to be tested and all the reaction systems of RT-PCR. The control tube contains the same sample as the reaction tube and PCR reaction system (e.g., RT-PCR reaction system except reverse transcriptase). In the reaction tube, both RNA and DNA are amplified to obtain the Ct value of the specifically amplified sequence element (e.g., WPRE element). The copy number calculated for the reaction tube is the RNA copy number of the RNA virus vector (e.g., lentivirus vector) + the copy number of the DNA molecule (e.g., plasmid DNA).

[0128] In the control tube, without reverse transcriptase, the RNA of the RNA viral vector (e.g., lentiviral vector) cannot be amplified, and only the DNA molecule (e.g., plasmid DNA) is amplified to obtain the Ct value of a specific amplified sequence element (e.g., WPRE element). The copy number obtained therefrom is the DNA copy number of the DNA molecule (e.g., plasmid DNA). Then, the RNA copy number of the RNA viral vector (e.g., lentiviral vector) can be obtained by subtracting the copy number of the DNA in the control tube (n1) from the copy number of the RNA and DNA in the reaction tube (n2), i.e., n2-n1=RNA copy number of the RNA viral vector (e.g., lentiviral vector) (shown in Figure 6).

[0129] Positive control The positive control can be a viral vector (e.g., an RNA viral vector such as a lentiviral vector) with known titer, infectious titer or physical titer (e.g., LV-CAR001 available from Shanghai CBMG Biotechnology Co., Ltd.).

[0130] In certain embodiments, the positive control also includes DNA and RNA, and the method of calculating copy number and titer of the positive control is the same as that of the sample being tested.

[0131] The present invention can be better understood by referring to the following non-limiting examples, which are presented to more fully describe the preferred embodiments of the present invention. The present disclosure will be further described below in relation to certain specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention, and are not used to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually based on the corresponding conventional conditions, such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or follow the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0132] Unless otherwise stated, all reagents and materials used in the examples of this disclosure are commercially available.

[0133] [Example 1] Equipment: Quantstudio (trademark) DX (ABI) 1. Reagent Preparation The experiment was carried out on ice. A sufficient volume of master reaction mixture (MRM) was prepared. [Table 1]

[0134] 2. Sample Dilution Dilute the sample to be tested to an appropriate concentration (10 5 ~10 9 The antibody was diluted to 0.05 μg / ml.

[0135] 3. Sample Dissolution 2 μl of diluted virus and 18 μl of virus lysis buffer were added, mixed well, and incubated at room temperature for 1-5 min.

[0136] 4. Establishing a Standard Curve Using Lenti-X RNA Control Dilution Template Standard dilutions were performed in clean 0.2 ml PCR tubes. Serial dilutions of the RNA standards were performed with reference to Figure 1. Each tube was mixed thoroughly before diluting the next tube.

[0137] 5×10 7 Copies / μl was used as the top point of the standard curve and EASY dilution buffer was used as the negative control (NTC, 0 copies / μl).

[0138] 5. Place 96-well PCR plate on ice. Pipette 18.4 μl of MRM (triplicate samples) into appropriate wells.

[0139] 6. Using a pipette, 1.6 μl of standard dilutions, NTCs, and samples (in triplicate) were transferred to a 96-well PCR plate.

[0140] 7. Centrifuge at 2000 rpm for 2 minutes at 4°C to remove air bubbles.

[0141] 8. The PCR program was set up according to Figure 2. The 96-well plate was filled and the program was started.

[0142] 9. Data Processing 1) Standard curve: The mean Ct values ​​of the Lenti-X RNA control gradient dilutions were linearly related to the RNA copy number (log scale).

[0143] 2) The RNA copy number of the samples in each reaction well was calculated based on the average Ct value of the diluted samples. The average Ct value obtained from the serially diluted samples of the lentivirus standard in the kit was used as the X-axis. The corresponding logarithmic value of the lentivirus standard RNA copy number was used as the Y-axis. The standard curve was obtained by fitting to the formula: Y=aX+b.

[0144] Y: logarithm (base 10) of the RNA copy number of the RNA standard or lentiviral vector being tested X: Mean Ct value obtained from standards or samples a: Coefficient obtained by standard curve fitting b: Intercept obtained by standard curve fitting A (number of copies of nucleic acid in each reaction well) = 10^ (aX+b) 3) Number of copies of RNA in the original sample (copies / ml) = 5 x 10 7 Copy / ul result: 1.Standard curve A standard curve was created using a standard of known copy number (e.g., RNA standard) to calculate the copy number of the unknown sample. Dilutions of Lenti-X RNA standard and dilutions of virus samples were performed as shown in Figure 1. The program shown in Figure 2 was used for PCR amplification. The standard curve was plotted based on the Ct value and the corresponding virus copy number (Figure 3). By measuring the standard product, the obtained detection value can be fitted. The fitted data showed a good linear correlation (R 2 ≧0.9999), indicating that the detection method has good stability and precision.

[0145] 2.Dissociation curve The melting curve (Figure 4) allows verification of the specificity of the amplification products and the state of the products by examining the number of peaks and the position of the peaks. Different peaks represent different products.

[0146] If there are two or even multiple peaks, it indicates that the primers are not highly specific, i.e., the Ct value obtained is not reliable. Here, the dissociation curve obtained by real-time quantitative PCR reaction had only one sharp peak, indicating that the primers in this reaction system have high specificity. The products amplified by this method were stable and accurate, and the detection data was reliable.

[0147] 3. Amplification curve (Figure 5) The amplification curve of real-time quantitative PCR can reflect the amplification efficiency of the reaction. High and consistent amplification efficiency is the key to successful detection. If the amplification efficiency is not consistent, the slope of the amplification efficiency curve will not have the same slope and will not be parallel, indicating that the primers are not the same efficient or that there is contamination that inhibits PCR in individual samples or reaction wells. From Figure 5, it can be seen that the amplification curves obtained using this method are substantially parallel, and the slopes are similar or substantially identical, indicating that the method of the present invention has high amplification efficiency.

[0148] 4.Calculation results [Table 2]

[0149] The Ct SD values ​​show that the samples tested were substantially parallel to each other. The melting temperatures (Tm) of the products after specific amplification were all around 75°C, indicating good primer amplification efficiency and no non-specific amplification. The infectious titer of the sample can also be quickly calculated / estimated by comparing with a positive control with a known infectious titer. It is very important to obtain the lentivirus titer of the sample in a timely manner. This method shows good applicability for the rapid detection of lentivirus titer.

[0150] The parameters of the qPCR program are shown in Figure 2. The total time from start to finish of the program is 1 hour and 20 minutes. Combined with sample preparation time and data processing time after the qPCR program, the total time can be up to 2 hours.

[0151] conclusion Typically, it can take 3-7 days to determine the infectious titer of a lentiviral vector.

[0152] Because lentiviral vectors are fragile and prone to degradation, there is a need to develop a rapid titering method for ongoing monitoring during lentiviral vector production. Using this method, the infectious titer (or physical titer) of lentiviral vectors can be determined efficiently, quickly (e.g., within 2 hours) and specifically. The method can be used to rapidly determine the titer of intermediate samples in the production process, determine the amount of intermediate products, and control the concentration of the final product.

[0153] The scope of the present disclosure is not limited by what has been specifically shown and described above. Those skilled in the art will recognize that there are suitable alternatives to the illustrated examples of materials, configurations, structures and dimensions. Numerous references, including patents and various publications, are cited and discussed in the description of the present invention. Citation and discussion of such references is provided merely to clarify the description of the present disclosure and is not an admission that any reference is prior art to the invention described herein. All references cited and discussed herein are incorporated herein by reference in their entirety. Variations, modifications, and other implementations of what is described herein will occur to those skilled in the art without departing from the spirit and scope of the present invention. While specific embodiments of the present disclosure have been shown and described, it will be apparent to those skilled in the art that changes and modifications can be made without departing from the spirit and scope of the present invention. The matter set forth in the foregoing description and accompanying drawings is offered by way of illustration only and not by way of limitation.

Claims

1. 1. A method for determining the titer of an RNA viral vector in a sample, comprising: (a) providing a sample comprising an RNA viral vector and a DNA molecule, or adding a DNA molecule to a sample comprising an RNA viral vector, wherein both the RNA viral vector and the DNA molecule comprise a sequence element; (b) obtaining a first portion and a second portion from the sample; and (c) performing a polymerase chain reaction (PCR) on the first portion to determine the copy number (n1) of the sequence element in the first portion, and performing a reverse transcription PCR (RT-PCR) on the second portion to determine the copy number (n2) of the sequence element in the second portion, wherein the RNA copy number of the RNA viral vector in the sample is determined by the difference between n1 and n2, i.e., n2-n1.

2. 2. The method of claim 1, further comprising a step (d) of determining an infectious titer of the RNA viral vector based on the RNA copy number of the RNA viral vector in the sample.

3. The method of claim 1 , wherein the RNA viral vector is a retroviral vector.

4. The method of claim 3 , wherein the retroviral vector is a lentiviral vector.

5. The method of claim 1 , wherein the sequence element is a regulatory element.

6. 6. The method of claim 5, wherein the regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

7. The method of claim 1 , wherein the sequence element is a long terminal repeat (LTR) or a promoter.

8. The method of claim 1 , wherein the PCR amplifies the region of the sequence element using a primer pair.

9. The method of claim 1, wherein the RT-PCR uses a primer pair to amplify the region of the sequence element.

10. The method of claim 1, wherein the PCR and the RT-PCR each use a primer pair to amplify a region of the sequence element.

11. The method of any of claims 8 to 10, wherein the primer pair comprises two primers comprising the nucleotide sequences set forth in: (i) SEQ ID NO:1 and SEQ ID NO:2, respectively; (ii) SEQ ID NO:3 and SEQ ID NO:4, respectively; or (iii) SEQ ID NO:5 and SEQ ID NO:6, respectively.

12. The method of claim 1, wherein the PCR is quantitative PCR (qPCR) and the RT-PCR is RT-qPCR.

13. The method of claim 1, wherein the titer is a physical titer or an infectious titer.

14. The method of claim 1 , wherein the DNA molecule is a DNA plasmid.

15. 15. The method of claim 14, wherein the DNA plasmid is a packaging plasmid.

16. 3. The method of claim 2, wherein the infectious titer of the RNA viral vector is determined by (the RNA copy number of the RNA viral vector x infectious titer of a positive control) / RNA copy number of the positive control, wherein the positive control is an RNA viral vector with a known infectious titer.

17. The method of claim 2, wherein the titer of the RNA viral vector is determined within 2 hours.

Images