How to test for prostate cancer

Abstract

To provide a method that can test the risk of development of prostate cancer with high accuracy.SOLUTION: A method for testing prostate cancer includes the step of analyzing one or more single nucleotide polymorphisms selected from the following group. Preferably, the one or more single nucleotide polymorphisms are used to calculate risk scores, and tests on prostate cancer are performed on the basis of the calculated risk scores. rs7542260, rs11125927, rs73862213, rs75777376, rs16901814, rs4554825, rs77911174, rs11055034, rs8023793, rs6117562, rs138708 and rs4826594.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for testing prostate cancer using gene sequence analysis. [Background technology]

[0002] Prostate cancer is one of the most common cancers worldwide, and has been considered common in Westerners and rare in Asians. However, in Japan, the number of patients has been rapidly increasing due to the Westernization of lifestyle habits such as diet and the super-aging of the population, and the number of patients in 2018 reached more than 78,000. Prostate cancer is also a typical cancer of the elderly, and about 43% of patients are late-stage elderly people aged 75 years or older. Prostate cancer is known to have a higher chance of being cured than other cancers, but for elderly people, aggressive treatment is increasingly not being performed due to the survival time after onset and side effects of treatment.

[0003] On the other hand, there are various treatments for non-elderly patients with prostate cancer, such as surgical therapy using surgical robots, hormone therapy to suppress male hormones, and radiation therapy. In addition, it is important for young people (under 60 years old) to actively diagnose early and undergo radical treatment, and PSA tests are used as a screening method for early detection.

[0004] General risk factors for the development of prostate cancer include race, Western-style diet, hormonal environment in the body, and aging. Although no specific risk factors were known, the existence of hereditary prostate cancer and the discovery of numerous genes and single nucleotide polymorphisms (SNPs) related to the development of prostate cancer have been reported. This has revealed that genetic factors are closely involved in the onset of the disease.

[0005] In 2010 and 2012, a research team at the RIKEN Institute conducted genome-wide analyses of approximately 5,000 Japanese samples collected through the Personalized Medicine Realization Project / BioBank Japan (BBJ). A gene-wide association study (GWAS) was conducted and 9 SNPs were found to be strongly associated with prostate cancer in Japanese subjects. (Non-Patent Documents 1 and 2) In addition, Patent Document 1 reports a SNP associated with prostate cancer. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Patent Publication No. 2012-157283 [Non-patent literature]

[0007] [Non-Patent Document 1] Nat Genet. 2010 Sep;42(9):751-4 [Non-Patent Document 2] Nat Genet. 2012 Feb 26;44(4):426-9 Summary of the Invention [Problem to be solved by the invention]

[0008] An objective of the present invention is to provide a method capable of testing the risk of developing prostate cancer with high accuracy. [Means for solving the problem]

[0009] The present inventors have conducted extensive research to solve the above problems. Genome-wide association studies were conducted on prostate cancer patients and approximately 84,000 male controls, based on frequency information for more than 500,000 SNPs across the genome. We identified 12 novel SNPs that are associated with increased risk of developing prostate cancer for each SNP. We also found that these new SNPs and the results of previous studies on Japanese patients increased the risk of developing glaucoma by 1.12 to 1.31 times. A total of 82 SNPs, including SNPs that have been proven to be associated with the development of prostate cancer, were combined to calculate a genomic risk score (PRS) that predicts the risk of developing prostate cancer, and the association with prostate cancer was Analysis showed that PRS values ​​were significantly associated with early onset (<60 years of age) and family history of prostate cancer. Based on this finding, the present invention has been completed.

[0010] The gist of the present invention is as follows. [1] A method for testing prostate cancer, comprising: A method comprising the step of analyzing one or more single nucleotide polymorphisms selected from the following: rs7542260, rs11125927, rs73862213, rs75777376, rs16901814, rs4554825, rs77911174, rs11055034, rs8023793, rs6117562, rs138708 and rs4826594 (Note that the rs number indicates the registration number in the dbSNP database of the National Center for Biotechnology Information.) [2] The method according to [1], further comprising analyzing one or more single nucleotide polymorphisms listed in Table 1. [3] The method according to [1] or [2], wherein a total of 10 or more types of single nucleotide polymorphisms are analyzed. [4] The method according to any one of [1] to [3], comprising calculating a risk score from the results of an analysis of a plurality of single nucleotide polymorphisms, and testing for prostate cancer based on the risk score. [5] The method according to any one of [1] to [4], wherein the prostate cancer is early-onset prostate cancer. [6] A reagent for testing for prostate cancer, comprising a reagent for analyzing one or more single nucleotide polymorphisms selected from the following: rs7542260, rs11125927, rs73862213, rs75777376, rs16901814, rs4554825, rs77911174, rs11055034, rs8023793, rs6117562, rs138708 and rs4826594 Effect of the Invention

[0011] By analyzing one or more of the prostate cancer-related SNPs newly identified in the present invention, the risk of developing prostate cancer can be efficiently examined.In addition, by calculating a risk score by combining a plurality of these prostate cancer-related SNPs or by combining them with known prostate cancer-related SNPs, and using the risk score obtained as an index, it becomes possible to perform a more accurate prostate cancer examination, and also to highly accurately predict prostate cancer that develops at a young age. [Brief description of the drawings]

[0012] [Figure 1] Genomic risk score (PRS) distribution for prostate cancer in the Japanese population. (a) PRS distribution for prostate cancer cases (n=4893) and male controls (n=10,682). Density was estimated using a Gaussian kernel. Percentiles above and below 5% are indicated by dotted lines. (b) PRS distribution by age at diagnosis of prostate cancer in prostate cancer cases (n=4762). Density was estimated using a Gaussian kernel. Three groups were analyzed: younger than 60 years (n=129); younger than 65 years (n=781); and ≥65 years (n=3852). (c) PRS distribution by presence or absence of family history of prostate cancer in prostate cancer cases (n=4893). Density was estimated using a Gaussian kernel. Two groups were analyzed: with family history (Yes) (n=272); without family history (No) (n=4621). (d) PRS distribution by age at prostate cancer diagnosis in the Jikei University validation cohort (n=2218). Density was estimated using a Gaussian kernel. The subjects were divided into four groups for analysis: younger than 55 years (n=94); younger than 60 years (n=310); ≥65 years (n=802); and ≥65 years (n=802). [Diagram 2] Graph showing the age-specific proportion of the top 5% PRS group in Biobank Japan (BBJ) or the Jikei University of Medicine validation cohort. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] The method for testing for prostate cancer of the present invention includes a step of analyzing one or more SNPs selected from the following: rs7542260, rs11125927, rs73862213, rs75777376, rs16901814, rs4554825, rs77911174, rs11055034, rs8023793, rs6117562, rs138708, and rs4826594. Of these SNPs, it is preferable to analyze two or more, three or more, four or more, or five or more.

[0014] The rs number indicates the registration number in the National Center for Biotechnology Information's dbSNP database (https: / / www.ncbi.nlm.nih.gov / snp / ).

[0015] The prostate cancer is not particularly limited as long as it is a malignant tumor occurring in the prostate, but may be early-onset prostate cancer occurring in subjects aged 59 or younger.

[0016] rs7542260 is a SNP located near the MIR4417 gene on chromosome 1. This refers to the SNP of thymine (T) / cytosine (C) at base 5743196 of No. NC_000001.10, and when this base is T, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is performed taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order TT>TC>CC. Therefore, it is considered that subjects with this base as T should be treated to prevent or treat prostate cancer.

[0017] For rs7542260, a sequence of 51 bp in length including the SNP base and a region of 25 bp before and after it is shown in SEQ ID NO: 1. If the 26th base in SEQ ID NO: 1 has an SNP and this base is T (risk allele), it is determined that there is a high possibility or risk of developing prostate cancer. GCAGTGACGCTTCTGGTCTTAAGCC(C / T)GCCCTTCTTGCCCCTTCCTCCCCTT (SEQ ID NO: 1)

[0018] rs11125927 is a SNP located near the RPL21P37 gene on chromosome 2, and is a guanine (G) / adenine (A) at base 62752975 of GenBank Accession No. NC_000002.11. This refers to SNP, and if this base is G, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is conducted taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order GG>AG>AA. Therefore, it is considered that subjects with this base as G should be given treatment to prevent or treat prostate cancer.

[0019] For rs11125927, a total of 51 bp including the SNP base and the 25 bp region before and after it was The length of the sequence is shown in SEQ ID NO: 2. The 26th base in SEQ ID NO: 2 has an SNP, and when this base is G (risk allele), the possibility of or risk of developing prostate cancer is determined to be high. TATTTTATTGGTTAATATTTGAACA(A / G)TTGTTGGGCAGAGAGTCTGTGTAAT (SEQ ID NO: 2)

[0020] rs73862213 is a SNP located near the LOC100506995 gene on chromosome 3, and refers to a guanine (G) / adenine (A) SNP at base 128217499 of GenBank Accession No. NC_000003.11, and when this base is G, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is performed taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order GG>AG>AA. Therefore, it is considered that subjects with this base G should be treated to prevent or treat prostate cancer.

[0021] For rs73862213, a total of 51 bp including the SNP base and the 25 bp region before and after it was The length of the sequence is shown in SEQ ID NO: 3. The 26th base in SEQ ID NO: 3 has an SNP, and when this base is G (risk allele), the possibility of or risk of developing prostate cancer is determined to be high. ATACCAGGATCCTTGGAGGTGAGGG(A / G)GTTCCTGTTTTGCTTGTGGCTACAG (SEQ ID NO: 3)

[0022] rs75777376 is a SNP located near the FAM84B gene on chromosome 8. This refers to the SNP of cytosine (C) / thymine (T) at the 127796183rd base of No. NC_000008.10, and if this base is C, there is a high possibility or risk of developing prostate cancer. In addition, when genotype is taken into consideration, the order of the possibility or risk of developing prostate cancer is CC>TC>TT. Therefore, subjects with this base as C may be considered to be treated for the prevention or treatment of prostate cancer.

[0023] For rs75777376, a total of 51bp including the SNP base and the 25bp region before and after it was The length of the sequence is shown in SEQ ID NO: 4. The 26th base in SEQ ID NO: 4 has an SNP, and when this base is C (risk allele), the possibility of or risk of developing prostate cancer is determined to be high. AAAATTCATATCACAAGTAAAATTA(T / C)TAAGTAATGTAGCATCATTCAGCTA (SEQ ID NO: 4)

[0024] rs16901814 is a SNP located near the SRRM1P1 gene on chromosome 8, and corresponds to a guanine (G) / adenine (A) sequence at base 127881952 of GenBank Accession No. NC_000008.10. This refers to SNP, and if this base is G, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is conducted taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order GG>AG>AA. Therefore, it is considered that subjects with this base as G should be given treatment to prevent or treat prostate cancer.

[0025] For rs16901814, a total of 51 bp including the SNP base and the 25 bp region before and after it was The length of the sequence is shown in SEQ ID NO: 5. The 26th base in SEQ ID NO: 5 has an SNP, and when this base is G (risk allele), the possibility of or risk of developing prostate cancer is determined to be high. TCCCATTAGAGACTCTGCAGATCAC(G / A)CAAGTCATTCATTCCTTATTAATCA (SEQ ID NO:5)

[0026] rs4554825 is a SNP located near the LOC100130698 gene on chromosome 10, and refers to a cytosine (C) / thymine (T) SNP at the 80244623rd base of GenBank Accession No. NC_000010.10, and when this base is C, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is performed taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order of CC>CT>TT. Therefore, it is considered that subjects with this base as C should be treated for the prevention or treatment of prostate cancer.

[0027] For rs4554825, a sequence of 51 bp in length including the SNP base and a region of 25 bp before and after the SNP base is shown in SEQ ID NO: 6. If the 26th base in SEQ ID NO: 6 has an SNP and this base is C (risk allele), the possibility or risk of developing prostate cancer is determined to be high. GCATTATTAAGTGTAGCTGTTGAGG (C / T) GTTTTCCATCATGGGGGAAACATGC (SEQ ID NO: 6)

[0028] rs77911174 is a SNP located near the LOC283050 gene on chromosome 10, and refers to a guanine (G) / adenine (A) SNP at the 80826833rd base of GenBank Accession No. NC_000010.10, and when this base is G, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is performed taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order GG>AG>AA. Therefore, it is considered that subjects with this base G should be treated to prevent or treat prostate cancer.

[0029] For rs77911174, a total of 51 bp including the SNP base and the 25 bp region before and after it was The length of the sequence is shown in SEQ ID NO: 7. When the 26th base in SEQ ID NO: 7 has an SNP and this base is G (risk allele), the possibility of or risk of developing prostate cancer is determined to be high. CCCAAGAGGCCCAGGAGACCCGCAA(A / G)TCTGTGCTGCACGTCCGCACTCCCA (SEQ ID NO: 7)

[0030] rs11055034 is a SNP located near the APOLD1 gene on chromosome 12 and is available in GenBank Accession No. Cytosine (C) / Adenine (A) at base 12890626 of No. NC_000012.11 This refers to SNP, and if this base is C, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is conducted taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order CC>CA>AA. Therefore, it is considered that subjects with this base as C should be treated to prevent or treat prostate cancer.

[0031] For rs11055034, a total of 51 bp including the SNP base and the 25 bp region before and after it was The length of the sequence is shown in SEQ ID NO: 8. When the 26th base in SEQ ID NO: 8 has an SNP and this base is C (risk allele), the possibility of or risk of developing prostate cancer is determined to be high. AGAAAGTGAGAAGGAGGGAGCTGGG(C / A)GCTTATCTTTGGCATATCCTCAGCT (SEQ ID NO: 8)

[0032] rs8023793 is a SNP located near the SMAD6 gene on chromosome 15. This refers to the adenine (A) / cytosine (C) SNP at the 66942093rd base of No. NC_000015.9, and when this base is A, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is performed taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order AA>AC>CC. Therefore, it is considered that subjects with this base as A should be treated to prevent or treat prostate cancer.

[0033] For rs8023793, a sequence of 51 bp in length in total including the SNP base and a 25 bp region before and after it is shown in SEQ ID NO: 9. If the 26th base in SEQ ID NO: 9 has an SNP and this base is A (risk allele), it is determined that there is a high possibility or risk of developing prostate cancer. CATGTTTATTAGATAACTAACCAAT(A / C)AAATAAAACAAACACACCAACAATT (SEQ ID NO: 9)

[0034] rs6117562 is a SNP located near the C20orf54 gene on chromosome 20, and refers to an adenine (A) / guanine (G) SNP at the 753310th base of GenBank Accession No. NC_000020.10, and when this base is A, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is performed taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order AA>AG>GG. Therefore, it is considered that subjects with this base A should be treated to prevent or treat prostate cancer.

[0035] For rs6117562, a sequence of 51 bp in length in total including the SNP base and a 25 bp region before and after it is shown in SEQ ID NO: 10. If the 26th base in SEQ ID NO: 10 has an SNP and this base is A (risk allele), it is determined that there is a high possibility or risk of developing prostate cancer. AGTTCTTATTTATTCATTTTAACCA(A / G)TATTTCTTGGGCACCAACTGTGTGC (SEQ ID NO: 10)

[0036] rs138708 is a SNP located near the SUN2 gene on chromosome 22, and is a guanine (G) / adenine (A) SNP at base 39138332 of GenBank Accession No. NC_000022.10. It stands for P, and if this base is G, the possibility or risk of developing prostate cancer is high. In addition, when the analysis is conducted taking into account the genotype, the possibility or risk of developing prostate cancer increases in the order GG>AG>AA. Therefore, it is considered that subjects with this base as G should be treated for the prevention or treatment of prostate cancer.

[0037] Regarding rs138708, the total length of 51 bp including the SNP base and the 25 bp region before and after it was The sequence is shown in SEQ ID NO: 11. The 26th base in SEQ ID NO: 11 has an SNP, and when this base is G (risk allele), the possibility or risk of developing prostate cancer is determined to be high. TGGATGCGAGCAGCAGTTTCCCTGC(G / A)GAAATCCTCCTTCAGGGCAGCTTCA (SEQ ID NO: 11)

[0038] rs4826594 is a SNP located near the TSR2 gene on chromosome X, and refers to an adenine (A) / guanine (G) SNP at base 54454406 of GenBank Accession No. NC_000023.10, and when this base is A, there is a high possibility or risk of developing prostate cancer. Therefore, it is considered that subjects with this base as A should be treated for the prevention or treatment of prostate cancer.

[0039] For rs4826594, a sequence of 51 bp in length in total including the SNP base and a 25 bp region before and after it is shown in SEQ ID NO: 12. If the 26th base in SEQ ID NO: 12 has an SNP and this base is A (risk allele), it is determined that there is a high possibility or risk of developing prostate cancer. ACATCCTTACTATTCTAGCCCTTGT(A / G)GCCAACAGATGCTAAAGTGACCTCC (SEQ ID NO: 12)

[0040] Although the position of the SNP to be analyzed has been described above, in the method of the present invention, it is sufficient to analyze the bases corresponding to these SNP bases. Here, the bases corresponding to the SNP bases refer to the corresponding bases in the above region on the human chromosome. In other words, "analyzing the bases corresponding to the above bases" includes analyzing the bases corresponding to the above bases even if the above sequence is not SNP due to differences in race, etc. Even if there is a slight change in the position, the relevant base in the region containing the SNP is analyzed.

[0041] In addition, the SNPs analyzed in the present invention are not limited to those mentioned above, and SNPs in linkage disequilibrium with the above SNPs may be analyzed. 2 >0.8, more preferably r 2SNPs that satisfy a relationship of >0.9. 2 is the linkage disequilibrium coefficient. SNPs in linkage disequilibrium can be identified, for example, using the HapMap database (http: / / www.hapmap.org / index.html.ja).

[0042] The above SNPs may be analyzed individually, or multiple SNPs including at least one of the above SNPs may be analyzed together. For example, multiple SNPs may be analyzed together, or at least one of the above 12 SNPs may be analyzed in combination with a known SNP associated with prostate cancer or an SNP in linkage disequilibrium with the known SNP. Table 1 below shows SNPs other than the above 12 SNPs that have been used in the GWAS and Replication study this time. The SNPs used are those known to be associated with prostate cancer. In Table 1, ORs (odds ratios) and DOSE (dosage) were calculated using non-risk alleles.

[0043] [Table 1-1] [Table 1-2] [Table 1-3]

[0044] By analyzing a plurality of SNPs related to prostate cancer, for example, a total of 10 or more SNPs, preferably a total of 20 or more SNPs, more preferably a total of 30 or more SNPs, and even more preferably a total of 40 or more SNPs, the accuracy of prostate cancer testing can be improved.A plurality of SNPs can be analyzed, and each of them can be confirmed to be a risk allele, and the total number of risk alleles can be used as an index of prostate cancer risk (for example, when there are 1 or more, 2 or more, or 3 or more risk alleles, the risk of prostate cancer is determined to be high), but it is more preferable to calculate a risk score from the analysis result of a plurality of SNPs, and use the obtained risk score as an index of prostate cancer risk.For example, when the risk score exceeds a certain reference value, the risk of prostate cancer can be determined to be high.

[0045] The risk score (PRS) may be, for example, expressed by the following formula: PRS = β1x1 + β2x2 + ... β k x k +β n x n Here, β k is a SNP k is the log odds ratio (OR) of risk allele for prostate cancer for x k is SNP k is the number of risk alleles (0, 1, or 2) for each SNP, and n is the total number of SNPs analyzed.

[0046] As described above, the type of base of one or more SNPs is examined, and the obtained results or the results based thereon are used. By correlating the risk score based on the above-mentioned index with prostate cancer, prostate cancer can be examined. That is, the method of the present invention can provide data for diagnosing prostate cancer.

[0047] The results determined by the method of the present invention are provided to doctors and the like as necessary. The doctors and the like who receive the results will then carry out necessary tests such as blood tests, X-rays, and CT scans, and provide information on the risk of developing the disease and the like. It is possible to diagnose the risk of progression. If a doctor or other medical professional diagnoses a patient as being at high risk of developing or progressing prostate cancer, they can administer treatment such as surgery or anti-cancer drug therapy. On the other hand, if the doctor or other medical professional diagnoses a patient as being at low risk, they can avoid these treatments, which are a heavy burden on the patient.

[0048] In the present invention, the subject of analysis is a human, for example, a human suspected of being at risk of prostate cancer. There is no particular limitation on the race of the subject, and examples of the subject include Asians, including Japanese. The sample used for SNP analysis is not particularly limited as long as it contains chromosomal DNA derived from a subject. Examples of samples used for SNP analysis include body fluids such as blood, urine, and cerebrospinal fluid, cervical and oral mucus samples, and the like. These samples include cells such as membranes and body hair. These samples are used directly for SNP analysis. However, chromosomal DNA can be isolated from these samples by standard methods and used for analysis. It is preferable to analyze the

[0049] The analysis of SNPs can be carried out by a conventional genetic polymorphism analysis method. These include sequence analysis, PCR, hybridization, and the Invader method. However, the present invention is not limited to these. For each SNP, either strand of double-stranded DNA may be analyzed. For example, each sequence may be analyzed by analyzing the sense strand or the antisense strand.

[0050] The sequence analysis can be performed by a conventional method. Specifically, a sequence reaction is performed using a primer set at a position several tens of bases on the 5' side of the base showing the polymorphism. From the analysis results, it is possible to determine what type of base is present at the corresponding position. It is preferable to amplify a fragment containing the SNP site by PCR or the like beforehand, prior to the sequencing reaction.

[0051] SNP analysis can also be performed by examining the presence or absence of amplification by PCR. For example, primers having a sequence corresponding to a region containing a base showing a polymorphism and having a 3' end corresponding to each polymorphism are prepared. PCR is performed using each primer, and the amplified product is The type of polymorphism can be determined by the presence or absence of the substance. The presence or absence of amplification can also be examined by the LAMP method (Japanese Patent No. 3313358), the NASBA method (Nucleic Acid Sequence-Based Amplification; Japanese Patent No. 2843586), the ICAN method (Japanese Patent Publication No. 2002-233379), the SmartAmp method (Japanese Patent No. 3897805), etc. Alternatively, a single-stranded amplification method may be used.

[0052] It is also possible to amplify a DNA fragment containing an SNP site and determine the type of polymorphism based on the difference in electrophoretic mobility of the amplified product. One such method is the PCR-SSCP (single-strand conformation polymorphism) method (Genomics. 1992 Jan 1;12(1): 139-146.). Specifically, first, DNA containing the target SNP is amplified and the amplified DNA is dissociated into single-stranded DNA. The dissociated single-stranded DNA is then separated on a non-denaturing gel. The type of polymorphism can be determined by the difference in the mobility of the separated single-stranded DNA on a gel. can be determined.

[0053] Furthermore, when the base showing the polymorphism is included in a restriction enzyme recognition sequence, it can be analyzed by the presence or absence of cleavage by the restriction enzyme (RFLP method). In this case, first, a DNA sample is cleaved by a restriction enzyme. The DNA fragments are then separated, and the type of polymorphism can be determined based on the size of the detected DNA fragment.

[0054] It is also possible to analyze the type of polymorphism by examining the presence or absence of hybridization. In other words, by preparing probes corresponding to each base and examining which probe hybridizes, it is possible to determine which base the SNP is. .

[0055] <2> Reagent for testing prostate cancer according to the present invention The present invention also provides test reagents such as primers and probes for testing prostate cancer. Such probes contain the above-mentioned SNP site and can be used to detect prostate cancer by the presence or absence of hybridization. Specifically, the probes can be used to determine the type of base at the SNP site. Examples of such probes include a probe having a length of 15 or more bases and including a sequence containing the 26th base of any one of the base sequences shown in any one of claims 1 to 12, or a complementary sequence thereof, and a probe having a length of 15 or more bases and including a sequence containing a base in a relationship of linkage disequilibrium with the said base, or a complementary sequence thereof. The length of the probe is preferably 15 to 35 bases, and more preferably 20 to 35 bases.

[0056] The primers may be used in PCR for amplifying the SNP site, or may be used for sequencing the SNP site. Examples of such primers include primers capable of amplifying or sequencing a region including the 26th base in the base sequence shown in any one of SEQ ID NOs: 1 to 12, and primers capable of amplifying or sequencing a region including a base in linkage disequilibrium with the base. The length of such primers is preferably 15 to 50 bases, more preferably 15 to 35 bases, and even more preferably 20 to 35 bases. stomach.

[0057] As a primer for sequencing the SNP site, the 5' region of the above base is Examples of the primer to be used for determining a polymorphism based on the presence or absence of amplification by PCR include a primer having a sequence including the above-mentioned base and including the above-mentioned base on the 3' side, and a primer having a complementary sequence to the sequence including the above-mentioned base and including the complementary base of the above-mentioned base on the 3' side.

[0058] In addition to these primers and probes, the test reagent of the present invention also contains a polymerase for PCR. The kit may contain enzymes, buffers, hybridization reagents, and the like. EXAMPLES

[0059] The present invention will be specifically described below with reference to examples, but the present invention is not limited to the following embodiments.

[0060] <Method> Study samples GWAS samples were taken from 5088 case samples from Biobank Japan (BBJ), established at the Institute of Medical Science, University of Tokyo. Among the 5088 cases, 272 (5.3%) subjects had a family history of prostate cancer, 1219 (23.9%) subjects had PSA ≥ 10, and 1989 (39.1%) subjects were diagnosed with cancer with a Gleason score of ≥ 7. Pathologically proven prostate cancer cases were selected from BBJ. Non-cancer controls were taken from samples of 10,682 Japanese men who had never been diagnosed with prostate cancer from four large-scale cohort studies (Japan Multicenter Cohort (J-MICC) Study, Multipurpose Cohort (JPHC) Study, Iwate Tohoku Medical Megabank Organization (IMM), and Tohoku Medical Megabank Organization (ToMMo)). Genomic DNA samples were extracted from peripheral blood leukocytes and normal tissues using standard methods. All studies were approved by the institutional ethics committee prior to enrolment and informed consent was obtained from all participants following protocols.

[0061] Genotyping and quality control GWAS was performed using the Illumina OmniExpress Exome or OmniExpress+ HumanExome BeadChip (Illumina Inc., San Diego, CA, USA). Of the 947,830 SNPs genotyped, 195,588 were monoallelic and were excluded from further analysis. Cluster plots of the top 100 SNPs with the lowest P-values ​​were visually checked, and 604,992 SNPs had a call rate of 1.01–1.000 in both case and control samples. The criteria of P ≥ 1.00 × 10 were met. -6 A total of 523,051 SNPs were analyzed for association. Imputation of ungenotyped SNPs was performed by MaCH (Science 316, 1341-1345 (2007)) as well as minimac (Nat. Genet. 44, 955-959(2012)).

[0062] Samples for follow-up and genotyping A replication study was conducted using 4818 independent prostate cancer case samples and 73,261 control samples. Case samples were obtained from Biobank Japan (2236 cases) and JIKEI samples (2582 samples) from the Jikei University School of Medicine. All cases were collected from the local pathology department. Histological diagnoses were performed by scholars, and clinical data were collected by local urologists. Control samples in the replication study were 73,261 men from BBJ who had been subjected to GWAS for diseases other than prostate cancer.

[0063] The targeted regions of case samples were sequenced using a multi-index PCR-based targeted sequencing method (Hum. Mol. Genet. 25, 5027-5034 (2016)). A two-step PCR method was used. DNA libraries were constructed using the 202 primer pairs and 2X Platinum Masterplex PCR Master Mix (Thermo Fisher Scientific) in a first PCR (25 cycles) to amplify the target region, followed by a second PCR (4 cycles) to add 8-bp barcode and adapter sequences using primers targeting the shared 5' overhangs introduced during the first PCR and KAPA HiFi HotStart DNA polymerase (KAPA). After purification and quantification of the pooled libraries, they were sequenced with 2150 bp paired-end reads on a HiSeq2500 (Illumina) instrument. Sequence reads assigned to each individual were aligned to the human reference sequence (hg19) using Burrows-Wheeler Aligner (version 0.7.12) and compiled into the Genome Compilation Library. The genome sequences were processed using the Genetic Analysis Toolkit (GATK, version 3.4-46). For quality control, individuals with >98% coverage of the target region by ≥20 sequence reads were selected. The UnifiedGenotyper and HaplotypeCaller of GATK, and VCMM (version 1.0.2) were used separately to investigate variants in each individual. All individuals were genotyped for each variant based on the sequence read ratio of the reference and alternative alleles together. Alternative allele frequencies between 0 and 0.15, 0.25 and 0.75, and 0.85 and 1 were considered homozygous for the reference allele, heterozygous, and homozygous for the alternative allele, respectively. SNPs that could not be analyzed by multi-index sequencing were genotyped by a multiplex PCR-based INVADER assay (J. Hum. Genet. 46, 471-7 (2001)).

[0064] statistical analysis At all stages, the correlation of each SNP was evaluated under an additive model. In GWAS, the genetic inflation factor λ GCwas derived from the P-values ​​obtained by the Cochran-Armitage trend test for all tested SNPs. Quantile-quantile plots were drawn using the R program. λ GC 1000 , as follows: 54 Calculated using: λ GC 1000 =1+(1-λ GC obs )×(1 / n cases +1 / n controls ) / (1 / 1000 caces +1 / 1000 controls ) The combined results of the GWAS and replication analyses were validated by the Mantel-Haenszel method. Heterogeneity across the two stages was examined using the P link (IARC Sci. Publ. 82, 1-406 (1987)). After Bonferroni correction for multiplex testing, the significance threshold was P = 5 × 10 -8 (GWAS and meta-analysis).

[0065] Polygenic Risk Scores Polygenic scores were computed as a weighted sum of the number of risk alleles. The logarithm of the odds ratio computed in the GWAS part of the study was used as the weight. The number of SNPs incorporated was 82 and 63 in the GWAS and validation cohorts, respectively. For alleles imputed in the GWAS, gene dosage was used as the number of risk alleles. Statistical associations between polygenic scores and clinical information were calculated using the statistical software R (A language and environment for statistical computing. R Analyses were performed using the R project (Foundation for Statistical Computing, Vienna, Austria. https: / / www.R-project.org / ).

[0066] <Result> Identification of prostate cancer susceptibility SNPs First, we performed GWAS using the above 5088 case and 10682 control samples, with P < 1 × 10 -5We identified 2997 SNPs that were associated with prostate cancer. We then performed an independent replication study using 4818 cases from the BBJ and JIKEI cohorts and 73,261 controls from the BBJ cohort. Quality (R 2 SNPs with a genomic correlation coefficient <0.3) and SNPs previously reported to be associated with prostate cancer were excluded. In the same linkage disequilibrium (LD) block, we selected representative SNPs for each gene region that showed the strongest correlation with prostate cancer. In addition, we selected 20 SNPs that showed a particularly significant correlation with prostate cancer compared with other SNPs in the same LD block. In total, we selected 101 SNPs for follow-up testing. In the follow-up testing, genotyping was performed using multi-index sequencing and multiplex invader methods. Among the candidate SNPs, 5 SNPs could not be genotyped by either method and were excluded. The results of the first and follow-up GWAS were P<5×10 -8 We identified 12 novel SNPs that were significantly correlated with prostate cancer (Table 2). In Table 2, RSQR indicates the imputation accuracy in GWAS, and OR indicates Allergy 2 This is the odds ratio compared with the control.

[0067] All novel SNPs identified in this study, except for rs138708, were located in non-exonic regions. Of the 12 novel loci, five loci (rs7542260 in chr.1, rs75777376 in chr.8, rs16901814 in chr.8, rs4554825 in chr.10, and rs8023793 in chr.15) did not contain protein-coding genes in their LD blocks or in their vicinity (within 100 kb). Meanwhile, rs11125927 in chr.2 was in an intron of the TMEM17 gene. rs73862213 in chr.3 was near GATA2. The rs77911174 region in chr.10 contained the ZMIZ1 gene. rs11055034 on chr.12 was in an intron of APOLD1, and this region included the 3' end of CDKN1B. rs6117562 on chr.20 was in a region containing SLC52A3. rs138708 on chr.22 formed a very large LD block that included many genes, but rs138708 is a nonsynonymous SNP in an exon of the SUN2 gene. The region spanning rs4826594 on chr.X included three genes, FGD1, GNL3L, and TSR2.

[0068] [Table 2]

[0069] Polygenic risk scores in the Japanese population. We selected 68 SNPs that showed a correlation with prostate cancer risk in Japanese men from the 12 newly discovered SNPs and previously reported SNPs in this study, and also included rs114780236 and rs4842687, which represent two previously reported loci (rs58235267 and rs5799921). The 68 SNPs, rs114780236 and rs4842687 are shown in Table 1 above.

[0070] A polygenic risk score (PRS) was calculated by summing the number of risk alleles and their effects in each individual in the GWAS sample. The distribution of PRS in prostate cancer cases (n=4893) and male controls (n=10,682) is shown in Figure 1a. We defined the top 5% of cases (n=245) as the genetic high-risk group and the bottom 5% (n=245) as the low-risk group, and examined the clinical characteristics of these genetic risk stratified groups. Notably, the mean age at diagnosis in the high-risk group was 2.7 years younger than that in the non-high-risk group (mean age 68.7 years vs. 71.4 years by t-test, P=6.54×10 -8 ), whereas we found little difference in the mean age at diagnosis between the low-risk and non-low-risk groups (72.3 vs. 71.1, P = 0.020). We also found that high PRS was more prevalent in early-onset prostate cancer cases (P = 0.00221 for cases aged < 60 years and P = 4.30 × 10 for cases aged < 65 years by t test). -9 , Fig. 1b). This trend was similar in the Jikei University validation cohort (Fig. 1d). In addition, the high-risk group had a higher proportion of patients with a positive family history of prostate cancer (P = 0.00339 by Fisher's test, Fig. 1c).

[0071] In this way, the top 5% of prostate cancer cases (those with a risk of developing 2.5 or more) were classified as prostate cancer. Among those at high risk of developing prostate cancer, there were significantly more cases of those who developed the disease at a young age and those with a family history of prostate cancer.

[0072] In addition, a prostate cancer case from BBJ (left, n=4633) and a prostate cancer case from Jikei University School of Medicine (right, Among those aged 60 and under, the proportion of those classified as in the high-risk group for PRS (top 5%) was 12% and 8%, respectively. Thus, the younger the age at onset, the higher the proportion of those in the high-risk group for PRS (Figure 2).

Claims

1. A method for testing prostate cancer, comprising: rs7542260, rs11125927, rs73862213, rs75777376, rs16901814, rs4554825, rs77911174, rs11055034, rs8023793, rs6117562, rs138708 and rs4826594 (Note that rs numbers indicate the registration numbers in the dbSNP database of the National Center for Biotechnology Information. ) analyzing one or more single nucleotide polymorphisms selected from the group consisting of

2. The method according to claim 1, further comprising analyzing one or more single nucleotide polymorphisms listed in Table 1 below. of method. 【Table 1-1】 【Table 1-2】 【Table 1-3】

3. The method according to claim 1 or 2, wherein a total of 10 or more types of single nucleotide polymorphisms are analyzed.

4. The method according to any one of claims 1 to 3, wherein a risk score is calculated from the analysis results of a plurality of single nucleotide polymorphisms, and prostate cancer is examined based on the risk score.

5. The method according to any one of claims 1 to 4, wherein the prostate cancer is early-onset prostate cancer.

6. A probe for prostate cancer testing having a complementary sequence of a sequence of 15 or more bases including the 26th base in a base sequence selected from SEQ ID NOs: 1 to 12, The base corresponding to the 26th base of SEQ ID NO:1 is T (risk allele); The base corresponding to the 26th base of SEQ ID NO:2 is G (risk allele); The base corresponding to the 26th base of SEQ ID NO:3 is G (risk allele); The base corresponding to the 26th base of SEQ ID NO: 4 is C (risk allele); The base corresponding to the 26th base of SEQ ID NO:5 is G (risk allele); The base corresponding to the 26th base of SEQ ID NO:6 is C (risk allele); The base corresponding to the 26th base of SEQ ID NO:7 is G (risk allele); The base corresponding to the 26th base of SEQ ID NO:8 is C (risk allele); The base corresponding to the 26th base of SEQ ID NO:9 is A (risk allele); The base corresponding to the 26th base of SEQ ID NO: 10 is A (risk allele); The base corresponding to the 26th base of SEQ ID NO: 11 is G (risk allele); or The base corresponding to the 26th base of SEQ ID NO: 12 is A (risk allele); That is, the probe.

7. A reagent for prostate cancer testing for analyzing one or more single nucleotide polymorphisms selected from rs7542260, rs11125927, rs73862213, rs75777376, rs16901814, rs4554825, rs77911174, rs11055034, rs8023793, rs6117562, rs138708, and rs4826594, comprising a set of primers having a base sequence of 15 or more bases capable of amplifying a region including the 26th base in a base sequence selected from SEQ ID NOs: 1 to 12.

Images