Amplification methods and systems for MERFISH and other applications

Abstract

The present invention generally relates to systems and methods for imaging or determining nucleic acids in cells or other samples. In some cases, the transcriptome of a cell may be determined. Certain embodiments are generally directed to determining nucleic acids and other targets in a sample at relatively high resolution. For example, a nucleic acid probe may be applied to the sample, and binding of the nucleic acid probe to the target may be amplified using primary and secondary amplification nucleic acids. In some cases, there is a maximum number of amplified nucleic acids that can bind to the target; for example, binding is saturable and cannot grow indefinitely, even in the presence of abundant reagents. This may be advantageous, for example, to control the brightness of each binding event, control the size of the amplified region (e.g., during imaging), and / or limit amplification noise (i.e., the ultimate variability of the amplified signal between molecules), etc. Additionally, in some embodiments, the primary and / or secondary amplification nucleic acids may be formed from only three of the four naturally occurring nucleotides, which may result in reduced secondary structure, increased binding rates, etc. These properties potentially facilitate the rapid design of multiple orthogonal amplification sequences, allowing the extension of such techniques to many significantly different molecular targets.

Description

[Technical field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 62 / 779,333, filed Dec. 13, 2018 by Zhuang et al., and entitled “Amplification Methods and Systems for MERFISH and Other Applications,” which is incorporated by reference in its entirety herein.

[0002] Government funding This invention was made with government support under Nos. MH113094, MH111502, and MH114830 awarded by the National Institutes of Health. The United States Federal Government has certain rights in this invention.

[0003] Field The present invention relates generally to systems and methods for imaging or determining nucleic acids in cells or other samples. [Background technology]

[0004] Single molecule fluorescence in situ hybridization (smFISH) provides both RNA abundance and spatial location by direct detection of individual RNA molecules in single cells. Using this technique, RNA localization has been shown to be associated with multiple cellular functions, such as the development of body patterning, cell fate determination during cell division, localized translation, cell migration, and polarity establishment. To study RNA localization at the transcriptome scale in intact cells and tissues, MERFISH (multiplexed error-robust fluorescence in situ hybridization) and in situ sequencing have been developed. Among these, MERFISH uses error-robust binary barcoding and sequential imaging to multiplex smFISH measurements with high detection efficiency. However, a higher signal photon count would improve throughput, which is limited by the imaging collection speed, light scattering caused by imaging deep tissues, and low signal-to-background ratio due to sample autofluorescence. Therefore, improvements in photon counting enhancement are needed to substantially increase imaging throughput, enable targeting of short RNAs that may not allow sufficient probe binding to provide a signal above background signal levels, and / or extend multiplex measurements to sample types with high levels of background signal.

[0005] However, the performance of multiplexed single molecule RNA imaging methods depends on many characteristics that may be compromised or challenged by signal amplification. For example, it is often important that the variation in signal brightness between molecules is relatively small. Similarly, it is often important that the physical size of the signal, or the spread from individual molecules, is as small as possible to prevent substantial overlap of signals from physically adjacent molecules. In parallel with this, amplification methods may not be highly efficient, and some molecules may not be amplified while others are, resulting in a reduced proportion of detected molecules. In addition, it is often important to be able to amplify multiple, orthogonal molecular signals, and it is extremely important that the amplification method can be rapidly extended to more significantly different molecular signals. Finally, such amplification methods should be rapid so as to reduce sample preparation time. For these reasons, there is a need for an amplification method that does not introduce variation in signal brightness and does not increase the physical spread of the signal from individual molecules, is highly efficient in amplifying signals from all target molecules, and can be rapidly extended to multiple significantly different targets. Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention relates generally to systems and methods for imaging or determining nucleic acids in cells or other samples. The subject matter of the invention sometimes involves interrelated products, alternative solutions to a particular problem, and / or multiple different uses of one or more systems and / or articles. [Means for solving the problem]

[0007] In one aspect, the invention is generally directed to a method. According to a first set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplifier nucleic acid capable of binding to the nucleic acid probe, where a maximum number of primary amplifier nucleic acids are capable of binding to the nucleic acid probe, exposing the primary amplifier nucleic acid to a secondary amplifier nucleic acid capable of binding to the primary amplifier nucleic acid, where a maximum number of secondary amplifier nucleic acids are capable of binding to the primary amplifier nucleic acid, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue Creating codewords and symbols issue For at least a part of the word, issue A word is a legal symbol. issue If no match is found, provide error correction as appropriate. issue Applying it to words, issue This involves forming words.

[0008] In another set of embodiments, a method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to a target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue Creating words and symbols issue For at least a part of the word, issue A word is a legal symbol. issue If no match is found, provide error correction as appropriate. issue Applying it to words, issue This involves forming words.

[0009] In yet another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, where the secondary amplified nucleic acid binds to the primary amplified nucleic acid within a fixed distance, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue Creating words and symbols issue For at least a part of the word, issue A word is a legal symbol. issue If no match is found, provide error correction as appropriate. issue Applying it to words, issue This involves forming words.

[0010] A method according to yet another set of embodiments includes exposing a sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, where the primary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid; determining a distribution of the nucleic acid probe in the sample using fluorescence; and determining a signature based on the fluorescence distribution in the sample. issue Creating words and symbols issue For at least a part of the word, issue A word is a legal symbol. issue If no match is found, provide error correction as appropriate. issue Applying it to words, issue This involves forming words.

[0011] In yet another set of embodiments, the method includes exposing a sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides; determining a distribution of the nucleic acid probe in the sample using fluorescence; and determining a signature based on the fluorescence distribution in the sample. issue Creating words and symbols issue For at least a part of the word, issue A word is a legal symbol. issue If no match is found, provide error correction as appropriate. issue Applying it to words, issue This involves forming words.

[0012] In one set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, where a maximum number of the primary amplified nucleic acids are capable of binding to the nucleic acid probe, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0013] In another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, where a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue Create words and sign issue For at least a part of the word, issue A word is a legal symbol. issue Matching to a word, and optionally providing error correction if a match is not found. issue Applying it to words, issue This involves forming words.

[0014] In yet another set of embodiments, the method includes exposing the sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, where binding of the primary amplified nucleic acid to the target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, and generating a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0015] A method according to yet another set of embodiments includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, where binding of the primary amplified nucleic acid to a target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue Create words and sign issue For at least a part of the word, issue A word is a legal symbol. issue Matching to a word, and optionally providing error correction if a match is not found. issue Applying it to words, issue This involves forming words.

[0016] In one set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, where the primary amplified nucleic acid binds to the nucleic acid probe within a fixed distance, determining a distribution of the nucleic acid probe in the sample using fluorescence, and generating a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0017] In another set of embodiments, the method includes exposing the sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, where the primary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0018] A method according to yet another set of embodiments includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, where the primary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue Create words and sign issue For at least a part of the word, issue A word is a legal symbol. issue Matching to a word, and optionally providing error correction if a match is not found. issue Applying it to words, issue This involves forming words.

[0019] According to yet another set of embodiments, a method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, where a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acids to secondary amplified nucleic acids capable of binding to the primary amplified nucleic acids, where a maximum number of secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acids, determining a distribution of the nucleic acid probes in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0020] In another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to a target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0021] In yet another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, where the secondary amplified nucleic acid binds to the primary amplified nucleic acid within a fixed distance, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0022] In yet another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, where the primary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0023] In yet another set of embodiments, the method includes exposing the sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, where the secondary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0024] A method according to another set of embodiments includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0025] In another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0026] According to yet another set of embodiments, the method includes exposing the sample to a binding entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0027] In yet another set of embodiments, the method includes exposing the sample to a binding entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, where binding of the primary amplified nucleic acid to the target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, and generating a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0028] In one set of embodiments, the method includes exposing a sample to a targeting entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0029] In another set of embodiments, a method includes exposing a sample to a targeting entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0030] According to yet another set of embodiments, the method includes exposing the sample to a targeting entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, the primary amplified nucleic acid being formed from only three of the four naturally occurring nucleotides, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0031] In yet another set of embodiments, the method includes exposing the sample to a targeting entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides, determining a distribution of the nucleic acid probe in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue This includes creating words.

[0032] In one set of embodiments, the method includes exposing a sample to a nucleic acid probe, the nucleic acid probe including a first portion including a target sequence and a second portion including one or more read sequences, at least a portion of the plurality of nucleic acid probes including distinguishable nucleic acid probes formed from a combinatorial combination of one or more read sequences taken from the plurality of read sequences, and exposing the nucleic acid probe to primary amplified nucleic acid and secondary amplified nucleic acid, the primary amplified nucleic acid is capable of binding to the nucleic acid probe, the secondary amplified nucleic acid is capable of binding to the primary nucleic acid probe, and the maximum number of targets in the sample associated with the primary amplified nucleic acid and the secondary amplified nucleic acid is constant.

[0033] In another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, determining a distribution of the secondary amplified nucleic acid in the sample using fluorescence, and determining a signature based on the fluorescence distribution in the sample. issue Create words and sign issue For at least a part of the word, issue A word is a legal symbol. issueIf no match is found, error correction is performed. issue Applying it to words, issue This involves forming words.

[0034] In another aspect, the invention includes a method of performing one or more of the embodiments described herein. In yet another aspect, the invention includes a method of using one or more of the embodiments described herein.

[0035] Other advantages and novel features of the present invention will become apparent from the following detailed description of various non-limiting embodiments of the invention when considered in conjunction with the accompanying drawings.

[0036] Non-limiting embodiments of the present invention are described by way of example with reference to the accompanying drawings, which are schematic and are not intended to be drawn to scale. In the drawings, each identical or nearly identical component illustrated is typically represented by a single number. For purposes of clarity, unless illustration is necessary to enable a person skilled in the art to understand the invention, not every component will be shown in every figure, nor will every component of every embodiment of the invention be shown. [Brief description of the drawings]

[0037] [Figure 1-1] 1A-1E provide schematic illustrations of embodiments in which primary and secondary amplification nucleic acids are used to amplify a signal. [Figure 1-2] Same as above [Figure 2-1] 2A-2F illustrate that amplification can dramatically increase signal brightness without a substantial change in spot size, according to another embodiment of the present invention. [Figure 2-2] Same as above [Figure 3-1] 3A to 3F illustrate MERFISH measurements on 130 RNAs in yet another embodiment of the present invention. [Figure 3-2] Same as above [Figure 4] 4A-4C illustrate amplification in a tissue sample in yet another embodiment of the present invention. [Figure 5-1] 5A-5C illustrate certain example sequences used for amplification in one embodiment of the present invention. [Figure 5-2] Same as above [Figure 5-3] Same as above DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0038] The present invention generally relates to systems and methods for imaging or determining nucleic acids in cells or other samples. In some cases, the transcriptome of a cell can be determined. Certain embodiments are generally directed to determining nucleic acids and other targets in a sample at relatively high resolution. For example, a nucleic acid probe can be applied to the sample, and the binding of the nucleic acid probe to the target can be amplified using primary and secondary amplification nucleic acids. In some cases, there is a maximum number of amplified nucleic acids that can be bound to the target, e.g., the binding is saturable and cannot grow indefinitely even in the presence of abundant reagents. This can be advantageous, for example, to control the brightness of each binding event, control the size of the amplified region (e.g., when imaging), and / or limit amplification noise (i.e., the final variation of the amplified signal between molecules), etc. In addition, in some embodiments, the primary and / or secondary amplification nucleic acids can be formed from only three of the four naturally occurring nucleotides, which can result in reduced secondary structure, increased binding rate, etc. These properties optionally facilitate the rapid design of multiple orthogonal amplification sequences, allowing the extension of such techniques to many significantly different molecular targets. The present invention may provide: [Section 1] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, such that a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a primary amplified nucleic acid capable of binding to the primary amplified nucleic acid, such that a maximum number of secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least a portion of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. The method includes: [Section 2] 2. The method of claim 1, comprising exposing the sample to at least five different nucleic acid probes. [Section 3] 3. The method of claim 1 or 2, comprising exposing the sample to at least 10 different nucleic acid probes. [Section 4] 4. The method of any one of paragraphs 1 to 3, comprising exposing the sample to at least 100 different nucleic acid probes. [Section 5] 5. The method of any one of paragraphs 1 to 4, comprising sequentially exposing the sample to a plurality of nucleic acid probes. [Section 6] 6. The method of any one of paragraphs 1 to 5, wherein the plurality of nucleic acid probes comprises a combinatorial combination of nucleic acid probes with different sequences. [Section 7] 7. The method of claim 6, wherein the combinatorial combination of nucleic acid probes targets combinatorial combinations of RNA molecular species in the sample. [Section 8] 8. The method of claim 6 or 7, wherein the combinatorial combination of nucleic acid probes targets combinatorial combinations of DNA sequences in the sample. [Section 9] 9. The method of any one of paragraphs 1 to 8, wherein at least a portion of the plurality of nucleic acid probes comprises DNA. [Section 10] 10. The method of any one of paragraphs 1 to 9, wherein at least a portion of the plurality of nucleic acid probes comprises RNA. [Section 11] 11. The method according to any one of items 1 to 10, wherein the plurality of nucleic acid probes have an average length of between 10 and 300 nucleotides. [Section 12] 12. The method of any one of paragraphs 1 to 11, wherein at least a portion of the plurality of nucleic acid probes are configured to bind to nucleic acids in the sample. [Section 13] 13. The method of any one of paragraphs 1 to 12, wherein at least a portion of the plurality of nucleic acid probes comprises a target sequence and one or more lead sequences. [Section 14] Item 14. The method according to item 13, wherein the target sequences of the multiple nucleic acid probes have an average length between 10 and 200 nucleotides. [Section 15] 15. The method of claim 13 or 14, wherein the target sequence is substantially complementary to a nucleic acid sequence encoding a protein. [Section 16] 16. The method of any one of paragraphs 13 to 15, wherein the target sequence binds to the target via specific binding. [Section 17] 17. The method of claim 16, wherein the target comprises RNA. [Section 18] The method of claim 17, wherein the RNA comprises a non-coding RNA. [Section 19] 19. The method of claim 17 or 18, wherein the RNA comprises mRNA. [Section 20] 20. The method of any one of paragraphs 17 to 19, wherein the RNA comprises transfer RNA (tRNA). [Section 21] 21. The method of any one of paragraphs 17 to 20, wherein the RNA comprises ribosomal RNA (rRNA). [Section 22] 22. The method of any one of paragraphs 16 to 21, wherein the target comprises DNA. [Section 23] 23. The method of claim 22, wherein the DNA comprises genomic DNA. [Section 24] 24. The method of any one of paragraphs 13 to 23, wherein the primary amplified nucleic acid is bound to the nucleic acid probe via a lead sequence. [Section 25] 25. The method of any one of paragraphs 13 to 24, wherein the plurality of nucleic acid probes comprises distinguishable nucleic acid probes formed from combinatorial combination of one or more pools of lead sequences. [Section 26] 26. The method of claim 25, wherein the pool has at least eight possible lead sequences. [Section 27] 27. The method of claim 25 or 26, wherein the pool has at least 16 possible lead sequences. [Section 28] 28. The method of any one of paragraphs 25 to 27, wherein the pool has at least 24 possible lead sequences. [Section 29] 29. The method of any one of clauses 25 to 28, wherein the pool has at least 32 possible lead sequences. [Section 30] 30. The method of any one of paragraphs 25 to 29, wherein the pool has at least 48 possible lead sequences. [Section 31] 31. The method of any one of paragraphs 25 to 30, wherein the pool has at least 64 possible lead sequences. [Section 32] 32. The method of any one of clauses 25 to 31, wherein the pool has no more than 32 possible lead sequences. [Section 33] 33. The method of any one of clauses 25 to 32, wherein the pool has no more than 16 possible lead sequences. [Section 34] 34. The method of any one of paragraphs 25 to 33, wherein the multiple read sequences are distributed on multiple nucleic acid probes so as to define an error correcting code. [Section 35] 35. The method of any one of claims 13 to 34, wherein the lead sequence has an average length between 5 nucleotides and 50 nucleotides. [Section 36] 36. The method of any one of paragraphs 13 to 35, wherein at least a portion of the plurality of nucleic acid probes comprises no more than 10 lead sequences. [Section 37] 37. The method of any one of paragraphs 13 to 36, wherein at least a portion of the plurality of nucleic acid probes comprises no more than five lead sequences. [Section 38] 38. The method of any one of paragraphs 1 to 37, wherein no more than 20 primary amplified nucleic acids are allowed to bind to the nucleic acid probe. [Section 39] 39. The method of any one of paragraphs 1 to 38, wherein no more than 10 primary amplified nucleic acids are allowed to bind to the nucleic acid probe. [Section 40] 40. The method of any one of paragraphs 1 to 39, wherein no more than five primary amplified nucleic acids are allowed to bind to the nucleic acid probe. [Section 41] 41. The method of any one of paragraphs 1 to 40, wherein the primary amplified nucleic acids have an average length of less than 300 nucleotides. [Section 42] 42. The method of any one of paragraphs 1 to 41, wherein the primary amplified nucleic acids have an average length of less than 200 nucleotides. [Section 43] 43. The method of any one of paragraphs 1 to 42, wherein the primary amplified nucleic acid has a repeat sequence to which the secondary amplified nucleic acid can bind. [Section 44] 44. The method of any one of paragraphs 1 to 43, wherein the secondary amplified nucleic acids each target a sequence of less than 10 nucleotides on the primary amplified nucleic acid. [Section 45] 45. The method of any one of paragraphs 1 to 44, wherein the primary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides. [Section 46] 46. ​​The method of any one of paragraphs 1 to 45, wherein no more than 20 secondary amplified nucleic acids are allowed to bind to the primary amplified nucleic acid. [Section 47] 47. The method of any one of paragraphs 1 to 46, wherein no more than 10 secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid. [Section 48] 48. The method of any one of paragraphs 1 to 47, wherein no more than five secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid. [Section 49] 49. The method of any one of paragraphs 1 to 48, wherein the secondary amplified nucleic acids have an average length of less than 300 nucleotides. [Section 50] 50. The method of any one of paragraphs 1 to 49, wherein the secondary amplified nucleic acids have an average length of less than 200 nucleotides. [Section 51] 51. The method of any one of paragraphs 1 to 50, wherein the secondary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides. [Section 52] 52. The method of any one of paragraphs 1 to 51, wherein the secondary amplified nucleic acid comprises a fluorescent signal generating entity. [Section 53] 53. The method of any one of paragraphs 1 to 52, further comprising exposing the secondary amplified nucleic acid to a fluorescent signal generating entity. [Section 54] 54. The method of claim 52 or 53, wherein the secondary amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 55] 55. The method of any one of paragraphs 52 to 54, wherein the fluorescent signal generating entity is linked to the secondary amplified nucleic acid by a disulfide. [Section 56] 52. The method of any one of paragraphs 1 to 51, further comprising exposing the secondary amplified nucleic acid to a tertiary amplified nucleic acid capable of binding to the secondary amplified nucleic acid. [Section 57] 57. The method of claim 56, wherein the tertiary amplified nucleic acid comprises a fluorescent signal generating entity. [Section 58] 57. The method of claim 56, further comprising exposing the tertiary amplified nucleic acid to a fluorescent signal generating entity. [Section 59] 59. The method of claim 57 or 58, wherein the tertiary amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 60] 57. The method of claim 56, further comprising exposing the tertiary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 61] 61. The method of claim 60, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 62] 61. The method of claim 60, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 63] 63. The method of claim 61 or 62, wherein the final round of amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 64] 64. The method of any one of paragraphs 52 to 55, 57 to 59, or 61 to 63, wherein the fluorescent signal generating entity comprises a protein. [Section 65] 55. The method of any one of paragraphs 52 to 55, 57 to 59, or 61 to 64, wherein the fluorescent signal generating entity comprises a dye. [Section 66] 66. The method of any one of paragraphs 52 to 55, 57 to 59, or 61 to 65, wherein the fluorescent signal generating entity comprises Alexa Fluor 750. [Section 67] 67. The method of any one of paragraphs 52 to 55, 57 to 59, or 61 to 66, wherein the fluorescent signal generating entity comprises Cy5. [Section 68] 68. The method of any one of paragraphs 52 to 55, 57 to 59, or 61 to 67, wherein the fluorescent signal generating entity comprises a nanoparticle. [Section 69] 70. The method of any one of paragraphs 52 to 55, 57 to 59, or 61 to 68, comprising inactivating the fluorescent signal generating entity during exposure of the sample to the nucleic acid probe. [Section 70] 70. The method of claim 69, comprising inactivating the fluorescent signal generating entity by removing the fluorescent signal generating entity. [Section 71] 71. The method of claim 69 or 70, comprising inactivating the fluorescent signal generating entity using a reducing agent. [Section 72] 72. The method of any one of paragraphs 69 to 71, comprising inactivating the fluorescent signal generating entity using disulfide cleavage. [Section 73] 73. The method of any one of paragraphs 69 to 72, comprising inactivating the fluorescent signal generating entity by photobleaching the fluorescent signal generating entity. [Section 74] 74. The method of any one of paragraphs 69 to 73, comprising inactivating the fluorescent signal generating entity by chemical bleaching of the fluorescent signal generating entity. [Section 75] 75. The method of any one of paragraphs 69 to 74, comprising inactivating the fluorescent signal generating entity by enzymatic cleavage of the fluorescent signal generating entity. [Section 76] 76. The method of any one of paragraphs 1 to 75, wherein the plurality of nucleic acid probes defines a code space having a Hamming distance of at least 2. [Section 77] 77. The method of any one of paragraphs 76, wherein the plurality of nucleic acid probes defines a code space having a Hamming distance of at least 3. [Section 78] 78. The method of claim 76 or 77, wherein the code space is a Hamming(7,4) code, a Hamming(15,11) code, a Hamming(31,26) code, a Hamming(63,57) code, or a Hamming(127,120) code. [Section 79] 79. The method of any one of clauses 76 to 78, wherein the code space is a SECDED code. [Section 80] 80. The method of claim 79, wherein the code space is a SECDED(8,4) code, a SECDED(16,4) code, a SECDED(16,11) code, a SECDED(22,16) code, a SECDED(39,32) code, or a SECDED(72,64) code. [Section 81] 81. The method of any one of paragraphs 76 to 80, wherein the nucleic acid probe defines a code space having a fixed number of ones only. [Section 82] 82. The method of any one of paragraphs 1 to 81, comprising determining the distribution of the nucleic acid probe by imaging at least a portion of the sample. [Section 83] 83. The method of claim 82, comprising determining binding of the nucleic acid probe using optical imaging techniques. [Section 84] 84. The method of claim 82 or 83, comprising determining binding of the nucleic acid probe using fluorescent imaging. [Section 85] 85. The method of any one of paragraphs 82 to 84, comprising determining binding of the nucleic acid probe using multi-color fluorescence imaging. [Section 86] 86. The method of any one of paragraphs 82 to 85, comprising determining binding of the nucleic acid probe using ultra-high resolution fluorescence imaging. [Section 87] 87. The method of claim 86, comprising determining binding of the nucleic acid probe using stochastic optical reconstruction microscopy (STORM). [Section 88] 88. The method of any one of paragraphs 82 to 87, comprising determining the centroid of the image for the secondary amplified nucleic acid using an algorithm to determine non-overlapping single emitters. [Section 89] 89. The method of any one of paragraphs 82 to 88, comprising determining the centroid of the image for the secondary amplified nucleic acid using an algorithm to determine partially overlapping single emitters. [Section 90] 90. The method of claim 88 or 89, further comprising determining a confidence level for the secondary amplified nucleic acid. [Section 91] 91. The method of claim 90, comprising determining a confidence level using a ratio of the number of exact matches to the number of matches having one or more single-bit errors for the code word. [Section 92] 92. The method of claim 90 or 91, comprising determining the confidence level using a ratio of the number of exact matches to the number of matches having exactly one 1-bit error for the code word. [Section 93] 93. The method of claim 82 to 92, comprising determining the distribution of nucleic acid probes in a sample at a resolution of greater than 300 nm. [Section 94] 94. The method of claim 82 to 93, comprising determining the distribution of nucleic acid probes in a sample at a resolution of greater than 100 nm. [Section 95] 95. The method of claim 82 to 94, comprising determining the distribution of nucleic acid probes in a sample at a resolution of greater than 50 nm. [Section 96] 96. The method of any one of paragraphs 1 to 95, wherein the sample comprises cells. [Section 97] 97. The method of claim 96, wherein the cell is a human cell. [Section 98] 98. The method of any one of paragraphs 96 to 97, wherein the cells are fixed. [Section 99] 99. The method of any one of paragraphs 1 to 98, wherein the sample comprises tissue. [Section 100] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least a portion of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. The method includes: [Section 101] The method of claim 100, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, in which each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid. [Section 102] 102. The method of claim 101, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 103] 102. The method of claim 101, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 104] 104. The method of claim 102 or 103, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 105] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, the secondary amplified nucleic acid binding within a fixed distance to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least a portion of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. The method includes: [Section 106] The method of claim 105, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, in which each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid. [Section 107] 107. The method of claim 106, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 108] 107. The method of claim 106, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 109] 109. The method of claim 107 or 108, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 110] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, the primary amplification nucleic acid being formed from only three of the four naturally occurring nucleotides; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least a portion of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. The method includes: [Section 111] The method of claim 110, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 112] 112. The method of claim 111, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 113] 112. The method of claim 111, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 114] 114. The method of claim 112 or 113, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 115] 115. The method of any one of paragraphs 111 to 114, wherein at least one of the amplified nucleic acids of the one or more further rounds is formed from only three of the four naturally occurring nucleotides. [Section 116] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, the secondary amplified nucleic acid being formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least a portion of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. The method includes: [Section 117] 117. The method of claim 116, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 118] 118. The method of claim 117, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 119] 118. The method of Clause 117, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 120] 120. The method of claim 118 or 119, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 121] 121. The method of any one of paragraphs 117 to 120, wherein at least one of the amplified nucleic acids of the one or more further rounds is formed from only three of the four naturally occurring nucleotides. [Section 122] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, such that a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 123] 123. The method of claim 122, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity. [Section 124] 123. The method of claim 122, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity. [Section 125] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, such that a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and generating code words based on the fluorescence distribution in the sample, and for at least a portion of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form the valid code words. The method includes: [Section 126] 126. The method of claim 125, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity. [Section 127] 126. The method of claim 125, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity. [Section 128] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein binding of the primary amplified nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 129] 130. The method of claim 128, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity. [Section 130] 130. The method of Paragraph 128, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity. [Section 131] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein binding of the primary amplified nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and generating code words based on the fluorescence distribution in the sample, and for at least a portion of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form the valid code words. The method includes: [Section 132] 132. The method of claim 131, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity. [Section 133] 132. The method of claim 131, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity. [Section 134] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, the primary amplified nucleic acid binding to the nucleic acid probe within a fixed distance; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 135] 135. The method of claim 134, wherein for at least a portion of the code words, the code words are matched to valid code words. [Section 136] 136. The method of claim 135, wherein if a match is not found, error correction is applied to the code word to form a valid code word. [Section 137] 137. The method of any one of paragraphs 134 to 136, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity. [Section 138] 137. The method of any one of paragraphs 134 to 136, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity. [Section 139] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, the primary amplification nucleic acid being formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 140] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, the primary amplification nucleic acid being formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and generating code words based on the fluorescence distribution in the sample, and for at least a portion of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form the valid code words. The method includes: [Section 141] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, such that a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein a maximum number of secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 142] 142. The method of claim 141, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 143] 143. The method of claim 142, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 144] 143. The method of claim 142, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 145] 145. The method of claim 143 or 144, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 146] 146. The method of any one of clauses 141 to 145, wherein for at least a portion of the code words, the code words are matched to valid code words. [Section 147] 147. The method of claim 146, optionally applying error correction to the code word to form a valid code word if a match is not found. [Section 148] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 149] The method of claim 148, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 150] 150. The method of claim 149, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 151] 150. The method of claim 149, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 152] 152. The method of claim 150 or 151, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 153] 153. The method of any one of clauses 148 to 152, wherein for at least a portion of the code words, the code words are matched to valid code words. [Section 154] 154. The method of claim 153, optionally applying error correction to the code word to form a valid code word if a match is not found. [Section 155] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, the secondary amplified nucleic acid binding within a fixed distance to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 156] 156. The method of claim 155, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 157] 157. The method of claim 156, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 158] 157. The method of claim 156, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 159] 159. The method of claim 157 or 158, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 160] 160. The method of any one of clauses 155 to 159, wherein for at least a portion of the code words, the code words are matched to valid code words. [Section 161] 161. The method of claim 160, optionally applying error correction to the code word if a match is not found to form a valid code word. [Section 162] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, the primary amplification nucleic acid being formed from only three of the four naturally occurring nucleotides; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 163] 163. The method of claim 162, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 164] 164. The method of claim 163, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 165] 164. The method of claim 163, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 166] 166. The method of claim 164 or 165, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 167] 167. The method of any one of clauses 162 to 166, matching the code words to valid code words for at least a portion of the code words. [Section 168] 168. The method of claim 167, optionally applying error correction to the code word to form a valid code word if a match is not found. [Section 169] 169. The method of any one of paragraphs 162 to 168, wherein at least one of the amplified nucleic acids of the one or more further rounds is formed from only three of the four naturally occurring nucleotides. [Section 170] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, the secondary amplified nucleic acid being formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 171] The method of claim 170, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 172] 172. The method of claim 171, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 173] 172. The method of claim 171, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 174] 174. The method of claim 172 or 173, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 175] 175. The method of any one of clauses 170 to 174, wherein for at least a portion of the code words, the code words are matched to valid code words. [Section 176] 176. The method of claim 175, optionally applying error correction to the code word if a match is not found to form a valid code word. [Section 177] 177. The method of any one of paragraphs 170 to 176, wherein at least one of the amplified nucleic acids of the one or more further rounds is formed from only three of the four naturally occurring nucleotides. [Section 178] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 179] exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 180] 180. The method of claim 179, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 181] 181. The method of claim 180, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 182] 181. The method of Clause 180, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 183] 183. The method of claim 181 or 182, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 184] exposing the sample to a binding entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 185] exposing the sample to a binding entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein binding of the primary amplified nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 186] exposing the sample to a targeting entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 187] 187. The method of claim 186, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 188] 188. The method of Paragraph 187, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 189] 188. The method of Clause 187, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 190] 190. The method of claim 188 or 189, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 191] exposing the sample to a targeting entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 192] 192. The method of claim 191, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 193] 193. The method of claim 192, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 194] 193. The method of claim 192, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 195] 195. The method of claim 193 or 194, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 196] exposing the sample to a targeting entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, the primary amplification nucleic acid being formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 197] 202. The method of claim 196, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 198] 200. The method of claim 197, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 199] 200. The method of claim 197, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 200] 200. The method of claim 198 or 199, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 201] 201. The method of any one of clauses 196 to 200, wherein for at least a portion of the code words, the code words are matched to valid code words. [Section 202] If no match is found, then the method of claim 201 optionally applies error correction to the code word to form a valid code word. [Section 203] 203. The method of any one of paragraphs 196 to 202, wherein at least one of the amplified nucleic acids of the one or more further rounds is formed from only three of the four naturally occurring nucleotides. [Section 204] exposing the sample to a targeting entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, the secondary amplified nucleic acid being formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the distribution of fluorescence in a sample The method includes: [Section 205] 205. The method of claim 204, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to a preceding round of amplified nucleic acid. [Section 206] 206. The method of claim 205, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity. [Section 207] 206. The method of claim 205, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity. [Section 208] 208. The method of claim 206 or 207, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind. [Section 209] 209. The method of any one of clauses 204 to 208, matching the code words to valid code words for at least a portion of the code words. [Section 210] 209. The method of claim 209, wherein if a match is not found, optionally, error correction is applied to the code word to form a valid code word. [Section 211] 211. The method of any one of paragraphs 204 to 210, wherein at least one of the amplified nucleic acids of the one or more further rounds is formed from only three of the four naturally occurring nucleotides.

[0039] In one aspect, the present invention is generally directed to systems and methods for amplifying the signals of targets (potentially tens, hundreds, thousands, or more) in biological samples using MERFISH or other techniques, for example, for imaging. For example, in some embodiments, these techniques provide a fast, simple, and / or efficient way to amplify the signals of hundreds or thousands of RNA targets simultaneously, for example, in the natural environment of a biological sample. Such amplification can be well controlled in certain embodiments by using a saturable system, as discussed herein. This allows for minimization of spot-to-spot brightness variations during amplification, which can be useful in decoding using MERFISH or other techniques. In some embodiments, the size of the amplified spots is also not increased. This can improve, for example, the ability to identify targets that are located relatively close to each other. For example, if the spot size is increased too much, the signal from one target can overlap with the signal from another target. In addition, as discussed below, in some embodiments, the amplification nucleic acid does not contain, for example, hairpin structures that may be involved in the amplification process, which can facilitate the creation of saturable systems and / or the design of multiplex amplifier systems can be applied to multiple targets.In addition, as also discussed below, the amplification nucleic acid can be constructed using only three nucleotides. Three-letter nucleotides can have significantly lower secondary structures and faster binding rates than four-letter nucleotides.In addition, in some cases, the likelihood that any given amplification sequence will work reliably is increased, for example, by reducing the possibility of unintended secondary structures.

[0040] A non-limiting example of such a system is now illustrated in Figures 1A-1E. In Figure 1A, a target 10 (in this example, RNA) is illustrated. There are hundreds or thousands of targets distributed in a biological sample (e.g., within a cell or tissue), and the binding of a nucleic acid probe to the target can be used to determine their distribution by imaging the sample, for example, using a fluorescent probe. However, it should be noted that in this figure, for clarity, only a single target is illustrated.

[0041] In some embodiments, multiple nucleic acid probes having different sequences are used, and the distribution of each of the nucleic acid probes is analyzed sequentially, and a "signature" is generated for each position based on the binding pattern of each of the nucleic acid probes. issue The appropriate mark is used to create a "word". issue By selecting nucleic acid probes that define a code space, apparent errors in the observed binding patterns can be identified and / or rejected and / or properly coded. issue The error-robust and error-correcting systems are first introduced for multiplexed error-robust fluorescence in situ hybridization (MERFISH) and have subsequently been used in a variety of related techniques. See, for example, International Patent Application Publication Nos. WO2016 / 018960 and WO2016 / 018963, each of which is incorporated herein by reference in its entirety.

[0042] An example of an encoding nucleic acid probe is shown in FIG. 1A, where encoded nucleic acid probe 15 (indicated by a dotted box) is bound to a target 10, e.g., a target RNA. Other nucleic acid probes 16, 17 may also bind to the target RNA and / or other targets in the sample. Probe 15 may include a target sequence 11 capable of binding to the target RNA (e.g., via specific binding) and a lead sequence 12 (or "readout" sequence), i.e., a sequence that can be "read" to determine whether binding has occurred or not. There may be one, two, three, or more lead sequences on a probe. For example, in this example, there are two such lead sequences on probe 15 (identified as lead sequence 12 and lead sequence 19). The lead sequences may each, independently, be the same or different. In addition, probes such as 16 and 17 may have the same or different number of lead sequences and / or may have the same or different structure as nucleic acid probe 15.

[0043] If no amplification is applied, the nucleic acid probe 15 can be exposed to a suitable secondary nucleic acid probe 32 containing a signaling entity 40, as shown in FIG. 1E. In this example, the signaling entity is linked to the secondary nucleic acid probe via a disulfide linkage, although in other embodiments other techniques can be used. However, in this case, only one signaling entity can be linked to the target. Therefore, it is relatively difficult to detect and use a single signaling entity to determine the binding of the nucleic acid probe 15 to the target 10 due to the low signal intensity resulting after such a binding event.

[0044] Thus, in FIG. 1B, according to certain embodiments, a primary amplified nucleic acid 20 can be used. The primary amplified nucleic acid can contain a first primary recognition sequence 22 capable of binding (e.g., specifically) to the lead sequence of the nucleic acid probe 15, as discussed below, and one or more primary lead sequences 23 capable of binding (e.g., specifically) to one or more secondary amplified nucleic acids. In this example, "N" such lead sequences are shown diagrammatically within the primary amplified nucleic acid (N can be, for example, 5, 7, 9, or other numbers, as discussed herein). The primary lead sequences can each have the same or different sequences and can have the same or different lengths. In this example, each lead sequence is 20 nucleotides long, but this is for example purposes only. Additionally, as already mentioned, in this example, two such primary amplified nucleic acids are shown, but this is for example purposes only, and in other embodiments, other numbers of primary amplified nucleic acids can be attached to the nucleic acid probe.

[0045] A secondary amplified nucleic acid 30 can then be attached to the primary amplified nucleic acid, as shown in Figure 1C. The secondary amplified nucleic acid can contain a first recognition sequence 33 capable of binding (e.g., specifically) to the lead sequence 23 of the primary amplified nucleic acid 20, and one or more secondary lead sequences 34 capable of binding to a signal generating entity, as discussed below.

[0046] As with the primary amplified nucleic acid, there can be any number of secondary read sequences within the secondary amplified nucleic acid, as shown in this figure. The secondary read sequences can each have the same or different sequences compared to each other, and can have the same or different lengths. The secondary read sequences can also be the same or different from the read sequence of the primary amplified nucleic acid. In this example, each secondary amplified nucleic acid can have "M" read sequences. M can be, for example, 5, 7, 9, or other numbers, as discussed herein, and M can be the same or different from N.

[0047] In Figure ID, multiple signal generating entities 40 are attached to the lead sequence of the secondary amplified nucleic acid. In this example, the signal generating entities are each attached via a disulfide linkage, although as discussed herein, in other embodiments, other techniques may be used.

[0048] In addition, in this case, it is expected that there is a maximum number or saturation limit of signal generating entities bound to each lead sequence of target sequence.In this particular example, assuming that both have substantially the same structure (though they do not necessarily have the same structure, i.e., for example, when having amplified nucleic acids with different structures, the same number of N×M positions are available), N×M such positions are available for each lead sequence of nucleic acid probe (two such lead sequences in this figure).Therefore, the number of signal generating entities that can associate with a given target is a finite and predictable number, and cannot grow indefinitely or without binding.

[0049] In this example, two lead sequences, lead sequences 12 and 19, each of which may have a primary and secondary amplified nucleic acid, and an associated signal generating entity, are discussed. These may or may not have the same or different structures, e.g., the signal generating entity and / or amplified nucleic acid associated with lead sequence 12 is not associated with lead sequence 19, and vice versa (however, as mentioned above, in this example, the two lead sequences are presented for example purposes only, and in other embodiments, there may be one, two, three, four, etc. significantly different lead sequences that may be amplified in parallel, e.g., using similar techniques, including techniques with significantly different amplified nucleic acids). The lead sequences may be determined independently, e.g., sequentially or simultaneously, by determining the signal generating entity associated with each of the lead sequences, which may be the same or different. For example, as shown in FIG. 1D, signal generating entity 40 can be associated with primary amplified nucleic acid 20 and secondary amplified nucleic acid 30, and ultimately with lead sequence 12, but not with lead sequence 19 or the primary amplified nucleic acid and secondary amplified nucleic acid associated therewith, primary amplified nucleic acid 29 and secondary amplified nucleic acid 39, respectively.

[0050] Additionally, in some embodiments, amplification can involve, as the case may be, combining only one round of amplified nucleic acid (resulting in an N-fold amplification), two rounds (resulting in an N×M-fold amplification), three rounds (resulting in an N×M×O-fold amplification, where the third round molecule contains O lead sequences), or more rounds. As the case may be, any number of rounds of amplification can be applied.

[0051] In addition, a sample may contain nucleic acid probes with many different readout sequences that can be recognized, for example, using different amplification nucleic acids or signal generating entities. For example, 8, 10, 12, 14, 16, 24, 32, 48, 64, or other numbers of readout sequences, including more than 64 rounds, could be used. In some cases, a unique amplification nucleic acid can be used to amplify the readout sequence, for example, the original readout sequence present can be amplified, for example, into N×M copies, using a suitable amplification nucleic acid. In certain cases, the amplification nucleic acid can be designed efficiently. For example, the probability of unforeseen secondary structures in the amplified nucleic acid can be reduced by utilizing only three of the four nucleotides in the sequence of the amplified nucleic acid. Without wishing to be bound by theory, it is believed that the effect of such secondary structures on the amplified nucleic acid itself, or on the binding of subsequent amplified nucleic acids, is difficult to predict, so reducing or eliminating secondary structures can increase the probability that a given amplified nucleic acid will assemble properly, which may facilitate the design and use of multiple orthogonal amplified nucleic acids. In addition, by reducing secondary structures, which may also inhibit the binding rate of these amplified nucleic acids, such design considerations may shorten the time required to assemble such structures, may reduce the amount of amplified nucleic acid required for each sample, etc.

[0052] The controlled amplification provided by this approach is in contrast to techniques such as hairpin unfolding or rolling circle amplification, in which signal amplification grows in an essentially uncontrolled manner or without limit when sufficient reagent is present. Such uncontrolled amplification can be difficult to determine accurately, since the amount of signal present may not correlate well with the number of targets or the location of the targets (e.g., since a large amount of signal is created by uncontrolled amplification, the "spot size" that appears in the microscopic image may grow large and not necessarily centered near the target, impairing image resolution or interfering with the signal from other nearby targets). In contrast, the use of saturable amplification methods discussed herein can create the maximum number of signal-generating entities that can associate with the target, which limits the spot size, creates uniformity in the brightness or intensity of the spot, improves detection, etc.

[0053] As mentioned, in certain embodiments, such techniques may be combined with error correction, for example, as used in MERFISH or other similar techniques. issue A term can be based on the binding (or non-binding) of multiple nucleic acid probes, and in some cases, the symbol issue The term may define an error correction code that helps to reduce or prevent misidentification of nucleic acid probe. In some cases, for example, by using various combinatorial methods, a relatively small number of labels can be used to identify a relatively large number of different targets. Image acquisition methods such as STORM can also be used to image such samples and facilitate the determination of nucleic acid probe. For example, for further details regarding techniques such as MERFISH, please refer to U.S. Patent No. 9,712,805 or No. 10,073,035, or International Patent Application Publication No. WO2008 / 091296 or No. WO2009 / 085218, each of which is incorporated herein by reference in its entirety.

[0054] The above discussion is a non-limiting example of one embodiment of the present invention that can be used to improve the determination of targets in a sample using MERFISH or other techniques. However, in addition to the embodiments described above, other embodiments may also be possible. Thus, more generally, various aspects of the present invention are directed to various systems and methods for imaging or determining nucleic acids in cells or other samples.

[0055] Thus, certain embodiments are directed to determining samples that may include cell cultures, cell suspensions, biological tissues, biopsies, organisms, etc. The sample may also be acellular, but may nevertheless optionally contain nucleic acid. If the sample contains cells, the cells may be human cells, or any other suitable cells, such as mammalian cells, fish cells, insect cells, plant cells, etc. In some cases, more than one cell may be present.

[0056] In a sample, the targets to be determined may include nucleic acids, proteins, etc. The nucleic acids to be determined may include, for example, DNA (e.g., genomic DNA), RNA, or other nucleic acids present in the cell (or in other samples). The nucleic acids may be endogenous to the cell or may be added to the cell. For example, the nucleic acids may be viral or artificially created. In some cases, the nucleic acids to be determined may be expressed by the cell. In some embodiments, the nucleic acid is RNA. The RNA may be coding RNA and / or non-coding RNA. For example, the RNA may code for a protein. Non-limiting examples of RNA that may be studied in a cell include mRNA, siRNA, rRNA, miRNA, tRNA, lncRNA, snoRNA, snRNA, exRNA, piRNA, etc.

[0057] In some cases, a substantial portion of the nucleic acids in a cell may be studied. For example, in some cases, a sufficient amount of RNA present in the cell may be determined to provide a partial or complete transcriptome of the cell. In some cases, at least four mRNAs in the cell may be determined, and in some cases, at least 3, at least 4, at least 7, at least 8, at least 12, at least 14, at least 15, at least 16, at least 22, at least 30, at least 31, at least 32, at least 50, at least 63, at least 64, at least 72, at least 75, at least 100, at least 127, at least 128, at least 140, at least 255, at least 256, at least 258, at least 259, at least 30 ... At least 500, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 4,000, at least 5,000, at least 7,500, at least 10,000, at least 12,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 40,000, at least 50,000, at least 75,000, or at least 100,000 mRNAs may be determined.

[0058] In some cases, the transcriptome of a cell can be determined. It should be understood that the transcriptome generally includes all RNA molecules produced in a cell, not just mRNA. Thus, for example, the transcriptome can also include rRNA, tRNA, siRNA, etc. in certain cases. In some embodiments, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the transcriptome of a cell can be determined.

[0059] In some embodiments, the other targets to be determined may include targets linked to nucleic acids, proteins, etc. For example, in one set of embodiments, a binding entity capable of recognizing a target may be conjugated to a nucleic acid probe. The binding entity may be any entity capable of recognizing a target, for example, specifically or non-specifically. Non-limiting examples include enzymes, antibodies, receptors, complementary nucleic acid strands, aptamers, etc. For example, an antibody linked to an oligonucleotide may be used to determine a target. The target may be capable of binding to an antibody linked to an oligonucleotide, and the oligonucleotide may be determined as discussed herein.

[0060] The determination of a target such as a nucleic acid in a cell or other sample may be qualitative and / or quantitative.In addition, the determination may be spatial, for example, the location of a nucleic acid or other target in a cell or other sample may be determined in two or three dimensions.In some embodiments, the location, number, and / or concentration of a nucleic acid or other target in a cell or other sample may be determined.

[0061] In some cases, a substantial portion of the genome of the cell may be determined. The determined genome segments may be continuous or interrupted in the genome. For example, in some cases, at least four genome segments are determined in the cell, and in some cases, at least 3, at least 4, at least 7, at least 8, at least 12, at least 14, at least 15, at least 16, at least 22, at least 30, at least 31, at least 32, at least 50, at least 63, at least 64, at least 72, at least 75, at least 100, at least 127, at least 128, at least 140, at least 255, at least 256, at least 257, at least 259, at least 30 ... At least 500, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 4,000, at least 5,000, at least 7,500, at least 10,000, at least 12,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 40,000, at least 50,000, at least 75,000, or at least 100,000 genome segments may be determined.

[0062] In some cases, the whole genome of a cell can be determined. It should be understood that genome generally includes all DNA molecules produced in a cell, not just chromosomal DNA. Thus, for example, genome can also include, for example, mitochondrial DNA, chloroplast DNA, plasmid DNA, etc., in addition to (or instead of) chromosomal DNA. In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or 100% of the genome of a cell can be determined.

[0063] As discussed herein, various nucleic acid probes can be used to determine one or more targets in cells or other samples. Probes can include nucleic acids (or entities that can specifically hybridize with nucleic acids, for example), such as DNA, RNA, LNA (locked nucleic acid), PNA (peptide nucleic acid), and / or combinations thereof. In some cases, additional components can also be present in the nucleic acid probe, for example, as discussed below. In addition, any suitable method can be used to introduce the nucleic acid probe into cells.

[0064] For example, in some embodiments, cells are fixed before introducing a nucleic acid probe, for example, to preserve the location of nucleic acids or other targets within the cells. Those skilled in the art know techniques for fixing cells. By way of non-limiting example, cells can be fixed using chemicals such as formaldehyde, paraformaldehyde, glutaraldehyde, ethanol, methanol, acetone, acetic acid, etc. In one embodiment, cells can be fixed using HEPES-glutamate buffer-mediated organic solvent (HOPE).

[0065] The nucleic acid probe can be introduced into the cell (or other sample) using any suitable method. In some cases, the cell can be sufficiently permeabilized so that the nucleic acid probe can be introduced into the cell by a fluid containing the nucleic acid probe in the vicinity of the cell. In some cases, the cell can be sufficiently permeabilized as part of a fixation process, and in other embodiments, the cell can be permeabilized by exposure to certain chemicals, such as ethanol, methanol, Triton, etc. Additionally, in some embodiments, techniques such as electroporation or microinjection can be used to introduce the nucleic acid probe into the cell or other sample.

[0066] Thus, certain embodiments are generally directed to nucleic acid probes that are introduced into cells (or other samples). Probes may include any of a variety of entities that can hybridize, depending on the application, typically with nucleic acids such as DNA, RNA, LNA, PNA, etc., by Watson-Crick base pairing. Nucleic acid probes typically contain a target sequence that can bind to at least a portion of a target, e.g., a target nucleic acid. In some cases, the binding can be specific (e.g., via complementary binding). Once introduced into a cell or other system, the target sequence can be capable of binding to a specific target (e.g., mRNA or other nucleic acid discussed herein). Nucleic acid probes may also contain one or more lead sequences, discussed below.

[0067] In some cases, more than one type of nucleic acid probe can be applied to the sample, for example, sequentially or simultaneously. For example, at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 300, at least 1,000, at least 3,000, at least 10,000, or at least 30,000 distinct nucleic acid probes can be applied to the sample. In some cases, the nucleic acid probes can be added sequentially. However, in some cases, more than one type of nucleic acid probe can be added simultaneously.

[0068] Nucleic acid probes may include one or more target sequences, which may be located anywhere within the nucleic acid probe. Target sequences may contain a region that is substantially complementary to a target, e.g., a portion of a target nucleic acid. For example, in some cases, a portion may be at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary, e.g., to provide specific binding. Typically, complementarity is determined based on Watson-Crick nucleotide base pairing.

[0069] In some cases, the target sequence can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the target sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible, for example, the target sequence may have a length between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0070] For targets that may be present in a cell or other sample, the target sequence of the nucleic acid probe can be determined. For example, the target nucleic acid for a protein can be determined using the sequence of the protein, for example, by determining the nucleic acid expressed to form the protein. In some cases, only a portion of the nucleic acid that codes for a protein, for example, having the length discussed above, can be used. In addition, in some cases, more than one target sequence can be used, which can be used to identify a specific target. For example, multiple probes can be used that can sequentially and / or simultaneously bind to or hybridize to the same or different regions of the same target. Hybridization typically refers to the annealing process in which complementary single-stranded nucleic acids associate through Watson-Crick type nucleotide base pairing (e.g., hydrogen bonds between guanine-cytosine and adenine-thymine) to form double-stranded nucleic acid.

[0071] In some embodiments, the nucleic acid probe may also include one or more "lead" sequences. The lead sequence may be used to identify the nucleic acid probe, for example, through association with a signal generating entity, as discussed below. In some embodiments, the nucleic acid probe may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more, 20 or more, 24 or more, 32 or more, 40 or more, 48 or more, 50 or more, 64 or more, 75 or more, 100 or more, 128 or more lead sequences. The lead sequence may be located anywhere within the nucleic acid probe. When more than one lead sequence is present, the lead sequences may be located next to each other and / or may be interrupted by other sequences.

[0072] The lead sequence can be any length. When more than one lead sequence is used, the lead sequences can be independently the same or different. For example, the lead sequence can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the lead sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible, for example, the lead sequence may have a length between 10-30 nucleotides, between 20-40 nucleotides, between 5-50 nucleotides, between 10-200 nucleotides, or between 25-35 nucleotides, between 10-300 nucleotides, etc.

[0073] In some embodiments, the lead sequence may be arbitrary or random. In certain cases, the lead sequence is selected to reduce or minimize homology with other components of a cell or other sample, for example, so that the lead sequence itself does not bind or hybridize with other nucleic acids that may be present in the cell or other sample. In some cases, the homology may be less than 10%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1%. In some cases, there may be less than 20 base pairs, less than 18 base pairs, less than 15 base pairs, less than 14 base pairs, less than 13 base pairs, less than 12 base pairs, less than 11 base pairs, or less than 10 base pairs of homology. In some cases, such base pairs are consecutive.

[0074] In one set of embodiments, the nucleic acid probe population may contain a certain number of lead sequences, which may be less than the number of targets of the nucleic acid probe. Those skilled in the art will appreciate that when there is one signal generating entity and n lead sequences, generally there are 2 n It will be appreciated that up to 1-1 different nucleic acid targets can be uniquely identified. However, it is not necessary that all possible combinations be used. For example, a nucleic acid probe population can target 12 different nucleic acid sequences, but contain no more than 8 lead sequences. As another example, a nucleic acid population can target 140 different nucleic acid sequences, but contain no more than 16 lead sequences. By using different combinations of lead sequences within each probe, different nucleic acid sequence targets can be individually identified. For example, each probe can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, etc. or more lead sequences. In some cases, a nucleic acid probe population can each contain the same number of lead sequences, but in other cases, there can be different numbers of lead sequences on various probes.

[0075] As a non-limiting example, a first nucleic acid probe may contain a first target sequence, a first lead sequence, and a second lead sequence, while a second, different nucleic acid probe may contain a second target sequence, the same first lead sequence, but not the second lead sequence, and a third lead sequence. Such probes may thus be identified by determining the various lead sequences present at or associated with a given probe or location, as discussed herein. For example, a probe may be identified by determining the various lead sequences present at or associated with a given probe or location, as discussed below. issue They can be sequentially identified and coded using the "code word". issue The words may also be subjected to error detection and / or correction.

[0076] In addition, in certain embodiments, the nucleic acid probe populations [and their corresponding, complimentary sites on the coding probes] can be made using only two or three of the four naturally occurring nucleotide bases, such as excluding all "G" or excluding all "C" in the probe population. In certain embodiments, sequences lacking "G" or "C" can form less secondary structure and contribute to more homogeneous and rapid hybridization. Thus, in some cases, the nucleic acid probes can contain only A, T, and G; only A, T, and C; only A, C, and G; or only T, C, and G.

[0077] In one embodiment, the lead sequence on the nucleic acid probe may be capable of binding (e.g., specifically) to a recognition sequence on the corresponding primary amplified nucleic acid. Thus, when the nucleic acid probe recognizes a target in a biological sample, e.g., a DNA or RNA target, the primary amplified nucleic acid may also associate with the target via the nucleic acid probe by interaction, e.g., complementary binding, between the lead sequence of the nucleic acid probe and the recognition sequence on the corresponding primary amplified nucleic acid. For example, the recognition sequence may be capable of recognizing the target lead sequence, but does not substantially recognize or substantially bind to other non-target lead sequences. The primary amplified nucleic acid may also include any of a variety of entities capable of hybridizing with nucleic acids, e.g., DNA, RNA, LNA, and / or PNA, depending on the application. For example, such entities may form part or all of the recognition sequence.

[0078] In some cases, the recognition sequence can be substantially complementary to the target lead sequence. In some cases, the sequence can be at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary. Typically, the complementarity is determined based on Watson-Crick type nucleotide base pairing. The structure of the target lead sequence can include those structures previously described.

[0079] In some cases, the recognition sequence can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the recognition sequence may be no more than 500, 450, 400, 350, 300, 250, 200, 175, 150, 125, 100, 75, 60, 65, 60, 55, 50, 45, 40, 35, 30, 20, or 10 nucleotides in length. Combinations of any of these may also be possible, for example, the recognition sequence may have a length between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0080] In some embodiments, the primary amplified nucleic acid may also include one or more lead sequences that can bind to the secondary amplified nucleic acid, discussed below. For example, the primary amplified nucleic acid may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more, 20 or more, 32 or more, 40 or more, 50 or more, 64 or more, 75 or more, 100 or more, 128 or more lead sequences. The lead sequences may be located anywhere within the primary amplified nucleic acid. When more than one lead sequence is present, the lead sequences may be located adjacent to each other and / or may be interrupted by other sequences. In one embodiment, the primary amplified nucleic acid includes a recognition sequence at a first end and multiple lead sequences at a second end.

[0081] In some cases, the lead sequence in the primary amplified nucleic acid can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the lead sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible, for example, the lead sequence may have a length between 10-20 nucleotides, between 10-30 nucleotides, between 20-40 nucleotides, between 5-50 nucleotides, between 10-200 nucleotides, or between 25-35 nucleotides, between 10-300 nucleotides, etc.

[0082] Any number of lead sequences may be present in the primary amplified nucleic acid. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more lead sequences may be present in the primary amplified nucleic acid. When more than one lead sequence is present in the primary amplified nucleic acid, the lead sequences may be the same or different. In some cases, for example, the lead sequences may all be identical.

[0083] In some embodiments, the population of primary amplified nucleic acids may be made using only two or three of the four naturally occurring nucleotide bases, such as excluding all "G" or excluding all "C" in the nucleic acid population. In certain embodiments, sequences lacking "G" or "C" may form fewer secondary structures and contribute to more homogeneous and rapid hybridization. Thus, in some cases, the primary amplified nucleic acids may contain only A, T, and G; only A, T, and C; only A, C, and G; or only T, C, and G.

[0084] In some cases, more than one type of primary amplification nucleic acid may be applied to sample, for example, sequentially or simultaneously.For example, at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 300, at least 1,000, at least 3,000, at least 10,000, or at least 30,000 distinct primary amplification nucleic acids may be applied to sample.In some cases, primary amplification nucleic acids may be added sequentially.However, in some cases, more than one primary amplification nucleic acid may be added simultaneously.

[0085] In one set of embodiments, the lead sequence on the primary amplified nucleic acid may be capable of binding (e.g., specifically) to a recognition sequence on the corresponding secondary amplified nucleic acid. Thus, when the nucleic acid probe recognizes a target in a biological sample, e.g., a DNA or RNA target, the secondary amplified nucleic acid may also associate with the target via the primary amplified nucleic acid by interaction, e.g., complementary binding, between the lead sequence of the primary amplified nucleic acid and the recognition sequence on the corresponding secondary amplified nucleic acid. For example, the recognition sequence on the secondary amplified nucleic acid may be capable of recognizing the lead sequence on the primary amplified nucleic acid, but does not substantially recognize or substantially bind to other non-target lead sequences. The secondary amplified nucleic acid may also include any of a variety of entities capable of hybridizing with nucleic acids, e.g., DNA, RNA, LNA, and / or PNA, depending on the application. For example, such entities may form part or all of the recognition sequence.

[0086] In some cases, the recognition sequence on the secondary amplified nucleic acid can be substantially complementary to the lead sequence on the primary amplified nucleic acid. In some cases, the sequence can be at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary.

[0087] In some cases, the recognition sequence on the secondary amplified nucleic acid can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the recognition sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible, for example, the recognition sequence may have a length between 10-30 nucleotides, between 20-40 nucleotides, between 5-50 nucleotides, between 10-200 nucleotides, or between 25-35 nucleotides, between 10-300 nucleotides, etc.

[0088] In some embodiments, the secondary amplified nucleic acid may also include one or more lead sequences capable of binding to a signal generating entity as discussed herein. For example, the secondary amplified nucleic acid may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more, 20 or more, 32 or more, 40 or more, 50 or more, 64 or more, 75 or more, 100 or more, 128 or more lead sequences capable of binding to a signal generating entity. The lead sequences may be located anywhere within the secondary amplified nucleic acid. When there is more than one lead sequence, the lead sequences may be located adjacent to each other and / or may be interrupted by other sequences. In one embodiment, the secondary amplified nucleic acid includes a recognition sequence at a first end and multiple lead sequences at a second end. This structure may also be the same or different from the structure of the primary amplified nucleic acid.

[0089] In some cases, the lead sequence in the secondary amplified nucleic acid can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the lead sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible, for example, the lead sequence in the secondary amplified nucleic acid may have a length between 10-20 nucleotides, between 10-30 nucleotides, between 20-40 nucleotides, between 5-50 nucleotides, between 10-200 nucleotides, or between 25-35 nucleotides, between 10-300 nucleotides, etc.

[0090] Any number of lead sequences may be present in the secondary amplified nucleic acid. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more lead sequences may be present in the secondary amplified nucleic acid. When more than one lead sequence is present in the secondary amplified nucleic acid, the lead sequences may be the same or different. In some cases, for example, the lead sequences may all be identical. In addition, the same or different number of lead sequences may be present independently in the primary amplified nucleic acid and the secondary amplified nucleic acid.

[0091] In certain embodiments, the population of secondary amplified nucleic acids may be made using only two or three of the four naturally occurring nucleotide bases, such as excluding all "G" or excluding all "C" in the nucleic acid population. In certain embodiments, sequences lacking "G" or "C" may form fewer secondary structures and contribute to more homogeneous and rapid hybridization. Thus, in some cases, the secondary amplified nucleic acids may contain only A, T, and G; only A, T, and C; only A, C, and G; or only T, C, and G.

[0092] In some cases, more than one type of secondary amplified nucleic acid may be applied to sample, for example, sequentially or simultaneously.For example, at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 300, at least 1,000, at least 3,000, at least 10,000, or at least 30,000 distinct secondary amplified nucleic acids may be applied to sample.In some cases, secondary amplified nucleic acids may be added sequentially.However, in some cases, more than one type of secondary amplified nucleic acid may be added simultaneously.

[0093] Additionally, in certain embodiments, this pattern is instead repeated, for example, with a tertiary amplification nucleic acid, a quaternary amplification nucleic acid, etc., prior to the signal generating entity, as discussed above. Thus, the signal generating entity may be bound to the final amplified nucleic acid. Thus, as a non-limiting example, the target may be bound to a coded nucleic acid probe, to which a primary amplified nucleic acid is bound, to which a secondary amplified nucleic acid is bound, to which a tertiary amplified nucleic acid is bound, to which a signal generating entity is bound, or the target may be bound to a coded nucleic acid probe, to which a primary amplified nucleic acid is bound, to which a secondary amplified nucleic acid is bound, to which a tertiary amplified nucleic acid is bound, to which a quaternary amplified nucleic acid is bound, to which a signal generating entity is bound, etc. Thus, in all embodiments, the final amplified nucleic acid does not necessarily have to be a secondary amplified nucleic acid.

[0094] Other components may also be present in the nucleic acid probe or the amplified nucleic acid. For example, in one set of embodiments, one or more primer sequences may be present, for example, to facilitate enzymatic amplification. Those skilled in the art will be aware of primer sequences suitable for applications such as amplification (e.g., using PCR or other suitable techniques). Many such primer sequences are commercially available. Other examples of sequences that may be present in the primary nucleic acid probe include, but are not limited to, promoter sequences, operons, discrimination sequences, nonsense sequences, etc.

[0095] Typically, a primer is a single-stranded or partially double-stranded nucleic acid (e.g., DNA) that is used as a starting point for nucleic acid synthesis, allowing a polymerase enzyme, such as a nucleic acid polymerase, to extend the primer and replicate the complementary strand. A primer is complementary to and hybridizes with (e.g., is designed to be complementary to and hybridize with) a target nucleic acid. In some embodiments, a primer is a synthetic primer. In some embodiments, a primer is a non-naturally occurring primer. A primer typically has a length of 10 to 50 nucleotides. For example, a primer can have a length of 10 to 40, 10 to 30, 10 to 20, 25 to 50, 15 to 40, 15 to 30, 20 to 50, 20 to 40, or 20 to 30 nucleotides. In some embodiments, a primer has a length of 18 to 24 nucleotides.

[0096] In some embodiments, one or more signal generating entities can be bound to a recognition entity on the secondary amplified nucleic acid (or other final amplified nucleic acid). Non-limiting examples of signal generating entities include, for example, fluorescent entities (fluorophores) or phosphorescent entities, discussed below. The signal generating entities can then be determined, for example, to determine the nucleic acid probe or target. In some cases, the determination can be spatial, for example, in two or three dimensions. In addition, in some cases, the determination can be quantitative, for example, the amount or concentration of the signal generating entity and / or the target can be determined.

[0097] In one set of embodiments, the signal generating entity may be conjugated to the secondary amplified nucleic acid (or other final amplified nucleic acid). The signal generating entity may be conjugated to the secondary amplified nucleic acid (or other final amplified nucleic acid) before or after the association of the secondary amplified nucleic acid with the target in the sample. For example, the signal generating entity may be conjugated to the secondary amplified nucleic acid first, or after the secondary amplified nucleic acid is applied to the sample. In some cases, the signal generating entity is added and then reacted to conjugate them to the amplified nucleic acid.

[0098] In one set of embodiments, the signal generating entity may be attached to the nucleotide sequence via a bond that can be cleaved to release the signal generating entity. For example, after determining the distribution of the nucleic acid probe in the sample, the signal generating entity may be released or inactivated before another round of nucleic acid probes and / or amplified nucleic acids. Thus, in some embodiments, the bond may be a cleavable bond, such as a disulfide bond or a photocleavable bond. Examples of photocleavable bonds are discussed in detail herein. In some cases, such bonds may be cleaved, for example, upon exposure to a reducing agent or light (e.g., ultraviolet light). For further details, see below. Other examples of systems and methods for inactivating and / or removing signal generating entities are discussed in detail herein.

[0099] In certain embodiments, the use of primary and secondary amplification nucleic acids suggests that there is a maximum number of signal generating entities that can be bound to a given nucleic acid probe. For example, there is a maximum number of primary amplification nucleic acids that can be bound to a nucleic acid probe, due to the maximum number of secondary amplification nucleic acids that can be bound to a finite number of primary amplification nucleic acids and / or due to the maximum number of primary amplification nucleic acids that can be bound to a lead sequence on a finite number of nucleic acid probes. Although each potential position does not have to actually be filled with a signal generating entity, this structure suggests that there is a saturation limit of signal generating entities beyond which any additional signal generating entities that may by chance be present cannot associate with the nucleic acid probe or its target.

[0100] Thus, certain embodiments of the present invention are generally directed to systems and methods for amplifying signals indicative of a nucleic acid probe or its target that are saturable, i.e., that there is a saturation limit, which is an upper limit on how many signal-generating entities can associate with the nucleic acid probe or its target. Typically, this number is greater than 1. For example, the upper limit of signal-generating entities can be at least 2, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 400, at least 500, etc. In some cases, the upper limit can be less than 500, less than 400, less than 300, less than 250, less than 200, less than 175, less than 150, less than 125, less than 100, less than 75, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10, less than 5, etc. In some cases, the upper limit can be determined as the maximum number of signal-generating entities that can be bound to secondary amplified nucleic acids multiplied by the maximum number of secondary amplified nucleic acids that can be bound to primary amplified nucleic acids multiplied by the maximum number of primary amplified nucleic acids that can be bound to the nucleic acid probe that binds to the target. In contrast, techniques such as rolling circle amplification or hairpin unfolding allow the amplification of signals in an uncontrolled manner, i.e., if sufficient reagents are present, amplification can continue without a predetermined end point or saturation limit. Thus, such techniques do not have a theoretical upper limit on the number of signal-generating entities that can be associated with a nucleic acid probe or its target.

[0101] However, it should be understood that the average number of signal generating entities actually bound to the nucleic acid probe or its target need not actually be the same as that upper limit, i.e., the signal generating entities may not actually be fully saturated (although fully saturated is possible). For example, the saturating amount (or the number of signal generating entities bound compared to the maximum number that can be bound) can be less than 97%, less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, etc., and / or at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, etc. In some cases, allowing time for binding to occur and / or increasing the concentration of the reagents can increase the saturating amount.

[0102] Due to a potential upper limit on the number of signal generating entities actually bound to a nucleic acid probe or its target, binding events distributed, for example spatially, in a sample may exhibit substantially uniform size and / or brightness, in contrast to uncontrolled amplification, such as the uncontrolled amplification discussed above. For example, due to the specific number of secondary amplified nucleic acids that may bind to a primary amplified nucleic acid, the secondary amplified nucleic acid may not be found beyond a fixed distance from the nucleic acid probe or its target, which may limit the "spot size," or diameter of the fluorescence from the signal generating entity, indicative of binding.

[0103] In certain embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the binding events may exhibit substantially the same brightness, size (e.g., apparent diameter), color, etc., which may facilitate distinguishing the binding events from other events, such as non-specific binding, noise, etc.

[0104] In addition, as previously discussed, certain aspects of the present invention provide code that encodes a variety of binding events. issueThe nucleic acid probes may be spaced apart, but may also be spaced apart, using error detection and / or correction to determine the binding of the nucleic acid probes to their targets. In some cases, the population of nucleic acid probes may contain a particular "lead sequence" that can bind to a particular amplified nucleic acid, as discussed above, but the location of the nucleic acid probe or target may be determined in the sample using a signal generating entity associated with the amplified nucleic acid, e.g., a particular signature, e.g., as discussed herein. issue The number of lead sequences in a nucleic acid probe may be determined in space. See also International Patent Application Publication Nos. WO2016 / 018960 and WO2016 / 018963, each of which is incorporated herein by reference in its entirety. As mentioned, in some cases, a population of lead sequences in a nucleic acid probe may be combined in various combinations, e.g., as discussed herein, such that a relatively small number of lead sequences may be used to determine a relatively large number of different nucleic acid probes.

[0105] Thus, in some cases, each nucleic acid probe population may contain a certain number of lead sequences, some of which are shared among different nucleic acid probes, such that the nucleic acid probe population may contain a certain number of lead sequences. The nucleic acid probe population may have any suitable number of lead sequences. For example, the nucleic acid probe population may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. lead sequences. In some embodiments, more than 20 lead sequences may also be possible. Additionally, in some cases, a nucleic acid probe population may have 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 20 or more, 24 or more, 32 or more, 40 or more, 50 or more, 60 or more, 64 or more, 100 or more, 128 or more, etc., lead sequences in total out of the possible lead sequences present, although some or all of the probes may each contain more than one lead sequence as discussed herein. Additionally, in some embodiments, a nucleic acid probe population may have no more than 100, no more than 80, no more than 64, no more than 60, no more than 50, no more than 40, no more than 32, no more than 24, no more than 20, no more than 16, no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, or no more than 2 lead sequences present. Combinations of any of these may also be possible, for example, a nucleic acid probe population may include between 10-15 lead sequences in total.

[0106] As a non-limiting example of a combinatorial approach to identify a relatively large number of nucleic acid probes from a relatively small number of lead sequences contained in the nucleic acid probes, in a population of six different types of nucleic acid probes, each containing one or more lead sequences, the total number of lead sequences in the population may not exceed four. In this example, for ease of explanation, four lead sequences are used, but it should be understood that in other embodiments, a large number of nucleic acid probes can be achieved using, for example, 5, 8, 10, 16, 32, etc., or more lead sequences, or any other suitable number of lead sequences described herein depending on the application. For example, if each of the nucleic acid probes contains two different lead sequences, a maximum of six probes can be identified individually by using four such lead sequences (A, B, C, and D). In this example, the order of the lead sequences on the nucleic acid probes is not critical, i.e., "AB" and "BA" can be treated as synonymous (although in other embodiments, the order of the lead sequences may be critical and "AB" and "BA" may not necessarily be synonymous). Similarly, if five lead sequences (A, B, C, D, and E) are used in a population of nucleic acid probes, then up to ten probes (e.g., AB, AC, AD, AE, BC, BD, BE, CD, CE, DE) can be individually identified. For example, assuming the order of the lead sequences is not critical, one of skill in the art would know that for k lead sequences in a population with n lead sequences on each probe, up to

[0107]

number

[0108] In some embodiments, the lead sequence and / or binding pattern of the nucleic acid probes in the sample can be used to define an error detection and / or error correction signature, e.g., to reduce or prevent misidentification or errors of the nucleic acid. Thus, for example, if binding is indicated (e.g., determined using a signal generating entity), the location can be identified by a "1"; conversely, if no binding is indicated, the location can be identified by a "0" (or vice versa, as the case may be). Then, for example, multiple rounds of binding determination, using different nucleic acid probes, can define a "signature" for this spatial location. issue In some embodiments, the symbol issue The words may be subjected to error detection and / or correction. issue The terms may be constructed such that for a given set of lead sequences or binding patterns of a nucleic acid probe, if no match is found, the match may be identified as an error, and the correction of the error may be a sequence applied to determine the correct target for the nucleic acid probe. issue If the terms encode different nucleic acids, issue The word is a sign. issue There may be fewer "letters" or positions than the total number of nucleic acids encoded by the word.

[0109] Such error detection and / or error correction codes can take a variety of forms. A variety of such codes have already been developed in other contexts, such as the telecommunications industry, such as Golay or Hamming codes. In one set of embodiments, the lead sequences or binding patterns of the nucleic acid probes are assigned such that not all possible combinations are assigned.

[0110] For example, if four lead sequences are possible and the nucleic acid probe contains two lead sequences, then up to six nucleic acid probes can be identified, but the number of nucleic acid probes used can be less than six. Similarly, for k lead sequences in a population with n lead sequences on each nucleic acid probe,

[0111]

number

[0112]

number

[0113] As another example, when multiple rounds of nucleic acid probes are used, the number of rounds can be chosen arbitrarily. If within each round, each target can have two possible outcomes, such as detection or non-detection, then for n rounds of probes, at most 2 n Although different targets are possible, the number of targets actually used is limited to 2 n For example, if within each round, each target can have more than two possible outcomes, such as detection in different color channels, then for n rounds of probes, 2 nMore than one (e.g., 3 n , 4 n , , , , different targets may be possible. In some cases, the number of targets actually used may be any number less than this number. In addition, these may be assigned randomly or in a specific manner that increases the ability to detect and / or correct errors.

[0114] sign issue Words are made up of various symbols. issue For example, in one set of embodiments, the symbol issue The words or nucleic acid probes are coded such that the assignments are separated by a Hamming distance, which measures the number of incorrect "reads" in a given pattern that would cause the nucleic acid probe to be misinterpreted as a different, legitimate nucleic acid probe. issue The assignments may be assigned in space. In certain cases, the Hamming distance may be at least 2, at least 3, at least 4, at least 5, at least 6, etc. Additionally, in one set of embodiments, the assignments may be formed as Hamming codes, e.g., a Hamming(7,4) code, a Hamming(15,11) code, a Hamming(31,26) code, a Hamming(63,57) code, a Hamming(127,120) code, etc. In another set of embodiments, the assignments may form SECDED codes, e.g., a SECDED(8,4) code, a SECDED(16,4) code, a SECDED(16,11) code, a SECDED(22,16) code, a SECDED(39,32) code, a SECDED(72,64) code, etc. In yet another set of embodiments, the assignments may form extended binary Golay codes, complete binary Golay codes, or ternary Golay codes. In another set of embodiments, the assignment may represent a subset of possible values ​​taken from any of the codes listed above.

[0115] For example, an error-correcting code may be formed by encoding a target using only binary words that contain a fixed or constant number of "1" bits (or "0" bits). issueThe space may contain only 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, etc. "1" bits (or "0" bits), e.g., all of the codes have the same number of "1" or "0" bits, etc. In another set of embodiments, the assignment may represent a subset of possible values ​​taken from any of the codes described above for purposes of addressing asymmetric read-out errors. For example, in some cases, a code in which the number of "1" bits may be fixed for all binary words used may eliminate biased measurements of words with different numbers of "1"s when the percentage of "0" bits measured as "1" or the percentage of "1" bits measured as "0" are different.

[0116] Thus, in some embodiments, the symbol issue Once the word has been determined (e.g., as discussed herein), issue The term is a known nucleic acid sequence. issue If a match is found, the nucleic acid target can be identified or determined. If no match is found, the code can be used. issue Errors in word reading can be identified. issue Error correction may also be applied to determine the sequence, thereby resulting in proper identification of the nucleic acid target. issue A word is a single possible and correct symbol, assuming only one error is present. issue Only one word is available, which may be selected to allow only one correct identification of a nucleic acid target. issue It may also be generalized to word spacing or Hamming distance; for example, issue A word is divided into one possible and correct symbol if there are two, three, or four errors (or more, as the case may be). issue Only words are available and can be selected to allow only one proper identification of a nucleic acid target.

[0117] The error correcting code may be a binary error correcting code or may be based on other numbering systems, such as ternary or quaternary error correcting codes. For example, in one set of embodiments, more than one type of signal emitting entity may be used and assigned to different numbers in the error correcting code. Thus, as a non-limiting example, a first signal emitting entity (or, as the case may be, more than one signal emitting entity) may be assigned as a "1" and a second signal emitting entity (or, as the case may be, more than one signal emitting entity) may be assigned as a "2" (with a "0" indicating the absence of a signal emitting entity), and the code issue The words are distributed to define a ternary error correcting code. Similarly, a third signaling entity may be assigned as "3" to create a quaternary error correcting code, and so on.

[0118] As discussed herein, in certain embodiments, the signal generating entity is used to, for example, image, determine and / or encode the nucleic acid probe. issue The term is determined by creating a term. Examples of signal generating entities include those discussed herein. In some cases, the signal generating entities in a sample can be determined, for example, spatially, using various techniques. In some embodiments, the signal generating entities can be fluorescent, and techniques for determining fluorescence in a sample, such as fluorescence microscopy or confocal microscopy, can be used to spatially identify the location of the signal generating entities within a cell. In some cases, the location of the entities in a sample can be determined in two or even three dimensions. In addition, in some embodiments, more than one signal generating entity can be determined simultaneously (e.g., signal generating entities with different colors or emissions) and / or sequentially.

[0119] In addition, in some embodiments, a confidence level for the identified target, e.g., a nucleic acid target, can be determined. For example, the confidence level can be determined using the ratio of the number of exact matches to the number of matches with one or more 1-bit errors. In some cases, only matches with a confidence ratio above a certain value can be used. For example, in certain embodiments, a match can be accepted only if the confidence ratio for the match is greater than about 0.01, greater than about 0.03, greater than about 0.05, greater than about 0.1, greater than about 0.3, greater than about 0.5, greater than about 1, greater than about 3, greater than about 5, greater than about 10, greater than about 30, greater than about 50, greater than about 100, greater than about 300, greater than about 500, greater than about 1000, or any other suitable value. Additionally, in some embodiments, a match may be accepted only if the confidence ratio for the identified target exceeds the internal standard or false positive control by about 0.01, about 0.03, about 0.05, about 0.1, about 0.3, about 0.5, about 1, about 3, about 5, about 10, about 30, about 50, about 100, about 300, about 500, about 1000, or any other suitable value.

[0120] In some embodiments, the spatial location of an entity (and therefore a nucleic acid probe that may be associated with the entity) can be determined at a relatively high resolution. For example, the location can be determined at a spatial resolution of greater than about 100 micrometers, greater than about 30 micrometers, greater than about 10 micrometers, greater than about 3 micrometers, greater than about 1 micrometer, greater than about 800 nm, greater than about 600 nm, greater than about 500 nm, greater than about 400 nm, greater than about 300 nm, greater than about 200 nm, greater than about 100 nm, greater than about 90 nm, greater than about 80 nm, greater than about 70 nm, greater than about 60 nm, greater than about 50 nm, greater than about 40 nm, greater than about 30 nm, greater than about 20 nm, or greater than about 10 nm.

[0121] There are various techniques that can optically determine or image the spatial location of an entity, for example using fluorescence microscopy. In some embodiments, more than one color can be used. In some cases, the spatial location can be determined at ultra-high resolution, or at a resolution that exceeds the wavelength or diffraction limit of light. Non-limiting examples include stochastic optical reconstruction microscopy (STORM), stimulated emission depletion microscopy (STED), near-field scanning optical microscopy (NSOM), 4Pi microscopy, structured illumination microscopy (SIM), spatially modulated illumination microscopy (SMI), reversible saturable optically linear fluorescence transition microscopy (RESOLFT), ground state depletion microscopy (GSD), saturated structured-illumination microscopy (SSIM), spectral precision distance microscopy (SPDM), photoactivated localization microscopy (PALM), fluorescent photoactivated localization microscopy (FPALM), 3D light microscopical nanosizing microscopy (LIMON), super-resolution optical fluctuation imaging (SOFI), and the like.See, for example, U.S. Pat. No. 7,838,302, issued on Nov. 23, 2010, to Zhuang et al., entitled "Sub-Diffraction Limit Image Resolution and Other Imaging Techniques"; U.S. Pat. No. 8,564,792, issued on Oct. 22, 2013, to Zhuang et al., entitled "Sub-diffraction Limit Image Resolution in Three Dimensions"; or International Patent Application Publication No. WO2013 / 090360, published on June 20, 2013, to Zhuang et al., entitled "High Resolution Dual-Objective Microscopy," each of which is incorporated herein by reference in their entireties.

[0122] As an illustrative, non-limiting example, in one set of embodiments, the sample may be imaged with a high numerical aperture, 100x magnification oil immersion objective and light collected on an electron multiplying CCD camera. In another example, the sample could be imaged with a high numerical aperture, 40x magnification oil immersion objective and light collected by a wide-field academic CMOS camera. In various non-limiting embodiments, with different combinations of objectives and cameras, a single field of view may correspond to a field of view not exceeding 40x40 microns, 80x80 microns, 120x120 microns, 240x240 microns, 340x340 microns, or 500x500 microns, etc. Similarly, in some embodiments, a single camera pixel may correspond to a sample area not exceeding 80x80 nm, 120x120 nm, 160x160 nm, 240x240 nm, or 300x300 nm, etc. In another example, the sample may be imaged with a low numerical aperture, 10x magnification air lens and light collected by an sCMOS camera. In a further embodiment, the sample may be optically resolved by focusing light through a single or multiple pinholes and illuminating it through a single or multiple scans of diffraction-limited focused light generated by a scanning mirror or a rotating disk. In another embodiment, the sample may also be illuminated through a slab of light generated through any one of several methods known to those skilled in the art.

[0123] In one embodiment, the sample may be illuminated with a single Gaussian mode laser beam. In some embodiments, the illumination profile may be flattened by passing these laser beams through a multimode fiber that is vibrated via piezoelectric or other mechanical means. In some embodiments, the illumination profile may be flattened by passing the single mode Gaussian beam through various refractive beam shapers, such as a pi-shaper, or a series of stacked Powell lenses. In yet another set of embodiments, the Gaussian beam may be passed through a variety of different diffusing elements, such as ground glass or an optical diffuser, which may optionally be spun at high speed to remove residual laser speckle. In yet another embodiment, the laser illumination may be passed through a series of lenslet arrays to produce overlapping illumination images that approximate a planar illumination field.

[0124] In some embodiments, the centroid of the spatial location of the entity can be determined. For example, the centroid of the signal-emitting entity can be determined in an image or in a series of images using image analysis algorithms known to those skilled in the art. In some cases, the algorithm can be selected to determine non-overlapping single emitters and / or partially overlapping single emitters in the sample. Non-limiting examples of suitable techniques include maximum likelihood algorithms, least squares algorithms, Bayesian algorithms, compressed sensing algorithms, etc. In some cases, combinations of these techniques can also be used.

[0125] In addition, in some cases, the signal generating entity may be inactivated. For example, in some embodiments, a first secondary nucleic acid probe that can associate with the signal generating entity (e.g., using an amplified nucleic acid) and recognize a first lead sequence (e.g., on a nucleic acid probe) may be applied to the sample, and then the signal generating entity may be inactivated, for example, before a second secondary nucleic acid probe that can associate with the signal generating entity (e.g., using an amplified nucleic acid) is applied to the sample. When multiple signal generating entities are used, the same or different techniques may be used to inactivate the signal generating entities, and some or all of the multiple signal generating entities may be inactivated, for example, sequentially or simultaneously.

[0126] Inactivation may be caused by removal of the signal generating entity (e.g., from the sample or from the nucleic acid probe, etc.) and / or by chemically altering the signal generating entity in some way (e.g., by photobleaching the signal generating entity, by bleaching the signal generating entity, by chemically altering the structure of the signal generating entity, e.g., by reduction, etc.). For example, in one set of embodiments, fluorescent signal generating entities may be inactivated by chemical or optical techniques such as oxidation, photobleaching, chemically bleaching, rigorous washing, or reaction by digestion or exposure to enzymes, dissociating the signal generating entity from other components (e.g., the probe), chemical reaction of the signal generating entity (e.g., a reactant capable of altering the structure of the signal generating entity), etc. For example, bleaching may occur by exposure to oxygen, reducing agents, or the signal generating entity may be chemically cleaved from the nucleic acid probe and washed away via fluid flow.

[0127] In some embodiments, for example, using the amplified nucleic acid discussed herein, multiple nucleic acid probes can be associated with one or more signal generating entities. When more than one nucleic acid probe is used, the signal generating entities can be the same or different. In certain embodiments, the signal generating entity is any entity capable of emitting light. For example, in one embodiment, the signal generating entity is a fluorescent entity. In other embodiments, the signal generating entity can be a phosphorescent entity, an emissive entity, an absorbent entity, etc. In some cases, the signal generating entity is any entity that can be determined in a sample at a relatively high resolution, for example, at a resolution that exceeds the wavelength or diffraction limit of visible light. The signal generating entity can be, for example, a dye, a small molecule, a peptide, or a protein, etc. In some cases, the signal generating entity can be a single molecule. When multiple secondary nucleic acid probes are used, the nucleic acid probes can be associated with the same or different generating entities.

[0128] Non-limiting examples of signal generating entities include fluorescent entities (fluorophores) or phosphorescent entities, such as cyanine dyes (e.g., Cy2, Cy3, Cy3B, Cy5, Cy5.5, Cy7, etc.), Alexa Fluor dyes, Atto dyes, photoswitchable dyes, photoactivatable dyes, fluorescent dyes, metal nanoparticles, semiconductor nanoparticles, or "quantum dots", fluorescent proteins such as GFP (green fluorescent protein), or photoactivatable fluorescent proteins such as PAGFP, PSCFP, PSCFP2, Dendra, Dendra2, EosFP, tdEos, mEos2, mEos3, PAmCherry, PAtagRFP, mMaple, mMaple2, and mMaple3. Other suitable signal generating entities are also known to those skilled in the art. For example, see U.S. Patent No. 7,838,302, or International Patent Application Publication No. WO2015 / 160690, each of which is incorporated herein by reference in its entirety.

[0129] In one set of embodiments, the signal generating entity may be joined to the oligonucleotide sequence via a bond that may be cleaved to release the signal generating entity. In one set of embodiments, the fluorophore may be conjugated to the oligonucleotide via a cleavable bond, such as a photocleavable bond. Non-limiting examples of photocleavable bonds include 1-(2-nitrophenyl)ethyl, 2-nitrobenzyl, biotin phosphoramidite, acryl phosphoramidite, diethylaminocoumarin, 1-(4,5-dimethoxy-2-nitrophenyl)ethyl, cyclododecyl(dimethoxy-2-nitrophenyl)ethyl, 4-aminomethyl-3-nitrobenzyl, (4-nitro-3-(1-chlorocarbonyloxyethyl)phenyl)methyl-S-acetylthioate, [4-nitro-3-(1-chlorocarbonyloxyethyl)phenyl]methyl-3-(2-pyridyldithiopropionic acid] ester [(4-nitro-3-(1-thlorocarbonyloxyethyl)phenyl)methyl-3-(2-pyridyldithiopropionic acid) ester. linkers, including, but not limited to, 3-(4,4'-dimethoxytrityl)-1-(2-nitrophenyl)-propane-1,3-diol-[2-cyanoethyl-(N,N-diisopropyl)]-phosphoramidite, 1-[2-nitro-5-(6-trifluoroacetylcaproamidomethyl)phenyl]-ethyl-[2-cyano-ethyl-(N,N-diisopropyl)]-phosphoramidite, 1-[2-nitro-5-(6-(4,4'-dimethoxytrityloxy)butylamidomethyl)phenyl]-ethyl-[2-cyanoethyl-(N,N-diisopropyl)]-phosphoramidite, 1-[2-nitro-5-(6-(N-(4,4'-dimethoxytrityl))-biotinamidocaproamido-methyl)phenyl]-ethyl-[2-cyanoethyl-(N,N-diisopropyl)]-phosphoramidite, or similar linkers. The oligonucleotide sequences can be, for example, primary or secondary (or other) amplified nucleic acids, such as the amplified nucleic acids discussed herein.

[0130] In another set of embodiments, the fluorophore may be conjugated to the oligonucleotide via a disulfide bond. Disulfide bonds can be cleaved by a variety of reducing agents, such as, but not limited to, dithiothreitol, dithioerythritol, beta-mercaptoethanol, sodium borohydride, thioredoxin, glutaredoxin, trypsinogen, hydrazine, diisobutylaluminum hydride, oxalic acid, formic acid, ascorbic acid, phosphoric acid, stannous chloride, glutathione, thioglycolate, 2,3-dimercaptopropanol, 2-mercaptoethylamine, 2-aminoethanol, tris(2-carboxyethyl)phosphine, bis(2-mercaptoethyl)sulfone, N,N'-dimethyl-N,N'-bis(mercaptoacetyl)hydrazine, 3-mercaptopropionate, dimethylformamide, thiopropyl agarose, tri-n-butylphosphine, cysteine, ferrous sulfate, sodium sulfite, phosphites, hypophosphites, phosphorothioates, and the like, and / or any combination thereof. The oligonucleotide sequences can be, for example, primary or secondary (or other) amplified nucleic acids, such as the amplified nucleic acids discussed herein.

[0131] In another embodiment, the fluorophore may be conjugated to the oligonucleotide via one or more phosphorothioate modified nucleotides, where a sulfur modification replaces the bridging and / or non-bridging oxygens. In certain embodiments, the fluorophore may be cleaved from the oligonucleotide via the addition of compounds such as, but not limited to, iodoethanol, which is iodine mixed in ethanol, silver nitrate, or mercuric chloride. In yet another set of embodiments, the signal generating entity may be chemically inactivated via reduction or oxidation. For example, in one embodiment, a chromophore such as Cy5 or Cy7 may be reduced to a stable, non-fluorescent state using sodium borohydride. In yet another set of embodiments, the fluorophore may be conjugated to the oligonucleotide via an azo bond, which may be cleaved by 2-[(2-N-arylamino)phenylazo]pyridine. In yet another set of embodiments, the fluorophore can be conjugated to the oligonucleotide via a suitable nucleic acid segment that can be cleaved when appropriately exposed to a DNase, such as an exodeoxyribonuclease or an endodeoxyribonuclease. Examples include, but are not limited to, DNase I or DNase II. In one set of embodiments, cleavage can occur via a restriction endonuclease. Non-limiting examples of potentially suitable restriction endonucleases include BamHI, BsrI, NotI, XmaI, PspAI, DpnI, MboI, MnlI, Eco57I, Ksp632I, DraIII, AhaII, SmaI, MluI, HpaI, ApaI, BclI, BstEII, TaqI, EcoRI, SacI, HindII, HaeII, DraII, Tsp509I, Sau3AI, PacI, etc. Over 3000 restriction enzymes have been studied in detail, and over 600 of these are commercially available. In yet another set of embodiments, the fluorophore may be conjugated to biotin, and the oligonucleotide may be conjugated to avidin or streptavidin.The interaction of biotin with avidin or streptavidin conjugates the fluorophore to the oligonucleotide, while with sufficient exposure to excess addition, free biotin may "overcome" the ligation, thereby causing cleavage. Additionally, in another set of embodiments, the probes may be removed using a corresponding "toe-hold-probe" that contains the same sequence as the probe, as well as an extra number of bases (e.g., 1-20 extra bases, e.g., 5 extra bases) with homology to the coding probe. These probes may remove the labeled readout probe through strand displacement interactions. The oligonucleotide sequence may be, for example, a primary or secondary (or other) amplified nucleic acid, such as the amplified nucleic acids discussed herein.

[0132] As used herein, the term "light" generally refers to electromagnetic radiation having any suitable wavelength (or, equivalently, frequency). For example, in some embodiments, light may include wavelengths in the optical or visible range (e.g., light having a wavelength between about 400 nm and about 700 nm, i.e., "visible light"), infrared wavelengths (e.g., light having a wavelength between about 300 micrometers and 700 nm), ultraviolet wavelengths (e.g., light having a wavelength between about 400 nm and about 10 nm), and the like. In certain cases, as discussed in detail below, more than one entity may be used, i.e., entities that are chemically distinct or significantly, e.g., structurally distinct. In other cases, however, the entities may be chemically identical, or at least substantially, chemically identical.

[0133] In one set of embodiments, the signal-generating entity is "switchable", i.e., the entity can be switched between two or more states, at least one of which emits light having a desired wavelength. In the other state(s), the entity may not emit light or may emit light of a different wavelength. For example, the entity can be "activated" to a first state capable of providing light having a desired wavelength, and "inactivated" to a second state not capable of emitting light of the same wavelength. An entity is "photoactivatable" when it is activated by incident light of the appropriate wavelength. As a non-limiting example, Cy5 can be switched between a fluorescent state and a non-light-emitting state in a controlled and reversible manner by light of different wavelengths, i.e., red light at 633 nm (or 642 nm, 647 nm, 656 nm) can switch or inactivate Cy5 to a stable non-light-emitting state, while green light at 405 nm can switch or activate Cy5 back to a fluorescent state. In some cases, the entity can be reversibly switched between two or more states, for example, when exposed to an appropriate stimulus. For example, a first stimulus (e.g., light of a first wavelength) can be used to activate the switchable entity, while a second stimulus (e.g., light of a second wavelength) can be used to inactivate the switchable entity, for example, to a non-light-emitting state. Any suitable method can be used to activate the entity. For example, in one embodiment, incident light of an appropriate wavelength can be used to activate the entity to emit light, i.e., the entity is "photoswitchable." Photoswitchable entities can thus be switched between different emitting or non-emitting states, for example, by incident light of different wavelengths. The light can be monochromatic (e.g., provided using a laser) or polychromatic. In another embodiment, the entity can be activated when stimulated with an electric and / or magnetic field. In other embodiments, the entity can be activated when exposed to an appropriate chemical environment, for example, by adjusting the pH or inducing a reversible chemical reaction involving the entity.Similarly, any suitable method may be used to inactivate an entity, and the method that activates an entity and the method that inactivates an entity need not be the same, for example, an entity may be inactivated upon exposure to incident light of an appropriate wavelength, or an entity may be inactivated by waiting for a sufficient period of time.

[0134] Typically, a "switchable" entity may be identified by one of skill in the art by determining the conditions under which the entity in a first state will luminesce when exposed to an excitation wavelength, switching the entity from the first state to a second state, e.g., by exposing it to light of the switched wavelength, and then demonstrating that when the entity is in the second state it no longer luminesce (or emits light of reduced intensity) when exposed to the excitation wavelength.

[0135] As discussed, in one set of embodiments, the switchable entity may be switched upon exposure to light. In some cases, the light used to activate the switchable entity may come from an external light source, such as a laser light source, another light-emitting entity in close proximity to the switchable entity, etc. In some cases, the second light-emitting entity may be a fluorescent entity, and in certain embodiments, the second light-emitting entity may also itself be a switchable entity.

[0136] In some embodiments, the switchable entity includes a first light-emitting moiety (e.g., a fluorophore) and a second moiety that activates or "switches" the first moiety. For example, when exposed to light, the second moiety of the switchable entity may activate the first moiety, causing the first moiety to emit light. Examples of activator moieties include, but are not limited to, Alexa Fluor 405 (Invitrogen), Alexa Fluor 488 (Invitrogen), Cy2 (GE Healthcare), Cy3 (GE Healthcare), Cy3B (GE Healthcare), Cy3.5 (GE Healthcare), or other suitable dyes. Examples of light-emitting moieties include, but are not limited to, Cy5, Cy5.5 (GE Healthcare), Cy7 (GE Healthcare), Alexa Fluor 647 (Invitrogen), Alexa Fluor 680 (Invitrogen), Alexa Fluor 700 (Invitrogen), Alexa Fluor 750 (Invitrogen), Alexa Fluor 790 (Invitrogen), DiD, DiR, YOYO-3 (Invitrogen), YO-PRO-3 (Invitrogen), TOT-3 (Invitrogen), TO-PRO-3 (Invitrogen), or other suitable dyes.These may be linked together, for example, covalently, e.g., directly, or via a linker, e.g., Cy5-Alexa Fluor 405, Cy5-Alexa Fluor 488, Cy5-Cy2, Cy5-Cy3, Cy5-Cy3.5, Cy5.5-Alexa Fluor 405, Cy5.5-Alexa Fluor 488, Cy5.5-Cy2, Cy5.5-Cy3, Cy5.5-Cy3.5, Cy7-Alexa Fluor 405, Cy7-Alexa Fluor 488, Cy7-Cy2, Cy7-Cy3, Cy7-Cy3.5, Alexa Fluor 647-Alexa Fluor 405, Alexa Fluor 647-Alexa Fluor 488, Alexa Fluor 647-Cy2, Alexa Fluor The luminescent or activator moiety may include a moiety having two quaternized nitrogen atoms connected by a polymethine chain, each nitrogen being independently a part of a heteroaromatic moiety, such as pyrrole, imidazole, thiazole, pyridine, quinoine, indole, benzothiazole, or the like, or a part of a non-aromatic amine. Optionally, there may be 5, 6, 7, 8, 9 or more carbon atoms between the two nitrogen atoms.

[0137] In certain cases, when the luminescent moiety and the activator moiety are separated from each other, each can be a fluorophore, i.e., an entity that can emit light of a certain emission wavelength when exposed to a stimulus, e.g., an excitation wavelength. However, when a switchable entity is formed that includes a first fluorophore and a second fluorophore, the first fluorophore forms a first luminescent moiety, and the second fluorophore forms an activator moiety that activates or "switches" the first moiety in response to a stimulus. For example, the switchable entity can include a first fluorophore directly bonded to a second fluorophore, or the first and second entities can be connected via a linker or a common entity. Whether a pair of a luminescent moiety and an activator moiety results in a suitable switchable entity can be examined by methods known to those skilled in the art. For example, light of various wavelengths may be used to stimulate the pairs, and the emission from the light emitting moieties may be determined to determine whether the pairs result in an appropriate switch.

[0138] As a non-limiting example, Cy3 and Cy5 can be linked together to form such an entity. In this example, Cy3 is an activator moiety that can activate Cy5, the light-emitting moiety. Thus, light at or near the absorption maximum of the activating or second portion of the entity (e.g., light near 532 nm for Cy3) can cause this portion to activate the first light-emitting moiety, thereby causing the first portion to emit light (e.g., near 647 nm for Cy5). See, for example, U.S. Patent No. 7,838,302, which is incorporated herein by reference in its entirety. Optionally, the first light-emitting moiety can then be inactivated by any suitable technique (e.g., by directing 647 nm red light to the Cy5 portion of the molecule).

[0139] Other non-limiting examples of potentially suitable activator moieties include 1,5 IAEDANS, 1,8-ANS, 4-methylumbelliferone, 5-carboxy-2,7-dichlorofluorescein, 5-carboxyfluorescein (5-FAM), 5-carboxynaphthofluorescein, 5-carboxytetramethylrhodamine (5-TAMRA), 5-FAM (5-carboxyfluorescein), 5-HAT (hydroxytryptamine), 5-hydroxytryptamine (HAT), 5-ROX (carboxy-X-rhodamine), 5-TAMRA (5-carboxytetramethylrhodamine), 6-carboxyrhodamine 6G, 6-CR 6G, 6-JOE, 7-amino-4-methylcoumarin, 7-aminoactinomycin D (7-AAD), 7-hydroxy-4-methylcoumarin, 9-amino-6-chloro-2-methoxyacridine, ABQ, acid fuchsin, ACMA (9-amino-6-chloro-2-methoxyacridine), acridine orange, acridine red, acridine yellow, acriflavine, acriflavine feulgen SITSA, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 635, Alizarin Complexone, Alizarin Red, AMC, AMCA-S, AMCA (Aminomethylcoumarin), AMCA-X, Aminoactinomycin D, Aminocoumarin, Aminomethylcoumarin (AMCA), Aniline Blue, Anthrosyl Stearate, APTRA-BTC, APTS, Astrazon Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B, Astrazon Yellow 7 GLL, Atabrine, ATTO 390, ATTO 425, ATTO 465, ATTO 488, ATTO 495, ATTO 520, ATTO 532, ATTO 550, ATTO 565, ATTO590, ATTO 594, ATTO 610, ATTO 611X, ATTO 620, ATTO 633, ATTO 635, ATTO 647, ATTO 647N, ATTO 655, ATTO 680, ATTO 700, ATTO 725, ATTO 740, ATTO-TAG CBQCA, ATTO-TAG FQ, Auramine, Aurophosphine G, Aurophosphine, BAO9 (Bisaminophenyloxadiazole), BCECF (High pH), BCECF (Low pH), Berberine Sulfate, Bimane, Bisbenzamide, Bisbenzimide (Hoechst), Bis-BTC, Blancophor FFG, Blancophor SV, BOBO-1, BOBO-3, Bodipy 492 / 515, Bodipy 493 / 503, Bodipy 500 / 510, Bodipy 505 / 515, Bodipy 530 / 550, Bodipy 542 / 563, Bodipy 558 / 568, Bodipy 564 / 570, Bodipy 576 / 589, Bodipy 581 / 591, Bodipy 630 / 650-X, Bodipy 650 / 665-X, Bodipy 665 / 676, Bodipy Fl, Bodipy FL ATP, Bodipy Fl-ceramide, Bodipy R6G, Bodipy TMR, Bodipy TMR-X conjugate, Bodipy TMR-X, SE, Bodipy TR, Bodipy TR ATP, Bodipy TR-X SE, BO-PRO-1, BO-PRO-3, Brilliant SulphoflavinFF, BTC, BTC-5N, Calcein, Calcein Blue, Calcium Crimson, Calcium Green, Calcium Green-1 Ca 2+ Pigment, Calcium Green-2 Ca 2+ , Calcium Green-5N Ca 2+ , Calcium Green-C18 Ca 2+, Calcium Orange, Calcofluor White, Carboxy-X-Rhodamine (5-ROX), Cascade Blue, Cascade Yellow, Catecholamine, CCF2 (GeneBlazer), CFDA, Chromomycin A, Chromomycin A, CL-NERF, CMFDA, Coumarin phalloidin, CPM methylcoumarin, CTC, CTC formazan, Cy2, Cy3.18, Cy3.5, Cy3, Cy5.18, Cyclic AMP Fluorosensor (FiCRhR), Dabcyl, Dansyl, Dansylamine, Dansylcadaverine, Dansyl chloride, DansylDHPE, Dansyl fluoride, DAPI, Dapoxyl, Dapoxyl 2, Dapoxyl 3'DCFDA, DCFH (dichlorodihydrofluorescein diacetate), DDAO, DHR (dihydrorhodamine 123), di-4-ANEPPS, di-8-ANEPPS [non-ratio], DiA (4-di-16-ASP), dichlorodihydrofluorescein diacetate (DCFH), DiD (lipophilic tracer), DiD [DiIC18(5)], DIDS, dihydrorhodamine 123 (DHR), DiI [DiIC18(3)], dinitrophenol, DiO [DiOC18(3)], DiR, DiR [DiIC18(7)], DM-NERF (high pH), DNP, dopamine, DTAF, DY-630-NHS, DY-635-NHS, DyLight 405, DyLight 488, DyLight 549, DyLight 633, DyLight 649, DyLight 680, DyLight 800, ELF97, Eosin, Erythrosin, Erythrosin ITC, Ethidium Bromide, Ethidium Homodimer 1 (EthD-1), Euchrisin, EukoLight, Europium(III) Chloride, Fast Blue, FDA, Feulgen (Pararoseaniline), FIF [Formaldehyd-Induced Fluorescence], FITC, FlazoOrange, Fluo-3, Fluo-4, Fluorescein (FITC), Fluorescein diacetate, Fluoro-Emerald, Fluoro-Gold (hydroxystilbamidine), Fluor-Ruby, FluorX, FM1-43, FM4-46, Fura Red (high pH), Fura Red / Fluo-3, Fura-2, Fura-2 / BCECF, Genacryl Brilliant Red B, Genacryl Brilliant Yellow 10GF, Genacryl Pink 3G, Genacryl Yellow 5GF, GeneBlazer (CCF2), Gloxalic Acid, Granular blue, Hematoporphyrin, Hoechst 33258, Hoechst 33342, Hoechst 34580, HPTS, Hydroxycoumarin, Hydroxystilbamidine (FluoroGold), Hydroxytryptamine, Indo-1 (High Calcium), Indo-1 (Low Calcium), Indodicarbocyanine (DiD), Indotricarbocyanine (DiR), Intrawhite Cf, JC-1, JO-JO-1, JO-PRO-1, LaserPro, Laurodan, LDS 751 (DNA), LDS 751 (RNA), Leucophor PAF, Leucophor SF, Leucophor WS, Lissamine Rhodamine, Lissamine Rhodamine B, Calcein / Ethidium Homodimer, LOLO-1, LO-PRO-1, Lucifer Yellow, Lyso Tracker Blue, Lyso Tracker Blue-White, Lyso Tracker Green, Lyso Tracker Red, Lyso Tracker Yellow, LysoSensor Blue, LysoSensor Green, LysoSensor Yellow / Blue, Mag Green, Magdala Red (Phloxin B), Mag-Fura Red, Mag-Fura-2, Mag-Fura-5, Mag-Indo-1, Magnesium Green, Magnesium Orange, Malachite Green, Marina Blue, Maxilon Brilliant Flavin 10 GFF, MaxilonBrilliant Flavin 8 GFF, Merocyanine, Methoxycoumarin, Mitotracker Green FM, Mitotracker Orange, Mitotracker Red, Mithramycin, Monobromobimane, Monobromobimane (mBBr-GSH), Monochlorobimane, MPS (Methyl Green Pyronine Stilbene), NBD, NBD-amine, Nile Red, Nitrobenzoxadidole, Noradrenaline, Nuclear Fast Red, Nuclear Yellow, Nylosan Brilliant Iavin E8G (Nylosan Brilliant Iavin E8G), Oregon Green, Oregon Green 488-X, Oregon Green, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, Pararosaniline (Feulgen), PBFI, Phloxin B (Magdala Red), Phorwite AR, Phorwite BKL, Phorwite Rev, Phorwite RPA, Phosphine 3R, PKH26 (Sigma), PKH67, PMIA, Pontochrome Blue Black, POPO-1, POPO-3, PO-PRO-1, PO-PRO-3, Primulin, Procion Yellow, Propidium Iodide (PI), PyMPO, Pyrene, Pyronine, Pyronine B, Pyrazole Brilliant Flavin 7GF, QSY 7, Quinacrine Mustard, Resorufin, RH 414, Rhod-2, Rhodamine, Rhodamine 110, Rhodamine 123, Rhodamine 5 GLD, Rhodamine 6G, Rhodamine B, Rhodamine B 200, Rhodamine B Extra, Rhodamine BB, Rhodamine BG, Rhodamine Green, Rhodamine Phallicidin, Rhodamine Phalloidin, Rhodamine Red, Rhodamine WT, Rose Bengal, S65A, S65C, S65L, S65T, SBFI, Serotonin, Sevron Brilliant Red 2B, Sevron Brilliant Red 4G, Sevron Brilliant RedB, Sevron Orange, Sevron Yellow L, SITS, SITS (primulin), SITS (stilbene isothiosulfonate), SNAFL calcein, SNAFL-1, SNAFL-2, SNARF calcein, SNARF1, Sodium Green, Spectrum Aqua, Spectrum Green, Spectrum Orange, Spectrum Red, SPQ [6-Methoxy-N-(3-sulfopropyl)quinolinium], stilbene, sulforhodamine B and C, sulforhodamine Extra, SYTO 11, SYTO 12, SYTO 13, SYTO 14, SYTO 15, SYTO 16, SYTO 17, SYTO 18, SYTO 20, SYTO 21, SYTO 22, SYTO 23, SYTO 24, SYTO 25, S YTO 40, SYTO 41, SYTO 42, SYTO 43, SYTO 44, SYTO 45, SYTO 59, SYTO 60, SYTO 61, SYTO 62, SYTO 63, SYTO 64, SYTO 80, SYTO 81, SYTO 82, SYTO 83, SYTO 84, SYTO 85, SYTOX Blue, SYTOX Green, SYTOX Orange, Tetracycline, Tetramethylrhodamine (TAMRA), Texas Red, Texas Red-X Conjugate, Thiadicarbocyanine (DiSC3), Thiazine Red R, Thiazole Orange, Thioflavin 5, Thioflavin S, Thioflavin TCN, Thiolyte, Thiozole Orange, Tinopol CBS (Calcofluor White), TMR, TO-PRO-1, TO-PRO-3, TO-PRO-5, TOTO-1, TOTO-3, TRITC (tetramethylrhodamine isothiocyanate), True Blue, TruRed, Ultralite, Uranine B, Uvitex SFC, WW 781, X-rhodamine, XRITC, Xylene Orange, Y66F, Y66H, Y66W, YO-PRO-1, YO-PRO-3, YOYO-1, YOYO-3, SYBR Green, thiazole orange [interchelating dye], or combinations thereof.

[0140] Another aspect of the present invention is directed to a computer-implemented method. For example, a computer and / or an automated system can be provided that can automatically and / or repeatedly perform any of the methods described herein. As used herein, an "automated" device refers to a device that can operate without human instruction, i.e., an automated device can perform a function at a time after any human has taken any action to advance the function, for example, by inputting an instruction to start the process into a computer. Typically, an automated apparatus can perform a repetitive function after this point. In some cases, the process steps can also be recorded in a computer-readable medium.

[0141] For example, in some cases, a computer may be used to control imaging of a sample using, for example, a fluorescent microscope, STORM, or other ultra-high resolution techniques, such as the techniques described herein. In some cases, a computer may also control operations in image analysis, such as drift correction, physical registration, hybridization, and cluster alignment, cluster decoding (e.g., fluorescent cluster decoding), error detection or correction (e.g., as discussed herein), noise reduction, distinguishing foreground features from background features (such as noise or debris in an image). By way of example, a computer may be used to control activation and / or excitation of a signal generating entity in a sample and / or collection of images of the signal generating entity. In one set of embodiments, a sample may be excited using light having a variety of wavelengths and / or intensities, and using a computer, the sequence of wavelengths of light used to excite the sample may be correlated with images collected of the sample containing the signal generating entity. For example, the computer may direct light having various wavelengths and / or intensities at the sample to result in an average number of different signal generating entities within each region of interest (e.g., one activating entity per location, two activating entities per location, etc.). In some cases, this information may be used to construct an image of the signal generating entities and / or determine the location of the signal generating entities, optionally at high resolution, as mentioned above.

[0142] In some embodiments, the sample is placed on a microscope. In some cases, the microscope may contain one or more channels, such as microfluidic channels, that direct or control fluid to or from the sample. For example, in one embodiment, a nucleic acid probe, such as the nucleic acid probes discussed herein, may be fluidically introduced and / or removed to or from the sample through one or more channels. In some cases, there may also be one or more chambers or reservoirs for holding fluid, for example, in fluid communication with the channel and / or the sample. Those skilled in the art will be familiar with channels, including microfluidic channels, for moving fluid to or from the sample.

[0143] U.S. Provisional Patent Application No. 62 / 779,333, filed Dec. 13, 2018 by Zhuang et al. and entitled "Amplification Methods and Systems for MERFISH and Other Applications," is incorporated herein by reference in its entirety. The following documents are also incorporated herein by reference in their entirety: U.S. Patent Application Nos. 2017 / 0220733 and 2017 / 0212986; International Patent Application Publication Nos. WO2016 / 018960, WO2016 / 018963, WO2018 / 089445, and WO2018 / 089438; and International Patent Application No. PCT / US18 / 34651. EXAMPLES

[0144] The following examples are intended to illustrate certain embodiments of the present invention, but do not exemplify the full scope of the invention. EXAMPLES

[0145] Multiplexed error-robust fluorescence in situ hybridization (MERFISH) allows for spatially resolved, single-cell transcriptomics by directly imaging and profiling hundreds to thousands of RNA species in their native intracellular environment. The following examples use controlled or saturable amplification methods for MERFISH measurements. These examples demonstrate substantial signal increase in RNA FISH samples without increasing spot size or spot-to-spot brightness variability. 130 RNA species were accurately measured and identified with nearly 100% detection efficiency. These advances should substantially expand the scope of biological questions that can be addressed by MERFISH, both in cell culture and in tissues.

[0146] In particular, these examples demonstrate a methodology that combines MERFISH amplification to dramatically increase MERFISH signal brightness. These examples demonstrate that this methodology amplified RNAsmFISH signals up to 30.6-fold with a constant coefficient of variation and no change in spot size. This methodology provided a rapid, simple, and efficient way to simultaneously amplify signals from hundreds of RNAs in the same single cell with nearly 100% detection efficiency.

[0147] Design of incorporating DNA amplification into MERFISH: These examples show that this amplification strategy has certain advantages when combined with MERFISH using certain modifications described herein.The scaffold that determines the amplification fold is found to be predictable and designable.Even if multiple amplification sequences have different binding rates, it still allows enough time for all tested amplification sequences to reach saturation, making the amplification controllable, reproducible, and less variable, which benefits the decoding step of MERFISH.

[0148] The labeling method used in these examples is illustrated in Figures 1A-1E. The MERFISH system was used to stain a composite library of oligonucleotide probes having a 30-mer target region sequence complementary to a target RNA template and a plurality of 20-mer readout sequences, referred to as coding probes (see, e.g., International Patent Application Publication Nos. WO2016 / 018960 and WO2016 / 018963, each of which is incorporated herein by reference in its entirety).

[0149] The amplified sequence sets were named primary and secondary amplified sequences according to the amplified sequence staining round. Each of the primary amplified sequence set had a complementary sequence that bound to one of the readout sequences of the coded probe and N (N) 20-mer repeat sequences. Each of the secondary amplified sequence set had a complementary sequence to one 20-mer repeat sequence on the primary amplified sequence and N 20-mer repeat sequences that were complementary to the final readout. After staining of the primary and secondary amplified sequences, the original readout signal was converted to a final readout signal by N 2 The amplification was performed 1:1, i.e., N×N amplification (FIGS. 1A to 1E).

[0150] There have been some notable advances in these amplifications. First, the amplification sequence was designed using only three nucleotides. The probe sequence containing only three of the four nucleotides had a higher hybridization rate than the sequence using all four nucleotides. This is believed to be due to the significantly less secondary structure in such sequences. In addition, in the staining and washing steps of the amplification sequence, in order to maintain the binding of the coding probe to RNA, a 20-mer binding sequence was used in the amplification sequence, which was stained and washed with 10% formamide at 37°C. The coding probe containing a 30-mer targeting region for RNA was washed with 30% formamide at 47°C. The amplification was carried out on gel-embedded and cleared MERFISH samples, which has the inherent ability to remove fluorescent background. See, for example, International Patent Application Publication No. WO2018 / 089445, which is incorporated herein by reference in its entirety.

[0151] 1A-1E show schematic illustrations of amplification for MERFISH imaging. FIG. 1A shows that a sample was stained with MERFISH coded probe library and cleared in a polyacrylamide gel. Each coded probe has a 30-mer target sequence and multiple readout sequences. FIG. 1B shows the boxed area in FIG. 1A, where a primary amplified sequence was hybridized to the original readout on the coded probe, followed by a wash step to remove excess primary amplified sequence. The primary amplified sequence had a complementary sequence to the readout sequence on the coded probe and N 20-mer repeat sequences. FIG. 1C shows that a secondary amplified sequence binds to the repeat region of the primary amplified sequence. The secondary amplified sequence had a complementary sequence to one of the 20-mer repeat sequences on the primary amplified sequence and N 20-mer repeat sequences complementary to the final readout. After washing, the sample was used in multi-round MERFISH imaging, where the final readout uses a disulfide-linked fluorophore. Figure ID shows the final readout staining from the first round of MERFISH from an NxN amplified sample, in comparison to Figure IE which shows the readout staining from the first round of MERFISH from an unamplified sample. EXAMPLES

[0152] Characteristics of DNA amplification: In this example, to realize the design, the coding probe containing the readout sequence was hybridized with Filamin A (FLNA) mRNA, and 5x5 amplification was performed on the coding probe in U-2 OS cells, with 15 minutes per amplification sequence staining round. The average FLNA smFISH spot brightness was measured for the direct labeling of the readout on the coding probe or the 5x5 amplified labeling by the readout on the coding probe. A 10.5-fold increase in signal was observed, which achieved 42% of the theoretical value. See Figures 2A and 2B.

[0153] One possibility that the theoretical amplification fold was not reached was that the staining time of the amplified sequence was not sufficient. The same 5x5 amplification was performed with a time sequence of 15 minutes, 30 minutes, 60 minutes, and 180 minutes for each round of staining of the amplified sequence (Figure 2C). The results showed that the amplified signal was saturated with the hybridized amplified sequence within 15 minutes in each round. The saturation after 15 minutes indicates that the complete assembly of the amplified sequence was rapid, illustrating the further advantage of using the three-letter alphabet for the design of the amplification probe in this example. In comparison, other methods often require 45 minutes or more per round of amplification.

[0154] Next, we investigated whether the length of the amplification sequence affected the performance of the amplification. 4x4 and 9x9 amplification sequences were studied. A 5.5-fold and 30.6-fold increase in brightness was observed for the 4x4 and 9x9 amplification sequences, respectively. The results suggested that all three amplification sequence lengths yielded about 40% of the theoretical amplification value (Figure 2D).

[0155] One potential consequence of amplification is an increase in FISH spot size, which may reduce the ability to identify these RNAs due to signal from one molecule overlapping with signals from other molecules. The scaffold of the 9x9 amplified sequence has a length of approximately 132 nm (200 nucleotides x 2 x 0.33 nm per nucleotide), which is considered to be within the diffraction limit. The spot size measurements from 4x4, 5x5, and 9x9 amplification were identical, as expected (Figure 2E). Based on this design, it was predicted that the brightness variability between spots would not increase substantially. To confirm this, the coefficient of variation of spot brightness was measured for non-amplified, 4x4, 5x5, and 9x9 amplified samples. It was found that the brightness variability between spots did not increase with amplification (Figure 2F).

[0156] Figures 2A-2F show that DNA amplification dramatically increased signal intensity without substantially changing spot size and spot-to-spot intensity variability. Figure 2A shows images of U-2 OS cell images stained with FLNA smFISH probes, non-amplified samples labeled with readout probes (left). The contrast was increased 10-fold compared to the left image to better illustrate the fluorescent signal (middle) or stained with readout probes after 5x5 amplification (right) (scale bar: 10 micrometers). Figure 2B shows a magnified view of the boxed area in Figure 2A (scale bar: 2 micrometers).

[0157] FIG. 2C shows the average brightness of individual FLNA mRNA spots according to the time sequence of amplified sequence staining. The average brightness was normalized to the non-amplified control sample stained directly with the readout probe. FIG. 2D shows the average brightness of individual FLNA mRNA spots in 4×4 and 9×9 amplified samples. The average brightness was normalized to the non-amplified control sample stained directly with the readout probe. FIG. 2E shows the average FLNA mRNA spot size in non-amplified, 4×4, 5×5, and 9×9 amplified cells. The width (half-width) was determined by fitting a point spread function (PSF) to the RNA spots with a Gaussian distribution. FIG. 2F shows the coefficient of variation for the RNA spot brightness in non-amplified, 4×4, 5×5, and 9×9 amplified samples. EXAMPLES

[0158] Screening of amplification sequences for MERFISH imaging: In this example, 16 pairs of primary and secondary amplification sequences were used to extend amplification to MERFISH measurement, with a 16-bit modified Hamming distance 4 (MHD4) coding scheme. Briefly, 20-mer triplet repeat sequences were designed by generating a random set of sequences with per-base probabilities of primary and secondary amplification sequences of 25% A, 25% T, and 50% C, or 25% A, 25% T, and 50% G, respectively. BLAST analysis was performed against the human transcriptome to match sequences within themselves and avoid homologous regions longer than 11 nucleotides. The 5x5 amplification sequence results in an order of magnitude change in spot brightness. Therefore, the 5x5 amplification sequence was also used in subsequent MERFISH measurements. It was also found that about 20% of the amplified sequences strongly induced secondary amplified sequences, were RNA-dependent, or had background or low amplification efficiency. These could be corrected by changing the amplified sequence pair. Sixteen pairs were screened from 20 pairs of 5 × 5 amplified sequences for MERFISH imaging (Figures 5A-5C). EXAMPLES

[0159] MERFISH measurement with DNA amplification: To verify whether the 16-pair amplification sequence described in Example 3 works with MERIFSH, a 5x5 amplification was performed using a MERFISH library of 130 RNAs in U-2 OS cells. Eight rounds of two-color imaging were used to read out 16 bits. In addition, cleavage of disulfide bonds by reduction was used to remove the fluorophore linked to the readout probe during successive rounds of imaging with both amplified and non-amplified samples. Figure 3A shows that individual RNA molecules could be detected in each of the eight hybridization and imaging rounds for the 5x5 amplified sample, allowing their identity to be decoded.

[0160] To determine the quality of the RNA decoding of the 5x5 amplified MERFISH run, we considered several aspects of the non-zero misidentification error caused by misidentifying some RNAs as the wrong species and the non-100% call rate caused by missing some RNAs during detection and decoding. First, we considered the blank barcode RNA counts per cell and the 130 actual RNA barcodes, which correlate with the misidentification rate. We found that 121 of the 130 RNA species in the 5x5 amplified MERFISH run had a copy number per cell that was greater than the maximum copy number per cell observed with the blank barcode (Figure 3B).

[0161] Next, the average 1 to 0 error rate and the average 0 to 1 error rate were determined for each bit. If these error rates were low, a high call rate would be observed that could potentially be obtained in theory. A 1 to 0 error rate of about 1.7% and a 0 to 1 error rate of about 0.6% were observed (Figure 3C). The 5x5 amplified data was further compared to the previous non-amplified MERFISH data, which had a detection efficiency of nearly 100%. Figure 3D shows that the copy numbers per cell observed in the amplified samples correlated strongly with the copy numbers per cell measured in the non-amplified samples, with a Pearson correlation coefficient of 0.98 [ρ for 121 RNA species whose measured copy numbers were greater than the copy numbers observed for the largest blank barcode count]. 10 (rho)=0.98]. The ratio of copy number t measured in the amplified samples to the copy number measured in the unamplified samples was 0.98±0.12 (SEM; n=121 RNAs), so that the 5×5 amplification retained nearly 100% detection efficiency.

[0162] For these RNAs, the average copy number per cell detected by MERFISH was compared to the 5x5 amplifications where RNA abundance was measured by RNA-seq (Figure 3E). The Pearson correlation coefficient was 0.90. Copy number results per cell were also highly reproducible among multiple replicate MERFISH experiments with amplification (Figure 3F).

[0163] Figures 3A-3F show MERFISH measurements of 130 RNAs with 5x5 amplification in U-2 OS cells. Figure 3A, left panel: All identified RNAs detected in 5x5 amplified MERFISH measurements of 130 RNA species with RNA barcodes represented by the marker color (represented by shading in this figure) (scale bar: 10 micrometers). Right panel: Two-color smFISH images from each of 8 rounds of hybridization and imaging using readout probes labeled with Cy5 (green) or Alexa750 (red) for the boxed area in the left panel (scale bar: 2 micrometers). Figure 3B shows the average RNA copy number per cell, sorted from maximum to minimum, for actual RNA barcodes (dark) and blank control barcodes (light) detected in approximately 1200 cells with 5x5 amplification. FIG. 3C shows the error rate, which is the fraction of measured barcodes that contain a given bit inversion, for each bit with 5×5 amplified MERFISH measurements. The 1 to 0 error rate (left) and 0 to 1 error rate (right) are shown for each bit. FIG. 3D shows the average copy number per cell observed for these RNA species in 5×5 amplified U-2 OS cells versus the copy number obtained from non-amplified samples. Pearson's correlation coefficient was 0.98. FIG. 3E shows the average RNA copy number per cell determined by MERFISH with 5×5 amplification versus abundance determined by RNAseq. The Pearson correlation coefficient for the log10 value of RNA abundance was 0.9. FIG. 3F shows the average copy number per cell detected in a single 5×5 amplified sample versus replicate samples. Pearson's correlation coefficient was 0.96. EXAMPLES

[0164] These examples present the combination of MERFISH and three-letter amplification to measure hundreds of RNAs in a single cell. The three-letter amplification sequences were shown to bind to the target and reach saturation within 15 minutes per amplification sequence staining round. Using this approach, the RNA smFISH signal was amplified 5.5-fold, 10.5-fold, and 30.6-fold by using 4x4, 5x5, and 9x9 amplifications, respectively, without any change in spot size. The coefficients of variation of spot brightness in non-amplified, 4x4, 5x5, and 9x9 amplified samples were very close, indicating that the variability of spot brightness did not increase upon DNA amplification, which is important for MERFISH decoding. Finally, accurate identification and counting of 130 RNA species was supported by nearly 100% detection efficiency in amplified samples, with a ratio of copy numbers measured in amplified samples to those measured in unamplified samples of 0.98.

[0165] The amplification fold was observed to be approximately 40% of the theoretical value for all three amplifications, including 4x4, 5x5, and 9x9 amplifications. It is believed that the binding efficiency of the amplification sequences and readouts was not 100%. The average binding rate per round was approximately 73.5%. In addition, 80% of the screened amplification sequence sets worked well and resulted in substantial amplification. The remaining 20% ​​had high background or low amplification efficiency. This probability that the amplification sequence sets worked without further refinement illustrates the ability to rapidly scale up this approach to the amplification of a large number of readout sequences, which will be useful for expanding the multiplexing capacity.

[0166] Amplification was applied to an existing MERFISH library. The substantial increase in signal brightness brought about by amplification should expand several further applications of MERFISH. In this example, MERFISH measurements were performed using 92 coding probes per RNA. This increase in signal by amplification should provide the possibility to detect much shorter RNAs, potentially as short as 300-mers, with as few as 10 coding probes. The ability to detect RNA molecules with a relatively small number of probes would also dramatically improve RNA isoform discrimination. Second, MERFISH measurements used a dynamic time that is proportional to the number of imaging fields of view (FOV) and the fixation, readout cutting, and washing times of the readout stain. If the field of view is increased to a large number, the imaging time will dominate the throughput of MERFISH. A shorter exposure time with the amplified signal should allow the duration of imaging to be substantially reduced, thereby improving the throughput of MERFISH. In addition, spinning disk confocal imaging provided greater contrast but was less sensitive than widefield microscopy in detecting photons in thicker samples. Thus, the incorporation of amplification by MERFISH would facilitate detection of FISH signals in tissues, for example by spinning disk confocal microscopy. EXAMPLES

[0167] Below are various materials and methods used in the above examples.

[0168] Design of coding probes: MERFISH measurements in human osteosarcoma cells (U-2 OS) (ATCC) were performed as follows. Briefly, RNA was coded using a 16-bit MHD4 code. In this coding scheme, each of the 140 possible barcodes had a constant Hamming weight (i.e., the number of "1" bits in each barcode) of 4 to avoid potential bias in the measurement of different barcodes due to the differential ratio of "1" to "0" errors and "0" to "1" errors. In addition, all barcodes had a Hamming distance of at least 4 to allow error detection and correction. Of the 140 possible barcodes, 130 were used to code intracellular RNA, and 10 barcodes were used as blank controls. In the coding probe library, each RNA species contained 92 coding probes, and each coding probe contained three of the four readout sequences assigned to each RNA.

[0169] Construction of coded probes: The coded probe library was amplified from a complex oligonucleotide pool. Briefly, the oligo pool (CustomArray) was first amplified via limited cycle PCR to create an in vitro transcription template, which was converted and amplified to RNA via in vitro transcription (New England Biolabs), and then the RNA was converted back to DNA via reverse transcription (Maxima RT H-, Thermo Fisher). See, for example, US Patent Application Publication No. 2017 / 0212986, which is incorporated herein by reference. Excess NTPs or NTPs were removed via desalting columns (Thermo Fisher) after both in vitro transcriptions, and phenol-chloroform extraction was performed to improve purity and reaction yield. The final DNA probes were purified via alkaline hydrolysis to remove the RNA template, phenol-chloroform extraction to remove protein, and ethanol precipitation to concentrate the probes. The final probes were resuspended in RNAase-free water and stored at -20°C.

[0170] Silanization of coverslips: To stabilize the polyacrylamide (PA) gel, coverslips were silanized. Briefly, 40-mm-diameter No. 1.5 coverslips (Bioptechs, 0420-0323-2) were washed via immersion in a 1:1 mixture of 37% (volume / volume) methanol and hydrochloric acid for 30 min at room temperature in a fume hood. The coverslips were then washed three times in demineralized water and once in 70% (volume / volume) ethanol. The coverslips were dried with a stream of nitrogen gas and then immersed in chloroform with 0.1% (volume / volume) triethylamine (Sigma) and 0.2% (volume / volume) allyltrichlorosilane (Sigma) for 30 min at room temperature. The coverslips were washed once each with pure chloroform and pure ethanol, then dried with nitrogen gas in a dryer. The silanized coverslips were then stored at room temperature in a dry chamber for several weeks without any obvious deterioration in the quality of the silane layer.

[0171] Cell culture and fixation: U-2 OS cells were cultured with Eagle's minimum essential medium (ATCC) containing 10% (vol / vol) fetal bovine serum (FBS) (Thermo Fisher Scientific) and penicillin-streptomycin (Thermo Fisher Scientific). To aid cell attachment, silanized coverslips were coated with 0.1 mg / mL poly-D-lysine (PDL) (Sigma) diluted in nuclease-free water for 1 hour at room temperature. Coverslips were washed three times with water, incubated overnight in water at room temperature, then dried and UV sterilized before seeding cells. U-2 OS cells were then seeded at 250,000 cells per coverslip for 48 hours at 37°C with 5% CO2. Cells were fixed with 4% (v / v) paraformaldehyde (PFA) (Electron Microscopy Sciences) in 1× PBS for 15 min at room temperature, washed three times with 1× PBS, then permeabilized with 0.5% (v / v) Triton X-100 (Sigma) in 1× PBS for 10 min, and washed again three times with 1× PBS.

[0172] Staining of the coding probe was performed as follows: fixed and permeabilized U-2 OS cells were incubated for 5 min in coding wash buffer containing 2x sodium citrate saline (SSC) (Ambion) and 30% (vol / vol) formamide (Ambion) in nuclease-free water. Thirty microliters of about 300 micromolar MERFISH-encoded probe or about 1 micromolar FLNA-encoded probe and 3.3 micromolar poly(dT) LNA anchor probe [having the sequence: 5Acryd / TTGAGTGGATGGAGTGTAATT+TT+TT+TT+TT+TT+TT+TT+TT+TT (SEQ ID NO: 65), a 20 nucleotide sequence with alternating dT and thymidine-locked nucleic acid (dT+), with the 20 nucleotide reverse complement of the readout sequence, and a 5'-acrydite modification (Integrated DNA Technologies)] in encoding hybridization buffer were then added to the surface of the Parafilm and covered with a coverslip containing the cells. The coding hybridization buffer contained coding wash buffer supplemented with 10% (wt / vol) dextran sulfate (Sigma), 0.1% (wt / vol) yeast tRNA (Life Technologies), and 1% (vol / vol) mouse RNase inhibitor (New England Biolabs). Samples were incubated for 36 hours at 37°C in a humidified chamber inside the hybridization oven. Cells were then washed twice with coding wash buffer and incubated at 47°C for 30 minutes each time.

[0173] Embedding and clearing of samples: 4% PA gel was used to anchor RNA in place in the coding probe stained samples. Briefly, the coding probe stained samples on the coverslip were first incubated for 2 minutes with degassed PA solution with 4% (volume / volume) 19:1 acrylamide / bis-acrylamide (BioRad), 60 mM Tris HCl pH 8 (Thermo Fisher), 0.3 M NaCl (Thermo Fisher), and a 1:100,000 dilution of carboxylic acid-modified orange fluorescent beads (Life Technologies, F-8800) with a diameter of 0.1 micrometers. The beads were used as fiducial markers for alignment of images taken over multiple rounds of MERFISH imaging. The cover slip containing the cells was then incubated again for 2 minutes with the same PA gel solution containing the polymerization inducer ammonium persulfate (Sigma) and the accelerator TEMED (Sigma) at final concentrations of 0.05% (w / v) and 0.05% (v / v), respectively. 50 microliters of this gel solution was added to the surface of a glass plate (TED Pella) that had been pretreated with 1 mL of GelSlick (Lonza) to prevent PA from sticking. The sample was aspirated to remove excess PA gel solution, and then inverted onto the 50 microliter drop to form a thin layer of PA without air bubbles between the cover slip and the glass plate. Then, after 1.5 hours of gel casting at room temperature, the coverslip and glass plate were gently separated and the coverslip was washed twice with digestion buffer having 2% (wt / vol) sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific), 50 mM Tris HCl pH 8 (Ambion), 1 mM EDTA (Ambion), and 0.5% (vol / vol) Triton X-100 in nuclease-free water. The gel was then submerged and digested for >12 hours in digestion buffer supplemented with 1% (vol / vol) proteinase K (New England Biolabs) in a humidified 37° C. incubator.The digested samples were washed three times for 15 min each with 2×SSC on a rocker. Samples were either stored for no more than 48 h at 4° C. in 2×SSC supplemented with 0.1% (v / v) mouse RNase inhibitor for non-amplified MERFISH measurements or proceeded to staining for amplified sequences.

[0174] Staining of amplified sequences: Primary and secondary amplified sequences were stained in gel-embedded and cleared samples. Samples were incubated for 5 minutes in 10% formamide wash buffer containing 2x SSC (ThermoFisher) and 10% (vol / vol) formamide (ThermoFisher) in nuclease-free water. Then, 50 microliters of 5 nM primary amplified sequence was added to the surface of the Parafilm in an amplified sequence hybridization buffer containing 2x SSC, 10% (vol / vol) formamide, 0.1% (w / vol) yeast tRNA (Life Technologies), 1% (v / vol) mouse RNase inhibitor (New England Biolabs), and 10% (w / vol) dextran sulfate (Sigma). The samples covered on the 50 microliter droplets on the Parafilm were incubated in a humidity-controlled 37°C incubator for 30 minutes (MERFISH) or for a time sequence of 15, 30, 60, and 180 minutes for binding rate measurements after removing excess 10% formamide wash buffer with Kimwipes. The samples were then washed three times in a Petri dish at room temperature in 10% formamide wash buffer for 5 minutes each time. Onto the unused Parafilm, 50 microliters of 5 nM secondary amplification sequence in amplification sequence hybridization buffer was added. The washed samples were covered again on the droplets and incubated in a 37°C incubator for the same time as the primary amplification sequence staining. Samples were then washed twice for 5 min each in 10% formamide wash buffer at room temperature, with a third wash in 10% formamide wash buffer for 15 min in a 37° C. incubator. Samples were either imaged immediately or stored in 2× SSC supplemented with 0.1% (v / v) mouse RNase inhibitor at 4° C. for no more than 48 h.

[0175] MERFISH Imaging Platform: Samples were imaged on a home-built high-throughput imaging platform at the Center for Advanced Imaging, Harvard University. Briefly, the microscope was built around an Olympus IX-71 microscope body and a Nikon, CFI Plan Apo Lambda 60x oil objective. Illumination at 750, 647, 560, 488, and 405 nm was provided using solid-state lasers (MBP Communications, 2RU-VFL-P-500-750-B1R; MBP Communications, 2RU-VFL-P-2000-647-B1R; MBP Communications, 2RU-VFL-P-2000-560-B1R; MBP Communications, 2RU-VFL-P-500-488-B1R; Coherent, Cube 405). These laser beams were used to excite Alexa750 and Cy5, orange reference beads, polydT readout and DAPI labeled readout probes, respectively. The illumination profile was flattened by a πShaper (Pishaper). Fluorescence emission from the sample was separated from the laser illumination using a pentaband dichroic mirror (Chroma, zy405 / 488 / 561 / 647 / 752RP-UF1) and imaged by an academic CMOS camera (sCMOS; Hamamatsu Photonics, C11440-C22CU) after removing excitation stray light through two custom-made overlapping Venta notch filters (Chroma, ZET405 / 488 / 561 / 647-656 / 752m). The pixel size for the sCMOS camera was determined to correspond to 109 nm in the sample plane. The exposure time was 500 ms for each imaging frame.Sample position was controlled via a motorized microscope stage (Ludl) and focus was maintained via a custom-built focus lock system achieved via a feedback system between an objective nanopositioner (Mad City Labs, Nano-F100S) and the reflected light of an IR laser (Thorlabs, LP980-SF15) onto a CMOS camera (Thorlabs, DCC1545M). Sample coverslips were held within a flow chamber (Bioptechs, FCS2) and buffer exchange within this chamber was directed using a custom-built automated fluidics system controlling three 8-way valves (Hamilton, MVP and HVXM 8-5) and a peristaltic pump (Gilison, Minipuls 3).

[0176] Imaging of samples: Sequential MERFISH imaging was performed on the high-throughput imaging platform described above. Briefly, each MERFISH round involved staining of the readout probe (10 min), washing with wash buffer (5 min), flowing with imaging buffer (3 min), imaging with 100-400 fields of view, fluorophore cleavage of the readout (15 min), and washing with 2x SSC (5 min). Eight rounds of two-color MERFISH imaging were performed for each sample. Specifically, staining of the readout probe was performed by flowing 3 nM readout probe into hybridization buffer with 2x SSC, 10% (v / v) ethylene carbonate (Sigma-Aldrich), 0.1% (v / v) mouse RNase inhibitor (NEB) in nuclease-free water. The wash buffer contained 2x SSC and 10% (vol / vol) ethylene carbonate in nuclease-free water. The imaging buffer used 2x SSC, 50 mM Tris HCl pH 8, 10% (wt / vol) glucose, 2 mM Trolox (Sigma-Aldrich), 0.5 mg / mL glucose oxidase (Sigma-Aldrich), 40 micrograms per mL catalase (Sigma-Aldrich), and 0.1% (vol / vol) mouse RNase inhibitor in nuclease-free water. A cleavage buffer containing 2x SSC and 50 mM tris(2-carboxyethyl)phosphine (TCEP; Sigma) was used to cleave the disulfide bond conjugating the dye to the probe. SmFISH imaging was similar to single-round MERFISH imaging, but without the cleavage and washing steps with 2x SSC.

[0177] Image processing and decoding: For FLNA smFISH data, the intensity and PSF size of non-amplified and amplified FISH spots were calculated through a Gaussian fitting routine. For MERFISH data, registration of images of the same field of view across different imaging rounds and decoding of RNA barcodes were performed as follows. Briefly, the offset between images in each imaging round was corrected using the localization of fiducial beads in each imaging round. Next, the background in the images was removed by a high-pass filter, the RNA spots were tightened by deconvolution, and the RNA centroids, which have slightly different positions between images, were connected through a low-pass filter. The intensity of the different color channels of the RNA spots was then normalized by equalizing their intensity histograms through an iterative process. Barcodes were assigned to individual pixels by comparing the normalized intensity of each pixel among all 16 images in the eight two-color rounds.

[0178] The calculations were performed on a desktop server containing two 10-core Intel Xeon E5-2680 2.8-GHz CPUs and 256 GB of RAM. EXAMPLES

[0179] In order to confirm 5x5 amplification in tissue samples, in this example, mouse medial preoptic area (MPOA) was selected. The tissue was cut into 10 micrometer sections, stained with 135 genes MERFISH library, and then gel embedded and cleared. Then, 5x5 amplification was performed on the tissue samples using the same technique as described above.

[0180] Figure 4A shows a first round raw image of a 5x5 amplified bright spot, and Figure 4B is a magnified view of the area outlined in white in Figure 4A (scale bar in Figure 4A is 10 micrometers, scale bar in Figure 4B is 2 micrometers).

[0181] After decoding, RNA counts from MERFISH measurements were compared to RNA abundance data from RNA-seq. They were strongly correlated, with a Pearson correlation coefficient of 0.81. This can be seen in Figure 4C, which shows plots for FPKM (fragments per kilobase of transcript per million mapped reads) and counts per field of view (FOV).

[0182] Although several embodiments of the invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing the functions and / or obtaining one or more of the results and / or advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the specific application or applications for which the teachings of the invention are used. Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Thus, the foregoing embodiments are presented by way of example only, and it will be understood that, within the scope of the appended claims and their equivalents, the invention may be practiced otherwise than as specifically described and claimed. The invention is directed to each individual feature, system, item, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, items, materials, kits, and / or methods is also included within the scope of the present invention, to the extent that such features, systems, items, materials, kits, and / or methods are not mutually inconsistent.

[0183] In the event that the present specification and a document incorporated by reference include conflicting and / or inconsistent disclosure, the present specification shall control. In the event that two or more documents incorporated by reference include conflicting and / or inconsistent disclosure with respect to each other, the document having the later publication date shall control.

[0184] All definitions provided and used herein are to be understood to take precedence over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0185] The indefinite articles "a" and "an," as used in the specification and claims, unless indicated to the contrary, shall be understood to mean "at least one."

[0186] The term "and / or" as used herein and in the claims shall be understood to mean "one or both" of the elements so connected, i.e., elements that are conjunctive in some cases and disjunctive in other cases. Multiple elements listed with "and / or" shall be understood in the same manner, i.e., "one or more" of the elements so connected. The "and / or" clause may include other elements other than the element specifically identified, whether related or unrelated to the element specifically identified. Thus, as a non-limiting example, a reference to "A and / or B," when used in conjunction with an open-ended phrase such as "including," may refer, in one embodiment, to only A (which may include elements other than B); in another embodiment, to only B (which may include elements other than A); in yet another embodiment, to both A and B (which may include other elements), and so forth.

[0187] As used herein and in the claims, "or" shall be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as being inclusive, i.e., the inclusion of at least one of a number or list of elements, but also including more than one number or list, and may include additional items not listed. Only terms clearly indicated to the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," shall refer to exactly one element of a number or list of elements. In general, the term "or" as used herein shall be interpreted to refer to exclusive alternatives (i.e., "one or the other, but not both") only when preceded by a term of exclusivity, such as "either," "one of," "only one of," or "exactly one of."

[0188] The phrase "at least one," as used herein and in the claims, in reference to a list having one or more elements, shall be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed in the list of elements, and not excluding any combination of elements in the list of elements. This definition also allows for elements to be present other than the elements specifically identified in the list of elements to which the phrase "at least one" refers, whether related or unrelated to the specifically identified element. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B" or, equivalently, "at least one of A and / or B") can refer, in one embodiment, to at least one A (and can include elements other than B), which may include more than one A but no B; in another embodiment, to at least one B (and can include elements other than A), which may include more than one B but no A; in yet another embodiment, to at least one A, which may include at least one A and more than one B, which may include at least one B (and can include other elements), etc.

[0189] When the word "about" is used herein in reference to a number, it should be understood that further embodiments of the invention include numbers that are not modified by the word "about."

[0190] It is also to be understood that, unless expressly indicated to the contrary, in any method claimed herein that includes more than one step or act, the order of the method steps or acts is not necessarily limited to the order of the method steps or acts recited.

[0191] In the claims, as well as in the above specification, all transitional phrases such as "comprising," "including," "holding," "having," "containing," "with," "holding," "consisting of," etc., shall be understood to be open-ended, i.e., to mean "including, but not limited to." Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as expressly set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

Claims

1. exposing a sample containing nucleic acid targets to nucleic acid probes, where each nucleic acid probe comprises a target sequence and one or more lead sequences capable of binding to the target; exposing the nucleic acid probe to a primary amplified nucleic acid that includes a repeat sequence to which a secondary amplified nucleic acid can bind and a complementary sequence that can bind to the lead sequence of the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid that contains repeat sequences to which a fluorescent signal generating entity can bind and complementary sequences that can bind to the repeat sequences of the primary amplified nucleic acid; exposing the secondary amplified nucleic acid to a fluorescent signal generating entity in successive rounds of hybridizing and imaging; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word for the nucleic acid target based on sequential fluorescence imaging of the sample; and for at least a portion of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words; 1. A method for imaging nucleic acids in a sample, comprising:

2. The method of claim 1 , wherein a maximum number of primary amplified nucleic acids are allowed to bind to the nucleic acid probe.

3. The method of claim 1 or 2, wherein a maximum number of secondary amplified nucleic acids are allowed to bind to the primary amplified nucleic acids.

4. The method of any one of claims 1 to 3, comprising exposing the sample to at least 5, at least 10 or at least 100 different nucleic acid probes.

5. The method of any one of claims 1 to 4, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable.

6. The method of any one of claims 1 to 5, wherein the secondary amplified nucleic acid binds within a fixed distance to the primary amplified nucleic acid.

7. The method of any one of claims 1 to 6, comprising sequentially exposing the sample to a plurality of nucleic acid probes.

8. The method of any one of claims 1 to 7, wherein the plurality of nucleic acid probes comprises a combination of nucleic acid probes with different sequences.

9. The method of any one of claims 1 to 8, wherein at least a portion of the plurality of nucleic acid probes comprises DNA.

10. The method of any one of claims 1 to 9, wherein at least a portion of the plurality of nucleic acid probes comprises RNA.

11. The method of any one of claims 1 to 10, wherein the target comprises RNA or DNA.

12. The method of claim 11 , wherein the RNA comprises non-coding RNA, mRNA, transfer RNA (tRNA) or ribosomal RNA (rRNA), or the DNA comprises genomic DNA.

13. The method of any one of claims 1 to 12, wherein no more than 5, no more than 10, or no more than 20 primary amplified nucleic acids are allowed to bind to the nucleic acid probe.

14. The method according to any one of claims 1 to 13, wherein the primary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides.

15. 15. The method of any one of claims 1 to 14, wherein no more than 5, no more than 10, or no more than 20 secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid.

16. The method of any one of claims 1 to 15, wherein the secondary amplified nucleic acids have an average length of less than 300 nucleotides or less than 200 nucleotides.

17. The method according to any one of claims 1 to 16, wherein the secondary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides.

18. The method of any one of claims 1 to 17, wherein the fluorescent signal generating entity comprises a protein, a dye, Alexa Fluor 750, Cy5, and / or a nanoparticle.

19. A method according to any one of claims 1 to 18, comprising inactivating the fluorescent signal generating entity by removing the fluorescent signal generating entity.

20. 19. The method of any one of claims 1 to 18, comprising cleaving a disulfide bond or a photocleavable bond to inactivate the fluorescent signal generating entity by photobleaching the fluorescent signal generating entity, by chemically bleaching the fluorescent signal generating entity, or by enzymatic cleavage of the fluorescent signal generating entity.

21. 21. The method of any one of claims 1 to 20, wherein a plurality of nucleic acid probes are assigned code spaces separated by a Hamming distance of at least 2 or a Hamming distance of at least 3.

22. The method of any one of claims 1 to 21, comprising determining the distribution of the nucleic acid probes by imaging at least a portion of the sample.

23. 23. The method of any one of claims 1 to 22, comprising determining the binding of the nucleic acid probe using optical imaging, fluorescence imaging, multi-colour fluorescence imaging, super-resolution fluorescence imaging or STORM (stochastic optical reconstruction microscopy).

24. 24. The method of claim 22 or 23, comprising determining the centroid of the image for the secondary amplified nucleic acid using an algorithm for determining non-overlapping single emitters or partially overlapping single emitters, and optionally determining a confidence level for the secondary amplified nucleic acid.

25. 25. The method of claim 24, comprising determining a confidence level using a ratio of the number of exact matches to the number of matches with one or more single-bit errors for the codeword, or using a ratio of the number of exact matches to the number of matches with exactly one single-bit error for the codeword.

26. 26. The method of any one of claims 1 to 25, comprising determining the distribution of nucleic acid probes in a sample at a resolution of greater than 50 nm, 100 nm, or 300 nm.

27. The method of any one of claims 1 to 26, wherein the sample comprises a cell or tissue.

28. 28. The method of claim 27, wherein the cells are fixed, and optionally the cells are human cells.

29. 29. The method of any one of claims 1 to 28, further comprising exposing the secondary amplified nucleic acid to one or more further rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each amplified nucleic acid capable of binding to a preceding round of amplified nucleic acid.

30. 30. The method of any one of claims 1 to 29, wherein the plurality of nucleic acid probes comprises distinguishable nucleic acid probes formed from a combination of one or more lead sequences.

Images