Aptamers for TGF-β1 and uses thereof

Abstract

The purpose of the present invention is to provide an aptamer for TGF-β1. This aptamer, which has four consecutive sets of G bases and binds to TGF-β1 containing a combination of nucleotide sequences represented by formulae (I) and (II), may be useful as a preventive and / or therapeutic medicine, a diagnostic agent, or a labeling agent for various diseases associated with the activation of TGF-β1. Formula (I): UAAX Formula (II): ARACUU (In the formulae, X represents a bond or GU, and R represents A or G.)

Description

[Technical field]

[0001] The present invention relates to an aptamer against transforming growth factor β1 and a method for using the same. [Background technology]

[0002] Transforming growth factor-β (TGF-β) was initially identified as a growth factor that promotes the transformation of fibroblasts (Non-Patent Documents 1 and 2). Recent research has revealed that TGF-β contributes to the inhibition of proliferation, cell differentiation, cell adhesion and migration, and induction of apoptosis in many cell types. Therefore, TGF-β is considered to play an important role in a wide range of areas, such as ontogenesis, tissue reconstruction, wound healing, inflammation and immunity, and cancer invasion and metastasis. There are five known isoforms of TGF-β with 70-80% homology in amino acid sequence, and the first to be discovered was TGF-β1. Each isoform, including TGF-β1, is secreted as a high molecular weight inactive (latent) form and exerts its effect upon activation in the vicinity of target cells. The production and deposition-promoting activity of extracellular matrix proteins accounts for a large part of the biological activity of TGF-β1. In various diseases that cause fibrosis (pulmonary fibrosis, hepatic fibrosis, scirrhous gastric cancer, etc.), the plasma TGF-β1 level increases. In addition, its association with renal glomerular lesions, bone diseases, ischemic diseases, etc. has also attracted attention.

[0003] Several molecules that bind to TGF-β1 and inhibit its function have been reported. Anti-TGF-β monoclonal antibodies LY238770 (recognizes TGF-β1) and Fresolimumab (GC1008; recognizes TGF-β1, 2, and 3) bind to the target TGF-β1 (Non-Patent Document 3), and are expected to be new therapeutic agents for several types of malignant neoplasms and idiopathic pulmonary fibrosis due to their functional inhibitory effects (NCT00356460, NCT00923169, NCT01472731, NCT01112293, NCT01401062; Non-Patent Document 4). Peptides that bind to TGF-β1 and exhibit functional inhibitory effects have also been reported (Non-Patent Document 5). Among small molecules, Galunisertib (LY2157299) has been reported to exhibit functional inhibitory effects by binding to the TGF-β1 type receptor to which TGF-β1 binds.

[0004] Also, antibodies specific for human TGF-β1 have been shown to be effective in animal models for the treatment of TGF-β1 glomerulonephritis (Non-Patent Document 6), neural scarring (Non-Patent Document 7), skin scarring (Non-Patent Document 8), and pulmonary fibrosis (Non-Patent Document 9). Furthermore, antibodies against TGF-β1, 2, and 3 have been shown to be effective in models of pulmonary fibrosis, radiation-induced fibrosis (Patent Document 5), myelofibrosis, burns, Dupuytren's contracture, gastric ulcer, and rheumatoid arthritis (Non-Patent Document 10).

[0005] By the way, an aptamer means a nucleic acid that specifically binds to a target molecule (protein, sugar chain, hormone, etc.). It binds to the target molecule due to the three-dimensional structure of a single-stranded RNA (or DNA). A screening method called the SELEX method (Systematic Evolution of Ligands by Exponential Enrichment) is used to obtain it (Patent Documents 1 to 3). The aptamer obtained by the SELEX method has a chain length of about 80 nucleotides, and is then shortened using the physiological inhibitory activity of the target molecule as an indicator. Furthermore, chemical modifications are added to improve stability in the body, and the aptamer is optimized as a pharmaceutical. Aptamers have high binding properties with target molecules, and their affinity is often higher than that of antibodies with similar functions. Furthermore, they are less susceptible to immune exclusion, and are less likely to cause side effects such as antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC), which are specific to antibodies. From the perspective of delivery, aptamers are about 1 / 10 the molecular size of antibodies, so they are more likely to migrate into tissues, making it easier to deliver drugs to the desired site. In addition, some small molecules of the same molecular targeted drugs are poorly soluble and may require optimization for formulation, but aptamers are highly water soluble, which is also an advantage. Furthermore, since they are produced by chemical synthesis, costs can be reduced by mass production. Other advantageous features of aptamers include long-term storage stability and heat and solvent resistance. On the other hand, the half-life of aptamers in the blood is generally shorter than that of antibodies. However, this can also be an advantage when considering toxicity.

[0006] As an aptamer for TGF-β, there is an aptamer developed by Gilead Sciences. Patent Document 4 describes an aptamer that binds to TGF-β obtained by the above-mentioned SELEX method. However, the sequence of this aptamer is different from that of the aptamer specifically shown in this specification. Furthermore, this document does not suggest anything about the aptamer specifically shown in this specification. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] International Publication WO91 / 19813 Brochure [Patent Document 2] International Publication WO94 / 08050 Brochure [Patent Document 3] International Publication WO95 / 07364 Brochure [Patent Document 4] International Publication WO2005 / 113811 Brochure [Patent Document 5] U.S. Patent No. 5,616,561 [Non-patent literature]

[0008] [Non-Patent Document 1] Roberts AB et al., Proc Natl Acad Sci US A. 1981 Sep;78(9):5339-43. [Non-Patent Document 2] Anzano MA. et al., Cancer Res. 1982 Nov;42(11):4776-8. [Non-Patent Document 3] Grutter C. et al., Proc Natl Acad Sci US A. 2008 Dec 23;105(51):20251-6. [Non-Patent Document 4] Neuzillet C. et al., Pharmacol Ther. 2015 Mar;147:22-31. [Non-Patent Document 5] Gallo-Oller G. et al., Cancer Lett. 2016 Oct 10;381(1):67-75. [Non-Patent Document 6] Border WA. et al., Nature. 1990 Jul 26;346(6282):371-4. [Non-Patent Document 7] Logan A. et al., Eur J Neurosci. 1994 Mar 1;6(3):355-63. [Non-Patent Document 8] Shah M. et al., Lancet. 1992 Jan 25;339(8787):213-4. [Non-Patent Document 9] Giri SN et al., Thorax. 1993 Oct;48(10):959-66. [Non-Patent Document 10] 1554341459068_0 et al., J Exp Med. 1993 Jan 1;177(1):225-30. Summary of the Invention [Problem to be solved by the invention]

[0009] An object of the present invention is to provide an aptamer against TGF-β1. [Means for solving the problem]

[0010] As a result of intensive research to solve the above problems, the present inventors have succeeded in producing an aptamer that specifically binds to TGF-β1 and demonstrated that this aptamer inhibits the activity of TGF-β1. In particular, many of these aptamers have a characteristic motif sequence and a set of four consecutive G bases, and are novel in that they have a structure completely different from that of conventionally known TGF aptamers.

[0011] That is, the present invention provides the following inventions: [1] An aptamer that binds to TGF-β1, which has a set of four consecutive G bases and comprises a combination of nucleotide sequences represented by the following formula (I) and formula (II): Formula (I): UAAX Formula (II): ARACUU (wherein X represents a bond or GU; R represents A or G). [2] An aptamer described in [1], in which a nucleotide sequence represented by formula (I): UAAX is located at the most N-terminal side of a set of four G bases, and a nucleotide sequence represented by formula (II): ARACUU is located between the second and third sets of G bases. [3] The aptamer according to [1] or [2], wherein the aptamer is represented by the following formula (III): Formula (III):UAAXGGRNGGSGARACUUGKGVNRGG (In the formula, X represents a bond or GU; N represents any base; R represents A or G; S represents C or G; K represents G or U; V represents A, C or G; and B represents C, G or U (limited to combinations in which the set of G bases is four). An aptamer comprising a nucleotide sequence represented by: [4] The aptamer according to [1] or [2], wherein the aptamer is represented by the following formula (III'): Formula (III'): UAAXGGRBGGGSGARACUUGKGVBRGG (In the formula, X represents a bond or GU; R represents A or G; S represents C or G; K represents G or U; V represents A, C or G; and B represents C, G or U (limited to combinations in which the set of G bases is four). An aptamer comprising a nucleotide sequence represented by: [5] The aptamer according to [1] or [2], wherein the aptamer is represented by the following formula (III″): Formula (III''):AUAAGGGHGGGGAGACUUGUGGWGGG (Wherein, W represents A or U; H represents A, C or U). An aptamer comprising a nucleotide sequence represented by: [6] The aptamer according to any one of [1] to [5], wherein at least one nucleotide contained in the aptamer is modified. [7] An aptamer that binds to TGF-β1, comprising any one of the nucleotide sequences (a) to (c) below. (a) a sequence represented by SEQ ID NO: 4 to 6, 9, 11, 13, 17 to 22, 26 to 29, or 31 (b) A sequence in which one or more nucleotides are substituted, deleted, inserted or added in the above (a); or (c) A sequence in which at least one nucleotide in the above (a) or (b) is modified. [8] The aptamer according to any one of [1] to [6], having a nucleotide length of 55 nucleotides or less. [9] The aptamer according to any one of [1] to [8], which inhibits the binding of TGF-β1 to a TGF-β1 receptor.

[10] A complex comprising the aptamer described in any one of [1] to [9] and a functional substance.

[11] A pharmaceutical comprising the aptamer according to any one of [1] to [9] or the complex according to

[10] .

[12] A method for detecting TGF-β1, comprising using the aptamer according to any one of [1] to [9] or the complex according to

[10] . Effect of the Invention

[0012] According to the present invention, the activity of TGF-β1 can be selectively inhibited, and therefore, diseases caused by the overexpression of TGF-β1 can be treated. [Brief description of the drawings]

[0013]

Figure 1

[0014] The present invention will be described in detail below. In the present specification, the abbreviations for nucleic acid bases are as follows: Symbol Meaning Explanation AA Adenine CC Cytosine GG Guanine TT Thymine UU Uracil MA or C Amino RA or G Purine WA or U - SC or G - YC or U pyrimidine KG or U Keto VA or C or G - HA or C or U - BC or G or U - N A or C or G or U - (The same applies when using lowercase letters.)

[0015] The present invention provides an aptamer having binding activity to TGF-β1. The aptamer of the present invention can inhibit the activity of TGF-β1.

[0016] An aptamer refers to a nucleic acid molecule that has binding activity to a specific target molecule. An aptamer can inhibit the activity of a specific target molecule by binding to the specific target molecule. The aptamer of the present invention is an aptamer that has binding activity to TGF-β1. It can also be an aptamer that can inhibit the activity of TGF-β1. The aptamer of the present invention can also be RNA, DNA, modified nucleic acid, or a mixture thereof. The aptamer of the present invention can also be in a linear or cyclic form.

[0017] TGF-β1 (transforming growth factor-β1) is a multifunctional cytokine and a protein produced in almost all cells. TGF-β1 protein is produced as a precursor polypeptide (UniProtKB-P01137, 390 amino acid residues: signal peptide (positions 1-29), LAP (positions 30-278), mature (or active) TGF-β1 (positions 279-390)). The precursor polypeptide is cleaved by a furin-like protease to generate LAP (latency associated protein, 249 amino acid residues) at the N-terminus and mature TGF-β1 (112 amino acid residues) at the C-terminus. The LAP and mature TGF-β1 portions homodimerize with each other via disulfide bonds. Such homodimerized mature TGF-β1 and LAP bind non-covalently to form a complex. In mammals, including humans, TGF-β exists in three isoforms: β1, β2, and β3. The homology of these isoforms is 70-80%. TGF-β1 is known to have many functions, such as cell proliferation, control of cell differentiation, induction of epithelial-mesenchymal transition, immune system regulation through control of T cell differentiation, regulation of angiogenesis, and promotion of extracellular matrix production. As mentioned above, it has been reported that the administration of TGF-β1 inhibitors can treat diseases such as cancer and fibrosis.

[0018] The aptamer of the present invention has binding activity against TGF-β1 derived from any mammal. The aptamer of the present invention may also have inhibitory activity against TGF-β1 derived from any mammal. Examples of such mammals include primates (e.g., humans, monkeys), rodents (e.g., mice, rats, guinea pigs, hamsters), pets, livestock, and working animals (e.g., dogs, cats, horses, cows, goats, sheep, and pigs), and preferably humans. The amino acid sequence of TGF-β1 is not limited to the wild-type sequence, and may be one in which one to several residues are mutated relative to the wild-type sequence, or a domain portion or peptide portion thereof.

[0019] The aptamer of the present invention binds to TGF-β1 in a physiological buffer solution. The buffer solution is not particularly limited, but one having a pH of about 5.0 to 10.0 is preferably used, and an example of such a buffer solution is solution A (see Example 1) described below. The aptamer of the present invention specifically binds to TGF-β1 with a strength detectable by any of the following tests.

[0020] The binding strength can be measured using Biacore T200 manufactured by GE Healthcare. In one measurement method, the aptamer is first immobilized on a sensor chip. The amount of immobilization is about 1000 RU (e.g., 1500 RU, etc.). The TGF-β1 solution for the analyte is prepared at 1 nM to 200 nM (e.g., 4 nM or 10 nM, etc.) and 20 μL of the solution is injected, and the binding of TGF-β1 to the aptamer is detected. RNA containing a random nucleotide sequence consisting of 30 to 100 nucleotides (e.g., 66, 80, or 90 nucleotides, etc.) is used as a negative control. When TGF-β1 binds to the aptamer equally or significantly stronger than the control RNA, the aptamer can be determined to have the ability to bind to TGF-β1.

[0021] In another measurement method, TGF-β1 is first immobilized on a sensor chip. The amount of immobilization is about 1000 RU. 20 μL of an aptamer solution for the analyte prepared at 10 nM to 200 nM (e.g., 20 nM or 100 nM, etc.) is injected, and the binding of the aptamer to TGF-β1 is detected. RNA containing a random nucleotide sequence consisting of 30 to 100 nucleotides (e.g., 66, 80, or 90 nucleotides, etc.) is used as a negative control, and when TGF-β1 binds to the aptamer equally or significantly stronger than the control RNA, the aptamer is determined to have the ability to bind to TGF-β1.

[0022] The inhibitory activity against TGF-β1 means the ability to inhibit any activity possessed by TGF-β1.For example, the activity of TGF-β1 includes, but is not limited to, TGF-β-mediated signal transduction, extracellular matrix (ECM) deposition, inhibition of epithelial and endothelial cell proliferation, promotion of smooth muscle proliferation, induction of collagen expression, induction of the expression of TGF-β, fibronectin, VEGF and IL-11, suppression of tumor-induced immunity, promotion of angiogenesis, activation of myofibroblasts, promotion of metastasis, and inhibition of NK cell activity.The aptamer of the present invention inhibits at least one of these activities of TGF-β1.

[0023] Whether or not an aptamer inhibits the activity of TGF-β1 can be evaluated by, for example, a cell assay system that monitors the Smad signaling pathway, which is known to be activated by stimulation with TGF-β, as described in the Examples. Briefly, the evaluation can be performed by the following means: Photinus luciferase with SBE (Smad-binding element) mounted in the promoter region is used as a reporter. Renilla luciferase expression plasmid is mixed with this SBE-induced Photinus luciferase reporter plasmid at an appropriate ratio (e.g., 20:1) as a standardization control for transfection efficiency, and transfected into HEK293 cells. The transfected HEK293 cells are re-seeded on a 96-well plate and cultured until confluent. A mixture of TGF-β1 and an aptamer synthesized using T7 RNA polymerase or a chemically synthesized aptamer is added thereto to an appropriate final concentration (e.g., 10 pM to 100 nM, etc.), and cultured for 1 to 8 hours (e.g., 3 hours, etc.). The expression levels of Photinas luciferase and Renilla luciferase are then confirmed using an appropriate method, and the expression levels are appropriately corrected and compared to evaluate whether the aptamer inhibits the activity of TGF-β1.

[0024] In one embodiment, the aptamer of the present invention is an aptamer that binds to TGF-β1, which has four sets of G bases and includes a combination of nucleotide sequences represented by formula (I) and formula (II) below.

[0025] Formula (I): UAAX Formula (II): ARACUU

[0026] (wherein X represents a bond or GU; R represents A or G). The term "bond" means that there is no nucleotide at the position of X, and the nucleotide adjacent to the 5' side of X (i.e., adenosine 5'-phosphate) is linked to the ribonucleotide adjacent to the 3' side of X via a phosphodiester bond.

[0027] In one embodiment, the aptamer of the present invention has four sets of G bases as described above, and is characterized by also having nucleotide sequences represented by formula (I): UAAX and formula (II): ARACUU. The arrangement of the four "sets of G bases", "nucleotides represented by formula (I)", and "nucleotides represented by formula (II)" is not particularly limited, but preferably, the motif represented by formula (I) UAAX constituting the aptamer of the present invention is present on the N-terminal side of the G set located at the most N-terminal side (hereinafter, the four G sets contained in the aptamer of the present invention may be referred to as the "first G set", the "second G set", the "third G set", and the "fourth G set" from the N-terminal side), and the motif represented by formula (II) ARACUU is present between the second G set and the third G set. In this schematic diagram (Fig. 1), a parallel G-quartet structure is shown as an example, but this does not exclude the possibility of other types of G-quartet structure (antiparallel type, mixed type), triplex structure other than quadruplex structure, or other three-dimensional structures.

[0028] The number of G bases in the above-mentioned "set of G bases" is not particularly limited as long as the G bases are consecutive, as long as it is 2 or more, but is preferably 5 or less, and more preferably 2 to 4. All four "sets of G bases" do not need to have the same number of G bases, and an appropriate number of G bases can be selected as long as the aptamer of the present invention has the desired activity. However, the number of G bases in the "second set of G bases" is preferably 4, and the number of G bases in the "fourth set of G bases" is preferably 3.

[0029] The above-mentioned "set of G bases" and "nucleotides represented by formula (I)" and "nucleotides represented by formula (II)" may or may not be directly adjacent to each other, so long as the aptamer of the present invention has the desired activity. When they are not adjacent to each other, the distance between them is not particularly limited, but is preferably one to several bases, for example, about 1 to 9 bases, 1 to 5 bases, or 1 to 3 bases. At least one base other than G is present between the two "sets of G bases".

[0030] The G-quartet structure predicted as a possible structure of the aptamer of the present invention is a well-known structure in the art, and is an intermolecular and intramolecular quadruplex structure in DNA or RNA rich in guanosine nucleotides (G). The basic structure of the G-quartet structure is a plane in which four guanosine bases are cyclically tetramerized by Hoogsteen type base pairs with two adjacent guanosine bases. Finally, two to three planes overlap to form a stable quadruplex structure (G-quadruplex).

[0031] The G-quartet structure that the aptamer of the present invention may have is illustrated in Figure 1. In Figure 1, the white arrows represent two or more consecutive Gs ("G-assemblies") involved in the G-quartet structure, and the black arrows represent bonds or one or more bases.

[0032] The aptamer having a G-quartet structure can be confirmed by a measurement method known per se. For example, the aptamer can be confirmed to have a G-quartet structure by confirming a predetermined waveform using a CD spectrum. More specifically, the aptamer is dissolved in a TBS buffer solution (10 mM Tris-HCl, 150 mM NaCl, 5 mM KCl, pH 7.4) to prepare a sample solution, and the spectrum is measured under the conditions of a temperature of 20°C, a wavelength of 200 nm to 320 nm, a scanning speed of 100 nm / min, and an accumulation number of 10 times. In the CD spectrum, the aptamer can be confirmed to have a minimum value near 240 nm and a maximum value near 260 nm.

[0033] In another embodiment, the aptamer of the present invention is an aptamer that binds to TGF-β1, which has a set of four consecutive G bases and includes a combination of a nucleotide sequence represented by the following formula (III).

[0034] Formula (III):UAAXGGRNGGSGARACUUGKGVNRGG (In the formula, X represents a bond or GU; N represents any base; R represents A or G; S represents C or G; K represents G or U; V represents A, C or G; B represents C, G or U (limited to combinations in which the set of G bases is four). Note that "limited to combinations in which the set of G bases is four" means that combinations of bases that result in combinations in which the set of G bases in the formula is not four are excluded. Examples of combinations of bases that result in combinations in which the set of G bases in the formula is not four include, but are not limited to, the following: (1) K is G, (2) The first R is G and the first N is G; (3) K, V, the second N, and the third R are all G.

[0035] In one embodiment, formula (III) may be the following sequence: Formula (III-1): UAAGGRNGGSGARACUUGKGVNRGG (when X is a bond (SEQ ID NO: 49)); Formula (III-2): UAAGUGGRNGGSGARACUUGKGVNRGG (when X is GU (SEQ ID NO: 50)) (In the formula, N, R, S, K, V and B are as defined above, and the combination is limited to one in which the set of G bases is four.)

[0036] In another embodiment, the aptamer of the present invention is an aptamer that binds to TGF-β1, which has a set of four consecutive G bases and includes a combination of a nucleotide sequence represented by the following formula (III').

[0037] Formula (III'): UAAXGGRBGGGSGARACUUGKGVBRGG (wherein, X represents a bond or GU; R represents A or G; S represents C or G; K represents G or U; V represents A, C or G; and B represents C, G or U (limited to combinations in which the set of G bases is four).

[0038] In one embodiment, formula (III') can be the following sequence: Formula (III'-1): UAAGGRBGGSGARACUUGKGVBRGG (wherein X is a bond (SEQ ID NO: 51)); Formula (III'-2): UAAGUGGRBGGSGARACUUGKGVBRGG (wherein X is GU (SEQ ID NO: 52)) (In the formula, R, S, K, V and B are as defined above, and the combination is limited to one in which the set of G bases is four.)

[0039] In another embodiment, the aptamer of the present invention is an aptamer that binds to TGF-β1, which has a set of four consecutive G bases and includes a combination of a nucleotide sequence represented by the following formula (III″).

[0040] Formula (III''):AUAAGGGHGGGGAGACUUGUGGWGGG (Wherein W represents A or U; H represents A, C or U) (SEQ ID NO: 34)

[0041] In another embodiment of the present invention, the aptamer of the present invention may also include the following aptamers having activity of binding to TGF-β1 and / or activity of inhibiting the biological activity of TGF-β1: (a) an aptamer comprising a nucleotide sequence represented by SEQ ID NO: 4 to 6, 9, 11, 13, 17 to 22, 26 to 29, or 31; (b) an aptamer comprising a sequence in (a) in which one or several (e.g., one, two, three, four, or five) nucleotides have been substituted, deleted, inserted, or added; or (c) An aptamer comprising a sequence in (a) or (b) in which at least one nucleotide has been modified. It should be noted that the aptamers listed here may also include aptamers that do not contain the above-mentioned common motifs (i.e., SEQ ID NOs: 5, 11, 13, 18, 19, 20, 22, 26, and 27).

[0042] In another embodiment of the invention, the aptamer of the invention is the following aptamer: (a) an aptamer consisting of a base sequence represented by SEQ ID NO: 4 to 6, 9, 11, 13, 17 to 22, 26 to 29, or 31; (b) an aptamer consisting of a sequence in (a) in which one or several (e.g., one, two, three, four, or five) nucleotides have been substituted, deleted, inserted, or added; or (c) An aptamer comprising a sequence in (a) or (b) in which at least one nucleotide has been modified.

[0043] The length of the aptamer of the present invention is not particularly limited, and may be generally about 25 to about 200 nucleotides, for example, about 100 nucleotides or less, preferably about 55 nucleotides or less, more preferably about 45 nucleotides or less, and most preferably about 35 nucleotides or less. If the total number of nucleotides is small, chemical synthesis and mass production are easier, and there is also a large cost advantage. In addition, chemical modification is also easy, and the in vivo stability is high, and toxicity is thought to be low. On the other hand, the length of the aptamer of the present invention is generally about 25 nucleotides or more, preferably about 28 nucleotides or more, more preferably about 29 nucleotides or more, and particularly preferably about 30 nucleotides or more. If the total number of nucleotides is too small, it may not have a common sequence described below, and the potential tertiary structure may become unstable, and in some cases, it may not have activity.

[0044] The aptamer of the present invention inhibits the activity of TGF-β1 by specifically binding to TGF-β1. The aptamer of the present invention may bind to any part of TGF-β1 and inhibit the activity of TGF-β1 by any mechanism of action as long as it can inhibit the activity of TGF-β1. In one embodiment, the aptamer of the present invention inhibits the binding between TGF-β1 and the receptor of TGF-β1 by binding to TGF-β1, thereby inhibiting the activity of TGF-β1. It is clear that the aptamer known to inhibit the activity of TGF-β1 is an aptamer that binds to TGF-β1, even without confirming the binding to TGF-β1.

[0045] Furthermore, the aptamer of the present invention may have a modified sugar residue (e.g., ribose) of each nucleotide in order to enhance the binding affinity, stability, drug delivery, etc. to TGF-β1. Examples of the sites modified in the sugar residue include those in which the oxygen atoms at the 2', 3', and / or 4' positions of the sugar residue are replaced with other atoms. Examples of the types of modification include fluorination, O-alkylation (e.g., O-methylation, O-ethylation), O-allylation, S-alkylation (e.g., S-methylation, S-ethylation), S-allylation, and amination (e.g., -NH2). Such modifications of sugar residues can be carried out by methods known per se (see, for example, Sproat et al., (1991) Nucle. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145).

[0046] In one embodiment, each nucleotide contained in the aptamer of the present invention may be the same or different, and may be a nucleotide containing a hydroxyl group at the 2' position of the ribose (e.g., the ribose of a pyrimidine nucleotide, the ribose of a purine nucleotide) (i.e., an unsubstituted nucleotide), or a nucleotide in which the hydroxyl group at the 2' position of the ribose is substituted with any atom or group. Examples of such any atom or group include nucleotides substituted with a hydrogen atom, a fluorine atom, or an -O-alkyl group (e.g., an -O-Me group (sometimes also referred to as an "OMe group")), an -O-acyl group (e.g., an -O-COMe group), or an amino group (e.g., an -NH2 group).

[0047] In the aptamer of the present invention, all pyrimidine nucleotides may be nucleotides substituted at the 2' position of ribose with a fluorine atom, either identically or differently, or nucleotides substituted with any of the atoms or groups mentioned above, preferably an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group and a methoxy group.

[0048] In the aptamer of the present invention, all purine nucleotides may be nucleotides substituted at the 2' position of ribose with, either identically or differently, a hydroxyl group, or with any of the atoms or groups described above, preferably an atom or group selected from the group consisting of a hydrogen atom, a methoxy group and a fluorine atom.

[0049] The aptamer of the present invention may also be a nucleotide in which all nucleotides contain the same group at the 2' position of the ribose, which group is a hydroxyl group or any of the atoms or groups mentioned above, e.g., a hydrogen atom, a fluorine atom, a hydroxyl group, and a methoxy group.

[0050] The aptamer of the present invention can be further modified by adding polyethylene glycol, amino acids, peptides, inverted dT, nucleic acids, nucleosides, myristoyl, lithocolic-oleyl, docosanyl, lauroyl, stearoyl, palmitoyl, oleoyl, linoleoyl, other lipids, steroids, cholesterol, caffeine, vitamins, dyes, fluorescent substances, anticancer drugs, toxins, enzymes, radioactive substances, biotin, etc. to the termini. Such modifications can be performed, for example, with reference to U.S. Patent Nos. 5,660,985 and 5,756,703.

[0051] In this specification, the nucleotide constituting the aptamer is assumed to be RNA (i.e., the sugar group is assumed to be ribose), and the manner of modification to the sugar group in the nucleotide is described, but this does not mean that DNA is excluded from the nucleotide constituting the aptamer, and it can be appropriately interpreted as a modification to DNA. For example, when the nucleotide constituting the aptamer is DNA, the substitution of the hydroxyl group at the 2' position of ribose with X can be interpreted as the substitution of one of the hydrogen atoms at the 2' position of deoxyribose with X.

[0052] The aptamer of the present invention can be synthesized by the method disclosed in the present specification or a method known per se in the art. One of the synthesis methods is a method using RNA polymerase. The target RNA can be obtained by chemically synthesizing DNA having a target sequence and a promoter sequence of RNA polymerase and transcribing it using a template by a method already known. The aptamer can also be synthesized using DNA polymerase. The DNA having the target sequence is chemically synthesized and amplified using the template by a method already known, polymerase chain reaction (PCR). This is made into a single strand by a method already known, polyacrylamide electrophoresis or enzyme treatment. When synthesizing a modified aptamer, the efficiency of the extension reaction can be increased by using a polymerase with a mutation introduced at a specific position. The aptamer obtained in this way can be easily purified by a method already known.

[0053] Aptamers can be synthesized in large quantities by chemical synthesis methods such as the amidite method or the phosphoramidite method. The synthesis method is well known and is described in Nucleic Acid (Vol. 2) [1] Synthesis and Analysis of Nucleic Acid (Editor: Yukio Sugiura, Hirokawa Publishing Company), etc. In practice, synthesizers such as OligoPilot 100 and OligoProcess manufactured by GE Healthcare Biosciences are used. Purification is performed by a method known per se, such as chromatography.

[0054] Aptamers can be modified by introducing an active group such as an amino group during chemical synthesis using the phosphoramidite method, etc. For example, by introducing an amino group to the terminus of an aptamer, a polyethylene glycol chain having a carboxyl group can be condensed.

[0055] Aptamers bind to target substances through various binding modes, such as ionic bonds using the negative charge of phosphate groups, hydrophobic bonds and hydrogen bonds using ribose, and hydrogen bonds and stacking interactions using nucleic acid bases. In particular, ionic bonds using the negative charges of phosphate groups, which exist in the same number as the number of constituent nucleotides, are strong and bind to the positive charges of lysine and arginine present on the surface of proteins. For this reason, nucleic acid bases that are not involved in direct binding with target substances can be replaced. Regarding modification of the 2' position of ribose, in rare cases, the functional group at the 2' position of ribose directly interacts with the target molecule, but in many cases it is unrelated and can be replaced with other modified molecules. In this way, aptamers often retain their activity unless the functional group involved in direct binding with the target molecule is replaced or deleted. It is also important that the overall three-dimensional structure does not change significantly.

[0056] Aptamers can be prepared by using the SELEX method and its improved methods (e.g., Ellington et al., (1990) Nature, 346, 818-822; Tuerk et al., (1990) Science, 249, 505-510). In the SELEX method, aptamers with stronger binding strength to the target substance are concentrated and selected by increasing the number of rounds or using a competing substance to make the selection conditions stricter. Therefore, by adjusting the number of rounds of SELEX and / or changing the competitive conditions, it may be possible to obtain aptamers with different binding strengths, aptamers with different binding forms, and aptamers with the same binding strength or binding form but different base sequences. In addition, the SELEX method includes an amplification process by PCR, and by introducing mutations during the process, such as by using manganese ions, it becomes possible to perform SELEX with greater diversity.

[0057] Aptamers obtained by SELEX are nucleic acids with high affinity for target substances, but this does not mean that they inhibit the physiological activity of the target substance.

[0058] Based on the active aptamers selected in this way, SELEX can be performed to obtain aptamers with higher activity. A specific method is to prepare a template in which a part of an aptamer with a fixed sequence is randomized or a template doped with about 10-30% random sequence, and perform SELEX again.

[0059] Aptamers obtained by SELEX are about 80 nucleotides long, making it difficult to turn them into medicines as is. Therefore, it is necessary to shorten them through repeated trial and error to a length of about 50 nucleotides or less that can be easily chemically synthesized. The ease of subsequent minimization work for aptamers obtained by SELEX depends on the primer design. If the primers are not well designed, even if an active aptamer is selected by SELEX, further development will be impossible.

[0060] Aptamers can be chemically synthesized and therefore easily modified. By predicting the secondary structure of an aptamer using the MFOLD program or predicting the three-dimensional structure by X-ray analysis or NMR analysis, it is possible to predict to some extent which nucleotides can be replaced or deleted, and where new nucleotides can be inserted. Aptamers with predicted new sequences can be easily chemically synthesized, and whether the aptamer retains activity can be confirmed by existing assay systems.

[0061] When the portion of the aptamer that is important for binding to the target substance can be identified by repeating the above-mentioned trial and error, the activity is often not changed even if new sequences are added to both ends of the sequence. The length of the new sequences is not particularly limited.

[0062] As for modifications, similar to sequences, those skilled in the art can freely design or modify them.

[0063] As can be seen, aptamers are highly designable and modifiable.

[0064] The present invention also provides a complex comprising the aptamer of the present invention and a functional substance bound thereto (hereinafter, sometimes referred to as the "complex of the present invention"). The bond between the aptamer and the functional substance in the complex of the present invention may be a covalent bond or a non-covalent bond. The complex of the present invention may be a complex in which the aptamer of the present invention is bound to one or more (e.g., two or three) functional substances of the same kind or different kinds. The functional substance is not particularly limited as long as it can newly add some function to the aptamer of the present invention or can change (e.g., improve) some characteristic that the aptamer of the present invention can have. Examples of functional substances include proteins, peptides, amino acids, lipids, carbohydrates, monosaccharides, polynucleotides, and nucleotides.Examples of functional substances include affinity substances (e.g., biotin, streptavidin, polynucleotides having affinity for target complementary sequences, antibodies, glutathione sepharose, histidine), labeling substances (e.g., fluorescent substances, luminescent substances, radioisotopes), enzymes (e.g., horseradish peroxidase, alkaline phosphatase), drug delivery vehicles (e.g., liposomes, microspheres, peptides, polyethylene glycols), drugs (e.g., those used in missile therapy such as calicheamicin and duocarmycin, nitrogen mustard analogs such as cyclophosphamide, melphalan, ifosfamide, or trofosfamide, ethylenimines such as thiotepa, nitrosoureas such as carmustine, alkylating agents such as temozolomide or dacarbazine, methotrexate or raltitre, etc. Folate-like antimetabolites such as oxeda, purine analogs such as thioguanine, cladribine or fludarabine, pyrimidine analogs such as fluorouracil, tegafur or gemcitabine, vinca alkaloids such as vinblastine, vincristine or vinorelbine and their analogs, etoposide, taxanes, podophyllotoxin derivatives such as docetaxel or paclitaxel, anthracyclines and analogs such as doxorubicin, epirubicin, idarubicin and mitoxantrone, other cytotoxic antibiotics such as bleomycin and mitomycin, platinum compounds such as cisplatin, carboplatin and oxaliplatin, pentostatin, miltefosine, estramustine, topotecan, irinotecan and bicalutamide), toxins (e.g., ricin toxin, riatoxin and verotoxin). These functional molecules may be eventually removed. Furthermore, the nucleic acid may be a peptide that can be recognized and cleaved by an enzyme such as thrombin, matrix metalloprotease (MMP) or Factor X, or a polynucleotide that can be cleaved by a nuclease or restriction enzyme.

[0065] The aptamers and complexes of the present invention can be used, for example, as medicines, diagnostic agents, test agents, or reagents.

[0066] The aptamer and complex of the present invention can selectively inhibit the activity of TGF-β1. TGF-β1 is a multifunctional cytokine that is involved in cell proliferation and differentiation, embryonic development, extracellular matrix formation, bone development, wound healing, hematopoiesis, and immune and inflammatory responses. Thus, overexpression of TGF-β1 has been implicated in many conditions in humans, such as fibrotic diseases, cancer, immune-mediated diseases, wound healing, kidney diseases, etc. Thus, the aptamer and complex of the present invention are also useful as medicines for treating or preventing these diseases.

[0067] The aptamers and conjugates of the invention may be useful in the treatment or prevention of fibrotic diseases such as glomerulonephritis, neural scarring, skin scarring, pulmonary fibrosis, radiation-induced fibrosis, liver fibrosis, and bone marrow fibrosis.

[0068] The aptamers and conjugates of the invention may be useful in the treatment or prevention of cancers such as breast cancer, prostate cancer, ovarian cancer, gastric cancer, renal cancer, pancreatic cancer, colorectal cancer, skin cancer, lung cancer, cervical cancer, bladder cancer, glioma, mesothelioma, leukemia, and sarcoma.

[0069] The aptamers and complexes of the invention may be useful in enhancing immune responses to macrophage-mediated infections and in reducing immune suppression caused by, for example, tumors or AIDS.

[0070] The aptamers and conjugates of the invention may also be useful for treating wounds such as systemic sclerosis, post-surgical adhesions, keloids, hypertrophic scars, corneal injuries, cataracts, Peyronie's disease, liver cirrhosis, post-myocardial infarction scars, post-angioplasty restenosis, post-subarachnoid hemorrhage scars, biliary cirrhosis (including sclerosing cholangitis), and the like.

[0071] The aptamers and complexes of the invention may also be useful in the treatment or prevention of kidney diseases such as diabetic (type I and type II) nephropathy, radiation-induced nephropathy, obstructive nephropathy, inherited kidney diseases (e.g., polycystic kidney disease, sponge kidney, horseshoe kidney), glomerulonephritis, nephrosclerosis, nephrocalcinosis, systemic lupus erythematosus, Sjogren's syndrome, Buerger's disease, systemic or glomerular hypertension, tubulointerstitial nephritis, renal tubular acidosis, renal tuberculosis, and renal infarction.

[0072] The aptamer and complex of the present invention can specifically bind to TGF-β1. Therefore, in another aspect of the present invention, the aptamer and complex of the present invention can be useful as a probe for detecting TGF-β1. The probe is useful for in vivo imaging of TGF-β1, blood concentration measurement, tissue staining, ELISA, etc. In addition, the probe can be useful as a diagnostic agent, test agent, reagent, etc. for diseases (cancer, fibrosis, etc.) involving TGF-β1.

[0073] Furthermore, based on their specific binding to TGF-β1, the aptamer and complex of the present invention can be used as ligands for separating and purifying TGF-β1.

[0074] The aptamers and complexes of the present invention can also be used as drug delivery agents.

[0075] The pharmaceutical of the present invention, which contains the aptamer of the present invention or a complex containing the aptamer of the present invention, may further contain a pharma- ceutically acceptable carrier. Examples of pharma-ceutically acceptable carriers include excipients such as sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate, and calcium carbonate, binders such as cellulose, methylcellulose, hydroxypropylcellulose, polypropylpyrrolidone, gelatin, gum arabic, polyethylene glycol, sucrose, and starch, disintegrants such as starch, carboxymethylcellulose, hydroxypropyl starch, sodium glycol-starch, sodium bicarbonate, calcium phosphate, and calcium citrate, magnesium stearate, ethylene glycol, and the like. These include, but are not limited to, lubricants such as arosil, talc, sodium lauryl sulfate, fragrances such as citric acid, menthol, glycyrrhizin ammonium salt, glycine, orange powder, preservatives such as sodium benzoate, sodium bisulfite, methylparaben, propylparaben, stabilizers such as citric acid, sodium citrate, acetic acid, suspending agents such as methylcellulose, polyvinylpyrrolidone, aluminum stearate, dispersing agents such as surfactants, diluents such as water, saline, orange juice, base waxes such as cocoa butter, polyethylene glycol, white kerosene, etc.

[0076] The route of administration of the pharmaceutical of the present invention is not particularly limited, but examples thereof include oral administration and parenteral administration.

[0077] Formulations suitable for oral administration include liquid preparations in which an effective amount of the ligand is dissolved in a diluent such as water, saline, or orange juice; capsules, sachets, or tablets containing an effective amount of the ligand as a solid or granules; suspensions in which an effective amount of the active ingredient is suspended in a suitable dispersion medium; emulsions in which a solution in which an effective amount of the active ingredient is dissolved is dispersed and emulsified in a suitable dispersion medium; and C10, which promotes absorption of water-soluble substances.

[0078] If necessary, the medicine of the present invention can be coated by a method known per se for the purpose of taste masking, enteric or sustained release. Examples of coating agents used for coating include hydroxypropylmethylcellulose, ethylcellulose, hydroxymethylcellulose, hydroxypropylcellulose, polyoxyethylene glycol, Tween 80, Pluronic F68, cellulose acetate phthalate, hydroxypropylmethylcellulose phthalate, hydroxymethylcellulose acetate succinate, Eudragit (manufactured by Rohm, Germany, methacrylic acid-acrylic acid copolymer) and dyes (e.g., red iron oxide, titanium dioxide, etc.). The medicine may be either an immediate release formulation or a sustained release formulation.

[0079] Suitable preparations for parenteral administration (e.g., intravenous, subcutaneous, intramuscular, topical, intraperitoneal, nasal, etc.) include aqueous and non-aqueous isotonic sterile injection solutions, which may contain antioxidants, buffers, bacteriostatic agents, isotonicity agents, etc. Also included are aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives, etc. The preparations can be sealed in unit doses or multiple doses in containers such as ampoules and vials. Also, the active ingredient and a pharma- ceutical acceptable carrier can be freeze-dried and stored in a state in which it is sufficient to dissolve or suspend them in an appropriate sterile solvent immediately before use.

[0080] In addition, sustained release formulations can also be used as suitable formulations. Examples of the dosage form of sustained release formulations include sustained release from carriers or containers embedded in the body, such as artificial bones, biodegradable substrates, or non-biodegradable sponges and bags. Alternatively, sustained release formulations include devices that deliver drugs continuously or intermittently from outside the body to the body or to a local area, such as drug pumps and osmotic pumps. Examples of biodegradable substrates include liposomes, cationic liposomes, Poly(lactic-co-glycolic)acid (PLGA), atelocollagen, gelatin, hydroxyapatite, and polysaccharide schizophyllan.

[0081] Furthermore, in addition to injection solutions, suspensions and sustained release preparations, inhalants suitable for pulmonary administration and ointments suitable for transdermal administration are also possible.

[0082] In the case of inhalants, the active ingredient in a freeze-dried state is pulverized and administered by inhalation using a suitable inhalation device. The inhalant may further contain surfactants, oils, seasonings, cyclodextrin or derivatives thereof, etc., as necessary. The inhalant may be manufactured according to a conventional method. That is, the aptamer or complex of the present invention may be made into a powder or liquid form, mixed with an inhalation propellant and / or carrier, and then filled into a suitable inhalation container. In addition, when the aptamer or complex of the present invention is in a powder form, a conventional mechanical powder inhaler may be used, and when the aptamer or complex is in a liquid form, an inhaler such as a nebulizer may be used. Here, a wide variety of known inhalation propellants can be used, and examples of such propellants include fluorocarbon compounds such as fluorocarbon-11, fluorocarbon-12, fluorocarbon-21, fluorocarbon-22, fluorocarbon-113, fluorocarbon-114, fluorocarbon-123, fluorocarbon-142c, fluorocarbon-134a, fluorocarbon-227, fluorocarbon-C318, and 1,1,1,2-tetrafluoroethane; hydrocarbons such as propane, isobutane, and n-butane; ethers such as diethyl ether; and compressed gases such as nitrogen gas and carbon dioxide gas.

[0083] Examples of surfactants include oleic acid, lecithin, diethylene glycol dioleate, tetrahydrofurfuryl oleate, ethyl oleate, isopropyl myristate, glyceryl trioleate, glyceryl monolaurate, glyceryl monooleate, glyceryl monostearate, glyceryl monoricinoate, cetyl alcohol, stearyl alcohol, polyethylene glycol 400, cetylpyridinium chloride, sorbitan trioleate (trade name Span 85), sorbitan monooleate (trade name Span 80), sorbitan monolaurate (trade name Span 20), polyoxyethylene hydrogenated castor oil ( Examples of the oils include oleyl polyoxyethylene (2) ether (Brij 92), stearyl polyoxyethylene (2) ether (Brij 72), lauryl polyoxyethylene (4) ether (Brij 30), oleyl polyoxyethylene (2) ether (Genapol 0-020), and block copolymers of oxyethylene and oxypropylene (Simperonic). Examples of the oils include corn oil, olive oil, cottonseed oil, and sunflower oil. In the case of ointments, a suitable pharma- ceutically acceptable base (yellow petrolatum, white petrolatum, paraffin, plastibase, silicone, white ointment, beeswax, lard, vegetable oil, hydrophilic ointment, hydrophilic petrolatum, refined lanolin, hydrous lanolin, absorbent ointment, hydrophilic plastibase, macrogol ointment, etc.) is used, mixed with the active ingredient, the aptamer of the present invention, and formulated for use.

[0084] The dosage of the pharmaceutical of the present invention will vary depending on the type and activity of the active ingredient, the severity of the disease, the animal species to be administered, the drug tolerance, body weight, age, etc. of the subject, but can usually be about 0.0001 to about 100 mg / kg, for example, about 0.0001 to about 10 mg / kg, and preferably about 0.005 to about 1 mg / kg, in terms of the active ingredient per day for an adult.

[0085] The present invention also provides a solid-phase carrier on which the aptamer and complex of the present invention are immobilized. Examples of solid-phase carriers include substrates, resins, plates (e.g., multi-well plates), filters, cartridges, columns, and porous materials. The substrate may be one used in DNA chips and protein chips, and examples thereof include nickel-PTFE (polytetrafluoroethylene) substrates, glass substrates, apatite substrates, silicon substrates, and alumina substrates, and examples of such substrates coated with polymers and the like. Examples of resins include agarose particles, silica particles, copolymers of acrylamide and N,N'-methylenebisacrylamide, polystyrene-crosslinked divinylbenzene particles, particles in which dextran is crosslinked with epichlorohydrin, cellulose fibers, crosslinked polymers of allyl dextran and N,N'-methylenebisacrylamide, monodisperse synthetic polymers, monodisperse hydrophilic polymers, Sepharose, and Toyopearl, and also include resins in which various functional groups are bound to these resins. The solid phase carrier of the present invention can be useful, for example, for purifying TGF-β1, and detecting and quantifying TGF-β1.

[0086] The aptamer and complex of the present invention can be immobilized on a solid phase carrier by a method known per se. For example, an affinity substance (e.g., those described above) or a predetermined functional group is introduced into the aptamer and complex of the present invention, and then the affinity substance or the predetermined functional group is used to immobilize the aptamer and complex on a solid phase carrier. The present invention also provides such a method. The predetermined functional group may be a functional group that can be subjected to a coupling reaction, and examples of such functional groups include an amino group, a thiol group, a hydroxyl group, and a carboxyl group. The present invention also provides an aptamer having such a functional group introduced therein.

[0087] The present invention also provides a method for purifying and concentrating TGF-β1. In particular, the present invention can separate TGF-β1 from other family proteins. The purification and concentration method of the present invention may include adsorbing TGF-β1 to the solid phase carrier of the present invention and eluting the adsorbed TGF-β1 with an elution solution. Adsorption of TGF-β1 to the solid phase carrier of the present invention can be performed by a method known per se. For example, a sample containing TGF-β1 (e.g., a bacterial or cell culture or culture supernatant, blood) is introduced into the solid phase carrier of the present invention or its contents. For elution of TGF-β1, an appropriate elution solution may be selected in consideration of the known properties of TGF-β1. The purification and concentration method of the present invention may further include washing the solid phase carrier with a washing solution after adsorption of TGF-β1. The washing solution may be appropriately selected in consideration of the known properties of TGF-β1. The purification and concentration method of the present invention may further include heat-treating the solid phase carrier. By such a step, the solid phase carrier can be regenerated and sterilized.

[0088] The present invention also provides a method for detecting and quantifying TGF-β1. In particular, the present invention can detect and quantify TGF-β1 in a manner that distinguishes it from other family proteins. The detection and quantification method of the present invention may include measuring TGF-β1 using the aptamer of the present invention (e.g., by using the complex and solid phase carrier of the present invention). The detection and quantification method of TGF-β1 may be performed in a manner similar to an immunological method, except that the aptamer of the present invention is used instead of an antibody. Therefore, by using the aptamer of the present invention as a probe instead of an antibody, detection and quantification can be performed in a manner similar to an enzyme immunoassay (EIA) (e.g., direct competitive ELISA, indirect competitive ELISA, sandwich ELISA), radioimmunoassay (RIA), fluorescent immunoassay (FIA), Western blotting, immunohistochemical staining, cell sorting, etc. It can also be used as a molecular probe such as PET. Such a method may be useful, for example, for measuring the amount of TGF-β1 in a living body or biological sample, and for diagnosing a disease associated with TGF-β1.

[0089] The contents of all publications, including patents and patent applications, cited in this specification are hereby incorporated by reference in their entirety to the same extent as if fully set forth herein.

[0090] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to the following examples in any way. EXAMPLES

[0091] [Example 1] Preparation of RNA aptamer that specifically binds to TGF-β1 1 The RNA aptamer that specifically binds to TGF-β1 was prepared using the SELEX method. SELEX was performed with reference to the method of Ellington et al. (Ellington and Szostak, Nature 346, 818-822, 1990) and the method of Tuerk et al. (Tuerk and Gold, Science 249, 505-510, 1990). NHS-activated Sepharose was used as the target substance. TM 4 TGF-β1 (Recombinant Human TGF-β1, Peprotech, hereafter referred to as TGF-β1) immobilized on a Fast Flow (GE Healthcare) carrier was used. The carrier with immobilized TGF-β1 was obtained by activating the carrier with 1 mM hydrochloric acid, mixing the two, and reacting them at room temperature for about 3 hours. The amount of immobilization was confirmed by examining the TGF-β1 solution before immobilization and the supernatant immediately after immobilization by SDS-PAGE. As a result of SDS-PAGE, no band of TGF-β1 was detected in the supernatant, and it was confirmed that almost all of the TGF-β1 used was coupled. Approximately 40 pmol of TGF-β1 was immobilized on approximately 1 μL of resin.

[0092] The random sequence RNA (40N) used in the first round was obtained by transcribing chemically synthesized DNA with T7 RNA polymerase (Y639F). The RNA obtained by this method has a fluorinated 2'-position of the ribose of the pyrimidine nucleotide. As a DNA template, an 80-nucleotide DNA with primer sequences on both ends of the 40-nucleotide random sequence shown below was used. The DNA template and primers were prepared by chemical synthesis.

[0093] DNA template sequence: 5'-TGATAGCTTCAGTAGACGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACTCTAGATGCGGATCCC-3' (SEQ ID NO: 1) Primer Fwd: 5'-TAATACGACTCACTATAGGGATCCGCATCTAGAGTAC-3' (SEQ ID NO: 2) Primer Rev: 5'-TGATAGCTTCAGTAGACGTT-3' (SEQ ID NO: 3)

[0094] In the DNA template (SEQ ID NO: 1), N is any combination of nucleotides (A, G, C, or T). Primer Fwd contains a promoter sequence for T7 RNA polymerase.

[0095] The RNA pool was added to the carrier on which TGF-β1 was immobilized, and after keeping it at room temperature for 30 minutes, the resin was washed with solution A to remove RNA that did not bind to TGF-β1. Here, solution A is a mixed solution of 145 mM sodium chloride, 5.4 mM potassium chloride, 1.8 mM calcium chloride, 0.8 mM magnesium chloride, 20 mM Tris (pH 7.6), and 0.05% Tween 20. The RNA bound to TGF-β1 was recovered from the supernatant after adding solution B as an eluent and heat-treating at 90°C for 5 minutes. Here, solution B is a mixed solution of 7 M urea, 5 mM EDTA, and 0.1 M Tris (pH 7.6). The recovered RNA was amplified by RT-PCR, transcribed with T7 RNA polymerase (Y639F), and used as the pool for the next round. The above was considered as one round, and the same procedure was repeated multiple times. After SELEX, the PCR product was cloned into pGEM-T Easy vector (Promega) and used to transform Escherichia coli strain DH5α (TAKARA). Plasmids were extracted from single colonies, and the base sequences of the clones were examined using a DNA sequencer (FASMAC).

[0096] After five rounds of SELEX, the sequences of 88 clones were examined, and sequence convergence was observed. Sequences SEQ ID NOs: 4 to 13 were obtained as sequences from which two or more clones were obtained.

[0097] The nucleotide sequences of SEQ ID NOs: 4 to 13 are shown below. Unless otherwise specified, each sequence in the examples is shown in the 5' to 3' direction, and each nucleotide means that the purines (A and G) are 2'-OH (natural RNA type) and the pyrimidines (U and C) are 2'-fluoro modified. Primer binding sequences are written in lower case.

[0098] SEQ ID NO: 4: gggauccgcaucuagaguacUAAGGGUGGGGAGACUUGGGCCGGGCAGUCAGACGCGUGAaacgucuacugaagcuauca SEQ ID NO: 5:gggauccgcaucuagaguacAUCGUGGCGGGAAAGCCGCCCCAUUCUCUCGGGUCCUAGAaacgucuacugaagcuauca SEQ ID NO: 6: gggauccgcaucuagaguacUUGUAUAAGUGGAGGGCGAGACUUGGGAGGGGCGAAUUGAaacgucuacugaagcuauca SEQ ID NO: 7: gggauccgcaucuagaguacGAAUAGUAAGGGAAUGACUCUCGGACCAAUGUAUUGCUAUaacgucuacugaagcuauca SEQ ID NO: 8: gggauccgcaucuagaguacGAUGUGCUUGUGCUGAAAUUAGAUUUCGCCGACUUUCCCUaacgucuacugaagcuauca SEQ ID NO: 9: gggauccgcaucuagaguacCAUAAGGGUGGGGAGACUUGGGAGAGGGCAAAGAAGACUAaacgucuacugaagcuauca SEQ ID NO: 10: gggauccgcaucuagaguacGAUGCAUGUUUUUAUAAAGUAUUGUUAUGUAAUGCAUCAAaacgucuacugaagcuauca SEQ ID NO: 11: gggauccgcaucuagaguacCGCGUGAGCGGCGUCUUGCUAUGACGUAAAGAAUCGUUACaacgucuacugaagcuauca SEQ ID NO: 12: gggauccgcaucuagaguacCUAGAGGUGACUUGGGACGCGAGUUAUAAGGGAAUAGUCCaacgucuacugaagcuauca SEQ ID NO: 13: gggauccgcaucuagaguacACUAGUCACAUUGCGUGUACAUUACUCUGCGCAAUCGAUAaacgucuacugaagcuauca

[0099] [Example 2] Preparation of RNA aptamer that specifically binds to TGF-β1 2 SELEX was carried out in the same manner as in Example 1, except that the random sequence was 35 nucleotides and the primer sequence was different from that used in Example 1. NHS-activated Sepharose was used as the target substance for SELEX. TM 4 TGF-β1 (Recombinant Human TGF-β1, Peprotech) immobilized on a Fast Flow (GE Healthcare) carrier was used. The sequences of the template and primers used are shown below. The DNA template and primers were prepared by chemical synthesis.

[0100] DNA template sequence: 5'-GACTGACGTCGCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCCAAGTTCTCCC-3' (SEQ ID NO: 14) Primer Fwd: 5'-TAATACGACTCACTATAGGGAGAACTTGGAGCT-3' (SEQ ID NO: 15) Primer Rev: 5'-GACTGACGTCGCACT-3' (SEQ ID NO: 16)

[0101] In the DNA template (SEQ ID NO: 14), N is any combination of nucleotides (A, G, C, or T). Primer Fwd contains a promoter sequence for T7 RNA polymerase.

[0102] After seven rounds of SELEX, the sequences of 48 clones were examined, and convergence in sequences was observed. From among them, representative sequences were obtained as shown in SEQ ID NOs: 17 to 22.

[0103] The nucleotide sequences of SEQ ID NOs: 17 to 22 are shown below. Unless otherwise specified, each sequence in the examples is shown in the 5' to 3' direction, and each nucleotide means that the purines (A and G) are 2'-OH (natural RNA type) and the pyrimidines (U and C) are 2'-fluoro modified. Furthermore, the primer binding sequences are written in lower case.

[0104] SEQ ID NO: 17: gggagaacuuggagcuGAUGUCUGGAGUCCCCAUAUAUCACGUACAGUGUagugcgacgucaguc SEQ ID NO: 18: gggagaacuuggagcuCCCCCUCGCACUUAAUGGGUUCUGUGGCUGGAGAAagugcgacgucaguc SEQ ID NO: 19: gggagaacuuggagcuCCCCCUCGCAUUCGGAUUAAUUUGUGACUGCAUUGagugcgacgucaguc SEQ ID NO: 20: gggagaacuuggagcuGGUCCGGAAACUGGAUUCUCUCUAAAAGGGGUACCagugcgacgucaguc SEQ ID NO: 21: gggagaacuuggagcuCCUGAAUAAGGGCGGGGAAACUUGUGGUGGGCUAAagugcgacgucaguc SEQ ID NO: 22: gggagaacuuggagcuUGACGGCGCUACAUUAUGCUCCAACGGUACUUUAUagugcgacgucaguc

[0105] [Example 3] Preparation of RNA aptamer that specifically binds to TGF-β1 3 SELEX was carried out in the same manner as in Example 1, except that the random sequence was 50 nucleotides and the primer sequence was a template different from that used in Examples 1 and 2. NHS-activated Sepharose was used as the target substance for SELEX. TM 4 TGF-β1 (Recombinant Human TGF-β1, Peprotech) immobilized on a Fast Flow (GE Healthcare) carrier was used. The sequences of the template and primers used are shown below. The DNA template and primers were prepared by chemical synthesis.

[0106] DNA template sequence: 5'-CTGACTCGACGTGCAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAACACTAGTGCATTCCC-3' (SEQ ID NO: 23) Primer Fwd: 5'-TAATACGACTCACTATAGGGAATGCACTAGTGTTCAA-3' (SEQ ID NO: 24) Primer Rev: 5'-CTGACTCGACGTGCAAGCTT-3' (SEQ ID NO: 25)

[0107] In the DNA template (SEQ ID NO: 23), N is any combination of nucleotides (A, G, C, or T). Primer Fwd contains a promoter sequence for T7 RNA polymerase.

[0108] After eight rounds of SELEX, the sequences of 48 clones were examined, and convergence in sequences was observed. From among them, representative sequences were obtained as shown in SEQ ID NOs: 26 to 28.

[0109] The nucleotide sequences of SEQ ID NOs: 26 to 28 are shown below. Unless otherwise specified, each sequence in the examples is shown in the 5' to 3' direction, and each nucleotide means that the purines (A and G) are 2'-OH (natural RNA type) and the pyrimidines (U and C) are 2'-fluoro modified. Furthermore, the primer binding sequences are written in lower case.

[0110] SEQ ID NO: 26: gggaaugcacuaguguucaaCCCCGACCAAUAGCAGCCCGUCUUUAACUAUUGGAAUCGCAUACGGGCCCaagcuugcacgucgagucag SEQ ID NO: 27:gggaaugcacuaguguucaaCAUUUAGCAACACAAGUCGUCCCCCACGGCAAGCAGUCCUCAAUCCUGACaagcuugcacgucgagucag SEQ ID NO: 28:gggaaugcacuaguguucaaUAAACACUAAGUGAUCCUCCUGCAAGCUAUGAAGAACUUAACGGCUCGUAaagcuugcacgucgagucag

[0111] [Example 4] Measurement of inhibitory activity of aptamer against TGF-β1 1 Whether the nucleic acids of SEQ ID NOs: 4-13, 17-22, and 26-28 inhibit the activity of TGF-β1 was evaluated by a cell assay system that monitors the Smad signaling pathway, which is known to be activated by stimulation with TGF-β. Specifically, Photinus luciferase carrying SBE (Smad-binding element) in the promoter region was used as a reporter (pGL4.48[luc2P / SBE / Hygro] Vector, Promega). This SBE-induced Photinus luciferase reporter plasmid was mixed with a Renilla luciferase expression plasmid (pGL4.74[hRluc / TK] Vector, Promega) as a standardization control for transfection efficiency at a ratio of 20:1, and transfected into HEK293 cells. The transfected HEK293 cells were re-seeded on a 96-well plate and cultured until confluent. A mixture of TGF-β1 and nucleic acid aptamers of SEQ ID NOs: 4-13, 17-22, and 26-28 synthesized using T7 RNA polymerase (Y639F) was added to the mixture so that the final concentrations were 80 pM and 20 nM, respectively, and the mixture was cultured for 3 hours. The expression levels of Photinas luciferase and Renilla luciferase were then confirmed using the Dual-Luciferase (registered trademark) Reporter Assay System (Promega). The measured values ​​of Photinas luciferase in each sample were corrected with the measured values ​​of Renilla luciferase, and the relative expression levels of each sample were calculated by setting the ratio of Photinas luciferase to Renilla luciferase in a sample to which TGF-β1 was not added as 1. Furthermore, the relative expression level of a sample to which only TGF-β1 was added was defined as an inhibition rate of 0%, and the relative expression level of a sample to which TGF-β1 was not added was defined as an inhibition rate of 100%, and the inhibitory activity when each nucleic acid was added was determined. The same treatment and measurement were performed using the 35N, 40N, or 50N nucleic acid pool (SEQ ID NO: 14, 1, 23) as a negative control and a known TGF-β antibody (R&D MAB1835) as a positive control. The results are shown in Table 1.

[0112] Measurement of the inhibitory activity of aptamers against TGF-β1 2 The surface plasmon resonance method was used to evaluate whether the nucleic acids of SEQ ID NOs: 6, 9, 19, 21, and 26 inhibit the binding of TGF-β1 to the TGF-β receptor. Measurements were performed using a Biacore T200 manufactured by GE Healthcare, using the method described below. Approximately 1500 RU of protein A was immobilized on the sensor chip surface of a CM4 chip using an amine coupling kit. At a flow rate of 20 μL / min, 20 μL of Fc-fused TRII receptor (R&D) adjusted to 30 nM was injected as an analyte. This causes the Fc-fused TRII receptor to be immobilized on the sensor chip surface of the CM4 chip via protein A. Furthermore, a mixed solution of TGF-β1 (4 nM) or TGF-β1 (10 nM) and nucleic acid (30 nM) was injected. Solution A was used as the running buffer. The RU value of the sample injected with only TGF-β1 and the RU value before TGF-β1 were used as the standard, and the effect of suppressing the increase in the RU value when TGF-β1 was injected in the presence of nucleic acid was calculated as the binding inhibitory effect of TGF-β1 to the TRII receptor. The results for TGF-β1: nucleic acid (Apt) = 10 nM: 30 nM are shown in Table 1.

[0113] [Table 1]

[0114] As shown in Table 1, the nucleic acids consisting of the base sequences represented by SEQ ID NOs: 5, 11, 13, 17, 18, 20, 21, 22, 27 and 28 specifically bound to TGF-β1 (left column of Table 1).

[0115] Furthermore, the nucleic acids consisting of the base sequences shown in SEQ ID NOs: 6, 9, 19, 21 and 26 inhibited the binding of TGF-β1 to the TGF-β receptor (center column of Table 1).

[0116] Furthermore, the nucleic acids consisting of the base sequences shown in SEQ ID NOs: 4, 6, 9, 19, 21 and 26 exhibited strong inhibitory activity in a cell assay system (right column in Table 1). On the other hand, the nucleic acids consisting of the base sequences shown in SEQ ID NOs: 5, 7-8, 10-13, 17-18, 20, 22 and 27-28 did not have inhibitory activity against TGF-β1 in a cell assay system.

[0117] A notable point in this result is that SEQ ID NOs: 4, 6, 9, and 21 contained a common sequence. This sequence is referred to as consensus sequence 1 in this specification.

[0118] Consensus sequence 1: UAAXGGRBGGSGARACUUGKGVBRGG (X represents a bond or GU; R represents A or G; S represents C or G; K represents G or U; V represents A, C or G; B represents C, G or U).

[0119] As shown in Table 1, the aptamer having the nucleotide sequence represented by the above consensus sequence 1 exhibits remarkably strong inhibitory activity against TGF-β1.

[0120] In other words, the aptamer having the nucleotide sequence represented by consensus sequence 1 was considered to be an aptamer that specifically and remarkably strongly binds to TGF-β1. In addition, the aptamer having the nucleotide sequence represented by consensus sequence 1 was considered to be highly likely to be an aptamer that can inhibit the activity of TGF-β1.

[0121] [Example 5] Shortening of aptamer The aptamer of SEQ ID NO: 21 was shortened. The sequences of these shortened versions are shown in SEQ ID NOs: 29 to 31.

[0122] The nucleotide sequences of each are shown below. The underlined portion indicates the common sequence 1 portion found in Examples 1 to 4. Unless otherwise specified, each sequence listed in the Examples is shown in the 5' to 3' direction, and each nucleotide means that the purines (A and G) are 2'-OH (natural RNA type) and the pyrimidines (U and C) are 2'-fluoro modified. Furthermore, the primer binding sequence is written in lower case.

[0123] SEQ ID NO: 29: (the aptamer represented by SEQ ID NO: 21 is shortened to a length of 51 nucleotides containing a common sequence) gggagaacuuggagcuCCUGA AUAAGGGCGGGGAAACUUGUGGUGGG CUAA SEQ ID NO: 30: (the aptamer represented by SEQ ID NO: 21 is shortened to a length of 26 nucleotides containing a part of the common sequence) GGGCGGGGAAACUUGUGGUGGG CUAA SEQ ID NO: 31: (the aptamer represented by SEQ ID NO: 21 is shortened to a length of 33 nucleotides containing a common sequence) ggc AUAAGGGCGGGGAAACUUGUGGUGGG CUAA

[0124] The nucleic acids of SEQ ID NOs: 29 to 31 were obtained by transcribing a chemically synthesized DNA sequence containing a promoter sequence of T7 RNA polymerase as a template with T7 RNA polymerase (Y639F).

[0125] Whether these nucleic acids inhibit the binding of TGF-β1 to the TGF-β receptor was evaluated by surface plasmon resonance by injecting a mixed solution of TGF-β1 (4 nM) or TGF-β1 (10 nM) and nucleic acid (30 nM) in the same manner as in Example 4. The measurement results in the case of TGF-β1: nucleic acid (Apt) = 10 nM: 30 nM (1:3) are shown in Table 2.

[0126] The nucleic acids of SEQ ID NOs: 21, 29, and 31 were obtained by transcribing a chemically synthesized DNA sequence containing a promoter sequence of T7 RNA polymerase as a template using T7 RNA polymerase (Y639F). Whether these nucleic acids inhibit the activity of TGF-β1 was evaluated by luciferase reporter assay in the same manner as in Example 4. The measurement results are shown in Table 2. In Table 2, the values ​​of the luciferase assay inhibition rate are shown together with the results of two independent tests.

[0127] [Table 2]

[0128] As shown in Table 2, the inhibitory activity against TGF-β1 was maintained even when the sequence around the consensus sequence was removed (SEQ ID NO: 29, 31). On the other hand, when the consensus sequence was also removed, the inhibitory activity against TGF-β1 was significantly reduced (SEQ ID NO: 30). From the above, it was shown that consensus sequence 1 is important for exerting binding activity against TGF-β1 and inhibitory activity against TGF-β1.

[0129] [Example 6] Preparation of highly active TGF-β1 aptamer 1 SELEX was performed using an RNA pool in which part of the consensus sequence 1 in the sequence represented by SEQ ID NO: 31 was replaced with a random sequence. SELEX was performed in the same manner as in Example 1. The template and 5'-terminal primer sequences are shown below. The nucleic acid of SEQ ID NO: 16 was used as the primer Rev.

[0130] DNA template sequence: 5'-gggagaacttggagctcctgaNNNNGGGNNGGGNNNNNNGTGGNGGGNNNNagtgcgacgtcagtc-3' (SEQ ID NO: 32) Primer Fwd: 5'-TAATACGACTCACTATAGGGAGAACTTGGAGCTCCTGA-3' (SEQ ID NO: 33)

[0131] After rounds 0 to 6, each DNA library pool was sequenced on a high-throughput sequencer (IonPGM TM When the sequence was examined using a 3D-PCR system (ThermoFisher Scientific), the sequence after 2R had the common sequence 2 (SEQ ID NO: 34). Among them, the sequence with the highest number of reads (SEQ ID NO: 35) and the sequence with the second highest number of reads (SEQ ID NO: 36), the sequence with one base different from the sequence with the highest number of reads (SEQ ID NO: 35) (SEQ ID NO: 37, 38), the sequence with one base deleted from the common sequence 2 portion in SEQ ID NO: 35 (SEQ ID NO: 39), the sequence with one base deleted at a position different from SEQ ID NO: 39 (the last GGG on the 3' end side) (SEQ ID NO: 41), and the sequence without the deletion (SEQ ID NO: 40) are shown below. SEQ ID NOs: 35 to 40 are all sequences detected in this experiment (Example 6). Unless otherwise specified, each sequence listed in the examples is shown in the 5' to 3' direction, and each nucleotide means that the purines (A and G) are 2'-OH (natural RNA type) and the pyrimidines (U and C) are 2'-fluoro modified. In addition, the primer binding sequence is written in lower case.

[0132] SEQ ID NO: 34: (Consensus sequence 2 obtained from this experiment) AUAAGGGHGGGGAGACUUGUGGWGGG (H represents A, C, or U; W represents A or U)

[0133] The nucleotide sequences of each are shown below. The underlined portion corresponds to consensus sequence 2 (SEQ ID NO: 34). Unless otherwise specified, each sequence in the examples is shown in the 5' to 3' direction, and each nucleotide means that the purines (A and G) are 2'-OH (natural RNA type) and the pyrimidines (U and C) are 2'-fluoro modified. Furthermore, the primer binding sequence is written in lower case.

[0134] SEQ ID NO: 35: (The sequence with the highest number of reads detected by the high-throughput sequencer) gggagaacuuggagcuccuga AUAAGGGAGGGGAGACUUGUGGAGGGCAAGagugcgacgucaguc SEQ ID NO: 36: (The sequence with the second highest number of reads detected by the high-throughput sequencer) gggagaacuuggagcuccuga AUAAGGGAGGGGAGACUUGUGGAGGG CAAAagugcgacgucaguc SEQ ID NO: 37: (a sequence that differs by one base from the sequence with the most reads (SEQ ID NO: 35)) gggagaacuuggagcuccuga AUAAGGGAGGGGAGACUUGUGGUGGG CAAGagugcgacgucaguc SEQ ID NO: 38: (a sequence that differs by one base from the sequence with the most reads (SEQ ID NO: 35)) gggagaacuuggagcuccuga AUAAGGGUGGGGAGACUUGUGGAGGG CAAGagugcgacgucaguc SEQ ID NO: 39: (Sequence in which one base is deleted from the portion of consensus sequence 2 in SEQ ID NO: 35) gggagaacuuggagcuccuga AUAAGGGAGGGAGACUUGUGGAGGG CAAGagugcgacgucaguc SEQ ID NO: 40: (sequence when no deletion occurs in SEQ ID NO: 41) gggagaacuuggagcuccuga AUAAGGGAGGGGAGACUUGUGGAGGG CAGAagugcgacgucaguc SEQ ID NO: 41: (a sequence in which a single base is deleted at the last GGG on the 3' end side of the consensus sequence 2 of SEQ ID NO: 35) gggagaacuuggagcuccuga AUAAGGGAGGGGAGACUUGUGGAGG CAGAagugcgacgucaguc

[0135] The nucleic acids of SEQ ID NOs: 35 to 41 were obtained by transcribing a chemically synthesized DNA sequence containing a promoter sequence of T7 RNA polymerase as a template using T7 RNA polymerase (Y639F). Whether these nucleic acids inhibit the binding of TGF-β1 to the TGF-β receptor was evaluated by injecting a mixed solution of TGF-β1 (10 nM) and nucleic acid (10 nM or 30 nM) in the same manner as in Example 4, and using a surface plasmon resonance method. The measurement results for TGF-β1: nucleic acid (Apt) = 10 nM: 30 nM, 10 nM: 10 nM are shown in Table 3.

[0136] Furthermore, whether these nucleic acids inhibit the activity of TGF-β1 was evaluated by the same luciferase reporter assay as in Example 4, in the same manner as in Example 1. The measurement results are shown in Table 3.

[0137] [Table 3]

[0138] As shown in Table 3, the aptamer containing the nucleotide sequence represented by consensus sequence 2 (SEQ ID NO: 34) exhibited inhibitory activity against TGF-β1 (SEQ ID NOs: 35 to 38, 40). On the other hand, the aptamer lacking a portion of consensus sequence 2 (SEQ ID NO: 34) had no inhibitory activity against TGF-β1 (SEQ ID NOs: 39, 41). These results demonstrated that the aptamer having the nucleotide sequence represented by consensus sequence 2 (SEQ ID NO: 34) binds to TGF-β1 and inhibits the activity of TGF-β1.

[0139] [Example 7] Shortening and base substitution of highly active TGF-β1 aptamer The sequence represented by SEQ ID NO:35 was shortened with reference to SEQ ID NO:31 to obtain SEQ ID NO:42. In addition, in order to determine the optimal bases at two positions considered to be highly variable based on the results of high-throughput sequencing, sequences were created in which other bases were substituted based on SEQ ID NO:42 (SEQ ID NOs:43 to 47). Furthermore, with reference to the results of high-throughput sequencing, SEQ ID NO:48, which has a different pattern from SEQ ID NOs:43 to 47, was created from among the sequences with a relatively large number of detected reads.

[0140] The nucleotide sequences of each are shown below. Unless otherwise specified, the individual sequences listed in the examples are shown in the 5' to 3' direction, and each nucleotide means that the purines (A and G) are 2'-OH (natural RNA type) and the pyrimidines (U and C) are 2'-fluoro modified. [ ] indicates a nucleotide that is considered to be highly variable.

[0141] SEQ ID NO: 42: (the aptamer represented by SEQ ID NO: 35 is shortened to a length of 33 nucleotides with reference to SEQ ID NO: 32) GGC AUAAGGG[A]GGGGAGACUUGUGG[A]GGG CAAG SEQ ID NO: 43: (the aptamer sequence shown in SEQ ID NO: 42 in which the 11th A is replaced with U) GGC AUAAGGG[U]GGGGAGACUUGUGG[A]GGG CAAG SEQ ID NO: 44: (the sequence in which the 11th A of the aptamer represented by SEQ ID NO: 42 is replaced with C) GGC AUAAGGG[C]GGGGAGACUUGUGG[A]GGG CAAG SEQ ID NO: 45: (the sequence in which the 26th A of the aptamer represented by SEQ ID NO: 42 is replaced with U) GGC AUAAGGG[A]GGGGAGACUUGUGG[U]GGG CAAG SEQ ID NO: 46: (the sequence in which the 11th A of the aptamer represented by SEQ ID NO: 42 is replaced with U and the 26th A is replaced with U) GGC AUAAGGG[U]GGGGAGACUUGUGG[U]GGG CAAG SEQ ID NO: 47: (the sequence in which the 11th A of the aptamer represented by SEQ ID NO: 42 is replaced with C and the 26th A is replaced with U) GGC AUAAGGG[C]GGGGAGACUUGUGG[U]GGG CAAG SEQ ID NO: 48: (A sequence similar to SEQ ID NO: 42, in which the 26th A is replaced with C, designed based on the results of high-throughput sequencing) GGC AUAAGGG[A]GGGGAGACUUGUGG[C]GGG UAAA

[0142] The nucleic acids of SEQ ID NOs: 42 to 48 were chemically synthesized and purified by HPLC. Whether these nucleic acids inhibit the binding of TGF-β1 to the TGF-β receptor was evaluated by injecting a mixed solution of TGF-β1 (4 nM) and nucleic acid (4 nM) in the same manner as in Example 4, and using surface plasmon resonance. The measurement results for TGF-β1: nucleic acid (Apt) = 4 nM: 4 nM (1:1) are shown in Table 4.

[0143] Furthermore, whether these nucleic acids inhibit the activity of TGF-β1 was evaluated by luciferase reporter assay after adding them to the medium to give final concentrations of TGF-β1 (80 pM) and nucleic acid (312.5 pM) in the same manner as in Example 4. The measurement results are shown in Table 4.

[0144] [Table 4]

[0145] As shown in Table 4, the aptamer containing the nucleotide sequence represented by consensus sequence 2 (SEQ ID NO: 34) exhibited inhibitory activity against TGF-β1 even when shortened (SEQ ID NO: 42).

[0146] Furthermore, the results of high-throughput sequencing showed that even when two bases thought to be highly variable (the base [A] between the first and second G sets (H in consensus sequence 2) and the base [A] between the third and fourth G sets (W in consensus sequence 2)) were modified, the inhibitory activity against TGF-β1 was maintained (SEQ ID NO: 42-47). Furthermore, even when the CAGG after the fourth G set was changed to another sequence, the inhibitory activity against TGF-β1 was maintained (SEQ ID NO: 48). From the above, it was shown that consensus sequence 2 (SEQ ID NO: 34) is important for binding activity to TGF-β1 and for exerting inhibitory activity against TGF-β1.

[0147] [Example 8] Optimization of chemical modification of highly active shortened aptamer 1 Based on the sequence shown in SEQ ID NO: 42, the ribose of the nucleotide was modified to a chemically modified form with 2'-OMe, and the effect on the TGF-β1 inhibitory activity of the aptamer was examined. The modified forms prepared are shown in SEQ ID NO: 42(1) to 42(3). Each nucleotide means that the purine (A and G) is 2'-OH (natural RNA type), and the base marked with (F) is a 2'-fluoro modified form. The base marked with (M) is a 2'-OMe modified form. Each sequence listed in the examples is shown in the 5' to 3' direction.

[0148] SEQ ID NO: 42(1): (Sequence in which the 1st to 3rd bases of the aptamer represented by SEQ ID NO: 42 are replaced with OMe-modified bases) G(M)G(M)C(M)A U(F)AAGGGAGGGGAGAC(F)U(F)U(F)GU(F)GGAGGG C(F)AAG SEQ ID NO: 42(2): (Sequence in which the 11th base of the aptamer represented by SEQ ID NO: 42 is replaced with an OMe-modified base) GGC(F) AU(F)AAGGGA(M)GGGGAGAC(F)U(F)U(F)GU(F)GGAGGG C(F)AAG SEQ ID NO: 42(3): (Sequence in which the 26th base of the aptamer represented by SEQ ID NO: 42 is replaced with an OMe-modified base) GGC(F) AU(F)AAGGGAGGGGAGAC(F)U(F)U(F)GU(F)GGA(M)GGG C(F)AAG

[0149] The nucleic acids of SEQ ID NOs: 42(1) to 42(3) were chemically synthesized and purified by HPLC. Whether these nucleic acids inhibit the binding of TGF-β1 to the TGF-β receptor was evaluated by injecting a mixed solution of TGF-β1 (4 nM) and nucleic acid (4 nM) in the same manner as in Example 4, and using surface plasmon resonance. The measurement results for TGF-β1: nucleic acid (Apt) = 4 nM: 4 nM (1:1) are shown in Table 5.

[0150] In addition, whether these nucleic acids inhibit the activity of TGF-β1 was evaluated by adding them to the medium to give final concentrations of TGF-β1 (80 pM) and nucleic acid (312.5 pM) in the same manner as in Example 4, and performing a luciferase reporter assay. The measurement results are shown in Table 5.

[0151] [Table 5]

[0152] As shown in Table 5, it was found that in the aptamer of the present invention, sequences other than the nucleotide sequence represented by consensus sequence 2 (SEQ ID NO: 34) can be OMe modified (SEQ ID NO: 42(1)).

[0153] On the other hand, even in the nucleotide sequence represented by consensus sequence 2 (sequence number 34), it was found that two bases that were considered to be highly variable based on the results of high-throughput sequencing examined in Example 7 (Table 4) could be modified with OMe (sequence numbers 42(2) and 42(3)).

[0154] Optimization of chemical modification of highly active shortened aptamers 2 Based on the sequence shown in SEQ ID NO: 42(2), the ribose of the nucleotide was replaced with a modified base having 2'-OMe, and the effect on the TGF-β1 inhibitory activity of the aptamer was examined. The sequences of the mutant aptamers prepared are shown in SEQ ID NO: 42(2-1) to 42(2-8). The underline indicates the replaced nucleotide. Each nucleotide means that the purine (A and G) is 2'-OH (natural RNA type), and the base marked with (F) is 2'-fluoro modified. The base marked with (M) is 2'-OMe modified. Each sequence listed in the examples is shown in the 5' to 3' direction.

[0155] SEQ ID NO: 42(2-1): (Sequence in which the 26th base of the aptamer represented by SEQ ID NO: 42(2) is replaced with an OMe-modified base) GGC(F) AU(F)AAGGGA(M)GGGGAGAC(F)U(F)U(F)GU(F)GGA(M)GGG C(F)AAG SEQ ID NO: 42(2-2): (Sequence in which the first base of the aptamer represented by SEQ ID NO: 42(2) is replaced with an OMe-modified base) G(M)GC(F) AU(F)AAGGGA(M)GGGGAGAC(F)U(F)U(F)GU(F)GGAGGG C(F)AAG SEQ ID NO: 42(2-3): (Sequence in which the fourth base of the aptamer represented by SEQ ID NO: 42(2) is replaced with an OMe-modified base) GGC(F) A(M)U(F)AAGGGA(M)GGGGAGAC(F)U(F)U(F)GU(F)GGAGGG C(F)AAG SEQ ID NO: 42(2-4): (Sequence in which the 16th base of the aptamer represented by SEQ ID NO: 42(2) is replaced with an OMe-modified base) GGC(F) AU(F)AAGGGA(M)GGGGA(M)GAC(F)U(F)U(F)GU(F)GGAGGG C(F)AAG SEQ ID NO: 42(2-5): (Sequence in which the 17th base of the aptamer represented by SEQ ID NO: 42(2) is replaced with an OMe-modified base) GGC(F) AU(F)AAGGGA(M)GGGGAG(M)AC(F)U(F)U(F)GU(F)GGAGGG C(F)AAG SEQ ID NO: 42(2-6): (Sequence in which the 31st base of the aptamer represented by SEQ ID NO: 42(2) is replaced with an OMe-modified base) GGC(F) AU(F)AAGGGA(M)GGGGAGAC(F)U(F)U(F)GU(F)GGAGGG C(F)A(M)AG SEQ ID NO: 42(2-7): (Sequence in which the 32nd base of the aptamer represented by SEQ ID NO: 42(2) is replaced with an OMe-modified base) GGC(F) AU(F)AAGGGA(M)GGGGAGAC(F)U(F)U(F)GU(F)GGAGGG C(F)AA(M)G SEQ ID NO: 42(2-8): (Sequence in which the 33rd base of the aptamer represented by SEQ ID NO: 42(2) is replaced with an OMe-modified base) GGC(F) AU(F)AAGGGA(M)GGGGAGAC(F)U(F)U(F)GU(F)GGAGGG C(F)AAG(M)

[0156] The nucleic acids of SEQ ID NOs: 42(2-1) to 42(2-8) were chemically synthesized and purified by HPLC. Whether these nucleic acids inhibit the binding of TGF-β1 to the TGF-β receptor was evaluated by injecting a mixed solution of TGF-β1 (4 nM) and nucleic acid (4 nM) in the same manner as in Example 4, and by surface plasmon resonance. The measurement results in the case of TGF-β1: nucleic acid (Apt) = 4 nM: 4 nM (1:1) are shown in Table 6. In addition, whether these nucleic acids inhibit the activity of TGF-β1 was evaluated by adding them to the medium to a final concentration of TGF-β1 (80 pM) and nucleic acid (312.5 pM) in the same manner as in Example 4, and by luciferase reporter assay. The measurement results are shown in Table 6.

[0157] [Table 6]

[0158] From the results in Table 6, in the nucleotide sequence represented by consensus sequence 2 (SEQ ID NO: 34), (1) The two bases considered to be highly variable based on the results of high-throughput sequencing examined in Example 7 (Table 4) can both be OMe-modified (SEQ ID NO: 42 (2-1)). (2) The bases AUAA and AGACUU can also be modified with OMe (SEQ ID NOs: 42(2-4) and 42(2-5)). I found out that... [Industrial Applicability]

[0159] The aptamer of the present invention may be useful as a pharmaceutical agent, diagnostic agent, or labeling agent for the prevention and / or treatment of various diseases involving the activation of TGF-β1, such as fibrosis and cancer. This application is based on patent application No. 2019-126940 filed in Japan (filing date: July 8, 2019), the contents of which are incorporated in their entirety herein.

Claims

1. An aptamer that binds to TGF-β1, which has four sets of 2 to 5 consecutive G bases, comprises a nucleotide sequence represented by the following formula (III), formula (III') or formula (III''), and has a length of 25 to 200 nucleotides: Formula (III): UAAXGGRNGGSGARACUUGKGVNRGG (wherein, X represents a bond or GU; N represents any base; R represents A or G; S represents C or G; K represents G or U; and V represents A, C, or G (limited to combinations in which the set of G bases is four). Formula (III'): UAAXGGRBGGSGARACUUGKGVBRGG (wherein X represents a bond or GU; R represents A or G; S represents C or G; K represents G or U; V represents A, C or G; and B represents C, G or U (limited to combinations in which the set of G bases is four). Formula (III''): AUAAGGGGHGGGAGACUUGUGGWGGG (wherein W represents A or U; H represents A, C or U).

2. The aptamer of claim 1 , wherein at least one nucleotide contained in the aptamer is modified.

3. An aptamer that binds to TGF-β1, comprising any one of the following nucleotide sequences (a) to (c): (a) a sequence represented by SEQ ID NO: 4 to 6, 9, 11, 13, 17 to 22, 26 to 29, or 31 (b) the sequence of (a) above, in which 1 to 5 nucleotides have been substituted, deleted, inserted or added; or (c) The sequence of (a) or (b) above, in which at least one nucleotide is modified.

4. 3. The aptamer of claim 1 or 2, having a length of 55 nucleotides or less.

5. The aptamer according to any one of claims 1 to 4, which inhibits binding between TGF-β1 and a TGF-β1 receptor.

6. A complex comprising the aptamer according to any one of claims 1 to 5 and a functional substance.

7. A pharmaceutical comprising the aptamer according to any one of claims 1 to 5 or the complex according to claim 6.

8. A method for detecting TGF-β1, comprising using the aptamer according to any one of claims 1 to 5 or the complex according to claim 6.

Images