Models of tauopathy

Abstract

BANF1, PPP2CA, and ANKLE2 have been identified as genes that promote tau aggregation when disrupted. Improved tauopathy models, such as cells, tissues, or animals, are provided that have mutations in the expression of BANF1 and / or PPP2CA and / or ANKLE2 or inhibit their expression. Methods for using such improved tauopathy models to evaluate therapeutic drug candidates for the treatment of tauopathy, methods for producing the improved tauopathy models, and methods for accelerating or worsening tau aggregation in tauopathy models are also provided.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Application No. 62 / 861,553, filed June 14, 2019, which is incorporated by reference in its entirety for all purposes.

[0002] Reference to sequence listing submitted as a text file via EFS WEB The sequence listing set forth in file 548673SEQLIST.txt is 203 kilobytes, was created on June 12, 2020, and is incorporated herein by reference. [Background technology]

[0003] Aberrant aggregation or fibrillization of proteins such as tau is a hallmark of many diseases, including many neurodegenerative disorders such as Alzheimer's disease (AD) and frontotemporal dementia (FTD). In many of these diseases, fibrillization of certain proteins into insoluble aggregates is not only a hallmark of the disease but also implicated as a causative factor of neurotoxicity. Moreover, these diseases are characterized by the propagation of the pathology of aggregation through the central nervous system following a stereotyped pattern, and this process correlates with disease progression. Thus, the identification of genes and genetic pathways that alter the process of aberrant protein aggregation, or the intercellular propagation of aggregates, would be of great value in better understanding the pathogenesis of neurodegenerative diseases, as well as in devising strategies for therapeutic intervention. Summary of the Invention [Means for solving the problem]

[0004] Provided herein are improved tauopathy models of non-human animals, animal tissues, and animal cell populations, as well as methods for making and using such models.Such improved tauopathy models can have one or more or all of BANF1, PPP2CA, and ANKLE2 genetic modifications that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2, respectively, and / or can include one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in one or more cells.Some such improved tauopathy models can also include microtubule-associated protein tau coding sequences (e.g., endogenous or exogenous).Some such improved tauopathy models can also include exogenous microtubule-associated protein tau coding sequences (e.g., exogenous human microtubule-associated protein tau coding sequences). Alternatively, some such improved tauopathy models may include a tau coding sequence (endogenous or exogenous) that encodes a tau protein that contains a tauopathy-associated mutation or a tau pathogenic mutation.

[0005] In one aspect, a non-human animal, animal tissue, or population of animal cells is provided, comprising: (a) a microtubule-associated protein tau coding sequence in one or more cells; and (b) (i) one or more or all of BANF1, PPP2CA, and ANKLE2 genetic modifications that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in one or more cells, respectively; and / or (ii) one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in one or more cells. Optionally, the microtubule-associated protein tau coding sequence is a human microtubule-associated protein tau coding sequence. Optionally, the microtubule-associated protein tau coding sequence is an exogenous human microtubule-associated protein tau coding sequence. In one embodiment, a non-human animal, animal tissue, or population of animal cells is provided, comprising: (a) an exogenous human microtubule-associated protein tau coding sequence in one or more cells; and (b) (i) one or more or all genetic modifications of BANF1, PPP2CA, and ANKLE2 that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2, respectively, in one or more cells, and / or (ii) one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in one or more cells. Optionally, the one or more cells are neuronal cells.

[0006] In some such non-human animals, animal tissues, or animal cell populations, the exogenous human microtubule-associated protein tau coding sequence is integrated into the genome. In some such non-human animals, animal tissues, or animal cell populations, the exogenous human microtubule-associated protein tau coding sequence comprises a complementary DNA (cDNA) sequence. In some such non-human animals, animal tissues, or animal cell populations, the exogenous human microtubule-associated protein tau coding sequence is codon-optimized for expression in the non-human animals, animal tissues, or animal cell populations.

[0007] In some such non-human animals, animal tissues, or animal cell populations, the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter.Optionally, the heterologous promoter is a mouse prion protein promoter.Optionally, the heterologous promoter is a neuron-specific promoter.Optionally, the neuron-specific promoter is a synapsin-1 promoter.

[0008] In some such non-human animals, animal tissues, or populations of animal cells, the microtubule-associated protein tau comprises a tauopathy-associated mutation. In some such non-human animals, animal tissues, or populations of animal cells, the tauopathy-associated mutation comprises a P301S mutation. Optionally, the microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 98. In some such non-human animals, animal tissues, or populations of animal cells, the tauopathy-associated mutation comprises an A152T / P301L / S320F triple mutation. Optionally, the microtubule-associated protein tau coding sequence comprises the sequence set forth in SEQ ID NO: 83, or the microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 84.

[0009] In some such non-human animals, animal tissues, or populations of animal cells, the exogenous human microtubule-associated protein tau comprises a tauopathy-associated mutation. In some such non-human animals, animal tissues, or populations of animal cells, the tauopathy-associated mutation comprises a P301S mutation. Optionally, the exogenous human microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 98. In some such non-human animals, animal tissues, or populations of animal cells, the tauopathy-associated mutation comprises an A152T / P301L / S320F triple mutation. Optionally, the exogenous human microtubule-associated protein tau coding sequence comprises the sequence set forth in SEQ ID NO: 83, or the exogenous human microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 84.

[0010] In some such non-human animals, animal tissues, or populations of animal cells, the non-human animals, animal tissues, or populations of animal cells comprise one or more of BANF1, PPP2CA, and ANKLE2 or genetic modifications that reduce expression of one or more or all of BANF1, PPP2CA, and ANKLE2, respectively, in one or more cells. In some such non-human animals, animal tissues, or populations of animal cells, the non-human animals, animal tissues, or populations of animal cells comprise one or more agents that reduce expression of one or more or all of BANF1, Ppp2ca, and ANKLE2 in one or more cells.

[0011] In some such non-human animals, animal tissues, or animal cell populations, the one or more agents comprise a nuclease agent that targets BANF1, PPP2CA, or ANKLE2, or a nucleic acid that encodes a nuclease agent. In some such non-human animals, animal tissues, or animal cell populations, the nuclease agent is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeats (CRISPR) associated (Cas) protein and a guide RNA. Optionally, the nuclease agent is a Cas protein and a guide RNA. Optionally, the Cas protein is a Cas9 protein. Optionally, the Cas protein is a catalytically active Cas protein. Optionally, the Cas protein is a catalytically inactive Cas protein fused to a transcriptional repressor domain, and optionally, the transcriptional repressor domain is a Kruppel associated box (KRAB) domain. In some such non-human animals, animal tissues, or populations of animal cells, the guide RNA targets mouse Banf1 and comprises any one of the sequences set forth in SEQ ID NOs: 44-46, or the guide RNA targets human BANF1 and comprises any one of the sequences set forth in SEQ ID NOs: 27-30. In some such non-human animals, animal tissues, or populations of animal cells, the guide RNA targets mouse Ppp2ca and comprises any one of the sequences set forth in SEQ ID NOs: 47-49, or the guide RNA targets human PPP2CA and comprises any one of the sequences set forth in SEQ ID NOs: 31-32. In some such non-human animals, animal tissues, or populations of animal cells, the guide RNA targets mouse Ankle2 and comprises any one of the sequences set forth in SEQ ID NO: 50-52, or the guide RNA targets human ANKLE2 and comprises the sequence set forth in SEQ ID NO: 38.

[0012] In some such non-human animals, animal tissues, or populations of animal cells, the one or more agents comprise a transcriptional repressor or a nucleic acid encoding a transcriptional repressor that targets BANF1, PPP2CA, or ANKLE2. Optionally, the transcriptional repressor comprises a catalytically inactive Cas protein (e.g., a Cas9 protein) fused to a transcriptional repressor domain, and optionally, the transcriptional repressor domain is a Krüppel-associated box (KRAB) domain. In some such non-human animals, animal tissues, or populations of animal cells, the guide RNA targets mouse Banf1 and comprises any one of the sequences set forth in SEQ ID NOs: 44-46, or the guide RNA targets human BANF1 and comprises any one of the sequences set forth in SEQ ID NOs: 27-30. In some such non-human animals, animal tissues, or populations of animal cells, the guide RNA targets mouse Ppp2ca and comprises any one of the sequences set forth in SEQ ID NOs: 47-49, or the guide RNA targets human PPP2CA and comprises any one of the sequences set forth in SEQ ID NOs: 31-32. In some such non-human animals, animal tissues, or populations of animal cells, the guide RNA targets mouse Ankle2 and comprises any one of the sequences set forth in SEQ ID NO: 50-52, or the guide RNA targets human ANKLE2 and comprises the sequence set forth in SEQ ID NO: 38.

[0013] In some such non-human animals, animal tissues, or populations of animal cells, the one or more agents comprise an antisense oligonucleotide, antisense RNA, small interfering RNA (siRNA), or short hairpin RNA (shRNA) that targets BANF1, PPP2CA, or ANKLE2. In some such non-human animals, animal tissues, or populations of animal cells, the one or more agents comprise an antisense oligonucleotide or RNAi agent, or a nucleic acid encoding an antisense oligonucleotide or RNAi agent, that targets BANF1, PPP2CA, or ANKLE2. Optionally, the antisense oligonucleotide or RNAi agent comprises a sequence set forth in any one of SEQ ID NOs: 105-324, or a modified version thereof. Optionally, the antisense oligonucleotide or RNAi agent is selected from the group consisting of SEQ ID NOs: 105, 106, 110-113, 115, 120-122, 124, 125, 130, 133, 136, 137, 150, 152, 153, 155, 158-160, 162, 165, 166, 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 3, 215, 216, 220-223, 225, 230-232, 234, 235, 240, 243, 246, 247, 260, 262, 263, 265, 268-270, 272, 275, 276, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321, and 323, or modified versions thereof. Optionally, the antisense oligonucleotide or RNAi agent comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl modified bases. Optionally, the antisense oligonucleotide is a 5-10-5 gapmer comprising a phosphorothioate backbone, a 5' wing of 2'-methoxyethyl modified bases, a central 10 nucleotide core of DNA, and a 3' wing of 2'-methoxyethyl modified bases.

[0014] In some such non-human animals, animal tissues, or animal cell populations, at least one sign or symptom of tauopathy is increased in the non-human animals, animal tissues, or animal cell populations compared to non-human animals, animal tissues, or animal cell populations that do not contain one or more or all of the genetic modifications of BANF1, PPP2CA, and ANKLE2, or do not contain one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2.Optionally, at least one sign or symptom comprises tau hyperphosphorylation or tau aggregation.Optionally, at least one sign or symptom comprises tau hyperphosphorylation and tau aggregation. In some cases, at least one symptom of the condition includes increased tau and / or phosphotau in an insoluble fraction after cellular fractionation, increased phosphotau in the somatodendritic compartment of a neuron, increased phosphotau in the perinuclear region of a neuron, a decreased nuclear to cytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 (Nup98) in a neuron, a decreased nuclear to cytoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in a neuron, or a decreased nuclear to cytoplasmic ratio of Ran GTPase-activating protein 1 (RanGAP1) in a neuron, or any combination thereof.

[0015] In some such populations of animal cells, the cells are in vivo. In some such populations of animal cells, the cells are in vitro. In some such populations of animal cells, the cells are human cells. In some such populations of animal cells, the cells are rodent cells, and optionally the rodent cells are mouse or rat cells. Optionally, the cells are mouse cells. In some such populations of animal cells, the cells comprise neuronal cells. Optionally, the neuronal cells comprise neurons derived from human induced pluripotent stem cells. Optionally, the neuronal cells comprise neurons derived from mouse embryonic stem cells. Optionally, the neuronal cells comprise primary mouse neurons.

[0016] In some such animal tissues, the tissue is in vivo. In some such animal tissues, the tissue is ex vivo. In some such animal tissues, the animal is a rodent, optionally the rodent is a mouse or a rat. Optionally, the animal is a mouse. In some such animal tissues, the tissue is nervous system tissue. Optionally, the tissue comprises a brain slice (e.g., an organotypic brain slice culture).

[0017] In some such non-human animals, the non-human animal is a rodent, and optionally the rodent is a mouse or rat.Optionally, the non-human animal is a mouse.Optionally, the mouse is a PS19 transgenic mouse, further comprising one or more or all of the genetic modifications of BANF1, PPP2CA and ANKLE2, which respectively reduce the expression of one or more or all of BANF1, PPP2CA and ANKLE2 in one or more cells, and / or further comprising one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA and ANKLE2 in one or more cells.

[0018] In another aspect, a method is provided for evaluating a therapeutic candidate for the treatment of a tauopathy using any of the above non-human animals, animal tissues, and animal cell populations. Some such methods include: (a) administering a candidate agent to any of the above non-human animals, animal tissues, and animal cell populations; (b) performing one or more assays to determine whether the candidate agent has an effect on one or more signs or symptoms associated with a tauopathy; and (c) identifying a candidate agent that has an effect on one or more signs or symptoms associated with a tauopathy as a therapeutic candidate. In some such methods, the one or more signs or symptoms include tau hyperphosphorylation or tau aggregation. Optionally, the one or more signs or symptoms include tau hyperphosphorylation and tau aggregation. In some such methods, the one or more signs or symptoms include increased tau and / or phospho-tau in the insoluble fraction after cellular fractionation, increased phospho-tau in the somatodendritic compartment of a neuron, increased phospho-tau in the perinuclear region of a neuron, a decreased nuclear to cytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 (Nup98) in a neuron, a decreased nuclear to cytoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in a neuron, a decreased nuclear to cytoplasmic ratio of Ran GTPase-activating protein 1 (RanGAP1) in a neuron, or any combination thereof.

[0019] In some such methods, the candidate agent is administered to a non-human animal. In some such methods, the candidate agent is administered to animal tissue ex vivo. In some such methods, the candidate agent is administered to a population of animal cells in vitro.

[0020] In another embodiment, a method for producing any of the above non-human animals, animal tissues, and animal cell populations is provided. Some such methods include: (a) introducing one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 into a non-human animal, animal tissue, or animal cell population that contains a microtubule-associated protein tau coding sequence; and (b) screening the non-human animal, animal tissue, or animal cell population to confirm the presence of the one or more agents. Some such methods include: (a) introducing one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 into a non-human animal, animal tissue, or animal cell population that contains an exogenous human microtubule-associated protein tau coding sequence; and (b) screening the non-human animal, animal tissue, or animal cell population to confirm the presence of the one or more agents. Some such methods include: (a) introducing into a population of non-human animals, animal tissues, or animal cells (i) an exogenous human microtubule-associated protein tau coding sequence, and (ii) one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2, and (b) screening the population of non-human animals, animal tissues, or animal cells to confirm the presence of the one or more agents and the exogenous human microtubule-associated protein tau coding sequence. Optionally, the exogenous human microtubule-associated protein tau coding sequence is delivered via adeno-associated virus, lentivirus, or lipid nanoparticles.

[0021] In some such methods, one or more agents are delivered via adeno-associated virus, lentivirus, or lipid nanoparticles.In some such methods, the method is for making a non-human animal, and one or more agents are administered to the non-human animal by intrathecal injection, intracranial injection, or intracerebroventricular injection.Optionally, the method is for making a non-human animal, and one or more agents are administered to the non-human animal by stereotactic injection into the brain or brain region (e.g., hippocampus).Optionally, the method is for making a non-human animal, and one or more agents are administered to the non-human animal by stereotactic injection into the hippocampus.

[0022] In another embodiment, a method is provided for accelerating or exacerbating tau aggregation in a tauopathy model non-human animal, a tauopathy model animal tissue, or a population of tauopathy model animal cells. Some such methods include introducing one or more agents that reduce expression of one or more or all of BANF1, PPP2CA, and ANKLE2 into a tauopathy model non-human animal, a tauopathy model animal tissue, or a tauopathy model population of animal cells.

[0023] In some such methods, the tauopathy model non-human animal, the tauopathy model animal tissue, or the tauopathy model population of animal cells comprises an exogenous human microtubule-associated protein tau coding sequence. In some such methods, the exogenous human microtubule-associated protein tau coding sequence is integrated into the genome. In some such methods, the exogenous human microtubule-associated protein tau coding sequence comprises a complementary DNA (cDNA) sequence. In some such methods, the exogenous human microtubule-associated protein tau coding sequence is codon-optimized for expression in the non-human animal, animal tissue, or population of animal cells.

[0024] In some such methods, the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter. Optionally, the heterologous promoter is a mouse prion protein promoter. Optionally, the heterologous promoter is a neuron-specific promoter. Optionally, the neuron-specific promoter is a synapsin-1 promoter.

[0025] In some such methods, the exogenous human microtubule-associated protein tau comprises a tauopathy-associated mutation. In some such methods, the tauopathy-associated mutation comprises a P301S mutation. Optionally, the exogenous human microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 98. In some such methods, the tauopathy-associated mutation comprises an A152T / P301L / S320F triple mutation. Optionally, the exogenous human microtubule-associated protein tau coding sequence comprises the sequence set forth in SEQ ID NO: 83, or the exogenous human microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 84.

[0026] In some such methods, the one or more agents include a nuclease agent that targets BANF1, PPP2CA, or ANKLE2, or a nucleic acid encoding a nuclease agent. In some such methods, the nuclease agent is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeats (CRISPR) associated (Cas) protein and a guide RNA. Optionally, the nuclease agent is a Cas protein and a guide RNA. Optionally, the Cas protein is a Cas9 protein. Optionally, the Cas protein is a catalytically active Cas protein. Optionally, the Cas protein is a catalytically inactive Cas protein fused to a transcriptional repressor domain, and optionally, the transcriptional repressor domain is a Kruppel associated box (KRAB) domain. In some such methods, the guide RNA targets mouse Banf1 and comprises any one of the sequences set forth in SEQ ID NOs: 44-46, or the guide RNA targets human BANF1 and comprises any one of the sequences set forth in SEQ ID NOs: 27-30. In some such methods, the guide RNA targets mouse Ppp2ca and comprises any one of the sequences set forth in SEQ ID NOs: 47-49, or the guide RNA targets human PPP2CA and comprises any one of the sequences set forth in SEQ ID NOs: 31-32. In some such methods, the guide RNA targets mouse Ankle2 and comprises any one of the sequences set forth in SEQ ID NOs: 50-52, or the guide RNA targets human ANKLE2 and comprises the sequence set forth in SEQ ID NO: 38.

[0027] In some such methods, the one or more agents include a transcriptional repressor that targets BANF1, PPP2CA, or ANKLE2, or a nucleic acid encoding the transcriptional repressor. Optionally, the transcriptional repressor includes a catalytically inactive Cas protein (e.g., a Cas9 protein) fused to a transcriptional repressor domain, and optionally, the transcriptional repressor domain is a Krüppel-associated box (KRAB) domain. In some such non-human animals, animal tissues, or populations of animal cells, the guide RNA targets mouse Banf1 and includes any one of the sequences set forth in SEQ ID NOs: 44-46, or the guide RNA targets human BANF1 and includes any one of the sequences set forth in SEQ ID NOs: 27-30. In some such non-human animals, animal tissues, or populations of animal cells, the guide RNA targets mouse Ppp2ca and includes any one of the sequences set forth in SEQ ID NOs: 47-49, or the guide RNA targets human PPP2CA and includes any one of the sequences set forth in SEQ ID NOs: 31-32. In some such non-human animals, animal tissues, or populations of animal cells, the guide RNA targets mouse Ankle2 and comprises any one of the sequences set forth in SEQ ID NO: 50-52, or the guide RNA targets human ANKLE2 and comprises the sequence set forth in SEQ ID NO: 38.

[0028] In some such methods, the one or more agents comprise an antisense oligonucleotide, antisense RNA, small interfering RNA (siRNA), or short hairpin RNA (shRNA) that targets BANF1, PPP2CA, or ANKLE2. In some such methods, the one or more agents comprise an antisense oligonucleotide, or RNAi agent, or a nucleic acid encoding the antisense oligonucleotide or RNAi agent, that targets BANF1, PPP2CA, or ANKLE2. Optionally, the antisense oligonucleotide or RNAi agent comprises a sequence set forth in any one of SEQ ID NOs: 105-324, or a modified version thereof. Optionally, the antisense oligonucleotide or RNAi agent is selected from the group consisting of SEQ ID NOs: 105, 106, 110-113, 115, 120-122, 124, 125, 130, 133, 136, 137, 150, 152, 153, 155, 158-160, 162, 165, 166, 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 3, 215, 216, 220-223, 225, 230-232, 234, 235, 240, 243, 246, 247, 260, 262, 263, 265, 268-270, 272, 275, 276, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321, and 323, or modified versions thereof. Optionally, the antisense oligonucleotide or RNAi agent comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl modified bases. Optionally, the antisense oligonucleotide is a 5-10-5 gapmer comprising a phosphorothioate backbone, a 5' wing of 2'-methoxyethyl modified bases, a central 10 nucleotide core of DNA, and a 3' wing of 2'-methoxyethyl modified bases.

[0029] In some such methods, one or more agents are delivered via adeno-associated virus, lentivirus, or lipid nanoparticles.In some such methods, one or more agents are administered to non-human animals by intrathecal injection, intracranial injection, or intracerebroventricular injection, and optionally, one or more agents are administered to non-human animals by stereotactic injection into brain or brain region (e.g., hippocampus), and optionally, one or more agents are administered to non-human animals by stereotactic injection into hippocampus.

[0030] In some such methods, at least one sign or symptom of tauopathy is increased in a non-human animal, animal tissue, or animal cell population compared to a non-human animal, animal tissue, or animal cell population that does not contain one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2.Optionally, the at least one sign or symptom comprises tau hyperphosphorylation or tau aggregation.Optionally, the at least one sign or symptom comprises tau hyperphosphorylation and tau aggregation. Optionally, the at least one sign or symptom comprises an increase in tau and / or phosphotau in the insoluble fraction after cellular fractionation, an increase in phosphotau in the somatodendritic compartment of a neuron, an increase in phosphotau in the perinuclear region of a neuron, a decrease in the nuclear to cytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 (Nup98) in a neuron, a decrease in the nuclear to cytoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in a neuron, a decrease in the nuclear to cytoplasmic ratio of Ran GTPase-activating protein 1 (RanGAP1) in a neuron, or any combination thereof.

[0031] In some such methods, the cell is in vivo. In some such methods, the cell is in vitro. In some such methods, the cell is a human cell. In some such methods, the cell is a rodent cell, and optionally the rodent cell is a mouse cell or a rat cell. Optionally, the cell is a mouse cell. In some such methods, the cell comprises a neuronal cell. Optionally, the neuronal cell comprises a neuron derived from a human induced pluripotent stem cell. Optionally, the neuronal cell comprises a neuron derived from a mouse embryonic stem cell. Optionally, the neuronal cell comprises a primary mouse neuron.

[0032] In some such methods, the tissue is in vivo. In some such methods, the tissue is ex vivo. In some such methods, the animal tissue is rodent tissue, and optionally the rodent is a mouse or a rat. Optionally, the animal tissue is mouse tissue. In some such methods, the tissue is nervous system tissue. Optionally, the tissue comprises a brain slice (e.g., an organotypic brain slice culture).

[0033] In some such methods, the non-human animal is a rodent, and optionally the rodent is a mouse or a rat.Optionally, the non-human animal is a mouse.Optionally, the mouse is a PS19 transgenic mouse, further comprising one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2.

[0034] In another aspect, a non-human animal genome is provided that comprises an exogenous human microtubule-associated protein tau coding sequence and one or more or all of Banf1, Ppp2ca, and Ankle2 genetic modifications that reduce expression of one or more or all of Banf1, Ppp2ca, and Ankle2, respectively.

[0035] In another aspect, provided is an agent or a nucleic acid encoding the agent that reduces or inhibits expression of BANF1, PPP2CA, or Ankle2 in a cell, optionally wherein the agent is a nuclease agent or an antisense oligonucleotide, an antisense RNA, a small interfering RNA (siRNA), or a short hairpin RNA (shRNA) that targets BANF1, PPP2CA, or ANKLE2. Optionally, the agent is a nuclease agent or an antisense oligonucleotide RNAi agent that targets BANF1, PPP2CA, or ANKLE2. Optionally, the antisense oligonucleotide or RNAi agent comprises a sequence set forth in any one of SEQ ID NOs: 105-324, or a modified version thereof. Optionally, the antisense oligonucleotide or RNAi agent is selected from the group consisting of SEQ ID NOs: 105, 106, 110-113, 115, 120-122, 124, 125, 130, 133, 136, 137, 150, 152, 153, 155, 158-160, 162, 165, 166, 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 3, 215, 216, 220-223, 225, 230-232, 234, 235, 240, 243, 246, 247, 260, 262, 263, 265, 268-270, 272, 275, 276, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321, and 323, or modified versions thereof. Optionally, the antisense oligonucleotide or RNAi agent comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl modified bases. Optionally, the antisense oligonucleotide is a 5-10-5 gapmer comprising a phosphorothioate backbone, a 5' wing of 2'-methoxyethyl modified bases, a central 10 nucleotide core of DNA, and a 3' wing of 2'-methoxyethyl modified bases. [Brief description of the drawings]

[0036] [Figure 1]FIG. 1 shows a schematic diagram of the tau isoform 2N4R (not to scale). The tau biosensor line contains only tau4RD-YFP and tau4RD-CFP as transgenes, rather than the full 2N4R. [Diagram 2] Figure 1 shows a schematic of how aggregate formation is monitored by fluorescence resonance energy transfer (FRET) in a tau biosensor cell line. Tau4RD-CFP protein is excited with violet light and emits blue light. Tau4RD-YFP fusion protein is excited with blue light and emits yellow light. In the absence of aggregation, excitation with violet light does not result in FRET. In the presence of tau aggregation, excitation with violet light results in FRET and yellow emission. [Figure 3A] Figure 1 shows the relative Cas9 mRNA expression in Tau4RD-CFP / Tau4RD-YFP (TCY) biosensor cell clones transduced with lentiviral Cas9 expression constructs relative to clone Cas9H1, a previously isolated disappointing control Cas9-expressing TCY clone. [Figure 3B] Shown are cleavage efficiencies at the PERK and SNCA loci in Cas9 TCY clones 3 and 7 days after transduction with sgRNAs targeting PERK and SNCA, respectively. [Figure 4] Figure 1 shows a schematic of the strategy for disrupting target genes in Cas9 TCY biosensor cells using a genome-wide CRISPR / Cas9 sgRNA library. [Diagram 5] Schematic diagram showing induction of stably growing tau aggregate-containing Tau4RD-YFP Agg[+] subclones when Tau4RD-YFP cells are seeded with Tau4RD fibrils. Fluorescence microscopy images showing the subclones containing tau aggregates are also shown. [Figure 6]Schematic diagram showing that conditioned medium from Tau4RD-YFP Agg[+] subclones collected after 3 days in confluent cells can provide a source of tau aggregation activity, whereas medium from Tau4RD-YFP Agg[-] subclones does not. Conditioned medium was applied to recipient cells as 75% conditioned medium and 25% fresh medium. Respective fluorescence-activated cell sorting (FACS) analysis images are shown. The x-axis indicates CFP (405 nm laser excitation) and the y-axis indicates FRET (excitation from CFP emission). The top right quadrant is FRET[+], the bottom right quadrant is CFP[+], and the bottom left quadrant is double negative. [Figure 7] FIG. 1 is a schematic showing the strategy of genome-wide CRISPR nuclease (CRISPRn) screening to identify modifier genes that promote tau aggregation. [Figure 8] FIG. 1 is a schematic illustrating the concept of abundance and enrichment for next-generation sequencing (NGS) analysis using genome-wide CRISPRn screening. [Figure 9] A schematic diagram of the secondary screening of target genes 1 to 14 identified in the genome-wide screening of modifier genes that promote tau aggregation is shown. [Figure 10] Figure 1 shows FRET induction by tau aggregate-conditioned medium in Cas9 TCY biosensor cells transduced with lentiviral expression constructs of sgRNAs targeting target genes 1 to 14. A secondary screen confirmed that target genes 2 (BANF1) and 8 (PPP2CA) regulate the susceptibility of cells to tau seeding / aggregation. [Figure 11]Shown are FACS analysis images of Cas9 TCY biosensor cells transduced with lentiviral expression constructs of BANF1 gRNA1, PPP2CA gRNA5, non-targeting gRNA, and no gRNA. Cells were cultured in conditioned medium or fresh medium. The x-axis shows CFP (405 nm laser excitation) and the y-axis shows FRET (excitation from CFP emission). The top right quadrant is FRET [+], the bottom right quadrant is CFP [+], and the bottom left quadrant is double negative. Disruption of BANF1 or PPP2CA increases tau aggregate formation in response to tau aggregate-conditioned medium but not to fresh medium. [Figure 12] Figure 1 shows a schematic of secondary screening in Cas9 TCY biosensor cells transduced with lentiviral expression constructs of sgRNAs targeting BANF1 and PPP2CA, including mRNA expression analysis, protein expression analysis, and FRET analysis. Two sgRNAs were used against BANF1 (g1 and g3), one sgRNA was used against PPP2CA (g5), and a non-targeting sgRNA (g3) was used as a non-targeting control. [Figure 13] Relative expression of BANF1 and PPP2CA in Cas9 TCY biosensor cells assessed by qRT-PCR 6 days after transduction of lentiviral sgRNA expression constructs. [Figure 14] Shows BANF1 and PPP2CA protein expression in Cas9TCY biosensor cells assessed by Western blot 13 days after transduction with lentiviral sgRNA expression constructs. [Figure 15] Figure 1 shows tau aggregation as measured by percent FRET[+] cells in Cas9 TCY biosensor cells 10 days after transduction with lentiviral sgRNA expression constructs. Lipofectamine was not used. [Figure 16] 1 shows expression of BANF1 and PPP2CA in knockdown Cas9 TCY cell clones as assessed by Western blot. [Figure 17]1 shows expression of tau in knockdown Cas9 TCY cell clones as assessed by Western blot, and phosphorylation of tau at positions S262 and S356 in those clones as assessed by Western blot. [Figure 18] 13 shows tau aggregation in BANF1 and PPP2CA knockdown Cas9TCY cell clones assessed by FRET. [Figure 19] 13 shows tau aggregation in BANF1, VRK1, CDK5, PPP2CA, PPP2R2A, ANKLE2, EMD, LEMD2, LEMD3 / MAN1, and TMPO / LAP2 knockdown Cas9TCY cell clones assessed by FRET. [Figure 20] Shows tau aggregation as measured by percent FRET[+] cells in Cas9 TCY biosensor cells following transduction of lentiviral sgRNA expression constructs targeting ANKLE2, EMD, or VRK1. [Figure 21A] Relative expression of Banf1 in Cas9-enabled mouse embryonic stem cells after transduction with lentiviral sgRNA expression constructs as assessed by qRT-PCR. [Figure 21B] Relative expression of Ppp2ca in Cas9-enabled mouse embryonic stem cells assessed by qRT-PCR after transduction with lentiviral sgRNA expression constructs. [Figure 22A] Relative expression of Ankle2 in F1H4 mouse embryonic stem cells as assessed by qRT-PCR following transduction with lentiviral sgRNA expression constructs (all-in-one (AIO) constructs containing Cas9, or sgRNA only). [Figure 22B] Relative expression of Banf1 in F1H4 mouse embryonic stem cells as assessed by qRT-PCR following transduction with lentiviral sgRNA expression constructs (all-in-one (AIO) constructs containing Cas9, or sgRNA only). [Figure 22C]Relative expression of Ppp2ca in F1H4 mouse embryonic stem cells as assessed by qRT-PCR following transduction with lentiviral sgRNA expression constructs (all-in-one (AIO) constructs containing Cas9, or sgRNA only). [Diagram 23] BANF1 / PPP2CA interactome is shown. [Figure 24A] Relative expression of ANKLE2 in Tau-CFP / Tau-YFP(TCY)dCas-KRAB clones (targeted knockdown of BANF1 or ANKLE2 or non-targeted) is shown. [Figure 24B] Relative expression of BANF1 in Tau-CFP / Tau-YFP(TCY)dCas-KRAB clones (targeted knockdown of BANF1 or ANKLE2 or non-targeted) is shown. [Diagram 25] Shown are tau aggregation measured by percentage of FRET[+] cells in tau-CFP / tau-YFP(TCY)dCas-KRAB clones (targeted knockdown of BANF1 or ANKLE2) treated with conditioned media Tau-YFP Agg[+] for 3 days. [Figure 26] We show that cell fractionation of ΔBANF1 and ΔANKLE2 clones allows detection of tau and phosphotau (serine 356) in the insoluble fraction after 2 days using tau-YFP Agg[+] cell lysates. [Figure 27] Gene list sizes for significant genes (fold change ≥1.5) in four comparisons by RNA-seq analysis are shown (BANF1KD vs. non-targeted control, BANF1KD vs. parent, ANKLE2KD vs. non-targeted control, and ANKLE2KD vs. parent). [Figure 28] A schematic diagram for testing cDNA complementation to rescue increased tau aggregation in ΔBANF1 and ΔANKLE2 knockdown cells is shown. [Figure 29]Figure 1 shows tau aggregation measured by percent FRET[+] cells after cDNA complementation of Tau-CFP / Tau-YFPdCas-KRABΔBANF1 and ΔANKLE2 knockdown cells treated with Tau-YFP Agg[+] cell lysates (2 μg) for 2 days. No_KRAB_gRNA refers to negative control samples where no gRNA was administered. [Figure 30A] Counts of DAPI+ nuclei in untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons are shown. [Figure 30B] Figure 2 shows MAP2 intensity in cell bodies as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons using a two-tailed unpaired Student's t-test (ns = non-significant, error bars represent standard error of the mean (sem)). [Figure 31A] Shown is phospho-tau S356 intensity (measured by fluorescence intensity) in the cell bodies of untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons. [Figure 31B] Perinuclear phospho-tau S356 intensity (measured by fluorescence intensity) in non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons was used with a two-tailed unpaired Student's t-test (*** = p < 0.004 **** = p < 0.0001, error bars represent standard error of the mean). [Figure 32A] Counts of DAPI+ nuclei in untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons are shown. [Figure 32B] MAP2 intensity in the cell body as measured by fluorescence intensity in untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons is shown. [Figure 32C] Total tau intensity in the cell body as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons is shown using a two-tailed unpaired Student's t-test (ns = not significant, error bars represent standard error of the mean). [Figure 33A] Nuclei counts of untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 and ΔPPP2CA mutant cortical neurons are shown. [Figure 33B] Shown is MAP2 intensity in the cell body as measured by fluorescence intensity in untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 and ΔPPP2CA mutant cortical neurons. [Figure 33C] Shown is phospho-tau AT8 (S202, T205) intensity in the cell body as measured by fluorescence intensity in untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 and ΔPPP2CA mutant cortical neurons. [Figure 33D] Shown is phospho-tau AT8 (S202, T205) intensity in the perinuclear domain as measured by fluorescence intensity in untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 and ΔPPP2CA mutant cortical neurons. [Figure 33E] Shown is total tau intensity in the cell body as measured by fluorescence intensity in untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 and ΔPPP2CA mutant cortical neurons. [Figure 34A] Counts of DAPI+ nuclei in untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons are shown. [Figure 34B] 1 shows the Nup98 nuclear / cytoplasmic ratio in non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons. [Figure 34C] Shown is phospho-tau S356 intensity (measured by fluorescence intensity) in the soma of untargeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons. [Fig. 34D] Perinuclear phospho-tau S356 intensity (measured by fluorescence intensity) in non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons was used with a two-tailed unpaired Student's t-test (*=p<0.05, error bars represent standard error of the mean). [Figure 35A]1 shows the RanGAP1 nuclear / cytoplasmic ratio in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. [Figure 35B] Total RanGAP1 levels in untargeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons are shown. [Figure 35C] 1 shows the Ran nuclear / cytoplasmic ratio in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. [Figure 35D] Total Ran levels in non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons are shown using a two-tailed unpaired Student's t-test (**=p<0.002-ns, non-significant, error bars represent standard error of the mean). [Figure 36A] DAPI+ nuclei counts in non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons upon addition of tau-cDNA 3MUT are shown. [Figure 36B] Shown is phospho-tau S356 intensity (measured by fluorescence intensity) in the cell bodies of non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons upon addition of tau cDNA 3MUT. [Figure 36C] Perinuclear phosphorylated tau S356 intensity (measured by fluorescence intensity) in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons upon addition of tau cDNA 3MUT. [Figure 36D] MAP2 intensity (measured by fluorescence intensity) in the cell bodies of non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons upon addition of tau-cDNA 3MUT, using a two-tailed unpaired Student's t-test (*=p<0.05, **=p<0.002-ns, non-significant, error bars represent standard error of the mean). [Figure 37A]DAPI+ nuclei counts in non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons upon addition of tau-cDNA 3MUT are shown. [Figure 37B] Shown is total tau intensity (measured by fluorescence intensity) in the cell bodies of non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons upon addition of tau cDNA 3MUT. [Figure 37C] MAP2 intensity (measured by fluorescence intensity) in the cell bodies of non-targeted mouse primary cortical neurons and ΔBANF1 and ΔANKLE2 mutant cortical neurons upon addition of tau-cDNA 3MUT. Two-tailed unpaired Student's t-test was used (ns = not significant, error bars represent standard error of the mean). [Figure 38A] Counts of DAPI+ nuclei in untargeted mouse primary cortical neurons and ΔBANF1 and ΔPPP2CA mutant cortical neurons are shown. [Figure 38B] Shown is phospho-tau (S356) intensity in the perinuclear domain as measured by fluorescence intensity in untargeted mouse primary cortical neurons and ΔBANF1 and ΔPPP2CA mutant cortical neurons. [Figure 38C] 1 shows the correlation between phospho-tau (S356) intensity and increased detection of misfolded tau in the somas of ΔPPP2CA mutant cortical neurons. [Figure 38D] Shown is phospho-tau (S356) intensity in cells as measured by fluorescence intensity in untargeted mouse primary cortical neurons and ΔBANF1 and ΔPPP2CA mutant cortical neurons. [Figure 38E] Aggresome Detection Reagent (ADR) intensity in cells of non-targeted mouse primary cortical neurons and ΔBANF1 and ΔPPP2CA mutant cortical neurons. [Figure 38F]Correlation between phospho-tau (S356) intensity and increased detection of misfolded tau in the soma of ΔBANF1 mutant cortical neurons using two-tailed unpaired Student's t-test (*=p<0.05, **=p<0.02, ***=p<0.004, error bars represent standard error of the mean, Pearson correlation (ρ)-R-squared-two-tailed P-value<0.05). [Figure 39A] Counts of DAPI+ nuclei in untargeted mouse primary cortical neurons and ΔBANF1 and ΔPPP2CA mutant cortical neurons are shown. [Figure 39B] Shown is phospho-tau AT8 (S202, T205) intensity in the perinuclear domain as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and ΔBANF1 and ΔPPP2CA mutant cortical neurons. [Figure 39C] Correlation of phospho-tau AT8 (S202, T205) intensity with increased detection of misfolded tau in the somas of ΔPPP2CA mutant cortical neurons. [Figure 39D] Shown are phospho-tau AT8 (S202, T205) intensity in the cell body as measured by fluorescence intensity in untargeted mouse primary cortical neurons and ΔBANF1 and ΔPPP2CA mutant cortical neurons. [Figure 39E] Aggresome Detection Reagent (ADR) intensity in the cell bodies of untargeted mouse primary cortical neurons and ΔBANF1 and ΔPPP2CA mutant cortical neurons. [Figure 39F] Correlation between phospho-tau AT8 (S202, T205) intensity and increased detection of misfolded tau in the soma of ΔBANF1 mutant cortical neurons using two-tailed unpaired Student's t-test (*=p<0.05, **=p<0.02, ***=p<0.004, ns=non-significant, error bars represent standard error of the mean, Pearson correlation (ρ)-R-squared-two-tailed P-value<0.05). [Diagram 40]A general schematic of the ASO design is shown, where the ASO was designed as a 5-10-5 gapmer with a phosphorothioate backbone, 2' methoxyethyl modified bases used in each wing (5 nucleotides from both ends), and a 10 nucleotide core of unmodified DNA bases. [Figure 41A] Figure 41 shows the results of qPCR screening of mAnkle2 ASO in mouse NSC34 cells 72 hours after transfection with ASO. Knockdown of total target mRNA was compared to untreated cells. Figure 41A shows the results of a primary screen performed at 100 nM ASO concentration (two replicates, top dashed line indicates 75% knockdown), Figure 41B shows the results of a secondary screen performed at 50 nM ASO concentration (two replicates, bottom dashed line indicates 75% knockdown), and Figure 41C shows the results of a secondary screen performed at 5 nM ASO concentration (two replicates, middle dashed line indicates 25% knockdown). [Figure 41B] Same as above. [Figure 41C] Same as above. [Figure 42A] 42A shows the results of qPCR screening of mPpp2ca ASO in mouse NSC34 cells 72 hours after transfection with ASO. The knockdown of total target mRNA was compared to untreated cells. Figure 42A shows the results of a primary screen performed at 100 nM ASO concentration (dotted line indicates 75% knockdown), Figure 42B shows the results of a secondary screen performed at 50 nM ASO concentration (triplicate, bottom dotted line indicates 75% knockdown), and Figure 42C shows the results of a secondary screen performed at 5 nM ASO concentration (triplicate, bottom dotted line indicates 40% knockdown). [Figure 42B] Same as above. [Figure 42C] Same as above. [Diagram 43] Figure 1 shows qPCR results (2 replicates) screening mBanf1 ASO in mouse NSC34 cells 72 hours after transfection with the ASO at a concentration of 100 nM. Total target mRNA knockdown was compared to untreated cells. The dotted line indicates 75% knockdown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0037] definition The terms "protein," "polypeptide," and "peptide," as used interchangeably herein, include polymeric forms of amino acids of any length, including coded and non-coded amino acids, and amino acids that are chemically or biochemically modified or derivatized. These terms also include modified polymers, such as polypeptides having modified peptide backbones. The term "domain" refers to any portion of a protein or polypeptide that has a specific function or structure.

[0038] Proteins are said to have an "N-terminus" and a "C-terminus". The term "N-terminus" refers to the beginning of a protein or polypeptide terminated by an amino acid having a free amine group (-NH2). The term "C-terminus" refers to the end of an amino acid chain (protein or polypeptide) terminated by a free carboxyl group (-COOH).

[0039] The terms "nucleic acid" and "polynucleotide," used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. These include single-stranded, double-stranded, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers that contain purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derivatized nucleotide bases.

[0040] Nucleic acids are said to have a "5' end" and a "3' end" because mononucleotides react to make oligonucleotides in a manner that the 5' phosphate of one mononucleotide pentose ring is attached in one direction to the 3' oxygen of its neighbor via a phosphodiester bond. An end of an oligonucleotide is called a "5' end" if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring. An end of an oligonucleotide is called a "3' end" if its 3' oxygen is not linked to the 5' phosphate of another mononucleotide pentose ring. A nucleic acid sequence may also be said to have a 5' and a 3' end, even if it is internal to a larger oligonucleotide. In either a linear or circular DNA molecule, separate elements are referred to as being "upstream" or "downstream" 5' or 3' elements.

[0041] The term "genomically integrated" refers to a nucleic acid that has been introduced into a cell such that the nucleotide sequence is integrated into the genome of the cell. Any protocol may be used for stable integration of a nucleic acid into the genome of a cell.

[0042] The term "targeting vector" refers to a recombinant nucleic acid that can be introduced by homologous recombination, non-homologous end joining mediated ligation, or any other means of recombination into a target location in the genome of a cell.

[0043] The term "viral vector" refers to a recombinant nucleic acid that contains at least one element of viral origin and contains elements sufficient for or permitting packaging into a viral vector particle. The vector and / or particle can be used to introduce DNA, RNA, or other nucleic acid into cells in vitro, ex vivo, or in vivo. Many forms of viral vectors are known.

[0044] The term "isolated" with respect to cells, tissues (e.g., brain slices), proteins, and nucleic acids includes cells, tissues (e.g., brain slices), proteins, and nucleic acids that are relatively purified with respect to other bacteria, viruses, cells, or other components that may normally be present in situ, including up to and including substantially pure preparations of cells, tissues (e.g., brain slices), proteins, and nucleic acids. The term "isolated" also includes cells, tissues, proteins, and nucleic acids that have no naturally occurring counterpart and have been chemically synthesized such that they are substantially free from other contaminating cells, tissues (e.g., brain slices), proteins, and nucleic acids, or that have been separated or purified from most other components (e.g., cellular components) that naturally accompany them (e.g., other cellular proteins, polynucleotides, or other components).

[0045] The term "wild-type" refers to an entity having a structure and / or activity as found in a normal state or context (as opposed to mutant, diseased, altered, etc.). Wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0046] The term "endogenous sequence" refers to a nucleic acid sequence that occurs naturally within a cell or organism. For example, an endogenous MAPT sequence of a cell or organism refers to the native MAPT sequence that occurs naturally at the MAPT locus of the cell or organism.

[0047] An "exogenous" molecule or sequence includes a molecule or sequence that is not normally present in a cell in that form. Normal presence includes presence with respect to a particular developmental stage and environmental conditions of a cell. An exogenous molecule or sequence may include, for example, a mutated version of a corresponding endogenous sequence in a cell, such as a humanized version of an endogenous sequence, or may include a sequence that is in a cell but corresponds to an endogenous sequence in a different form (i.e., not in a chromosome, or in a different location in a chromosome, or in a different chromosome, such as a human tau transgene randomly inserted into a genomic locus other than the endogenous MAPT locus). In contrast, an endogenous molecule or sequence includes a molecule or sequence that is normally present in that form, in a particular cell, at a particular developmental stage, and under a particular environmental condition.

[0048] The term "heterologous" when used in the context of a nucleic acid or a protein indicates that the nucleic acid or protein comprises at least two segments that do not naturally occur together in the same molecule. For example, the term "heterologous" when used in reference to a segment of a nucleic acid or a segment of a protein indicates that the nucleic acid or protein comprises two or more subsequences that are not found in the same relationship (e.g., linked together) to each other in nature. As an example, a "heterologous" region of a nucleic acid vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature. For example, a heterologous region of a nucleic acid vector can include a coding sequence adjacent to a sequence that is not found in association with the coding sequence in nature. Similarly, a "heterologous" region of a protein is a segment of amino acids within or attached to another peptide molecule that is not found in association with other peptide molecules in nature (e.g., a fusion protein, or a tagged protein). Similarly, a nucleic acid or protein can include a heterologous label or a heterologous secretion or localization sequence.

[0049] "Codon optimization" refers to the process of modifying a nucleic acid sequence for enhanced expression in a particular host cell by taking advantage of the degeneracy of codons, as indicated by the diversity of combinations of three base pairs of codons that specify amino acids, and generally by replacing at least one codon of the native sequence with a codon that is more or most frequently used in the host cell's genes while maintaining the native amino acid sequence. For example, a nucleic acid encoding a tau protein can be modified to replace a codon that has a higher frequency of use in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, or any other host cell, when compared to the naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example in "codon usage databases." These tables can be adapted in a variety of ways. See Nakamura et al. (2000) Nucleic Acids Res. 28:292, which is incorporated herein by reference in its entirety for all purposes. Computer algorithms are also available for codon optimization of a particular sequence for expression in a particular host (see, eg, Gene Forge).

[0050] The term "locus" refers to a specific location of a gene (or sequence of interest), DNA sequence, polypeptide coding sequence, or position on a chromosome of an organism's genome. For example, "MAPT locus" can refer to a specific location of the MAPT gene, a MAPT DNA sequence, a microtubule-associated protein tau coding sequence, or a MAPT position on a chromosome of an organism's genome identified with respect to where such a sequence resides. "MAPT locus" can include regulatory elements of the MAPT gene, including, for example, enhancers, promoters, 5' and / or 3' untranslated regions (UTRs), or combinations thereof.

[0051] The term "gene" refers to a DNA sequence in a chromosome that, when present in nature, may include at least one coding region and at least one non-coding region. A DNA sequence in a chromosome that codes for a product (e.g., but not limited to, an RNA product and / or a polypeptide product) may include coding regions interrupted by non-coding introns and sequences located adjacent to the coding region at both the 5' and 3' ends, such that the gene corresponds to a full-length mRNA (including 5' and 3' untranslated sequences). In addition, other non-coding sequences, including regulatory sequences (e.g., but not limited to, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences, and matrix attachment regions, may also be present in a gene. These sequences may be proximal (e.g., but not limited to, within 10 kb) or distant from the coding region of the gene, and they affect the level or rate of transcription and translation of the gene.

[0052] The term "allele" refers to variant forms of a gene. Some genes have a variety of different forms located at the same position, or locus, on a chromosome. Diploid organisms have two alleles at each locus. Each pair of alleles represents a genotype at a particular locus. A genotype is described as homozygous if there are two identical alleles at a particular locus, and as heterozygous if the two alleles are different.

[0053] A "promoter" is a regulatory region of DNA that typically contains a TATA box that can direct RNA polymerase II to begin RNA synthesis at the appropriate transcription initiation site for a particular polynucleotide sequence. A promoter may further contain other regions that affect the rate of transcription initiation. The promoter sequences disclosed herein regulate the transcription of operably linked polynucleotides. The promoter may be active in one or more cell types disclosed herein (e.g., human cells, pluripotent cells, one-cell stage embryos, differentiated cells, or combinations thereof). The promoter may be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., a developmentally regulated promoter), or a spatially restricted promoter (e.g., a cell-specific or tissue-specific promoter, such as a neuron-specific promoter like the sympathin-1 promoter). Examples of promoters can be found, for example, in WO2013 / 176772, which is incorporated herein by reference in its entirety for all purposes.

[0054] "Operable linkage" or "operably linked" includes the juxtaposition of two or more components (e.g., a promoter and another sequence element) that allows both components to function normally and allows the possibility that at least one of the components may mediate a function on at least one of the other components. For example, a promoter may be operably linked to a coding sequence if it controls the level of transcription of the coding sequence depending on the presence or absence of one or more transcriptional regulatory factors. Operable linkage may include such sequences being in close proximity to each other or acting in trans (e.g., regulatory sequences may act at a distance to control transcription of the coding sequence).

[0055] The term "variant" refers to a nucleotide sequence (eg, a single nucleotide) that differs from the most common sequence in a population, or a protein sequence (eg, a single amino acid) that differs from the most common sequence in a population.

[0056] The term "fragment", when referring to a protein, refers to a protein that is shorter or has fewer amino acids than the full-length protein. The term "fragment", when referring to a nucleic acid, refers to a nucleic acid that is shorter or has fewer nucleotides than the full-length nucleic acid. A fragment can be, for example, an N-terminal fragment (i.e., removal of a portion of the C-terminus of a protein), a C-terminal fragment (i.e., removal of a portion of the N-terminus of a protein), or an internal fragment (i.e., removal of a portion of each of the N-terminus and C-terminus of a protein). A fragment can be, for example, when referring to a nucleic acid fragment, a 5' fragment (i.e., removal of a portion of the 3' terminus of a nucleic acid), a 3' fragment (i.e., removal of a portion of the 5' terminus of a nucleic acid), or an internal fragment (i.e., removal of a portion of each of the 5' terminus and 3' terminus of a nucleic acid).

[0057] "Sequence identity" or "identity" in the context of two polynucleotide or polypeptide sequences refers to the residues of the two sequences that are the same when aligned for maximum correspondence over a particular comparison window. When using percentages of sequence identity with respect to proteins, residue positions that are not identical often differ by conservative amino acid substitutions, in which an amino acid residue is replaced with another amino acid residue that has similar chemical properties (e.g., charge or hydrophobicity), and thus does not change the functional properties of the molecule. When sequences differ by conservative substitutions, the percent sequence identity may be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known. Typically, this involves scoring conservative substitutions as partial mismatches rather than complete mismatches, thereby increasing the percentage sequence identity. Thus, for example, conservative substitutions are given a score of 0 to 1, where identical amino acids are given a score of 1 and non-conservative substitutions are given a score of 0. Scoring of conservative substitutions is calculated, for example, as implemented in the program PC / GENE (Intelligenetics, Mountain View, California).

[0058] "Percentage of sequence identity" includes values ​​determined by comparing two optimally aligned sequences (maximum number of perfectly matched residues) over a comparison window, where the portion of the polynucleotide sequence in the comparison window may contain additions or deletions (i.e., gaps) when compared to a reference sequence (not including additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base or amino acid residue occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Unless otherwise specified (e.g., the shorter sequence includes a concatenated non-homologous sequence), the comparison window is the full length of the shorter of the two sequences being compared.

[0059] Unless otherwise stated, sequence identity / similarity values ​​include values ​​obtained using GAP version 10 with the following parameters: nucleotide sequence % identity and % similarity using a GAP weight of 50 and a length weight of 3, and the nwsgapdna.cmp scoring matrix; amino acid sequence % identity and % similarity using a GAP weight of 8 and a length weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program. "Equivalent programs" include any sequence comparison program that produces alignments that have identical nucleotide or amino acid residue matches and identical percent sequence identity for any two sequences at issue when compared to corresponding alignments produced by GAP version 10.

[0060] The term "conservative amino acid substitution" refers to the replacement of an amino acid that is normally present in a sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the replacement of a non-polar (hydrophobic) residue, such as isoleucine, valine, or leucine, with another non-polar residue. Similarly, examples of conservative substitutions include the replacement of one polar (hydrophilic) residue with another, such as between arginine and lysine, between glutamine and asparagine, or between glycine and serine. In addition, the replacement of a basic residue, such as lysine, arginine, or histidine, with another, or the replacement of one acidic residue, such as aspartic acid or glutamic acid, with another acidic residue, are additional examples of conservative substitutions. Examples of non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue, e.g., isoleucine, valine, leucine, alanine, or methionine, for a polar (hydrophilic) residue, e.g., cysteine, glutamine, glutamic acid, or lysine, and / or a polar residue for a non-polar residue. Exemplary amino acid categories are summarized below. [Table 1]

[0061] A "homologous" sequence (e.g., a nucleic acid sequence) includes a sequence that is identical or substantially similar to a known reference sequence, e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the known reference sequence. Homologous sequences can include, for example, orthologous and paralogous sequences. For example, homologous genes typically originate from a common ancestral DNA sequence, either through a speciation event (orthologous genes) or a gene duplication event (paralogous genes). "Orthologous" genes include genes from different species that have evolved from a common ancestral gene by speciation. Orthologs typically retain the same function during evolution. "Paralogous" genes include genes that are related by duplication within a genome. Paralogs can evolve new functions during evolution.

[0062] The term "in vitro" includes an artificial environment and processes or reactions that occur within an artificial environment (e.g., a test tube or an isolated cell or cell line). The term "in vivo" includes a natural environment (e.g., a cell or organism or body) and processes or reactions that occur within a natural environment. The term "ex vivo" includes cells or tissues removed from an individual's body (e.g., brain slice cultures, such as organotypic brain slice cultures), and processes or reactions that occur within such cells.

[0063] The term "reporter gene" refers to a nucleic acid having a sequence encoding a gene product (typically an enzyme) that is easily and quantitatively assayed when a construct containing a reporter gene sequence operably linked to a heterologous promoter and / or enhancer element is introduced into a cell that contains (or can be made to contain) the factors necessary for activation of the promoter and / or enhancer element. Examples of reporter genes include, but are not limited to, the gene encoding beta-galactosidase (lacZ), the bacterial chloramphenicol acetyltransferase (cat) gene, the firefly luciferase gene, the gene encoding beta-glucuronidase (GUS), and genes encoding fluorescent proteins. "Reporter protein" refers to the protein encoded by the reporter gene.

[0064] The term "fluorescent reporter protein" as used herein means a reporter protein detectable based on fluorescence, which may be from either the reporter protein directly, the activity of the reporter protein on a fluorogenic substrate, or a protein with affinity for binding to a fluorescently tagged compound. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, and ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, and ZsYellowl), blue fluorescent proteins (e.g., BFP, eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, and T-sapphire), cyan fluorescent proteins (e.g., CFP, eCFP, Cerulean, CyPet, AmCyanl, and Midor, and the like). iishi-Cyan), red fluorescent proteins (e.g., RFP, mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, and Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, and tdTomato), and any other suitable fluorescent proteins whose presence within a cell can be detected by flow cytometry methods.

[0065] A composition or method that "comprising" or "including" one or more recited elements may include other elements not specifically recited. For example, a composition that "comprises" or "includes" a protein may include the protein alone or in combination with other ingredients. The transitional phrase "consisting essentially of" means that the claims are to be interpreted to include the specific elements recited in the claims, as well as elements that do not materially affect the basic and novel characteristics of the claimed invention. Thus, the term "consisting essentially of" when used in the claims of the present invention is not intended to be interpreted as equivalent to "comprising."

[0066] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not occur.

[0067] The specification of a range of values ​​includes every integer within or defining that range, and every subrange defined by integers within that range.

[0068] Unless otherwise clear from the context, the term "about" encompasses values ​​within the standard error (eg, SEM) of measurement of the stated value.

[0069] The term "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0070] The term "or" refers to any one member of a particular list and also includes any combination of members of that list.

[0071] The singular articles "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "protein" or "at least one protein" can include a plurality of proteins, including mixtures thereof.

[0072] Statistically significant means p≦0.05. [Mode for carrying out the invention]

[0073] I. Overview Tauopathies are a heterogeneous group of neurodegenerative conditions characterized by the deposition of abnormal tau protein in the brain. For example, in the brains of people with Alzheimer's disease, tau is abnormally hyperphosphorylated and appears to fibrillate into paired helical filaments (PHFs) that appear as neurofibrillary tangles (NFTs). Thus, intracellular aggregation of hyperphosphorylated tau in NFTs is the neuropathological hallmark of tauopathies.

[0074] To identify modifier genes that promote tau aggregation when disrupted, we performed a genome-wide screen. High-confidence hits emerged for two genes, BANF1 and PPP2CA, that contribute to the process of maintaining the integrity of the nuclear membrane. Examination of other proteins involved in this biological process identified one additional gene, ANKLE2, that enhances tau aggregation when disrupted.

[0075] Barrier-to-autointegration factor (BANF1 / BAF) connects chromatin to the nuclear membrane, and serine / threonine-protein phosphatase 2A catalytic subunit alpha isoform (PPP2CA) regulates BANF1 function. BANF1 is a small (10 kDa), abundant, and highly conserved DNA-binding protein. BANF1 is involved in multiple pathways including mitosis, nuclear assembly, viral infection, chromatin and gene regulation, and DNA damage response. BANF1 connects chromatin to the nuclear membrane and binds DNA in a sequence-independent manner. BANF1 also binds to the LEM (LAP2 / Emerin / MAN1) domain of one of the inner nuclear membrane (INM) proteins. BANF1 localization changes during the cell cycle.

[0076] During mitosis, the breakdown and remodeling of the nuclear envelope is controlled by protein phosphorylation. Phosphorylation of BANF1 by VRK1 upon entry into mitosis severs the link between chromatin, BANF1, and LEM proteins. BANF1 is distributed uniformly throughout the cell. When the nuclear envelope is reformed, ankyrin repeat and LEM domain-containing protein 2 (ANKLE2) inhibits VRK1 enzymatic activity. ANKLE2 also binds to PPP2CA and promotes its activity of dephosphorylating BANF1 so that it can reassociate with LEM proteins, chromatin, and the nuclear envelope. PPP2CA is the major tau phosphatase. PPP2CA can bind to tau-4RD and is associated with Alzheimer's disease.

[0077] Here, we reveal new models of tau aggregation for ex vivo and in vivo studies of tauopathy. These new models can combine, for example, mutations or reduced / inhibited expression of BANF1 and / or PPP2CA and / or ANKLE2 with existing models of tauopathy. Disclosed herein are improved tauopathy models (e.g., non-human animals, animal tissues, or animal cells), methods of using such improved tauopathy models to evaluate therapeutic candidates for the treatment of tauopathy, methods of making improved tauopathy models, and methods of accelerating or exacerbating tau aggregation in tauopathy models.

[0078] II. Improved tauopathy models Disclosed herein are tauopathy models that include genetic alterations or reduced / inhibited expression of BANF1, PPP2CA, or ANKLE2 to accelerate the formation of tau aggregates in cells and animals. Such tauopathy models may include, for example, genomes, cells, tissues, or animals that include microtubule-associated protein tau coding sequences and genetic alterations or reduced / inhibited expression of BANF1, PPP2CA, or ANKLE2 to accelerate the formation of tau aggregates in cells, allowing for better development of in vitro, ex vivo, and in vivo models of tauopathy. Particular examples include an animal (e.g., a non-human animal), an animal tissue (e.g., a non-human animal tissue), or an animal cell or a population of animal cells (e.g., a non-human animal cell or a plurality of cells), comprising: (a) a microtubule-associated protein tau coding sequence in one or more cells; and (b) (i) one or more or all of BANF1, PPP2CA, and ANKLE2 genetic modifications that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in one or more cells, respectively, and / or (ii) one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in one or more cells. The one or more cells can be any type of cell type. In one example, they are neuronal cells.

[0079] The animal, tissue, or cell population may have at least one sign or symptom of a tauopathy that is increased compared to an animal, tissue, or cell population that does not contain one or more genetic modifications of BANF1, PPP2CA, and ANKLE2, or does not contain one or more agents that reduce the expression of one or more of BANF1, PPP2CA, and ANKLE2. Such signs and symptoms are discussed in more detail elsewhere herein and can include, for example, tau hyperphosphorylation and tau aggregation. Other signs and symptoms can include, for example, increased tau and / or phosphotau in insoluble fraction after cell fractionation, increased phosphotau in somatodendritic compartment of neurons, increased phosphotau in perinuclear region of neurons, decreased nuclear to cytoplasmic ratio of nuclear pore complex protein Nup98-Nup96 (Nup98) in neurons, decreased nuclear to cytoplasmic ratio of GTP-binding nuclear protein Ran (Ran) in neurons, or decreased nuclear to cytoplasmic ratio of Ran GTPase activating protein 1 (RanGAP1) in neurons.Phosphotau can be, for example, phosphotau (S356) or phosphotau AT8 (S202, T205).

[0080] The microtubule-associated protein tau coding sequence is one that is expressed in one or more cells. The tau coding sequence can be endogenous or exogenous, and it can code for wild-type tau protein or tau protein containing mutations (e.g., tauopathy-associated mutations or tau pathogenic mutations). The tau coding sequence can code for human microtubule-associated protein tau, such as exogenous human microtubule-associated protein tau. The coding sequence can include both coding and non-coding sequences (e.g., exons and introns), or can include complementary DNA (cDNA) sequences. The coding sequence can optionally be codon-optimized for expression in animals, tissues, or cells (e.g., codon-optimized for expression in human or mouse cells).

[0081] The tau coding sequence may be integrated into the genome or may be extrachromosomal. When integrated into the genome, the coding sequence may be integrated into the genome randomly (transgenic) or integrated into a targeted genomic locus in a targeted manner. The coding sequence may be present in all cells of an animal, tissue, or population of cells, or may be present in a portion of cells (e.g., neurons) or may be integrated into the genome. An animal containing a genomically integrated sequence may contain a genomically integrated sequence in its germline.

[0082] The tau coding sequence can be operably linked to a promoter, such as a heterologous promoter. The promoter can be endogenous or exogenous to a cell, tissue, or animal. As a specific example, the promoter can be a prion protein promoter, such as a mouse prion protein promoter. As another example, the promoter can be a neuron-specific promoter. Examples of neuron-specific promoters are well known and include, for example, the synapsin-1 promoter (e.g., the human synapsin-1 promoter or the mouse synapsin-1 promoter).

[0083] The microtubule-associated protein tau may be any tau isoform. In one particular example, the tau coding sequence encodes the 1N4R isoform. The microtubule-associated protein tau may be a wild-type tau protein or may include a mutation, such as a tauopathy-associated mutation or a tau pathogenic mutation. Examples of such mutations are well known and are discussed in more detail elsewhere herein. In one particular example, the tau includes a P301S mutation (optionally, the tau coding sequence is operably linked to a mouse prion protein promoter). In another particular example, the tau includes an A152T / P301L / S320F triple mutation (optionally, the tau coding sequence is operably linked to a sympathin-1 promoter). The DNA and protein sequences of 3MUT tau 1N4R (A152T, P301L, S320F) are set forth in SEQ ID NOs: 83 and 84, respectively.

[0084] Examples of agents that can reduce expression of BANF1, PPP2CA, or ANKLE2 include nuclease agents (e.g., ZFN, TALEN, or CRISPR / Cas), DNA binding proteins fused to transcriptional repressors (e.g., transcriptional repressors such as catalytically inactive Cas fused to KRAB (dCas-KRAB)), or antisense oligonucleotides, siRNAs, shRNAs, or antisense RNAs. Examples of these are discussed in more detail elsewhere herein.

[0085] BANF1 (also called BAF, BCRG1, BCRP1, and L2BP1) encodes barrier to self-integration factor (also called breakpoint cluster region protein 1 and LAP2-binding protein 1). It plays a fundamental role in nuclear assembly, chromatin organization, gene expression, and gonadal development, strongly compacting the structure of chromatin and may be involved in membrane recruitment and chromatin decondensation during nuclear assembly. Exemplary human barrier to self-integration factor proteins have been assigned accession numbers NP_001137457.1 and NP_003851.1 (NCBI) and O75531 (UniProt). Exemplary human BANF1 mRNA is designated by NCBI accession numbers NM_001143985.1 and NM_003860.3. Exemplary human BANF1 coding sequence is designated by CCDS ID CCDS8125.1. An exemplary human BANF1 gene is designated by NCBI RefSeq GeneID8815. An exemplary mouse self-integration barrier factor protein is assigned accession numbers NP_001033320.1, NP_001273537.1, and NP_035923.1 (NCBI) and O54962 (UniProt). An exemplary mouse Banf1 mRNA is designated by NCBI accession numbers NM_001038231.2, NM_001286608.1, and NM_011793.3. An exemplary mouse Banf1 coding sequence is designated by CCDS ID CCDS29458.1. An exemplary mouse Banf1 gene is designated by NCBI RefSeq GeneID23825. Exemplary rat self-integration barrier factor proteins are assigned accession numbers NP_446083.1 (NCBI) and Q9R1T1 (UniProt). Exemplary rat Banf1 mRNA is designated by NCBI accession number NM_053631.3. Exemplary rat Banf1 gene is designated by NCBI RefSeq GeneID114087.

[0086] PPP2CA encodes serine / threonine protein phosphatase 2A catalytic subunit alpha isoform (also called PP2A-alpha, replication protein C, RP-C, protein phosphatase 2, protein phosphatase 2A, or PP2A). PP2A is the major phosphatase of microtubule-associated proteins (MAPs). PP2A can regulate the activity of phosphorylase B kinase casein kinase 2, mitogen-stimulated S6 kinase, and MAP-2 kinase. Exemplary human serine / threonine protein phosphatase 2A catalytic subunit alpha isoform proteins have been assigned accession numbers NP_002706.1 (NCBI) and P67775 (UniProt). Exemplary human PPP2CA mRNA is designated by NCBI accession number NM_002715.2. Exemplary human PPP2CA coding sequences are designated by CCDS ID CCDS4173.1. An exemplary human PPP2CA gene is designated by NCBI RefSeq GeneID5515. An exemplary mouse serine / threonine protein phosphatase 2A catalytic subunit alpha isoform protein is assigned the accession numbers NP_062284.1 (NCBI) and P63330 (UniProt). An exemplary mouse Ppp2ca mRNA is designated by NCBI accession number NM_019411.4. An exemplary mouse Ppp2ca coding sequence is designated by CCDS ID CCDS24666.1. An exemplary mouse Ppp2ca gene is designated by NCBI RefSeq GeneID19052. An exemplary rat serine / threonine protein phosphatase 2A catalytic subunit alpha isoform protein is assigned the accession numbers NP_058735.1 (NCBI) and P63331 (UniProt). An exemplary rat Ppp2ca mRNA is designated by NCBI accession number NM_017039.2. An exemplary rat Ppp2ca gene is designated by NCBI RefSeq GeneIDs 24672 and 103694903.

[0087] ANKLE2 (also called KIAA0692, LEM4, and D5Ertd585e) encodes ankyrin repeat and LEM domain-containing protein 2 (also called LEM domain-containing protein 4 and liver regeneration-related protein LRRG057). It participates in mitotic nuclear envelope remodeling by promoting dephosphorylation of BAF / BANF1 at the end of mitosis. It coordinates the control of dephosphorylation of BAF / BANF1 by inhibiting VRK1 kinase and promoting dephosphorylation of BAF / BANF1 by protein phosphatase 2A (PP2A), thereby promoting nuclear envelope assembly. Exemplary human ankyrin repeat and LEM domain-containing protein 2 proteins have been assigned the accession numbers NP_055929.1 (NCBI) and Q86XL3 (UniProt). Exemplary human ANKLE2 mRNA is designated by NCBI accession number NM_015114.2. Exemplary human ANKLE2 coding sequence is designated by CCDS ID CCDS41869.1. Exemplary human ANKLE2 gene is designated by NCBI RefSeq GeneID23141. Exemplary mouse ankyrin repeat and LEM domain-containing protein 2 protein is assigned accession numbers NP_001240743.1 and NP_082198.1 (NCBI) and Q6P1H6 (UniProt). Exemplary mouse Ankle2 mRNA is designated by NCBI accession numbers NM_001253814.1 and NM_027922.2. Exemplary mouse Ankle2 coding sequence is designated by CCDS ID CCDS57372.1 and CCDS80360.1. An exemplary mouse Ankle2 gene is designated by NCBI RefSeq GeneID 71782. An exemplary rat ankyrin repeat and LEM domain-containing protein 2 protein has been assigned the accession numbers NP_001041366.1 (NCBI) and Q7TP65 (UniProt).An exemplary rat Ankle2 mRNA is designated by NCBI accession number NM_001047901.1. An exemplary rat Ankle2 gene is designated by NCBI RefSeq GeneID360829.

[0088] Various models of tauopathy have been developed. Any of these models can be adapted as disclosed herein by mutating or inhibiting / reducing the expression of BANF1 and / or PPP2CA and / or ANKLE2. These include cell / cell culture models (non-neuronal cell lines, neuronal cell lines such as PC12, SY5Y, CN1.4 cells, or primary neuronal cells), tissue models (e.g., brain slice cultures such as organotypic brain slice cultures), and whole animal transgenic models (e.g., C.elegans, Drosophila, zebrafish, or mice). See, for example, Hall et al. (2005) Biochim.Biophys.Acta 1739:224-239, Brandt et al. (2005) Biochim.Biophys.Acta 1739:331-354, and Lee et al. (2005) Biochim.Biophys.Acta 1739:251-259, each of which is incorporated herein by reference in its entirety for all purposes.Typically, such models are transgenic models in which wild-type or mutant human tau isoforms are overexpressed under the control of various promoters to cause neurofibrillary tangles.Cell-based models have the advantage of being more accessible and flexible to manipulate, while whole animal models (such as transgenic mouse models) are more complete and more directly related to human disease.

[0089] The animal, tissue, or cell population can be male or female. The cell population can be in vitro, ex vivo, or in vivo. Similarly, the tissue can be ex vivo or in vivo. In one particular example, the tissue can be a brain slice (e.g., a brain slice culture, such as an organotypic brain slice culture).

[0090] The population of cells can be any type of cell. The cells can be monoclonal cell lines or populations of cells. The cells can be from any source. Such cells can be derived from model organisms such as nematodes, fruit flies, zebrafish, etc. Such cells can be fish or bird cells, or such cells can be mammalian cells, such as human cells, non-human mammalian cells, rodent cells, mouse cells, or rat cells. Mammals include, for example, humans, non-human primates, monkeys, apes, cats, dogs, horses, bulls, deer, bison, sheep, rodents (e.g., mice, rats, hamsters, guinea pigs), livestock (e.g., bovine species such as cows and steers, ovine species such as sheep and goats, porcine species such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, and ducks. Domestic and agricultural animals are also included. The term "non-human animals" excludes humans. In particular examples, the cell is a human cell (eg, a HEK293T cell or a neuronal cell) or a mouse cell (eg, a neuronal cell).

[0091] The cell can be, for example, a totipotent or pluripotent cell (e.g., an embryonic stem (ES) cell, such as a rodent ES cell, a mouse ES cell, or a rat ES cell). A totipotent cell includes an undifferentiated cell that can give rise to any cell type, and a pluripotent cell includes an undifferentiated cell that has the ability to develop into multiple differentiated cell types. Such a pluripotent and / or totipotent cell can be, for example, an ES cell or an ES-like cell, such as an induced pluripotent stem (iPS) cell. An ES cell includes an embryo-derived totipotent or pluripotent cell that can contribute to any tissue of the developing embryo when introduced into the embryo. An ES cell can be derived from the inner cell mass of a blastocyst and can differentiate into any cell of the three vertebrate germ layers (endoderm, ectoderm, and mesoderm).

[0092] The cells may also be primary somatic cells, or cells that are not primary somatic cells. Somatic cells may include any cells that are not gametes, germ cells, gamete cells, or undifferentiated stem cells. The cells may also be primary cells. Primary cells include cells or cultures of cells that are directly isolated from an organism, organ, or tissue. Primary cells include cells that are not transformed or immortalized. They include any cells obtained from an organism, organ, or tissue that have not previously been passaged in tissue culture, or that have previously been passaged in tissue culture but cannot be passaged indefinitely in tissue culture. Such cells may be isolated by conventional techniques and include, for example, neurons. For example, primary cells may be derived from nervous system tissue (e.g., primary neurons, such as primary mouse neurons).

[0093] Such cells include those that do not normally proliferate indefinitely, but due to mutations or modifications, can avoid normal cellular senescence and continue to divide instead. Such mutations or modifications can occur naturally or can be induced intentionally. Examples of immortalized cells include Chinese hamster ovary (CHO) cells, human embryonic kidney cells (e.g., HEK293T cells), and mouse embryonic fibroblast cells (e.g., 3T3 cells). Many types of immortalized cells are well known. Immortalized or primary cells typically include cells used for culturing or expressing recombinant genes or proteins. Examples of neuronal cell lines include rat PC12 pheochromocytoma, human SH-SY5Y neuroblastoma cells, human N-Tera 2 (NTERA-2 or NT2) teratocarcinoma cells, H4 human glioma cells, human neuronal BE(2)-M17D cells, C1.4 mouse cortical neurons, or HCN2A human cortical neurons.

[0094] The cells can also be differentiated cells, such as neural cells (e.g., human neural cells). Such neural cells can be primary neural cells (e.g., mouse primary neural cells), neurons derived from induced pluripotent stem (iPS) cells, such as human iPS cells, or neurons derived from embryonic stem (ES) cells (e.g., mouse ES cells). For example, the cells can be iCELL GABA neurons, which are a highly pure population of human neurons derived from iPS cells. They are a mixture of postmitotic neural subtypes, composed primarily of GABAergic neurons, and exhibit typical physiological properties and responses.

[0095] The non-human animals described herein can be produced by methods described elsewhere herein. The term "animal" includes any member of the animal kingdom, including, for example, mammals, fish, reptiles, amphibians, birds, and worms. The animal can be, for example, a fruit fly, a nematode, or a zebrafish. In certain examples, the non-human animal is a non-human mammal. Non-human mammals include, for example, non-human primates, monkeys, apes, orangutans, cats, dogs, horses, bulls, deer, bison, sheep, rabbits, rodents (e.g., mice, rats, hamsters, and guinea pigs), and livestock (e.g., bovine species such as cows and steers, ovine species such as sheep and goats, and porcine species such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, and ducks. Domestic and agricultural animals are also included. The term "non-human animal" excludes humans. Preferred non-human animals include, for example, rodents such as mice and rats.

[0096] The non-human animal may be from any genetic background. For example, suitable mice may be from the 129 strain, the C57BL / 6 strain, a hybrid of 129 and C57BL / 6, the BALB / c strain, or the Swiss Webster strain. Examples of 129 strains include 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / Svlm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, and 129T2. See, for example, Festing et al. (1999) Mammalian Genome 10:836, which is incorporated herein by reference in its entirety for all purposes. Examples of C57BL strains include C57BL / A, C57BL / An, C57BL / GrFa, C57BL / Kal_wN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. Suitable mice may also be from a hybrid of the aforementioned 129 strain and the aforementioned C57BL / 6 strain (e.g., 50% 129 and 50% C57BL / 6). Similarly, suitable mice may be from a hybrid of the aforementioned 129 strain or a hybrid of the aforementioned BL / 6 strain (e.g., 129S6 (129 / SvEvTac) strain).

[0097] Similarly, the rats may be from, for example, the ACI rat strain, the Dark Agouti (DA) rat strain, the Wistar rat strain, the LEA rat strain, the Sprague Dawley (SD) rat strain, or a Fisher rat strain such as Fisher F344 or Fisher F6. Rats may also be obtained from strains derived from crosses of two or more of the above-mentioned strains. For example, suitable rats may be from the DA strain or the ACI strain. The ACI rat strain has a white belly and feet, and an RT1 av1The Dark Agouti (DA) rat strain is characterized by the presence of the black agouti haplotype. Such strains are available from a variety of sources, including Harlan Laboratories. The Dark Agouti (DA) rat strain has the agouti coat and the RT1 haplotype. av1 The rat is characterized by having haplotype.Such rats can be obtained from various sources, including Charles River and Harlan Laboratories.Some suitable rats can be derived from inbred rat strains.See, for example, US2014 / 0235933, the entirety of which is incorporated herein by reference for all purposes.

[0098] In one particular example, the mouse strain is the PS19 (TauP301S (line PS19); PS19Tg; B6; C3-Tg (Prnp-MAPT*P301S) PS19Vle / J) line. The genetic background of this line is C57BL / 6xC3H. PS19 transgenic mice express mutant human microtubule-associated protein Tau MAPT driven by the mouse prion protein (Prnp) promoter. The transgene encodes the disease-associated P301S mutation and contains four microtubule-binding domains and one N-terminal insert (4R / 1N). The transgene was inserted into Chr3:140354280-140603283 (build GRCm38 / mm10), resulting in a 249Kb deletion that does not affect any known genes. See Goodwin et al. (2019) Genome Res. 29(3):494-505, which is incorporated by reference in its entirety for all purposes. Expression of mutant human tau is 5-fold higher than that of the endogenous mouse protein. See Yoshiyama et al. (2007) Neuron 53(3):337-351, which is incorporated by reference in its entirety for all purposes. PS19 mice develop neuronal loss and brain atrophy by 8 months of age. They also develop extensive tau aggregates, known as neurofibrillary tangle-like inclusions, in the neocortex, amygdala, hippocampus, brainstem, and spinal cord. See Yoshiyama et al. (2007). Prior to the appearance of overt tau pathology by histological methods, the brains of these mice have been shown to exhibit tau seeding activity. That is, tau aggregates present in brain homogenates can induce further tau aggregation, possibly via a prion-like mechanism. See Holmes (2014) Proc. Natl. Acad. Sci. USA 111(41):E4376-E4385, which is incorporated by reference in its entirety for all purposes.

[0099] A. Tau and Tauopathies The microtubule-associated protein tau (also called neurofibrillary tangle protein, paired helical filament-tau (PHF-tau), or tau) is a protein that promotes microtubule assembly and stability, and is expressed primarily in neurons, where it preferentially localizes to the axonal compartment. Tau is encoded by the MAPT gene (also called MAPTL, MTBT1, TAU, or MTAPT). Tau plays a role in stabilizing neuronal microtubules and thus promoting axonal outgrowth. In humans, it appears as a set of six isoforms that are differentially spliced ​​from the transcript of a single gene located on chromosome 17. Each tau isoform contains a series of 3 / 4 tandem repeat units (depending on the isoform) that bind to and stabilize microtubules. The microtubule-binding repeat region of tau is adjacent to a serine / threonine-rich region that is phosphorylated by various kinases and is associated with hyperphosphorylation of tau in Alzheimer's disease (AD) and a family of related neurodegenerative disorders called tauopathies.

[0100] The tau protein in the model and method disclosed herein can be the tau protein from any animal or mammal, such as human, mouse, or rat.In one particular example, tau is derived from human tau protein.Exemplary human tau protein is assigned UniProt accession number P10636 and GeneID4137.Exemplary human tau protein is assigned UniProt accession number P10637 and GeneID17762.Exemplary human tau protein is assigned UniProt accession number P19332.

[0101] Tau protein is the product of alternative splicing from a single gene, called MAPT (microtubule-associated protein tau) in humans. The tau repeat domain carries sequence motifs involved in aggregation (i.e., it is the aggregation-prone domain from tau). Depending on the splicing, the repeat domain of tau protein has either three or four repeat regions that constitute the aggregation-prone core of the protein, which are often referred to as repeat domains (RDs). Specifically, the repeat domain of tau represents the core of the microtubule-binding region and harbors the R2 and R3 hexapeptide motifs involved in tau aggregation. In the human brain, there are six tau isoforms ranging from 352 to 441 amino acids in length. These isoforms vary at the carboxyl terminus according to the presence or absence of one or two insert domains at the amino terminus, as well as the presence of either three repeat domains or four repeat domains (R1-R4). The repeat domain located in the carboxyl-terminal half of tau is believed to be important for microtubule binding as well as the pathological aggregation of tau into paired helical filaments (PHFs), which are the core components of the neurofibrillary tangles seen in tauopathies. Exemplary sequences of the four repeat domains (R1-R4) are provided in SEQ ID NOs: 88-91, respectively. Exemplary coding sequences of the four repeat domains (R1-R4) are provided in SEQ ID NOs: 92-95. An exemplary sequence of the tau4 repeat domain is provided in SEQ ID NO: 96. An exemplary coding sequence of the tau4 repeat domain is provided in SEQ ID NO: 97. An exemplary sequence of the tau4 repeat domain with a P301S mutation is provided in SEQ ID NO: 98. An exemplary coding sequence of the tau4 repeat domain with a P301S mutation is provided in SEQ ID NO: 99.

[0102] Tauopathies are a heterogeneous group of neurodegenerative conditions characterized by abnormal tau deposition in the brain. These include, for example, Alzheimer's disease, Down's syndrome, Pick's disease, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17). In AD and other tauopathies, tau protein is abnormally hyperphosphorylated and aggregates into bundles of filaments (paired helical filaments) that appear as neurofibrillary tangles.

[0103] There are several tau pathogenic mutations, such as pro-aggregation mutations, that are associated with (e.g., segregate with) or cause tauopathy. Pathogenic tau mutations, which may be either exonic or intronic, generally alter the relative production of tau isoforms, which may result in changes in microtubule assembly and / or the propensity of tau to aggregate. As an example, the mutation may be an aggregation-sensitizing mutation that sensitizes tau to seeding but does not result in tau easily aggregating by itself. For example, the mutation may be a disease-associated P301S mutation. By P301S mutation, we mean the human tau P301S mutation, or the corresponding mutation of another tau protein when optimally aligned with the human tau protein. Other pathogenic tau mutations include, for example, A152T, G272V, K280del, P301L, S320F, V337M, R406W, P301L / V337M, K280del / I227P / I308P, G272V / P301L / R406W, and A152T / P301L / S320F. See alzforum.org / mutations / mapt, Brandt et al. (2005) Biochim. Biophys. Acta 1739:331-354, and Wolfe (2009) J. Biol. Chem. 284(10):6021-6025, each of which is incorporated herein by reference in its entirety for all purposes. The DNA and protein sequences of wild-type Tau1N4R are set forth in SEQ ID NOs: 81 and 82, respectively. The DNA and protein sequences of 3MUT Tau1N4R (A152T, P301L, S320F) are set forth in SEQ ID NOs: 83 and 84, respectively.

[0104] Some examples of signs and symptoms of tauopathy at the cellular level include hyperphosphorylation of tau (e.g., in the somatodendritic compartment of neurons, because it is generally considered an axonal protein, tau is found in the dendritic compartment of degenerating neurons, and this redistribution is thought to trigger the neurodegeneration of Alzheimer's disease), tau aggregation, abnormal shape of the nuclear lamina, and impaired nucleocytoplasmic transport. Other signs and symptoms at the organismal level may include neurofibrillary tangles (e.g., in the neocortex, amygdala, hippocampus, brainstem, or spinal cord), neuronal loss (e.g., in the hippocampus, amygdala, or neocortex), microgliosis, synaptic loss, cognitive impairment, or motor impairment. Other signs and symptoms can include, for example, increased tau and / or phosphotau in insoluble fraction after cell fractionation, increased phosphotau in somatodendritic compartment of neurons, increased phosphotau in perinuclear region of neurons, decreased nuclear to cytoplasmic ratio of nuclear pore complex protein Nup98-Nup96 (Nup98) in neurons, decreased nuclear to cytoplasmic ratio of GTP-binding nuclear protein Ran (Ran) in neurons, or decreased nuclear to cytoplasmic ratio of Ran GTPase activating protein 1 (RanGAP1) in neurons.Phosphotau can be, for example, phosphotau (S356) or phosphotau AT8 (S202, T205).

[0105] B. Agents for reducing the expression of BANF1, PPP2CA, or ANKLE2 Any suitable agent can be used to reduce or inhibit the expression of BANF1, PPP2CA or ANKLE2. Examples of agents that can reduce the expression of BANF1, PPP2CA or ANKLE2 include nuclease agents (e.g., ZFN, TALEN, or CRISPR / Cas), DNA binding proteins fused to transcriptional repressors (e.g., transcriptional repressors such as catalytically inactive / dead Cas (dCas) fused to KRAB domain (dCas-KRAB)), or antisense oligonucleotides, siRNAs, shRNAs, or antisense RNAs. Other examples of agents that can reduce expression of BANF1, PPP2CA, or ANKLE2 include nuclease agents (e.g., ZFN, TALEN, or CRISPR / Cas), DNA binding proteins fused to transcriptional repressors (e.g., transcriptional repressors such as catalytically inactive / dead Cas (dCas) fused to a KRAB domain (dCas-KRAB)), or nucleic acids encoding antisense oligonucleotides, siRNAs, shRNAs, or antisense RNAs. Examples of these are described in more detail below.

[0106] 1. Nucleases and transcriptional repressors Nuclease agents can be used to reduce the expression of BANF1, PPP2CA, or ANKLE2. For example, such nuclease agents can be designed to target and cleave a region of the BANF1, PPP2CA, or ANKLE2 gene that disrupts the expression of the BANF1, PPP2CA, or ANKLE2 gene. As a specific example, the nuclease agent can be designed to cleave a region of BANF1, PPP2CA, or ANKLE2 near the start codon. For example, the target sequence can be within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon, and cleavage by the nuclease agent can destroy the start codon. Alternatively, a nuclease agent designed to cleave a region near the start codon and the stop codon can be used to delete the coding sequence between two nuclease target sequences. A DNA binding protein fused to a transcriptional repressor domain can also be used to reduce expression of BANF1, PPP2CA, or ANKLE2. For example, a DNA binding protein fused to a transcriptional repressor domain (e.g., a catalytically inactive Cas fused to a KRAB transcriptional repressor domain) can be designed to target a region of BANF1, PPP2CA, or ANKLE2 near the start codon, e.g., within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon).

[0107] Cleavage by nuclease agents can cause double-stranded breaks that can be repaired by non-homologous end joining (NHEJ). NHEJ involves the repair of double-stranded breaks in nucleic acids by directly ligating the cut ends to each other or to exogenous sequences without the need for a homologous template. Ligation of non-adjacent sequences by NHEJ can often result in deletions, insertions, or translocations near the site of the double-stranded break. These insertions and deletions (indels) can disrupt the expression of target genes, for example, through frameshift mutations or disruption of start codons.

[0108] Any nuclease agent that induces a nick or double-stranded break at a desired recognition site can be used in the methods and compositions disclosed herein. Naturally occurring or natural nuclease agents can be used as long as the nuclease agent induces a nick or double-stranded break at a desired recognition site. Alternatively, modified or engineered nuclease agents can be used. An "engineered nuclease agent" includes a nuclease that has been engineered (modified or derived) from its natural form to specifically recognize and induce a nick or double-stranded break at a desired recognition site. Thus, an engineered nuclease agent can be derived from a natural naturally occurring nuclease agent, or can be artificially created or synthesized. An engineered nuclease can, for example, induce a nick or double-stranded break at a recognition site that is not a sequence that would be recognized by a natural (non-engineered or unmodified) nuclease agent. The modification of the nuclease agent can be as little as one amino acid in a protein cleavage agent or one nucleotide in a nucleic acid cleavage agent. Creating a nick or double-stranded break in the recognition site or other DNA can be referred to herein as "cutting" or "cleaving" the recognition site or other DNA.

[0109] Also provided are active variants and fragments of the exemplified recognition sites.Such active variants can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with a given target sequence, and active variants retain biological activity and can therefore be recognized and cut by nuclease agents in a sequence-specific manner.The assay for measuring double-stranded cuts of recognition sites by nuclease agents is known in the art (e.g., TaqMan® qPCR assay, Frendewey et al. (2010) Methods in Enzymology 476:295-307, which is incorporated herein by reference in its entirety for all purposes).

[0110] The recognition site for the nuclease agent can be located anywhere in or near the target locus. The recognition site may be located within the coding region of the gene or within a regulatory region that affects the expression of the gene (e.g., near the start codon). The recognition site for the nuclease agent may be located in an intron, exon, promoter, enhancer, regulatory region, or any non-protein coding region. Alternatively, the recognition site can be located within a polynucleotide that encodes a selection marker. Such a location can be located within the coding region or within a regulatory region of the selection marker, which affects the expression of the selection marker. Thus, the recognition site for the nuclease agent may be located in an intron, promoter, enhancer, regulatory region, or any non-protein coding region of the polynucleotide that encodes the selection marker. A nick or double-strand break at the recognition site may destroy the activity of the selection marker, and methods are known for assaying the presence or absence of a functional selection marker.

[0111] One type of nuclease agent is the transcription activator-like effector nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of prokaryotes or eukaryotes. TAL effector nucleases are created by fusing natural or engineered transcription activator-like (TAL) effectors, or functional parts thereof, to the catalytic domain of an endonuclease, such as, for example, FokI. The unique modular TAL effector DNA binding domain allows the design of proteins with specific DNA recognition specificity. Thus, the DNA binding domain of the TAL effector nuclease can be engineered to recognize specific DNA target sites and thus can be used to make double-strand breaks at desired target sequences. See WO2010 / 079430, Morbitzer et al. (2010) Proc. Natl. Acad. Sci. USA 107(50):21617-21622, Scholze & Boch (2010) Virulence 1:428-432, Christian et al. Genetics (2010) 186:757-761, Li et al. (2010) Nucleic Acids Res. (2011) 39(1):359-372, and Miller et al. (2011) Nature Biotechnology 29:143-148, each of which is incorporated by reference in its entirety for all purposes.

[0112] Examples of suitable TAL nucleases and methods for preparing suitable TAL nucleases are disclosed, for example, in US2011 / 0239315A1, US2011 / 0269234A1, US2011 / 0145940A1, US2003 / 0232410A1, US2005 / 0208489A1, US2005 / 0026157A1, US2005 / 0064474A1, US2006 / 0188987A1, and US2006 / 0063231A1, each of which is incorporated by reference in its entirety for all purposes. In various embodiments, for example, TAL effector nucleases are engineered that cleave within or near a target nucleic acid sequence at a locus of interest or a genomic locus of interest, where the target nucleic acid sequence is at or near a sequence modified by a targeting vector. TAL nucleases suitable for use in the various methods and compositions provided herein include those specifically designed to bind to or near a target nucleic acid sequence that is modified by the targeting vectors described herein.

[0113] In some TALENs, each monomer of the TALEN contains 33-35 TAL repeats that recognize a single base pair through two hypervariable residues. In some TALENs, the nuclease agent is a chimeric protein that includes a TAL repeat-based DNA binding domain operably linked to an independent nuclease, such as a FokI endonuclease. For example, the nuclease agent can include a first TAL repeat-based DNA binding domain and a second TAL repeat-based DNA binding domain, each of the first and second TAL repeat-based DNA binding domains operably linked to a FokI nuclease, the first and second TAL repeat-based DNA binding domains recognize two adjacent target DNA sequences in each strand of the target DNA sequence separated by spacer sequences of various lengths (12-20 bp), and the FokI nuclease subunits dimerize to create an active nuclease that makes a double-stranded break in the target sequence.

[0114] The nuclease agent used in the various methods and compositions disclosed herein can further include a zinc finger nuclease (ZFN). In some ZFNs, each monomer of the ZFN includes three or more zinc finger-based DNA binding domains, and each zinc finger-based DNA binding domain binds to a 3 bp subsite. In other ZFNs, the ZFN is a chimeric protein that includes a zinc finger-based DNA binding domain operably linked to an independent nuclease, such as a FokI endonuclease. For example, the nuclease agent can include a first ZFN and a second ZFN, each of the first and second ZFNs operably linked to a FokI nuclease subunit, the first and second ZFNs recognize two adjacent target DNA sequences in each strand of the target DNA sequence separated by a spacer of about 5-7 bp, and the FokI nuclease subunits dimerize to generate an active nuclease that performs a double-stranded break. See, e.g., US2006 / 0246567, US2008 / 0182332, US2002 / 0081614, US2003 / 0021776, WO / 2002 / 057308A2, US2013 / 0123484, US2010 / 0291048, WO / 2011 / 017293A2, and Gaj et al. (2013) Trends Biotechnology, 31(7):397-405, each of which is incorporated by reference in its entirety for all purposes.

[0115] Also provided are active variants and fragments of nuclease agents (i.e. engineered nuclease agents). Such active variants may have at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the native nuclease agent, and the active variants retain the ability to cleave at a desired recognition site, and thus retain nick or double-strand break inducing activity. For example, any of the nuclease agents described herein may be modified from the native endonuclease sequence and designed to recognize and induce a nick or double-strand break at a recognition site that was not recognized by the native nuclease agent. Thus, some engineered nucleases have the specificity to induce a nick or double-strand break at a recognition site that is different from the corresponding native nuclease agent recognition site. Assays for nick or double-strand break inducing activity are known and generally measure the overall activity and specificity of an endonuclease on a DNA substrate that contains a recognition site.

[0116] The nuclease agent may be introduced into the cell by any known means. The polypeptide encoding the nuclease agent may be directly introduced into the cell. Alternatively, the polynucleotide encoding the nuclease agent may be introduced into the cell. When the polynucleotide encoding the nuclease agent is introduced into the cell, the nuclease agent may be expressed in the cell transiently, conditionally, or constitutively. Thus, the polynucleotide encoding the nuclease agent may be included in an expression cassette and may be operably linked to a conditional promoter, an inducible promoter, a constitutive promoter, or a tissue-specific promoter. Such promoters of interest are discussed in more detail elsewhere herein. Alternatively, the nuclease agent is introduced into the cell as an mRNA encoding the nuclease agent.

[0117] The polynucleotide encoding the nuclease agent can be stably integrated into the genome of the cell and operably linked to a promoter active in the cell. Alternatively, the polynucleotide encoding the nuclease agent can be in a targeting vector (e.g., the targeting vector that contains the insert polynucleotide, or a vector or plasmid that is separate from the targeting vector that contains the insert polynucleotide).

[0118] When a nuclease agent is provided to a cell by introducing a polynucleotide that codes for a nuclease agent, such a polynucleotide that codes for a nuclease agent can be modified to replace the codons that have a higher frequency of use in a cell of interest, compared to the polynucleotide sequence that codes for a naturally occurring nuclease agent.For example, a polynucleotide that codes for a nuclease agent can be modified to replace the alternative codons that are more frequently used in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest, compared to the polynucleotide sequence that codes for a naturally occurring nuclease agent.

[0119] CRISPR / Cas system. The methods and compositions disclosed herein can utilize a clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) system or components of such a system to modify genomes or alter the expression of genes in cells. CRISPR / Cas systems include transcripts and other elements that are involved in the expression of or direct the activity of Cas genes. CRISPR / Cas systems can be, for example, type I, type II, type III systems, or type V systems (e.g., subtype VA or subtype VB). The methods and compositions disclosed herein can employ CRISPR / Cas systems by utilizing a CRISPR complex (including a guide RNA (gRNA) complexed with a Cas protein) for site-specific binding or cleavage of nucleic acids.

[0120] The CRISPR / Cas system used in the compositions and methods disclosed herein can be non-naturally occurring. "Non-naturally occurring" systems include those that show the involvement of human assistance, such as one or more components of the system that are modified or mutated from the naturally occurring state, or that are at least substantially free from at least one other component that they are essentially associated with in nature, or that are associated with at least one other component that they are not naturally associated with.For example, some CRISPR / Cas systems use non-naturally occurring CRISPR complexes that include non-naturally occurring gRNA and Cas protein together, or use non-naturally occurring Cas protein, or use non-naturally occurring gRNA.

[0121] Cas Proteins Cas proteins generally contain at least one RNA recognition or binding domain that can interact with guide RNA. Cas proteins may also contain nuclease domains (e.g., DNase or RNase domains), DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains, and other domains. Some such domains (e.g., DNase domains) may be derived from native Cas proteins. Other such domains may be added to create modified Cas proteins. Nuclease domains have catalytic activity for nucleic acid cleavage, including covalent cleavage of nucleic acid molecules. Cleavage can generate blunt or staggered ends, which can be single-stranded or double-stranded. For example, wild-type Cas9 proteins usually generate blunt-end cleavage products. Alternatively, wild-type Cpf1 proteins (e.g., FnCpf1) can result in cleavage products that contain a 5-nucleotide 5' overhang, with cleavage occurring after the 18th base pair from the PAM sequence on the non-targeted strand and after the 23rd base on the targeted strand. A Cas protein can have full cleavage activity and create a double-stranded break at the target genomic locus (e.g., a double-stranded break with a blunt end), or it can be a nickase that creates a single-stranded break at the target genomic locus.

[0122] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), These include Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, as well as homologs or modified versions thereof.

[0123] Exemplary Cas protein is Cas9 protein or Cas9 protein derived protein.Cas9 protein is derived from type II CRISPR / Cas system, and typically shares four important motifs with conserved architecture.Motifs 1, 2 and 4 are RuvC-like motifs, and motif 3 is HNH motif. Exemplary Cas9 proteins are Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of Cas9 family members are described in WO2014 / 131833, which is incorporated by reference in its entirety for all purposes. Cas9 from S. pyogenes (SpCas9), which has been assigned SwissProt accession number Q99ZW2, is an exemplary Cas9 protein. S.Cas9 from S. aureus (SaCas9), which has been assigned the UniProt accession number J7RUA5, is another exemplary Cas9 protein. Cas9 from Campylobacter jejuni (CjCas9), which has been assigned the UniProt accession number Q0P897, is another exemplary Cas9 protein. See, for example, Kim et al. (2017) Nat. Commun. 8:14500, which is incorporated by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Exemplary DNA and protein sequences of SpCas9 are shown in SEQ ID NOs: 86 and 87, respectively. Cas9 from Neisseria meningitidis (Nme2Cas9) is another exemplary Cas9 protein. See, for example, Edraki et al. (2019) Mol. Cell 73(4):714-726, which is incorporated by reference in its entirety for all purposes. Cas9 proteins from Streptococcus thermophilus (e.g., Streptococcus thermophilus LMD-9 Cas9 encoded by the CRISPR1 locus (St1Cas9) or Streptococcus thermophilus Cas9 from the CRISPR3 locus (St3Cas9)) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or the RHA Francisella novicida Cas9 variant (E1369R / E1449H / R1556A substitutions) that recognize alternative PAMs are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are reviewed, for example, in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247-261, which is incorporated by reference in its entirety for all purposes.

[0124] Another example of a Cas protein is the Cpf1 (CRISPR of Prevotella and Francisella 1) protein. Cpf1 is a large protein (about 1300 amino acids) that contains a RuvC-like nuclease domain that is homologous to the corresponding domain of Cas9, along with the counterpart of Cas9's characteristic arginine-rich cluster. However, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and in contrast to Cas9, which contains a long insertion containing the HNH domain, the RuvC-like domain is adjacent in the Cpf1 sequence. See, e.g., Zetsche et al. (2015) Cell 163(3):759-771, which is incorporated herein by reference in its entirety for all purposes. Exemplary Cpf1 proteins are Francisella tularensis 1, Francisella tularensis subsp.novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp.SCADC, Acidaminococcus sp.BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis Cpf1 from Francisella novicida U112 (FnCpf1; assigned UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.

[0125] The Cas protein may be a wild-type protein (i.e., naturally occurring), a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein. The Cas protein may also be an active variant or fragment with respect to catalytic activity of a wild-type or modified Cas protein. A catalytically active variant or fragment may comprise at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a wild-type or modified Cas protein or a portion thereof, and an active variant retains the ability to cleave at a desired cleavage site and thus retains nick-inducing or double-strand break-inducing activity. Assays for nick-inducing or double-strand break-inducing activity are known and generally measure the overall activity and specificity of a Cas protein on a DNA substrate that contains a cleavage site.

[0126] One example of a modified Cas protein is the modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 (N497A / R661A / Q695A / Q926A) that harbors modifications designed to reduce non-specific DNA contacts. See, e.g., Kleinstiver et al. (2016) Nature 529(7587):490-495, incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas protein is the modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, e.g., Slaymaker et al. (2016) Science 351(6268):84-88, incorporated herein by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are reviewed, for example, in Cebrian-Serrano and Davies (2017) Mamm.Genome 28(7):247-261, which is incorporated by reference in its entirety for all purposes. Another example of a modified Cas9 protein is xCas9, which is an SpCas9 variant that can recognize an expanded range of PAM sequences. See, for example, Hu et al. (2018) Nature 556:57-63, which is incorporated by reference in its entirety for all purposes.

[0127] Cas proteins can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. Cas proteins can also be modified to change other activities or properties of the protein, such as stability. For example, one or more nuclease domains of the Cas protein can be modified, deleted, or inactivated, or the Cas protein can be truncated to remove domains that are not essential for the function of the protein, or the activity or properties of the Cas protein can be optimized (e.g., enhanced or reduced).

[0128] Cas protein may contain at least one nuclease domain, such as a DNase domain. For example, wild-type Cpf1 protein generally contains a RuvC-like domain, which presumably in a dimeric conformation, and cleaves both strands of target DNA. Cas protein may also contain at least two nuclease domains, such as a DNase domain. For example, wild-type Cas9 protein generally contains a RuvC-like nuclease domain and an HNH-like nuclease domain. Each of the RuvC domain and the HNH domain can cleave different strands of double-stranded DNA to make double-stranded breaks in DNA. See, for example, Jinek et al. (2012) Science 337:816-821, which is incorporated herein by reference in its entirety for all purposes.

[0129] One or more or all of the nuclease domains can be deleted or mutated so that they are no longer functional or have reduced nuclease activity. For example, if one of the nuclease domains is deleted or mutated in a Cas9 protein, the resulting Cas9 protein is called a nickase and can generate single-stranded breaks in double-stranded target DNA but not double-stranded breaks (i.e., it can cleave either the complementary or non-complementary strand, but not both). If both nuclease domains are deleted or mutated, the resulting Cas protein (e.g., Cas9) has a reduced ability to cleave both strands of double-stranded DNA (e.g., nuclease null or nuclease inactive Cas protein, or Cas protein without catalytic activity (dCas)). An example of a mutation that converts Cas9 into a nickase is the D10A (aspartate to alanine at position 10 of Cas9) mutation in the RuvC domain of Cas9 from S. pyogenes. Similarly, H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840), or N863A (asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from S. pyogenes can convert Cas9 into a nickase. Other examples of mutations that convert Cas9 into a nickase include the corresponding mutations in Cas9 from S. thermophilus. See, for example, Sapranauskas et al. (2011) Nucleic Acids Research 39):9275-9282 and WO2013 / 141680, each of which is incorporated herein by reference in its entirety for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Other examples of nickase-generating mutations can be found, for example, in WO2013 / 176772 and WO2013 / 142578, each of which is incorporated by reference herein in its entirety for all purposes.When all nuclease domains are deleted or mutated in a Cas protein (e.g., both nuclease domains are deleted or mutated in a Cas9 protein), the resulting Cas protein (e.g., Cas9) has a reduced ability to cleave both strands of double-stranded DNA (e.g., a nuclease null, or nuclease inactive Cas protein). One specific example is the D10A / H840A S.pyogenes Cas9 double mutant, or the corresponding double mutant of a Cas9 from another species when optimally aligned with S.pyogenes Cas9. Another specific example is the D10A / N863A S.pyogenes Cas9 double mutant, or the corresponding double mutant of a Cas9 from another species when optimally aligned with S.pyogenes Cas9.

[0130] Examples of inactivating mutations in the catalytic domain of xCas9 are the same as those described above for SpCas9. Examples of inactivating mutations in the catalytic domain of the Cas9 protein of Staphylococcus aureus are also known. For example, the Cas9 enzyme of Staphylococcus aureus (SaCas9) can include a substitution at position N580 (e.g., N580A substitution) and a substitution at position D10 (e.g., D10A substitution), resulting in a nuclease-inactive Cas protein. See, for example, WO2016 / 106236, which is incorporated by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domain of Nme2Cas9 are also known (e.g., a combination of D16A and H588A). Examples of inactivating mutations in the catalytic domain of St1Cas9 are also known (e.g., a combination of D9A, D598A, H599A, and N622A). Examples of inactivating mutations in the catalytic domain of St3Cas9 are also known (e.g., a combination of D10A and N870A). Examples of inactivating mutations in the catalytic domain of CjCas9 are also known (e.g., a combination of D8A and H559A). Examples of inactivating mutations in the catalytic domain of FnCas9 and RHA FnCas9 are also known (e.g., N995A).

[0131] Examples of inactivating mutations in the catalytic domain of Cpf1 protein are also known. For Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp.BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovoculi 237 (MbCpf1 Cpf1), such mutations may include mutations at positions 908, 993, or 1263 of AsCpf1 or the corresponding positions of Cpf1 orthologs, or at positions 832, 925, 947, or 1180 of LbCpf1 or the corresponding positions of Cpf1 orthologs. Such mutations may include, for example, one or more of the mutations D908A, E993A, and D1263A of AsCpf1 or corresponding mutations of Cpf1 orthologues, or D832A, E925A, D947A, and D1180A of LbCpf1 or corresponding mutations of Cpf1 orthologues. See, e.g., US2016 / 0208243, which is incorporated herein by reference in its entirety for all purposes.

[0132] Cas proteins can also be operably linked to heterologous polypeptides as fusion proteins. For example, Cas proteins can be fused to cleavage domains, epigenetic modification domains, or transcriptional repressor domains. See WO2014 / 089290, which is incorporated by reference in its entirety for all purposes. Examples of transcriptional repressor domains include inducible cAMP early repressor (ICER) domain, Kruppel-associated box A (KRAB-A) (or Kruppel-associated box (KRAB)) repressor domain, YY1 glycine-rich repressor domain, Sp1-like repressor, E(spl) repressor, ΙκΒ repressor, and MeCP2. Other examples include transcriptional repressor domains from A / B, KOX, TGF-beta inducible early gene (TIEG), v-erbA, SID, SID4X, MBD2, MBD3, DNMT1, DNMG3A, DNMT3B, Rb, ROM2. See, for example, EP3045537 and WO2011 / 146121, each of which is incorporated by reference in its entirety for all purposes. Cas proteins can also be fused to heterologous polypeptides that provide increased or decreased stability. The fusion domain or heterologous polypeptide can be located at the N-terminus, C-terminus, or internally of the Cas protein.

[0133] As an example, Cas proteins can be fused to one or more heterologous polypeptides that provide intracellular localization. Such heterologous polypeptides can include one or more nuclear localization signals (NLSs), such as monopartite SV40 NLS and / or bipartite alpha-importin NLS for targeting the nucleus, mitochondrial localization signals for targeting mitochondria, ER retention signals, and the like. See, for example, Lange et al. (2007) J.Biol.Chem.282:5101-5105, which is incorporated herein by reference in its entirety for all purposes. Such intracellular localization signals can be located at the N-terminus, C-terminus, or anywhere within the Cas protein. The NLS can include a stretch of basic amino acids and can be a monopartite or bipartite sequence. Optionally, the Cas protein may contain two or more NLSs, including an NLS at the N-terminus (e.g., an alpha-importin NLS or a monoglottal NLS) and an NLS at the C-terminus (e.g., an SV40 NLS or a biglottal NLS). The Cas protein may also contain two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.

[0134] Cas protein can also be operably linked to a cell-penetrating domain or a protein transduction domain.For example, the cell-penetrating domain can be derived from HIV-1 TAT protein, the TLM cell-penetrating motif from human hepatitis B virus, MPG, Pep-1, VP22, the cell-penetrating peptide from herpes simplex virus, or a polyarginine peptide sequence.See, for example, WO2014 / 089290 and WO2013 / 176772, each of which is incorporated herein by reference in its entirety for all purposes.The cell-penetrating domain can be located at the N-terminus, C-terminus, or anywhere within the Cas protein.

[0135] The Cas protein may also be operably linked to a heterologous polypeptide, such as a fluorescent protein, a purification tag, or an epitope tag, to facilitate tracking or purification. Examples of fluorescent proteins include green fluorescent protein (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, Monomeric Examples of tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0136] The Cas protein may be tethered to a labeled nucleic acid. Such tethering (i.e., physical association) can be achieved through covalent or non-covalent interactions, and tethering can be achieved directly (e.g., via direct fusion or chemical conjugation, which can be achieved by modification of cysteine ​​or lysine residues on the protein or intein modifications) or through one or more intervening linker or adapter molecules, such as streptavidin or aptamers. See, for example, Pierce et al. (2005) Mini Rev. Med. Chem. 5(1):41-55, Duckworth et al. (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822, Schaeffer and Dixon (2009) Australian J. Chem. 62(10):1328-1332, Goodman et al. (2009) Chembiochem. 10(9):1551-1557, and Khatwani et al. (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is incorporated by reference in its entirety for all purposes. Non-covalent strategies for synthesizing protein-nucleic acid conjugates include biotin-streptavidin and nickel-histidine methods. Covalent protein-nucleic acid conjugates can be synthesized by connecting appropriately functionalized nucleic acids and proteins using various chemistries. Some of these chemistries involve direct attachment of oligonucleotides to amino acid residues on the protein surface (e.g., lysine amines or cysteine ​​thiols), while other more complex schemes require post-translational modification of proteins or the involvement of catalytic or reactive protein domains. Methods of covalent attachment of proteins to nucleic acids can include, for example, chemical cross-linking of oligonucleotides to protein lysine or cysteine ​​residues, expressed protein ligation, chemoenzymatic methods, and the use of photoaptamers. The labeled nucleic acid may be tethered to the C-terminus, N-terminus, or internal region of the Cas protein. In one example, the labeled nucleic acid is tethered to the C-terminus or N-terminus of the Cas protein.Similarly, the Cas protein may be tethered to the 5' end, 3' end, or internal region of the labeled nucleic acid. That is, the labeled nucleic acid may be tethered in any orientation and polarity. For example, the Cas protein may be tethered to the 5' end or 3' end of the labeled nucleic acid.

[0137] The Cas protein may be provided in any form. For example, the Cas protein may be provided in the form of a protein, such as a Cas protein complexed with a gRNA. Alternatively, the Cas protein may be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Cas protein may be codon-optimized for efficient translation into protein in a particular cell or organism. For example, the nucleic acid encoding the Cas protein may be modified to alternative codons that are more frequently used in bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest, compared to the naturally occurring polynucleotide sequence. When the nucleic acid encoding the Cas protein is introduced into a cell, the Cas protein may be expressed in the cell transiently, conditionally, or constitutively.

[0138] Cas proteins provided as mRNA can be modified to improve stability and / or immunogenic properties. Modifications can be made to one or more nucleosides within the mRNA. Examples of chemical modifications to mRNA nucleobases include pseudouridine, 1-methyl-pseudouridine, and 5-methyl-cytidine. For example, capped and polyadenylated Cas mRNA containing N1-methylpseudouridine can be used. Similarly, Cas mRNA can be modified by depleting uridine using synonymous codons.

[0139] The nucleic acid encoding the Cas protein may be stably integrated in the genome of the cell and operably linked to a promoter active in the cell. Alternatively, the nucleic acid encoding the Cas protein may be operably linked to a promoter in an expression construct. An expression construct includes any nucleic acid construct that can direct the expression of a gene or other nucleic acid sequence of interest (e.g., Cas gene) and can introduce such a nucleic acid sequence of interest into a target cell. For example, the nucleic acid encoding the Cas protein may be present in a vector that includes a DNA encoding a gRNA. Alternatively, it may be a vector or plasmid separate from the vector that includes a DNA encoding a gRNA. Promoters that can be used in the expression construct include, for example, promoters active in one or more of eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or one-cell stage embryos. Such promoters may be, for example, conditional, inducible, constitutive, or tissue-specific. Optionally, the promoter may be a bidirectional promoter that drives the expression of both Cas protein in one direction and guide RNA in the other direction. Such a bidirectional promoter may consist of (1) a complete conventional unidirectional Pol III promoter that includes three external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box, and (2) a second basic Pol III promoter that includes a PSE and a TATA box fused in reverse orientation to the 5' end of the DSE. For example, in the H1 promoter, the DSE is flanked by a PSE and a TATA box, and the promoter can be made bidirectional by creating a hybrid promoter in which transcription in the reverse orientation is controlled by adding a PSE and a TATA box from the U6 promoter. See, for example, US2016 / 0074535, which is incorporated herein by reference in its entirety for all purposes.Bidirectional promoters can be used to simultaneously express genes encoding Cas proteins and guide RNAs, generating compact expression cassettes to facilitate delivery.

[0140] Guide RNA "guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., Cas9 protein) and targets the Cas protein to a specific location in a target DNA. Guide RNA may contain two segments: a "DNA targeting segment" and a "protein binding segment". A "segment" includes a section or region of a molecule, such as a consecutive stretch of nucleotides in an RNA. Some gRNAs, such as those of Cas9, may contain two separate RNA molecules: an "activator RNA" (e.g., tracrRNA) and a "targeter RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides), which may also be referred to as "single molecule gRNA", "single guide RNA", or "sgRNA". See, for example, WO2013 / 176772, WO2014 / 065596, WO2014 / 089290, WO2014 / 093622, WO2014 / 099750, WO2013 / 142578, and WO2014 / 131833, each of which is incorporated herein by reference in its entirety for all purposes. For example, in the case of Cas9, a single guide RNA may include a crRNA fused to a tracrRNA (e.g., via a linker). For example, in the case of Cpf1, only the crRNA is required to achieve binding to a target sequence. The terms "guide RNA" and "gRNA" include both double-molecule (i.e., modular) gRNA and single-molecule gRNA.

[0141] Exemplary bimolecular gRNAs include a crRNA-like ("CRISPR RNA" or "targeter RNA" or "crRNA" or "crRNA repeat") molecule and a corresponding tracrRNA-like ("trans-acting CRISPR RNA" or "activator RNA" or "tracrRNA") molecule. The crRNA comprises both the DNA-targeting segment (single strand) of the gRNA and a stretch of nucleotides that forms one half of the dsRNA duplex of the protein-binding segment of the gRNA. An example of a crRNA tail located downstream (3') of the DNA-targeting segment comprises, consists essentially of, or consists of GUUUUAGAGCUAUGCU (SEQ ID NO: 65). Any of the DNA-targeting segments (guide sequences) disclosed herein can be attached to the 5' end of SEQ ID NO: 65 to form a crRNA. Such DNA targeting segments include, for example, SEQ ID NOs: 44-46 (mouse Banf1), SEQ ID NOs: 27-30 (human BANF1), SEQ ID NOs: 47-49 (mouse Ppp2ca), SEQ ID NOs: 31-32 (human PPP2CA), SEQ ID NOs: 50-52 (mouse Ankle2), and SEQ ID NO: 38 (human ANKLE2).

[0142] The corresponding tracrRNA (activator RNA) contains a stretch of nucleotides that forms the other half of the dsRNA duplex of the protein-binding segment of the gRNA. The stretch of nucleotides of the crRNA is complementary to and hybridizes with the stretch of nucleotides of the tracrRNA to form the dsRNA duplex of the protein-binding domain of the gRNA. Thus, each crRNA can be said to have a corresponding tracrRNA. Exemplary tracrRNA sequences comprise, consist essentially of, or consist of AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU (SEQ ID NO: 66), AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 100), or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 101).

[0143] In systems where both crRNA and tracrRNA are required, the crRNA and the corresponding tracrRNA hybridize to form a gRNA. In systems where only crRNA is required, the crRNA may be the gRNA. The crRNA further provides a single-stranded DNA target segment that hybridizes to the complementary strand of the target DNA. When used for modification in cells, the exact sequence of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecule is used. See, e.g., Mali et al. (2013) Science 339:823-826, Jinek et al. (2012) Science 337:816-821, Hwang et al. (2013) Nat. Biotechnol. 31:227-229, Jiang et al. (2013) Nat. Biotechnol. 31:233-239, and Cong et al. (2013) Science 339:819-823, each of which is incorporated by reference in its entirety for all purposes.

[0144] The DNA-targeting segment (crRNA) of a given gRNA comprises a nucleotide sequence that is complementary to a sequence on the complementary strand of the target DNA, as described in more detail below. The DNA-targeting segment of the gRNA interacts with the target DNA in a sequence-specific manner via hybridization (i.e., base pairing). Thus, the nucleotide sequence of the DNA-targeting segment may vary and determines the location within the target DNA where the gRNA and the target DNA interact. The DNA-targeting segment of a gRNA of interest may be modified to hybridize to any desired sequence within the target DNA. Naturally occurring crRNAs often contain a targeting segment that is 21-72 nucleotides long, flanked by two direct repeats (DRs) that are 21-46 nucleotides long, depending on the CRISPR / Cas system and organism (see, e.g., WO2014 / 131833, incorporated herein by reference in its entirety for all purposes). For S. pyogenes, the DR is 36 nucleotides long and the targeting segment is 30 nucleotides long. The 3'-located DR is complementary to and hybridizes with the corresponding tracrRNA, which in turn binds to the Cas protein.

[0145] The DNA targeting segment can have a length of, for example, at least about 12, 15, 17, 18, 19, 20, 25, 30, 35, or 40 nucleotides. Such DNA targeting segments can have a length of, for example, about 12 to about 100, about 12 to about 80, about 12 to about 50, about 12 to about 40, about 12 to about 30, about 12 to about 25, or about 12 to about 20 nucleotides. For example, the DNA targeting segment can be about 15 to about 25 nucleotides (e.g., about 17 to about 20 nucleotides, or about 17, 18, 19, or 20 nucleotides). See, for example, US2016 / 0024523, which is incorporated by reference in its entirety for all purposes. For Cas9 from S. pyogenes, a typical DNA targeting segment is 16 to 20 nucleotides in length, or 17 to 20 nucleotides in length. For Cas9 from S. aureus, a typical DNA targeting segment is 21-23 nucleotides in length. For Cpf1, a typical DNA targeting segment is at least 16 nucleotides in length or at least 18 nucleotides in length.

[0146] TracrRNA can be in any form (e.g., full-length tracrRNA or active partial tracrRNA) and of various lengths. They can include primary transcripts or processed forms. For example, tracrRNA (as part of a single guide RNA or as a separate molecule as part of a bimolecular gRNA) can comprise, consist essentially of, or consist of all or part of a wild-type tracrRNA sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of the wild-type tracrRNA sequence). Examples of wild-type tracrRNA sequences from S. pyogenes include 171-nucleotide, 89-nucleotide, 75-nucleotide, and 65-nucleotide versions. See, for example, Deltcheva et al. (2011) Nature 471:602-607, WO2014 / 093661, each of which is incorporated herein by reference in its entirety for all purposes. Examples of tracrRNA within a single guide RNA (sgRNA) include the tracrRNA segments found within the +48, ​​+54, +67, and +85 versions of the sgRNA, where "+n" indicates that up to +n nucleotides of the wild-type tracrRNA are included in the sgRNA. See US8,697,359, which is incorporated by reference in its entirety for all purposes.

[0147] The percent complementarity between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%). The percent complementarity between the DNA targeting segment and the complementary strand of the target DNA can be at least 60% over about 20 consecutive nucleotides. As an example, the percent complementarity between the DNA targeting segment and the complementary strand of the target DNA can be 100% over 14 consecutive nucleotides at the 5' end of the complementary strand of the target DNA and can be as low as 0% over the remaining portion. In such a case, the DNA targeting segment can be considered to be 14 nucleotides long. As another example, the percent complementarity between the DNA targeting segment and the complementary strand of the target DNA can be 100% over 7 consecutive nucleotides at the 5' end of the complementary strand of the target DNA and can be as low as 0% over the remaining portion. In such a case, the DNA target segment can be considered to be 7 nucleotides long. In some guide RNAs, at least 17 nucleotides in the DNA target segment are complementary to the complementary strand of the target DNA. For example, the DNA target segment can be 20 nucleotides long and can include 1, 2, or 3 mismatches with the complementary strand of the target DNA. In one example, the mismatch is not adjacent to the region of the complementary strand that corresponds to the protospacer adjacent motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (e.g., the mismatch is at the 5' end of the DNA targeting segment of the guide RNA, or the mismatch is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 base pairs away from the region of the complementary strand that corresponds to the PAM sequence).

[0148] The protein-binding segment of gRNA may contain two stretches of nucleotides that are complementary to each other. The complementary nucleotides of the protein-binding segment hybridize to form a double-stranded RNA duplex (dsRNA). The protein-binding segment of the gRNA of interest interacts with the Cas protein, and the gRNA directs the bound Cas protein to a specific nucleotide sequence in the target DNA via the DNA-targeting segment.

[0149] A single guide RNA may include a DNA targeting segment and a scaffold sequence (i.e., the protein-binding or Cas-binding sequence of the guide RNA). For example, such a guide RNA may have a 5' DNA targeting segment attached to a 3' scaffold sequence. Exemplary scaffold sequences include, consist essentially of, or consist of: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (Version 1, SEQ ID NO: 67), GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Version 2, SEQ ID NO: 68), GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Version 3, SEQ ID NO: 69), GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Version 4, SEQ ID NO: 70), GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (Version 5, SEQ ID NO: 102), GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Version 6, SEQ ID NO: 103), or GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (Version 7, SEQ ID NO: 104). A guide RNA targeting any of the guide RNA target sequences disclosed herein may, for example, comprise a DNA-targeting segment at the 5' end of the guide RNA fused to any of the exemplary guide RNA scaffold sequences at the 3' end of the guide RNA.That is, any of the DNA targeting segments (guide RNAs) disclosed herein can be bound to the 5' end of any one of the above scaffold sequences to form a single guide RNA (chimeric guide RNA). Such DNA targeting segments include, for example, SEQ ID NOs: 44-46 (mouse Banf1), 27-30 (human BANF1), 47-49 (mouse Ppp2ca), 31-32 (human PPP2CA), 50-52 (mouse Ankle2), and 38 (human ANKLE2).

[0150] Guide RNAs may contain modifications or sequences that provide additional desirable characteristics (e.g., modified or regulated stability; intracellular targeting; tracking by fluorescent labels; binding sites for proteins or protein complexes, etc.). Examples of such modifications include, for example, 5' caps (e.g., 7-methylguanylate caps (m7G)), 3' polyadenylation tails (i.e., 3' poly(A) tails), riboswitch sequences (e.g., to allow for regulated stability and / or regulated accessibility by proteins and / or protein complexes), stability control sequences, sequences that form dsRNA duplexes (i.e., hairpins), modifications or sequences that target the RNA to a location within a cell (e.g., nucleus, mitochondria, chloroplasts, etc.), modifications or sequences that provide tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, sequences that allow for fluorescent detection, etc.), modifications or sequences that provide binding sites for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.), and combinations thereof. Other examples of modifications include engineered stem-loop duplexes, engineered bulge regions, engineered hairpins 3' of stem-loop duplexes, or any combination thereof. See, e.g., US2015 / 0376586, incorporated herein by reference in its entirety for all purposes. A bulge can be an unpaired region of nucleotides in a duplex comprised of a crRNA-like region and a minimal tracrRNA-like region. A bulge can comprise an unpaired 5'-XXXY-3' on one side of the duplex, where X is any purine and Y can be a nucleotide that can form a wobble pair with a nucleotide on the opposite strand and a region of unpaired nucleotides on the opposite side of the duplex.

[0151] Unmodified nucleic acids may be prone to degradation. Exogenous nucleic acids may also induce an innate immune response. Modifications may help introduce stability and reduce immunogenicity. Guide RNAs may include modified nucleosides and nucleotides, including, for example, one or more of the following: (1) modification or substitution of one or both of the non-linked phosphate oxygens and / or one or more of the linked phosphate oxygens in the phosphodiester backbone linkage, (2) modification or substitution of components of the ribose sugar, such as modification or substitution of the 2' hydroxyl of the ribose sugar, (3) replacement of the phosphate moiety with a dephosphoryl linker, (4) modification or substitution of naturally occurring nucleobases, (5) substitution or modification of the ribose-phosphate backbone, (6) modification of the 3' or 5' end of the oligonucleotide (e.g., removal, modification, or substitution of the terminal phosphate group, or conjugation of a moiety), and (7) modification of the sugar. Other possible guide RNA modifications include modification or substitution of uracil or poly-uracil tracts. See, for example, WO2015 / 048577 and US2016 / 0237455, each of which is incorporated herein by reference in its entirety for all purposes.Similar modifications can be made to Cas-encoding nucleic acids, such as Cas mRNA.For example, Cas mRNA can be modified by depleting uridines using synonymous codons.

[0152] As an example, the nucleotides at the 5' or 3' end of the guide RNA may include phosphorothioate bonds (e.g., the base may have a modified phosphate group that is a phosphorothioate group). For example, the guide RNA may include phosphorothioate bonds between the two, three, or four terminal nucleotides at the 5' or 3' end of the guide RNA. As another example, the nucleotides at the 5' and / or 3' end of the guide RNA may have 2'-O-methyl modifications. For example, the guide RNA may include 2'-O-methyl modifications at the two, three, or four terminal nucleotides at the 5' and / or 3' end (e.g., the 5' end) of the guide RNA. See, for example, WO2017 / 173054A1 and Finn et al. (2018) Cell Rep. 22:(9):2227-2235, each of which is incorporated herein by reference in its entirety for all purposes. Other possible modifications are described in more detail elsewhere herein. In certain examples, guide RNAs contain 2'-O-methyl analogs and 3' phosphorothioate internucleotide linkages at the first three 5' and 3' terminal RNA residues. Such chemical modifications, for example, provide guide RNAs with better stability and protection from exonucleases, allowing them to persist in cells longer than unmodified guide RNAs. Such chemical modifications can also protect against natural intracellular immune responses, for example, that can aggressively degrade RNAs or trigger immune cascades that lead to cell death.

[0153] Guide RNA can be provided in any form. For example, gRNA can be provided in the form of RNA, either as two molecules (separate crRNA and tracrRNA) or one molecule (sgRNA), and optionally in the form of a complex with Cas protein. gRNA can also be provided in the form of DNA encoding gRNA. The DNA encoding gRNA can encode a single RNA molecule (sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding gRNA can be provided as one DNA molecule or as separate DNA molecules encoding crRNA and tracrRNA, respectively.

[0154] When the gRNA is provided in the form of DNA, the gRNA may be expressed in the cell transiently, conditionally, or constitutively. The DNA encoding the gRNA may be stably integrated in the genome of the cell and operably linked to a promoter active in the cell. Alternatively, the DNA encoding the gRNA may be operably linked to a promoter in an expression construct. For example, the DNA encoding the gRNA may be in a vector that includes a heterologous nucleic acid, such as a nucleic acid encoding a Cas protein. Alternatively, it may be a vector or plasmid that is separate from the vector that includes the nucleic acid encoding the Cas protein. Promoters that may be used in such expression constructs include, for example, promoters that are active in one or more of eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or one-cell stage embryos. Such promoters may be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters may also be, for example, bidirectional promoters. Specific examples of suitable promoters include RNA polymerase III promoters, such as the human U6 promoter, the rat U6 polymerase III promoter, or the mouse U6 polymerase III promoter.

[0155] Alternatively, gRNA can be prepared in various other ways. For example, gRNA can be prepared by in vitro transcription, for example, using T7 RNA polymerase (see, for example, WO2014 / 089290 and WO2014 / 065596, each of which is incorporated herein by reference in its entirety for all purposes). Guide RNA can also be a synthetically produced molecule prepared by chemical synthesis. For example, guide RNA can be chemically synthesized to include 2'-O-methyl analogs and 3' phosphorothioate internucleotide linkages in the first three 5' and 3' terminal RNA residues.

[0156] The guide RNA (or a nucleic acid encoding the guide RNA) can be in a composition comprising one or more guide RNAs (e.g., one, two, three, four, or more guide RNAs) and a carrier that increases the stability of the guide RNA (e.g., extends the time below a threshold such that degradation products remain below 0.5% by weight of the starting nucleic acid or protein under a given storage condition (e.g., at -20°C, 4°C, or ambient temperature) or increases stability in vivo). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic-acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochleates, and lipid microtubules. Such compositions can further comprise a Cas protein, such as a Cas9 protein, or a nucleic acid encoding a Cas protein.

[0157] Guide RNA target sequence. The target DNA of the guide RNA includes a nucleic acid sequence present in the DNA to which the DNA target segment of the gRNA binds when sufficient conditions for binding exist. Suitable DNA / RNA binding conditions include physiological conditions that normally exist in cells. Other suitable DNA / RNA binding conditions (e.g., conditions in cell-free systems) are known in the art (see, e.g., Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001), which is incorporated herein by reference in its entirety for all purposes). The strand of the target DNA that is complementary to and hybridizes with the gRNA can be referred to as the "complementary strand", and the strand of the target DNA that is complementary to the "complementary strand" (and thus is not complementary to the Cas protein or gRNA) can be referred to as the "non-complementary strand" or "template strand".

[0158] The target DNA includes both the sequence on the complementary strand to which the guide RNA hybridizes and the corresponding sequence on the non-complementary strand (e.g., adjacent to the protospacer adjacent motif (PAM)). The term "guide RNA target sequence" as used herein specifically refers to the sequence on the non-complementary strand that corresponds to (i.e., its reverse complement) the sequence to which the guide RNA hybridizes on the complementary strand. That is, the guide RNA target sequence refers to the sequence on the non-complementary strand adjacent to the PAM (e.g., upstream or 5' of the PAM in the case of Cas9). The guide RNA target sequence is equivalent to the DNA-targeting segment of the guide RNA, but contains thymine instead of uracil. As an example, the guide RNA target sequence of the SpCas9 enzyme may refer to the sequence upstream of the 5'-NGG-3' PAM on the non-complementary strand. The guide RNA is designed to have complementarity to the complementary strand of the target DNA, and hybridization between the DNA-targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, as long as there is sufficient complementarity to cause hybridization and promote the formation of CRISPR complex.When guide RNA is referred to herein as targeting guide RNA target sequence, it means that guide RNA hybridizes to the complementary strand sequence of target DNA that is the reverse complement of guide RNA target sequence on non-complementary strand.

[0159] The target DNA or guide RNA target sequence can comprise any polynucleotide, for example, it can be located in the nucleus or cytoplasm of a cell, or in a cell organelle, such as mitochondria or chloroplast.The target DNA or guide RNA target sequence can be any nucleic acid sequence that is endogenous or exogenous to a cell.The guide RNA target sequence can be a sequence that codes for a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence), or it can comprise both.

[0160] Site-specific binding and cleavage of target DNA by Cas proteins can occur at a location determined by both (i) base-pairing complementarity between the guide RNA and the complementary strand of the target DNA, and (ii) a short motif, called a protospacer adjacent motif (PAM), on the non-complementary strand of the target DNA. The PAM can be adjacent to the guide RNA target sequence. Optionally, the guide RNA target sequence can be adjacent to the PAM at the 3' end (e.g., in the case of Cas9). Alternatively, the guide RNA target sequence can be adjacent to the PAM at the 5' end (e.g., in the case of Cpf1). For example, the cleavage site of the Cas protein can be about 1 to about 10 or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream (e.g., within the guide RNA target sequence) of the PAM sequence. In the case of SpCas9, the PAM sequence (i.e., on the non-complementary strand) can be 5'-N 1 GG-3', N 1 is any DNA nucleotide, and the PAM is immediately 3' to the guide RNA target sequence on the non-complementary strand of the target DNA. Thus, the sequence corresponding to the PAM on the complementary strand (i.e., the reverse complement) is 5'-CCN 2 -3' and N 2 is any DNA nucleotide immediately 5' to the sequence where the DNA-targeting segment of the guide RNA hybridizes to the complementary strand of the target DNA. In some such cases, N 1 and N 2 can be complementary to N 1 ~N 2 The base pair can be any base pair (e.g., N 1 =C and N 2 =G,N 1 = G and N 2 =C,N 1 = A and N 2 =T, or N 1 =T and N 2= A). For Cas9 from S. aureus, the PAM can be NNGRRT or NNGRR, where N can be A, G, C, or T, and R can be G or A. For Cas9 from C. jejuni, the PAM can be, for example, NNNNACAC or NNNNRYAC, where N can be A, G, C, or T, and R can be G or A. In some cases (e.g., for FnCpf1), the PAM sequence is 5' upstream and can have the sequence 5'-TTN-3'.

[0161] An example of a guide RNA target sequence is a 20-nucleotide DNA sequence immediately preceding the NGG motif recognized by the SpCas9 protein. For example, two examples of a guide RNA target sequence + PAM are GN 19 NGG (SEQ ID NO: 71) or N 20 NGG (SEQ ID NO: 72). See, for example, WO2014 / 165825, which is incorporated by reference in its entirety for all purposes. The guanine at the 5' end can promote transcription by RNA polymerase in cells. Another example of a guide RNA target sequence + PAM can include two guanine nucleotides at the 5' end (e.g., GGN 20 NGG; SEQ ID NO: 73). See, for example, WO2014 / 065596, incorporated herein by reference in its entirety for all purposes. Other guide RNA target sequences plus PAMs may have a length of 4-22 nucleotides of SEQ ID NOs: 71-73, including 5'G or GG and 3'GG or NGG. Still other guide RNA target sequences plus PAMs may have a length of 14-20 nucleotides of SEQ ID NOs: 71-73. Examples of guide RNA target sequences for BANF1, PPP2CA, and ANKLE2 include SEQ ID NOs: 1-4 (human BANF1), SEQ ID NOs: 5-6 (human PPP2CA), SEQ ID NO: 12 (human ANKLE2), SEQ ID NOs: 18-20 (mouse Banf1), SEQ ID NOs: 21-23 (mouse Ppp2ca), and SEQ ID NOs: 24-26 (mouse Ankle2).

[0162] Formation of a CRISPR complex hybridized to the target DNA can result in cleavage of one or both strands of the target DNA within or near the region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non-complementary strand of the target DNA and the reverse complement on the complementary strand to which the guide RNA hybridizes). For example, the cleavage site can be within the guide RNA target sequence (e.g., at a defined position relative to the PAM sequence). A "cleavage site" includes a position in the target DNA where the Cas protein generates a single-stranded or double-stranded break. The cleavage site can be only single-stranded (e.g., when a nickase is used) or on both strands of double-stranded DNA. The cleavage site can be at the same position on both strands (generating blunt ends; e.g., Cas9) or at different sites on each strand (generating staggered ends (i.e., overhangs); e.g., Cpf1). Staggered ends can be generated, for example, by using two Cas proteins, each generating a single-stranded break at a different cleavage site on a different strand, thereby generating a double-stranded break. For example, a first nickase can create a single-stranded break on a first strand of double-stranded DNA (dsDNA) and a second nickase can create a single-stranded break on a second strand of the dsDNA such that an overhang sequence is created. In some cases, the guide RNA target sequence or cleavage site of the first strand nickase is separated from the guide RNA target sequence or cleavage site of the second strand nickase by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs.

[0163] 2. Antisense oligonucleotides, antisense RNA, siRNA, or shRNA Antisense oligonucleotides, antisense RNA, small interfering RNA (siRNA), or short hairpin RNA (shRNA) can also be used to reduce the expression of BANF1, PPP2CA, or ANKLE2. Such antisense RNA, siRNA, or shRNA can be designed to target any region of BANF1, PPP2CA, or ANKLE2 mRNA.

[0164] The term "antisense RNA" refers to a single-stranded RNA that is complementary to a messenger RNA strand transcribed within a cell. The term "small interfering RNA (siRNA)" refers to a typical double-stranded RNA molecule that induces the RNA interference (RNAi) pathway. These molecules vary in length (generally between 18-30 base pairs) and contain various degrees of complementarity to the target mRNA of the antisense strand. Some, but not all, siRNAs have unpaired overhanging bases at the 5' or 3' end of the sense and / or antisense strands. The term "siRNA" includes duplexes of two separate strands, as well as single strands that can form hairpin structures that include a double-stranded region. The double-stranded structure can be, for example, less than 20, 25, 30, 35, 40, 45, or 50 nucleotides in length. For example, the double-stranded structure can be about 21-23 nucleotides in length, about 19-25 nucleotides in length, or about 19-23 nucleotides in length. The term "short hairpin RNA (shRNA)" refers to a single strand of RNA bases that can self-hybridize in a hairpin structure and induce the RNA interference (RNAi) pathway upon processing. These molecules vary in length (usually about 50-90 nucleotides long, sometimes up to more than 250 nucleotides long (e.g., in the case of shRNAs adapted for microRNAs)). shRNA molecules are processed intracellularly to form siRNAs, which can knock down gene expression. shRNAs can be incorporated into vectors. The term "shRNA" also refers to DNA molecules into which short hairpin RNA molecules may be transcribed.

[0165] Antisense oligonucleotides and RNAi agents can also be used to reduce the expression of BANF1, PPP2CA, or ANKLE2. Such antisense oligonucleotides or RNAi agents can be designed to target any region of BANF1, PPP2CA, or ANKLE2 mRNA.

[0166] An "RNAi agent" is a composition comprising small double-stranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can promote the degradation or inhibition of translation of a target RNA, such as messenger RNA (mRNA), in a sequence-specific manner. The oligonucleotides of an RNAi agent are polymers of linked nucleosides, each of which may or may not be independently modified. RNAi agents function through an RNA interference mechanism (i.e., induce RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells). Although RNAi agents, as that term is used herein, are believed to act primarily through an RNA interference mechanism, the disclosed RNAi agents are not constrained or limited to a particular pathway or mechanism of action. The RNAi agents disclosed herein include sense and antisense strands, including, but not limited to, small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of an RNAi agent described herein is at least partially complementary to the sequence (i.e., the sequence or order of nucleobases or nucleotides described as a series of letters using standard nomenclature) of a target RNA.

[0167] Single-stranded antisense oligonucleotides (ASOs) and RNA interference (RNAi) share the basic principle that oligonucleotides bind to target RNA through Watson-Crick base pairing. Without wishing to be bound by theory, during RNAi, a small RNA duplex (the RNAi agent) binds to an RNA-induced silencing complex (RISC) and one strand (the passenger strand) is lost while the remaining strand (the guide strand) binds to complementary RNA in cooperation with the RISC. Argonaute 2 (Ago2), the catalytic component of RISC, then cleaves the target RNA. The guide strand is always associated with either a complementary sense strand or a protein (RISC). In contrast, ASOs must survive and function as single strands. ASOs bind to target RNA and block other factors, such as ribosomes or splicing factors, from binding to the RNA or recruit proteins such as nucleases. Various modifications and target regions are selected for ASOs based on the desired mechanism of action. Gapmers are ASO oligonucleotides that contain 2-5 chemically modified nucleotides (e.g., LNA or 2'-MOE) at each end flanking a central 8-10 base gap in DNA. After binding to the target RNA, the DNA-RNA hybrid serves as a substrate for RNase H.

[0168] ASOs are DNA oligos, usually 15–25 bases long, designed in the antisense orientation to an RNA of interest. Hybridization of ASOs to target RNAs can mediate RNase H cleavage of the RNA, preventing protein translation of the mRNA. To increase nuclease resistance, phosphorothioate (PS) modifications can be added to oligos. Phosphorothioate linkages also facilitate binding to serum proteins, increasing the bioavailability of ASOs and facilitating productive cellular uptake. In phosphorothioates, a sulfur atom replaces a non-bridging oxygen in the oligophosphate backbone. ASOs can be chimeras that contain both DNA and modified RNA bases. The use of modified RNAs such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or Affinity Plus Locked Nucleic Acid bases in chimeric antisense designs can improve nuclease stability and affinity (T) of antisense oligos to target RNAs. m) to increase both the RNase H activity and the cleavage potential of the target. However, these modifications do not activate RNase H cleavage (i.e., ASOs composed entirely of sugar-modified RNA-like nucleotides (e.g., 2'-MOE) do not support RNase H cleavage of complementary RNA). Thus, one antisense strategy is the "gapmer" design, which incorporates 2'-O-modified RNA or affinity-plus-locked nucleobases into a chimeric antisense oligo that retains an RNase-H activation domain. A standard gapmer retains a central region of PS-modified DNA bases sufficient to induce RNase H cleavage. These bases are flanked on either side by blocks of 2' modifications that increase binding affinity to the target. For example, gapmers can contain a central section of deoxynucleotides that allows induction of RNase H cleavage, and the central portion is flanked by a block of 2'-O-alkyl-modified ribonucleotides that protect the central section from nuclease degradation. Once delivered to a cell, the ASO enters the nucleus and binds to the complementary endogenous RNA target. Hybridization of the ASO gapmer to the target RNA forms a DNA:RNA heteroduplex in the central region that becomes a substrate for cleavage by the enzyme RNase H1.

[0169] In one example, a 5-10-5 gapmer ASO is used, which contains 5' and 3' wings of five chemically modified nucleotides flanking a central 10 nucleotide core of DNA. In a particular example, a 5-10-5 gapmer ASO is used, which contains a phosphorothioate backbone, 2' methoxyethyl modified bases in the wings (5 nucleotides from each end), and a 10 nucleotide core of unmodified DNA bases. See, for example, Figure 40.

[0170] In one example, an ASO targeting mBanf1 can include a modified version of a parent antisense RNA sequence set forth in any one of SEQ ID NOs: 215-236. In another example, an ASO targeting mBanf1 can include a modified version of a parent antisense RNA sequence set forth in any one of SEQ ID NOs: 215, 216, 220-223, 225, 230-232, 234, and 235. Such modifications can include, for example, one or more of the following: substitution of one or more RNA bases with one or more DNA bases, addition of one or more phosphorothioate linkages, or substitution of one or more bases with modified RNA, such as, for example, 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-plus locked nucleobases. In one example, an ASO targeting mBanf1 can include a sequence set forth in any one of SEQ ID NOs: 105-126, or a modified version thereof. In another example, an ASO targeting mBanf1 can include a sequence set forth in any one of SEQ ID NOs: 105, 106, 110-113, 115, 120-122, 124, and 125, or a modified version thereof. Such modifications can include, for example, the addition of one or more phosphorothioate bonds and / or the replacement of one or more bases with modified RNA bases, such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-plus locked nucleobases. In another example, an ASO targeting mBanf1 can include any of the sequences and / or modification patterns set forth in Table 13. In any of the above sequences, any "T" in the first 5 nucleotides or the last 5 nucleotides can be replaced with "U".

[0171] In one example, an ASO targeting mPpp2ca can include a modified version of a parent antisense RNA sequence set forth in any one of SEQ ID NOs: 237-278. In another example, an ASO targeting mPpp2ca can include a modified version of a parent antisense RNA sequence set forth in any one of SEQ ID NOs: 240, 243, 246, 247, 260, 262, 263, 265, 268-270, 272, 275, and 276. Such modifications can include, for example, one or more of the following: substitution of one or more RNA bases with one or more DNA bases, addition of one or more phosphorothioate linkages, or substitution of one or more bases with modified RNA, such as, for example, 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity plus locked nucleobases. In one example, an ASO targeting mPpp2ca can include a sequence set forth in any one of SEQ ID NOs: 127-168, or a modified version thereof. In another example, an ASO targeting mPpp2ca can include a sequence set forth in any one of SEQ ID NOs: 130, 133, 136, 137, 150, 152, 153, 155, 158-160, 162, 165, and 166, or a modified version thereof. Such modifications can include, for example, the addition of one or more phosphorothioate linkages and / or the replacement of one or more bases with modified RNA bases, such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-plus locked nucleobases. In another example, an ASO targeting mPpp2ca can include any of the sequences and / or modification patterns set forth in Table 14. In any of the above sequences, any "T" in the first 5 nucleotides or the last 5 nucleotides can be replaced with a "U".

[0172] In one example, an ASO targeting mAnkle2 can include a modified version of a parent antisense RNA sequence set forth in any one of SEQ ID NOs: 279-324. In another example, an ASO targeting mAnkle2 can include a modified version of a parent antisense RNA sequence set forth in any one of SEQ ID NOs: 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321, and 323. Such modifications can include, for example, one or more of the following: substitution of one or more RNA bases with one or more DNA bases, addition of one or more phosphorothioate linkages, or substitution of one or more bases with modified RNA, such as, for example, 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-plus locked nucleobases. In one example, an ASO targeting mAnkle2 can include a sequence set forth in any one of SEQ ID NOs: 169-214, or a modified version thereof. In another example, an ASO targeting mAnkle2 can include a sequence set forth in any one of SEQ ID NOs: 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, and 213, or a modified version thereof. Such modifications can include, for example, the addition of one or more phosphorothioate bonds and / or the replacement of one or more bases with modified RNA bases, such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-plus locked nucleobases. In another example, an ASO targeting mAnkle2 can include any of the sequences and / or modification patterns set forth in Table 15. In any of the above sequences, any "T" in the first 5 nucleotides or the last 5 nucleotides can be replaced with "U".

[0173] III. Methods for Producing Improved Tauopathy Models and for Accelerating Tau Aggregation in Tauopathy Models Also provided are methods of making improved tauopathy models, which are disclosed in detail elsewhere herein. Such methods can start with an existing tauopathy model (e.g., a transgenic cell, tissue, or animal that contains an exogenous human tau coding sequence). That is, such methods can be methods for accelerating or exacerbating tau aggregation in an existing tauopathy model (e.g., a tauopathy model non-human animal, a tauopathy model animal tissue, or a tauopathy model animal cell). For example, such methods can include introducing one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 into an existing tauopathy model cell(s), tissue, or animal (e.g., a non-human animal, animal tissue, or animal cell population that contains an exogenous human microtubule-associated protein tau coding sequence). Any of the tauopathy models discussed in more detail elsewhere herein can be used.

[0174] Various models of tauopathy have been developed.These include cell / cell culture models (non-neuronal cell lines, neuronal cell lines such as PC12, SY5Y, CN1.4 cells, primary neuronal cells), tissue models (e.g., brain slice cultures such as organotypic brain slice cultures), and whole animal transgenic models (e.g., nematodes, fruit flies, zebrafish, or mice).See, for example, Hall et al.(2005) Biochim.Biophys.Acta 1739:224-239, Brandt et al.(2005) Biochim.Biophys.Acta 1739:331-354, and Lee et al.(2005) Biochim.Biophys.Acta 1739:251-259, each of which is incorporated herein by reference in its entirety for all purposes. Typically, such models are transgenic models in which wild-type or mutant human tau isoforms are overexpressed under the control of various promoters to induce neurofibrillary tangles. While cell-based models have the advantage of being more accessible and flexible for manipulation, whole animal models (e.g. transgenic mouse models) are more complete and more directly relevant to human disease.

[0175] One specific tauopathy model is the PS19 (Tau P301S (line PS19); PS19Tg; B6; C3-Tg (Prnp-MAPT*P301S) PS19Vle / J) mouse line. The genetic background of this line is C57BL / 6xC3H. PS19 transgenic mice express mutant human microtubule-associated protein tau MAPT driven by the mouse prion protein (Prnp) promoter. The transgene encodes the disease-associated P301S mutation and contains four microtubule-binding domains and one N-terminal insert (4R / 1N). The transgene was inserted at Chr3:140354280-140603283 (build GRCm38 / mm10), resulting in a 249 Kb deletion that does not affect any known genes. See Goodwin et al. (2019) Genome Res. 29(3):494-505, which is incorporated by reference in its entirety for all purposes. Expression of mutant human tau is 5-fold higher than that of the endogenous mouse protein. See Yoshiyama et al. (2007) Neuron 53(3):337-351, which is incorporated by reference in its entirety for all purposes. PS19 mice develop neuronal loss and brain atrophy by 8 months of age. They also develop extensive tau aggregates, known as neurofibrillary tangle-like inclusions, in the neocortex, amygdala, hippocampus, brainstem, and spinal cord. See Yoshiyama et al. (2007). Prior to the appearance of overt tau pathology by histological methods, the brains of these mice have been shown to exhibit tau seeding activity. That is, tau aggregates present in brain homogenates can induce further tau aggregation, possibly via a prion-like mechanism. See Holmes (2014) Proc. Natl. Acad. Sci. USA 111(41):E4376-E4385, which is incorporated by reference in its entirety for all purposes.

[0176] Other such methods can include introducing one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 into a non-human animal, animal tissue, or population of animal cells, as well as introducing an exogenous microtubule-associated protein tau coding sequence (e.g., an exogenous human microtubule-associated protein tau coding sequence). Examples of such coding sequences are discussed in more detail elsewhere herein, such as in the section on improved tauopathy models. Any such sequence can be used.

[0177] The agent (and optionally the tau coding sequence) can be introduced by any known means. "Introducing" includes presenting the agent (e.g., nucleic acid or protein) to a cell or animal in such a way that the sequence gains access to the interior of a cell(s) or cell(s) within the tissue or animal. The methods provided herein do not depend on a particular method for introducing the agent, only on the nucleic acid or protein gaining access to the interior of at least one cell. Methods for introducing nucleic acids and proteins into various cell types are known, and include, for example, stable transfection methods, transient transfection methods, and virus-mediated methods.

[0178] Molecules (e.g., Cas proteins or guide RNAs or RNAi agents or ASOs) introduced into non-human animals or cells can be provided in compositions that include carriers that increase the stability of the introduced molecule (e.g., extend the period during which degradation products remain below a threshold value, e.g., below 0.5% by weight of the starting nucleic acid or protein, under given storage conditions (e.g., −20° C., 4° C., or ambient temperature), or increase stability in vivo). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic-acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochleates, and lipid microtubules.

[0179] In order to allow the introduction of molecules (e.g., nucleic acid or protein) into cells or non-human animals, various methods and compositions are provided herein.Methods for introducing molecules into various cell types are known, including, for example, stable transfection methods, transient transfection methods, and virus-mediated methods.

[0180] Transfection protocols and protocols for introducing molecules (e.g., nucleic acids or proteins) into cells can vary. Non-limiting transfection methods include chemical-based transfection methods using liposomes, nanoparticles, calcium phosphate (Graham et al. (1973) Virology 52(2):456-67, Bacchetti et al. (1977) Proc. Natl. Acad. Sci. USA 74 (4): 1590-4, and Kriegler, M (1991). Transfer and Expression: A Laboratory Manual. New York: WH Freeman and Company. pp.96-97, each of which is incorporated herein by reference in its entirety for all purposes), dendrimers, or cationic polymers such as DEAE-dextran and polyethyleneimine. Non-chemical methods include electroporation, sonoporation, and phototransfection. Particle-based transfection includes the use of a gene gun or magnet-assisted transfection (Bertram (2006) Current Pharmaceutical Biotechnology 7, 277-28, incorporated herein by reference in its entirety for all purposes). Viral methods can also be used for transfection.

[0181] The introduction of molecules (e.g., nucleic acids or proteins) into cells can also be mediated by electroporation, intracytoplasmic injection, viral infection, adenovirus, adeno-associated virus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or nucleofection. Nucleofection is an improved electroporation technique that allows nucleic acid substrates to be delivered not only to the cytoplasm but also to the nucleus through the nuclear membrane. Furthermore, the use of nucleofection in the methods disclosed herein typically requires much fewer cells than regular electroporation (e.g., only about 2 million versus 7 million for regular electroporation). In one example, nucleofection is performed using the LONZA® NUCLEOFECTOR™ system.

[0182] The introduction of molecules (e.g., nucleic acids or proteins) into cells can also be achieved by microinjection. Microinjection of mRNA is preferably into the cytoplasm (e.g., to deliver mRNA directly to the translation machinery), while microinjection of proteins or DNA encoding proteins is preferably into the nucleus. Alternatively, microinjection can be performed by injection into both the nucleus and the cytoplasm, where the needle can be first introduced into the nucleus and the first amount can be injected, and the second amount can be injected into the cytoplasm while the needle is removed from the cell. Methods for performing microinjection are well known. See, e.g., Nagy et al. (Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003, Manipulating the Mouse Embryo. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press), Meyer et al. (2010) Proc. Natl. Acad. Sci. USA 107:15022-15026, and Meyer et al. (2012) Proc. Natl. Acad. Sci. USA 109:9354-9359, each of which is incorporated by reference in its entirety for all purposes.

[0183] Other methods for introducing molecules (e.g., nucleic acids or proteins) into cells may include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, cell-penetrating peptide-mediated delivery, or implantable device-mediated delivery. Methods for administering nucleic acids or proteins to a subject to modify cells in vivo are disclosed elsewhere herein. As specific examples, molecules (e.g., nucleic acids or proteins) can be introduced into cells or non-human animals in carriers such as poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochleates, or lipid microtubules. Some specific examples of delivery to non-human animals include hydrodynamic delivery, virus-mediated delivery (e.g., adeno-associated virus (AAV)-mediated delivery), and lipid nanoparticle-mediated delivery.

[0184] In one example, the agent (and optionally the tau coding sequence) can be introduced via viral transduction, such as lentiviral or adeno-associated viral transduction.

[0185] In some methods, components of the CRISPR / Cas system are introduced into a non-human animal or cell. Guide RNA can be introduced into a non-human animal or cell in the form of RNA (e.g., in vitro transcribed RNA) or in the form of DNA encoding the guide RNA. When introduced in the form of DNA, the DNA encoding the guide RNA can be operably linked to a promoter active in the cells of the non-human animal. For example, the guide RNA can be delivered via AAV and expressed in vivo under the U6 promoter. Such DNA can be in one or more expression constructs. For example, such an expression construct can be a component of a single nucleic acid molecule. Alternatively, they can be separated in any combination between two or more nucleic acid molecules (i.e., the DNA encoding one or more CRISPR RNAs and the DNA encoding one or more tracrRNAs can be components of separate nucleic acid molecules).

[0186] Similarly, the Cas protein may be provided in any form. For example, the Cas protein may be provided in the form of a protein, such as a Cas protein complexed with a gRNA. Alternatively, the Cas protein may be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Cas protein may be codon-optimized for efficient translation into protein in a particular cell or organism. For example, the nucleic acid encoding the Cas protein may be modified to alternative codons that are more frequently used in mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest, compared to the naturally occurring polynucleotide sequence. When the nucleic acid encoding the Cas protein is introduced into a non-human animal, the Cas protein may be expressed in the cell transiently, conditionally, or constitutively.

[0187] The nucleic acid encoding the Cas protein or guide RNA may be operably linked to a promoter in an expression construct. An expression construct includes any nucleic acid construct that can direct the expression of a gene or other nucleic acid sequence of interest (e.g., Cas gene) and transfer such a nucleic acid sequence of interest to a target cell. For example, the nucleic acid encoding the Cas protein may be present in a vector that includes DNA encoding one or more gRNAs. Alternatively, it may be a vector or plasmid separate from the vector that includes DNA encoding one or more gRNAs. Suitable promoters that can be used in the expression construct include, for example, promoters active in one or more of eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, rabbit cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or one-cell stage embryos. Such promoters may be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter may be a bidirectional promoter that drives the expression of both the Cas protein in one direction and the guide RNA in the other direction. Such a bidirectional promoter may consist of (1) a complete conventional unidirectional Pol III promoter that includes three external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box, and (2) a second basic Pol III promoter that includes a PSE and a TATA box fused in reverse orientation to the 5' end of the DSE. For example, in the H1 promoter, the DSE is adjacent to the PSE and TATA box, and the promoter can be made bidirectional by creating a hybrid promoter in which transcription in the reverse orientation is controlled by adding a PSE and a TATA box from the U6 promoter. See, for example, US2016 / 0074535, which is incorporated by reference in its entirety for all purposes.Bidirectional promoters can be used to simultaneously express genes encoding Cas proteins and guide RNAs, generating compact expression cassettes to facilitate delivery.

[0188] Introduction of the nuclease agent can also be achieved by virus-mediated delivery, such as AAV-mediated delivery or lentivirus-mediated delivery. Other exemplary viruses / viral vectors include retroviruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses. The viruses can infect dividing cells, non-dividing cells, or both dividing and non-dividing cells. The viruses may integrate into the host genome, or alternatively may not integrate into the host genome. Such viruses can also be engineered to be immunocompromised. The viruses may be replication competent or replication deficient (e.g., defective in one or more genes required for additional rounds of virion replication and / or packaging). The viruses may cause transient expression, long-term expression (e.g., at least 1 week, 2 weeks, 1 month, 2 months, or 3 months), or permanent expression (e.g., of Cas9 and / or gRNA). Exemplary viral titers (e.g., AAV titers) include titers of about 10 12 , about 10 13 , about 10 14 , about 10 15 , and about 10 16 Other exemplary viral titers (e.g., AAV titers) include about 10 12 , about 10 13 , about 10 14 , about 10 15 , and about 10 16 Vector genome (vg) / kg body weight.

[0189] The ssDNA AAV genome consists of two open reading frames, Rep and Cap, flanked by two terminal inverted sequences that allow synthesis of a complementary DNA strand. When constructing an AAV transfer plasmid, the transgene is placed between the two ITRs, and Rep and Cap are supplied in trans. In addition to Rep and Cap, AAV may require a helper plasmid containing genes from adenovirus. These genes (E4, E2a, and VA) mediate AAV replication. For example, the transfer plasmid, Rep / Cap, and helper plasmid can be transfected into HEK293 cells containing adenovirus genes E1+ to generate infectious AAV particles. Alternatively, Rep, Cap, and adenovirus helper genes can be combined into a single plasmid. Similar packaging cells and methods can be used for other viruses, such as retroviruses.

[0190] Multiple serotypes of AAV have been identified. These serotypes differ in the type of cells they infect (i.e., their tropism), allowing preferential transduction of certain cell types. Serotypes for CNS tissues include AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9. Serotypes for cardiac tissues include AAV1, AAV8, and AAV9. Serotypes for kidney tissues include AAV2. Serotypes for lung tissues include AAV4, AAV5, AAV6, and AAV9. Serotypes for pancreatic tissues include AAV8. Serotypes for photoreceptor cells include AAV2, AAV5, and AAV8. Serotypes for retinal pigment epithelium tissues include AAV1, AAV2, AAV4, AAV5, and AAV8. Serotypes for skeletal muscle tissues include AAV1, AAV6, AAV7, AAV8, and AAV9. Serotypes for liver tissue include AAV7, AAV8, and AAV9, especially AAV8. The selectivity of AAV serotypes for gene delivery in neurons is discussed, for example, in Hammond et al. (2017) PLoS One 12(12):e0188830, which is incorporated herein by reference in its entirety for all purposes.

[0191] Tropism can be further refined by pseudotyping, which is a mixture of capsids and genomes from different viral serotypes. For example, AAV2 / 5 denotes a virus containing a serotype 2 genome packaged in a serotype 5 capsid. The use of pseudotyped viruses can not only improve transduction efficiency but also alter tropism. Hybrid capsids derived from different serotypes can also be used to modify viral tropism. For example, AAV-DJ contains hybrid capsids from eight serotypes and displays high infectivity across a wide range of cell types in vivo. AAV-DJ8 is another example that displays the properties of AAV-DJ but with enhanced brain uptake. AAV serotypes can also be modified by mutations. Examples of mutational modifications in AAV2 include Y444F, Y500F, Y730F, and S662V. Examples of mutational modifications in AAV3 include Y705F, Y731F, and T492V. Examples of mutational modifications of AAV6 include S663V and T492V. Other pseudotype / modified AAV variants include AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, AAV8.2, and AAV / SASTG.

[0192] To accelerate transgene expression, self-complementary AAV (scAAV) variants can be used. AAV relies on the cell's DNA replication machinery to synthesize a complementary strand of the AAV's single-stranded DNA genome, which can delay transgene expression. To address this delay, scAAV can be used, which contain complementary sequences that can spontaneously anneal upon infection, eliminating the need for host cell DNA synthesis. However, single-stranded AAV (ssAAV) vectors can also be used.

[0193] To increase packaging capacity, a longer transgene can be split into two AAV transfer plasmids, one a 3' splice donor and the second a 5' splice acceptor. Upon co-infection of cells, these viruses can form concatemers and be spliced ​​together to express the full-length transgene. This allows for expression of longer transgenes, but at a reduced efficiency of expression. A similar method to increase capacity utilizes homologous recombination. For example, a transgene can be split into two transfer plasmids, but with substantial sequence overlap, such that co-expression induces homologous recombination and expression of the full-length transgene.

[0194] Introduction of nucleic acids and proteins can also be achieved by lipid nanoparticle (LNP)-mediated delivery. For example, LNP-mediated delivery can be used to deliver a combination of Cas mRNA and guide RNA, or a combination of Cas protein and guide RNA. Delivery by such methods may result in transient Cas expression, and biodegradable lipids may improve clearance, improve tolerability, and reduce immunogenicity. Lipid formulations can protect biomolecules from degradation while at the same time improving cellular uptake. Lipid nanoparticles are particles that contain multiple lipid molecules physically bound to each other by intermolecular forces. These include microspheres (including unilamellar and multilamellar vesicles, e.g., liposomes), the dispersed phase in an emulsion, micelles, or the internal phase in a suspension. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins for delivery. Formulations containing cationic lipids are useful for delivering polyanions, such as nucleic acids. Other lipids that can be included are neutral lipids (i.e., uncharged or zwitterionic lipids), anionic lipids, helper lipids that enhance transfection, and stealth lipids that increase the time that the nanoparticles can exist in vivo. Examples of suitable cationic lipids, neutral lipids, anionic lipids, helper lipids, and stealth lipids can be found in WO2016 / 010840A1, which is incorporated by reference in its entirety for all purposes. Exemplary lipid nanoparticles can include cationic lipids and one or more other components. In one example, the other components can include a helper lipid, such as cholesterol. In another example, the other components can include a helper lipid, such as cholesterol, and a neutral lipid, such as DSPC. In another example, the other components can include a helper lipid, such as cholesterol, any neutral lipid, such as DSPC, and a stealth lipid, such as S010, S024, S027, S031, or S033.

[0195] LNPs may include one or more or all of the following: (i) lipids for encapsulation and endosomal escape, (ii) neutral lipids for stabilization, (iii) helper lipids for stabilization, and (iv) stealth lipids. See, for example, Finn et al. (2018) Cell. 22(9):2227-2235 and WO2017 / 173054A1, each of which is incorporated by reference in its entirety for all purposes. In certain LNPs, the cargo may include a guide RNA or a nucleic acid encoding a guide RNA. In certain LNPs, the cargo may include an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA or a nucleic acid encoding a guide RNA.

[0196] The lipid for encapsulation and endosomal escape can be a cationic lipid. The lipid can also be a biodegradable lipid, such as a biodegradable ionizable lipid. One example of a suitable lipid is lipid A or LP01, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate. See, for example, Finn et al. (2018) Cell. 22(9):2227-2235 and WO2017 / 173054A1, each of which is incorporated by reference in its entirety for all purposes. Another example of a suitable lipid is lipid B, which is ((5-((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate), also known as ((5-((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate). Another example of a suitable lipid is lipid C, which is 2-((4-(((3-(dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1,3-diyl(9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12-dienoate). Another example of a suitable lipid is lipid D, which is 3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl 3-octylundecanoate. Other suitable lipids include heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (also known as Dlin-MC3-DMA(MC3)).

[0197] Some of such lipids suitable for use in the LNPs described herein are biodegradable in vivo. For example, LNPs containing such lipids include those in which at least 75% of the lipid is cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days. As another example, at least 50% of the LNP is cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days.

[0198] Such lipids may be ionizable depending on the pH of the medium in which they are contained. For example, in a slightly acidic medium, the lipids may be protonated and thus positively charged. Conversely, in a slightly basic medium, such as blood, which has a pH of about 7.35, the lipids may not be protonated and therefore may not be charged. In some embodiments, the lipids may be protonated at a pH of at least about 9, 9.5, or 10. The ability of such lipids to be charged is related to their inherent pKa. For example, the lipids may independently have a pKa ranging from about 5.8 to about 6.2.

[0199] The neutral lipids function to stabilize the LNPs and improve their processing. Examples of suitable neutral lipids include a variety of neutral, uncharged, or zwitterionic lipids. Examples of neutral phospholipids suitable for use in the present disclosure include 5-heptadecylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), phosphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearoylphosphatidylcholine (PMP ...

[0033] Examples of phosphatidylcholine include, but are not limited to, palmitoyl oleoyl phosphatidylcholine (PSPC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoylphosphatidylcholine (POPC), lysophosphatidylcholine, dioleoylphosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), palmitoyloleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine and combinations thereof. For example, the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC), and dimyristoylphosphatidylethanolamine (DMPE).

[0200] Helper lipids include lipids that promote transfection. The mechanism by which helper lipids enhance transfection may include enhancing particle stability. In some cases, helper lipids can enhance membrane fusogenicity. Helper lipids include steroids, sterols, and alkylresorcinols. Examples of suitable helper lipids include cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In one example, the helper lipid can be cholesterol or cholesterol hemisuccinate.

[0201] Stealth lipids include lipids that change the length of time that nanoparticles can exist in vivo. Stealth lipids are useful in formulation processes, for example, by reducing particle aggregation and controlling particle size. Stealth lipids can modulate the pharmacokinetic properties of LNPs. Suitable stealth lipids include lipids that have a hydrophilic head group linked to the lipid moiety.

[0202] The hydrophilic head group of the stealth lipid may comprise a polymer moiety selected from, for example, PEG (often referred to as poly(ethylene oxide)), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N-vinylpyrrolidone), polyamino acids, and poly(N-(2-hydroxypropyl)methacrylamide)-based polymers. The term PEG refers to polyethylene glycol or other polyalkylene ether polymers. In certain LNP formulations, the PEG is PEG-2K, also referred to as PEG2000, with an average molecular weight of about 2,000 daltons. See, for example, WO2017 / 173054A1, which is incorporated herein by reference in its entirety for all purposes.

[0203] The lipid portion of the stealth lipid may be derived from a diacylglycerol or diacylglycamide, including, for example, those containing a dialkylglycerol or dialkylglycamide group having an alkyl chain length containing, independently, from about C4 to about C40 saturated or unsaturated carbon atoms, where the chain may contain one or more functional groups, such as, for example, an amide or ester. The dialkylglycerol or dialkylglycamide group may further contain one or more substituted alkyl groups.

[0204] As an example, stealth lipids include PEG-dilaurylglycerol, PEG-dimyristoylglycerol (PEG-DMG), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE), PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, and PEG-distearoylglycamide, PEG-cholesterol (l-[8'-(cholest-5-en-3[beta]-oxy)carboxamido-3',6'-dioxaotanyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4-ditetradecoxybenzyl-[omega]-methyl-poly(ethylene glycol)), and PEG-DMB (3,4-ditetradecoxybenzyl-[omega]-methyl-poly(ethylene glycol)). The stealth lipid may be selected from 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG2k-DSG), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DMA), and 1,2-distearyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSA). In one specific example, the stealth lipid may be PEG2k-DMG.

[0205] LNPs can include different molar ratios of each of the component lipids in the formulation. The mol% of CCD lipids can be, for example, about 30 mol% to about 60 mol%, about 35 mol% to about 55 mol%, about 40 mol% to about 50 mol%, about 42 mol% to about 47 mol%, or about 45%. The mol% of helper lipids can be, for example, about 30 mol% to about 60 mol%, about 35 mol% to about 55 mol%, about 40 mol% to about 50 mol%, about 41 mol% to about 46 mol%, or about 44 mol%. The mol% of neutral lipids can be, for example, about 1 mol% to about 20 mol%, about 5 mol% to about 15 mol%, about 7 mol% to about 12 mol%, or about 9 mol%. The molar percentage of the stealth lipid can be, for example, about 1 molar percentage to about 10 molar percentage, about 1 molar percentage to about 5 molar percentage, about 1 molar percentage to about 3 molar percentage, about 2 molar percentage, or about 1 molar percentage.

[0206] LNPs can have different ratios between the positively charged amine groups of the biodegradable lipids (N) and the negatively charged phosphate groups of the encapsulated nucleic acid (P). This can be mathematically represented by the equation N / P. For example, the N / P ratio can be about 0.5 to about 100, about 1 to about 50, about 1 to about 25, about 1 to about 10, about 1 to about 7, about 3 to about 5, about 4 to about 5, about 4, about 4.5, or about 5. The N / P ratio can also be about 4 to about 7 or about 4.5 to about 6. In certain examples, the N / P ratio can be 4.5 or 6.

[0207] In some LNPs, the cargo can include Cas mRNA and gRNA. The Cas mRNA and gRNA can be in different ratios. For example, the LNP formulation can include a ratio of Cas mRNA to gRNA ranging from about 25:1 to about 1:25, from about 10:1 to about 1:10, from about 5:1 to about 1:5, or about 1:1. Alternatively, the LNP formulation can include a ratio of Cas mRNA to gRNA nucleic acid ranging from about 1:1 to about 1:5, or about 10:1. Alternatively, the LNP formulation can include a ratio of Cas mRNA to gRNA nucleic acid ranging from about 1:10, 25:1, 10:1, 5:1, 3:1, 1:1, 1:3, 1:5, 1:10, or 1:25. Alternatively, the LNP formulation can include a ratio of Cas mRNA to gRNA nucleic acid ranging from about 1:1 to about 1:2. In specific examples, the ratio of Cas mRNA to gRNA may be about 1:1 or about 1:2.

[0208] A specific example of using LNPs for delivery to the brain is disclosed in Nabhan et al. (2016) Sci. Rep. 6:20019, incorporated herein by reference in its entirety for all purposes.

[0209] In vivo administration can be by any suitable route, including, for example, parenteral, intravenous, oral, subcutaneous, intraarterial, intracranial, intrathecal, intraperitoneal, topical, intranasal, or intramuscular. Systemic administration modes include, for example, oral and parenteral routes. Examples of parenteral routes include intravenous, intraarterial, intraosseous, intramuscular, intradermal, subcutaneous, intranasal, and intraperitoneal routes. A specific example is intravenous injection. Intranasal injection and intravitreal injection are other specific examples. Local modes of administration include, for example, intrathecal, intracerebroventricular, intraparenchymal (e.g., localized intraparenchymal delivery to the striatum (e.g., into the caudate nucleus or putamen), cerebral cortex, precentral gyrus, hippocampus (e.g., dentate gyrus or CA3 region), temporal cortex, amygdala, frontal cortex, thalamus, cerebellum, medulla, thalamus, optic tectum, putamen, or parenchyma nigra), intraocular, intraorbital, subconjunctival, intravitreal, subretinal, and transscleral routes. Significantly smaller amounts of the components (compared to systemic approaches) may exert an effect when administered locally (e.g., intraparenchymal or intravitreal) compared to when administered systemically (e.g., intravenously). Local modes of administration may also reduce or eliminate the incidence of potentially toxic side effects that may occur when therapeutically effective amounts of the components are administered systemically. In certain examples, administration to animals is by intrathecal or intracranial injection (e.g., stereotactic surgery for injection into the hippocampus and other brain regions, or intracerebroventricular injection).

[0210] The frequency and number of doses may depend on the half-life and route of administration of the agent, among other factors. The introduction of the nucleic acid or protein into the cell or non-human animal may be performed one or more times over a period of time. For example, the introduction may be performed at least two times over a period of time, at least three times over a period of time, at least four times over a period of time, at least five times over a period of time, at least six times over a period of time, at least seven times over a period of time, at least eight times over a period of time, at least nine times over a period of time, at least ten times over a period of time, at least eleven times over a period of time, at least twelve times over a period of time, at least thirteen times over a period of time, at least fourteen times over a period of time, at least fifteen times over a period of time, at least sixteen times over a period of time, at least seventeen times over a period of time, at least eighteen times over a period of time, at least nineteen times over a period of time, or at least twenty times over a period of time.

[0211] Such methods may further include screening the cells, tissues, or animals to confirm the presence of one or more agents (and optionally the tau coding sequence). Screening of cells, tissues, or animals containing the agents (and optionally the tau coding sequence) may be carried out by any known means.

[0212] As an example, a reporter gene can be used to screen cells with a drug (or optionally a tau coding sequence). For example, the tau coding sequence can code for a tau protein fused to a reporter gene, such as a fluorescent protein. Exemplary reporter genes include those encoding luciferase, β-galactosidase, green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (eBFP), DsRed, ZsGreen, MmGFP, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, T-Sapphire, and alkaline phosphatase. For example, if the first and second reporters are fluorescent proteins (e.g., CFP and YFP), cells containing these reporters can be selected by flow cytometry to select double-positive cells. The double-positive cells can then be combined to generate polyclonal lines, or monoclonal lines can be generated from a single double-positive cell.

[0213] As another example, a selection marker can be used to screen for cells that have the agent (or optionally the tau coding sequence). Exemplary selection markers include neomycin phosphotransferase (neomycin phosphotransferase). r ), hygromycin B phosphotransferase (hyg r ), puromycin N-acetyltransferase (puro r ), blasticidin S deaminase (bsr r ), xanthine / guanine phosphoribosyltransferase (gpt), or herpes simplex virus thymidine kinase (HSV-k).

[0214] The cells or tissues can then be seeded with tau aggregates by any suitable means. This can be done, for example, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 2 weeks, or about 3 weeks in culture (e.g., about 1 week in culture) after introducing one or more agents (and optionally tau coding sequences). Alternatively, the cells or tissues can be seeded with tau aggregates before introducing one or more agents (and optionally tau coding sequences). For example, the cells or tissues can be treated with recombinant fibrillated tau (e.g., recombinant fibrillated tau repeat domains) to seed aggregates of tau repeat domain proteins stably expressed by these cells. Intercellular propagation of tau can also result from tau aggregation activity secreted by aggregate-containing cells. For example, the cells or tissues can be cultured using conditioned medium harvested from cultured tau aggregation-positive cells in which tau repeat domains are stably present in an aggregated state. Conditioned medium refers to spent medium harvested from cultured cells. It includes metabolites, growth factors, and extracellular matrix proteins secreted from cultured cells into the medium. As an example, conditioned medium can be generated by collecting medium on confluent tau aggregation-positive Agg[+] cells. The medium can be on confluent Agg[+] cells for about 12 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days. For example, the medium can be on confluent Agg[+] cells for about 1 to about 7, about 2 to about 6, about 3 to about 5, or about 4 days. The conditioned medium can then be combined with fresh medium and applied to cells or tissues. The ratio of conditioned medium to fresh medium can be, for example, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, or about 1:10. For example, the ratio of conditioned medium to fresh medium can be about 5:1 to about 1:1, about 4:1 to about 2:1, or about 3:1.For example, it may be about 90% conditioned medium and about 10% fresh medium, about 85% conditioned medium and about 15% fresh medium, about 80% conditioned medium and about 20% fresh medium, about 75% conditioned medium and about 25% fresh medium, about 70% conditioned medium and about 30% fresh medium, about 65% conditioned medium and about 35% fresh medium, about 60% conditioned medium and about 40% fresh medium, about 55% conditioned medium and about 45% fresh medium, about 50% conditioned medium and about 50% fresh medium. , about 45% conditioned medium and about 55% fresh medium, about 40% conditioned medium and about 60% fresh medium, about 35% conditioned medium and about 65% fresh medium, about 30% conditioned medium and about 70% fresh medium, about 25% conditioned medium and about 75% fresh medium, about 20% conditioned medium and about 80% fresh medium, about 15% conditioned medium and about 85% fresh medium, or about 10% conditioned medium and about 90% fresh medium. In one example, it may include culturing the genetically modified cell population in a medium that includes at least about 50% conditioned medium and about 50% or less fresh medium. In a particular example, it may include culturing the genetically modified cell population in about 75% conditioned medium and about 25% fresh medium.

[0215] Conditioned medium can be used without co-culture. Conditioned medium without co-culture has never been used in this context as a seeding agent before. However, conditioned medium is particularly useful for large-scale genome-wide screening because in vitro generated tau fibrils are of limited supply. Furthermore, conditioned medium is more physiologically relevant because it is produced by cells rather than in vitro. The use of conditioned medium as described herein provides a boost of tau seeding activity (e.g., about 0.1%, as measured by FRET induction as disclosed elsewhere herein) to sensitize cells to tau aggregation.

[0216] One or more signs or symptoms of tauopathy can then be evaluated by any suitable means. Examples of such signs and symptoms are discussed in more detail elsewhere herein, and include, for example, tau hyperphosphorylation or tau aggregation. Other signs and symptoms can include, for example, increased tau and / or phosphotau in the insoluble fraction after cell fractionation, increased phosphotau in the somatodendritic compartment of neurons, increased phosphotau in the perinuclear region of neurons, decreased nuclear to cytoplasmic ratio of nuclear pore complex protein Nup98-Nup96 (Nup98) in neurons, decreased nuclear to cytoplasmic ratio of GTP-binding nuclear protein Ran (Ran) in neurons, or decreased nuclear to cytoplasmic ratio of Ran GTPase activating protein 1 (RanGAP1) in neurons. Phosphotau can be, for example, phosphotau (S356) or phosphotau AT8 (S202, T205). This can be done, for example, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, or more after tau seeding or after introduction of the one or more agents (and optionally the tau coding sequence). For example, the assessment can be done about 2 weeks to about 6 weeks, or about 3 weeks to about 5 weeks after tau seeding or after introduction of the one or more agents (and optionally the tau coding sequence).

[0217] IV. METHODS OF TESTING CANDIDATE TAUOPHYTE TREATMENTS Various methods are provided for identifying or evaluating candidate therapeutic agents for the treatment of tauopathy using the improved tauopathy models disclosed in detail elsewhere herein. Such methods can include, for example, administering a candidate agent to an improved tauopathy model (e.g., an animal, tissue, or cell disclosed elsewhere herein) as disclosed elsewhere herein, performing one or more assays to determine whether the candidate agent has an effect on one or more signs or symptoms associated with the tauopathy, and identifying the candidate agent as a candidate therapeutic agent if it has an effect on one or more signs or symptoms associated with the tauopathy.

[0218] Any candidate agent can be tested. Such candidates can include, for example, large molecules or small molecules, such as siRNA, antibodies, or CRISPR / Cas gRNA. Candidate agents can be administered to non-human animals or non-human animal cells by any means via any suitable route.

[0219] Any assay that measures signs or symptoms associated with tauopathy can be used. Examples of such signs and symptoms are disclosed elsewhere herein. As a first example, the sign or symptom can be hyperphosphorylation of tau (e.g., AT8 staining, as described in the Examples). As a second example, the sign or symptom can be tau aggregation (e.g., Thioflavin S staining, as described in the Examples). Other signs and symptoms can include, for example, increased tau and / or phosphotau in the insoluble fraction after cellular fractionation, increased phosphotau in the somatodendritic compartment of neurons, increased phosphotau in the perinuclear region of neurons, decreased nuclear to cytoplasmic ratio of nuclear pore complex protein Nup98-Nup96 (Nup98) in neurons, decreased nuclear to cytoplasmic ratio of GTP-binding nuclear protein Ran (Ran) in neurons, or decreased nuclear to cytoplasmic ratio of Ran GTPase activating protein 1 (RanGAP1) in neurons. The phosphotau can be, for example, phosphotau (S356) or phosphotau AT8 (S202, T205).

[0220] A candidate agent can be administered to an animal in vivo, and one or more assays can be performed in the animal. Alternatively, a candidate agent can be administered to an animal in vivo, and one or more assays can be performed in vitro on cells isolated from the animal after administration of the candidate agent. Alternatively, a candidate agent can be administered to cells in vitro (e.g., neurons) or to tissues ex vivo (e.g., brain slices, such as organotypic brain slice cultures), and assays can be performed in cells in vitro or tissues ex vivo.

[0221] Optionally, cells or tissues can be seeded with tau aggregates by any suitable means before or after administering the candidate agent. For example, cells or tissues can be treated with recombinant fibrillated tau (e.g., recombinant fibrillated tau repeat domain) to seed aggregates of tau repeat domain proteins stably expressed by these cells. Intercellular propagation of tau can also result from tau aggregation activity secreted by aggregate-containing cells. For example, cells or tissues can be cultured using conditioned medium collected from cultured tau aggregation-positive cells in which tau repeat domains stably exist in an aggregated state. Conditioned medium refers to spent medium collected from cultured cells. It includes metabolites, growth factors, and extracellular matrix proteins secreted from cultured cells into the medium. As an example, conditioned medium can be generated by collecting medium on confluent tau aggregation-positive Agg[+] cells. The medium can be on the confluent Agg[+] cells for about 12 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days. For example, the medium can be on the confluent Agg[+] cells for about 1 to about 7, about 2 to about 6, about 3 to about 5, or about 4 days. The conditioned medium can then be combined with fresh medium and applied to the cells or tissue. The ratio of conditioned medium to fresh medium can be, for example, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, or about 1:10. For example, the ratio of conditioned medium to fresh medium can be about 5:1 to about 1:1, about 4:1 to about 2:1, or about 3:1.For example, it may be about 90% conditioned medium and about 10% fresh medium, about 85% conditioned medium and about 15% fresh medium, about 80% conditioned medium and about 20% fresh medium, about 75% conditioned medium and about 25% fresh medium, about 70% conditioned medium and about 30% fresh medium, about 65% conditioned medium and about 35% fresh medium, about 60% conditioned medium and about 40% fresh medium, about 55% conditioned medium and about 45% fresh medium, about 50% conditioned medium and about 50% fresh medium. , about 45% conditioned medium and about 55% fresh medium, about 40% conditioned medium and about 60% fresh medium, about 35% conditioned medium and about 65% fresh medium, about 30% conditioned medium and about 70% fresh medium, about 25% conditioned medium and about 75% fresh medium, about 20% conditioned medium and about 80% fresh medium, about 15% conditioned medium and about 85% fresh medium, or about 10% conditioned medium and about 90% fresh medium. In one example, it may include culturing the genetically modified cell population in a medium that includes at least about 50% conditioned medium and about 50% or less fresh medium. In a particular example, it may include culturing the genetically modified cell population in about 75% conditioned medium and about 25% fresh medium.

[0222] One or more signs or symptoms of tauopathy can then be evaluated by any suitable means at any suitable time after seeding or after administration of the candidate agent.This can be done, for example, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, or more after tau seeding or after administration of the candidate agent.For example, the evaluation can be done about 2 weeks to about 6 weeks, or about 3 weeks to about 5 weeks after tau seeding or after administration of the candidate agent.

[0223] All patent applications, websites, other publications, accession numbers, etc. cited above or below are incorporated herein by reference in their entirety for all purposes to the same extent as if each item was specifically and individually indicated to be incorporated by reference. Where different versions of a sequence are associated with an accession number at different times, it refers to the version associated with the accession number at the effective filing date of this application. The effective filing date refers to the filing date of the actual application or priority application prior to the accession number, if applicable. Similarly, where different versions of a publication, website, etc. are published at different times, it refers to the version published most recently before the effective filing date of this application, unless otherwise specified. Any feature, step, element, embodiment, or aspect of the invention can be used in combination with any other, unless otherwise indicated. The invention has been described in some detail through diagrams and examples for purposes of clarity and understanding, but it will be apparent that certain changes and modifications can be made within the scope of the appended claims.

[0224] A brief description of the sequence The nucleotide and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases and three-letter code for amino acids. The nucleotide sequences follow the standard convention of starting at the 5'-end of the sequence and proceeding forward (i.e., left to right on each line) to the 3'-end. Only one strand of each nucleotide sequence is shown, but the complementary strand is understood to be included by any reference to the strand shown. Where a nucleotide sequence encoding an amino acid sequence is provided, it is understood that codon-degenerate variants thereof that encode the same amino acid sequence are also provided. The amino acid sequences follow the standard convention of starting at the amino terminus of the sequence and proceeding forward (i.e., left to right on each line) to the carboxy terminus. [Table 2-1] [Table 2-2] [Table 2-3] EXAMPLES

[0225] Example 1. Development of a genome-wide CRISPR / Cas9 screening platform to identify genetic modifiers of tau aggregation Abnormal aggregation or fibrillization of proteins is a defining feature of many diseases, including several neurodegenerative disorders such as Alzheimer's disease (AD), Parkinson's disease (PD), frontotemporal dementia (FTD), amyotrophic lateral sclerosis (ALS), chronic traumatic encephalopathy (CTE), and Creutzfeldt-Jakob disease (CJD), among others. In many of these diseases, fibrillization of certain proteins into insoluble aggregates is not only a hallmark of the disease but also implicated as a causative factor of neurotoxicity. Moreover, these diseases are characterized by the propagation of the pathology of aggregation through the central nervous system following a stereotyped pattern, and this process is correlated with disease progression. Thus, the identification of genes and genetic pathways that alter the process of abnormal protein aggregation, or the intercellular propagation of aggregates, would be of great value in better understanding the pathogenesis of neurodegenerative diseases, as well as in devising strategies for therapeutic intervention.

[0226] To identify genes and pathways that modify the process of abnormal tau protein aggregation, a platform was developed to perform genome-wide screening using CRISPR nuclease (CRISPRn) sgRNA libraries to identify genes that regulate the likelihood of a cell to be "seeded" by tau disease-associated protein aggregates (i.e., genes that, when disrupted, render a cell more susceptible to tau aggregate formation when exposed to a source of tau fibrillizing protein). Identification of such genes may elucidate mechanisms of tau intercellular aggregate growth and genetic pathways that govern the susceptibility of neurons to form tau aggregates in the context of neurodegenerative disease.

[0227] The screen used a tau biosensor human cell line consisting of HEK293T cells stably expressing the tau 4-repeat domain, tau_4RD, which contains the tau microtubule-binding domain (MBD) with the P301S pathogenic mutation fused to either CFP or YFP. Briefly, the HEK293T cell line stably expresses two transgenes: tau_4RD, which contains the tau microtubule-binding domain (MBD) with the P301S pathogenic mutation fused to either the fluorescent protein CFP or the fluorescent protein YFP. 4RD -CFP / Tau 4RD -YFP (TCY), and the tau repeat domain (4RD) contains the P301S pathogenic mutation. See Figure 1. In these biosensor lines, aggregation of tau-CFP / tau-YFP proteins generates a FRET signal that is the result of the transfer of fluorescent energy from the donor CFP to the acceptor YFP. See Figure 2. FRET-positive cells containing tau aggregates can be sorted and isolated by flow cytometry. At baseline, unstimulated cells express the reporter in a stable soluble state with minimal FRET signal. Upon stimulation (e.g., liposomal transfection of seed particles), the reporter protein forms aggregates and generates a FRET signal. Aggregate-containing cells can be isolated by FACS. Stably growing aggregate-containing cell lines Agg[+] can be isolated by clonal serial dilution of the Agg[-] cell line.

[0228] Several modifications were made to this tau biosensor cell line to make it useful for genetic screening. First, these tau biosensor cells were modified by introducing a Cas9 expression transgene (SpCas9) via a lentiviral vector. Clonal transgenic cell lines expressing Cas9 were selected with blasticidin and isolated by clonal serial dilution to obtain single-cell derived clones. Clones were assessed for the level of Cas9 expression by qRT-PCR (Figure 3A) and DNA cleavage activity by digital PCR (Figure 3B). Relative Cas9 expression levels are also shown in Table 3. [Table 3]

[0229] Specifically, Cas9 mutation efficiency was assessed by digital PCR 3 and 7 days after transduction of lentiviruses encoding gRNAs against two selected target genes. Cleavage efficiency was limited by Cas9 levels in low-expressing clones. Clones with adequate levels of Cas9 expression were required to achieve maximal activity. Although several derived clones with lower Cas9 expression were unable to cleave the target sequences efficiently, clones with higher expression (including those used for screening) were able to generate mutations in the target sequences in the PERK and SNCA genes with approximately 80% efficiency after 3 days in culture. Efficient cleavage was already observed 3 days after gRNA transduction, with only minor improvement after 7 days. Clone 7B10-C3 was selected as a high-performing clone to be used in subsequent library screening.

[0230] Next, reagents and methods were developed to sensitize cells to tau seeding activity. Intercellular proliferation of tau can also result from tau aggregation activity secreted by aggregate-containing cells. To study the cellular proliferation of tau aggregates, subclones of a tau-YFP cell line were obtained consisting of HEK293T cells stably expressing the tau repeat domain, tau_4RD, containing the tau microtubule-binding domain (MBD) with the P301S pathogenic mutation fused to YFP. See Figure 5. Cells in which tau-YFP protein stably exists in an aggregated state (Agg[+]) were obtained by treating these tau-YFP cells with recombinant fibrillated tau mixed with Lipofectamine reagent to seed aggregates of tau-YFP protein stably expressed by these cells. The "seeded" cells were then serially diluted to obtain single cell-derived clones. These clones were then expanded to identify clonal cell lines in which Tau-YFP aggregates stably persisted in all cells, growing and passaged multiple times over time. One of these Tau-YFP_Agg[+] clones, Clone_18, was used to generate conditioned medium by collecting media present on confluent Tau-YFP_Agg[+] cells for 4 days. Conditioned medium (CM) was then applied to naive biosensor Tau-CFP / Tau-YFP cells at a ratio of 3:1 CM:fresh medium, allowing Tau aggregation to be induced in a small percentage of these recipient cells. Lipofectamine was not used. Lipofectamine was not used to make the assay as physiological as possible without tricking the recipient cells into forcing / increasing Tau aggregation using Lipofectamine. Conditioned medium consistently induced FRET in approximately 0.1% of cells, as measured by assessing the percentage of cells generating a FRET signal as a measure of aggregation using flow cytometry. See Figure 6. In conclusion, although tau-YFP_Agg[+] cells are unable to generate a FRET signal, they can provide a source of tau seeding.

[0231] Example 2. Genome-wide CRISPR / Cas9 screen to identify genetic modifiers of tau aggregation To reveal modifier genes of tau aggregation as enriched sgRNAs in FRET[+] cells, aggregate-free Cas9-expressing tau-CFP / tau-YFP biosensor cells (Agg[-]) were transduced with two human genome-wide CRISPR sgRNA libraries using a lentiviral delivery approach to introduce knockout mutations in each target gene. See Figure 4. Each CRISPR sgRNA library targets a 5' constitutive exon for functional knockout and covers an average of about 3 sgRNAs per gene (total of 6 gRNAs per gene in the two libraries combined). The distribution of read counts (i.e., representation of each gRNA in the libraries) was normal and similar for each library. The sgRNAs were designed to avoid off-target effects by avoiding sgRNAs with no more than two mismatches to off-target genomic sequences. The libraries cover 19,050 human genes and 1864 miRNAs, including 1000 non-targeting control sgRNAs. Libraries were transduced at a multiplicity of infection (MOI) <0.3 with a coverage of >300 cells per sgRNA. Tau biosensor cells were grown under puromycin selection to select for cells containing unique sgRNA integration and expression per cell. Puromycin selection began 24 hours after transduction at 1 μg / mL. Five independent screening replicates were used in the primary screen.

[0232] Samples of the complete transduced cell population were collected at cell passage 3 and 6 days after transduction. After passage 6 days, cells were grown in conditioned medium to sensitize to seeding activity. At day 10, a subpopulation of FRET[+] cells was specifically isolated using fluorescence-assisted cell sorting (FACS). See Figure 7. The screen consisted of five replicate experiments. DNA isolation and PCR amplification of the integrated sgRNA constructs allowed for characterization of the sgRNA repertoire at each time point by next-generation sequencing (NGS).

[0233] Statistical analysis of the NGS data allowed the identification of sgRNAs enriched in the FRET[+] subpopulation on day 10 of five experiments compared to the sgRNA repertoire at earlier time points on days 3 and 6. The concept of relative abundance and enrichment for NGS analysis is illustrated in Figure 8. The first strategy to identify potential tau modifiers was to use DNA sequencing to generate sgRNA read counts for each sample using the DESeq algorithm to find sgRNAs that were more abundant on day 10 vs. day 3 or day 10 vs. day 6 (but not day 6 vs. day 3) (fold change (fc) ≥ 1.5 and negative binomial test p < 0.01). Fc ≥ 1.5 means a ratio of (mean of day 10 counts) / (mean of day 3 or day 6 counts) ≥ 1.5. P < 0.01 means no statistical difference between day 10 and day 3 or day 6 counts < 0.01. The DESeq algorithm is a widely used algorithm for "differential expression analysis of sequence count data". See, e.g., Anders et al. (2010) Genome Biology 11:R106, incorporated by reference in its entirety for all purposes.

[0234] Specifically, significant sgRNAs were identified using two comparisons for each library: day 10 vs. day 3, and day 10 vs. day 6. For each of these four comparisons, the DESeq algorithm was used, and the cutoff thresholds for being considered significant were a fold change of ≧1.5 and a negative binomial test p<0.01. Once significant guides were identified in each of these comparisons for each library, genes were considered significant if they met either of the following two criteria: (1) at least two sgRNAs corresponding to that gene were considered significant in one comparison (either day 10 vs. day 3 or day 10 vs. day 6); and (2) at least one sgRNA was significant in both comparisons (day 10 vs. day 3 and day 10 vs. day 6). Using this algorithm, five genes were identified as significant from the first library and four genes were identified as significant from the second library. See Table 4. [Table 4]

[0235] However, the first strategy requires a certain level of read counts, and uniformity within each experimental group may be too stringent. For the same sgRNA, many factors could generate variations in read counts between samples (day 3, day 6, or day 10 samples) within each experimental group, including the initial virus count of the screening library, infection or gene editing efficiency, and relative growth rate after gene editing. Therefore, we also used the second strategy, based on the positive occurrence (read counts >30) of guides per gene in each sample on day 10 (post-selection) rather than the exact read counts. Given the library size (x), the number of guides per gene (n), and the total number of positive guides in the post-selection samples (m), we calculated a formal statistical p-value for positively observing the number of guides (n') in the post-selection samples (where "number" refers to sgRNA type (i.e., unique guide RNA sequence), not read counts) (p n’The probability that gene g exists through a mutation with more than n' guides was calculated as follows:

number

[0236] More specifically, the second strategy is a new and more sensitive analysis method for CRISPR positive selection. The goal of CRISPR positive selection is to use DNA sequencing to identify genes whose perturbation by sgRNAs is correlated with a phenotype. To reduce noise background, these experiments usually use multiple sgRNAs of the same gene together with experimental replicates. However, currently commonly used statistical analysis methods require a certain degree of uniformity / concordance between sgRNAs of the same gene as well as between technical replicates and do not perform well. This is because these methods cannot handle large variations between sgRNAs and replicates of the same gene for many possible reasons (e.g., different infection or gene editing efficiencies, initial virus counts in the screening library, and the presence of other sgRNAs with the same phenotype). In contrast, we developed a method that is robust against large variations. It is based on the positive occurrence of guides per gene in individual experiments, rather than on the exact read counts of each sgRNA. Considering the library size, the number of sgRNAs per gene, and the total number of positive sgRNAs in each experiment, a formal statistical p-value for the number of sgRNAs positively observed across experimental replicates is calculated. The relative sgRNA sequence read enrichment before and after phenotypic selection is also used as a parameter. This method performs better than the latest widely used methods such as DESeq, MAGECK, etc. Specifically, this method includes the following steps:

[0237] (1) For each experiment, identify any guides present in phenotypically positive cells.

[0238] (2) At the gene level, calculate the random probability that a guide is present in each experiment: nCn'*(x-n')C(mn) / xCm (where x is the various guides before phenotypic selection, m is the various guides after phenotypic selection, n is the various guides of the gene before phenotypic selection, and n' is the various guides of the gene after phenotypic selection). The overall probability of being present across multiple experiments is calculated by multiplying the above calculated probabilities from each experiment.

[0239] (3) Calculate the average enrichment of guides at gene level: enrichment score = relative abundance after selection / relative abundance before selection. Relative abundance = read count of guide for gene / read count of all guides.

[0240] (4) Select genes that are significantly below random probability of being present and above a certain enrichment score.

[0241] Fourteen of the target genes identified as enriched in FRET[+] cells by the two different approaches (either or both) were selected as top candidates for further validation after visual inspection based on read count data. See Table 5. Thirty individual sgRNAs were tested in a secondary screen for validation. A schematic of the secondary screen is shown in Figure 9, and the results are shown in Figure 10. Disruption of either BANF1 or PPP2CA by multiple tested sgRNAs increased the susceptibility of cells to form tau aggregates in response to a source of tau seeding activity (conditioned medium). Induction of FRET signal was increased 15-20 fold in cells with disruption of either of these two targets. Disruption of these two target genes increased the formation of tau aggregates in response to conditioned medium, but not to fresh medium. See Figure 11. [Table 5]

[0242] Further experiments were then performed with BANF1 and PPP2CA to further verify that targeting each gene promoted tau aggregation. See Figure 12. Two different sgRNAs against BANF1 were tested, and one sgRNA against PPP2CA was used. A non-targeting sgRNA was used as a negative control. Four independent lentiviral transductions were performed for each guide RNA on day 0. On day 6, tau seeding with conditioned medium was performed with or without lipofectamine, and samples were collected for qRT-PCR. The qRT-PCR data are shown in Figure 13. The two sgRNAs targeting BANF1 each reduced the expression of BANF1 mRNA, and the gRNA targeting PPP2CA reduced the expression of PPP2CA. On day 10, FACS analysis was performed to evaluate the induction of FRET signals. Tau aggregation was increased by each of the two sgRNAs targeting the target BANF1 and the gRNA targeting the target PPP2CA. See Figure 15. On day 13, samples were collected for Western blot analysis. Western blot results are shown in Figure 14. Antibodies used are shown in Table 6. Similar to the qRT-PCR experiments evaluating mRNA expression, barrier-to-autointegration factor (BANF1) protein expression is reduced by two sgRNAs targeting BANF1, and serine / threonine protein phosphatase 2A catalytic subunit alpha (PPP2CA) protein expression is reduced by an sgRNA targeting PPP2CA. [Table 6]

[0243] Further validation of BANF1 and PPP2CA as modifiers of tau aggregation was performed by isolating individual BANF1 knockdown clones and individual PPP2CA knockdown clones for validation. Aggregate-free Cas9-expressing tau-CFP / tau-YFP biosensor cells (Agg[-]) were transduced with lentivirus expressing sgRNA 1 for BANF1, sgRNA 5 for PPP2CA, or a non-targeting sgRNA. Serial clonal dilutions were then performed to select individual clones. BANF1 mRNA and PPP2CA mRNA levels were assessed by qRT-PCR (TaqMan qRT-PCR assays obtained from ThermoFisher, assay IDs Hs00427805_g1 and Hs00427260_m1), and barrier to autointegration factor (BANF1) protein and serine / threonine protein phosphatase 2A catalytic subunit alpha (PPP2CA) protein levels were assessed by western blot. Each BANF1 sgRNA clone reduced BANF1 mRNA expression (data not shown) and barrier to self-integration factor (BANF1) protein expression (Figure 16), and each PPP2CA sgRNA clone reduced PPP2CA mRNA expression (data not shown) and serine / threonine protein phosphatase 2A catalytic subunit alpha (PPP2CA) protein expression (Figure 16).

[0244] Tau expression and phosphorylation of tau were also assessed in each clone by Western blot. PPP2CA knockdown increased phospho-tau and tau levels. See Figure 17.

[0245] Each clone was then seeded in conditioned medium for 3 days and FRET analysis was performed to assess tau aggregation. The knockdown clones validate BANF1 and PPP2CA as modifiers of tau aggregation. See Figure 18. FRET enhancement was directly correlated with the degree of gene editing in BANF1 and PPP2CA mutant clones.

[0246] Then, each clone was further characterized by next generation sequencing to determine what modifications were made to the BANF1 and PPP2CA loci. The modifications are summarized in Table 7 below. Almost all mutant clones contain some proportion of wild-type alleles. The proportion of FRET(+) cells (tau aggregation activity) correlated with the proportion of insertions / deletions caused by non-homologous end joining at the break site (i.e., tau aggregation correlates inversely with the proportion of wild-type alleles, and the lower the proportion of wild-type alleles, the higher the proportion of Fret(+) cells). See Figure 16 and Table 7. [Table 7]

[0247] We investigated whether BANF1 and PPP2CA are involved in the same biological pathway or function using String, a software program based on protein-protein interaction networks. See Szklarczyk et al. (2015) Nucleic Acids Res. 43 (database issue): D447-D452, which is incorporated by reference in its entirety for all purposes. Using BANF1 and PPP2CA as input, we found a "catalysis" relationship between BANF1 and PPP2CA based on Reactome Pathways. See Figure 23. BANF1 also interacts with several proteins that play important roles in nuclear envelope biology. These targets were tested as potential modifiers of tau aggregation.

[0248] Cas9-expressing tau biosensor cells were transduced with lentiviral vectors containing sgRNAs targeting these genes of interest. The target sequences of these sgRNAs are shown in Table 8. Antibiotic selection was initiated after 24 hours. After 1 week of culture, conditioned medium (CM) collected after 3 days at confluence tau-YFP (Agg[+]) was applied to the transduced cells as 75% CM / 25% fresh medium, and seeding activity was assessed as the percentage of FRET[+] cells. Knockdown of specific targets was assessed by qRT-PCR. As expected, disruption of BANF1 or PPP2CA enhanced tau aggregation. Disruption of ANKLE2 also promoted tau aggregation. See Figure 19. ANKLE2 is the only LEM domain protein that localizes to both the endoplasmic reticulum and the inner nuclear membrane. [Table 8]

[0249] Next, genes in the BANF1 / PPP2CA interaction network were further evaluated. In particular, ANKLE2, EMD, and VRK1 were evaluated. To evaluate genes in the BANF1 / PPP2CA interaction network, sgRNAs targeting ANKLE2, EMD, or VRK1 were tested in non-targeting clones 4-1 and 4-19. The percentage of FRET[+] cells was assessed after 3 days of conditioned media. Disruption of genes in the BANF1 / PPP2CA interaction network revealed ANKLE2 as a modifier of tau aggregation (see Figure 20) and VRK1 as an enhancer of BANF1-induced aggregation (data not shown).

[0250] This further supported the link between tau aggregation and the BANF1 / PPP2CA pathway regulating nuclear membrane integrity. Consistent with this, lamin staining revealed abnormal nuclear membranes in BANF1 and ANKLE2 knockdown dCas9-KRAB expressing tau biosensor cell clones compared to non-targeted clones, and similar results were observed in BANF1 and ANKLE2 mutant Cas9 expressing tau biosensor cell clones compared to non-targeted clones (data not shown). BANF1 interacts with lamin A / C and lamin B1, two major components of the nuclear lamina. Recent studies have linked abnormal morphology of the nuclear lamina to the neurodegenerative processes of FTD and AD. Disruption of the lamin nucleoskeleton causes heterochromatin relaxation and neuronal cell death in Drosophila models of tauopathy. Lamin pathology is preserved in postmortem AD brains. Following transduction of tau biosensor cells expressing dCas9-KRAB, knockdown clones of BANF1 and ANKLE2 were isolated. Lamin staining revealed abnormal nuclear membranes in these BANF1 and ANKLE2 knockdown clones compared to clones transduced and selected for non-targeting sgRNA (data not shown). The striking abnormalities in the shape of the nuclear lamina are similar to those recently reported in FTD neurons.

[0251] Nuclear pore complex (NPC) abnormalities and resulting nucleocytoplasmic transport (NCT) defects contribute to the pathogenesis of mouse models of tauopathy. NPC disruption and functional nuclear transport may also be present in cells containing hyperphosphorylated tau in human neurons, as well as in mouse and cellular models of tauopathy. Nuclear pore and nuclear envelope defects may represent a common mechanism of neurodegeneration in ALS / FTD and Huntington's disease.

[0252] Immunostaining for the GTP-binding nuclear proteins Ran (Ran), Ran GTPase-activating protein 1 (RanGAP1), and regulator of chromosome condensation (RCC1) can be used to examine the disruption of the NCT in cells. The Ran protein gradient is important for active transport through the NPC. Most Ran proteins are nuclear and most often contain Ran-GTP. RanGAP1 localizes to the cytoplasmic side of the NPC and converts Ran-GTP to Ran-GDP. RCC1 localizes to the nucleus and converts Ran-GDP to Ran-GTP.

[0253] To determine subcellular localization, neurons are stained for tau, phospho-tau, Ran, RanGAP1, RCC1, nuclear pore complex protein Nup98-Nup96 (Nup98) (which interacts with phospho-tau), and nuclear pore glycoprotein p62 (Nup62) (a core component of NPCs that can form hydrogels), as well as TAR DNA-binding protein 43 (N-term), RNA-binding protein FUS (FUS), and heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1). Mislocalization of TDP-43, HNRNPA1, and FUS from the nucleus to the cytoplasm is associated with ALS / FTD.

[0254] This validation confirmed the value of the primary screening approach in identifying genes that can modulate the susceptibility of cells to tau seeding when exposed to an external source of tau seeding activity. Thus, targets identified by the screen may be relevant targets in the intercellular propagation of tau pathology in the context of neurodegenerative diseases and will be further investigated. Genome-wide screening of modifiers of tau aggregation in FRET biosensor cell lines identified multiple targets (BANF1, PPP2CA, and ANKLE2) involved in nuclear membrane integrity. BANF1 and ANKLE2 mutant clones showed prominent abnormalities in nuclear lamina shape similar to those reported in both FTD neurons and Alzheimer's disease postmortem neurons.

[0255] Example 3. Targeting Ankle2, Banf1, and Ppp2ca in mouse cells To validate putative tau modifier genes in mouse models of tauopathy, it was first necessary to validate CRISPR tools capable of modifying the expression of these genes in mouse cells. sgRNAs targeting mouse genes Ankle2, Banf1, and Ppp2ca, as well as non-targeting (NT) control sgRNAs not matching any genomic sequence, were tested in mouse ES cells. Expression of these genes was then assessed by qRT-PCR (using Thermo Fischer's TaqMan assays and normalized to the expression of the housekeeping gene Drosha).

[0256] In initial experiments, the following sgRNA-containing plasmids (obtained from GenScript) were packaged into lentivirus (LV) and transduced into a Cas9-enabled mouse ES cell line (2600A-A3) in which Cas9 expression is driven from the Rosa26 locus. The sgRNA target sequences are presented in Table 9. [Table 9]

[0257] Expression was selected by puromycin selection (1.5 μg / mL). Mouse ES cells were transduced with individual LVs at an MOI of 600 in the presence of polybrene (64 μg / mL). Cells were grown for 10 days without feeders under puromycin selection. RNA was collected from cells and expression of the target genes was assessed by qRT-PCR. In this experiment, targeting cells with Banf1 g2 or Banf1 g3 reduced Banf1 expression by approximately 35% compared to NT control. See Figure 21A. Similarly, targeting cells with Ppp2ca g2 reduced Ppp2ca expression by approximately 65% ​​compared to NT control. See Figure 21B.

[0258] To further evaluate sgRNAs targeting these mouse genes, the following plasmids (obtained from GenScript) were packaged into LV and transduced into F1H4 mouse ES cells, wild-type mouse ES cells in a hybrid genetic background (50% C57BL / 6NTac 50% 129S6 / SvEvTac). The pLentiCRISPR-v2 plasmid construct contains both the Cas9 coding sequence and the sequence of a specific sgRNA in a single "all-in-one" (AIO) vector, allowing expression of both Cas9 and sgRNA to be selected with puromycin. As additional negative controls, sgRNAs targeting Banf1 or Ppp2ca in the pLentiGuide-puro vector (containing the sgRNA but lacking Cas9) were also used. The vectors are listed in Table 10. [Table 10]

[0259] In this experiment, mouse ES cells were again transduced with LVs at MOI 600 in the presence of polybrene and grown for 10 days under puromycin selection. RNA was extracted and qRT-PCR analysis was performed (TaqMan qRT-PCR assays obtained from ThermoFisher, assay IDs Mm01205802_m1, Mm01231514_g1, and Mm00479816_m1). Confirming the results of the previous experiment, Ppp2ca g2 again caused a specific and sharp reduction of Ppp2ca expression (in this case >80%), confirming the specific effect of this sgRNA. See Figure 22C. Even more dramatically, in this experiment, selecting for the expression of several sgRNAs (Ankle2 g1, Ankle2 g3, Banf1 g1, Banf1 g2, Banf1 g3, and Ppp2ca g3) caused widespread cell death and loss of all cells, making the collection of RNA impossible. See Figures 22A-22C. Notably, transduction with NT control sgRNA in the all-in-one vector did not cause cell death, indicating that expression of Cas9 from this construct is essentially non-toxic to the cells. Furthermore, expression of sgRNAs targeting Banf1 and Ppp2ca in the pLentiGuide-puro vector (lacking Cas9) similarly did not cause cell death. We therefore concluded that the Cas9-mediated activity of these sgRNAs causing specific destruction of their target genes is responsible for cell death in these cells, indicating that the sgRNAs are likely effective in hitting their targets. This result was not entirely surprising, as BANF1 and PPP2CA have been reported to be essential for ES cell viability and / or pluripotency.

[0260] Example 4. Improvement of tauopathy model Tau inclusions are a pathological hallmark of tauopathies, including AD, progressive supranuclear palsy, corticobasal degeneration, Pick's disease, and frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17). Tau inclusions are composed of multiple forms of aggregated post-translationally modified tau, including highly phosphorylated, truncated, and acetylated species. We then set out to develop a novel screening platform that recapitulates tau hyperphosphorylation and tau aggregation ex vivo in neurons derived from human induced pluripotent stem (iPS) cells (e.g., iCELL GABA Neurons), neurons derived from mouse embryonic stem (ES) cells, and primary mouse neurons (isolated mouse cortical neurons). In the case of human iPS-derived neurons, human iPS-derived neurons that are already postmitotic and ready for use are used. Cells are thawed and plated according to established protocols for ICELL® GABANeurons.

[0261] Initially, several constructs were generated to express human tau cDNA (1N4R) under the control of the human synapsin 1 promoter. These constructs were codon-optimized for use in human or mouse neurons. Seven constructs were generated: (1) pSynapsin1-GFP (SEQ ID NO: 74), (2) pSynapsin1-hTAU WT (SEQ ID NO: 75), (3) pSynapsin1-hTAU WT-GFP (SEQ ID NO: 76), (4) pSynapsin1-GFP-hTAU WT (SEQ ID NO: 77), (5) pSynapsin1-hTAU 3MUT(A152T, P301L, S320F) (SEQ ID NO: 78), (6) pSynapsin1-hTAU 3MUT(A152T, P301L, S320F)-GFP (SEQ ID NO: 79), and (7) pSynapsin1-GFP-hTAU 3MUT(A152T, P301L, S320F) (SEQ ID NO: 80). The synapsin1 gene promoter confers neuron-specific expression. These constructs can be packaged and delivered in lentivirus or adeno-associated virus. The DNA and protein sequences of wild-type tau1N4R are set forth in SEQ ID NOs: 81 and 82, respectively. The DNA and protein sequences of 3MUT tau1N4R (A152T, P301L, S320F) are set forth in SEQ ID NOs: 83 and 84, respectively.

[0262] TaqMan assays were designed to specifically detect transgenic expression of human tau cDNA in human or mouse neurons. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to detect transgenic human TAU using specific primers and probes and codon-optimized sequences of wild-type (WT) and mutant (MUT) TAU cDNA. Total RNA was isolated using the Direct-zol RNA Miniprep plus kit according to the manufacturer's protocol (Zymo Research). Total RNA was treated with DNase and diluted to 20 ng / μL using the Turbo DNA-free kit according to the manufacturer's protocol (Invitrogen). Reverse transcription (RT) and PCR were performed in a one-step reaction using the Quantitect Probe RT-PCR kit (Qiagen). The qRT-PCR reaction contained 2 μL of RNA and 8 μL of a mixture containing RT-PCR master mix, ROX dye, RT mix, and gene-specific primer-probe mix, resulting in a final volume of 10 μL. After reverse transcription, the PCR reaction solution was reconstituted to a final volume of 8 μL containing 3 μL of cDNA and 5 μL of PCR mix, probe, and gene-specific primers. Final primer and probe concentrations were 0.5 μM and 0.25 μM, respectively, unless otherwise noted. qPCR qRT-PCR was performed on a ViiA™ 7 Real-Time PCR Detection System (ThermoFisher). PCR reactions were performed in quadruplicate at 95°C for 10 min and 95°C for 3 s, 60°C for 30 s, with an RT step of 45°C for 10 min, followed by 95°C for 10 min, and 45 cycles of 95°C for 5 s, 60°C for 30 s, in an optical 384-well plate. The sequences of primers and probes used in each analysis are shown in Table 11 below. [Table 11]

[0263] Neurons are plated in 6-well plates (approximately 300,000 cells per well) to perform biochemical assays, and in 96-well plates (approximately 15,000 neurons per well) for immunostaining followed by high-content imaging and image analysis. Neurons are transduced with human tau constructs alone or in combination with an all-in-one virus (SEQ ID NO: 85) expressing a Cas9 transgene under a specific promoter (e.g., EF1 alpha promoter) and BANF1, PPP2CA, ANKLE2, or non-targeting sgRNA (e.g., under the control of the U6 promoter). The DNA and protein sequences of Cas9 are set forth in SEQ ID NOs: 86 and 87, respectively.

[0264] After approximately one week in culture, cells are exposed to 50% conditioned medium Tau-YFP(Agg[+]) to maintain the culture. Cells in 96-well plates are finally fixed and immunostained with specific antibodies to detect: tau hyperphosphorylation and tau aggregation (AT8 and S356 antibodies to detect tau hyperphosphorylation with subcellular localization (axonal, somatodendritic compartments)), abnormal morphology of the nuclear lamina and impaired nucleocytoplasmic transport (lamin A / C, lamin B1, FUS, TDP-43, HNRPA1, NPC, and NPT), and cell survival (DAPI / NeuN / MAP2) in cells transduced with BANF1, PPP2CA, or ANKLE2 sgRNA compared to non-targeting sgRNA. Thioflavin S is also used to stain and visualize β-amyloid structures. Neuronal function (neurite retraction, synaptic loss, abnormal calcium homeostasis, and imbalanced neurotransmitter release) is also assessed. The high content imager Phenix Opera (96-well format) is used for cell viability assays (DAPI / NeuN / MAP2), phospho-tau assays (AT8, S356), and Thioflavin S assays. Cells in 6-well plates are collected to perform cell fractionation assays, revealing the presence of insoluble and mislocalized tau.

[0265] We next set out to develop a new screening platform that recapitulates tau hyperphosphorylation and tau aggregation ex vivo in mouse brain slice cultures. Brain slice assays are well known. See, e.g., Polleux et al. (2002) Sci. STKE 2002(136) pl9 (doi: 10.1126 / stke.2002.136.pl9), incorporated herein by reference in its entirety for all purposes.

[0266] Mouse neonatal brain slice cultures are transduced with all-in-one lentivirus or adeno-associated virus (to induce expression of Cas9 and specific sgRNAs) or antisense oligonucleotides (ASOs), exposed to conditioned medium tau-YFP (Agg[+]), and maintained in culture. Finally, sections are fixed to reveal tau hyperphosphorylation and tau aggregation as described above. Sections are also collected to reveal the presence of insoluble tau.

[0267] We next set out to develop a screening platform that would recapitulate tau hyperphosphorylation and tau aggregation in vivo. Adult PS19 mice (6–8 weeks) are infused via intracranial (stereotaxic surgery for infusion into hippocampus and other brain regions or intracerebroventricular infusion) or intrathecal (intraspinal) injection with: (1) lipid nanoparticles (LNPs) containing Cas9 mRNA and sgRNA, (2) LNPs containing siRNA, (3) lentivirus (LV) all-in-one (Cas9 + sgRNA), (4) adeno-associated virus (AAV) all-in-one (Cas9+sgRNA), or (5) antisense oligonucleotides (ASO). PS19 mice (available at jax.org / strain / 008169, incorporated herein by reference in its entirety for all purposes) are used.

[0268] sgRNA, siRNA, and antisense oligonucleotides are targeted to the genes Banf1, Ppp2ca, Ankle2, or comprised of non-targeting control sequences. Animals are sacrificed, and after brain sectioning and staining as described above to reveal tau hyperphosphorylation (AT8 staining) and tau aggregation. Brains are also collected to reveal the presence of insoluble and mislocalized tau (Thioflavin S staining).

[0269] Since BANF1 / PPP2CA / ANKLE2 is essential in mitotic cells, we hypothesized that a knockdown strategy could better understand this new association with tau aggregation. We introduced the dCas9-KRAB CRISPRi system of transcriptional suppression in tau biosensor cells and transduced specific sgRNAs targeting the promoter region immediately before the transcription start site. See Figures 24A and 24B. After treatment with conditioned medium Tau-YFP (Agg[+]), we isolated ΔBANF1 and ΔANKLE2 knockdown clones by serial dilution of clones that could induce tau aggregation. See Figure 25. This indicated that the CRISPRi dCas9-KRAB ΔBANF1 and ΔANKLE2 targeted knockdown clones could induce tau aggregation.

[0270] Next, cellular fractionation of ΔBANF1 and ΔANKLE2 clones was performed, allowing detection of tau and phosphotau (serine 356) in the insoluble fraction after 2 days using tau-YFP Agg[+] cell lysates, providing functional evidence of an association between ΔBANF1 and ΔANKLE2 clones with tau insolubility and phosphorylation at serine 356. See FIG. 26.

[0271] RNA was also collected from ΔBANF1 and ΔANKLE2 clones and two control groups (non-targeted and parental). RNA-seq analysis characterized significant differences between ΔBANF1 and ΔANKLE2 knockdown clones and the two control groups. RNA-seq analysis of CRISPRi knockdown clones revealed that ΔBANF1 knockdown samples were more distinct from ΔANKLE2 or non-targeted samples. See Figure 27. Ten transcriptional differences between these groups were validated (data not shown). These ten target genes were reduced in expression in both ΔBANF1 and ΔANKLE2 knockdown clones.

[0272] We then employed a cDNA complementation approach by adding BANF1 cDNA (with luciferase cDNA as a control). A schematic of the cDNA complementation experimental design is shown in FIG.

[0273] BANF1 cDNA was subcloned into pLVX-EF1a plasmid and packaged for lentiviral transduction of cDNA in ΔBANF1 knockdown cells, ΔANKLE2 knockdown cells, and non-targeted control cells. Specifically, the cDNA was tested for rescue of increased tau aggregation in ΔBANF1 and ΔANKLE2 knockdown cells. cDNA-expressing cells were treated with tau-YFP Agg[+] cell lysate for 2 days. BANF1 cDNA rescued tau aggregation in both ΔBANF1 and ΔANKLE2 knockdown cells, indicating that it could provide another functional link between BANF1 / ANKLE2 and tau aggregation. See Figure 29.

[0274] We next used primary cultures of mouse cortical neurons to study the effects of ΔBANF1 and ΔANKLE2 mutations on tau phosphorylation, misfolding, and insolubility in postmitotic cells. Cortical neurons were transduced with an all-in-one lentivirus (AIO_LV, LV_Cas9_sgRNA) expressing both Cas9 and an sgRNA (Banf1_g3, Ankle2_g3, or Ppp2ca_g2) previously validated for efficacy in mouse ESCs. Mouse primary cortical neurons were transduced 2 days after plating with AIO_LV and maintained in culture for 14 days for immunofluorescence staining and Western blot studies (using WES technology by Protein Simple). For immunofluorescence, C57BL / 6 mouse primary cortical neurons (commercially available) were plated on day 0 at a density of 25,000 neurons per well in 96-well poly-D-lysine-coated plates. On day 2, neurons were transduced with AIO_LVs of Banf1_g3 or Ankle2_g3 or Ppp2ca_g2, or non-targeting_gRNA control, at a multiplicity of infection of 40,000 viral genomes per neuron. Medium was changed every 3–4 days. On day 16, neurons were fixed with a solution of 4% paraformaldehyde (PFA) and examined by fluorescent immunostaining. For Western blot studies, 400,000 neurons were plated in poly-D-lysine 6-wells and transduced with AIO-LVs (25,000VG per neuron). Medium was changed every 3–4 days. Neurons were collected after 14 days in culture and prepared for protein studies.

[0275] After 14 days, AIO_LV-transduced neurons were also collected to determine the extent of gene editing (INDEL%). Gene editing was found to be consistently higher using Banf1_g3 sgRNA than Ankle2_g3. See Table 12. [Table 12]

[0276] Immunofluorescence staining studies focused on abnormal phenotypes associated with tauopathy, such as tau hyperphosphorylation (somatodendritic domains), nuclear pore complex integrity (Nup98 mislocalization), and impaired nucleocytoplasmic transport (reduced Ran / RanGAP1 nuclear / cytoplasmic ratio).

[0277] For image data analysis, an automated, unbiased image analysis approach was used, combining an Opera Phenix high-content confocal imager (Perkin Elmer) with Harmony software (Perkin Elmer). For each experiment, an average of six biological replicates were performed, with approximately 70 fields imaged and analyzed per biological replicate, and fluorescently labeled secondary antibodies were used to label the primary antibodies. Secondary antibodies were conjugated with Alexa-488 nm (green), -568 nm (orange), and -647 nm (far red). 4',6-diamidino-2-phenylindole (DAPI) was used for nuclear staining.

[0278] In each field, first DAPI + The number of neurons was counted. Second, the fluorescence intensity of microtubule-associated protein-2 (Map2), a neuronal marker in the somatodendritic domain, was used to segment the cytoplasm, including the somatodendritic domain, and count the number of healthy neurons. Third, the fluorescence intensity of different cellular markers (phospho-tau S356, phospho-tau AT8 (S202, T205), total tau, Nup98, LaminB1, Ran, RanGAP1) was measured in several subcellular compartments, including the cytoplasm, the nucleus as well as the perinuclear region surrounding the nucleus. Fourth, the mean fluorescence intensity of each well (biological replicates) was calculated, including the average of all cells in all fields of each well.

[0279] We developed image analysis methods to quantify biomarker intensity in the following combinations: phospho-tau and total tau; phospho-tau and LaminB1 or nuclear pore complex (NPC); nuclear / cytoplasmic ratios of Nup98, Ran and RanGAP1, and phospho-tau intensity.

[0280] ΔBanf1 and ΔAnkle2 mutant mouse cortical neurons displayed similar Map2 soma-dendritic staining intensity as non-targeted cortical neurons (see Figures 30A and 30B), indicating that disruption of Banf1 and Ankle2 does not affect neuronal survival of 14-day postmitotic cortical neurons.

[0281] Phospho-tau (serine 356) staining was increased in the somatodendritic compartment of ΔBanf1 (p-value < 0.004) and ΔAnkle2 (p-value < 0.001) mutant cortical neurons compared to non-targeted cortical neurons. See Figure 31A. This is reminiscent of observations in Alzheimer's disease, where the protein tau forms hyperphosphorylated aggregates in the somatodendritic domain. Notably, the increase in phospho-tau staining intensity was found to be particularly pronounced in the perinuclear region. See Figure 31B. Data are expressed as mean ± standard error of the mean (SEM) and the number of biological replicates for each experimental condition is indicated by dots. Data were analyzed by unpaired Student's t-test when comparing two samples (i.e., ΔBanf1 vs. non-targeted cortical neurons).

[0282] As a control experiment, we determined that total tau staining intensity was not increased in the somatodendritic compartment of ΔBanf1 and ΔAnkle2 mutants compared to non-targeted cortical neurons, see Figures 32A-32C.

[0283] As shown in Figures 33A-33E, phospho-tau AT8 (S202, T205) staining is increased in the somatodendritic compartment of ΔBanf1 and ΔAnkle2 mutant neurons compared to non-targeted cortical neurons.

[0284] Pathological tau can impair nuclear import and export in tau-overexpressing transgenic mice and human AD brain tissue. Phospho-tau disrupts the diffusion barrier function of the nuclear pore complex. The nuclear pore complex protein nucleoporin Nup98 accumulates in the soma of some tangle-bearing neurons and can promote tau aggregation in vitro. We investigated the subcellular localization of Nup98 and found that it was enriched in the soma of ΔBanf1 and ΔAnkle2 mutants compared to non-targeted cortical neurons. The nuclear / cytoplasmic ratio of Nup98 was decreased. See Figures 34A-34D.

[0285] Furthermore, the decreased nuclear / cytoplasmic ratios of Ran and RanGAP1 provide evidence for impaired active transport of the nuclear pore complex in ΔBanf1 and ΔAnkle2 mutants compared to non-targeted cortical neurons. See Figures 35A-35D.

[0286] Mouse primary cortical neurons were transduced 2 days after plating with AIO_LV_NT, AIO_LV_Banf1_g3, and AIO_LV_Ppp2ca_g2 and maintained in culture for 14 days for fluorescent phospho-tau immunostaining (serine 356 and serine 202 / threonine 205, also known as AT8 antibody) and misfolded tau detection. A robust and quantitative method for detecting misfolded protein aggregates and aggresomes was used with the PROTEOSTAT® Aggresome Detection Kit by ENZO, which is optimized for antibody colocalization studies with Aggresome Detection Reagent (ADR). PROTEOSTAT® dyes specifically intercalate into cross-beta spines, quaternary protein structures typically found in misfolded and aggregated proteins, inhibiting dye turnover and emitting strong fluorescence. On day 16, neurons were fixed with a solution of 4% paraformaldehyde (PFA) and examined for fluorescent immunostaining. Increased phosphorylation of tau at serine 356 in the somatodendritic compartment of ΔBanf1 (p-value < 0.026) and ΔPpp2ca (p-value < 0.0087) was evident in mutant cortical neurons compared to non-targeted cortical neurons. See Figure 38D. Notably, increased phospho-tau staining intensity was found to be particularly pronounced in the cytoplasmic region immediately surrounding the nucleus, defined as the perinuclear region (ΔBanf1 p-value < 0.002 and ΔPpp2ca p-value < 0.04). See Figure 38B. Similarly, increased phospho-tau (serine 202 / threonine 205) in the perinuclear region of ΔBanf1 (p-value < 0.026) and ΔPpp2ca (p-value < 0.0087) was observed in mutant cortical neurons compared to non-targeted cortical neurons. See Figures 39B and 39D. Data are expressed as mean ± standard error of the mean (SEM), and the number of biological replicates for each experimental condition is indicated by dots. Data were analyzed by unpaired Student's t-test when comparing two samples (i.e., ΔBanf1 and non-targeted cortical neurons).Increased tau phosphorylation at serine 356 (for ΔBanf1, Pearson correlation (ρ) = 0.85 - R-squared = 0.72; for ΔPpp2ca, ρ = 0.92 - R-squared = 0.85) and serine 202 and threonine 205 (for ΔBanf1, ρ = 0.86 - R-squared = 0.74; for ΔPpp2ca, ρ = 0.94 - R-squared = 0.89) correlates with increased detection of misfolded tau in the soma of mutant neurons compared to non-targeted. See Figures 38A-38F and 39A-39F. Correlation analysis was performed using Pearson's parametric test. A P value of <0.05 was considered significant. We confirmed that disruption of Banf1, Ankle2, or Ppp2ca can increase tau phosphorylation and misfolding.

[0287] We next performed experiments using tau seeding in mutant cortical neurons using brain cell lysates from mice transduced with tau cDNA 3MUT or P301S. Phospho-tau (serine 356) staining was increased in the somatodendritic domains of ΔBanf1 and ΔAnkle2 mutants when tau cDNA 3MUT was added compared to non-targeted cortical neurons. See Figures 36A-36D. However, total tau staining was not increased in the somatodendritic domains of ΔBanf1 and ΔAnkle2 mutants when tau cDNA 3MUT was added compared to non-targeted cortical neurons. See Figures 37A-37C.

[0288] We then use organotypic brain slice cultures to validate Banf1, Ankle2, and Ppp2ca as genetic modifiers of tau aggregation. Organotypic brain slice cultures were prepared from wild-type C57BL / 6 mice and transfected with LV-All-In-One (AIO) constructs containing Cas9_Banf1_g3, Cas9_Ankle2_g3, Cas9_Ppp2ca_g2, and Cas9_non-targeting_g3 at day 0 and 10. 10Alternatively, organotypic brain slice cultures are prepared from wild-type C57BL / 6 mice and transduced with ASOs targeting Ankle2, Ppp2ca, or Banf1 on day 0. On day 14, samples are collected for NGS analysis (INDEL%), phospho-tau staining (S356 and AT8), and ThS staining for misfolded tau.

[0289] We next validated Banf1, Ankle2, and Ppp2ca as genetic modifiers of tau aggregation using stereotactic AIO-LV injection into the mouse hippocampus. A total of 24 C57BL / 6 wild-type animals (NT, AIO Cas9_Banf1, AIO Cas9_Ankle2, and AIO Cas9_Ppp2ca) were injected. Two animals (per each condition) were unloaded 7 days after injection. NGS revealed significant editing (as INDELs% approximately >15%; data not shown). Animals were then unloaded for Western blot analysis (phospho-tau, misfolded tau, total tau) and tau seeding assay of hippocampal lysates in tau biosensor cells. We then use stereotactic AIO-LV injection of dCas9-KRAB and gRNAs targeting Banf1, Ankle2, or Ppp2ca in the mouse hippocampus to validate Banf1, Ankle2, and Ppp2ca as genetic modifiers of tau aggregation.

[0290] Next, we use stereotactic injection of ASOs into the mouse hippocampus to validate Banf1, Ankle2, and Ppp2ca as genetic modifiers of tau aggregation. An example of an ASO targeting mouse Banf1 is shown in Table 13. An example of an ASO targeting mouse Ppp2ca is shown in Table 14. An example of an ASO targeting mouse Ankle2 is shown in Table 15. The parent antisense RNA sequences used to design the ASOs in Tables 13-15 are shown in Table 16. [Table 13-1] [Table 13-2]

Table 14-1

Table 14-2

Table 14-3

Table 15-1

Table 15-2

Table 15-3

Table 16-1

Table 16-2

Table 16-3

[0291] All ASOs were designed as 5-10-5 gapmers with phosphorothioate backbones. 2' methoxyethyl modified bases were used in the wings (5 nucleotides from both ends) and the 10 nucleotide core had unmodified DNA bases. See Figure 40. Primary screening was first performed in NSC34 cells at an ASO concentration of 100 nM. All ASOs were transfected using Lipofectamine RNAiMAx and cells were incubated for 72 hours before harvesting RNA for TaqMan qPCR. Knockdown of total target mRNA was compared to untreated cells. Based on the primary screening data, hits were selected for secondary screening at 50 nM and 5 nM. Transfection and TaqMan qPCR analysis were performed in a similar manner to the primary screening. The results of the primary screening of mAnkle2 are shown in Figure 41A and the results of the secondary screening of mAnkle2 are shown in Figures 41B and 41C. The results of the primary screen for mPpp2ca are shown in Figure 42A, and the results of the secondary screen for mPpp2ca are shown in Figures 42B and 42C. The results of the primary screen for mBanf1 are shown in Figure 43. As shown in these results, ASOs targeting Banf1, Ankle2, or Ppp2ca have been validated in NSC34 cells and show a >75% reduction in expression.

[0292] In conclusion, we developed three approaches to validate Banf1, Ankle2, and Ppp2ca as modifiers of tau aggregation in vitro (primary cultures of mouse cortical neurons), ex vivo (organotypic brain slice cultures), and in vivo (stereotaxic injection of the hippocampus). We propose that disruption of Banf1, Ankle2, and / or Ppp2ca can be used to develop new mouse models of tauopathies. The present invention provides, for example, the following items. (Item 1) A non-human animal, animal tissue, or population of animal cells, comprising: (a) a microtubule-associated protein tau coding sequence in one or more cells; (b) a non-human animal, animal tissue, or population of animal cells comprising: (i) a genetic modification of one or more of BANF1, PPP2CA, and ANKLE2 that reduces expression of one or more of BANF1, PPP2CA, and ANKLE2, respectively, in said one or more cells; and / or (ii) one or more agents that reduce expression of one or more of BANF1, PPP2CA, and ANKLE2 in said one or more cells. (Item 2) 2. The non-human animal, animal tissue, or population of animal cells according to item 1, wherein the one or more cells are neuronal cells. (Item 3) 3. The non-human animal, animal tissue or population of animal cells according to item 1 or 2, wherein the microtubule-associated protein tau coding sequence is an exogenous human microtubule-associated protein tau coding sequence. (Item 4) 4. The non-human animal, animal tissue, or population of animal cells according to item 3, wherein the exogenous human microtubule-associated protein tau coding sequence is integrated into the genome. (Item 5) 5. The non-human animal, animal tissue, or population of animal cells according to item 3 or 4, wherein the exogenous human microtubule-associated protein tau coding sequence comprises a complementary DNA (cDNA) sequence. (Item 6) 6. The non-human animal, animal tissue, or population of animal cells according to any one of items 3 to 5, wherein the exogenous human microtubule-associated protein tau coding sequence is codon-optimized for expression in the non-human animal, animal tissue, or population of animal cells. (Item 7) 7. The non-human animal, animal tissue, or population of animal cells according to any one of items 3 to 6, wherein the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter. (Item 8) 8. The non-human animal, animal tissue, or population of animal cells according to item 7, wherein the heterologous promoter is a mouse prion protein promoter. (Item 9) 8. The non-human animal, animal tissue, or population of animal cells according to item 7, wherein the heterologous promoter is a neuron-specific promoter. (Item 10) 10. The non-human animal, animal tissue, or population of animal cells according to item 9, wherein the neuron-specific promoter is the synapsin-1 promoter. (Item 11) 2. The non-human animal, animal tissue, or population of animal cells of any one of the preceding items, wherein the microtubule-associated protein tau comprises a tauopathy-associated mutation. (Item 12) 12. The non-human animal, animal tissue, or population of animal cells of item 11, wherein the tauopathy-associated mutation comprises a P301S mutation. (Item 13) 12. The non-human animal, animal tissue, or population of animal cells according to item 11, wherein the microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO:98. (Item 14) 12. The non-human animal, animal tissue, or population of animal cells of item 11, wherein the tauopathy-associated mutation comprises an A152T / P301L / S320F triple mutation. (Item 15) 15. The non-human animal, animal tissue, or population of animal cells according to item 14, wherein the microtubule-associated protein tau coding sequence comprises the sequence set forth in SEQ ID NO: 83 or the microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 84. (Item 16) A non-human animal, animal tissue, or population of animal cells described in any one of the preceding items, wherein the non-human animal, animal tissue, or population of animal cells comprises one or more of the genetic modifications of BANF1, PPP2CA, and ANKLE2 that reduce expression of one or more or all of BANF1, PPP2CA, and ANKLE2, respectively, in one or more cells. (Item 17) The non-human animal, animal tissue, or population of animal cells of any one of the preceding items, wherein the non-human animal, animal tissue, or population of animal cells comprises one or more agents that reduce expression of one or more or all of BANF1, Ppp2ca, and ANKLE2 in the one or more cells. (Item 18) The non-human animal, animal tissue, or population of animal cells of any one of the preceding items, wherein the one or more agents comprise a nuclease agent that targets BANF1, PPP2CA, or ANKLE2, or a nucleic acid encoding the nuclease agent. (Item 19) 19. The non-human animal, animal tissue, or population of animal cells of item 18, wherein the nuclease agent is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeats (CRISPR) associated (Cas) protein and guide RNA. (Item 20) 20. The non-human animal, animal tissue, or population of animal cells of item 19, wherein the nuclease agent is the Cas protein and the guide RNA. (Item 21) 21. The non-human animal, animal tissue, or population of animal cells of item 20, wherein the Cas protein is a Cas9 protein. (Item 22) 22. The non-human animal, animal tissue, or population of animal cells according to item 20 or 21, wherein the Cas protein is a catalytically active Cas protein. (Item 23) 18. The non-human animal, animal tissue, or population of animal cells according to any one of items 1 to 17, wherein the one or more agents comprise a transcriptional repressor that targets BANF1, PPP2CA, or ANKLE2, or a nucleic acid encoding the transcriptional repressor. (Item 24) 24. The non-human animal, animal tissue, or population of animal cells of item 23, wherein the transcriptional repressor comprises a guide RNA and a catalytically inactive Cas protein fused to a transcriptional repressor domain, and optionally, the transcriptional repressor domain is a Krüppel-associated box (KRAB) domain. (Item 25) The non-human animal, animal tissue, or population of animal cells according to any one of items 20 to 24, wherein the guide RNA targets mouse Banf1 and comprises any one of the sequences set forth in SEQ ID NOs: 44 to 46, or the guide RNA targets human BANF1 and comprises any one of the sequences set forth in SEQ ID NOs: 27 to 30. (Item 26) 25. The non-human animal, animal tissue, or population of animal cells according to any one of items 20 to 24, wherein the guide RNA targets mouse Ppp2ca and comprises any one of the sequences set forth in SEQ ID NOs: 47 to 49, or the guide RNA targets human PPP2CA and comprises any one of the sequences set forth in SEQ ID NOs: 31 to 32. (Item 27) 25. The non-human animal, animal tissue, or population of animal cells according to any one of items 20 to 24, wherein the guide RNA targets mouse Ankle2 and comprises any one of the sequences set forth in SEQ ID NOs: 50 to 52, or the guide RNA targets human ANKLE2 and comprises the sequence set forth in SEQ ID NO: 38. (Item 28) 18. The non-human animal, animal tissue, or population of animal cells of any one of items 1 to 17, wherein the one or more agents comprise an antisense oligonucleotide or RNAi agent targeting BANF1, PPP2CA, or ANKLE2, or a nucleic acid encoding the antisense oligonucleotide or RNAi agent. (Item 29) 29. The non-human animal, animal tissue, or population of animal cells according to item 28, wherein the antisense oligonucleotide comprises a sequence set forth in any one of SEQ ID NOs: 105 to 324 or a modified version thereof. (Item 30) The antisense oligonucleotide is selected from the group consisting of SEQ ID NOs: 105, 106, 110 to 113, 115, 120 to 122, 124, 125, 130, 133, 136, 137, 150, 152, 153, 155, 158 to 160, 162, 165, 166, 169, 171 to 173, 175, 177, 181 to 184, 187, 194, 197, 211, 213, 215, 216, 220 to 223, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 28 30-232, 234, 235, 240, 243, 246, 247, 260, 262, 263, 265, 268-270, 272, 275, 276, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321, and 323, or a modified version thereof. (Item 31) 31. The non-human animal, animal tissue, or population of animal cells according to item 29 or 30, wherein the antisense oligonucleotide comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl modified bases. (Item 32) 32. The non-human animal, animal tissue, or population of animal cells of item 31, wherein the antisense oligonucleotide is a 5-10-5 gapmer comprising a phosphorothioate backbone, a 5' wing of 2'-methoxyethyl modified bases, a central 10 nucleotide core of DNA, and a 3' wing of 2'-methoxyethyl modified bases. (Item 33) The non-human animal, animal tissue, or population of animal cells of any one of the preceding items, wherein at least one sign or symptom of a tauopathy is increased in the non-human animal, animal tissue, or population of animal cells compared to a non-human animal, animal tissue, or population of animal cells that does not contain the genetic modification of one or more of BANF1, PPP2CA, and ANKLE2 or that does not contain the one or more agents that reduce expression of one or more of BANF1, PPP2CA, and ANKLE2. (Item 34) 34. The non-human animal, animal tissue, or population of animal cells of item 33, wherein the at least one sign or symptom comprises tau hyperphosphorylation or tau aggregation. (Item 35) 35. The non-human animal, animal tissue, or population of animal cells of item 33 or 34, wherein the at least one sign or symptom comprises an increase in tau and / or phosphotau in the insoluble fraction after cellular fractionation, an increase in phosphotau in the somatodendritic compartment of neurons, an increase in phosphotau in the perinuclear region of neurons, a decrease in the nuclear to cytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 (Nup98) in neurons, a decrease in the nuclear to cytoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in neurons, or a decrease in the nuclear to cytoplasmic ratio of Ran GTPase-activating protein 1 (RanGAP1) in neurons. (Item 36) 2. The population of animal cells of any one of the preceding claims, wherein the cells are in vivo. (Item 37) 36. The population of animal cells according to any one of items 1 to 35, wherein the cells are in vitro. (Item 38) 2. The population of animal cells of any one of the preceding claims, wherein the cells are human cells. (Item 39) 38. The population of animal cells of any one of items 1 to 37, wherein the cells are rodent cells, optionally wherein the rodent cells are mouse cells or rat cells. (Item 40) 40. The population of animal cells according to item 39, wherein the cells are mouse cells. (Item 41) 2. The population of animal cells of any one of the preceding claims, wherein the cells comprise neuronal cells. (Item 42) 42. The population of animal cells according to item 41, wherein the neural cells comprise neurons derived from human induced pluripotent stem cells. (Item 43) 42. The population of animal cells according to item 41, wherein the neural cells comprise neurons derived from mouse embryonic stem cells. (Item 44) 42. The population of animal cells of item 41, wherein the neural cells comprise primary mouse neurons. (Item 45) 36. The animal tissue according to any one of items 1 to 35, wherein the tissue is in vivo. (Item 46) 36. The animal tissue according to any one of items 1 to 35, wherein the tissue is ex vivo. (Item 47) 47. The animal tissue according to any one of items 1 to 35 and 45 to 46, wherein the animal is a rodent, optionally wherein the rodent is a mouse or a rat. (Item 48) Item 48. The animal tissue of item 47, wherein the animal is a mouse. (Item 49) 49. The animal tissue according to any one of items 1 to 35 and 45 to 48, wherein the tissue is a nervous system tissue. (Item 50) 50. The animal tissue of item 49, wherein the tissue comprises a brain slice. (Item 51) 36. The non-human animal of any one of items 1-35, wherein the genetic modification of one or more of BANF1, PPP2CA, and ANKLE2 is in one or more neuronal cells, and / or the one or more agents that reduce expression of one or more of BANF1, PPP2CA, and ANKLE2 are in one or more neuronal cells, optionally wherein the one or more neuronal cells are in the hippocampus. (Item 52) 52. The non-human animal according to any one of items 1 to 35 and 51, wherein the non-human animal is a rodent, optionally wherein the rodent is a mouse or a rat. (Item 53) 53. The non-human animal of item 52, wherein the non-human animal is a mouse. (Item 54) 54. The non-human animal of item 53, wherein the mouse is a PS19 transgenic mouse, further comprising one or more genetic modifications of BANF1, PPP2CA, and ANKLE2 that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2, respectively, in the one or more cells, and / or further comprising one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in the one or more cells. (Item 55) 1. A method for evaluating a therapeutic candidate for the treatment of a tauopathy, comprising: (a) administering a candidate drug to a non-human animal according to any one of items 1 to 35 and 51 to 54, to an animal tissue according to any one of items 1 to 35 and 45 to 50, or to a population of animal cells according to any one of items 1 to 44; (b) performing one or more assays to determine whether the candidate agent has an effect on one or more signs or symptoms associated with a tauopathy; (c) identifying the candidate agent having an effect against the one or more signs or symptoms associated with a tauopathy as a candidate therapeutic agent. (Item 56) 56. The method of claim 55, wherein the one or more signs or symptoms comprises tau hyperphosphorylation or tau aggregation. (Item 57) 57. The method of item 55 or 56, wherein the at least one sign or symptom comprises an increase in tau and / or phosphotau in the insoluble fraction after cellular fractionation, an increase in phosphotau in the somatodendritic compartment of neurons, an increase in phosphotau in the perinuclear region of neurons, a decrease in the nuclear to cytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 (Nup98) in neurons, a decrease in the nuclear to cytoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in neurons, or a decrease in the nuclear to cytoplasmic ratio of Ran GTPase-activating protein 1 (RanGAP1) in neurons. (Item 58) 58. The method according to any one of items 55 to 57, wherein the candidate agent is administered to the non-human animal. (Item 59) 58. The method of any o...

Claims

1. A rodent, animal tissue, or population of animal cells, comprising: (a) a microtubule-associated protein tau coding sequence in one or more cells; (b) (i) a genetic modification of one or both of BANF1 and ANKLE2 that reduces expression of one or both of BANF1 and ANKLE2, respectively, in the one or more cells, and / or (ii) one or more agents that reduce expression of one or both of BANF1 and ANKLE2 in the one or more cells, wherein the population of animal cells does not include human germ cells and does not include human embryonic cells.

2. The rodent, animal tissue, or population of animal cells of claim 1 , wherein the one or more cells are neuronal cells.

3. The microtubule-associated protein tau coding sequence is an exogenous human microtubule-associated protein tau coding sequence; A rodent, animal tissue, or population of animal cells according to claim 1 or 2.

4. (I) the exogenous human microtubule-associated protein tau coding sequence is integrated into the genome; and / or (II) the exogenous human microtubule-associated protein tau coding sequence comprises a complementary DNA (cDNA) sequence; and / or (III) the exogenous human microtubule-associated protein tau coding sequence is codon-optimized for expression in the rodent, the animal tissue, or the population of animal cells; and / or (IV) the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter, a mouse prion protein promoter, a neuron-specific promoter or a synapsin-1 promoter; A rodent, animal tissue, or population of animal cells according to claim 3.

5. the microtubule-associated protein tau comprises a tauopathy-associated mutation; (I) the tauopathy-associated mutation comprises a P301S mutation or the microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 98; or (II) The rodent, animal tissue, or population of animal cells of any one of claims 1 to 4, wherein the tauopathy-associated mutation comprises an A152T / P301L / S320F triple mutation, or the microtubule-associated protein tau coding sequence comprises the sequence set forth in SEQ ID NO: 83, or the microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO:

84.

6. The rodent, animal tissue, or population of animal cells described in any one of claims 1 to 5, wherein the rodent, animal tissue, or population of animal cells comprises a genetic modification of one or both of BANF1 and ANKLE2 that reduces expression of one or both of BANF1 and ANKLE2, respectively, in one or more cells.

7. The rodent, the animal tissue, or the population of animal cells comprises one or more agents that reduce expression of one or both of BANF1 and ANKLE2 in the one or more cells, the one or more agents comprising: (I) A nuclease agent targeting BANF1 or ANKLE2, or a nucleic acid encoding said nuclease agent, wherein said nuclease agent is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeats (CRISPR) associated (Cas) protein and a guide RNA; (II) A transcriptional repressor that targets BANF1 or ANKLE2, or a nucleic acid encoding said transcriptional repressor, wherein said transcriptional repressor comprises a guide RNA and a catalytically inactive Cas protein fused to a transcriptional repressor domain; or (III) Antisense oligonucleotides or RNAi agents targeting BANF1 or ANKLE2, or nucleic acids encoding said antisense oligonucleotides or said RNAi agents. Including, A rodent, animal tissue or population of animal cells according to any one of claims 1 to 6.

8. 8. The rodent, animal tissue, or population of animal cells of claim 7, wherein the nuclease agent is the Cas protein and the guide RNA, the Cas protein is a Cas9 protein, and the Cas protein is a catalytically active Cas protein.

9. (I) The guide RNA targets mouse Banf1 and comprises any one of the sequences set forth in SEQ ID NOs: 44-46, or the guide RNA targets human BANF1 and comprises any one of the sequences set forth in SEQ ID NOs: 27-30, or (II) The guide RNA targets mouse Ankle2 and comprises any one of the sequences set forth in SEQ ID NOs: 50-52; or the guide RNA targets human ANKLE2 and comprises the sequence set forth in SEQ ID NO: 38; 9. The rodent, animal tissue, or population of animal cells of claim 8.

10. (I) the antisense oligonucleotide comprises a sequence set forth in any one of SEQ ID NOs: 105-126, 169-236, or 279-324, or a modified version thereof; or (II) the antisense oligonucleotide comprises any one of the sequences set forth in SEQ ID NOs: 105, 106, 110-113, 115, 120-122, 124, 125, 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, 213, 215, 216, 220-223, 225, 230-232, 234, 235, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321, and 323, or a modified version thereof; the antisense oligonucleotide comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl modified bases, or the antisense oligonucleotide is a 5-10-5 gapmer comprising a phosphorothioate backbone, a 5' wing of 2'-methoxyethyl modified bases, a central 10 nucleotide core of DNA, and a 3' wing of 2'-methoxyethyl modified bases; 8. A rodent, animal tissue, or population of animal cells according to claim 7.

11. at least one sign or symptom of a tauopathy is increased in the rodent, the animal tissue, or the population of animal cells compared to a rodent, the animal tissue, or the population of animal cells that does not comprise the genetic modification of one or both of BANF1 and ANKLE2 or does not comprise the one or more agents that reduce expression of one or both of BANF1 and ANKLE2, and ... (I) tau hyperphosphorylation or tau aggregation, and / or (II) an increase in tau and / or phosphotau in the insoluble fraction after cellular fractionation, an increase in phosphotau in the somatodendritic compartment of neurons, an increase in phosphotau in the perinuclear region of neurons, a decrease in the nuclear to cytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 (Nup98) in neurons, a decrease in the nuclear to cytoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in neurons, or a decrease in the nuclear to cytoplasmic ratio of Ran GTPase activating protein 1 (RanGAP1) in neurons. Including, A rodent, animal tissue or population of animal cells according to any one of claims 1 to 10.

12. the cell is in vitro; (I) the cell is a human cell or a rodent cell, and / or (II) The cell comprises a neuron, A population of animal cells according to any one of claims 1 to 11.

13. The population of animal cells of claim 12 , wherein the rodent cells are mouse cells or rat cells.

14. 13. The population of animal cells of claim 12, wherein the neural cells comprise neurons derived from human induced pluripotent stem cells, neurons derived from mouse embryonic stem cells, or primary mouse neurons.

15. the tissue is ex vivo; (I) the animal is a rodent, and / or (II) The animal tissue according to any one of claims 1 to 11, wherein the tissue is a nervous system tissue.

16. The animal tissue of claim 15 , wherein the rodent is a mouse or a rat.

17. The animal tissue of claim 15 , wherein the tissue comprises a brain slice.

18. (I) the genetic modification of one or both of BANF1 and ANKLE2 is in one or more neuronal cells, and / or the one or more agents that reduce expression of one or both of BANF1 and ANKLE2 are in one or more neuronal cells; and / or (II) The rodent is a mouse or a rat; A rodent according to any one of claims 1 to 11.

19. the rodent is a mouse, and the mouse further comprises the genetic modification of one or both of BANF1 and ANKLE2 that reduces the expression of one or both of BANF1 and ANKLE2, respectively, in the one or more cells, and / or the one or more agents that reduce the expression of one or both of BANF1 and ANKLE2 in the one or more cells, is a PS19 transgenic mouse.

20. The rodent of claim 18.

20. 1. A method for evaluating a therapeutic candidate for the treatment of a tauopathy, comprising: (a) administering a candidate agent to a rodent according to any one of claims 1 to 11 and 18 to 19, to an animal tissue according to any one of claims 1 to 11 and 15 to 17, or to a population of animal cells according to any one of claims 1 to 14; (b) performing one or more assays to determine whether the candidate agent has an effect on one or more signs or symptoms associated with a tauopathy; (c) identifying the candidate agent as a candidate therapeutic agent having an effect against the one or more signs or symptoms associated with a tauopathy, wherein the animal tissue is ex vivo, the population of animal cells is in vitro, and the population of animal cells does not include human germ cells and does not include human embryonic cells.

21. The one or more signs or symptoms are (I) tau hyperphosphorylation or tau aggregation, or (II) an increase in tau and / or phosphotau in the insoluble fraction after cellular fractionation, an increase in phosphotau in the somatodendritic compartment of neurons, an increase in phosphotau in the perinuclear region of neurons, a decrease in the nuclear to cytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 (Nup98) in neurons, a decrease in the nuclear to cytoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in neurons, or a decrease in the nuclear to cytoplasmic ratio of Ran GTPase activating protein 1 (RanGAP1) in neurons. Including, 21. The method of claim 20.

22. A method for producing a population of a rodent according to any one of claims 1 to 11 and 18 to 19, an animal tissue according to any one of claims 1 to 11 and 15 to 17, or an animal cell according to any one of claims 1 to 14, comprising: (I) (a) introducing said one or more agents that reduce expression of one or both of BANF1 and ANKLE2 into a rodent, an ex vivo animal tissue, or an in vitro population of animal cells that contain said microtubule-associated protein tau coding sequence; (b) screening the rodent, the animal tissue, or the population of animal cells to identify the presence of the one or more agents; or (II) (a) administering to a rodent, to an ex vivo animal tissue, or to a population of animal cells in vitro; (i) an exogenous human microtubule-associated protein tau coding sequence; (ii) introducing one or more agents that reduce expression of one or both of BANF1 and ANKLE2; (b) screening the rodent, the animal tissue, or the population of animal cells to confirm the presence of the one or more agents and the exogenous human microtubule-associated protein tau coding sequence, wherein the population of animal cells does not contain human germ cells and does not contain human embryonic cells. method.

23. (I) the exogenous human microtubule-associated protein tau coding sequence is delivered via an adeno-associated virus, a lentivirus, or a lipid nanoparticle; and / or (II) the one or more agents are delivered via an adeno-associated virus, a lentivirus, or a lipid nanoparticle; and / or (III) the method is for producing the rodent, and the one or more agents are administered to the rodent by intrathecal, intracranial, or intraventricular injection, or the one or more agents are administered to the rodent by stereotactic injection into the brain.

23. The method of claim 22.

24. A method for accelerating or exacerbating tau aggregation in a tauopathy model rodent, a tauopathy model animal tissue, or a tauopathy model population of animal cells, comprising introducing into the tauopathy model rodent, the tauopathy model animal tissue, or the tauopathy model population of animal cells one or more agents that reduce expression of one or both of BANF1 and ANKLE2, wherein the tauopathy model animal tissue is ex vivo, the tauopathy model population of animal cells is in vitro, and the tauopathy model population of animal cells does not comprise human germ cells and does not comprise human embryonic cells.

25. the tauopathy model rodent, the tauopathy model animal tissue, or the tauopathy model population of animal cells comprises an exogenous human microtubule-associated protein tau coding sequence; 25. The method of claim 24.

26. (I) the exogenous human microtubule-associated protein tau coding sequence is integrated into the genome; and / or (II) the exogenous human microtubule-associated protein tau coding sequence comprises a complementary DNA (cDNA) sequence; and / or (III) the exogenous human microtubule-associated protein tau coding sequence is codon-optimized for expression in the rodent, the animal tissue, or the population of animal cells; and / or (IV) the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter, a mouse prion protein promoter, a neuron-specific promoter or a synapsin-1 promoter; 26. The method of claim 25.

27. the exogenous human microtubule-associated protein tau comprises a tauopathy-associated mutation; (I) the tauopathy-associated mutation comprises a P301S mutation or the exogenous human microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 98; or (II) the tauopathy-associated mutation comprises an A152T / P301L / S320F triple mutation, or the exogenous human microtubule-associated protein tau coding sequence comprises the sequence set forth in SEQ ID NO: 83, or the exogenous human microtubule-associated protein tau comprises the sequence set forth in SEQ ID NO: 84; 27. The method of claim 25 or 26.

28. The one or more drugs (I) A nuclease agent targeting BANF1 or ANKLE2, or a nucleic acid encoding said nuclease agent, wherein said nuclease agent is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeats (CRISPR) associated (Cas) protein and a guide RNA; (II) A transcriptional repressor that targets BANF1 or ANKLE2, or a nucleic acid encoding said transcriptional repressor, wherein said transcriptional repressor comprises a guide RNA and a catalytically inactive Cas protein fused to a transcriptional repressor domain; or (III) An antisense oligonucleotide or RNAi agent targeting BANF1 or ANKLE2, or a nucleic acid encoding said antisense oligonucleotide or said RNAi agent. The method according to any one of claims 24 to 27, comprising:

29. 29. The method of claim 28, wherein the nuclease agent is the Cas protein and the guide RNA, the Cas protein is a Cas9 protein, and the Cas protein is a catalytically active Cas protein.

30. (I) The guide RNA targets mouse Banf1 and comprises any one of the sequences set forth in SEQ ID NOs: 44-46; or the guide RNA targets human BANF1 and comprises any one of the sequences set forth in SEQ ID NOs: 27-30; or (II) The guide RNA targets mouse Ankle2 and comprises any one of the sequences set forth in SEQ ID NOs: 50-52; or the guide RNA targets human ANKLE2 and comprises the sequence set forth in SEQ ID NO: 38; 30. The method of claim 29.

31. (I) the antisense oligonucleotide comprises a sequence set forth in any one of SEQ ID NOs: 105-126, 169-236 or 279-324, or a modified version thereof; or (II) the antisense oligonucleotide comprises any one of the sequences set forth in SEQ ID NOs: 105, 106, 110-113, 115, 120-122, 124, 125, 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, 213, 215, 216, 220-223, 225, 230-232, 234, 235, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321, and 323, or a modified version thereof; the antisense oligonucleotide comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl modified bases, or the antisense oligonucleotide is a 5-10-5 gapmer comprising a phosphorothioate backbone, a 5' wing of 2'-methoxyethyl modified bases, a central 10 nucleotide core of DNA, and a 3' wing of 2'-methoxyethyl modified bases; 29. The method of claim 28.

32. (I) the one or more agents are delivered via an adeno-associated virus, a lentivirus, or a lipid nanoparticle; and / or (II) the one or more agents are administered to the rodent by intrathecal, intracranial, or intracerebroventricular injection, or the one or more agents are administered to the rodent by stereotactic injection into the brain; The method according to any one of claims 24 to 31.

33. at least one sign or symptom of a tauopathy is increased in the rodent, the animal tissue, or the population of animal cells compared to a rodent, the animal tissue, or the population of animal cells that does not contain the one or more agents that reduce expression of one or both of BANF1 and ANKLE2, and the at least one sign or symptom is (I) tau hyperphosphorylation or tau aggregation, and / or (II) an increase in tau and / or phosphotau in the insoluble fraction after cellular fractionation, an increase in phosphotau in the somatodendritic compartment of neurons, an increase in phosphotau in the perinuclear region of neurons, a decrease in the nuclear to cytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 (Nup98) in neurons, a decrease in the nuclear to cytoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in neurons, or a decrease in the nuclear to cytoplasmic ratio of Ran GTPase activating protein 1 (RanGAP1) in neurons. Including, 33. The method according to any one of claims 24 to 32.

34. (I) The cell is a human cell or a rodent cell, and / or (II) The cell comprises a neuron, 34. The method according to any one of claims 24 to 33.

35. 35. The method of claim 34, wherein the rodent cell is a mouse cell or a rat cell.

36. 35. The method of claim 34, wherein the neural cells comprise neurons derived from human induced pluripotent stem cells, neurons derived from mouse embryonic stem cells, or primary mouse neurons. (I) The animal is a rodent, and / or (II) The tissue is a nervous system tissue; 34. The method according to any one of claims 24 to 33.

38. 38. The method of claim 37, wherein the rodent is a mouse or a rat.

39. 38. The method of claim 37, wherein the tissue comprises a brain slice.

40. The method of any one of claims 24 to 33, wherein the rodent is a mouse or a rat.

41. The method of claim 40, wherein the rodent is a mouse, and the mouse is a PS19 transgenic mouse further comprising the one or more agents that reduce expression of one or both of BANF1 and ANKLE2.

Images