Nucleic Acid Vaccination with Neoepitope-Encoding Constructs

Abstract

The present disclosure provides novel means and methods for cancer-targeting DNA vaccination, particularly for anti-cancer vaccination using plasmid-based vaccines containing regions encoding neoepitopes and amphiphilic block copolymers such as poloxamers and poloxamines.

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present invention relates to cancer therapy, in particular to cancer immunotherapy. In particular, the present invention relates to methods and products for treating cancer by nucleic acid vaccination. [Background technology]

[0002] 2. Background of the Invention Treatment of malignant neoplasms in patients has traditionally focused on eradicating / removing the malignant tissue by surgery, radiation therapy, and / or chemotherapy with cytotoxic agents in dosage regimens aimed at preferentially killing malignant cells relative to non-malignant cells.

[0003] In addition to the use of cytotoxic drugs, more recent approaches focus on targeting specific biological markers in cancer cells to reduce the systemic side effects manifested by conventional chemotherapy. Monoclonal antibody therapy targeting cancer-associated antigens has shown to be highly effective in extending life expectancy in many malignant neoplasms. Although successful drugs, monoclonal antibodies targeting cancer-associated antigens, by their nature, can only be developed to target expression products that are well known and found in multiple patients; that is, as seen below, many cancer-specific antigens are only expressed in tumors from a single patient, and therefore the vast majority of cancer-specific antigens cannot be addressed by this type of therapy.

[0004] The immune surveillance theory, proposed as early as the late 1990s by Burnet and Thomas, suggested that lymphocytes recognize and eliminate autologous cells, including cancer cells, that display altered antigenic determinants, and it is now generally accepted that the immune system is highly responsible for controlling the growth of primary tumors and eliminating metastases. However, immune surveillance is not 100% effective, and devising cancer therapies that improve / stimulate the immune system's ability to eliminate cancer cells is an ongoing challenge.

[0005] One approach is to induce immunity against cancer-associated antigens, which can be effective but suffers from the same drawbacks as antibody therapy: only a limited number of antigens can be addressed.

[0006] Many, if not all, tumors express mutations. These mutations may generate novel target antigens (neo-antigens), which may be useful in specific T cell immunotherapy if it is possible to identify the neo-antigens and their antigenic determinants in a clinically relevant time frame. Modern techniques allow the complete sequencing of the genome of cells and the analysis of the presence of altered or newly expressed gene products, thus allowing the design of personalized vaccines based on neo-antigens. However, attempts to provide satisfactory clinical endpoints have largely failed today or are still in an inconclusive early stage.

[0007] One mode of vaccination that has been studied in detail since the early 1950s is nucleic acid vaccination (also called DNA vaccination), in which DNA is administered in the form of a non-viral plasmid into mammalian somatic cells, resulting in expression of an insert sequence contained within the plasmid; in DNA vaccination, the encoded material is an immunogenic polypeptide that, when produced in somatic cells, is capable of inducing an immune response. This approach is attractive because it avoids the need to produce protein immunogens at clinical grade purity using expensive recombinant expression systems. However, it has proven difficult to obtain sufficient expression levels from the administered DNA to elicit a satisfactory immune response in humans.

[0008] Thus, there is a need to provide anti-cancer vaccines, particularly nucleic acid vaccines, that can effectively target neoantigens and induce clinically significant immune responses in vaccinated humans. Summary of the Invention [Problem to be solved by the invention]

[0009] Object of the invention It is an object of embodiments of the present invention to provide methods and articles for use in nucleic acid vaccination to treat or ameliorate cancer in many mammals, including humans. [Means for solving the problem]

[0010] Summary of the Invention The inventors have found that immunizing mice with a dose of a DNA vaccine plasmid encoding the identified cancer neoepitopes can provide protective immunity against cancer; the dose is further translated into a clinically acceptable human dose. The present disclosure may provide the following aspects. [Section 1] 1. A method of inducing a therapeutic or ameliorative immune response against a malignant neoplasm in a patient, wherein the malignant neoplastic cells express genetic material encoding a polypeptide comprising a neoepitope, the method comprising: 1) at least one expression vector comprising a nucleic acid encoding at least one polypeptide that exhibits one or more neoepitopes of a malignant neoplasm; and 2) amphiphilic block copolymers containing blocks of poly(ethylene oxide) and poly(propylene oxide), and 3) a pharma- ceutically acceptable carrier, diluent, or excipient; administering to the patient an effective amount of at least one composition comprising the steps of: [Section 2] Item 2. The method according to item 1, wherein the amphiphilic block copolymer is a poloxamer or a poloxamine. [Section 3] Item 3. The method according to item 1, wherein the amphiphilic block copolymer is a poloxamer selected from poloxamer 407 and 188, preferably poloxamer 188. [Section 4] The amphiphilic block copolymer has the formula (PEO-PPO) 4 Item 2. The method of item 1, wherein the sequential poloxamine is -ED, where PEO is poly(ethylene oxide), PPO is poly(propylene oxide) and ED is an ethylenediaminyl group. [Section 5] The method according to any one of the preceding clauses, wherein the pharma- ceutically acceptable carrier, diluent, or excipient is an aqueous buffer solution. [Section 6] Item 6. The method according to item 5, wherein the aqueous buffer solution is Tyrode's buffer or 2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS) buffer or PBS. [Section 7] The Tyrode buffer contains 140mM NaCl, 6mM KCl, 3mM CaCl 2 , 2 mM MgCl 2 , 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Hepes), and 10 mM glucose, or 140 mM NaCl, 6 mM KCl, 3 mM CaCl 2 , 2 mM MgCl 2 Item 7. The method according to item 6, having a composition of 10 mM 2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS), and 10 mM glucose. [Section 8] Item 11. The method of any one of the preceding paragraphs, wherein the concentration of the Tyrode's buffer is about 35% v / v. [Section 9] A method according to any one of the preceding clauses, wherein the concentration of the amphiphilic block copolymer is between 2% and 5% w / v, for example about 3% w / v. [Section 10] The method of any one of the preceding clauses, wherein the composition further comprises at least one immunostimulatory sequence (ISS). [Section 11] 11. The method of claim 10, wherein the ISS is an oligodeoxyribonucleotide (ODN) containing at least one CpG motif, wherein the ODN preferably contains phosphorothioate groups. [Section 12] 11. The method of claim 10, wherein the ISS is or comprises an oligoribonucleotide. [Section 13] The method of any one of the preceding clauses, wherein the effective amount comprises between 10 μg and 25 mg of expression vector, for example between 100 μg and 20 mg, between 0.5 mg and 15 mg, between 1 mg and 10 mg, and between 2 mg and 8 mg, in particular about 0.5 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, and about 8 mg of expression vector. [Section 14] The method of any one of the preceding clauses, wherein the expression vector expresses at least or about 5, such as at least or about 10, at least or about 15, at least or about 20, at least or about 25, and at least or about 30 neoepitopes. [Section 15] The method of any one of the preceding clauses, wherein the expression vector encodes a separate peptide for each encoded neoepitope. [Section 16] The method of any one of the preceding claims, wherein the expression vector encodes a plurality of peptides, wherein at least one peptide exhibits several encoded neoepitopes, and optionally at least some of the neoepitopes are separated by peptide linkers. [Section 17] The method according to any one of the preceding clauses, wherein the expression vector further comprises or encodes at least one immunostimulatory sequence (ISS). [Section 18] 18. The method of claim 17, wherein the at least one ISS or the sequence encoding an ISS is located between the stop codon of the sequence encoding the neoepitope and the polyadenylation signal. [Section 19] 19. The method of any one of paragraphs 17-18, wherein the at least one ISS is contained in an expression vector. [Section 20] 19. The method of any one of paragraphs 17-18, wherein the sequence encoding the at least one ISS is encoded by an expression vector. [Section 21] 20. The method of claim 19, wherein the ISS is or comprises a sequence that activates Toll-like receptor 9 (TLR9), such as a CpG motif. [Section 22] The method of claim 20, wherein the ISS encodes an RNA sequence that activates a cytoplasmic RNA receptor, such as Toll-like receptor 3 (TLR-3) and / or RIG-1, MDA5, and LGP2, e.g., an RNA sequence that forms an RNA hairpin or constitutes an immunostimulatory RNA sequence. [Section 23] Item 11. The method according to any one of the preceding items, wherein said expression vector is contained in or constitutes a plasmid. [Section 24] The method of any one of the preceding clauses, wherein at least one effective amount is a series of administrations, such as 2, 3, 4, 5, 6 or more series of administrations. [Section 25] The method of any one of the preceding clauses, wherein the patient is a human. [Section 26] The method of any one of the preceding clauses, wherein the effective amount is administered parenterally, for example via intramuscular, intradermal, transdermal, subcutaneous, intravenous, intraarterial, the intratechal, the intramedullary, the intrathecal, intraventricular, intraperitoneal, intranasal, intravaginal, intraocular, or intrapulmonary routes, or via oral, sublingual, buccal, or anal routes, or topically. [Section 27] 1) at least one expression vector comprising a nucleic acid encoding at least one polypeptide that exhibits one or more neoepitopes of a malignant neoplasm; and 2) amphiphilic block copolymers containing blocks of poly(ethylene oxide) and poly(propylene oxide), and 3) Tyrode's buffer. A composition comprising: [Section 28] 28. The composition according to item 27, as defined in any one of items 2-23. [Section 29] A composition as defined in any one of paragraphs 1-23 for use as a medicament. [Section 30] A composition as defined in paragraphs 1-23 for use in a method according to any one of paragraphs 1-14.

[0011] Thus, in a first aspect, the present invention relates to a method of inducing a therapeutic or ameliorative immune response against a malignant neoplasm in a patient, wherein the malignant neoplastic cells express genetic material encoding a neoepitope comprising a polypeptide, the method comprising: 1) at least one expression vector comprising a nucleic acid encoding at least one polypeptide that exhibits one or more neoepitopes of a malignant neoplasm; and 2) amphiphilic block copolymers containing blocks of poly(ethylene oxide) and poly(propylene oxide), and 3) a pharma- ceutically acceptable carrier or diluent; wherein the patient's somatic cells express a nucleic acid encoding at least one polypeptide.

[0012] In a second aspect, the present invention provides a method for producing a composition comprising the steps of: 1) at least one expression vector comprising a nucleic acid encoding at least one polypeptide that exhibits one or more neoepitopes of a malignant neoplasm; and 2) amphiphilic block copolymers containing blocks of poly(ethylene oxide) and poly(propylene oxide), and 3) a pharma- ceutically acceptable carrier or diluent; i.e. the same composition as that administered in the method of the first aspect of the invention.

[0013] In a third and fourth aspect, the invention relates, respectively, to a composition of the second aspect, 1) for use as a medicament, and 2) for use in a method of the first aspect. [Brief description of the drawings]

[0014] Description of the drawings [Figure 1] Figure 1: Plasmid map of pVAX1. Details are given in the Examples and in SEQ ID NO:1.

[0015] [Diagram 2] Figure 2: Plasmid map of pVAX1 S16A. Details are provided in the Examples.

[0016] [Diagram 3] Figure 3: Plasmid map of pVAX1 S16B. Details are given in the Examples.

[0017] [Figure 4] Figure 4: Detection of C22 MHCI multimers. Graph shows the frequency of mouse CD8+ T cells responding to C22 peptides upon inoculation of mice with an experimental DNA vaccine.

[0018] [Diagram 5] Figure 5: Plasmid map showing preferred ISS locations in pTVG4.

[0019] [Figure 6] Figure 6: Tumor volume (area under the curve, AUC) in mice vaccinated with Lutrol® and vaccine plasmid. See Example 1 for details.

[0020] [Figure 7] Figure 7: Tumor volume (area under the curve, AUC) in mice vaccinated with the test vaccines. For details, see Example 2.

[0021] [Figure 8]Figure 8: C22 tetramer staining of CD8+ T cells isolated from vaccinated mice. For details see Example 2.

[0022] [Figure 9] Figure 9: Tumor size (area under the curve, AUC) in mice vaccinated with the test vaccines. For details, see Example 3.

[0023] [Figure 10] Figure 10: C22 tetramer staining of CD8+ T cells isolated from vaccinated mice. For details see Example 3.

[0024] [Figure 11] Figure 11: Tumor size (area under the curve, AUC) in mice vaccinated with the test vaccine. For details, see Example 4. *: p<0.05 (Kruskal-Wallis test) **: p<0.01 (Kruskal-Wallis test) ***: p<0.001 (Kruskal-Wallis test) ****: p<0.001 (Kruskal-Wallis test)

[0025] [Figure 12] Figure 12: C22 tetramer staining of CD8+ T cells isolated from vaccinated mice. For details see Example 4.

[0026] [Figure 13] Figure 13: Graph showing reactive T cells capable of producing multiple cytokines (TNFα and IFNγ). A: Data from CD8+ cells B: Data from CD4+ cells DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] Detailed Disclosure of the Invention definition "PEO-PPO" amphiphilic block copolymers are linear or branched copolymers comprising or consisting of blocks of poly(ethylene oxide) ("PEO") and blocks of poly(propylene oxide) ("PPO"). Exemplary useful PEO-PPO amphiphilic block copolymers have the general structures PEO-PPO-PEO ("poloxamer"), PPO-PEO-PPO, (PEO-PPO-)4ED ("poloxamine"), and (PPO-PEO-)4ED ("reverse poloxamine"), where "ED" is an ethylenediaminyl group.

[0028] A "poloxamer" is a linear amphiphilic block copolymer consisting of a block of poly(propylene oxide) ("PPO") linked to a block of poly(ethylene oxide) ("PEO"), and further linked to a block of PEO, i.e., having the formula EOa-POb-EOa, where EO is ethylene oxide, PO is propylene oxide, a is an integer between 2 and 130, and b is an integer between 15 and 67. Poloxamers are traditionally designated using a three-digit identifier, where the first two digits multiplied by 100 indicate the approximate molecular weight of the PPO content, and the last digit multiplied by 10 indicates the approximate percentage of PEO content. For example, "poloxamer 188" refers to a polymer containing a PPO block with Mw of about 1800 (corresponding to a PPO of b: about 31), and about 80% (w / w) PEO (corresponding to an a of about 82). However, this value is known to vary to some extent and is consistent with research grade Lutrol 登録商標 F68 and clinical grade Kolliphor 登録商標 Commercially available products such as P188, although both are poloxamer 188 according to the manufacturer's datasheet, are shown to have large differences in molecular weight (between 7680 and 9510), and the values ​​of a and b provided for these particular products are shown to be approximately 79 and approximately 28, respectively. This reflects the heterogeneous nature of the block copolymer, meaning that the values ​​of a and b are averages in the final formulation.

[0029] "Poloxamine" or "Sequential Poloxamine" (Tetronic 登録商標 (commercially available under the trade name POLOXAMINE) is an X-shaped block copolymer in which four PEO-PPO arms are connected to a central ethylenediamine via bonds between the free OH groups of the PEO-PPO-groups and the primary amine groups of the ethylenediamine, and "reverse poloxamine" is likewise an X-shaped block copolymer in which four PPO-PEO arms are connected to a central ethylenediamine via bonds between the free OH groups of the PPO-PEO-groups and the primary amine groups of the ethylenediamine.

[0030] A "cancer-specific" antigen is an antigen that is not expressed as an expression product in an individual's non-neoplastic somatic cells, but is expressed as an expression product in an individual's cancer cells. This is in contrast to a "cancer-associated" antigen, which is an antigen that is expressed in low concentrations in normal somatic cells, but is found in high concentrations in at least some tumor cells.

[0031] The term "adjuvant" has its ordinary meaning in the vaccine art, i.e., a substance or composition of substances that 1) is not itself capable of generating a specific immune response to the vaccine immunogen, but 2) can nevertheless enhance the immune response to the immunogen. Or, in other words, vaccination with an adjuvant alone will not elicit an immune response to the immunogen, vaccination with an immunogen may or may not enhance the immune response to the immunogen, but vaccination with an immunogen in combination with an adjuvant will induce a stronger immune response to the immunogen than would be induced by the immunogen alone.

[0032] "CAF09" (Cationic Adjuvant Formulation 09) is an immunological adjuvant liposomal formulation that contains the quaternary ammonium surfactant N,N-dimethyl-N,N-dioctadecylammonium (DDA), synthetic 3-hydroxy-2-tetradecyl-octadecanoic acid-2,3-dihydroxypropyl ester (monomycolylglycerol, "MMG"), which acts as a ligand for C-type lectin receptors (CLRs), and polyinosinic-polycytidylic acid (sodium salt) ("Poly IC" or "Poly(I:C)"), which acts as a ligand for Toll-like receptors (TLRs). A number of CAF family adjuvants, including CAF09, are disclosed in detail in US2014 / 0112979 and US2016 / 0228528. The relative amounts (w:w:w) of DDA:MMG:Poly(I:C) are 5:1:1.

[0033] "CAF09b" is a version of CAF09 in which the relative amount of poly(I:C) has been reduced to approximately 1 / 4 of that disclosed in US2014 / 0112979: thus, the relative amounts of DDA:MMG:poly(I:C) (w:w:w) in CAF09 is 20:4:1, with a typical human dose containing 625 μg DDA, 125 μg MMG, and 31.25 μg poly(I:C).

[0034] A "neoepitope" is an antigenic determinant (typically an epitope restricted to MHC class I or II) that is absent as an expression product from normal somatic cells in an individual due to a deletion of the gene encoding the neoepitope, but is present as an expression product in mutated cells (e.g. cancer cells) of the same individual. As a result, from an immunological point of view, neoepitopes are truly non-self, despite their self origin, and therefore in the individual in which they constitute an expression product, they can be characterized as tumor-specific antigens. Being non-self, neoepitopes may potentially trigger a specific adaptive immune response in the individual, where the immune response elicited is specific to the antigen and cells bearing the neoepitope. On the other hand, neoepitopes are specific to the individual, since the chances that the same neoepitope will be an expression product in other individuals are minimal. Thus, neoepitopes have several characteristics that distinguish them from, for example, epitopes of tumor-specific antigens: the latter are typically found in multiple cancers of the same type (because they may be the expression products of activated oncogenes) and / or may be present, albeit in small amounts, in non-malignant cells due to overexpression of related genes in cancer cells.

[0035] A "neopeptide" is a peptide (i.e., a polyamino acid up to about 50 amino acid residues) that contains within its sequence a neoepitope as defined herein. Neopeptides are typically "natural", i.e., the entire amino acid sequence of the neopeptide constitutes a fragment of an expression product that can be isolated from an individual, but neopeptides can also be "artificial", i.e., the neopeptide is composed of the sequence of the neoepitope and one or two additional amino acid sequences, at least one of which is not naturally associated with the sequence of the neoepitope. In the latter case, the additional amino acid sequence may simply serve as a carrier for the neoepitope or may further enhance the immunogenicity of the neoepitope (e.g., by facilitating processing of the neopeptide by antigen-presenting cells, improving the biological half-life of the neopeptide, or altering the solubility).

[0036] A "neoantigen" is any antigen that contains a neoepitope. Typically, neoantigens are composed of proteins, but depending on their length, they can also be identical to neoepitopes or neopeptides.

[0037] The term "amino acid sequence" is the order of amino acid residues linked by peptide bonds in a chain of peptides and proteins. Sequences are conventionally written in the N-terminal to C-terminal direction.

[0038] A "linker" is an amino acid sequence introduced between two different amino acid sequences to spatially separate them. A linker may be "rigid", meaning that it does not allow the two amino acid sequences it connects to move substantially freely relative to each other. Similarly, a "flexible" linker allows the two sequences connected via the linker to move substantially freely relative to each other. Either type of linker is useful in encoded expression products that contain one or more neoepitopes. However, one particularly interesting linker useful in the present invention has a 12 amino acid residue sequence of AEAAAKEAAAKA (SEQ ID NO: 9).

[0039] Other linkers of interest that may be encoded in the expression vectors used in the present invention are shown in Table 2 below.

[0040] [Table 1]

[0041] An "immunogenic carrier" is a molecule or moiety that can be combined with an immunogen or hapten to enhance or induce an immune response to the immunogen / hapten. Immunogenic carriers are traditionally relatively large molecules (e.g., tetanus toxoid, KLH, diphtheria toxoid, etc.) that can be fused or conjugated to immunogens / haptens that are poorly immunogenic in their own right, and typically, immunogenic carriers can induce a strong T-helper lymphocyte response to the combined substance constituted by the immunogen and the immunogenic carrier, thus providing an enhanced response to the immunogen by B-lymphocytes and cytotoxic lymphocytes. More recently, large carrier molecules have been replaced to some extent by shorter peptides called promiscuous T-helper epitopes, i.e., those that are recognized by a large proportion of the HLA haplotypes of the population and that induce a T-helper lymphocyte response.

[0042] A "T helper lymphocyte response" is an immune response elicited by a peptide that can bind to an MHC class II molecule (e.g., an HLA class II molecule) on an antigen-presenting cell and stimulate T helper lymphocytes in an animal species as a result of T cell receptor recognition of the complex of the peptide and the MHC class II molecule presenting the peptide.

[0043] An "immunogen" is a substance that can induce an adaptive immune response in a host whose immune system is confronted with the immunogen. Thus, immunogens are a subset of the larger genus "antigens" and are substances that can be specifically recognized by the immune system (e.g., fragments of an antigen bound by an antibody, or alternatively bound to an MHC molecule, may be recognized by a T cell receptor), but not necessarily induce immunity; however, an antigen can always elicit immunity, i.e., a host with an established immune memory against an antigen will mount a specific immune response against that antigen.

[0044] A "hapten" is a small molecule that is unable to induce or elicit an immune response, but when conjugated to an immunogenic carrier, antibodies or T cell receptors (TCRs) that recognize the hapten can be induced upon contact of the immune system with the hapten-carrier conjugate.

[0045] An "adaptive immune response" is an immune response in response to contact with an antigen or immunogen, where the immune response is specific for an antigenic determinant of the antigen / immunogen. Examples of adaptive immune responses are the induction of antigen-specific antibody production or the antigen-specific induction / activation of T helper lymphocytes or cytotoxic lymphocytes.

[0046] A "protective, adaptive immune response" is an antigen-specific immune response induced in a subject in response to immunization (artificial or natural) with an antigen, which immune response can protect the subject against subsequent challenge with the antigen, or a pathology-associated agent that contains the antigen. Typically, vaccination aims to establish a protective adaptive immune response against one or several pathogens.

[0047] "Stimulation of the immune system" means that a substance or composition of substances exhibits a general, non-specific immunostimulatory effect. Many adjuvants and putative adjuvants (e.g., certain cytokines) share the ability to stimulate the immune system. Use of an immunostimulant results in increased "alertness" of the immune system, i.e., simultaneous or subsequent immunization with an immunogen induces a significantly more effective immune response compared to use of the immunogen alone.

[0048] The term "polypeptide" is intended in the present context to mean both short peptides of 2 to 50 amino acid residues, oligopeptides of 50 to 100 amino acid residues, and polypeptides of 100 or more amino acid residues. Moreover, the term is also intended to include proteins, i.e., functional biomolecules that contain at least one polypeptide, and when a functional biomolecule contains at least two polypeptides, these may be complexed, covalently linked, or non-covalently linked. Furthermore, the polypeptides in a protein may be glycosylated and / or lipidated and / or may contain prosthetic groups.

[0049] A first embodiment of the present invention. The methods disclosed herein induce a therapeutic or ameliorative immune response in a patient, preferably a human, against a malignant neoplasm, where the malignant neoplastic cells express genetic material encoding a neoepitope-containing polypeptide. The methods include: 1) at least one expression vector comprising a nucleic acid encoding at least one polypeptide that exhibits one or more neoepitopes of a malignant neoplasm; and 2) amphiphilic block copolymers containing blocks of poly(ethylene oxide) and poly(propylene oxide), and 3) a pharma- ceutically acceptable carrier, diluent, or excipient; wherein the patient's somatic cells express a nucleic acid encoding at least one polypeptide.

[0050] The expression vector typically and preferably comprises or is composed of a plasmid, although other expression vectors can also be employed. The composition of the present invention and the amphiphilic block copolymers contained therein are intended to ensure that the expression vector is delivered to cells as a "naked" DNA, i.e., a DNA expression vector and not part of a bacterium or virus that can affect the introduction of the expression vector into the target cell. Thus, the vectors useful in the compositions and methods of the present invention can be circular or linear, single-stranded or double-stranded, and in addition to plasmids, can also be, for example, cosmids, minichromosomes or episomes.

[0051] Each coding (and expressible) region may be present on the same or separate vectors, but it should be understood that one or more coding regions may be present on a single vector, and that these coding regions may be under the control of a single or multiple promoters. This means that an expression vector may encode a separate peptide expression product for each encoded neoepitope, or that an expression vector may encode multiple peptide expression products, where at least some of the expression products exhibit multiple encoded neoepitopes, at least some of which are optionally separated by peptide linkers.

[0052] In other words, in some cases only one single expression vector is administered and expressed, and this expression vector may code for several separate proteinaceous expression products, or may code for only two or one single expression product; in the context of the present text, it is only relevant whether the encoded neoepitopes are presented satisfactorily to the immune system, and therefore the choice of their separate presence on the combined expression product is not so relevant. In a preferred embodiment, the expression vector expresses at least or about 5, for example at least or about 10, at least or about 15, at least or about 20, at least or about 25, at least or about 30 proteinaceous expression products. When considering a number greater than this, the limit is mainly set by the number of neoepitopes that can be identified from a particular malignant neoplasm. Needless to say, the number of neoepitopes encoded in the expression vector cannot exceed the number of neoepitopes found in the relevant malignant tissue.

[0053] The use of peptide linkers to separate the encoded neoepitope expression products allows for spatial separation of epitopes within the expression products, which may have several advantages: the linker may ensure that each neoepitope is presented to the immune system in an optimized conformation, and the use of an appropriate linker may minimize the problem of expression products containing multiple epitopes eliciting irrelevant immune responses against "junctional epitopes" that occur in the region consisting of the C-terminus of one neoepitope adjacent to the N-terminus of the next neoepitope.

[0054] The encoded peptide linker can be either "flexible" or "rigid", with reference to the above definitions describing preferred encoded peptide linkers. It is also envisioned that in some embodiments the linker used in the present invention can be cleavable, i.e., contain a recognition site for an endopeptidase, such as furin, caspase, cathepsin, etc.

[0055] Neoepitopes encoded in expression vectors can be identified in a manner known per se: by "deep sequencing" of the genomes of malignant and healthy cells in the same individual, or of a standard healthy genome, portions of expressed DNA can be identified that provide potentially immunogenic expression products unique to malignant cells. The identified DNA sequences can then be codon-optimized (typically for expression by human cells) and included in expression vectors, either as separate expression regions or as part of a larger chimeric construct.

[0056] To optimize the identification and selection of neoepitopes expressed by the vector, any predictive method available for this purpose would be of practical use. One example of a state-of-the-art predictive algorithm is NetMHCpan-4.0 (www.cbs.dtu.dk / services / NetMHCpan / ; Jurtz V et al., J Immunol (2017), ji1700893; DOI:10.4049 / jimmunol.1700893). This method is trained on a combination of traditional MS-derived ligand and pMHC affinity data. Another example is NetMHCstabpan-1.0 (www.cbs.dtu.dk / services / NetMHCstabpan / ; RasmussenM et al., Accepted for J of Immunol, June 2016). This method is trained on a dataset of in vitro pMHC stability measurements using assays in which each peptide is synthesized and complexed to MHC molecules in vitro. No cell processing is performed in this assay, and the environment in which pMHC stability is measured is somewhat artificial. The method is generally less accurate than NetMHCpan-4.0. US Patent 10,055,540 describes a method for the identification of neoepitopes using ligands detected by conventional MS. Other patent applications using similar technology are WO2019 / 104203, WO2019 / 075112, WO2018 / 195357 (MHC class II specific), and WO2017106638. Finally, MHCflurry: www-sciencedirect-com.proxy.findit.dtu.dk / science / article / pii / S2405471218302321 is like NetMHCpan trained on MS detected ligand data and pMHC affinity. Also, peptide-MHC class II interaction prediction methods are disclosed in a recent publication Garde C et al., Immunogenetics, DOI:doi.org / 10.1007 / s00251-019-01122-z. In this publication, native processed peptides eluted from MHC class II are used as part of the training set and assigned a binding affinity value of 1 if confirmed as a ligand and 0 if negative.

[0057] Typically, these forecasting systems employ artificial neural networks (ANNs): ANNs can identify nonlinear correlations: Quantifying nonlinear correlations is not an easy task, as they are difficult to compute using simple calculations. This is mainly because nonlinear correlations are described by many more parameters than linear correlations, and probably only emerge when all features are considered together. Thus, in order to capture the dependencies between features, all features must be taken into account.

[0058] To further improve the likelihood that the selected and encoded neoepitopes will provide an effective immune response, one may preferably use the techniques disclosed in European Patent Applications Nos. 19197295.9 and 19197306.4, both filed on September 13, 2019. These applications disclose techniques that allow the stability of binding between peptides and MHC molecules to be determined, and that allow for determining the MHC binding stability of neoepitopes as part of the detection and selection of neoepitopes. Briefly, the data obtained from the stability determination is used, for example, in the training set of an ANN, which may then rank the identified peptides according to their predicted binding stability to the associated MHC molecule.

[0059] When the nucleic acid vaccine is administered to a patient, the corresponding gene product (e.g., a desired antigen) is produced in the patient. In some embodiments, a nucleic acid vaccine vector comprising an optimized recombinant polynucleotide can be administered to a human to induce a therapeutic or prophylactic immune response.

[0060] Plasmids and other naked DNA vectors are typically more efficient at transferring genes to muscle tissue. The feasibility of delivering DNA vectors to mucosal surfaces by oral administration has also been reported, and DNA plasmids have been used to directly transfer genes to tissues other than muscle. DNA vaccines are primarily administered by intramuscular injection, delivery by gene gun, or jet injection (such as the Stratis IV vaccine from PharmaJet). 登録商標 The plasmid is introduced into the animal by a device such as a stimulatory device, or by electroporation, each of which is applicable to the methods of the present disclosure. After introduction, the plasmid is generally maintained episomally without replication. Expression of the encoded protein is long-lasting and has been shown to stimulate both B cells and T cells.

[0061] For the determination of the effective amount of vector to be administered in the treatment method disclosed herein, the physician evaluates the toxicity of the vector, the adverse events induced by the vaccine, the progression of the cancer to be treated, and the production of anti-vector antibodies, if any. Administration can be by single or divided doses, typically a series of time-separated doses. In the method disclosed herein, the effective human dose per immunization in the time-separated immunization series is between 10 μg and 500 mg, preferably between 100 μg and 25 mg of expression vector. That is, in the implementation of the method disclosed herein, a dose of between 1 mg and 20 mg in humans is typically used, and the dose is usually between 0.5 and 15 mg, between 1 and 10 mg, and between 2 and 8 mg, and the dose of particular interest is about 0.5 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, and about 8 mg.

[0062] A series of immunizations with an effective dose typically consists of a series of 2, 3, 4, 5, 6 or more doses. For example, to suppress malignant neoplasms for a long time, multiple doses (e.g., 6 or more) may be involved, and in such a situation, the exact selection of neoepitopes encoded in the vaccine vector may change over time, depending on the changes in the genome and proteome of the malignant cells. When or if new neoepitopes are produced by the malignant cells, these neoepitopes can be conveniently included as targets of the vaccine.

[0063] The vaccines used in the methods disclosed herein include one or more expression vectors; for example, the vaccines may include multiple expression vectors, each capable of autonomously expressing a nucleotide coding region in a mammalian cell to produce at least one immunogenic polypeptide. Expression vectors often include a eukaryotic promoter sequence, e.g., a nucleotide sequence of a strong eukaryotic promoter operably linked to one or more coding regions. The compositions and methods herein may include the use of any particular eukaryotic promoter, a wide variety of which are known; for example, the CMV or RSV promoter. The promoter may be heterologous to the host cell. The promoter used may be a constitutive promoter. The promoter used may include enhancer and intron regions to improve expression, such as, for example, the CMV promoter.

[0064] Numerous plasmids known in the art can be used to produce nucleic acid vaccines. Preferred embodiments of nucleic acid vaccines employ constructs using plasmids VR1012 (Vical Inc., San Diego Calif.), pCMVI.UBF3 / 2 (S. Johnston, University of Texas), pTVG4 (Johnson et al., 2006, Vaccine 24(3);293-303), pVAX1 (Thermo Fisher Scientific, see above and in the Examples below), or pcDNA3.1 (InVitrogen Corporation, Carlsbad, Calif.) as vectors.

[0065] Furthermore, the vector construct may advantageously contain an immunostimulatory sequence (ISS) according to the invention. The purpose of using such sequences in vaccine vectors is to enhance T cell responses against the encoded neoepitopes, in particular Th1 cell responses, elicited by adjuvants incorporating agonists of Toll-like receptors TLR3, TLR7-TLR8 and TLR9, and / or agonists of cytoplasmic RNA receptors, such as but not limited to RIG-1, MDA5 and LGP2 (Desmet et al. 2012. Nat. Rev. Imm. 12(7), 479-491).

[0066] One possibility for employing the ISS is to mimic bacterial infections that activate TLR9 by stimulating it with unmethylated CG-rich motifs (called CpG motifs) with the common sequence of six bases NNCGNN (which occurs 20 times more frequently in bacterial DNA than in mammalian DNA) either by directly administering small synthetic DNA oligos (ODNs) containing partially or fully phosphorothioated backbones or by incorporating the CpG motifs into the DNA vector backbone. The immunostimulatory CpGs may be part of the DNA backbone or be concentrated in the ISS, where the CpGs are typically located between the stop codon of the neoepitope-encoding sequence and the sequence encoding the polyA tail (i.e., the ISS is located between the stop codon and the polyadenylation signal). However, because CpG sequences are effective regardless of their position within a long DNA molecule, their location can in principle be anywhere within the vaccine vector, as long as the presence of the CpG motif does not interfere with the vector's ability to express the vaccine coding region.

[0067] When present as a separate ODN in the vaccine, and the ODN functions as an immunological adjuvant, the oligonucleotide containing the CpG motif is typically administered / formulated with the DNA vaccine by the selected delivery technology, and typically comprises a multi-base DNA of 6 or more bases containing the sequence NNCGNN or its reverse complement. ODN useful for this purpose are commercially available, for example, from InvivoGen (5 Rue Jean Rodier, F-31400, Toulouse, France), which sells a range of ODNs of classes A, B, and C. Examples are shown in Table 2 below.

[0068] [Table 2] In these 12 ODNs, the capitalized nucleotides are phosphodiesters, the lower case nucleotides are phosphorothioates, and the underlined portions are palindromic sequences.

[0069] When CpG sequences are present in the backbone of the plasmid (thereby making it "self-adjuvanting"), any number of possible NNGCNN sequences may be present according to the invention, either as identical sequences or in the form of sequences non-identical to the CpG motifs, or in the form of palindromic sequences that may form stem-loop structures. For example, the following CpG motifs are of interest: AACGAC and GTCGTT, as well as CTCGTT and GCTGTT. An example of such a CpG-encoding sequence is the following sequence taken from the commercially available pTVG4 vaccine vector backbone (schematically depicted in its entirety in FIG. 5 and SEQ ID NO: 40): …agatct aacgac aa aacgac aa aacgac aaggcgccagatctggcgtttcgtttt gtcgtt tt gtcgtt agattct… (SEQ ID NO:41) Here, the underlined nucleotides constitute the CpG present in the pTVG4 plasmid vector sequence.

[0070] Another possibility is to mimic an RNA virus infection that activates TLR3 by adding double-stranded (ds) RNA as synthetic RNA oligos such as poly I:C (polyinosinic-polycytidylic acid), poly I:C U12 (uridine-substituted poly I:C) or in the form of synthetic RNA oligonucleotides (ORNs), and the addition of these RNA molecules to the vaccine is a way to acquire adjuvant activity, similar to the ODN approach. Alternatively, dsRNA can be encoded in a DNA vector backbone that is transcribed into RNA after vaccination, in which case the DNA vaccine will code for an immunological adjuvant. In this approach, a DNA sequence can be included that codes for a hairpin RNA of up to 100 base pairs in length, where the sequence is non-specific. The DNA may also contain ODNs of known sequence and code for ORNs of known sequence; thus, the DNA may be transcribed into double-stranded RNA that can activate cytoplasmic RNA receptors such as TLR3 and / or RIG-1, MDA5, and LGP2, and may contain ODNs that activate TLR9. Examples of specific DNA sequences that contain / code immunostimulatory CpG and dsRNA are, for example, 5'-GGTGCATCGA TGCAGGGGGG-3' (SEQ ID NO: 41) and 5'-GGTGCATCGA TGCAGGGGGG TATATATATA TTGAGGACAG GTTAAGCTCC CCCCAGCTTA ACCTGTCCTT CAATATATA TATA-3' (SEQ ID NO: 42) (see Wu et al. 2011, Vaccine 29(44):7624-30).

[0071] When an ISS is present in a DNA vaccine vector, it is possible and advantageous to combine the approach using CpG to activate TLR9 with the presence of sequences encoding immunostimulatory RNAs that activate TLR3 and / or cytoplasmic RNA receptors such as RIG-1, MDA5, and LGP2; see Grossmann C et al. 2009, BMC.Immunology 10:43 and Desmet et al. 2012.Nat.Rev.Imm.12(7),479-491. Similarly, the incorporation of ORNs and ODNs as separate adjuvants (alone or in combination) in a vaccine may be combined with the incorporation of both types of ISS in a DNA vaccine vector.

[0072] As with the CpG motif, the DNA encoding the immunostimulatory RNA ISS is preferably located between the stop codon and the polyadenylation signal, but may be present in any part of the vector so long as this does not impair production of the intended polypeptide expression product.

[0073] In a particularly important embodiment, the ISS is included in the vaccine composition, and in a particularly important embodiment, this is achieved by incorporating an immunologically active and pharma- ceutically acceptable amount of poly I:C and / or poly IC:U12. Poly I:C is composed of mismatched double-stranded RNA (dsRNA) in which one strand is a polymer of inosinic acid and the other is a polymer of cytidylic acid. Poly IC:U12 is a variant of poly I:C in which uridines have been introduced into the poly I:C strand. These two substances function in this context as immunological adjuvants, i.e. substances that do not themselves induce a specific adaptive immune response, but enhance the specific adaptive immune response to the vaccine antigen (or, in this case, the encoded antigen).

[0074] Poly I:C or Poly I:U12 (e.g., Ampligen) 登録商標) is preferably present in the composition at a dosage between 0.1 and 20 mg per administration of an effective amount of the expression vector, i.e., the amount present in the composition is adjusted to this dosage per administration. Preferably, the dosage per administration of Poly I:C or Poly IC:U12 is between 0.2 and 15 mg, e.g., between 0.3 mg and 12 mg, 0.4 mg and 10 mg, and 0.5 mg and 8 mg per administration of an effective amount of the expression vector, preferably about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, 1. The preferred ranges are 1 mg, 1.2 mg, 1.3 mg, 1.4 mg, 1.5 mg, 1.6 mg, 1.7 mg, 1.8 mg, 1.9 mg, 2.1 mg, 2.2 mg, 2.3 mg, 2.4 mg, 2.5 mg, 2.6 mg, 2.7 mg, 2.8 mg, 2.9 mg, 3.1 mg, 3.2 mg, 3.3 mg, 3.4 mg, 3.5 mg, 3.6 mg, 3.7 mg, 3.8 mg, 3.9 and 4.0 mg. Particularly preferred is the range of 0.5 to 2.0 mg per administration.

[0075] Nucleic acid vaccines can also encode fusion products containing one or more immunogenic polypeptides, including neoepitopes. Plasmid DNA can also be delivered using attenuated bacteria as a delivery system, which is a suitable method for orally administered DNA vaccines. Bacteria are transformed with independently replicating plasmids, and the plasmids are released into the cytoplasm of the host cell after death of the attenuated bacteria within the host cell.

[0076] The DNA vaccine containing the DNA encoding the desired antigen can be introduced into the host cell in any suitable form, including fragment alone, linear plasmid, circular plasmid, replicable plasmid, episome, RNA, etc. Preferably, the gene is contained in a plasmid. In certain embodiments, the plasmid is an expression vector. Individual expression vectors capable of expressing the genetic material can be produced using standard recombinant techniques.

[0077] The routes of administration include, but are not limited to, intramuscular, intranasal, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterial, intraocular and oral, as well as topical or transdermal administration by inhalation or suppository, or by lavage, to mucosal tissues, such as vaginal, rectal, urethral, ​​buccal and sublingual tissues. In other words, the route of administration may be selected from any one of the parenteral routes, such as via intramuscular, intradermal, transdermal, subcutaneous, intravenous, intraarterial, intrathecal, intrathecal, intraventricular, intraperitoneal, intranasal, intravaginal, intraocular or intrapulmonary routes; administered via oral, sublingual, buccal or anal routes; or administered topically.

[0078] Typical routes of administration include intramuscular, intraperitoneal, intradermal and subcutaneous injection. Gene constructs can be administered by means including, but not limited to, conventional syringes, needleless injection devices, "biolist gene guns", or other physical methods such as electroporation ("EP"), "hydrodynamic methods", or ultrasound. DNA vaccines can be delivered by any method that can be used to deliver DNA, as long as the DNA is expressed in cells and the desired antigen is produced.

[0079] In some embodiments, the DNA vaccine compositions disclosed herein are delivered via or in combination with known transfection reagents such as cationic liposomes, fluorocarbon emulsions, cochleae, tubules, gold particles, biodegradable microspheres, or cationic polymers. Cochleae delivery vehicles are stable phospholipid calcium precipitants composed of phosphatidylserine, cholesterol, and calcium, which are non-toxic and non-inflammatory transfection reagents that can be present in the digestive system. Biodegradable microspheres contain polymers such as poly(lactide-co-glycolide), a polyester that can be used to manufacture DNA microcapsules for transfection. Lipid-based microtubules often consist of two layers of lipids wound into a helix, packed together by binding their ends together. When tubules are used, nucleic acids can be placed into their central hollow space for delivery and controlled release into the animal's body.

[0080] DNA vaccines can be delivered to mucosal surfaces via microspheres. Bioadhesive microspheres can be prepared using a variety of techniques to adhere to any mucosal tissue found in the eyes, nasal passages, urinary tract, colon, and gastrointestinal tract, providing the possibility of local and systemic controlled release of vaccines. Application of bioadhesive microspheres to specific mucosal tissues can also be used for localized vaccination. In some embodiments, an alternative approach for mucosal vaccine delivery is to administer plasmid DNA expression vectors encoding genes for specific protein antigens directly to mucosal surfaces.

[0081] The disclosed DNA plasmid vaccines are formulated according to the mode of administration to be used. Typically, DNA plasmid vaccines are injectable compositions, which are sterile and / or pyrogen-free and / or particle-free. In some embodiments, isotonicity agents are preferably used. In general, additives for isotonicity may include sodium chloride, dextrose, mannitol, sorbitol, and lactose, in some embodiments, isotonic solutions such as phosphate buffered saline are preferred; one preferred solution is Tyrode's buffer. In some embodiments, stabilizers include gelatin and albumin. In some embodiments, stabilizers are added to the formulation, such as LGS or other polycations or polyanions, which allow the formulation to be stable for long periods of time at room temperature or ambient temperature.

[0082] The DNA vaccine compositions disclosed herein comprise pharmacologically acceptable amphiphilic block copolymers comprising blocks of poly(ethylene oxide) and poly(propylene oxide), which are described in detail below:

[0083] The disclosed amphiphilic block copolymers are more generally described under the heading of definitions, however, preferred amphiphilic block copolymers are poloxamers or poloxamines. The poloxamers differ only slightly in terms of their nature, but are preferably poloxamer 407 and 188, especially poloxamer 188.

[0084] When the amphiphilic block copolymer is a poloxamine, a preferred type is the sequential poloxamine of the formula (PEO-PPO)4-ED, where PEO is poly(ethylene oxide), PPO is poly(propylene oxide) and ED is an ethylenediaminyl group. These molecules have an X-like shape with the PEO-PPO groups protruding from the central ethylenediaminyl group. Particularly preferred poloxamines are available under the trademark Tetronic®, respectively. 登録商標These poloxamines are sold under the names Tetronic, 904, 704, and 304. 登録商標 The total average molecular weight of 904 is 6700, the total average weight of PPO units is 4020, and the proportion of PEO is about 40%. 登録商標 The total average molecular weight of 704 is 5500, the total average weight of PPO units is 3300, and the proportion of PEO is about 40%. 登録商標 The total average molecular weight of 304 is 1650, the total average weight of PPO units is 990, and the proportion of PEO is about 40%.

[0085] When used in the methods disclosed herein, the concentration of the amphiphilic block copolymer in the vaccine composition is from 2% to 5% w / v, for example about 3% w / v.

[0086] The third component in the compositions disclosed herein is a pharma- ceutically acceptable carrier, diluent, or excipient, preferably in the form of a buffer solution. Parenteral vehicles include sodium chloride solution, Ringer's dextrose and sodium chloride, lactated Ringer's solution, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives, antimicrobial agents include antioxidants, chelating agents, inert gases, and the like. Preferred preservatives include formalin, thimerosal, neomycin, polymyxin B, and amphotericin B.

[0087] In a preferred embodiment, the buffer solution is one known as "Tyrode's buffer," and in a preferred embodiment, the Tyrode's buffer has a composition of 140 mM NaCl, 6 mM KCl, 3 mM CaCl2, 2 mM MgCl2, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Hepes), preferably at pH 7.4, and 10 mM glucose, or alternatively, 140 mM NaCl, 6 mM KCl, 3 mM CaCl2, 2 mM MgCl2, 10 mM 2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS), preferably at pH 7.4, and 10 mM glucose. The concentration of the Tyrode's buffer (or its alternative) is typically about 35% v / v, although depending on the water content of the suspended plasmid, this concentration can vary widely - as the buffer is physiologically acceptable, it can constitute any proportion of the aqueous phase of the composition.

[0088] Other buffers may also be utilized, such as 2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS) or phosphate buffered saline.

[0089] Additional carrier materials may be included and may include proteins, sugars, etc. Such carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous carriers are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline solutions.

[0090] Second Aspect - Vaccine Composition The vaccine composition which constitutes the second aspect of the invention is a composition as described in the first aspect of the invention and in the claims, and thus each and every feature and consideration relating to the composition used in the methods disclosed herein also applies mutatis mutandis to the composition of the second aspect of the invention.

[0091] Third, fourth and related aspects of the invention The two aspects are related in that they relate to a composition of the second aspect for pharmaceutical use, i.e. they relate to a composition of the second aspect of the invention for use as a medicament or for use in a method according to the first aspect of the invention, respectively.

[0092] Similarly, the fourth aspect of the invention also covers the use of the composition of the second aspect in the method of the first aspect, and the use of components of the composition of the second aspect for use in the preparation of a pharmaceutical composition for use in the treatment of a malignant neoplasm. EXAMPLES

[0093] Example 1 Experimental vaccine research The purpose of the study is, first, to test the ability of the DNA vaccine of the present invention to induce neopeptide-specific T cells and to observe the effect of the vaccine on the health of vaccinated mice.

[0094] The plasmid for DNA vaccination was the commercially available pVax1 plasmid sold by ThermoFisher Scientific / Invitrogen. 商標 Vector based.

[0095] According to the manufacturer's documentation, pVAX1 商標 is a 3.0 kb plasmid vector that allows for high copy number replication in E. coli and high level transient expression of the encoded protein of interest in most mammalian cells. This vector (see FIG. 1) contains the following elements: 1) Human cytomegalovirus immediate early (CMV) promoter for high-level expression in a wide range of mammalian cells 2) the bovine growth hormone (BGH) polyadenylation signal for efficient mRNA transcription termination and polyadenylation; and 3) A kanamycin resistance gene for selection in E. coli.

[0096] pVAX1 商標 The entire sequence of the plasmid is set forth in SEQ ID NO: 1. A control plasmid, pVAX1, was used as a positive control for transfection and expression in the selected cell lines. 商標 / lacZ can be used, the sequence of which is set forth in SEQ ID NO:2.

[0097] Two expression vectors, pVAX1 S16A and pVAX1 S16B, were constructed.

[0098] We first identified neopeptides / neoepitopes by whole-exome sequencing of the mouse rectal cancer cell line CT26 and normal tissue samples from BALB / c mice and selecting peptides found exclusively in cancer cells, which were confirmed by measuring RNA expression levels. In this experiment, we assessed the ability of mice to generate an immune response against the identified neoepitopes.

[0099] pVAX1 S16A was constructed by ligating codon-optimized (for expression in mouse) DNA encoding a peptide containing the five sequentially linked neoepitopes C22, C23, C25, C30, and C38 (SEQ ID NO: 11-15) into the pVax1 expression cassette. Similarly, pVax1 S16B was constructed by ligating codon-optimized DNA encoding the sequentially linked neoepitopes C29, C37, C39, C40, and C41 (SEQ ID NO: 16-20) into the pVax1 expression cassette. To serve as a control, a peptide mixture of C22, C23, C25, C26 (SEQ ID NO: 21), and C38 was formulated in CAF09 adjuvant as described above. In the pVAX1 S16A and S16B vectors, both inserts contain Kozak consensus sequences for efficient translation initiation. The 11 amino acid sequences used in this experiment (and in the Examples below) are set forth in the table below.

[0100] [Table 3]

[0101] Plasmids pVAX1 S16A, pVAX1 S16B, and (empty) pVAX1 were dissolved in sterile water and incubated with poloxamer 188 (Lutrol 188, Sigma Aldrich) for 1 h at 37 °C for 2 h. 登録商標 F68) and Tyrode's buffer to give a composition of 3% v / v poloxamer 188 and 1 μg / μl plasmid in Tyrode's buffer. Vehicle solutions of water, Tyrode's buffer (ratio of water:buffer) and poloxamer 188 (3% v / v) were also prepared.

[0102] In parallel, a peptide mixture as described above was prepared by mixing DMSO-solubilized peptides, Tris buffer and CAF09, resulting in a composition containing 5% w / v of each peptide (i.e., 25% w / v of total peptides), 5% DMSO, 66.67% v / v CAF09 in Tris buffer.

[0103] One group of 5 mice was immunized with the peptide composition at a dose of 50 μg of each peptide on days 0, 1, 2, 3, 9, and 16. In parallel, 4 groups of 5 mice each were injected with 100 μl of DNA vaccine (or mock control) in a 50 μl format into each tibia on days 2, 9, and 16. The four groups were immunized with poloxamer 188 only, poloxamer 188 and mock plasmid, poloxamer 188 and pVax S16A, and poloxamer 188 and pVax S16B, respectively.

[0104] To measure T cell activation, the following restimulation experiments were performed: Spleen cells were stimulated with the vaccine-containing neopeptides. In the spleen cell samples, antigen-presenting cells processed the neoepitopes and then presented them to T cells, leading to activation of cognate CD4+ and CD8+ T cells. Activated T cells increased the synthesis of cytokines, including tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ). Polyfunctional T cells were detected by staining with fluorescently labeled antibodies specific for cytokines and cell surface markers.

[0105] result Whole blood from all mice was collected 13 days after the first immunization and stained with fluorescently labeled C22 MHCI tetramer.

[0106] Vaccination with pVAX1 S16A vaccine encoding C22 on days 0 and 7 induced high frequencies of C22 neopeptide-specific CD8+ T cells (mean frequency of 0.6). See Figure 4. This effect was significantly better than the positive control consisting of five peptides (including C22) formulated in CAF09 (mean frequency of 0.1). Vaccination with S16A plasmid induced CD8+ T cells capable of producing IFNγ and TNFα in response to subsequent stimulation with the neopeptide, whereas samples from animals not immunized with S16A showed no cytokine signal upon stimulation with the neopeptide. Furthermore, vaccination with S16A and S16B induced reactive CD4+ T cells capable of producing IFNγ and TNFα in response to subsequent stimulation with the neopeptide, whereas samples from animals not immunized with S16A showed no cytokine signal upon stimulation with the neopeptide. Data from these two experiments are shown in Figures 13A and 13B.

[0107] No C22 neopeptide-specific CD8+ T cells were detected in any of the remaining groups of mice.

[0108] As an additional pilot experiment, mice were immunized with the above plasmid vaccine. Four weeks after the first immunization (i.e., between immunizations 4 and 5), tumor cells (CT26) were implanted. After 43 days, mice were sacrificed and tumor size was measured. This pilot experiment showed that the implanted tumors completely disappeared in the majority of mice in the group vaccinated with the plasmid vaccine. See Figure 6. Since only five mice per group were immunized in this study, there was no power to obtain statistically significant data. Since 100 μg of DNA was too strong to distinguish between effects induced by DNA-mediated TLR9 engagement and those induced by neoepitope-specific T cells, experiments with reduced doses of DNA plasmid and / or number of immunizations were necessary. Furthermore, the DNA vaccine was well tolerated in mice; no signs of side effects were observed and the mice's weights continuously increased throughout the study, indicating healthy and unaffected mice.

[0109] conclusion A high frequency of C22 neopeptide-specific CD8+ T cells was present in whole blood of mice vaccinated with plasmid vector S16A. Based on these data, we decided to implant mice with CT26 tumor cells and continue the 7-day immunization schedule. Immunizations were initiated 4 weeks before tumor cell implantation at 7-day intervals, resulting in complete disappearance of implanted tumors in the majority of mice vaccinated with DNA plasmid. The immunization schedule with 100 μg of DNA plasmid was too strong to distinguish between effects induced by DNA-mediated TLR9 engagement and those induced by neoepitope-specific T cells, and therefore the number of immunizations had to be reduced. Plasmid vector S16A vaccine generated CD8+ T cell neopeptide responses as measured by cytokine production upon stimulation, whereas plasmid vector pVAX1 S16B vaccine induced mainly CD4+ and not CD8+ T cell responses. These vaccines were well tolerated in mice; no signs of side effects were observed, and mice gained weight continuously throughout the study, indicating healthy and unaffected mice.

[0110] Example 2 Evaluation of plasmid vectors + / - different polymers in a study of CT26 tumors The aim of this study was to investigate the immunogenicity and antitumor efficacy of S16A plasmid vectors as naked DNA vaccines or in combination with different selected block copolymers.

[0111] Research Plan Mice were implanted with CT26 tumors on day 0 and immunized with the test vaccines on days -13, -6, 1, 7, and 14. For each immunization, 50 μl of vaccine was injected into the left and right tibia, respectively. One day after tumor implantation, blood samples were taken from the test animals for testing of C22 MHCI in a tetramer assay.

[0112] The tetramer assay was performed as follows: MHC class I molecules were generated and loaded with a stabilizing peptide, which was then exchanged for the C22 epitope by irradiating the molecule with UV light. The MHC I molecules were multimerized by conjugation with fluorescently labeled streptavidin. To identify neoepitope-positive CD8+ T cells, cells were co-stained with multimers and fluorescently labeled anti-CD3, anti-CD4, and anti-CD8 antibodies. Samples were then analyzed by flow cytometry, and the percentage of MHC:C22-positive CD8+ cells was calculated. Eight groups of 13 mice each were administered the following vaccine compositions, respectively:

[0113] [Table 4] The ninth group of naive mice contained 5 mice.

[0114] The amphiphilic block copolymer tested in combination with S16A was Lutrol. 登録商標 F68 and Kolliphor 登録商標 P188, which have the general formula: [ka] In addition, PE6400, which is shown in the following formula, 登録商標 (BASF) was also tested. [ka] The plasmid vector vaccine consisted of 100 μg of plasmid DNA in the form of PVAX1, S16A, and mock plasmids formulated into the above polymers.

[0115] [Table 5]

[0116] Experimental read-outs included body weight change relative to body weight at the time of priming, tumor volume, assessment of T cell activation upon peptide restimulation, and measurement of circulating neoepitope-specific CD8+ T cells.

[0117] result The effect of immunization on tumor growth is shown in FIG. 7: prophylactic immunization significantly reduced tumor volume in mice receiving copolymers Kolliphor, Lutrol and PE6400 in combination with 100 μg of S16A plasmid vector compared to mice receiving 100 μg of mock plasmid vector and copolymer alone, as well as naked S16A plasmid DNA.

[0118] Copolymer-enhanced delivery of S16A plasmid vector did not result in a significant reduction in tumor volume compared to naked S16A plasmid vector. The Lutrol-only and untreated control groups had significantly higher tumor volumes than those treated with 100 μg of S16A plasmid, but tumor volumes were somewhat lower than expected. The effect on tumor volume was also observed in mice followed for a longer period, with only 60% to 80% of vaccinated animals developing tumors compared to all untreated controls.

[0119] In addition (see Figure 8), the vaccine containing the copolymer allowed for an earlier initiation of the immune response. This was observed as the appearance of CD8+ cells when their presence was confirmed in a C22 tetramer staining assay: in mice immunized with the S16A plasmid vector, neopeptide C22-specific CD8+ T cells were observed in the tail vein blood on study day 1 (1 day after the third immunization) with and without the addition of copolymer, but in the group that received the vaccine formulated with the copolymer, a significantly higher frequency of CD8+ T cells was observed at this time point. There was no observable difference in promoting the immunogenicity of S16A between the Lutrol, Kolliphor, and PE6400 copolymers. In control samples, no tetramer signal was detected.

[0120] conclusion S16A plasmid vectors administered with and without different block copolymers produced CT26 antitumor efficacy. 100 μg of S16A vectors (Lutrol-, Kolliphor-, PE6400-, and as naked DNA) produced a significant tumor volume AUC reduction compared to the control group, demonstrating that the clinical grade polymer Kolliphor is as efficacious as the research grade version (Lutrol). No antitumor effect was seen with 100 μg mock plasmid immunization. Copolymer-enhanced delivery of plasmid vectors was more immunogenic early in the treatment compared to naked plasmid vector DNA. Restimulation with S16A neopeptide showed similar T cell immunogenicity profiles in splenocytes between groups administered S16A plasmid vectors with or without copolymers.

[0121] Example 3 Testing candidate vaccines The primary objective of this example was to test the vector pTVG4 as a platform for delivery of plasmid-encoded neoepitopes. The pTVG4 vector, containing the five predicted neoepitopes S16A (see above for details) in the CT26 mouse tumor model, was tested and benchmarked against the pVAX1 platform, which also contains the five neoepitopes S16A.

[0122] Additionally, a secondary objective is to test the TLR3 agonist poly I:C in combination with the DNA vaccine to determine whether the combination results in increased numbers of neoepitope-specific T cells.

[0123] experiment Mice were implanted with CT26 tumors on day 0 and immunized with the test vaccines on days -13, -6, 1, 7, and 14. For each immunization, 50 μl of vaccine was injected into the left and right tibia, respectively. One day after tumor implantation, blood samples were taken from the test animals for testing of C22 MHCI in a tetramer assay.

[0124] Seven groups of 13-15 mice each were administered the following vaccine compositions, respectively:

[0125] [Table 6] An eighth group of four naive mice was also tested.

[0126] Tumor volume, activation of splenic T cells by peptide restimulation, and circulating neoepitope-specific CD8+ T cells were read.

[0127] result The effect on tumor size is shown in Figure 9. Immunization with 50 μg pTVG4a S16A+Kolliphor and 50 μg pVAX1 S16A+Kolliphor both delayed the growth of CT26 tumors in the majority of mice. Naked pTVG4a S16A vector showed a similar effect. Somewhat surprisingly, formulation of poly I:C with pTVG4a S16A and pVAX1 S16A negated the antitumor effects of the two DNA immunotherapies.

[0128] A similar pattern can be seen in Figure 10, showing tetramer staining of C22 in blood obtained 6 days after tumor implantation: CD8+ T cells specific for the CT26 neopeptide C22 were observed in the tail vein of mice immunized with pTVG4a S16A+ / - Kolliphor and pVAX1 S16A+Kolliphor on study day 6, whereas C22-specific CD8+ T cells were observed at a lower frequency in the groups receiving poly I:C together with DNA immunotherapy. As expected, no tetramer signal was detected in control samples (Kolliphor+Poly I:C immunized or naive control mice).

[0129] conclusion The pTVG4 vector successfully delivered the encoded neoepitope and induced specific T cell responses and reduced tumor volume at least as well as the previously tested pVAX1 S16 plasmid. In this experiment, combination with poly I:C was tested and found to negate the antitumor effect of the test vaccine.

[0130] Example 4 Testing of optimized DNA insert sequences The aim was to determine whether the expression of different neoepitopes is influenced by their position within the insert sequence in the vaccine vector and whether this leads to differences in antitumor efficacy (positional bias test).

[0131] A further objective was to test a clinically relevant DNA construct carrying 13 neoepitopes and compare it with the one carrying the five neoepitopes tested above.

[0132] experiment Seven groups of 14 mice each were used in the experiment, five of which were administered the test vaccine (50 μg of DNA in Kolliphor 登録商標 One group received the adjuvant alone (combined with CT26+), one group received the empty vector, and one group received the adjuvant alone. In addition, one group of five naive mice was included in the experiment. They were implanted with CT26 tumor cells on day 0 and immunized on days -15, -8, -1, 6, and 13. Blood was sampled on day -2.

[0133] Group and vaccine allocations are shown below.

[0134] [Table 7]

[0135] The designation "OPTIM" indicates that the inserted DNA sequence was generated using a codon-optimized vector sequence. To test for positional bias, one specific neoepitope, C22, was moved to the first, middle, and last positions in the insert encoding 13 neoepitopes, designated S16T13 F / OPTIM, S16T13 M / OPTIM, and R / OPTIM, respectively. This approach is used to clarify whether the full length of the DNA insert is truly expressed and whether the relative position of the epitope affects the strength of expression. The rationale for selecting C22 as the epitope to be moved is related to its ease of detection, as we established a method for detecting C22-specific CD8+ T cells by MHCI tetramer assay.

[0136] The S16T13 polyepitope includes 13 epitopes: C22, C23, C38, C25, C30, C37, EV85, C40, C41, C29, EV22, EV105, and AA427.

[0137] Similar to previous experiments, readouts were made on tumor volume (day 19), activation of splenic T cells by peptide restimulation, and circulating neoepitope-specific CD8+ T cells.

[0138] result The effect of the vaccine on tumor volume (day 19) and C22-specific CD8+ T cells (day 2) is shown in Figures 11 and 12, respectively.

[0139] Regarding tumor volume, the Kruskal-Wallis test showed that all 13-neoepitope constructs completely (p<0.001) suppressed tumor growth, while both 5-neoepitope constructs also significantly suppressed tumor growth. Regarding CD8+ T cell recognition of C22, all constructs induced similar levels of CD8+ T cell recognition, indicating that the entire DNA insert was transcribed and translated in vivo.

[0140] conclusion All tested nucleotide sequences efficiently induced neoepitope-specific T cell responses leading to antitumor immunity. The position of the neoepitope within the DNA insert did not affect immunogenicity: all constructs induced neoepitope-specific CD8+ T cells at similar frequencies, regardless of the position of the neoepitope (C22) measured.

[0141] Finally, and importantly, the number of included neoepitopes influenced the antitumor efficacy of the DNA construct: the inclusion of more neoepitopes (5 vs. 13) significantly improved the clinical response.

Claims

1. 1. A pharmaceutical composition for the treatment of a patient by inducing a therapeutic or ameliorative immune response against a malignant neoplasm, comprising: wherein the malignant neoplastic cells express genetic material encoding a polypeptide comprising a neoepitope; Here, the procedure is 1) at least one expression vector comprising a nucleic acid encoding at least one polypeptide that exhibits one or more neoepitopes of a malignant neoplasm; and 2) amphiphilic block copolymers containing blocks of poly(ethylene oxide) and poly(propylene oxide), and 3) a pharma- ceutically acceptable carrier, diluent, or excipient; administering to the patient an effective amount of at least one composition comprising: wherein said at least one expression vector expresses at least five neoepitopes; wherein the amphiphilic block copolymer is a poloxamer, and wherein said amphiphilic block copolymer is a poloxamer selected from poloxamer 407 and 188.

2. The pharmaceutical composition of claim 1, wherein the amphiphilic block copolymer is poloxamer 188.

3. 3. The pharmaceutical composition of claim 1 or 2, wherein the pharma- ceutically acceptable carrier, diluent, or excipient is an aqueous buffer solution.

4. 4. The pharmaceutical composition of claim 3, wherein the aqueous buffer solution is Tyrode's buffer or 2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS) buffer or PBS.

5. Tyrode's buffer is 140 mM NaCl, 6 mM KCl, 3 mM CaCl ２ , 2 mM MgCl ２ , 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Hepes), and 10 mM glucose, or 140 mM NaCl, 6 mM KCl, 3 mM CaCl ２ , 2 mM MgCl ２ 5. The pharmaceutical composition of claim 4, having a composition of 10 mM 2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS), and 10 mM glucose.

6. 6. The pharmaceutical composition of claim 4 or 5, wherein the concentration of Tyrode's buffer is about 35% v / v.

7. A pharmaceutical composition according to any one of claims 1 to 6, wherein the concentration of the amphiphilic block copolymer is between 2% and 5% w / v, for example about 3% w / v.

8. The pharmaceutical composition of any one of claims 1 to 7, wherein the composition further comprises a nucleic acid comprising at least one immunostimulatory sequence (ISS).

9. The pharmaceutical composition of claim 8 , wherein the ISS is an oligodeoxyribonucleotide (ODN) containing at least one CpG motif.

10. The pharmaceutical composition of claim 9 , wherein the ODN comprises a phosphorothioate group.

11. The pharmaceutical composition of claim 8 , wherein the ISS is or comprises an oligoribonucleotide.

12. 12. The pharmaceutical composition according to any one of claims 1 to 11, wherein the effective amount comprises between 10 μg and 25 mg of expression vector, such as between 100 μg and 20 mg, between 0.5 mg and 15 mg, between 1 mg and 10 mg, and between 2 mg and 8 mg, in particular about 0.5 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg and about 8 mg of expression vector.

13. The pharmaceutical composition of any one of claims 1 to 12, wherein the expression vector expresses at least 10, at least 15, at least 20, at least 25, or at least 30 neoepitopes.

14. The pharmaceutical composition of any one of claims 1 to 13, wherein the expression vector encodes a separate polypeptide for each encoded neoepitope.

15. The pharmaceutical composition according to any one of claims 1 to 14, wherein the expression vector encodes a plurality of peptides, where at least one peptide exhibits several encoded neoepitopes, optionally at least some of the neoepitopes being separated by a peptide linker.

16. The pharmaceutical composition of any one of claims 1 to 15, wherein the expression vector further comprises or encodes at least one immunostimulatory sequence (ISS).

17. 17. The pharmaceutical composition of claim 16, wherein at least one ISS or an ISS-encoding sequence is located between the termination codon of the neoepitope-encoding sequence and the polyadenylation signal.

18. 18. The pharmaceutical composition of claim 16 or 17, wherein at least one ISS is comprised in an expression vector.

19. 18. The pharmaceutical composition of claim 16 or 17, wherein the sequence encoding at least one ISS is encoded by an expression vector.

20. The pharmaceutical composition of claim 18 , wherein the ISS is a CpG motif.

21. 20. The pharmaceutical composition of claim 19, wherein the ISS encodes an RNA sequence that forms an RNA hairpin or constitutes an immunostimulatory RNA sequence.

22. A pharmaceutical composition according to any one of claims 1 to 21, wherein the expression vector is comprised in or constitutes a plasmid.

23. The pharmaceutical composition according to any one of claims 1 to 22, wherein at least one effective amount is a series of administrations.

24. The pharmaceutical composition of claim 23, wherein the series of administrations is a series of 2, 3, 4, 5 or 6 administrations.

25. The pharmaceutical composition according to any one of claims 1 to 24, wherein the patient is a human.

26. 26. The pharmaceutical composition of any one of claims 1 to 25, wherein an effective amount is administered parenterally, for example via intramuscular, intradermal, transdermal, subcutaneous, intravenous, intraarterial, intramedullary, intrathecal, intraventricular, intraperitoneal, intranasal, intravaginal, intraocular, or intrapulmonary routes, or via oral, sublingual, buccal, or anal routes, or topically.

Images