RNA interference delivery formulations and methods for malignant tumors

Abstract

The present invention provides formulations for use in delivering RNAi molecules that target human GST-π to treat malignancies in a subject. The formulation can include nanoparticles composed of an ionizable lipid, a DSPE lipid, and an additional lipid. The formulation can be produced by lyophilization. The present invention further provides a method for ameliorating or treating malignant tumors by administering a therapeutically effective amount of a formulation containing an RNAi agent.

Description

[Technical field]

[0001] The present invention relates to the field of biopharmaceuticals and therapeutics composed of nucleic acid-based molecules. More specifically, the present invention relates to methods and compositions for delivering RNA interference agents to prevent, treat or ameliorate the effects of conditions and diseases associated with malignancies. [Background technology]

[0002] [References to related applications] This application claims priority to U.S. Patent Application No. 62 / 768,826, filed November 16, 2018, which is incorporated by reference in its entirety.

[0003] [Sequence table] This application contains a Sequence Listing, which has been submitted electronically as a file entitled HRAK001.014 txt, approximately 26 KB in size, and is hereby incorporated by reference in its entirety.

[0004] Mutations in the KRAS gene can be associated with malignancies such as lung adenocarcinoma, mucinous adenoma, and colorectal cancer. Recently, it has been observed that elevated levels of glutathione S-transferase-π (GST-π) protein are associated with such KRAS mutations.

[0005] GST-π is a member of the glutathione S-transferase (IUBMB EC 2.5.1.18) family of six isoenzymes that play a role in detoxification by catalyzing the conjugation of hydrophobic and electrophilic compounds with reduced glutathione. The GST-π gene (GSTP1) is a polymorphic gene that encodes active, functionally distinct GSTP1 mutant proteins that are thought to function in xenobiotic metabolism. GSTP1 may play a role in susceptibility to cancer and is abundantly expressed in tumor cells. See, e.g., Aliya S. et al., Mol Cell Biochem, 2003 Nov; 253(1-2):319-327. Glutathione S-transferase-π is an enzyme that is encoded by the GSTP1 gene in humans. See, e.g., Bora PS et al., October 1991, J. Biol. Chem., 266 (25): 16774-16777. GST-π isoenzymes have been shown to catalyze the conjugation of several alkylating anticancer drugs with GSH, suggesting that overexpression of GST-π leads to tumor cell resistance.

[0006] Elevated serum GST-π levels have been observed in patients with various gastrointestinal malignancies, including gastric, esophageal, colonic, hepatocellular and biliary tract cancers. More than 80% of patients with stage III or IV gastric cancer, and about 50% of patients with stage I and II gastric cancer, also had elevated serum GST-π levels. See, for example, Niitsu Y et al. Cancer, 1989 Jan 15; 63(2):317-23. GST-π has been found to be a useful marker for predicting tumor recurrence in oral cancer patients after chemotherapy. See, for example, Hirata S. et al. Cancer, 1992 Nov 15:70(10):2381-7.

[0007] Expression of GST-π is increased in various cancer cells, and is thought to be associated with resistance to some anticancer drugs (see, e.g., Ban et al., Cancer Res., 1996, 56(15):3577-82; Nakajima et al., J Pharmacol Exp Ther., 2003, 306(3):861-9).

[0008] Agents that inhibit GST-π have been disclosed to induce apoptosis in cells. However, such compositions and techniques induce autophagy and require the combined action of various agents. See, e.g., US 2014 / 0315975 A1. Furthermore, inhibition of GST-π has not been found to shrink or reduce tumors. For example, in cancers that overexpress GST-π, inhibition of GST-π had no effect on tumor weight, although other effects were observed. See, e.g., Hokaiwado et al., Carcinogenesis, 2008, 29(6):1134-1138.

[0009] There is an urgent need for methods and compositions to develop treatments for patients with malignant tumors, including siRNA agents, compounds and structures for inhibiting the expression of GST-π.

[0010] There is a need for methods and compositions for preventing or treating malignancies. There is a continuing need for RNAi molecules and other structures and compositions for preventing, treating or ameliorating malignancies. Summary of the Invention [Problem to be solved by the invention]

[0011] The present invention provides compositions and methods for the therapeutic use of RNAi molecules targeting human GST-π in combination with a pharma- ceutically acceptable carrier. [Means for solving the problem]

[0012] Various embodiments relate to molecules and compositions thereof for use in biomedicine and therapy for malignancies. More particularly, various embodiments relate to compounds, compositions and methods for providing nanoparticles that deliver and distribute active agents or drug compounds to cells, tissues, organs and subjects with malignancies.

[0013] Included is a method for preventing, treating, or ameliorating one or more symptoms of a malignant tumor in a subject in need thereof, which can include administering to the subject an effective amount of a composition comprising an RNAi molecule that targets GST-π.

[0014] Embodiments of the present invention include: The pharmaceutical composition comprises (a) nucleic acid active pharmaceutical ingredient (API); for example, API(26 / 52), containing siRNA targeting GST-π having the following sequence: Sense strand SEQ ID NO:26 (5'-3'): GAA GCCU U U U GAGACCC UAUU Antisense strand SEQ ID NO:52 (5'-3'): fUAGgGuCu C A AA AGC UU C UU ; where A, G, C, and U represent ribo-A, ribo-G, ribo-C, and ribo-U, respectively; lowercase letters a, u, g, c, and t represent 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2'-deoxy-C, and deoxythymidine, respectively (dT=T=t); and underlines indicate 2'-OMe substitutions, e.g. U where lower case f represents a 2'-deoxy-2'-fluoro substitution, e.g., fU represents 2'-deoxy-2'-fluoro-U, hereafter referred to as API(26 / 52); and further comprising: (b) a compound having formula II: [ka] For example, compound A having the structure described elsewhere herein (c) DSPE lipids, for example, DSPE lipids comprising a polyethylene glycol (PEG) region, a hyperbranched PEG region, a methoxypolyethylene glycol (mPEG) region, a carbonyl-methoxypolyethylene glycol region, or a polyglycerol region; (d) sterol lipids, and (e) one or more neutral lipids.

[0015] The compound of formula II (eg, compound A) can be 15 mol % to 35 mol % of the total lipids of the composition, or 20 mol % to 30 mol % of the total lipids of the composition.

[0016] The sterol may be 25 mol % to 40 mol % of the total lipids of the composition, or 30 mol % to 40 mol % of the total lipids of the composition. The sterol may be cholesterol.

[0017] The DSPE lipid can be 1 mol% to 10 mol%, or 1 mol% to 8 mol%, or 4 mol% to 6 mol% of the total lipid of the composition. The DSPE lipid may have a polyethylene glycol (PEG) region, a hyperbranched PEG region, a methoxypolyethylene glycol (mPEG) region, a carbonyl-methoxypolyethylene glycol region, or a polyglycerin region. In a particular embodiment, the DSPE lipid is DSPE-mPEG-2000.

[0018] The sum of the one or more neutral lipids can be 25 mol% to 45 mol% of the total lipid of the composition, where each of the neutral lipids is individually 5 mol% to 40% mol%. In certain embodiments, the sum of the one or more neutral lipids can be 30 mol% to 40 mol% of the total lipid of the composition, where each of the neutral lipids is individually 10 mol% to 30 mol%. The one or more neutral lipids can be selected from phosphatidylethanolamine compounds and phosphatidylcholine compounds. The one or more neutral lipids can include or consist of 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). The combination of cholesterol, DOPC and DOPE can be 50 mol% to 85 mol% of the total lipid of the composition.

[0019] Various embodiments relate to pharmaceutical compositions. wherein the compound of formula II (e.g., compound A) constitutes 15 mol % to 35 mol % of the total lipids of the composition; The combination of cholesterol, DOPC and DOPE constitutes 50 mol % to 85 mol % of the total lipids of the composition; DSPE-mPEG-2000 constitutes between 1 mol% and 10 mol%, or between 1 mol% and 8 mol%, or between 4 mol% and 6 mol% of the total lipid of the composition; wherein the combination of a compound of formula II (eg, Compound A), cholesterol, DOPC, DOPE, and DSPE-mPEG-2000 constitutes at least 97 mol % (eg, 100 mol %) of the total lipids of the composition.

[0020] Embodiments of the present invention include pharmaceutical compositions. wherein the compound of formula II (e.g., compound A) constitutes 20 mol % to 30 mol % of the total lipids of the composition; Cholesterol constitutes 25 mol% to 35 mol% of the total lipids of the composition, and DOPC and DOPE in combination constitute 30 mol% to 50 mol% of the total lipids of the composition; DSPE-mPEG-2000 constitutes between 1 mol% and 10 mol%, or between 1 mol% and 8 mol%, or between 4 mol% and 6 mol% of the total lipid of the composition; wherein the combination of a compound of Formula II (eg, Compound A), cholesterol, DOPC, DOPE, and DSPE-mPEG-2000 constitutes at least 97% (eg, 100 mol %) of the total lipids of the composition.

[0021] In one embodiment, the present invention provides The pharmaceutical composition includes 10 mg of API (26 / 52), Compound A (24-26 mol % of total lipids), cholesterol (29-31 mol % of total lipids), DOPE (19-21 mol % of total lipids), DOPC (19-21 mol % of total lipids) and DSPE-mPEG-2000 (4-6 mol % of total lipids).

[0022] In one embodiment, the present invention provides The pharmaceutical composition includes 10 mg of API (26 / 52), 49.1 mg of Compound A (about 25.0 mol % of total lipids), 29.5 mg of semi-synthetic cholesterol (about 30.0 mol % of total lipids), 37.8 mg of DOPE (about 20.0 mol % of total lipids), 40.0 mg of DOPC (about 20.0 mol % of total lipids), and 35.6 mg of DSPE-mPEG-2000 (about 4.99 mol % of total lipids).

[0023] In one embodiment, the present invention provides The pharmaceutical composition includes 10 mg of API (26 / 52), 49.1 mg of Compound A (about 24.98 mol % of total lipids), 29.5 mg of semi-synthetic cholesterol (about 30.01 mol % of total lipids), 37.8 mg of DOPE (about 19.99 mol % of total lipids), 40.0 mg of DOPC (about 20.02 mol % of total lipids), and 35.6 mg of DSPE-mPEG-2000 (about 4.992 mol % of total lipids).

[0024] In one embodiment, the present invention provides The pharmaceutical composition includes 10 mg of API (26 / 52), 49.1 mg of Compound A (24.985 mol % of total lipids), 29.5 mg of semi-synthetic cholesterol (30.015 mol % of total lipids), 37.8 mg of DOPE (19.989 mol % of total lipids), 40.0 mg of DOPC (20.019 mol % of total lipids), and 35.6 mg of DSPE-mPEG-2000 (4.992 mol % of total lipids).

[0025] The pharmaceutical composition can include nanoparticles encapsulating an API (e.g., API (26 / 52)), where the nanoparticles have a Z-average size of 30-100 nm.

[0026] The pharmaceutical composition can include nanoparticles encapsulating an API (e.g., API (26 / 52)), where the nanoparticles have a Z-average size of 46 nm and a PDI of 0.097.

[0027] In some embodiments, the pharmaceutical composition may comprise nanoparticles having a PDI of less than 0.30.

[0028] In some embodiments, the pharmaceutical solution may include the solvents ethanol and water for injection, as well as sucrose, 2-hydroxypropyl-β-cyclodextrin, a buffer solution, and a suspension of the pharmaceutical composition. The buffer may be selected from acetate buffer, citrate buffer, and phosphate buffer. In certain embodiments, the buffer may be selected from acetic acid and sodium acetate, citric acid and sodium citrate, and potassium dihydrogen phosphate and anhydrous disodium hydrogen phosphate, and may further include sodium chloride.

[0029] The present invention also contemplates that the pharmaceutical composition is a solid lyophilized product of the pharmaceutical solution. The formulation may include a vial containing a lyophilized cake of the pharmaceutical solution, the headspace of the vial being filled with nitrogen gas. The lyophilized cake may include sucrose, 2-hydroxypropyl-β-cyclodextrin, sodium acetate, and a lyophilized residue of the pharmaceutical composition.

[0030] The lyophilized cake can include 700 mg sucrose, 467 mg 2-hydroxypropyl-β-cyclodextrin, 2.7 mg sodium acetate, and a lyophilized residue of the pharmaceutical composition. The formulation vial can be a clear 20 mL USP Type I glass vial and can be sealed with a barrier film stopper and a flip-off aluminum seal.

[0031] Other embodiments of the invention can include a kit having the formulation and instructions for reconstituting the lyophilized cake and administering the reconstituted formulation to a subject. The kit can include a sterile diluent for reconstituting the lyophilized cake and an IV infusion bag.

[0032] In various embodiments, the drug for administration by injection can include a reconstituted solution of a lyophilized cake of the formulation in a sterile diluent. As used herein, the term "diluent" refers to an ingredient in a pharmaceutical composition that lacks pharmacological activity, but may be pharma- ceutically necessary or desirable. For example, a diluent can be used to increase the effective volume of a potent drug to facilitate administration, such as by dispersing or dissolving the drug in a liquid for administration by injection, ingestion, or inhalation. The diluent can be a sodium acetate solution, such as Sodium Acetate Injection, USP. The drug solution can include a concentration of an API, such as API(26 / 52), for example, 1.5 mg / mL, and can include liposomal nanoparticles (e.g., API(26 / 52)) that encapsulate the API.

[0033] In embodiments of the drug solution, the nanoparticles may be 10-150 nm in size, or 45-65 nm in size. The PDI of the nanoparticles may be less than 0.30. The average charge of the nanoparticles may be -10 mV to +10 mV.

[0034] The drug may further comprise one or more pharma- ceutically acceptable excipients (e.g., pharma-ceutically acceptable tonicity excipients). As used herein, an "excipient" is an inert substance included in a pharmaceutical composition to impart desirable physical properties to the composition, such as volume, concentration, stability, binding activity, lubricity, disintegration ability, etc. In certain embodiments, the tonicity excipient may be sucrose or 2-hydroxypropyl-β-cyclodextrin.

[0035] The medicament may further comprise a pharma- ceutically acceptable pH adjusting excipient, such as sodium hydroxide, whereby the pH of the medicament may be between 5 and 6.

[0036] The present invention further contemplates a method for treating or ameliorating one or more symptoms of cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the drug described above. The drug can be administered by parenteral infusion for 30-120 minutes. The cancer may be lung cancer. The administration can reduce expression of GST-π in the subject by at least 5% for at least 5 days. The administration can be by intravenous injection, subcutaneous injection, intraperitoneal injection, intravenous infusion or intraperitoneal infusion.

[0037] Various embodiments relate to the use of the drug product in medical therapy and for treating or ameliorating one or more symptoms of cancer, including lung cancer. The drug product can be used in the manufacture of a medicament for treating or ameliorating one or more symptoms of cancer. [Brief description of the drawings]

[0038] [Figure 1] Figure 1 shows enhanced distribution to mouse lungs in vivo using a pharmaceutical formulation of the present invention containing siRNA targeting GST-π, ionizable lipid compound A and DSPE lipid compound. Figure 1 shows significantly higher lung accumulation of the formulation (siRNA GST-π, 25 mol% compound A, 30 mol% cholesterol, 20 mol% DOPE, 20 mol% DOPC, 5 mol% DSPE-mPEG-2000) compared to a similar formulation using DMPE-mPEG-2000 lipid compound. The combination of compound A and DSPE lipid compound in a nanoparticle liposome formulation surprisingly enhanced the accumulation of GST-π siRNA in the lungs. [Diagram 2]Figure 2 shows the tumor growth inhibition efficacy of the liposomal formulation of GST-π siRNA of the present invention in A549 cell lung cancer sub-Q xenograft model in athymic nude (nu / nu) female mice. The pharmaceutical formulation API (26 / 52) siRNA GST-π, compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol% showed significant tumor growth inhibition effect within a few days after administration. After 49 days, the pharmaceutical formulation containing GST-π siRNA showed a remarkable favorable tumor growth inhibition efficacy, and the tumor volume was reduced by more than 3.4 times for the 4 mg / kg dose compared to the vehicle control. [Diagram 3] FIG. 3 shows the tumor growth inhibition efficacy of the liposomal formulation of GST-π siRNA of the present invention in a human H2009 cell lung cancer sub-Q xenograft model in athymic Balb / c nude (nu / nu) female mice. H2009 is a lymph node metastatic lung adenocarcinoma cell. The administered drug solution was reconstituted from a lyophilized pharmaceutical solution containing 10 mg / vial of API (26 / 52) GST-π siRNA. The pharmaceutical solution contained a suspension of the pharmaceutical formulation based on the pharmaceutical formulation (siRNA GST-π, Compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%), as well as sucrose and 2-hydroxypropyl-β-cyclodextrin for lyophilization protection, and 27 mg ascorbic acid and 27 mg sodium acetate as buffers. The formulation was reconstituted in 5.6 mL of sterile WFI containing drug solution to obtain a reconstituted suspension with 1.5 mg / mL of API(26 / 52)GST-π siRNA. As a result, the drug solution exhibited a dose-dependent tumor growth inhibitory effect in a KRAS mutant subcutaneous (sub-Q) xenograft H2009 NSCLC tumor model. [Figure 4]FIG. 4 shows the tumor growth inhibition efficacy of the liposomal formulation of GST-π siRNA of the present invention in a human H23 cell lung cancer sub-Q xenograft model in athymic Balb / c nude (nu / nu) female mice. H23 is an adenocarcinoma; non-small cell lung cancer. The administered composition contained a suspension of a pharmaceutical formulation based on API (26 / 52) siRNA GST-π, 25 mol% compound A, 30 mol% cholesterol, 20 mol% DOPE, 20 mol% DOPC, 5 mol% DSPE-mPEG-2000, and a pharmaceutical formulation containing 27 mg ascorbic acid and 27 mg sodium acetate as a buffer. As a result, a dose-dependent tumor growth inhibition effect of the pharmaceutical solution was observed in a KRAS mutant subcutaneous (sub-Q) xenograft H23 NSCLC tumor model. [Diagram 5] Figure 5 shows the tumor growth inhibition efficacy of the liposomal formulation of GST-π siRNA of the present invention in a human H23 cell lung cancer sub-Q xenograft model in athymic Balb / c nude (nu / nu) female mice. The administered composition contained a suspension of API (26 / 52) siRNA GST-π, compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%, and a pharmaceutical formulation containing 27 mg of ascorbic acid and 27 mg of sodium acetate as a buffer. The results at day 56 showed a dose-dependent tumor growth inhibition effect of the pharmaceutical solution in a KRAS mutant subcutaneous (sub-Q) xenograft H23 NSCLC tumor model. [Figure 6]Figure 6 shows the distribution ratio of the in vivo mouse lung to liver for the formulation of the present invention. The administered composition was based on two pharmaceutical formulations, namely "DMPE (left):" (API siRNA, Compound A 25 mol%, Cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DMPE-mPEG-2000 5 mol%) and "DSPE (right):" (API siRNA, Compound A 25 mol%, Cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%). The results showed that the distribution ratio of the active ingredient to the lung to the liver in vivo mice was 30 times higher for the formulation based on DSPE-mPEG-2000 compared to DMPE-mPEG-2000. [Figure 7] FIG. 7 shows the in vivo mouse lung to liver distribution ratio for an embodiment of a formulation of the invention containing liposome-encapsulated API siRNA. [Figure 8] FIG. 8 shows the in vivo mouse lung to liver distribution ratio for an embodiment of a formulation of the invention containing liposome-encapsulated API siRNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0039] Various embodiments of the present invention provide compounds and compositions for use in therapeutic formulations for delivery to malignant tumors. In some aspects, the present invention relates to compounds, compositions and methods for providing nanoparticles for delivery and distribution of active agents to malignant tumor cells, as well as tissues, organs and subjects bearing malignant tumors.

[0040] Various embodiments of the present invention provide formulations designed for clinical use that contain an active nucleic acid API (such as an active siRNA) agent capable of reducing the expression of a GST-π nucleic acid molecule.

[0041] An embodiment of the pharmaceutical composition of the present invention can include an ionizable lipid of formula I or II (e.g., Compound A) for delivery of an active nucleic acid API (e.g., siRNA) to cells of a malignant tumor. The ionizable lipid of formula I or II (e.g., Compound A) can be used with additional lipid components in the formulation of the present invention to form nanoparticles for delivery and distribution of an active nucleic acid API (e.g., siRNA) to treat or ameliorate a malignant tumor.

[0042] An embodiment of the pharmaceutical composition of the present invention can include 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) lipid compounds for delivery of active nucleic acid APIs (e.g., siRNA) to cells of malignant tumors. DSPE lipid compounds such as DSPE-mPEG-2000 can be used with further lipid components in the formulations of the present invention to form nanoparticles for delivery and distribution of active nucleic acid APIs (e.g., siRNA) for treating or ameliorating malignant tumors.

[0043] In some embodiments, a pharmaceutical composition of the present invention containing an active agent which is an siRNA targeting GST-π, together with an ionizable lipid of formula I or II (e.g., compound A) and a DSPE-mPEG-2000 lipid component, can enhance distribution of the active agent to the lungs by parenteral administration.

[0044] An embodiment of the present invention includes a pharmaceutical solution of a pharmaceutical composition suitable for lyophilization. The pharmaceutical solution of a pharmaceutical composition can include a solvent, such as ethanol and water for injection, and a protecting agent, such as sucrose and 2-hydroxypropyl-β-cyclodextrin, that protects the active substance during lyophilization. The pharmaceutical solution can also include a buffer. The pharmaceutical solution allows for the creation of a suspension of the pharmaceutical composition that can be maintained during lyophilization.

[0045] In a further embodiment, the invention comprises a solid lyophilisate composition made from a pharmaceutical solution. The pharmaceutical solution can be lyophilised into a solid cake or powder, which maintains the activity of the active agent of the pharmaceutical solution.

[0046] Various embodiments of the solid lyophilized compositions of the invention can be prepared in vials or other containers for use as pharmaceutical formulations. Kits utilizing vials of the solid lyophilized compositions can include instructions for using the formulation and for preparing a reconstituted drug from the solid lyophilized composition.

[0047] In a further embodiment, the active agent of the present invention can be delivered using a reconstituted form of a solid lyophilized composition. A reconstituted solution form of the solid lyophilized composition, which can be prepared with a sterile diluent, can be used as a drug for parenteral delivery.

[0048] In another aspect, embodiments of the present invention provide methods for utilizing a therapeutic composition that reduces expression of a GST-π nucleic acid molecule or polypeptide for the treatment of a neoplasm in a subject, where the neoplasm is associated with cells that contain a KRAS mutation or exhibit abnormal KRAS expression levels.

[0049] Therapeutic compositions of the present embodiments may include inhibitory nucleic acid molecules such as siRNA or shRNA.

[0050] A KRAS-associated malignancy or KRAS-associated cancer is defined herein as (a) a cancer cell or tumor cell that contains a somatic KRAS mutation, or (b) a cancer cell or tumor cell that has an abnormal expression level of KRAS (including but not limited to, amplification of DNA encoding KRAS, or overexpression of the KRAS gene or underexpression of the KRAS gene compared to levels found in normal non-cancerous cells).

[0051] GST-π is encoded by the GSTP1 gene and indicates an enzyme that catalyzes glutathione conjugation. GST-π exists in various animals including humans, and its sequence information is known and is given by NCBI database accession numbers (e.g., human: NP_000843 (NM_000852), rat: NP_036709 (NM_012577), mouse: NP_038569 (NM_013541), etc.

[0052] In one embodiment, the present invention encompasses RNAi molecules for suppressing DNA encoding GST-π, and dominant-negative mutants of GST-π.

[0053] Generally, after a subject has been diagnosed with a neoplasm associated with a KRAS mutation or KRAS amplification (eg, lung cancer), a method of treatment is selected that involves inhibition of GST-π.

[0054] Examples of agents or drugs that inhibit GST-π include RNAi molecules.

[0055] Lyophilized nanoparticle formulation In some aspects, delivery of active agents in vivo can surprisingly be achieved using nanoparticle formulations of the invention, which can be lyophilized, reconstituted, and injected intravenously.

[0056] Embodiments of the present invention further provide lyophilized forms of nanoparticles that can be reconstituted into effective therapeutic compositions that can be used to deliver therapeutic nucleic acid agents for transfection.

[0057] In some aspects, the present invention provides compositions and compounds for forming solutions or suspensions of therapeutic lipid nanoparticles that are stable in a lyophilization process. The therapeutic lipid nanoparticles can encapsulate nucleic acid agents and can be converted and stored in a solid lyophilized form. The lyophilized form can be reconstituted to provide therapeutic lipid nanoparticles with encapsulated nucleic acid agents. The reconstituted lipid nanoparticles can have surprisingly advantageous transfection properties, including particle size and distribution.

[0058] Embodiments of the present invention include a range of compositions and compounds for forming solutions or suspensions of therapeutic lipid nanoparticles that can undergo a lyophilization process to provide a stable solid lyophilized form for long-term storage of nucleic acid therapeutics.

[0059] In a further aspect, the present invention provides compounds and methods for forming solutions or suspensions of therapeutic lipid nanoparticles that are stable in a lyophilization process. The lyophilization process of the present invention can provide stable lyophilized forms of therapeutic lipid nanoparticles, where the nanoparticles can encapsulate nucleic acid agents. The lyophilized forms can be stored for a period of time and reconstituted to provide therapeutic lipid nanoparticles with encapsulated nucleic acid agents.

[0060] In some embodiments, the present invention includes a range of compositions and compounds for solutions or suspensions of lipid nanoparticles that can undergo a lyophilization process and provide a stable solid lyophilized form for long-term storage of nucleic acid therapeutics. The compositions and methods of the present invention can provide lyophilized forms that can be reconstituted and provide advantageous activity, particle size, storage time, and serum stability.

[0061] In a further aspect, the present invention relates to compounds, compositions and methods for providing nanoparticles for the delivery and distribution of active agents or drug compounds to subjects, tissues and organs.

[0062] In one embodiment, the present invention provides a series of lipid compounds and ionizable compounds for delivery of active agents to cells. The lipid compounds and ionizable compounds of the present disclosure can be used to form nanoparticles for delivery and distribution of active agents.

[0063] In one embodiment, the present invention contemplates a lipid nanoparticle drug formulation containing a siRNA agent, which can be prepared, for example, by lyophilization of a suspension of nanoparticles and reconstitution of the nanoparticles into a suspension.

[0064] In some embodiments, lipid nanoparticles can be synthesized by rapid injection of lipid / ethanol solution into siRNA buffer solution. The second buffer can be diafiltered and used as external buffer through TFF cartridge to make aqueous suspension of final product.

[0065] In some embodiments, the nanoparticles can have an average diameter of 45 nm to 110 nm. The concentration of the nucleic acid active agent can be from 1 mg / mL to 10 mg / mL.

[0066] It has been found that the lipid nanoparticles can survive lyophilization of the suspension when the suspension is made into a protected composition.

[0067] In some embodiments, the protected compositions of the present invention may comprise an aqueous suspension of lipid nanoparticles, a dextrin compound, and a carbohydrate-sugar compound in a pharma- ceutically acceptable solution. The lipid nanoparticles may encapsulate one or more active agents, such as nucleic acid active agents.

[0068] Lyophilization of the protected suspension can provide a solid lyophilized product that can be reconstituted into a suspension of lipid nanoparticles.

[0069] The reconstituted suspension can contain lipid nanoparticles that encapsulate and entrap the active agent and are comparable to the lipid nanoparticles prior to lyophilization.

[0070] In certain embodiments, the reconstituted suspension can provide an activity of the encapsulated agent that is comparable to the activity of the suspension before lyophilization.

[0071] In a further aspect, the reconstituted suspension can provide stable nanoparticles comparable to those of the pre-lyophilized suspension, hi certain aspects, the average particle size of the nanoparticles can be approximately equal to the size of the nanoparticles in the pre-lyophilized suspension.

[0072] In one embodiment, the compositions and methods of the present invention can provide surprising activity and stability of reconstituted suspensions composed of nanoparticles having encapsulated agents.

[0073] In a further aspect, the protected suspension, which can be lyophilized and reconstituted, can contain a protectant composition for lyophilization. The protectant composition of the present invention can be composed of a dextrin compound and a carbohydrate-sugar compound. The total amount of the dextrin and the sugar compound can be 2% to 20% (w / v) of the protected suspension.

[0074] In some embodiments, the dextrin compound can be 40%-70% (w / v) of the total amount of dextrin and sugar compounds in the protectant composition. In certain embodiments, the dextrin compound can be 40%-55% (w / v) of the total amount of dextrin and sugar compounds in the protectant composition. In further embodiments, the dextrin compound can be 40%-45% (w / v) of the total amount of dextrin and sugar compounds in the protectant composition. These compositions can provide unexpectedly advantageous properties of the reconstituted nanoparticle suspension, such as only slight changes in nanoparticle size or activity.

[0075] In some aspects, upon lyophilization and reconstitution of the protected suspension of nanoparticles, the average size of the nanoparticles can be within 10% of the size in the original composition prior to lyophilization. In certain embodiments, upon lyophilization and reconstitution of the protected suspension of nanoparticles, the average size of the nanoparticles can be within 5% of the size in the original composition prior to lyophilization.

[0076] The present invention contemplates lipid nanoparticle drug formulations, for example containing siRNA agents, that can be prepared by lyophilization of a suspension of nanoparticles and reconstitution of the nanoparticles into a suspension after a storage period. The reconstituted suspension can provide activity of the encapsulated agent comparable to the activity of the suspension before lyophilization.

[0077] Reconstituted suspensions prepared after the storage period can contain lipid nanoparticles encapsulating the active agent that are comparable to the lipid nanoparticles prior to lyophilization.

[0078] In certain embodiments, a reconstituted suspension prepared after a storage period can provide activity of the encapsulated agent that is comparable to the activity of the suspension prior to lyophilization.

[0079] In a further aspect, the reconstituted suspension prepared after the storage period can provide stable nanoparticles comparable to the suspension before lyophilization, hi certain embodiments, the average particle size of the nanoparticles can be approximately equal to the size of the nanoparticles in the suspension before lyophilization.

[0080] Lipid nanoparticle formulation before lyophilization Embodiments of the present invention can provide compositions of lipid nanoparticles that contain a protective compound against the lyophilization process.

[0081] The lipid nanoparticles can have any composition known in the art. The lipid nanoparticles can be synthesized and loaded with encapsulated cargo by any process, including processes known in the art.

[0082] In some embodiments, lipid nanoparticles can be prepared by a dip injection process. Some examples of processes for lipid nanoparticles are described in U.S. Patent Application Publication No. 2013 / 0115274.

[0083] Some examples for preparing liposomes are described in Szoka, Ann, Rev. Biophys. Bioeng. 9:467(1980); Liposomes, Marc J. Ostro, ed., Marcel Dekker, Inc., New York, 1983, Chapter 1.

[0084] Generally, lipid nanoparticles can be synthesized by mixing lipid components in an organic solvent with a buffered aqueous solution containing an active nucleic acid agent. Liposomes can be sized by filtration or extrusion. Liposome suspensions or solutions can be further transformed by diafiltration.

[0085] The lipid nanoparticle composition of the present invention stabilized for freeze-drying process may contain lipid nanoparticles encapsulating one or more active agents, such as nucleic acid agents, in suspension.The suspension may be aqueous or may contain a water-miscible solvent, such as ethanol.The composition stabilized for freeze-drying process may further contain a protective compound to stabilize liposomes in freeze-drying process.

[0086] The average size of the lipid nanoparticles synthesized may be 40 nm to 120 nm, 45 nm to 110 nm, 45 nm to 80 nm, or 45 nm to 65 nm.

[0087] The concentration of the active agent in the lipid nanoparticle composition of the present invention can range from about 0.1 mg / mL to about 10 mg / mL. In some embodiments, the concentration of the active agent in the lipid nanoparticle composition of the present invention can be 0.5 mg / mL to 8 mg / mL, or 1 mg / mL to 6 mg / mL, or 2 mg / mL to 5 mg / mL, or 3 mg / mL to 4 mg / mL.

[0088] Examples of protective compounds include dextrin compounds.

[0089] Examples of dextrin compounds include maltodextrin and β- and γ-cyclodextrin.

[0090] Examples of dextrin compounds include methylated β- and γ-cyclodextrin compounds, and sulfoalkyl ether β- and γ-cyclodextrin compounds.

[0091] Examples of dextrin compounds include cyclodextrin compounds in which one or more of the 2nd, 3rd, and 6th hydroxyl positions are substituted with a sulfoalkyl, a benzenesulfoalkyl, an acetoalkyl, a hydroxyalkyl, a hydroxyalkyl succinate, a hydroxyalkyl malonate, a hydroxyalkyl glutarate, a hydroxyalkyl adipate, a hydroxyalkyl, a hydroxyalkyl maleate, a hydroxyalkyl oxalate, a hydroxyalkyl fumarate, a hydroxyalkyl citrate, a hydroxyalkyl tartrate, a hydroxyalkyl malate, or a hydroxyalkyl citrate.

[0092] Examples of the dextrin compound include (2-hydroxypropyl)-β cyclodextrin, 2-hydroxypropyl-β cyclodextrin succinate, (2-hydroxypropyl)-γ cyclodextrin, and 2-hydroxypropyl-γ cyclodextrin succinate.

[0093] An example of the dextrin compound is hydroxyethyl β-cyclodextrin.

[0094] Examples of the dextrin compound include dimethyl β-cyclodextrin and trimethyl β-cyclodextrin.

[0095] Examples of the dextrin compound include sulfobutyl ether β-cyclodextrin and sulfobutyl ether γ-cyclodextrin.

[0096] Examples of the dextrin compound include methyl-β-cyclodextrin and methyl-γ-cyclodextrin.

[0097] An example of the dextrin compound is hydroxypropyl-sulfobutyl-β-cyclodextrin.

[0098] An example of a dextrin compound is H107 SIGMA cyclodextrin (Sigma-Aldrich Corp.).

[0099] Examples of dextrin compounds include CAVAMAX, CAVASOL, and CAVATRON cyclodextrins (Ashland Inc.).

[0100] Examples of dextrin compounds include KLEPTOSE and CRYSMEB cyclodextrins (Roquette America Inc.).

[0101] An example of a dextrin compound is CAPTISOL cyclodextrin (Ligand Pharmaceuticals, Inc.).

[0102] In some embodiments, the dextrin compound can include a dextrin compound attached to a polymer chain or network. For example, cyclodextrin molecules can be attached to a polymer of polyacrylic acid. In further embodiments, the cyclodextrin molecules can be linked together with a cross-linking compound such as an acryloyl group. In certain embodiments, a vinyl acrylate hydrogel form having attached cyclodextrin compounds can be used.

[0103] In some aspects, the dextrin compounds used in the lipid nanoparticle compositions of the present invention can be combined with an adsorbate compound prior to being introduced into the lipid nanoparticle composition. Without wishing to be bound to any one particular theory, pre-adsorption of the sterol compound by the dextrin compound can form an inclusion complex that can prevent inactivation of the active agent in the reconstituted formulation.

[0104] Examples of the adsorbed compound include cholesterol, lanosterol, zymosterol, zymostenol, desmosterol, stigmastanol, dihydrolanosterol, and 7-dehydrocholesterol.

[0105] Examples of adsorption compounds include PEGylated cholesterol and cholestane 3-oxo-(C1-22) acyl compounds, such as cholesteryl acetate, cholesteryl arachidonate, cholesteryl butyrate, cholesteryl hexanoate, cholesteryl myristate, cholesteryl palmitate, cholesteryl bephenate, cholesteryl stearate, cholesteryl caprylate, cholesteryl n-decanoate, cholesteryl dodecanoate, cholesteryl nervonate, cholesteryl pelargate, cholesteryl n-valerate, cholesteryl oleate, cholesteryl elaidate, cholesteryl erucate, cholesteryl heptanoate, cholesteryl linoleidate, and cholesteryl linoleate.

[0106] Examples of adsorbed compounds include phytosterol, β-sitosterol, campesterol, ergosterol, brassicasterol, delta-7-stigmasterol, and delta-7-avenasterol.

[0107] Further examples of the protective compound include saccharide compounds, and examples of the saccharide compounds include sugar compounds.

[0108] Examples of protected sugar compounds include monosaccharides such as C(5-6) aldoses and ketoses, and disaccharides such as sucrose, lactose, lactulose, maltose, trehalose, cellobiose, kojibiose, salmonobiose, isomaltose, sophorose, laminaribiose, gentiose, turanose, maltose, isomaltose, gentiobiulose, mannobiose, melibiose, melibiulose, and xylobiose.

[0109] Examples of protective carbohydrate compounds include polysaccharides such as ficoll.

[0110] The concentration of the protected compound in the pre-lyophilized formulation can be from about 1% (w / v) to about 25% (w / v).

[0111] In some embodiments, the concentration of the protected compound in the pre-lyophilized formulation can be between 2% (w / v) and 20% (w / v), or between 4% (w / v) and 16% (w / v), or between 5% (w / v) and 15% (w / v), or between 6% (w / v) and 14% (w / v), or between 8% (w / v) and 12% (w / v).

[0112] In certain embodiments, the concentration of the protected compound in the pre-lyophilized formulation can be 6% (w / v), or 8% (w / v), or 10% (w / v), or 12% (w / v), or 14% (w / v), or 16% (w / v), or 18% (w / v), or 20% (w / v), or 22% (w / v), or 24% (w / v).

[0113] Freeze-Drying Process The lyophilization process can be carried out in glass containers or any suitable container, such as, for example, glass vials, or dual chamber containers, as known in the pharmaceutical art.

[0114] The stabilized lipid nanoparticle composition of the present invention containing a protective compound can be introduced into a glass container. The volume of the composition added to the container can be 0.1 to 20 mL, or 1 to 10 mL.

[0115] Any lyophilization process can be used, including those known in the pharmaceutical art, see, e.g., Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co, Easton, Penn (1990).

[0116] The lyophilization process can include freezing the protectant-stabilized lipid nanoparticle composition at a temperature of about −40° C. to about −30° C. The frozen composition can be dried from the lyophilized composition.

[0117] In some embodiments, the freezing step can involve a temperature ramp from ambient to the final temperature over a period of several minutes. The temperature ramp can be about 1° C. / min.

[0118] In some embodiments, the drying step can be carried out at a pressure ranging from about 0 to 250 mTorr, or 50 to 150 mTorr, and at a temperature of about -15°C to about -38°C. The drying step can be continued at higher temperatures, up to ambient temperature, for periods up to several days. The level of residual water in the solid freeze-dried material can be less than about 5%, or less than 4%, or less than 3%, or less than 2%, or less than 1% (w / v).

[0119] The protectant-stabilized lipid nanoparticle compositions of the present embodiments can be lyophilized and then reconstituted by methods known in the pharmaceutical arts.

[0120] In some aspects, the present invention provides methods of inhibiting the level of aggregated particles in a reconstituted formulation made from a protectant-stabilized lipid nanoparticle composition of the present invention after lyophilization.

[0121] In some embodiments, reconstituted formulations made from the protectant-stabilized lipid nanoparticle compositions of the present invention after lyophilization can have reduced levels of aggregate particles.

[0122] In certain embodiments, reconstituted drug products made from the protectant-stabilized lipid nanoparticle compositions of the present invention after lyophilization can have reduced levels of aggregated particles having a size greater than about 0.2 μm, or greater than about 0.5 μm, or greater than about 1 μm.

[0123] Reconstituted Formulation The lyophilizate can be reconstituted in a pharma- ceutically acceptable carrier.

[0124] Examples of pharma- ceutically acceptable carriers include sterile water, water for injection, sterile physiological saline, bacteriostatic water for injection, and nebulizer solution.

[0125] An example of a pharma- ceutically acceptable carrier is a pharma- ceutically acceptable solution.

[0126] Examples of pharma- ceutically acceptable solutions include HEPES buffer, phosphate buffer, citrate buffer, and buffer containing tris(hydroxymethyl)aminomethane.

[0127] An example of a pharma- ceutically acceptable solution is a pharma- ceutically acceptable buffer solution.

[0128] Examples of pharma- ceutically acceptable solutions include buffered solutions of maleic acid, tartaric acid, lactic acid, acetic acid, sodium bicarbonate, and glycine.

[0129] The reconstituted lyophilisate can be used as a formulation.

[0130] The reconstituted lyophilizate can be further diluted with isotonic saline or other excipients to provide the desired concentration for administration.

[0131] An example of the excipient is a tonicity agent.

[0132] Examples of excipients include human serum albumin, bovine serum albumin, α-casein, globulin, α-lactalbumin, LDH, lysozyme, myoglobin, ovalbumin, and stabilizers such as RNase A.

[0133] Examples of excipients include buffers such as potassium acetate, sodium acetate, and sodium bicarbonate.

[0134] Examples of excipients include amino acids such as glycine, alanine, arginine, betaine, leucine, lysine, glutamic acid, aspartic acid, histidine, proline, 4-hydroxyproline, sarcosine, γ-aminobutyric acid, alanopine, octopine, strombine, and trimethylamine N-oxide.

[0135] Examples of excipients include non-ionic surfactants such as polysorbate 20, polysorbate 80, and poloxamer 407.

[0136] Examples of excipients include dispersants such as phosphotidylcholine, ethanolamine, acetyltryptophanate, polyethylene glycol, polyvinylpyrrolidone, ethylene glycol, glycerin, glycerol, propylene glycol, sorbitol, xylitol, dextran, and gelatin.

[0137] Examples of excipients include antioxidants such as ascorbic acid, cysteine, thioglycerol, thioglycolic acid, thiosorbitol, and glutathione.

[0138] Examples of excipients include reducing agents such as dithiothreitol, thiols, and thiophenes.

[0139] Examples of excipients include chelating agents such as EDTA, EGTA, glutamic acid, and aspartic acid.

[0140] In some embodiments, the lyophilisate can be reconstituted by passing the stoppered vial through a syringe needle. The lyophilisate can be reconstituted with or without shaking the vial.

[0141] The time for reconstitution may be from 3 to 30 seconds or more.

[0142] In some embodiments, a reconstituted nucleic acid drug product can have less than 0.001% (w / v) aggregated particles having a size greater than 0.2 μm.

[0143] In certain aspects, the reconstituted nucleic acid drug product can reduce cytokine activation.

[0144] In a further aspect, the nucleic acid drug product can be reconstituted after a six month storage time and retain 80% activity of the nucleic acid agent.

[0145] In some embodiments, the nucleic acid drug product can be reconstituted after a six month storage period and the average particle size of the lipid nanoparticles can be less than 25% larger than before lyophilization.

[0146] In certain embodiments, the nucleic acid drug product can be reconstituted after a 24 month storage period and retain 90% activity of the nucleic acid agent.

[0147] In a further embodiment, the nucleic acid drug product can be reconstituted after a storage period of 24 months and the average particle size of the lipid nanoparticles can be less than 25% larger than before lyophilization.

[0148] RNAi molecule Those skilled in the art will understand that the reported sequences change over time and will be able to incorporate any necessary changes in the nucleic acid molecules herein accordingly.

[0149] Embodiments of the present invention can provide compositions and methods for gene silencing of GST-π expression using nucleic acid molecules.

[0150] Embodiments of the present invention can provide compositions and methods for combinatorial gene silencing of GST-π expression using nucleic acid molecules.

[0151] Examples of nucleic acid molecules capable of mediating RNA interference include molecules active in RNA interference (RNAi molecules), including double-stranded RNA such as siRNA (small interfering RNA), miRNA (microRNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-interacting RNA), saRNA (small activating RNA), or rasiRNA (repeat-associated siRNA), and modified forms thereof.

[0152] The compositions and methods disclosed herein can also be used in treating various types of malignant tumors in a subject.

[0153] The nucleic acid molecules and methods of the present embodiments can be pooled or used in combination to downregulate expression of a gene encoding GST-π.

[0154] The compositions and methods of the present embodiments can include one or more nucleic acid molecules capable of regulating or controlling the expression of GST-π proteins and / or genes encoding such proteins that are associated with disease maintenance and / or development, as well as GST-π-associated conditions or disorders, such as malignant tumors.

[0155] Compositions and methods of embodiments of the invention are described with reference to exemplary sequences of GST-π. Those skilled in the art will appreciate that various aspects and embodiments of the invention are directed to any related GST-π genes, sequences, or variants (e.g., homologous genes and transcript variants), as well as polymorphisms, including single nucleotide polymorphisms (SNPs), associated with any GST-π gene.

[0156] In some embodiments, the compositions and methods of the present invention can provide double-stranded short interfering nucleic acid (siRNA) molecules that downregulate expression of a GST-π gene, for example, human GST-π.

[0157] The RNAi molecules of the invention can target any homologous sequence, for example, by using complementary sequences or by incorporating non-canonical base pairs (e.g., mismatched and / or wobble base pairs), thereby providing additional target sequences.

[0158] If mismatches are identified, non-canonical base pairs (eg, mismatched and / or wobbled bases) can be used to generate nucleic acid molecules that target two or more gene sequences.

[0159] For example, non-standard base pairs such as UU and CC base pairs can be used to generate nucleic acid molecules that can be targeted to different targets that share sequence homology.Thus, RNAi molecules can target the nucleotide sequences that are conserved between homologous genes, and a single RNAi molecule can be used to inhibit the expression of multiple genes.

[0160] In some aspects, the compositions and methods of the present embodiments include RNAi molecules that are active against any portion of the GST-π mRNA. The RNAi molecules can include sequences complementary to any mRNA that encodes the GST-π sequence.

[0161] In some embodiments, the RNAi molecules of the present disclosure can have activity against GST-π RNA, where the RNAi molecule can include a sequence complementary to an RNA having a mutant GST-π coding sequence, e.g., a mutant GST-π gene known in the art to be associated with malignant tumors.

[0162] In a further embodiment, the RNAi molecule of the present invention can comprise a nucleotide sequence capable of mediating silencing of GST-π gene expression.

[0163] Examples of RNAi molecules according to embodiments of the present invention that target GST-π mRNA are shown in Table 1.

[0164] [Table 1]

[0165] Key to Table 1: Capital letters A, G, C, and U refer to ribo-A, ribo-G, ribo-C, and ribo-U, respectively. Lowercase letters a, u, g, c, and t refer to 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2'-deoxy-C, and deoxythymidine (dT=T=t), respectively. Underlines indicate 2'-OMe substitutions, e.g. U The lower case f denotes a 2'-deoxy-2'-fluoro substitution, e.g., fU is 2'-deoxy-2'-fluoro-U. The lower case s denotes a phosphorothioate bond. N denotes A, C, G, U, U , A, c, g, u, t, or modified, inverted, or chemically modified nucleotides.

[0166] In a further aspect, the nucleic acid molecules of the present embodiments can have each strand of the molecule that is 18 to 22 nucleotides in length. The nucleic acid molecule can have a double-stranded region that is 19 nucleotides in length.

[0167] In certain embodiments, a nucleic acid molecule can have a sense polynucleotide strand and an antisense polynucleotide strand linked as a single strand to form a duplex region linked at one end by a loop.

[0168] The nucleic acid molecules of the present embodiments may have blunt ends and may have one or more 3' overhangs.

[0169] The nucleic acid molecule of the present embodiment can be an RNAi molecule active in gene silencing, such as a dsRNA, siRNA, microRNA, or shRNA active in gene silencing, as well as DNA-directed RNA (ddRNA), Piwi-interacting RNA (piRNA), and repeat-associated siRNA (rasiRNA).

[0170] The present invention further contemplates compositions comprising one or more nucleic acid molecules of the invention and a pharma- ceutically acceptable carrier, which may include a lipid molecule or a liposome.

[0171] In some embodiments, the invention provides a range of nucleic acid molecules, wherein: a) the molecule has a polynucleotide sense strand and a polynucleotide antisense strand; b) each strand of the molecule is 15-30 nucleotides in length; c) a contiguous region of 15-30 nucleotides in the antisense strand is complementary to a sequence of an mRNA encoding GST-π; d) at least a portion of the sense strand is complementary to at least a portion of the antisense strand, and the molecule has a double-stranded region 15-30 nucleotides in length.

[0172] In some embodiments, the nucleic acid molecule can have a contiguous region of 15 to 30 nucleotides in the antisense strand that is complementary to a sequence of an mRNA encoding GST-π, which region is located in the double-stranded region of the molecule.

[0173] In a further embodiment, the nucleic acid molecule can have a contiguous region of 15 to 30 nucleotides of the antisense strand that is complementary to a sequence of an mRNA encoding GST-π.

[0174] In certain embodiments, each strand of the nucleic acid molecule can be 18-22 nucleotides in length. The double-stranded region of the nucleic acid molecule can be 19 nucleotides in length.

[0175] In the alternative, a nucleic acid molecule can have a polynucleotide sense strand and a polynucleotide antisense strand linked as a single strand to form a duplex region connected at one end by a loop.

[0176] Some embodiments of the nucleic acid molecules of the present disclosure may have blunt ends. In certain embodiments, the nucleic acid molecules may have one or more 3' overhangs.

[0177] The present invention provides a range of nucleic acid molecules that are RNAi molecules active in gene silencing.The nucleic acid molecules of the present invention can be dsRNA, siRNA, microRNA, or shRNA active in gene silencing, as well as DNA-directed RNA (ddRNA), Piwi-interacting RNA (piRNA), or repeat-associated siRNA (rasiRNA).The nucleic acid molecules can be active in inhibiting the expression of GST-π.

[0178] Embodiments of the present invention further provide nucleic acid molecules that have an IC50 for knockdown of GST-π of less than 100 pM.

[0179] A further embodiment of the present invention provides a nucleic acid molecule having an IC50 for knockdown of GST-π of less than 50 pM.

[0180] The present invention further contemplates a composition comprising one or more nucleic acid molecules of the invention together with a pharma- ceutically acceptable carrier, in certain embodiments, the carrier may be a lipid molecule or a liposome.

[0181] The compounds and compositions of the present embodiments are useful in methods of preventing or treating GST-π associated diseases by administering the compound or composition to a subject in need thereof.

[0182] As used herein, RNAi molecules refer to any molecule that induces RNA interference, including double-stranded RNA, such as siRNA (small interfering RNA), miRNA (microRNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-interacting RNA), or rasiRNA (repeat-associated siRNA) and modified forms thereof. These RNAi molecules are commercially available or can be designed and prepared based on known sequence information, etc. Antisense nucleic acids include RNA, DNA, PNA, or complexes thereof. As used herein, DNA / RNA chimeric polynucleotides include double-stranded polynucleotides composed of DNA and RNA that inhibit the expression of a target gene.

[0183] In one embodiment, the drug of the present invention contains siRNA as a therapeutic agent. The siRNA molecule can have a length of about 10 to 50 or more nucleotides. The siRNA molecule can have a length of about 15 to 45 nucleotides. The siRNA molecule can have a length of about 19 to 40 nucleotides. The siRNA molecule can have a length of 19 to 23 nucleotides. The siRNA molecule of the present invention can mediate RNAi against a target mRNA. Commercially available design tools and kits, such as those available from Ambion, Inc (Austin, TX) and Whitehead Institute of Biomedical Research at MIT (Cambridge, MA), allow for the design and production of siRNA.

[0184] Methods for Treating Malignant Tumors Embodiments of the present invention can provide RNAi molecules that can be used to downregulate or inhibit the expression of GST-π and / or GST-π protein.

[0185] In some embodiments, the RNAi molecules of the present invention can be used to downregulate or inhibit expression of GST-π and / or GST-π proteins resulting from GST-π haplotype polymorphisms associated with a disease or condition such as a malignant tumor.

[0186] By monitoring GST-π protein or mRNA levels, the characteristics of gene silencing and the efficacy of the compounds and compositions of the invention can be determined.

[0187] The RNAi molecules of the present disclosure can be used individually or in combination with other siRNAs to modulate the expression of one or more genes.

[0188] The RNAi molecules of the embodiments of the present disclosure can be used individually, in combination, or in combination with other known drugs to prevent or treat diseases or ameliorate symptoms of conditions or disorders associated with GST-π, including malignant tumors.

[0189] The RNAi molecules of the present embodiments can be used to regulate or inhibit expression of GST-π in a sequence-specific manner.

[0190] The RNAi molecules of the present disclosure can include a guide strand in which a series of consecutive nucleotides is at least partially complementary to GST-π mRNA.

[0191] In a particular aspect, malignant tumors can be treated by RNA interference using the RNAi molecules of the present invention.

[0192] Treatment of malignant tumors is characterized in appropriate cell-based models as well as ex vivo or in vivo animal models.

[0193] The treatment of malignant tumors is characterized by determining the levels of GST-π mRNA or the levels of GST-π protein in cells of the affected tissue.

[0194] The treatment of malignant tumors is characterized by non-invasive medical scanning of the affected organ or tissue.

[0195] Embodiments of the invention can include methods for preventing, treating, or ameliorating symptoms of a disease or condition associated with GST-π in a subject in need thereof.

[0196] In some embodiments, a method for preventing, treating, or ameliorating symptoms of a malignant tumor in a subject can include administering to the subject an RNAi molecule of the present invention to regulate expression of a GST-π gene in the subject or organism.

[0197] In some embodiments, the present invention contemplates a method for downregulating expression of a GST-π gene in a cell or organism by contacting the cell or organism with an RNAi molecule of the present invention.

[0198] The GST-π inhibitory nucleic acid molecule can be a nucleotide oligomer that can be used as a single-stranded or double-stranded nucleic acid molecule capable of reducing gene expression. In one approach, the inhibitory nucleic acid molecule is a double-stranded RNA used to knock down gene expression via RNA interference (RNAi). In one embodiment, a double-stranded RNA (dsRNA) molecule active in RNA interference is generated that contains 8-25 (e.g., 8, 10, 12, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25) consecutive nucleotides of the nucleotide oligomer of the invention. The dsRNA can be two complementary strands of duplexed RNA, or a single RNA strand with self-binding (small hairpin (sh)RNA).

[0199] In some embodiments, the dsRNA that is active in RNA interference is about 21 or 22 base pairs, but can be shorter or longer, up to about 29 nucleotides. Double-stranded RNA can be produced using standard techniques (e.g., chemical synthesis or in vitro transcription). Kits are available, for example, from Ambion (Austin, TX) and Epicentre (Madison, WI).

[0200] Methods for expressing dsRNA in mammalian cells are described in Brummelkamp et al., Science 296:550-553,2002; Paddison et al., Genes & Devel. 16:948-958,2002; Paul et al., Nature Biotechnol. 20:505-508,2002; Sui et al., Proc. Natl. Acad. Sci. USA 99:5515-5520,2002; Yu et al., Proc. Natl. Acad. Sci. USA 99:6047-6052,2002; Miyagishi et al., Nature Biotechnol. 20:497-500,2002; and Lee et al., Nature Biotechnol. 20:500-505 2002, 2002, each of which is incorporated herein by reference.

[0201] An inhibitory nucleic acid molecule "corresponding to" a GST-π gene comprises at least one fragment of the double-stranded gene, and each strand of the double-stranded inhibitory nucleic acid molecule can bind to a complementary strand of the target GST-π gene. The inhibitory nucleic acid molecule need not correspond entirely to the reference GST-π sequence.

[0202] In one embodiment, the siRNA has at least about 85%, 90%, 95%, 96%, 97%, 98%, or even 99% sequence identity with the target nucleic acid. For example, a 19 base pair duplex with 1-2 base pair mismatches is contemplated to be useful in the methods of the invention. In other embodiments, the nucleotide sequence of the inhibitory nucleic acid molecule exhibits 1, 2, 3, 4, 5 or more mismatches.

[0203] Inhibitory nucleic acid molecules provided by embodiments of the present invention include, but are not limited to, siRNAs, and include any nucleic acid molecule sufficient to reduce the expression of a GST-π nucleic acid molecule or polypeptide. The DNA sequences provided herein can be used, for example, in the discovery and development of therapeutic antisense nucleic acid molecules to reduce the expression of encoded proteins. Embodiments of the present invention further provide catalytic RNA molecules or ribozymes. Such catalytic RNA molecules can be used to inhibit the expression of target nucleic acid molecules in vivo. The inclusion of a ribozyme sequence within an antisense RNA can provide the molecule with RNA cleavage activity, thereby increasing the activity of the construct. The design and use of target RNA-specific ribozymes are described in Haseloff et al., Nature 334:585-591, 1988, and US 2003 / 0003469 A1, each of which is incorporated by reference.

[0204] In various embodiments of the invention, the catalytic nucleic acid molecule is formed in a hammerhead motif or a hairpin motif. Examples of such hammerhead motifs are described in Rossi et al., Aids Research and Human Retroviruses, 8:183, 1992. Examples of hairpin motifs are described in Hampel et al., Biochemistry, 28:4929, 1989, and Hampel et al., Nucleic Acids Research, 18: 299, 1990. Those skilled in the art will recognize that an enzymatic nucleic acid molecule requires a specific substrate binding site that is complementary to one or more target gene RNA regions, and that there is a nucleotide sequence within or surrounding the substrate binding site that confers RNA cleavage activity to the molecule.

[0205] Inhibition of a target can be determined by the expression or activity of the corresponding protein in inhibited cells compared to cells in which the inhibitor is not used. Protein expression can be assessed by any known technique, including immunoprecipitation using antibodies, EIA, ELISA, IRA, IRMA, Western blotting, immunohistochemistry, immunocytochemistry, flow cytometry, various hybridization techniques using nucleic acids encoding the protein or specific fragments thereof, or nucleic acids that specifically hybridize with the transcription products (e.g., mRNA) or splicing products of said nucleic acids, Northern blotting, Southern blotting, and various PCR techniques.

[0206] The activity of a protein can be assessed by analyzing a known activity of the protein, including, for example, binding to a protein such as Raf-1 (particularly phosphorylated Raf-1) or EGFR (particularly phosphorylated EGFR), by means of any known method, such as, for example, immunoprecipitation, Western blotting, Amersham analysis, pull-down, or surface plasmon resonance (SPR).

[0207] Examples of mutant KRAS include, but are not limited to, those having mutations that cause constitutive activation of KRAS, such as mutations that inhibit endogenous GTPase or mutations that increase the rate of guanine nucleotide exchange. Specific examples of such mutations include, but are not limited to, mutations at amino acids 12, 13 and / or 61 in human KRAS (inhibiting endogenous GTPase) and mutations at amino acids 116 and / or 119 in human KRAS (increasing the rate of guanine nucleotide exchange) (Bos, Cancer Res. 1989; 49(17): 4682-9; Levi et al, Cancer Res.1991; 51(13): 3497-502).

[0208] In some embodiments of the invention, the mutant KRAS may be a KRAS having a mutation at at least one of amino acids 12, 13, 61, 116, and 119 of human KRAS. In one embodiment of the invention, the mutant KRAS has a mutation at amino acid 12 of human KRAS. In some embodiments, the mutant KRAS may induce overexpression of GST-π. Cells having the mutant KRAS may exhibit overexpression of GST-π.

[0209] Detection of mutant KRAS can be carried out using any known technique, such as selective hybridization by means of a nucleic acid probe specific for the known mutant sequence, the enzymatic mismatch cleavage method, sequencing (Bos, Cancer Res. 1989; 49(17):4682-9), and the PCR-RFLP method (Miyanishi et al., Gastroenterology. 2001; 121(4):865-74)).

[0210] Detection of target expression can be carried out by any known technique.Whether target is overexpressed can be evaluated, for example, by comparing the expression level of target in cells with mutant KRAS with the expression level of target in the same type of cells with normal KRAS.In this situation, if the expression level of target in cells with mutant KRAS exceeds the expression level of target in the same type of cells with normal KRAS, then the target is overexpressed.

[0211] In one aspect, an embodiment of the invention features a vector encoding an inhibitory nucleic acid molecule of any of the above aspects. In certain embodiments, the vector is a retroviral, adenoviral, adeno-associated viral, or lentiviral vector. In another embodiment, the vector comprises a promoter suitable for expression in a mammalian cell.

[0212] The amount of active RNA interference induction component formulated in the composition of the present embodiment can be the amount that does not cause adverse effects that exceed the benefits of administration.Such amount can be determined by in vitro test using cultured cells, or by test in model animals or mammals such as mice, rats, dogs or pigs, and such test methods are known to those skilled in the art.The method of the present embodiment can be applied to any animal, including human.

[0213] The amount of active ingredient to be formulated may vary depending on the method of administration of the drug or composition.For example, if multiple units of the composition are used for one administration, the amount of active ingredient to be formulated in one unit of the composition may be determined by dividing the amount of active ingredient required for one administration by the multiple units.

[0214] RNA interference RNA interference (RNAi) refers to the sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNA (siRNA).See, for example, Zamore et al., Cell, 2000, Vol. 101, pp.25-33; Fire et al., Nature, 1998, Vol. 391, pp. 806-811; Sharp, Genes & Development, 1999, Vol. 13, pp.139-141.

[0215] The RNAi response in cells is triggered by double-stranded RNA (dsRNA), but the mechanism has not yet been fully elucidated. Certain dsRNA in cells can be acted upon by the Dicer enzyme, a ribonuclease III enzyme. See, for example, Zamore et al., Cell, 2000, Vol. 101, pp.25-33; Hammond et al., Nature, 2000, Vol. 404, pp. 293-296. Dicer can break dsRNA into shorter fragments of dsRNA, which are siRNAs.

[0216] Generally, siRNAs can be from about 21 to about 23 nucleotides in length and contain a base-paired duplex region about 19 nucleotides in length.

[0217] RNAi involves an endonuclease complex known as the RNA-induced silencing complex (RISC). siRNA mediates the cleavage of single-stranded RNA targets that have sequences complementary to the antisense strand of the siRNA duplex, with the antisense or guide strand entering the RISC complex. The other strand of the siRNA is the passenger strand. Cleavage of the target RNA occurs in the middle of the region complementary to the antisense strand of the siRNA duplex (see, for example, Elbashir et al., Genes & Development, 2001, Vol.15, pp. 188-200).

[0218] As used herein, the term "sense strand" refers to a nucleotide sequence of an siRNA molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand of the siRNA molecule. The sense strand of an siRNA molecule can include a nucleic acid sequence that has homology with a target nucleic acid sequence.

[0219] As used herein, the term "antisense strand" refers to a nucleotide sequence of an siRNA molecule that is partially or completely complementary to at least a portion of a target nucleic acid sequence. The antisense strand of an siRNA molecule can include a nucleic acid sequence that is complementary to at least a portion of the corresponding sense strand of the siRNA molecule.

[0220] RNAi molecules can downregulate or knock down gene expression by mediating RNA interference in a sequence-specific manner.See, for example, Zamore et al., Cell, 2000, Vol. 101, pp.25-33; Elbashir et al., Nature, 2001, Vol. 411, pp.494-498; Kreutzer et al., WO2000 / 044895; Zernicka-Goetz et al., WO2001 / 36646; Fire et al., WO1999 / 032619; Plaetinck et al., WO2000 / 01846; Mello et al., WO2001 / 029058.

[0221] As used herein, the terms "inhibit," "downregulate," or "reduce" with respect to gene expression means that the expression of a gene or the level of an mRNA molecule encoding one or more proteins, or the activity of one or more of the encoded proteins, is reduced below that observed in the absence of an RNAi molecule or siRNA of the invention. For example, the level of expression, the level of mRNA, or the level of the encoded protein activity can be reduced by at least 1%, or at least 10%, or at least 20%, or at least 50%, or at least 90%, or more, from that observed in the absence of an RNAi molecule or siRNA of the invention.

[0222] RNAi molecules can also be used to knock down viral gene expression, thus affecting viral replication.

[0223] The RNAi molecule can be made of separate polynucleotide strands: a sense or passenger strand, and an antisense or guide strand. The guide strand and the passenger strand are at least partially complementary. The guide strand and the passenger strand can form a duplex region having about 15 to about 49 base pairs.

[0224] In some embodiments, the duplex region of the siRNA can be 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 base pairs.

[0225] In certain embodiments, the RNAi molecule is capable of exhibiting activity in a RISC complex and has a length of duplex region that is active for RISC.

[0226] In further embodiments, the RNAi molecule is capable of activity as a Dicer substrate for conversion into an RNAi molecule capable of activity in a RISC complex.

[0227] In some aspects, the RNAi molecule has complementary guide and passenger sequence portions at opposite ends of a long molecule, which allows the molecule to form a duplex region at the complementary sequence portion, and the strands can be linked at one end of the duplex region by either a nucleotide or non-nucleotide linker, for example, a hairpin configuration, or a stem and loop configuration. The linker interaction for the strands can be a covalent or non-covalent interaction.

[0228] The RNAi molecule of the present disclosure can include a nucleotide, non-nucleotide, or mixed nucleotide / non-nucleotide linker that links the sense region of the nucleic acid to the antisense region of the nucleic acid. The nucleotide linker can be a linker that is ≧2 nucleotides in length, for example, about 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. The nucleic acid linker can be a nucleic acid aptamer. "Aptamer" or "nucleic acid aptamer" as used herein refers to a nucleic acid molecule that specifically binds to a target molecule, where the nucleic acid molecule has a sequence that includes a sequence that is recognized by the target molecule in its natural environment. Alternatively, the aptamer can be a nucleic acid molecule that binds to a target molecule, where the target molecule does not naturally bind to a nucleic acid. For example, an aptamer can be used to bind to the ligand-binding domain of a protein, thereby preventing the interaction of the protein with a naturally occurring ligand. See, e.g., Gold et al., Annu Rev Biochem, 1995, Vol. 64, pp. 763-797; Brody et al., J Biotechnol, 2000, Vol. 74, pp. 5-13; Hermann et al., Science, 2000, Vol. 287, pp. 820-825.

[0229] Examples of non-nucleotide linkers include abasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, lipids, polyhydrocarbons, or other polymeric compounds (e.g., polyethylene glycols, such as those having 2 to 100 ethylene glycol units). Some examples are described in Seela et al., Nucleic Acids Research, 1987, Vol. 15, pp. 3113-3129; Cload et al., JA Am. ChemSoc, 1991, Vol. 113, pp. 6324-6326; Jaeschke et al., Tetrahedron Lett, 1993, Vol. 34, pp. 301; Arnold et al., WO1989 / 002439; Usman et al., WO1995 / 006731; Dudycz et al., WO1995 / 011910, and Ferentz et al., JA Am. ChemSoc, 1991, Vol. 113, pp. 4000-4002.

[0230] The RNAi molecule can have one or more overhangs from the double-stranded region. The overhang, which is a non-base-paired single-stranded region, can be 1-8 nucleotides in length or longer. The overhang can be a 3'-end overhang, where the 3'-end of the strand has a single-stranded region of 1-8 nucleotides. The overhang can be a 5'-end overhang, where the 5'-end of the strand has a single-stranded region of 1-8 nucleotides.

[0231] The overhangs of the RNAi molecules can have the same length or can be of different lengths.

[0232] The RNAi molecule can have one or more blunt ends, the double-stranded region ends with no overhangs, and the strands are base-paired to the end of the double-stranded region.

[0233] The RNAi molecules of the present disclosure can have one or more blunt ends, or can have one or more overhanging ends, or can have a combination of blunt and overhanging ends.

[0234] The 5' end of the strand of the RNAi molecule may be blunt ended or may be an overhang. The 3' end of the strand of the RNAi molecule may be blunt ended or may be an overhang.

[0235] The 5' end of the strand of the RNAi molecule may be blunt ended, while the 3' end may be an overhang. The 3' end of the strand of the RNAi molecule may be blunt ended, while the 5' end may be an overhang.

[0236] In some embodiments, both ends of the RNAi molecule are blunt ended.

[0237] In a further embodiment, both ends of the RNAi molecule have overhangs.

[0238] The overhangs at the 5' and 3' ends can be of different lengths.

[0239] In certain embodiments, the RNAi molecule may be blunt ended, with the 5' end of the antisense strand and the 3' end of the sense strand lacking any overhanging nucleotides.

[0240] In a further embodiment, the RNAi molecule may be blunt ended, with the 3' end of the antisense strand and the 5' end of the sense strand not having any overhanging nucleotides.

[0241] The RNAi molecule may have mismatches in base pairing in the duplex region.

[0242] Any nucleotide in the overhang of the RNAi molecule may be a deoxyribonucleotide or a ribonucleotide.

[0243] The one or more deoxyribonucleotides can be at the 5' end, where the 3' end of the other strand of the RNAi molecule can have no overhang or can have no deoxyribonucleotide overhang.

[0244] The one or more deoxyribonucleotides can be at the 3' end, where the 5' end of the other strand of the RNAi molecule can have no overhang or can have no deoxyribonucleotide overhang.

[0245] In some embodiments, one or more, or all, of the overhanging nucleotides of an RNAi molecule can be 2'-deoxyribonucleotides.

[0246] Dicer substrate RNAi molecules In some aspects, the RNAi molecule can be of suitable length as a Dicer substrate so that it can be processed to produce a RISC-active RNAi molecule, see, e.g., Rossi et al., US2005 / 0244858.

[0247] A double-stranded RNA (dsRNA) that is a Dicer substrate can be of sufficient length to be processed by Dicer to produce an active RNAi molecule and can further include one or more of the following features: (i) the Dicer substrate dsRNA can be asymmetric, e.g., have a 3' overhang on the antisense strand, and (ii) the Dicer substrate dsRNA can have an altered 3' end on the sense strand to direct the orientation of Dicer binding and processing of the dsRNA into an active RNAi molecule.

[0248] How RNAi molecules are used The nucleic acid molecules and RNAi molecules of the present embodiments can be delivered to cells or tissues by direct application of the molecules or with the molecules combined with a carrier or diluent.

[0249] The nucleic acid molecules and RNAi molecules of the present embodiments can be delivered or administered to a cell, tissue, organ, or subject by direct application of the molecule with a carrier or diluent, or any other delivery vehicle that acts to aid, facilitate, or promote entry into a cell (e.g., viral sequences, viral material, or lipid or liposomal formulations).

[0250] The nucleic acid molecules and RNAi molecules of the present embodiments can be packaged in liposomes or otherwise delivered to target cells or tissues. The nucleic acid or nucleic acid complexes can be administered locally to the relevant tissue ex vivo or in vivo by direct dermal application, transdermal application, or injection.

[0251] Delivery systems can include, for example, aqueous and non-aqueous gels, creams, emulsions, microemulsions, liposomes, ointments, aqueous and non-aqueous solutions, lotions, aerosols, hydrocarbon bases and powders, and may contain excipients such as solubilizers and penetration enhancers.

[0252] The inhibitory nucleic acid molecule or composition of the present embodiment may be administered in a unit dosage form in a pharma- ceutically acceptable diluent, carrier, or excipient. Certain pharmaceutical practices may be employed to provide an appropriate formulation or composition for administering the compound to a patient suffering from a disease caused by excessive cell proliferation. Administration may begin before the patient exhibits symptoms. Any suitable route of administration may be used, for example, parenteral, intravenous, intraarterial, subcutaneous, intratumoral, intramuscular, intracranial, intraorbital, intraocular, intraventricular, intrahepatic, intracapsular, intrathecal, intracisternal, or intraperitoneal. For example, the therapeutic formulation may be in the form of a liquid solution or suspension.

[0253] The compositions and methods of the disclosed embodiments can include an expression vector comprising a nucleic acid sequence encoding at least one RNAi molecule of the present invention in a manner that allows for expression of the nucleic acid molecule.

[0254] The nucleic acid molecules and RNAi molecules of the present invention can be expressed from transcription units inserted into DNA or RNA vectors.The recombinant vector can be a DNA plasmid or a viral vector.Viral vectors can be used that provide transient expression of nucleic acid molecules.

[0255] For example, a vector can contain sequences encoding both strands of a duplex RNAi molecule, or a single nucleic acid molecule that is complementary within itself to form an RNAi molecule. An expression vector can contain nucleic acid sequences encoding two or more nucleic acid molecules.

[0256] The nucleic acid molecule can be expressed intracellularly from a eukaryotic promoter. Those skilled in the art recognize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA / RNA vector.

[0257] In some aspects, an expression construct can be introduced into a cell using a viral construct for transcription of a dsRNA construct encoded by the expression construct, where the dsRNA is active in RNA interference.

[0258] The lipid formulations can be administered, for example, by intravenous, intramuscular, or intraperitoneal injection.

[0259] Pharmaceutically acceptable formulations for administering oligonucleotides are known and can be used.

[0260] In one embodiment of the method, the inhibitory nucleic acid molecule is about 5 mg / m 2 / day~about 500mg / m 2 / day, e.g., 5, 25, 50, 100, 125, 150, 175, 200, 225, 250, 275, or 300 mg / m 2 It is administered at a dose of / day.

[0261] In some embodiments, an inhibitory nucleic acid molecule of the invention is administered systemically at a dose of about 1 mg / kg to about 100 mg / kg, for example, 1, 5, 10, 20, 25, 50, 75, or 100 mg / kg.

[0262] In a further embodiment, the dosage is about 25 mg / m 2 / day~about 500mg / m 2 / day.

[0263] Methods known in the art for making formulations can be found, for example, in "Remington: The Science and Practice of Pharmacy" Ed. A. R. Gennaro, Lippincourt Williams & Wilkins, Philadelphia, Pa, 2000. See also Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co, Easton, Pa, 1990; Goodman & Gilman, The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, NY, 1996.

[0264] Dosage forms for parenteral administration may contain, for example, excipients, sterile water or saline, polyalkylene glycols such as polyethylene glycol, vegetable oils, or hydrogenated naphthalenes. Biocompatible, biodegradable lactide polymers, lactide / glycolide copolymers, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for inhibitory nucleic acid molecules include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycolates, and deoxycholates, or may be oily solutions for administration in the form of nose drops or as gels.

[0265] The formulations can be administered to a human patient in a therapeutically effective amount (e.g., an amount that prevents, eliminates, or reduces a pathological condition) to provide treatment for a neoplastic disease or condition. The preferred dosage of the nucleotide oligomer of the invention can depend on variables such as the type and extent of the disorder, the overall health of the particular patient, the formulation of the compound excipients, and its route of administration.

[0266] All of the above methods for reducing malignant tumors can be either in vitro or in vivo methods. The dosage can be determined by in vitro tests using cultured cells, etc., as known in the art. An effective amount can be an amount that reduces tumor size in KRAS-associated tumors by at least 10%, at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, up to 100% of tumor size.

[0267] The pharmaceutical composition of the present embodiment may be effective in treating KRAS-related diseases, including diseases caused by abnormal cell proliferation, diseases caused by KRAS mutations, and diseases caused by GST-π overexpression.

[0268] Examples of diseases caused by abnormal cell proliferation include malignant tumors, hyperplasia, keloids, Cushing's syndrome, primary aldosteronism, erythroplakia, polycythemia vera, leukoplakia, hypertrophic scar, lichen planus, and lentigo.

[0269] An example of a disease caused by a KRAS mutation is a malignant tumor (also called cancer or malignant neoplasm).

[0270] An example of a disease caused by overexpression of GST-π is a malignant tumor.

[0271] An example of the cancer is sarcoma.

[0272] In one embodiment of the invention, the cancer comprises cancer cells with mutant KRAS as defined above. In another embodiment, the cancer comprises cancer cells that exhibit hormone or growth factor independent growth. In a further embodiment, the cancer comprises cancer cells that exhibit GST-π overexpression.

[0273] Additional active agents or drugs for inhibiting GST-π Examples of additional active agents for inhibiting the activity of GST-pi include, but are not limited to, substances that bind to GST-pi, such as glutathione, glutathione analogs (e.g., those described in WO95 / 08563, WO96 / 40205, WO99 / 54346), ketoprofen, indomethacin (e.g., see Hall et al., Cancer Res. 1989; 49(22):6265-8), ethacrynic acid, piriprost (e.g., see Tew et al., Cancer Res. 1988; 48(13):3622-5), anti-GST-pi antibodies, and dominant negative mutants of GST-pi. These agents are commercially available or can be appropriately prepared based on known techniques.

[0274] Formulations with three or more components for the delivery of drugs in malignant tumors As used herein, a formulation component such as "lipid" can be a single compound or a combination of one or more suitable lipid compounds.For example, "stabilizing lipid" can refer to a single stabilizing lipid or a combination of one or more suitable stabilizing lipids.Those skilled in the art can easily understand that the specific combination of compounds described herein can be used without undue experimentation, and that various combinations of compounds are encompassed by the description of the formulation components.

[0275] The present invention can provide compositions for use in distributing active agents in cells, tissues or organs, organisms, and subjects, wherein the compositions comprise one or more ionizable lipid molecules of the present invention.

[0276] The compositions of the invention can include one or more ionizable lipid molecules along with the structured lipids and one or more lipids for reducing the immunogenicity of the nanoparticles.

[0277] The ionizable lipid molecules of the present embodiments may be any mole percentage of the compositions of the present invention.

[0278] The ionizable lipid molecules of the compositions of the present invention may comprise between 15 mol % and 35 mol % of the lipid component of the composition, and in certain embodiments, the ionizable lipid molecules of the composition may comprise between 20 mol % and 30 mol % of the lipid component of the composition.

[0279] The structured lipid of the composition of the present invention may comprise 20 mol % to 50 mol % of the lipid component of the composition, and in certain embodiments, the structured lipid of the composition may comprise 35 mol % to 45 mol % of the lipid component of the composition.

[0280] The one or more lipids for reducing the immunogenicity of the nanoparticles may, in total, comprise between 1 mol % and 10 mol %, or between 1 mol % and 8 mol % of the lipid component of the composition. In certain embodiments, the one or more lipids for reducing the immunogenicity of the nanoparticles may, in total, comprise between 1 mol % and 5 mol % of the lipid component of the composition.

[0281] In the compositions of the present embodiments, the total lipid component may include one or more ionizable lipid molecule components, one or more structural lipids, and one or more lipids for reducing the immunogenicity of the nanoparticles.

[0282] Formulations with four or more lipid components for drug delivery in malignant tumors The present invention can provide compositions for use in distributing active agents in cells, tissues or organs, organisms, and subjects, wherein the compositions comprise one or more ionizable lipid molecules of the present invention.

[0283] The compositions of the present embodiments may include one or more ionizable lipid molecules along with a structural lipid, one or more stabilizing lipids, and one or more lipids for reducing the immunogenicity of the nanoparticles.

[0284] The ionizable lipid molecules of the present embodiments can be present in any mole percentage in the compositions of the present invention.

[0285] The ionizable lipid molecules of the compositions of the present invention may comprise between 15 mol % and 35 mol % of the lipid component of the composition. In certain embodiments, the ionizable lipid molecules of the composition may comprise between 15 mol % and 25 mol % or between 20 mol % and 30 mol % of the lipid component of the composition.

[0286] The structured lipid of the composition of the present invention may comprise 25 mol % to 40 mol % of the lipid component of the composition. In certain embodiments, the structured lipid of the composition may comprise 25 mol % to 35 mol % or 30 mol % to 40 mol % of the lipid component of the composition.

[0287] The total stabilizing lipid of the composition of the present invention can be 25 mol% to 45 mol% of the lipid component of the composition. In certain embodiments, the total stabilizing lipid of the composition can be 30 mol% to 40 mol% of the lipid component of the composition.

[0288] In certain embodiments, the total of one or more stabilizing lipids can be between 25% and 45% by mole of the lipids in the composition, where each of the stabilizing lipids individually can be between 5% and 40% by mole.

[0289] In certain embodiments, the total of one or more stabilizing lipids can be 30 mol% to 40 mol% of the lipids of the composition, where each of the stabilizing lipids individually can be 10 mol% to 30 mol%. In various embodiments, the combined structured lipid (e.g., cholesterol) and stabilizing lipid (e.g., DOPC and DOPE) comprise 50 mol% to 85 mol% of the total lipids of the composition.

[0290] The one or more lipids for reducing the immunogenicity of the nanoparticles may, in total, comprise between 1 mol % and 10 mol %, or between 1 mol % and 8 mol % of the lipid component of the composition. In certain embodiments, the one or more lipids for reducing the immunogenicity of the nanoparticles may, in total, comprise between 1 mol % and 5 mol % of the lipid component of the composition.

[0291] In the compositions of the present invention, the total lipid component can include one or more ionizable lipid molecular components, one or more structural lipids, one or more stabilizing lipids, and one or more lipids for reducing the immunogenicity of the nanoparticles.

[0292] Examples of lipid compositions In some embodiments, the three lipid-like components, i.e., one or more ionizable molecules, structural lipids, and lipids for reducing the immunogenicity of one or more nanoparticles, can represent 100% of the lipid component of the composition.

[0293] Examples of formulations according to embodiments of the present invention are shown in Table 2.

[0294] [Table 2]

[0295] Ionizable lipid-like molecules An example of an ionizable lipid is a compound having the structure shown in Formula I.

[0296] [ka] Here, R1 and R2 are [ka] In the formula, n and m are 1 to 2; R 4 and R 5 is, independently at each occurrence, a C(12-20) alkyl group or a C(12-20) alkenyl group having 0-2 double bonds; Here, R 3 is selected from the following: [ka] Here, R 6 is selected from H, alkyl, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkoxy, aminoalkyl; R7 is selected from H, alkyl, and hydroxyalkyl; Q is O or NR 7 and; p is 1 to 4.

[0297] An example of the ionizable lipid is a compound of the following formula II:

[0298] [ka]

[0299] Compound A below is ((2-((3S,4R)-3,4-dihydroxypyrrolidin-1-yl)acetyl)azanediyl)bis(ethane-2,1-diyl)(9Z,9′Z,12Z,12′Z)-bis(octadeca-9,12-dienoate) and is an example of an ionizable lipid of formula II: TIFF0007667077000008.tif40156

[0300] structured lipids Examples of structured lipids include cholesterol, sterols, and steroids.

[0301] Examples of structural lipids include cholane, cholestane, ergostane, campestane, poriferastane, stigmastan, gorgostane, lanostane, gonane, estrane, androstane, pregnane, and cycloartane.

[0302] Examples of structured lipids include sterols and zosterols such as cholesterol, lanosterol, zymosterol, zymostenol, desmosterol, stigmastanol, dihydrolanosterol, and 7-dehydrocholesterol.

[0303] Examples of structured lipids include PEGylated cholesterol and cholestane 3-oxo-(C1-22) acyl compounds such as cholesteryl acetate, cholesteryl arachidonate, cholesteryl butyrate, cholesteryl hexanoate, cholesteryl myristate, cholesteryl palmitate, cholesteryl bephenate, cholesteryl stearate, cholesteryl caprylate, cholesteryl n-decanoate, cholesteryl dodecanoate, cholesteryl neurolate, cholesteryl pelargate, cholesteryl n-valerate, cholesteryl oleate, cholesteryl erucate, cholesteryl heptanoate, and cholesteryl linoleate.

[0304] Examples of structural lipids include sterols such as phytosterol, β-sitosterol, campesterol, ergosterol, brassicasterol, delta-7-stigmasterol, and delta-7-avenasterol.

[0305] stabilizing lipids An example of the stabilizing lipid is a zwitterionic lipid.

[0306] Examples of stabilizing lipids include compounds such as phospholipids.

[0307] Examples of phospholipids include phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine, and ordilinoleoylphosphatidylcholine.

[0308] Examples of the stabilizing lipid include a phosphatidylethanolamine compound and a phosphatidylcholine compound.

[0309] An example of the stabilizing lipid is 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC).

[0310] Examples of stabilizing lipids include diphytanoylphosphatidylethanolamine (DPhPE) and 1,2-diphytanoyl-sn-glycero-3-phosphocholine (DPhPC).

[0311] Examples of stabilizing lipids include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

[0312] Stabilizing lipids include 1,2-dilauroyl-sn-glycerol (DLG); 1,2-dimyristyl-sn-glycerol (DMG); 1,2-dipalmitoyl-sn-glycerol (DPG); 1,2-distearoyl-sn-glycerol (DSG); 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DAPC); 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC); 1,2-dimyristyl-sn-glycero-3-phosphocholine (DMPC); 1,2-dipalmitoyl-sn-glycero-O-ethyl-3-phosphocholine (DPePC); 1,2-dilauroyl Examples include 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE); 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE); 1-palmitoyl-2-linolenoyl-sn-glycero-3-phosphocholine; 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC); 1-palmitoyl-2-lyso-sn-glycero-3-phosphocholine (P-Lyso-PC); and 1-stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-Lyso-PC).

[0313] As used herein, the term DMPE-mPEG-2000 refers to 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000].

[0314] Lipids to reduce immunogenicity Examples of lipids for reducing immunogenicity include polymeric compounds and polymer-lipid conjugates.

[0315] The lipid for reducing immunogenicity can be exemplified by pegylated lipids having a polyethylene glycol (PEG) region. The PEG region can be of any molecular weight. In some embodiments, the PEG region can be of an average molecular weight of 200, 300, 350, 400, 500, 550, 750, 1000, 1500, 2000, 3000, 3500, 4000 or 5000 Da.

[0316] An example of a lipid for reducing immunogenicity is a compound having a methoxypolyethylene glycol region.

[0317] An example of a lipid for reducing immunogenicity is a compound having a carbonyl-methoxypolyethylene glycol region.

[0318] An example of a lipid for reducing immunogenicity is a compound having a multi-branched PEG region.

[0319] An example of a lipid for reducing immunogenicity is a compound having a polyglycerin region.

[0320] Examples of lipids for reducing immunogenicity include polymer lipids such as DSPE-mPEG, DMPE-mPEG, DPPE-mPEG, and DOPE-mPEG.

[0321] Examples of lipids for reducing immunogenicity include PEG-phospholipids and PEG-ceramides.

[0322] lipid composition In some embodiments, the composition may contain an ionizable lipid of formula II (e.g., Compound A), a structural lipid cholesterol, a stabilizing lipid DOPC and DOPE, and a lipid DSPE-mPEG for reducing immunogenicity. In certain embodiments, the ionizable lipid of formula II (e.g., Compound A) may be 15 mol% to 35 mol%, or 15 mol% to 25 mol%, or 20 mol% to 30 mol% of the composition; cholesterol may be 25 mol% to 35 mol% of the total lipid in the composition; a combination of DOPC and DOPE may be 30 mol% to 50 mol% of the total lipid in the composition; a combination of cholesterol, DOPC and DOPE may be 50 mol% to 85 mol%, or 60 mol% to 80 mol%, or 75 mol% to 85 mol% of the composition; DSPE-mPEG may be 1 mol% to 8 mol%, or 4 mol% to 6 mol%, or 5 mol% of the total lipid in the composition. In various embodiments, the combination of the compound of formula II, cholesterol, DOPC, DOPE and DSPE-mPEG-2000 can be at least 97 mol% of the total lipid in the composition. For example, in one embodiment, the combination of the compound of formula II, cholesterol, DOPC, DOPE and DSPE-mPEG-2000 can be about 100 mol% of the total lipid in the composition.

[0323] In one embodiment, the ionizable lipid of formula II (e.g., Compound A) can be 25 mol% of the total lipid in the composition; cholesterol can be 30 mol% of the total lipid in the composition, DOPC can be 20 mol% of the total lipid in the composition; DOPE can be 20 mol% of the total lipid in the composition; and DSPE-mPEG(2000) can be 5 mol% of the total lipid in the composition.

[0324] Nanoparticles The present invention can provide a liposomal nanoparticle composition. The ionizable molecules of the present invention can be used to form liposomal compositions that can have a bilayer of lipid-like molecules.

[0325] The nanoparticle composition can have one or more of the ionizable molecules of the present invention in a liposomal structure, a bilayer structure, a micellar, a lamellar structure, or a mixture thereof.

[0326] In some embodiments, the composition can include one or more liquid vehicle components.The liquid vehicle suitable for delivery of the active agent of the present invention can be a pharma-ceutically acceptable liquid vehicle.The liquid vehicle can include an organic solvent or a combination of water and an organic solvent.

[0327] Embodiments of the present invention can provide lipid nanoparticles having a size between 10 nm and 1000 nm. In some embodiments, the liposomal nanoparticles can have a size between 10 nm and 150 nm.

[0328] In certain embodiments, the liposomal nanoparticles of the present invention are capable of encapsulating RNAi molecules and retaining at least 80% of the encapsulated RNAi molecules after exposure to human serum for 1 hour.

[0329] As used herein, the term "encapsulate" refers to the ability of a nanoparticle to carry an active agent within its structure or on its surface such that the active agent is not removed by the solvent or mobile phase outside the particle.

[0330] Pharmaceutical Compositions The present invention further contemplates a method of delivering an active agent to an organ of a subject for treating a malignant tumor by administering to the subject a composition of the present invention. Organs that can be treated include the lungs.

[0331] In some embodiments, the present invention provides a method for treating a pulmonary malignancy disease by administering to a subject a composition of the present invention.

[0332] In a further aspect, the present invention provides a range of pharmaceutical formulations.

[0333] The pharmaceutical preparation herein can comprise active agent and drug carrier or lipid of the present invention together with pharmaceutically acceptable carrier or diluent.Generally, the active agent herein comprises any active agent for malignant tumor, including any inhibitory nucleic acid molecule and any small molecule drug.The inhibitory nucleic acid molecule can be exemplified by ribozyme, antisense nucleic acid, and RNA interference molecule (RNAi molecule).

[0334] Examples of anti-malignant tumor and anti-cancer agents include oncogene-related factors, tumor angiogenesis factors, metastasis-related factors, cytokines such as TGF-β, growth factors, proteinases such as MMP, caspases, and immunosuppressive factors.

[0335] The pharmaceutical formulations of the present invention may contain one or more of each of the following: surfactants, diluents, excipients, preservatives, stabilizers, dyes, and suspending agents.

[0336] Some pharmaceutical carriers, diluents and ingredients for pharmaceutical formulations, as well as methods for formulating and administering the compounds and compositions of the invention, are described in Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co, Easton, Penn, 1990.

[0337] Examples of preservatives include sodium benzoate, ascorbic acid, and esters of p-hydroxybenzoic acid.

[0338] Examples of the surfactant include alcohols, esters, and sulfated aliphatic alcohols.

[0339] Examples of excipients include sucrose, glucose, lactose, starch, crystallized cellulose, mannitol, light anhydrous silicate, magnesium aluminate, magnesium aluminometasilicate, synthetic aluminum silicate, calcium carbonate, sodium acid carbonate, calcium hydrogen phosphate, and calcium carboxymethylcellulose.

[0340] The therapeutic formulation of the present invention for the delivery of one or more molecules active in gene silencing can be administered to a mammal in need thereof. The formulation and an active agent, which can be encapsulated in liposomes, can be administered in a therapeutically effective amount to a mammal to prevent or treat malignant tumors.

[0341] The route of administration may be local or systemic.

[0342] The therapeutically effective formulations of the present invention can be administered by a variety of parenteral routes including intravenous, intraperitoneal, intramuscular and subcutaneous.

[0343] Routes of administration can include, for example, parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injection, as well as intrathecal, direct intraventricular, intraperitoneal, or intraocular injection.

[0344] The formulations may also be administered in sustained or controlled release dosage forms including depot injections, osmotic pumps, and the like, for prolonged and / or timed pulse administration at a predetermined rate.

[0345] The compositions of the present invention may be administered via various routes, including parenteral routes, including, but not limited to, intravenous, intramuscular, subcutaneous, topical, intrapulmonary, intraarterial, intraportal, intraventricular, intramedullary, intralymphatic, intracerebral, intrathecal, intraventricular, intraventricular, transdermal, and intraperitoneal routes. The compositions may be formulated into dosage forms suitable for each administration route. Such dosage forms and formulation methods may be appropriately selected from any known dosage forms and methods. For example, see Hyojun Yakuzaigaku, Standard Pharmaceutics, Edby Yoshiteru Watanabe et al, Nankodo, 2003.

[0346] Dosage forms suitable for parenteral administration include injections, such as injectable solutions, injectable suspensions, injectable emulsions, and ready-to-use injections. Preparations for parenteral administration can be in the form of aqueous or non-aqueous isotonic sterile solutions or suspensions.

[0347] Pharmaceutical preparations for parenteral administration, for example by bolus injection or continuous infusion, include aqueous solutions of the active agent in water-soluble form. Suspensions of the active compound can be prepared as appropriate oily injection suspensions. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran. Optionally, the suspension can also contain suitable stabilizers or agents that increase the solubility of the compound, allowing for the preparation of highly concentrated solutions.

[0348] Preparations for injection can be provided in unit dosage form, for example, in ampoules or in multi-dose containers, with the addition of a preservative.The preparations can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and / or dispersing agents.Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle (e.g., sterile pyrogen-free water) before use.

[0349] In addition to the preparation described above, the preparation can also be formulated as depot preparation.Such long-acting preparation can be administered by intramuscular injection.Therefore, for example, the preparation can be formulated as suitable polymer or hydrophobic material, for example, emulsion in acceptable oil, or ion exchange resin, or as poorly soluble derivative, for example, poorly soluble salt.

[0350] The compositions and formulations of the present invention may also be formulated for topical delivery and may be applied to the skin of a subject using any suitable process for application of a topical delivery vehicle. For example, the formulation may be applied manually, using an applicator, or by a process that includes both. After application, the formulation may be worked into the skin of the subject, for example, by rubbing. Application may be performed multiple times daily, or once daily. For example, the formulation may be applied to the skin of a subject once a day, twice a day, or multiple times a day, or once every two days, once every three days, or once a week, once every two weeks, or once every few weeks.

[0351] The formulations or pharmaceutical compositions described herein can be administered to a subject, for example, by parenteral route. Examples of administration methods include injection, subcutaneous, intraperitoneal, intravenous, intramuscular, intradermal, intraorbital, intracapsular, intraspinal, intrasternal, or the like, including infusion pump delivery; locally, such as by injection.

[0352] The exact formulation, route of administration and dosage for the pharmaceutical composition may be selected by the individual physician in consideration of the patient's condition. See, for example, Goodman & Gilman's The Pharmacological Basis of Therapeutics, 12th Ed, Sec.1, 2011. Typically, the dosage range of the composition administered to the patient may be about 0.5 mg / kg to about 1000 mg / kg of the patient's body weight. The dosage may be a single one or a series of two or more given for one or more days as needed by the patient. If a human dose of the compound has been established for at least some conditions, the dosage is about 0.1% to about 500%, more preferably about 25% to about 250%, of the established human dose. If a human dose has not been established, such as in the case of a newly discovered pharmaceutical composition, the appropriate human dose may be estimated from the ED50 or ID50 value or other suitable value obtained from in vitro or in vivo testing, as qualified by toxicity and efficacy testing in animals.

[0353] In some embodiments, an active agent, such as API(26 / 52), may be administered at a dose of 0.05 mg / kg to 50 mg / kg of the subject's body weight, or 0.01 mg / kg to 5 mg / kg, or 1 mg / kg to 2.5 mg / kg, or 1 mg, 2.5 mg, or 5 mg / kg of the subject's body weight.

[0354] In some embodiments, the active agent, eg, API(26 / 52), may be administered weekly, biweekly, or monthly.

[0355] Method for preventing or treating malignant tumors An embodiment of the present invention further relates to a method of controlling the activity or growth of a malignant tumor, comprising administering an effective amount of the composition to a subject in need thereof. The effective amount referred to herein is an amount that, in a method of treating a malignant tumor, alleviates symptoms or slows or stops its progression, and preferably prevents the onset or recurrence of the malignant tumor, or cures it. It is also preferably an amount that does not cause adverse effects that exceed the benefits obtained from administration. Such an amount can be suitably determined by in vitro tests using cultured cells, or tests in model animals or mammals such as mice, rats, dogs, pigs, etc. Such test methods are well known to those skilled in the art. Furthermore, the dose of the active agent in the carrier and the dose of the active agent used in the method of the present invention are known to those skilled in the art or can be suitably determined by the above tests.

[0356] The frequency of administration will depend on the characteristics of the composition used and the condition of the subject, and can be multiple times per day (i.e., 2, 3, 4, 5 or more times per day), once per day, every few days (i.e., every 2, 3, 4, 5, 6, or 7 days, etc.), several times per week (e.g., 2, 3, 4 times per week, etc.), weekly or every few weeks (i.e., every 2, 3, 4 weeks, etc.).

[0357] In some embodiments, the present invention also relates to a method of delivering a drug to malignant tumor cells utilizing the liposomal nanoparticle carriers described herein, which comprises administering or adding the carrier having therein and / or encapsulated therein a nucleic acid API to be delivered to an organism or medium (e.g., culture medium) containing lung extracellular matrix-producing cells. These steps can be suitably accomplished according to any known method or the method described in the present invention. The above method also includes an in vitro aspect and an in vivo aspect that targets lung malignant tumor cells.

[0358] The therapeutically effective formulations in accordance with embodiments of the present invention can be administered by systemic delivery, allowing for broad biodistribution of the active agent.

[0359] As used herein, the term "therapeutically effective amount" refers to an amount of a drug formulation effective to achieve its intended purpose.

[0360] An embodiment of the present invention can provide a therapeutic formulation comprising a therapeutic molecule of the present invention and a pharma- ceutically acceptable carrier, such as a liposomal nanoparticle.

[0361] An effective dose of the formulation of the present invention can be administered 1 to 12 times per day, or once per week. The administration period can be 1, 2, 3, 4, 5, 6, or 7 days, or 1, 2, 3, 4, 5, 6, 8, 10, or 12 weeks.

[0362] Additional Embodiments A composition for use in delivering an active agent (e.g., a nucleic acid API) for treating a malignancy in a subject, the composition comprising an ionizable lipid, a structural lipid, and a lipid for reducing the immunogenicity of the nanoparticle. The malignancy may occur in the lung.

[0363] The ionizable lipid can be 15 mol% to 35 mol% of the lipid of the composition, or 20 mol% to 30 mol% of the lipid of the composition. The structured lipid can be 25 mol% to 40 mol% of the lipid of the composition, or 30 mol% to 40 mol% of the lipid of the composition. The structured lipid can be cholesterol, sterol, or steroid. The lipid for reducing the immunogenicity of the nanoparticle can be 1 mol% to 10 mol%, or 1 mol% to 8 mol% of the lipid of the composition. The lipid for reducing the immunogenicity of the nanoparticle can have a polyethylene glycol (PEG) region with a molecular weight of 200 to 5000 Da. The lipid for reducing the immunogenicity of the nanoparticle can be DPPE-mPEG, DSPE-mPEG, DMPE-mPEG, or DOPE-mPEG.

[0364] The present invention further contemplates a composition for use in delivering an active agent (e.g., a nucleic acid API) for treating a malignancy in a subject, the composition comprising an ionizable lipid, a structural lipid, one or more stabilizing lipids, and a lipid for reducing immunogenicity of the nanoparticle. The ionizable lipid can be 15 mol % to 40 mol % of the lipid of the composition, or 20 mol % to 35 mol % of the lipid of the composition. The structural lipid can be 25 mol % to 40 mol % of the lipid of the composition, or 30 mol % to 35 mol % of the lipid of the composition.

[0365] The total of the one or more stabilizing lipids can be 25 mol% to 40 mol% of the lipids of the composition, where each of the stabilizing lipids individually is 5 mol% to 35 mol%. The one or more stabilizing lipids can be an ethanylethanolamine phosphate compound or a phosphatidylcholine compound.

[0366] In various embodiments, the composition can be one of the following combinations (Compound A / Cholesterol / DOPC / DOPE / DSPE-mPEG-2000): (25 / 30 / 30 / 10 / 5), (25 / 30 / 25 / 15 / 5), (25 / 30 / 20 / 20 / 5), (25 / 30 / 15 / 25 / 5), (25 / 30 / 10 / 30 / 5), (25 / 35 / 15 / 20 / 5), (25 / 35 / 20 / 15 / 5)(30 / 30 / 15 / 20 / 5), (30 / 30 / 20 / 15 / 5) or (35 / 30 / 15 / 15 / 5), where the numbers refer to the molar % concentrations of the components.

[0367] In some embodiments, the ionizable lipid can be of Formula II (e.g., Compound A), the structural lipid can be cholesterol, the stabilizing lipid can be DOPC and DOPE, and the lipid for reducing immunogenicity of the nanoparticle can be DSPE-mPEG-2000, wherein the lipid of Formula II (e.g., Compound A) comprises 15-35 mol % of the composition, the combination of cholesterol, DOPC, and DOPE comprises 50-85 mol % of the composition, DSPE-mPEG-2000 comprises 1-8 mol % of the composition, and the lipid of Formula II (e.g., Compound A), cholesterol, DOPC, DOPE, and DSPE-mPEG-2000 in combination comprises substantially 100 mol % of the lipid of the composition.

[0368] The active agent (e.g., a nucleic acid API) can be an RNAi molecule that targets GST-π. In some embodiments, the composition comprises a liposomal nanoparticle encapsulating an RNAi molecule.

[0369] The present invention also contemplates a pharmaceutical composition comprising the lipid composition and an active agent (e.g., a nucleic acid API). The active agent can be one or more RNAi molecules. The RNAi molecule for treating malignant tumors can include the RNAi molecule that targets GST-π. The RNAi molecule for treating malignant tumors can be, for example, siRNA, shRNA, or microRNA, as well as DNA-directed RNA (ddRNA), Piwi-interacting RNA (piRNA), and repeat-associated siRNA (rasiRNA).

[0370] In a specific embodiment, the present invention provides a pharmaceutical composition containing an RNAi molecule for treating malignant tumors with an RNAi molecule that targets only GST-π.

[0371] Administration can be at a dose of 0.01 mg / kg to 2 mg / kg of RNAi molecule at least once daily for a period of up to 12 weeks. Administration can provide a mean AUC(0-last) of 1 ug*min / mL to 1000 ug*min / mL and a mean Cmax of 0.1 ug / mL to 50 ug / mL for the GST-πRNAi molecule.

[0372] The present invention provides a method for preventing, treating or ameliorating one or more symptoms of malignant tumor in a mammal or any animal in need thereof, comprising administering to the mammal a therapeutically effective amount of a composition comprising an RNAi molecule, wherein at least some of the RNAi molecules are active in reducing the expression of GST-π. In some embodiments, the malignant tumor is associated with a KRAS mutation in the mammal, and the method further comprises identifying a tumor cell in the mammal, the tumor cell comprising at least one of (i) a mutation in the KRAS gene, and (ii) an abnormal expression level of the KRAS protein.

[0373] The methods of the present invention are applicable to any animal, including humans.

[0374] The mammal may be a human, and the GST-π may be human GST-π. The RNAi molecule may reduce expression of GST-π in the mammal. The administration may reduce expression of GST-π in the mammal by at least 5% for at least 5 days. The method may reduce one or more symptoms of a malignant tumor, or may delay or terminate the progression of a malignant tumor, or may reduce the proliferation of malignant tumor cells in the subject. The tumor cells may have an increased expression level of wild-type KRAS protein compared to that in normal cells. The tumor cells may overexpress wild-type GST-π RNA or protein.

[0375] In some embodiments, the tumor cell can include a mutation in the KRAS protein at one or more of residues 12, 13, and 61. In certain embodiments, the tumor cell can include a mutation in the KRAS protein and the tumor is lung cancer. The tumor can be a sarcoma, lung adenocarcinoma. The malignant tumor can be a sarcoma, such as lung adenocarcinoma.

[0376] In another aspect, embodiments of the present invention relate to the surprising discovery that malignant tumor size can be reduced in vivo by treatment with siRNA inhibitors of GST-π. Furthermore, embodiments of the present invention provide the unexpectedly advantageous result that tumor cell apoptosis can be increased to synthetic lethal levels to provide methods and compositions for preventing or treating malignant tumors.

[0377] The present invention relates to methods and compositions incorporating nucleic acid-based therapeutic compounds for use in delivery to various organs to prevent, treat, or ameliorate malignant conditions and diseases. In some embodiments, the present invention provides compositions of RNA interference molecules (RNAi molecules) for gene silencing of various targets associated with malignant tumors.

[0378] The present invention can provide compositions for the delivery of therapeutic molecules, as well as methods of use thereof. Various RNA-based and drug compositions of the present invention can be used in methods for preventing or treating malignant tumors.

[0379] In some embodiments, expression of GST-π can be reduced in malignant tumors that contain KRAS mutations or exhibit abnormal KRAS expression levels by treatment with siRNA agents that modulate levels that cause synthetic lethality to tumor cells.

[0380] The present invention relates to methods and compositions for nucleic acid-based therapeutic compounds for malignant tumors. In some embodiments, the present invention provides RNAi molecules, structures and compositions that can silence the expression of GST-π. The structures and compositions of the present disclosure's embodiments can be used to prevent, treat, or reduce the size of malignant tumors.

[0381] Embodiments of the present invention provide compositions and methods that can be used to treat neoplasms in a subject. In particular, embodiments of the present invention provide therapeutic compositions that can reduce the expression of a GST-π nucleic acid molecule or polypeptide for treating KRAS-associated neoplasms.

[0382] In some aspects, the invention includes inhibitory nucleic acid molecules that correspond to or are complementary to at least a fragment of a GST-π nucleic acid molecule and that reduce GST-π expression in a cell.

[0383] In certain embodiments, the present invention provides double-stranded nucleic acid molecules that are RNAi molecules, such as siRNA or shRNA, as well as DNA-directed RNA (ddRNA), Piwi-interacting RNA (piRNA) and repeat-associated siRNA (rasiRNA), for suppressing GST-π.

[0384] Method embodiments of the present invention are applicable to any animal, including humans.

[0385] In some aspects, the invention includes one or more vectors encoding the inhibitory nucleic acid molecules described above. The vectors can be retroviral, adenoviral, adeno-associated viral, or lentiviral vectors. In further embodiments, the vectors can include a promoter suitable for expression in mammalian cells. Further embodiments include cancer cells that contain KRAS mutations or exhibit abnormal KRAS expression levels, which can also include a vector or an inhibitory nucleic acid molecule of any one of the above aspects. In further embodiments, the cells can be neoplastic cells in vivo.

[0386] In some embodiments, the present invention includes a method for reducing GST-π expression in a malignant tumor cell that contains a KRAS mutation or exhibits aberrant KRAS expression. The method can include contacting the cell with an effective amount of an inhibitory nucleic acid molecule, where the inhibitory nucleic acid molecule inhibits expression of a GST-π polypeptide, thereby reducing GST-π expression in the cell.

[0387] In a further embodiment, the methods of the present invention can reduce GST-π transcription or translation in malignant tumors.

[0388] In certain embodiments, the invention includes a method for reducing GST-π expression in a malignant tumor cell, where the cell can be a human cell, a neoplastic cell, an in vivo cell, or an in vitro cell.

[0389] The embodiments of the present invention can also provide a method for treating a subject having a neoplasm, where the neoplastic cancer cells contain a KRAS mutation or exhibit an abnormal KRAS expression level. The method can include administering to the subject an effective amount of two or more inhibitory nucleic acid molecules, where the inhibitory nucleic acid molecules reduce GST-π expression, thereby treating the neoplasm. In some embodiments, the methods of the present invention can reduce the size of the neoplasm compared to the size of the neoplasm before or without treatment.

[0390] In various embodiments, the inhibitory nucleic acid molecules can be delivered in liposomes, polymers, microspheres, nanoparticles, gene therapy vectors or naked DNA vectors.

[0391] In a further aspect, the invention features a method for treating a subject (e.g., a human patient) having a neoplasm in which the neoplastic cancer cells contain a KRAS mutation or exhibit an abnormal KRAS expression level. In certain embodiments, the method can include administering to the subject an effective amount of an inhibitory nucleic acid molecule that inhibits expression of a GST-π polypeptide, where the inhibitory nucleic acid molecule is an antisense nucleic acid molecule, an siRNA, a dsRNA active against RNA interference, or a combination thereof.

[0392] In certain embodiments, the neoplasm can be a malignant tumor or lung cancer.

[0393] Lipid tail structure Embodiments of the lipid-like compounds of the present invention may have one or more lipophilic tails containing one or more alkyl or alkenyl groups, such as C(14:1(5)) alkenyl, C(14:1(9)) alkenyl, C(16:1(7)) alkenyl, C(16:1(9)) alkenyl, C(18:1(3)) alkenyl, C(18:1(5)) alkenyl, C(18:1(7)) alkenyl, C(18:1(9)) alkenyl, C(18:1(11)) alkenyl, C(18:1(12)) alkenyl, C(18:2(9,12)) alkenyl, C(18:2(9,11)) alkenyl, C(18:3(9,12,15)) alkenyl, C(18:3(6,9,12)) alkenyl, C(18:3(9,11,13)) alkenyl, C(18:4(6,9,12,15)) alkenyl, C(18:4(9,11,13,15)) alkenyl, C(20:1(9)) alkenyl, C(20:1(11)) alkenyl, C(20:2(8,11)) alkenyl, C(20:2(5,8)) alkenyl, C(20:2(11,14)) alkenyl, C(20:3(5,8,11)) alkenyl, C(20:4(5,8,11,14)) alkenyl, C(20:4 Examples include C(7,10,13,16)) alkenyl, C(20:5(5,8,11,14,17)) alkenyl, C(20:6(4,7,10,13,16,19)) alkenyl, C(22:1(9)) alkenyl, C(22:1(13)) alkenyl, and C(24:1(9)) alkenyl.

[0394] chemical definition The term "alkyl" as used herein refers to a hydrocarbyl group of a saturated aliphatic group that may be of any length. The alkyl group can be a branched or unbranched, substituted or unsubstituted aliphatic group containing 1 to 22 carbon atoms. This definition also applies to the alkyl moieties in other functional groups such as, for example, cycloalkyl, alkoxy, alkanoyl, and aralkyl.

[0395] As used herein, a term such as "C(1-5) alkyl" includes C(1) alkyl, C(2) alkyl, C(3) alkyl, C(4) alkyl, and C(5) alkyl. Similarly, a term such as, for example, "C(3-22) alkyl" includes C(1) alkyl, C(2) alkyl, C(3) alkyl, C(4) alkyl, C(5) alkyl, C(6) alkyl, C(7) alkyl, C(8) alkyl, C(9) alkyl, C(10) alkyl, C(11) alkyl, C(12) alkyl, C(13) alkyl, C(14) alkyl, C(15) alkyl, C(16) alkyl, C(17) alkyl, C(18) alkyl, C(19) alkyl, C(20) alkyl, C(21) alkyl, and C(22) alkyl.

[0396] As used herein, alkyl groups include Me (methyl), Et (ethyl), Pr (any propyl group), n Pr (n-Pr, n-propyl), i Pr (i-Pr, isopropyl), Bu (any butyl group), n Bu (n-Bu, n-butyl), i Bu (i-Bu, isobutyl), s Bu (s-Bu, sec-butyl) and t It can be designated by terms such as Bu (t-Bu, tert-butyl).

[0397] The term "alkenyl" as used herein refers to a hydrocarbyl radical having at least one carbon-carbon double bond. An alkenyl group can be a branched or unbranched, substituted or unsubstituted hydrocarbyl group having 2 to 22 carbon atoms and at least one carbon-carbon double bond.

[0398] The term "substituted" as used herein refers to an atom having one or more substitutions or substituents, which may be the same or different and may include hydrogen substituents. Thus, the terms "alkyl", "cycloalkyl", "alkenyl", "alkoxy", "alkanoyl", and "aryl" refer to groups that may include, for example, substituted variations. Substituted variations include straight-chain, branched-chain, and cyclic variations and functional groups that have one or more substituents replacing one or more hydrogens bonded to any carbon atom of the functional group.

[0399] In general, a compound may contain one or more chiral centers. Compounds containing one or more chiral centers may include those described as "isomers", "stereoisomers", "diastereomers", "enantiomers", "optical isomers" or "racemic mixtures". Conventions for stereochemical naming, such as the stereoisomer naming rules of Cahn, Ingold and Prelog, and methods for determining stereochemistry and separating stereoisomers are known in the art. See, for example, Michael BSmith and Jerry March, March's Advanced Organic Chemistry, 5th edition, 2001. The compounds and structures of the present disclosure are meant to encompass all possible isomers, stereoisomers, diastereomers, enantiomers and / or optical isomers that are understood to exist for a particular compound or structure, including any mixtures, racemates or otherwise.

[0400] The present invention encompasses any and all tautomers, solvated or unsolvated, hydrated or non-hydrated forms, and any atomic isotopic forms of the compounds and compositions disclosed herein.

[0401] The present invention includes any and all crystalline polymorphs or distinct crystalline forms of the compounds and compositions disclosed herein. EXAMPLES

[0402] Example 1: An embodiment of a pharmaceutical formulation of the present invention having siRNA targeting GST-π demonstrated enhanced distribution to the lung in vivo.

[0403] Figure 1 shows enhanced distribution to lungs in vivo in mice (non-tumor-bearing animals) using pharmaceutical formulations of the present invention containing siRNA targeting GST-π, ionizable lipid compound A, and DSPE-mPEG-2000 lipid compound. Organs were harvested from 5 animals per group 4 hours after injection of a dose of 4 mg / kg into naive animals. Accumulation of siRNA in organs was measured by fluorescence.

[0404] Figure 1 shows significantly higher accumulation in the lung for the formulation (siRNA GST-π, 25 mol% Compound A, 30 mol% Cholesterol, 20 mol% DOPE, 20 mol% DOPC, 5 mol% DSPE-mPEG-2000) compared to a similar formulation using DMPE-mPEG-2000 lipid compound. The combination of Compound A and DSPE-mPEG-2000 lipid compound in a nanoparticle liposomal formulation surprisingly enhanced accumulation of GST-π siRNA in the lung.

[0405] Example 2: An embodiment of the pharmaceutical formulation of the present invention having siRNA targeting GST-π demonstrated a significant reduction in tumor volume in vivo. GST-π siRNA provided gene knockdown efficacy in vivo when administered in a liposomal formulation to cancer xenograft tumors.

[0406] Figure 2 shows the tumor growth inhibition efficacy of the liposomal formulation of GST-π siRNA of the present invention in the A549 cell lung cancer sub-Q xenograft model in athymic nude (nu / nu) female mice. The pharmaceutical formulation (siRNA GST-π, Compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%) showed significant tumor growth inhibition effect within several days after administration. After 49 days, the pharmaceutical formulation containing GST-π siRNA showed a remarkable favorable tumor growth inhibition efficacy, and the tumor volume was reduced by more than 3.4 times for the 4 mg / kg dose compared to the vehicle control.

[0407] The tumor growth inhibition effect of the treatment was evaluated, and a dose-dependent tumor growth inhibition was observed. At 4 mg / kg, the T / C ratio on day 49 was 30% (tumor growth inhibition ratio, set to 100% for the vehicle control), the tumor growth inhibition rate was 70% (TGI%, 0% for the vehicle control), and the tumor doubling time was 47 days (t D , 16 days for vehicle control). No significant weight loss was observed.

[0408] Dose levels of 0.75 and 4 mg / kg of each formulation were administered to animals for 8 consecutive weeks according to a once-weekly (QWx8) dosing regimen. Efficacy (tumor volume reduction curve, T / C ratio, %TGI and t D Both efficacy and safety (body weight and overt signs) were monitored in this study. Tissue samples (tumor, lung, liver) were collected 24 hours after the last dose. There were 7 mice (145±5 mm) per group, and the dose volume was 10 mL / kg. The endpoints were (1) BW: daily for the first week, twice / week for the following 3 weeks after the first dose, and once / week for the remaining weeks if a booster dose was administered; and (2) tumor measurement: twice / week for the first 4 weeks, and once / week for the remaining weeks if a booster dose was administered. On the day of dosing, the frozen formulation vials were removed from the freezers at -80°C and -20°C, respectively.

[0409] Pharmaceutical formulations were used from frozen formulation stocks and the vials were left at room temperature for approximately 30 minutes. The contents were thoroughly mixed by gently inverting the vial. The stock solutions were diluted with an appropriate volume of saline to achieve the corresponding target concentration prior to IV administration.

[0410] Example protocol for cancer xenograft model. A549 cell line is obtained from ATCC. Cells are maintained in culture medium supplemented with 10% fetal bovine serum and 100 U / ml penicillin and 100 μg / ml streptomycin. Cells are individualized 48 hours before seeding so that they are in logarithmic growth phase at the time of collection. Cells are lightly trypsinized with trypsin-EDTA and harvested from tissue culture. The number of viable cells is counted and measured in a hemocytometer in the presence of trypan blue (only viable cells are counted). Cells are cultured at 5×10 in serum-free medium. 7 The cell suspension is then thoroughly mixed in a 1:1 ratio with ice-thawed BD Matrigel for injection.

[0411] Mice were Charles River Laboratory Athymic Nude (nu / nu) female mice, immunodeficient, 6-8 weeks old, 7-8 mice per group.

[0412] For tumor model preparation, each mouse was inoculated with 2.5 x 10 cells of A549 cells in 0.1 mL using a 25 G needle and syringe. 6 Mice are inoculated subcutaneously in the right flank with an inoculum of 100 μg / mouse (one inoculum per mouse). Mice are not anesthetized for inoculation.

[0413] For tumor volume measurement and randomization, tumor size is measured to the nearest 0.1 mm. Tumor volume is calculated according to the formula: tumor volume = length x width. 2 Established tumors are approximately 120-175 mm 3 When tumor volume reaches 100 mm, the average tumor volume is approximately 150 mm. 3Mice are assigned to various vehicle control and treatment groups with mean tumor volumes within 10% of the mean tumor volumes in the vehicle control groups, ideally with a CV% of tumor volumes of less than 25%. On the same day, test articles and control vehicles are administered according to the dosing regimen. Tumor volumes are monitored three times during the first week and twice during the remaining weeks, including the end of the study.

[0414] For dosing and administration, on the day of dosing, remove test articles from the -80°C freezer and thaw on ice. Invert the bottle containing the formulation several times by hand before loading into the syringe. All test articles are administered IV at 10 ml / kg.

[0415] For body weight, mice are weighed to the nearest 0.1 g. Body weight is monitored and recorded daily for up to 7 days after dosing for the first dose. Body weight is monitored and recorded twice weekly for the remainder of the week including the end of the study.

[0416] For tumor harvest, tumor volumes are measured 49 days after the first dose, and tumors are excised, weighed, and preserved for PD biomarker testing. Tumor weights are recorded.

[0417] Example 3: The drug product of the present invention embodiment having siRNA targeting GST-π showed a significant reduction in tumor volume in vivo. GST-π siRNA provided gene knockdown efficacy in vivo when administered in a liposomal formulation to cancer xenograft tumors.

[0418] FIG. 3 shows the tumor growth inhibition efficacy of the liposomal formulation of GST-π siRNA of the present invention in a human H2009 cell lung cancer sub-Q xenograft model in athymic Balb / c nude (nu / nu) female mice. H2009 is a lymph node metastatic lung adenocarcinoma cell. The administered drug solution was reconstituted from a lyophilized pharmaceutical solution containing 10 mg / vial of GST-π siRNA. The pharmaceutical solution contained a suspension of the pharmaceutical formulation based on the pharmaceutical formulation (siRNA GST-π, Compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%), as well as sucrose and 2-hydroxypropyl-β-cyclodextrin for lyophilization protection, and 27 mg ascorbic acid and 27 mg sodium acetate as buffers. The formulation was reconstituted in 5.6 mL of sterile WFI to obtain a 1.5 mg / mL API(26 / 52)GST-πsiRNA reconstituted suspension. The results showed that the drug solution exerted a dose-dependent tumor growth inhibitory effect in a KRAS mutant subcutaneous (sub-Q) xenograft H2009 NSCLC tumor model.

[0419] The Z-ave particle size of the drug solution was 54 nm (44 nm for the negative control) and the particle size distribution PDI was 0.15 (0.09 for the negative control).

[0420] On the day of dosing, the lyophilized formulation vial was removed from the 20° C. freezer. To prepare a working solution with a concentration of 2 mg / mL, 1.2 mL of water for injection (WFI) was added to reconstitute the lyophilized cake. The vial was left at room temperature for 5 minutes, gently swirled for 2 minutes, and then left at room temperature for an additional 20 minutes. A final dilution round was performed, where 5.4 mL of saline was added to 0.6 mL of the 2 mg / mL solution to obtain a 0.2 mg / mL dosing solution.

[0421] Mice were administered the negative control at 4 mpk and the test drug at 1 and 4 mpk, with a dose volume of 10 mL / kg, once weekly (QW) for 4 consecutive weeks.

[0422] Drug solutions reconstituted from lyophilized pharmaceutical formulations (siRNA GST-π, Compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%) showed significant tumor growth inhibition effects within a few days after administration. After 29 days, pharmaceutical formulations containing GST-π siRNA showed significantly favorable tumor growth inhibition efficacy, with tumor volume reduced by more than 1.5-fold at a dose of 4 mg / kg compared to the negative control.

[0423] In conclusion, the drug solution exhibited tumor growth inhibitory effects against human KRAS mutant H2009 sub-Q xenograft tumors, and the antitumor activity was shown to be dose-dependent.

[0424] [Table 3]

[0425] The tumor growth inhibition effect of the treatment was evaluated, and a dose-dependent tumor growth inhibition was observed. At 4 mg / kg, the T / C ratio on day 29 was 51% (tumor growth inhibition ratio, 78% vs. negative control), the tumor growth inhibition rate was 49% (TGI%, 22% vs. negative control), and the tumor doubling time was 27 days (t D and 16 days for negative controls). Test animals showed slight weight loss (<10%) during the first week after dosing, followed by a return to baseline levels and subsequent weight gain. No overt clinical signs were observed in the remaining animals throughout the study.

[0426] Protocol: Human H2009 cell line was obtained from ATCC (ATCC CCL-5911™, Manassas, VA). Cells were maintained in DMEM / F12 (catalog #30-2006) culture medium supplemented with 5% fetal bovine serum (lot # AAM211829 from HyClone / VWR), 100 U / ml penicillin (lot #1780186 from Gibco) and 100 μg / ml streptomycin (lot #1780186 from Gibco); additional components were added with the final formulation as follows: 0.005 mg / ml insulin, 0.01 mg / ml transferrin, 30 nM sodium selenate, 10 nM hydrocortisone, 4.5 mM L-glutamine, and maintained in a humidified atmosphere containing 5% CO2 for 48 hours. Cells were detached 48 hours prior to inoculation to ensure that they were in logarithmic growth phase at the time of harvest. Cells were lightly trypsinized with trypsin-EDTA and harvested from tissue culture. The number of viable cells was counted and measured in a hemocytometer in the presence of trypan blue (only viable cells are counted). Cells were then cultured at 3×10 7 The cell suspension was thoroughly mixed at a 1:1 ratio with ice-thawed BD Matrigel (Lot No. 7058007 from VWR) for injection to establish xenograft tumors in mice.

[0427] Six to eight week-old athymic Balb / c nude (nu / nu) female mice were purchased from Charles River Laboratories and housed in the animal facility. Each mouse was inoculated with 1.5 × 10 6 A 0.1 mL inoculum of NCI H2009 cells was inoculated subcutaneously in the right flank. Tumor size was measured to the nearest 0.1 mm. Tumor volume was calculated using the formula: Tumor volume = (length × width) 2 ) / 2. Established tumors are approximately 120-170 mm 3 (145 mm 3Once the mean tumor volume at 100 mg / kg / day was reached, mice were randomized into a vehicle control group and three treatment groups. Randomization was based on two main criteria: 1) the mean tumor volume for each treatment group was within 10% of the corresponding value for the vehicle control group, and 2) the CV% of tumor volume within each group was less than 15%. On the same day, test article and control vehicle were administered according to the dosing regimen. Tumor volumes were monitored three times during the first week and twice during the remaining weeks, including the end of the study. Body weights were also checked across all test groups to ensure that no extremes were included in any of the test groups. Seven mice per group were used in this study.

[0428] Body weights were measured daily for the first week and twice weekly for the remainder of the study. Tumor sizes were measured twice weekly throughout the study. Animals were observed daily for overt clinical signs.

[0429] Example 4: A pharmaceutical formulation of the present invention having siRNA targeting GST-π showed a significant reduction in cancer xenograft tumors in vivo. GST-π siRNA provided gene knockdown efficacy in vivo when administered to cancer xenograft tumors in a liposomal formulation.

[0430] FIG. 4 shows the tumor growth inhibition efficacy of the liposomal formulation of GST-π siRNA of the present invention in a human H23 cell lung cancer sub-Q xenograft model in athymic Balb / c nude (nu / nu) female mice. H23 is an adenocarcinoma; non-small cell lung cancer. The administered composition contained a suspension of a pharmaceutical formulation based on a pharmaceutical formulation (siRNA GST-π, compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%), as well as 27 mg ascorbic acid and 27 mg sodium acetate as buffer. As a result, a dose-dependent tumor growth inhibition effect of the drug solution was observed in a KRAS mutant subcutaneous (sub-Q) xenograft H23 NSCLC tumor model.

[0431] The Z-average particle size of the pharmaceutical composition was 47 nm (44 nm for the negative control) and the particle size distribution PDI was 0.07 (0.09 for the negative control).

[0432] On the day of administration, the frozen formulation vials were removed from the -80°C freezer and thawed at room temperature for approximately 30 minutes. The vials were gently inverted to mix the contents. The stock solutions were diluted with an appropriate volume of saline to achieve the target concentration prior to IV administration.

[0433] Mice were administered the negative control at a dose of 4 mpk and the test drug at a dose of 4 mpk, with a dosing volume of 10 mL / kg, once weekly (QW) for 4 consecutive weeks.

[0434] The pharmaceutical composition (siRNA GST-π, Compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%) showed significant tumor growth inhibition effects within a few days after administration. After 28 days, the pharmaceutical formulation containing GST-π siRNA showed a significantly favorable tumor growth inhibition efficacy, with tumor volume reduced by more than 1.3-fold for a 4 mg / kg dose compared to the negative control.

[0435] In conclusion, the drug solution exhibited tumor growth inhibitory effects against human KRAS mutant H23 sub-Q xenograft tumors, and the antitumor activity was shown to be dose-dependent.

[0436] [Table 4]

[0437] The tumor growth inhibition effect of the treatment was evaluated and a dose-dependent tumor growth inhibition was observed. At 4 mg / kg, the T / C ratio on day 28 was 52% (tumor growth inhibition ratio, 69% vs. negative control), and the percentage of tumor growth inhibition was 48% (TGI%, 31% vs. negative control).

[0438] Figure 5 shows the tumor growth inhibition efficacy of the liposomal formulation of GST-π siRNA of the present invention in a human H23 cell lung cancer sub-Q xenograft model in athymic Balb / c nude (nu / nu) female mice. The administered composition contains a suspension of a pharmaceutical formulation based on a pharmaceutical formulation (siRNA GST-π, Compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%), as well as 27 mg ascorbic acid and 27 mg sodium acetate as buffer. As a result, a dose-dependent tumor growth inhibition effect of the drug solution was observed in a KRAS mutant subcutaneous (sub-Q) xenograft H23 NSCLC tumor model.

[0439] The pharmaceutical composition (siRNA GST-π, Compound A 25 mol%, cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%) showed significant tumor growth inhibition effects within a few days after administration. After 56 days, the pharmaceutical formulation containing GST-π siRNA showed a significantly favorable tumor growth inhibition efficacy, with tumor volume reduced more than 2-fold for the 4 mg / kg dose compared to the negative control.

[0440] [Table 5]

[0441] Protocol: Human NCI-H23 cell line was obtained from ATCC (C / N: CRL-5800, L / N: 63990092, Manassas, VA). Cells were maintained in RPMI-1640 medium (HyClone / VWR, lot# AAF202601) containing 10% fetal bovine serum (Lot# AAM211829 from HyClone / VWR), 100 U / mL penicillin (Gibco, lot#1780186) and 100 μg / mL streptomycin (Gibco, lot#1780186) in a humidified atmosphere containing 5% CO2 for 48 hours. Cultured cells were passaged three times and then harvested prior to animal inoculation. The harvested cells were then cultured at 3×10 7The cells were resuspended at 1:1 cells / mL. The cell suspension was thoroughly mixed with ice-thawed BD Matrigel (Lot# 7058007, VWR) for injection at a 1:1 ratio to establish xenograft tumors in mice.

[0442] Six to eight week old athymic Balb / c nude (nu / nu) female mice were purchased from Charles River Laboratories and housed in the animal facility. 6 0.1 ml of cells were inoculated subcutaneously on the right flank. Tumor size was measured to the nearest 0.1 mm. Tumor volume was calculated using the formula: Tumor volume = (length x width) 2 ) / 2. Established tumors are approximately 120-170 mm 3 (145 mm 3 Once the mean tumor volume at 100 mg / kg / day was reached, mice were randomized into a vehicle control group and two treatment groups. Randomization was based on two main criteria: 1) the mean tumor volume of each treatment group was within 10% of the corresponding value of the vehicle control group, and 2) the CV% of tumor volume within each group was less than 15%. Body weights were also checked across all test groups to ensure that no extremes were included in any of the test groups. Seven mice per group were used in this study.

[0443] Example 5: Lipid nanoparticle formulations provide surprisingly high pulmonary delivery.

[0444] FIG. 6 shows the lung to liver distribution ratio in mice in vivo for an embodiment of the formulation of the present invention. The administered compositions were based on two pharmaceutical formulations, "DMPE (left):" (API siRNA, Compound A 25 mol%, Cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DMPE-mPEG-2000 5 mol%) and "DSPE (right):" (API siRNA, Compound A 25 mol%, Cholesterol 30 mol%, DOPE 20 mol%, DOPC 20 mol%, DSPE-mPEG-2000 5 mol%). The results showed that the distribution ratio of active agent to lung to liver in mice in vivo was surprisingly about 30 times higher for the formulation based on DSPE-mPEG-2000 compared to DMPE-mPEG-2000.

[0445] Example 6: Lipid nanoparticle formulations containing Compound A and DSPE-PEG2k show surprisingly high pulmonary delivery.

[0446] Figure 7 shows the lung to liver distribution ratios for in vivo mice for an embodiment of a formulation of the invention containing lipid-encapsulated API siRNA. The administered compositions were based on three pharmaceutical formulations as described in the table below. The results showed that in vivo mice, the ratio of siRNA active agent distribution to lung to liver was surprisingly 25-30 times higher for the DSPE-mPEG-2000 based formulation compared to otherwise identical DMPE-mPEG-2000 or DPPE-mPEG-2000 based formulations.

[0447] [Table 6]

[0448] Example 7: Lipid nanoparticle formulations containing lipid (Compound A, Compound B, or Compound C) and DSPE-PEG2k demonstrated surprisingly high lung delivery.

[0449] Figure 8 shows the lung to liver distribution ratio in mice in vivo for an embodiment of the formulation of the present invention containing lipid-encapsulated API siRNA. The administered compositions were based on three pharmaceutical formulations utilizing different lipids (compound A, compound B and compound C), as detailed in the table below.

[0450] [Table 7]

[0451] The results showed that the ratio of siRNA-active agent distribution to lung versus liver in mice in vivo was greater than 1.0 for all three lipids, and surprisingly, was significantly higher for the compound A-based formulations compared to otherwise identical formulations based on lipids compound B and compound C, whose chemical structures are illustrated in Figure 8.

[0452] The embodiments described herein are not limiting, and one of skill in the art can readily appreciate that particular combinations of the modifications described herein can be tested without undue experimentation to identify nucleic acid molecules with improved RNAi activity.

[0453] All publications, patents, and literature specifically mentioned herein are incorporated by reference in their entirety for all purposes.

[0454] It is understood that the present invention is not limited to the specific methods, protocols, materials, and reagents described, which may vary. It is also understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. It will be readily apparent to those skilled in the art that various substitutions and modifications can be made to the descriptions disclosed herein without departing from the scope and spirit of the descriptions, and that these embodiments are within the scope of the present specification and claims.

[0455] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Similarly, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein. It should also be noted that the terms "comprises," "comprising," "containing," and "including" can also be used interchangeably and are intended to be read expansively and without limitation.

[0456] Recitation of numerical ranges herein is intended merely to serve as a shorthand method for referring individually to each value falling within the range, unless otherwise noted herein, and each value is incorporated into the specification as if each was individually recited herein. For Markush groups, one of skill in the art will recognize that the description includes the individual members, as well as subgroups of members of the Markush group.

[0457] Without further elaboration, it is believed that one skilled in the art can, based on the preceding description, utilize the present invention to its fullest extent. Accordingly, the following specific embodiments are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

[0458] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose.

Claims

1. (a) Nucleic acid active pharmaceutical ingredient (active pharmaceutical ingredient); (b) a compound having formula II: (c) a DSPE lipid containing a polyethylene glycol (PEG) region, a hyperbranched PEG region, a methoxypolyethylene glycol (mPEG) region, a carbonyl-methoxypolyethylene glycol region, or a polyglycerol region; (d) sterol lipids, and (e) one or more neutral lipids wherein the DSPE lipid is 4 mol% to 6 mol% of the total lipid of the composition, and the nucleic acid active pharmaceutical ingredient is an siRNA targeting GST-π.

2. 2. The pharmaceutical composition of claim 1, wherein the compound of formula II is 15 mol % to 35 mol % of the total lipid of the composition.

3. 2. The pharmaceutical composition of claim 1, wherein the compound of formula II is 20 mol % to 30 mol % of the total lipid of the composition.

4. 4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the sterol lipid is 25 mol% to 40 mol% of the total lipid of the composition.

5. 4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the sterol lipid is 30 mol% to 40 mol% of the total lipid of the composition.

6. The pharmaceutical composition according to any one of claims 1 to 5, wherein the sterol lipid is cholesterol.

7. The pharmaceutical composition of any one of claims 1 to 6, wherein the DSPE lipid comprises a PEG region.

8. 8. The pharmaceutical composition of claim 1, wherein the DSPE lipid comprises a PEG region having a molecular weight of between 200 Da and 5000 Da.

9. The pharmaceutical composition of any one of claims 1 to 8, wherein the DSPE lipid is DSPE-mPEG-2000.

10. 10. The pharmaceutical composition of claim 1, wherein the sum of said one or more neutral lipids is 25 mol% to 45 mol% of the total lipid of the composition, and each of said neutral lipids is individually 5 mol% to 40 mol%.

11. 10. The pharmaceutical composition of claim 1, wherein the sum of said one or more neutral lipids is 30 mol% to 40 mol% of the total lipid of the composition, and each of said neutral lipids is individually 10 mol% to 30 mol%.

12. 12. The pharmaceutical composition according to any one of claims 1 to 11, wherein the one or more neutral lipids are selected from phosphatidylethanolamine compounds and phosphatidylcholine compounds.

13. 13. The pharmaceutical composition of any one of claims 1 to 12, wherein the one or more neutral lipids are 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

14. 14. The pharmaceutical composition of any one of claims 1 to 13, wherein cholesterol, DOPC, and DOPE in combination constitute 50 mol% to 85 mol% of the total lipids of the composition.

15. the compound of formula II comprises 15 mol% to 35 mol% of the total lipids of the composition; the combination of cholesterol, DOPC, and DOPE constitutes 50 mol% to 85 mol% of the total lipids of said composition; and 15. The pharmaceutical composition of any one of claims 1 to 14, wherein the combination of the compound of formula II, cholesterol, DOPC, DOPE and DSPE-mPEG-2000 constitutes at least 97 mol % of the total lipid of the composition.

16. 16. The pharmaceutical composition of claim 15, wherein the combination of the compound of formula II, cholesterol, DOPC, DOPE and DSPE-mPEG-2000 constitutes 100 mol % of the total lipid of the composition.

17. the compound of formula II comprises 20 mol % to 30 mol % of the total lipids of the composition; Cholesterol constitutes 25 mol% to 35 mol% of the total lipids of said composition; The combination of DOPC and DOPE constitutes 30 mol% to 50 mol% of the total lipids of the composition; and 15. The pharmaceutical composition of any one of claims 1 to 14, wherein the combination of the compound of formula II, cholesterol, DOPC, DOPE and DSPE-mPEG-2000 constitutes at least 97 mol % of the total lipid of the composition.

18. 18. The pharmaceutical composition of claim 17, wherein the combination of the compound of formula II, cholesterol, DOPC, DOPE and DSPE-mPEG-2000 constitutes 100 mol % of the total lipid of the composition.

19. The pharmaceutical composition of any one of claims 1 to 18, wherein the nucleic acid active pharmaceutical ingredient is API(26 / 52), and API(26 / 52) is an siRNA targeting GST-π having the following sequence: Sense strand SEQ ID NO:26 (5'→3'): GAAGCCUUUUGAGACCCUAUU; Antisense strand SEQ ID NO:52 (5'→3'): fUAGgGuCuCAAAAGGCUUCUU; where A, G, C and U represent ribo-A, ribo-G, ribo-C and ribo-U, respectively; lowercase a, u, g, c and t represent 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2'-deoxy-C and deoxythymidine, respectively (dT=T=t); underlines represent 2'-OMe-substitutions; and lowercase f represents 2'-deoxy-2'-fluoro-substitutions.

20. The pharmaceutical composition according to any one of claims 1 to 19, wherein the compound having formula II is compound A having the following formula:

21. The pharmaceutical composition of any one of claims 1 to 18, wherein the nucleic acid active pharmaceutical ingredient is an siRNA targeting GST-π, comprising a sense strand and an antisense strand, wherein the sense strand is SEQ ID NO: 1 and the antisense strand is SEQ ID NO: 27, where N is selected from the group of A, C, G, U, 2'-OMe-U, A, c, g, u, t, inverted nucleotides, and chemically modified nucleotides.

22. 22. The pharmaceutical composition of claim 21, wherein one or more nucleotides in the double-stranded region of the nucleic acid active pharmaceutical ingredient are chemically modified.

23. 23. The pharmaceutical composition of claim 22, wherein the one or more chemically modified nucleotides are selected from 2'-deoxy nucleotides, 2'-O-alkyl substituted nucleotides, 2'-deoxy-2'-fluoro substituted nucleotides, phosphorothioate nucleotides, locked nucleotides, and any combination thereof.

24. 24. The pharmaceutical composition of claim 22 or 23, wherein the sense strand and the antisense strand are any one of the combinations listed in Table 1. 【Table 1】

25. The nucleic acid active pharmaceutical ingredient is API (26 / 52), which is an siRNA targeting GST-π having the following sequence: Sense strand SEQ ID NO:26 (5'→3'): GAAGCCUUUUGAGACCCUAUU; Antisense strand SEQ ID NO:52 (5'→3'): fUAGgGuCuCAAAAGGCUUCUU; where A, G, C and U represent ribo-A, ribo-G, ribo-C and ribo-U, respectively; lowercase a, u, g, c and t represent 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2'-deoxy-C and deoxythymidine, respectively (dT=T=t); underlines represent 2'-OMe-substitutions; and lowercase f represents 2'-deoxy-2'-fluoro substitutions. The sterol lipid is semi-synthetic cholesterol; the one or more neutral lipids are 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE); the DSPE lipid is DSPE-mPEG-2000; 21. The pharmaceutical composition of claim 20, comprising 10 mg of API (26 / 52), 49.1 mg of compound A (24.985 mol% of total lipids), 29.5 mg of semi-synthetic cholesterol (30.015 mol% of total lipids), 37.8 mg of DOPE (19.989 mol% of total lipids), 40.0 mg of DOPC (20.019 mol% of total lipids), and 35.6 mg of DSPE-mPEG-2000 (4.992 mol% of total lipids).

26. 26. The pharmaceutical composition of any one of claims 1 to 25, comprising nanoparticles having a Z-average size of 30 nm to 100 nm.

27. 27. The pharmaceutical composition of claim 26, wherein the nanoparticles have a Z-average size of 46 nm and a polydispersity index (PDI) of 0.

097.

28. 28. The pharmaceutical composition of claim 26 or 27, wherein the nanoparticles encapsulate a nucleic acid active pharmaceutical ingredient.

29. 29. A pharmaceutical solution comprising the solvents ethanol and water for injection, comprising sucrose, 2-hydroxypropyl-β-cyclodextrin, a buffer, and a suspension of the pharmaceutical composition according to any one of claims 1 to 28.

30. 30. The pharmaceutical solution of claim 29, wherein the buffer is selected from an acetate buffer, a citrate buffer, and a phosphate buffer.

31. 31. The pharmaceutical solution of claim 30, wherein the buffer is selected from acetic acid and sodium acetate, citric acid and sodium citrate, and potassium dihydrogen phosphate and disodium hydrogen phosphate dihydrate.

32. 30. A pharmaceutical composition comprising a solid lyophilisate of the pharmaceutical solution of claim 29.

33. 33. The pharmaceutical composition of any one of claims 1 to 28 or 32, for treating or ameliorating one or more symptoms of lung cancer in a subject in need thereof.

34. The nucleic acid active pharmaceutical ingredient is API (26 / 52), which is an siRNA targeting GST-π having the following sequence: Sense strand SEQ ID NO:26 (5'→3'): GAAGCCUUUUGAGACCCUAUU; Antisense strand SEQ ID NO:52 (5'→3'): fUAGgGuCuCAAAAGGCUUCUU; wherein A, G, C and U represent ribo-A, ribo-G, ribo-C and ribo-U, respectively; lowercase a, u, g, c and t represent 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2'-deoxy-C and deoxythymidine, respectively (dT=T=t); the underline represents a 2'-OMe-substitution; and lowercase f represents a 2'-deoxy-2'-fluoro substitution; and the compound having formula II is compound A having the formula:

35. 31. A pharmaceutical product comprising a vial containing a lyophilized cake of the pharmaceutical solution of claim 30, wherein the headspace of said vial is filled with nitrogen gas.

36. 36. The pharmaceutical product of claim 35, wherein the lyophilized cake comprises sucrose, 2-hydroxypropyl-β-cyclodextrin, sodium acetate, and a lyophilized residue of the pharmaceutical composition.

37. 36. The pharmaceutical product of claim 35, wherein the lyophilized cake comprises 700 mg of sucrose, 467 mg of 2-hydroxypropyl-β-cyclodextrin, 2.7 mg of sodium acetate, and a lyophilized residue of the pharmaceutical composition.

38. 38. The pharmaceutical product of any one of claims 35 to 37, wherein said vial is a clear 20 mL USP Type I glass vial sealed with a barrier film stopper and a flip-off aluminum seal.

39. The nucleic acid active pharmaceutical ingredient is API (26 / 52), which is an siRNA targeting GST-π having the following sequence: Sense strand SEQ ID NO:26 (5'→3'): GAAGCCUUUUGAGACCCUAUU; Antisense strand SEQ ID NO:52 (5'→3'): fUAGgGuCuCAAAAGGCUUCUU; wherein A, G, C, and U represent ribo-A, ribo-G, ribo-C, and ribo-U, respectively; lowercase a, u, g, c, and t represent 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2'-deoxy-C, and deoxythymidine, respectively (dT=T=t); underline represents 2'-OMe-substitution; lowercase f represents 2'-deoxy-2'-fluoro substitution; and the compound having formula II is compound A having the formula:

40. 40. A kit comprising the pharmaceutical product of any one of claims 35 to 39 and instructions for reconstituting the lyophilized cake and administering the reconstituted formulation to a subject.

41. 41. The kit of claim 40, wherein the kit comprises a sterile diluent for reconstituting the lyophilized cake.

42. 41. The kit of claim 40, wherein the kit comprises an IV infusion bag.

43. A medicament for administration by injection comprising a reconstituted solution of a lyophilized cake of the pharmaceutical product of any one of claims 35 to 39 in a sterile diluent.

44. 44. The method of claim 43, wherein the diluent is a sodium acetate solution.

45. 44. The medicament of claim 43, wherein the diluent is Sodium Acetate Injection, USP.

46. 44. The drug of claim 43, wherein the concentration of the nucleic acid active pharmaceutical ingredient is 1.5 mg / mL or less.

47. The nucleic acid active pharmaceutical ingredient is API (26 / 52), which is an siRNA targeting GST-π having the following sequence: Sense strand SEQ ID NO:26 (5'→3'): GAAGCCUUUUGAGACCCUAUU; Antisense strand SEQ ID NO:52 (5'→3'): fUAGgGuCuCAAAAGGCUUCUU; wherein A, G, C and U represent ribo-A, ribo-G, ribo-C and ribo-U, respectively; lowercase a, u, g, c and t represent 2'-deoxy-A, 2'-deoxy-U, 2'-deoxy-G, 2'-deoxy-C and deoxythymidine, respectively (dT=T=t); the underline represents a 2'-OMe-substitution; and lowercase f represents a 2'-deoxy-2'-fluoro substitution; and the compound having formula II is compound A having the formula:

48. 48. The medicament of claim 47, wherein the medicament comprises a liposomal nanoparticle encapsulating the API (26 / 52).

49. The drug of claim 48, wherein the nanoparticles are between 30 nm and 100 nm in size.

50. The drug of claim 48, wherein the nanoparticles are between 45 nm and 65 nm in size.

51. 49. The drug of claim 48, wherein the nanoparticles have a PDI of less than 0.

30.

52. The drug of claim 48, wherein the average charge of the nanoparticles is between -10 and +10 mV.

53. 53. The medicament of any one of claims 43 to 52, further comprising one or more pharma- ceutically acceptable excipients.

54. 53. The medicament of any one of claims 43 to 52, further comprising a pharma- ceutically acceptable tonicity excipient.

55. 55. The medicament of claim 54, wherein the tonicity excipient is sucrose or 2-hydroxypropyl-β-cyclodextrin.

56. 56. The medicament of any one of claims 43-55, further comprising a pharma- ceutically acceptable pH adjusting excipient.

57. 57. The drug of claim 56, wherein the pH adjusting excipient is sodium hydroxide and the pH of the drug is between 5 and 6.

58. The medicament of any one of claims 43 to 57 for treating or ameliorating one or more symptoms of lung cancer in a subject in need thereof.

59. 59. The method of claim 58, wherein the drug is administered by parenteral infusion over a period of 30 to 120 minutes.

60. The drug of claim 58 or 59, wherein the administration reduces expression of GST-π in the subject by at least 5% for at least 5 days.

61. The medicament of any one of claims 58 to 60, wherein the administration is by intravenous injection, subcutaneous injection, intraperitoneal injection, intravenous infusion, or intraperitoneal infusion.

62. A pharmaceutical product described in any one of claims 35 to 39 for treating or ameliorating one or more symptoms of lung cancer.

63. Use of a pharmaceutical product described in any one of claims 35 to 39 in the manufacture of a medicament for treating or ameliorating one or more symptoms of lung cancer.

64. The pharmaceutical solution of any one of claims 29 to 31 for treating or ameliorating one or more symptoms of lung cancer in a subject in need thereof.

Images