Compositions and methods relating to nucleic acid anticoagulants

Abstract

The present disclosure provides compositions and methods relating to nucleic acid molecules having therapeutic aptamers. In particular, the present disclosure provides nucleic acid molecules comprising one or more aptamers with anticoagulant activity for the regulation of blood clotting in relation to disease and surgical intervention, as well as corresponding nucleic acid antidotes.

Description

Detailed Description of the Invention

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional Patent Application No. 62 / 750,900, filed October 26, 2018, which is incorporated herein by reference in its entirety for all purposes.

[0002] [Government funds] This invention was made with government support under Grant Numbers 1559077, 1603179, and 1709010 awarded by the National Science Foundation (NSF). The United States Government has certain rights in this invention.

[0003] [Incorporation by reference of electronically submitted material] Incorporated herein by reference in its entirety is a computer-readable nucleotide / amino acid sequence listing, submitted contemporaneously herewith, identified as follows: One 10,156 Byte ASCII (Text) file, named "37060-601_ST25.txt" (created October 25, 2019).

[0004] [Technical field] The present disclosure provides compositions and methods related to nucleic acid molecules having therapeutic aptamers.In particular, the present disclosure provides nucleic acid molecules that contain one or more aptamers with anticoagulant activity for the regulation of blood coagulation in disease and surgical intervention, as well as corresponding nucleic acid antidotes.

[0005] [Background technology] The coagulation cascade involves a series of enzymatic reactions that ultimately produce fibrin clots on ruptured blood vessels and cell surfaces. Anticoagulants disrupt the process of coagulation by blocking key players in the cascade. Regulation of fibrin clot formation by anticoagulants may consequently avoid thrombosis, the formation of blood clots, in vital organs such as the heart, lungs, and brain. Life-threatening consequences of thrombosis include stroke or transient ischemic attack, heart attack, deep vein thrombosis, and pulmonary embolism.

[0006] The most commonly prescribed anticoagulant is warfarin, a small molecule that is often used as a rodenticide. Warfarin is a vitamin K antagonist that inhibits the synthesis of blood clotting factors II, VII, IX, and X, as well as the synthesis of endogenous anticoagulant proteins C and S. The body's sensitivity to fluctuations in vitamin K requires close and timely monitoring of its concentration and adjusting the dosage accordingly. Other anticoagulants include heparin, factor Xa inhibitors, direct thrombin inhibitors, and fibrinolytics. A narrow therapeutic window for dosing that effectively treats coagulation without causing excessive anticoagulation, for example when anticoagulant dosages are too high during surgery, is consistent across all current anticoagulation methods. Unfortunately, there are no antidotes for chemically based anticoagulants that could further mediate dosing and combat cytotoxic effects.

[0007] Summary of the Invention An embodiment of the present disclosure provides a single-stranded nucleic acid molecule comprising at least one A-form double helix structure and at least one crossover region, at least one kissing loop region, and at least one nucleic acid aptamer having anticoagulant activity.

[0008] In some embodiments, the nucleic acid molecule comprises at least one tetraloop region. In some embodiments, the nucleic acid molecule is an RNA molecule or an RNA molecule comprising at least one nucleoside with a 2' modification.

[0009] In some embodiments, the single stranded nucleic acid molecule comprises at least one tetraloop region comprising a 4-nucleotide motif. In some embodiments, the single stranded nucleic acid molecule comprises 1-6 tetraloop regions each comprising a 4-nucleotide motif. In some embodiments, the single stranded nucleic acid molecule comprises at least one kissing loop region that is a 180° kissing loop region. In some embodiments, the single stranded nucleic acid molecule comprises one 180° kissing loop region.

[0010] In some embodiments, the single-stranded nucleic acid molecule comprises one to four aptamers having anticoagulant activity. According to these embodiments, each of the one to four aptamers replaces the tetraloop region.

[0011] In some embodiments, the nucleic acid molecule is an RNA molecule having at least 80% sequence identity to SEQ ID NO:1.

[0012] In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises thrombin inhibition. In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises inhibition of one or more of Factor XIIa, Factor XIIIa, Factor XIa, Factor IXa, Factor Xa, and von Willebrand factor. In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin RNA R9D-14T In some embodiments, the at least one nucleic acid aptamer comprises an anti-thrombin Toggle-25 tRNA aptamer or a derivative thereof.

[0013] In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 600 nucleotides.

[0014] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (2HO-RNA-12NN or 2HF-RNA-12NN) that comprises a nucleic acid aptamer capable of binding to exosite 1 of thrombin that replaces tetraloop region 1 of the RNA molecule, and a nucleic acid aptamer capable of binding to exosite 2 of thrombin that replaces tetraloop region 2 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity to SEQ ID NO:2.

[0015] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (2HO-RNA-1N2N or 2HF-RNA-1N2N) that comprises a nucleic acid aptamer capable of binding to exosite 1 of thrombin that replaces tetraloop region 1 of the RNA molecule, and a nucleic acid aptamer capable of binding to exosite 2 of thrombin that replaces tetraloop region 3 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity to SEQ ID NO:3.

[0016] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (2HO-RNA-2NN1 or 2HF-RNA-2NN1) that comprises a nucleic acid aptamer capable of binding to exosite 2 of thrombin that replaces tetraloop region 1 of the RNA molecule, and a nucleic acid aptamer capable of binding to exosite 1 of thrombin that replaces tetraloop region 4 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity to SEQ ID NO:4.

[0017] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (Fss12) comprising a nucleic acid aptamer capable of binding to exosite 2 of thrombin linked to one end of a single stranded RNA linker, and a nucleic acid aptamer capable of binding to exosite 1 of thrombin linked to the other end of the single stranded RNA linker. In some embodiments, the RNA molecule has at least 80% sequence identity to SEQ ID NO:5.

[0018] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (2H-2211) comprising two nucleic acid aptamers capable of binding to exosite 2 of thrombin, replacing tetraloop regions 1 and 2, respectively, of the RNA molecule, and two nucleic acid aptamers capable of binding to exosite 1 of thrombin, replacing tetraloop regions 3 and 4, respectively, of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity to SEQ ID NO:6.

[0019] In some embodiments, the single stranded nucleic acid molecule is a nucleic acid aptamer capable of binding to exosite 2 of thrombin that replaces tetraloop region 1 of the RNA molecule, a nucleic acid aptamer capable of binding to exosite 1 of thrombin that replaces tetraloop region 4 of the RNA molecule, and an RNA molecule (3H-2NN1) that comprises an A-form double helix structure that separates the nucleic acid aptamer capable of binding to exosite 2 of thrombin from the nucleic acid aptamer capable of binding to exosite 1 of thrombin. In some embodiments, the RNA molecule has at least 80% sequence identity to SEQ ID NO:7.

[0020] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (4H-2NN1) that comprises a nucleic acid aptamer capable of binding to exosite 2 of thrombin that replaces tetraloop region 1 of the RNA molecule, a nucleic acid aptamer capable of binding to exosite 1 of thrombin that replaces tetraloop region 4 of the RNA molecule, and two A-form double helix structures that separate the nucleic acid aptamer capable of binding to exosite 2 of thrombin from the nucleic acid aptamer capable of binding to exosite 1 of thrombin. In some embodiments, the RNA molecule has at least 80% sequence identity to SEQ ID NO:8.

[0021] In some embodiments, the nucleic acid aptamer capable of binding to exosite 1 of thrombin is an RNA R9D-14T Aptamer or derivative thereof In some embodiments, the nucleic acid aptamer capable of binding to exosite 2 of thrombin is a Toggle-25 tRNA aptamer or derivative thereof.

[0022] Embodiments of the present disclosure also include DNA molecules that encode any of the single stranded nucleic acid molecules described herein.

[0023] The embodiments of the present disclosure also include anticoagulant compositions. According to these embodiments, the compositions include a single-stranded nucleic acid molecule comprising at least one A-type double helix structure, at least one crossover region, at least one tetraloop region, at least one kissing loop region, and at least one nucleic acid aptamer having anticoagulant activity, and a pharma- ceutically acceptable excipient, solvent, carrier, or diluent.

[0024] The embodiments of the present disclosure also include a system for regulating coagulation. According to these embodiments, the system includes any of the single-stranded nucleic acid molecules described herein and at least one single-stranded nucleic acid antidote capable of binding to at least a portion of any of the single-stranded nucleic acid molecules described herein and preventing the anticoagulant activity of these single-stranded nucleic acid molecules.

[0025] In some embodiments, at least one nucleic acid antidote is a DNA molecule, an RNA molecule, an O-methyl RNA molecule, a fluoro-modified RNA molecule, a PNA molecule, an LNA molecule, or a combination thereof or a derivative thereof.In some embodiments, at least one nucleic acid antidote binds to at least a portion of any of the single-stranded nucleic acid molecules described herein in a reverse complementary manner.In some embodiments, at least one nucleic acid antidote binds to at least one nucleic acid aptamer of any of the single-stranded nucleic acid molecules described herein and prevents anticoagulant activity.

[0026] BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 contains a schematic diagram of the coagulation cascade and the corresponding enzymes targeted by anticoagulants. Thrombin plays a key role in coagulation by catalyzing the cleavage of fibrinogen, upstream coagulation factors, and platelet receptors. The catalytic active site and two extended surfaces of thrombin, called exosites, are involved in macromolecular ligand binding and can be blocked using chemical and biologically based molecules to prevent clotting. Control of thrombin activity in the coagulation cascade provides therapeutic, surgical, and clinical benefits.

[0027] Figures 2A-2E include representative depictions of nucleobase aptamers with anticoagulant activity. Figure 2A includes the tertiary structure of thrombin, including the locations of exosite 1 and exosite 2. Figures 2B-2E include examples of DNA and RNA aptamers used as anticoagulants for the specific inhibition of thrombin activity. RNA R9D-14T (Figure 2B) and Toggle-25t (Figure 2C) RNA aptamers bind to exosite 1 and exosite 2 of thrombin, respectively. DNA aptamers NU172 (Figure 2D) and HD22 (Figure 2E) bind to exosite 1 and exosite 2 of thrombin, respectively.

[0028] FIG. 3 shows the crystal structure of the Toggle-25 tRNA aptamer bound to exosite 2 of thrombin.

[0029] 4 is an exemplary image of an RNA origami bound to thrombin (not to scale). The RNA origami structure comprises a double helix structure.

[0030] Figures 5A-5B include representative images of an RNA molecule with an A-form duplex structure (Figure 5A) and a 180° kissing loop (Figure 5B).

[0031] Figures 6A-6B contain representative images of the tetraloop before (Figure 6A) and after (Figure 6B) extraction from the larger structure. The red circle indicates the tetraloop in the larger structure.

[0032] Figures 7A-7B contain representative images of the exosite 2 thrombin aptamer before (Figure 7A) and after (Figure 7B) extraction from the larger structure. The red circles indicate the tetraloops within the larger structure.

[0033] Figures 8A-8B include representative images of the double helices after they have been aligned to form a crossover (Figure 8A; the top helix is ​​helix 1 and the bottom helix is ​​helix 2). The phosphate atoms and the backbone and side (sugar / base) where the crossover is located are identified in red and yellow, respectively. Figure 8B includes a representative side view of the RNA structure with all the motifs aligned into a helix. The motif in the top left is the RNA thrombin aptamer.

[0034] FIG. 9 is a 3D representation of the ligation structure of a double-stranded RNA origami molecule containing an RNA aptamer.

[0035] Figure 10 is a representative illustration of an RNA origami molecule (top) being transcribed from a 2D model into a text file (bottom).

[0036] Figures 11A-11B include representative depictions of RNA origami sequences. Figure 11A includes a representative depiction of the text file after passing through the trace script, with the red box highlighting the outputted code that can be presented to NUPACK, which then provides the RNA sequence. Figure 11B includes a representative depiction of the RNA sequence output by NUPACK; the NED is also provided (generally, the sequence with the lowest NED is selected for analysis).

[0037] Figures 12A-12B include representative depictions of a 3D diagram (Figure 12A) and a 2D ribbon model (Figure 12B) of a double-stranded RNA origami without an RNA aptamer (2HO-RNA-NNNN). The numbers represent the four positions on the RNA origami molecule that may contain an RNA aptamer. The tetraloop is represented by a yellow box and the kissing loop is indicated by a green box.

[0038] Figures 13A-13D include representative 2D models of four designs of RNA origami containing two aptamers: Figure 13A shows 2HO-RNA-NNNN (SEQ ID NO: 1), Figure 13B shows 2HO-RNA-12NN (SEQ ID NO: 2), Figure 13C shows 2HO-RNA-1N2N (SEQ ID NO: 3), and Figure 13D shows 2HO-RNA-2NN1 (SEQ ID NO: 4).

[0039] Figures 14A-14C contain a representative 2D model of 2HO-RNA-NNNN (A), and computational simulations of RNA folding analyzed by mfold (B) and NUPACK (C). The tetraloop and kissing loop are indicated by yellow and green boxes, respectively.

[0040] Figure 15A-15C includes a representative 2D model of 2HO-RNA-12NN (A), and computational simulations of RNA folding analyzed by mfold (B) and NUPACK (C). The tetraloop and kissing loop are shown in yellow and green boxes, respectively. Exosite 1- and 2-binding RNA aptamers are represented by purple and blue rectangles, respectively.

[0041] Figures 16A-16C include a representative 2D model of 2HO-RNA-1N2N (A), and computational simulations of RNA folding analyzed by mfold (B) and NUPACK (C). The tetraloop and kissing loop are shown in yellow and green boxes, respectively. Exosite 1- and 2-binding RNA aptamers are represented by purple and blue rectangles, respectively.

[0042] Figure 17A-17C includes a representative 2D model of 2HO-RNA-2NN1 (A), and computational simulations of RNA folding analyzed by mfold (B) and NUPACK (C). The tetraloop and kissing loop are shown in yellow and green boxes, respectively. Exosite 1- and 2-binding RNA aptamers are represented by purple and blue rectangles, respectively.

[0043] Figure 18 includes representative images characterizing DNA template amplification using a 1% agarose gel run at 150 V for 30 min. 1 kb ladder (lanes 1 and 5), 2H-DNA-NNNN (lane 2), 2H-DNA-12NN (lane 3), 2H-DNA-1N2N (lane 4), and 2H-DNA-2NN1 (lane 6).

[0044] Figure 19 contains representative images of the difference between transcription with and without the new DTT. Native T7 RNA polymerase from New England Biolab was used for transcription of the unmodified RNA structures.

[0045] Figure 20 includes representative images of RNA origami run on a 6% denaturing acrylamide gel for 1 hour at 20 W. 1 kb ladder (lane 1), 2HO-RNA-NNNN (lane 2), 2HF-RNA-NNN (lane 3), 2HO-RNA-2NN1 (lane 4), 2HF-RNA-2NN1 (lane 5), 2HO-RNA-1N2N (lane 6), and 2HF-RNA-1N2N (lane 7).

[0046] Figure 21 includes representative images of RNA origami run on a 6% denaturing acrylamide gel for 1 hour at 20 W. 1 kb ladder (lane 1), 2HO-RNA-1N2N, 279 nt (lane 2), 2HO-RNA-NNNN, 210 nt (lane 3), 1 kb ladder (lane 4), 2HF-RNA-2NN1, 285 nt (lane 5), 2HF-RNA-1N2N, 279 nt (lane 6), 2HF-RNA-12NN, 279 nt (lane 7), and 2HF-RNA-NNNN, 210 nt (lane 8).

[0047] Figure 22 includes representative images of RNA origami run on a 6% native acrylamide gel for 3 hours at 150 V. DNA markers, GeneRuler Ultra Low Range DNA Ladder (left lane) and 2HO-RNA-2NN1 (right lane).

[0048] Figure 23 includes representative results of an anticoagulation study comparing the mean clotting times of 2'-fluoro-modified free aptamer, unmodified RNA origami (2HO-RNA), 2'-fluoro-modified RNA origami (2HF-RNA), and DNA woven tiles (2HT-DNA) using the aPTT assay. Error bars are standard deviation (N=3).

[0049] Figure 24 includes representative images of the results of acrylamide gel electrophoresis of RNA origami-thrombin complexes: nucleic acid stained gel (left) and protein stained gel (right).

[0050] Figure 25 includes representative images of acrylamide gel electrophoresis results of specificity testing of thrombin aptamer contained in RNA origami with four different proteins by gel electrophoretic mobility shift assay. Lane 1: DNA marker, lane 2: 2HF-RNA-NNNN, lanes 3-6: 2HF-RNA-NNNN incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel.

[0051] Figure 26 includes representative images of acrylamide gel electrophoresis results of specificity testing of thrombin aptamers contained in RNA origami with four different proteins. Lane 1: DNA marker, lane 2: 2HF-RNA-12NN, lanes 3-6: 2HF-RNA-12NN incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel.

[0052] Figure 27 includes representative images of acrylamide gel electrophoresis results of specificity testing of thrombin aptamers contained in RNA origami with four different proteins. Lane 1: DNA marker, lane 2: 2HF-RNA-1N2N, lanes 3-6: 2HF-RNA-1N2N incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel.

[0053] Figure 28 includes representative images of acrylamide gel electrophoresis results of specificity testing of thrombin aptamers contained in RNA origami with four different proteins. Lane 1: DNA marker, lane 2: 2HF-RNA-2NN1, lanes 3-6: 2HF-RNA-2NN1 incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel.

[0054] Figure 29 includes representative results of a binding assay between the thrombin DNA aptamer contained in the DNA weave tile and thrombin. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel.

[0055] Figures 30A-30B contain representative results of stability testing of modified (A) and unmodified (B) RNA origami treated with 10 ug / ml of RNase A. Samples were characterized by denaturing gel electrophoresis.

[0056] Figures 31A-31B contain representative results of stability testing of modified (A) and unmodified (B) RNA origami treated with high concentrations of RNase A (500ug / ml). Samples were characterized by denaturing gel electrophoresis.

[0057] Figures 32A-32B include representative results of a stability study of modified RNA origami (2HF-RNA-2NN1) stored in human plasma for 10 min to 24 h. Modified RNA origami (A) was stored with human plasma at 37 °C for 4 h. 2HF-RNA-2NN1 origami (B) was stored in human plasma for 10 min to 24 h. The control is 2HF-RNA-2NN1 stored in 1x buffer at 37 °C for 24 h.

[0058] Figure 33 contains representative results of a stability study of unmodified RNA origami (2HO-RNA-2NN1) stored in human plasma at 37 °C for 10 min to 24 h.

[0059] FIG. 34 contains representative results of a stability study of DNA woven tiles (2HT-DNA-PNNB) stored in human plasma at 37° C. for 10 minutes to 24 hours.

[0060] Figures 35A-35C contain representative 2D models of four designs of RNA origami containing two aptamers (Fss12; A) on a 31-nucleotide single-stranded RNA linker. Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B-C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively.

[0061] Figures 36A-36C contain representative 2D models of four designs of RNA origami containing four aptamers (2H-RNA-2211; A). Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B-C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, while green rectangles indicate kissing loop motifs.

[0062] Figures 37A-37C contain representative 2D models of four designs of RNA origami (3H-RNA-2NN1; A) containing two aptamers and three A-form duplex structures. Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B-C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, while yellow and green rectangles indicate tetraloop and kissing loop motifs, respectively.

[0063] Figures 38A-38C contain representative 2D models of four designs of RNA origami (4H-RNA-2NN1; A) containing two aptamers and four A-form duplex structures. Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B-C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, while yellow and green rectangles indicate tetraloops and kissing loops, respectively.

[0064] Figure 39 includes representative images characterizing DNA template amplification: Lanes 1 and 8: DNA marker, lane 2: Fss12, lane 3: 2H-DNA-NNNN, lane 4: 2H-DNA-2NN1, lane 5: 2H-DNA-2211, lane 6: 3H-DNA-2NN1, and lane 7: 4H-DNA-2NN1.

[0065] Figure 40 includes representative images characterizing RNA origami by denaturing acrylamide gel electrophoresis. Lanes 1 and 8: ssRNA marker, lane 2: 31 nt-linked aptamer (Fss12), lane 3: 2 HF-RNA-NNNN, lane 4: 2 HF-RNA-2NN1, lane 5: 2 HF-RNA-2211, lane 6: 3 HF-RNA-2NN1, lane 7: 4 HF-RNA-2NN1.

[0066] Figures 41A-41D include representative images characterizing RNA origami with aptamer binding to thrombin by 6% native acrylamide gel electrophoresis. RNA origami was incubated with thrombin for 1 hour at 37°C prior to characterization (A). Gels in (A) and (B) are the same gel and run at 150V for 3 hours. Gels (C) and (D) are the same gel and run at 150V for 6 hours. Nucleic acid stain gel, ethidium bromide (A and C). Protein stain gel, Coomassie blue (B and D). Negative and positive signs indicated the absence and presence of thrombin, respectively.

[0067] Figures 42A-42B include representative images of specific binding studies of two aptamers (Fss12) linked by 31 nt with four different proteins by native acrylamide gel electrophoresis. Lane 1: Fss12. Lane 2: Fss12 incubated with thrombin. Lane 3: Fss12 incubated with factor IXa. Lane 4: Fss12 incubated with factor Xa, and lane 5: Fss12 incubated with BSA. 6% native PAGE gels were run at 150 for 3 hours. Nucleic acid stained gel, ethidium bromide (A). Protein stained gel, Coomassie blue (B). (A) and (B) are the same gel.

[0068] Figures 43A-43B include representative images of specific binding studies of 2HF-RNA-2211 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 2HF-RNA-2211. Lane 2: 2HF-RNA-2211 incubated with thrombin. Lane 3: 2HF-RNA-2NN1 incubated with factor IXa. Lane 4: 2HF-RNA-2211 incubated with factor Xa, and Lane 5: 2HF-RNA-2211 incubated with BSA. 6% native PAGE gels were run at 150 for 3 hours. Nucleic acid stain gel, ethidium bromide (A). Protein stain gel, Coomassie blue (B). (A and B). (A) and (B) are the same gel.

[0069] Figures 44A-44B include representative images of specific binding studies of 3HF-RNA-2NN1 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 3HF-RNA-2NN1. Lane 2: 3HF-2NN1 incubated with thrombin. Lane 3: 3HF-RNA-2NN1 incubated with factor IXa. Lane 4: 3HF-RNA-2NN1 incubated with factor Xa, and Lane 5: 3HF-RNA-2NN1 incubated with BSA. 6% native PAGE gels were run at 150 for 6 hours. Nucleic acid stained gel, ethidium bromide (A). Protein stained gel, Coomassie blue (B). (A) and (B) are the same gel.

[0070] Figures 45A-45B include representative images of specific binding studies of 4HF-RNA-2NN1 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 2HF-RNA-4NN1. Lane 2: 4HF-RNA-2NN1 incubated with thrombin. Lane 3: 4HF-RNA-2NN1 incubated with factor IXa. Lane 4: 2HF-RNA-4NN1 incubated with factor Xa, and Lane 5: 4HF-RNA-2NN1 incubated with BSA. 6% native PAGE gels were run at 150 for 6 hours. Nucleic acid stained gel, ethidium bromide (A). Protein stained gel, Coomassie blue (B). (A) and (B) are the same gel.

[0071] Figure 46 contains representative results testing long-term storage of RNA origami. The average anticoagulant activity of freshly prepared 2HF-RNA-2NN1 samples is compared to samples stored at 4°C for up to 90 days. The results demonstrate that the RNA origami anticoagulant is stable and active for at least 3 months after storage at 4°C.

[0072] Figure 47 includes representative results of the anticoagulant activity of free aptamers, ssRNA-linked aptamers, and RNA origamis containing aptamers, tested by aPTT assay. All designs of anticoagulants are at a final concentration of 500 nM, except for 2HF-RNA-2211, which has a final concentration of 400 nM. The results demonstrate that the anticoagulant activity of two aptamers linked with ssRNA (Fss12) is higher than the free aptamer and the mixture of free aptamers. Furthermore, the anticoagulant activity of the two aptamers contained in the RNA origami (2HF-RNA-2NN1) is greater than the ssRNA-linked aptamer (Fss12). Furthermore, the RNA origami containing four aptamers (2HF-RNA-2211) shows the highest anticoagulant activity (more than twice the activity of 2HF-RNA-2NN1).

[0073] Figure 48 includes representative results testing the concentration-dependent clotting time of RNA origami containing two (2HF-RNA-2NN1) and four (2HF-RNA-2211) RNA aptamers. For 2HF-RNA-2211 at a concentration of 400 nM, the clotting time reached the maximum limit (999 seconds measured using a coagulometer). Surprisingly, the anticoagulant activity of 2HF-RNA-2211 (4 aptamers) is more than twice that of 2HF-RNA-2NN1 (2 aptamers).

[0074] Figure 49 includes representative results testing the anticoagulant activity of RNA origamis containing two RNA aptamers (2NN1) and two (2HF), three (3HF), or four (4HF) helical structures. The results show that 2HF, 3HF, and 4HF RNA origamis containing two RNA aptamers all exhibit anticoagulant activity.

[0075] 50A-50B include representative results of reversal of thrombin inhibition, showing clotting time (A) and anticoagulant activity (B).

[0076] Figure 51 contains representative results testing the reversal of thrombin activity by the addition of DNA or PNA antidote. The anticoagulant activity of 2HF-2NN1 origami anticoagulant was used as a control sample. DNA or PNA antidote (9 equiv.) was incubated with RNA origami. The inhibitory activity of PNA antidote was higher than that of DNA antidote.

[0077] Detailed Description The embodiments of the present disclosure provide nucleic acid-based anticoagulants that combine RNA aptamers with RNA origami structures produced as 2'-fluoro-modified transcripts. The new anticoagulants disclosed herein have demonstrated activity many times higher than free aptamers. The single molecule construct is advantageous for use as a surgical anticoagulant, being of sufficiently high molecular weight to greatly reduce rapid renal clearance. The nucleic acid anticoagulants disclosed herein will have fewer severe side effects compared to currently used small molecule blood thinners. Additionally, embodiments of the present disclosure include nucleic acid antidotes made from complementary DNA that prevent anticoagulant activity.

[0078] Nucleic acid therapeutics represent an alternative solution to current pharmaceutical anticoagulants (Figures 2A-2E and Figure 3). DNA and RNA aptamers can adopt structures that bind to specific target molecules and have been developed to bind thrombin and disrupt the coagulation cascade. Their advantages include better biocompatibility to minimize side effects, a better therapeutic window, and the availability of antidotes. Antidotes include natural nucleic acids (DNA / RNA) or non-natural nucleic acids (such as PNA) that are complementary to the aptamer to which the aptamer can be deployed. This brings advantages to clinical applications that require rapid and robust anticoagulant therapy. However, due to their small size (less than 30 KDa), these aptamers have poor pharmacokinetics and they are rapidly cleared by the kidney after circulation, thus requiring more concentrated dosages to be effective.

[0079] An embodiment of the present disclosure includes a novel functional RNA origami that can bind thrombin and prevent coagulation (Figure 4). In one embodiment, two aptamers were decorated on the RNA origami to increase the binding affinity by increasing the local concentration of the RNA aptamer, lowering the required dosage. The biocompatibility of RNA and the availability of antidotes may also enable precise treatment while minimizing negative side effects. The circulation of RNA origami in the human body is longer than free aptamers due to its higher molecular weight (e.g., greater than 80 kDa). The RNA origami anticoagulant composition and system of the present disclosure provide a viable alternative to current clinical anticoagulants by providing a more controllable solution with fewer side effects.

[0080] The section headings used in this section and throughout this disclosure are for organizational purposes only and are not intended to be limiting.

[0081] 1.Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. In case of conflict, the present specification, including definitions, shall prevail. Preferred methods and materials are described below, but similar or equivalent methods and materials to those described herein can be used in the practice or testing of this disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods and examples disclosed herein are illustrative only and are not intended to be limiting.

[0082] The terms "comprise(s)", "include(s)", "having", "has", "can", "contain(s)", and variations thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not exclude the possibility of additional acts or structures. The singular forms "a", "and", and "the" include plural references unless the context clearly dictates otherwise. The present disclosure also acknowledges other embodiments that "comprise", "consist of", and "consist essentially of" the embodiments or elements presented herein, whether or not expressly stated.

[0083] With respect to the recitation of numerical ranges herein, each intervening number therebetween, with the same degree of precision, is expressly acknowledged, for example, for the range 6 to 9, the numbers 7 and 8 are acknowledged in addition to 6 and 9, and for the range 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly acknowledged.

[0084] With respect to the recitation of numerical ranges herein, each intervening number therebetween, with the same degree of precision, is expressly acknowledged, for example, for the range 6 to 9, the numbers 7 and 8 are acknowledged in addition to 6 and 9, and for the range 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly acknowledged.

[0085] As used herein, "correlates with" refers to a comparison.

[0086] The term "aptamer" generally refers to either a single oligonucleotide of a defined sequence, or a mixture of said oligonucleotides, where the mixture retains the property of specifically binding to target molecules.Therefore, as used herein, "aptamer" refers to both single and multiple sequences of oligonucleotides.The term "aptamer" generally refers to single-stranded or double-stranded nucleic acid that can bind to proteins or other molecules, thereby interfering with the function of proteins or other molecules.

[0087] The term "single-stranded" oligonucleotide generally refers to an oligonucleotide that comprises a single covalently linked series of nucleotide residues.

[0088] The term "oligomer" or "oligonucleotide" includes RNA or DNA sequences of two or more nucleotides in either single-stranded or double-stranded form, specifically including short sequences such as dimers and trimers that can be intermediates in the production of specific binding oligonucleotides in either single-stranded or double-stranded form. The "modified" forms used in the candidate pool contain at least one non-native residue. "Oligonucleotide" or "oligomer" is generic to polydeoxyribonucleotides such as DNA (containing 2'-deoxy-D-ribose or modified forms thereof), polyribonucleotides such as RNA (containing D-ribose or modified forms thereof), and any other type of polynucleotide that is an N- or C-glycoside of a purine or pyrimidine base, or a modified purine or pyrimidine base, or an abasic nucleotide. "Oligonucleotide" or "oligomer" can also be used to refer to artificially synthesized polymers similar to RNA and DNA, including but not limited to peptide nucleic acid (PNA) oligos.

[0089] An "RNA aptamer" is an aptamer that includes ribonucleoside units, and "RNA aptamer" is also meant to encompass RNA analogs as disclosed herein.

[0090] The term "clotting factor" generally refers to a factor that acts in either or both of the intrinsic and extrinsic coagulation cascades.

[0091] The terms "RNA analog" or "RNA derivative" or "modified RNA" generally refer to polymeric molecules that, in addition to containing ribonucleosides as their units, also contain at least one of the following: 2'-deoxy, 2'-halo (including 2'-fluoro), 2'-amino (preferably unsubstituted, or mono- or di-substituted), 2'-mono-, di-, or tri-halomethyl, 2'-O-alkyl, 2'-O-halo substituted alkyl, 2'-alkyl, azido, phosphorothioate, sulfohydryl, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine, 2,6-diaminopurine, 2-hydroxy-6-mercaptopurine, and pyrimidine bases substituted at the 6-position with sulfur or at the 5-position with halo or C. 1-5 Alkyl-substituted pyrimidine bases, basic linkers, 3'-deoxy-adenosine, and other "chain terminators" or "non-extendable" analogs (at the 3'-end of RNA); 32 P, 33 Labels such as P and the like. All of the above can be incorporated into RNA using standard synthetic techniques as disclosed herein.

[0092] The terms "binding activity" and "binding affinity" generally refer to the tendency of a ligand molecule to bind or not bind to a target.The energetics of these interactions are important in "binding activity" and "binding affinity" because they can include the definition of the concentration of interacting partners, the rate at which these partners can associate, and the relative concentrations of bound and free molecules in solution.

[0093] "Sequence identity" refers to the degree to which two polymeric sequences (e.g., peptides, polypeptides, nucleic acids, etc.) have the same sequential monomer subunit composition. The term "sequence similarity" refers to the degree to which two polymeric sequences (e.g., peptides, polypeptides, nucleic acids, etc.) have similar polymeric sequences. For example, similar amino acids share the same biophysical properties and can be classified into, for example, acidic (e.g., aspartic acid, glutamic acid), basic (e.g., lysine, arginine, histidine), non-polar (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) and uncharged polar (e.g., glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) families. "Percent sequence identity" (or "percent sequence similarity") is calculated by: (1) comparing two optimally aligned sequences over a comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a particular window); (2) determining the number of positions that contain identical (or similar) monomers (e.g., the same amino acid occurs in both sequences, similar amino acids occur in both sequences) to obtain the number of matching positions; (3) dividing the number of matching positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a particular window); and (4) multiplying the result by 100 to obtain the percent sequence identity or percent sequence similarity. For example, if peptides A and B are both 20 amino acids in length and have identical amino acids at all but position 1, then peptide A and peptide B have 95% sequence identity. If the amino acids at non-identical positions share the same biophysical properties (e.g., both were acidic), then peptide A and peptide B have 100% sequence similarity. As another example, if peptide C is 20 amino acids in length and peptide D is 15 amino acids in length, and 14 of the 15 amino acids of peptide D are identical to those portions of peptide C, then peptides C and D have 70% sequence identity, but peptide D has 93.3% sequence identity over the optimal comparison window of peptide C.For purposes of calculating "percent sequence identity" (or "percent sequence similarity") herein, any gap in the aligned sequences is treated as a mismatch at that position.

[0094] The embodiments of the present disclosure provide a single-stranded nucleic acid molecule having an A-type double helix structure and at least one crossover region, at least one kissing loop region, and at least one nucleic acid aptamer having anticoagulant activity.According to these embodiments, the single-stranded nucleic acid molecule can be a DNA molecule or an RNA molecule, or any derivative or combination thereof.

[0095] In some embodiments, the single stranded nucleic acid molecule may be an RNA molecule comprising at least one nucleoside with a 2'-modification. In some embodiments, the single stranded RNA origami molecule of the present disclosure may comprise at least one 2'-fluoro-dCTP or 2'-fluoro-dUTP, or one other nucleoside with a 2'-modification such as 2'-amino or 2'-O-methyl, or a chemical modification of the backbone phosphate group such as phosphorothioate.

[0096] In some embodiments, the single-stranded nucleic acid molecule comprises at least one tetraloop region comprising a 4-nucleotide motif. In some embodiments, the single-stranded nucleic acid molecule comprises one to three tetraloop regions, each comprising a 4-nucleotide motif. In some embodiments, the single-stranded nucleic acid molecule comprises one to four aptamers having anticoagulant activity. According to these embodiments, each of the one to four aptamers replaces one of the at least one tetraloop regions. In some embodiments, the single-stranded nucleic acid molecule does not comprise a tetraloop region.

[0097] In some embodiments, the single stranded nucleic acid molecule comprises at least one kissing loop region that is a 180° kissing loop region. In some embodiments, the single stranded nucleic acid molecule comprises one 180° kissing loop region. In some embodiments, the single stranded nucleic acid molecule does not comprise a kissing loop region.

[0098] In some embodiments, the single-stranded nucleic acid molecule comprises a single-stranded RNA linker region.In some embodiments, the nucleic acid aptamer can be linked to one or both ends of the single-stranded RNA linker region.In some embodiments, the single-stranded nucleic acid molecule does not comprise a kissing loop region and a tetraloop region.

[0099] In some embodiments, the single-stranded nucleic acid molecule comprises at least one helical structure (e.g., an A-form double helix structure). In some embodiments, the single-stranded nucleic acid molecule comprises at least two helical structures. In some embodiments, the single-stranded nucleic acid molecule comprises at least three helical structures. In some embodiments, the single-stranded nucleic acid molecule comprises at least four helical structures. In some embodiments, the single-stranded nucleic acid molecule comprises five or more helical structures. In some embodiments, the single-stranded nucleic acid molecule comprises at least one helical structure separating two or more nucleic acid aptamers. In some embodiments, the at least one helical structure separating two or more nucleic acid aptamers comprises at least one nucleic acid aptamer. In some embodiments, the at least one helical structure separating two or more nucleic acid aptamers does not comprise a nucleic acid aptamer.

[0100] In some embodiments, the nucleic acid molecule is an RNA molecule having at least 80% sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 85% sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 90% sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 95% sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 96% sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 97% sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 98% sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 99% sequence identity to SEQ ID NO:1.

[0101] In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises inhibition of one or more of Factor XIIa, Factor XIIIa, Factor XIa, Factor IXa, Factor Xa, and von Willebrand factor. In some embodiments, nucleic acid aptamers that can be included in the RNA origami molecules disclosed herein include any aptamer involved in regulating blood coagulation, including, but not limited to, ARC183 / HD1 (targets FIIa); HD22 (targets FIIa); HD1-22 (targets FIIa); Tog25 (targets FII); R9d14t (targets FII / FIIa); 11F7t (targets FXa); 16.3 (targets FVIIa); 7S-1 / 7S-2 (targets FVII); 9.3t (targets FIXa); R4cXII-1 (targets FXII / FXIIa); NU172 (targets thrombin); REG1 (targets FIX / FIXa); REG2 (targets FIX / FIXa); ARC1779 (targets von Willebrand factor); and ARC19499 (targets TFPI).

[0102] In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises thrombin inhibition. In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin RNA R9D-14T In some embodiments, the at least one nucleic acid aptamer comprises an anti-thrombin Toggle-25t RNA aptamer or a derivative thereof. In some embodiments, the nucleic acid aptamer capable of binding to exosite 1 of thrombin comprises an RNA R9D-14T Aptamer or derivative thereof In some embodiments, the nucleic acid aptamer capable of binding to exosite 2 of thrombin is a Toggle-25 tRNA aptamer or derivative thereof.

[0103] In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 1000 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 900 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 800 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 700 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 500 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 400 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 300 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 150 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 150 to about 500 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 150 to about 400 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 150 to about 300 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 225 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 250 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 500 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 450 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 400 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 350 nucleotides.

[0104] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (2HO-RNA-12NN or 2HF-RNA-12NN) that includes a nucleic acid aptamer that replaces tetraloop region 1 of the RNA molecule that can bind to exosite 1 of thrombin, and a nucleic acid aptamer that replaces tetraloop region 2 of the RNA molecule that can bind to exosite 2 of thrombin. In some embodiments, the RNA molecule has 80% sequence identity to SEQ ID NO:2. In some embodiments, the RNA molecule has at least 85% sequence identity to SEQ ID NO:2. In some embodiments, the RNA molecule has at least 90% sequence identity to SEQ ID NO:2. In some embodiments, the RNA molecule has at least 95% sequence identity to SEQ ID NO:2. In some embodiments, the RNA molecule has at least 96% sequence identity to SEQ ID NO:2. In some embodiments, the RNA molecule has at least 97% sequence identity to SEQ ID NO:2. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO:2. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:2.

[0105] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (2HO-RNA-1N2N or 2HF-RNA-1N2N) that includes a nucleic acid aptamer that replaces tetraloop region 1 of the RNA molecule that can bind to exosite 1 of thrombin, and a nucleic acid aptamer that replaces tetraloop region 3 of the RNA molecule that can bind to exosite 2 of thrombin. In some embodiments, the RNA molecule has 80% sequence identity to SEQ ID NO:3. In some embodiments, the RNA molecule has at least 85% sequence identity to SEQ ID NO:3. In some embodiments, the RNA molecule has at least 90% sequence identity to SEQ ID NO:3. In some embodiments, the RNA molecule has at least 95% sequence identity to SEQ ID NO:3. In some embodiments, the RNA molecule has at least 96% sequence identity to SEQ ID NO:3. In some embodiments, the RNA molecule has at least 97% sequence identity to SEQ ID NO:3. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO:3. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:3.

[0106] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (2HO-RNA-2NN1 or 2HF-RNA-2NN1) that includes a nucleic acid aptamer that replaces tetraloop region 1 of the RNA molecule that can bind to exosite 2 of thrombin, and a nucleic acid aptamer that replaces tetraloop region 4 of the RNA molecule that can bind to exosite 1 of thrombin. In some embodiments, the RNA molecule has 80% sequence identity to SEQ ID NO:4. In some embodiments, the RNA molecule has at least 85% sequence identity to SEQ ID NO:4. In some embodiments, the RNA molecule has at least 90% sequence identity to SEQ ID NO:4. In some embodiments, the RNA molecule has at least 95% sequence identity to SEQ ID NO:4. In some embodiments, the RNA molecule has at least 96% sequence identity to SEQ ID NO:4. In some embodiments, the RNA molecule has at least 97% sequence identity to SEQ ID NO:4. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO:4. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:4.

[0107] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (Fss12) comprising a nucleic acid aptamer capable of binding to exosite 2 of thrombin linked to one end of the single stranded RNA linker, and a nucleic acid aptamer capable of binding to exosite 1 of thrombin linked to the other end of the single stranded RNA linker. In some embodiments, the RNA molecule has 80% sequence identity to SEQ ID NO:5. In some embodiments, the RNA molecule has at least 85% sequence identity to SEQ ID NO:5. In some embodiments, the RNA molecule has at least 90% sequence identity to SEQ ID NO:5. In some embodiments, the RNA molecule has at least 95% sequence identity to SEQ ID NO:5. In some embodiments, the RNA molecule has at least 96% sequence identity to SEQ ID NO:5. In some embodiments, the RNA molecule has at least 97% sequence identity to SEQ ID NO:5. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO:5. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:5.

[0108] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (2H-2211) comprising two nucleic acid aptamers capable of binding to exosite 2 of thrombin, replacing tetraloop regions 1 and 2 of the RNA molecule, respectively, and two nucleic acid aptamers capable of binding to exosite 1 of thrombin, replacing tetraloop regions 3 and 4 of the RNA molecule, respectively. In some embodiments, the RNA molecule has 80% sequence identity to SEQ ID NO:6. In some embodiments, the RNA molecule has at least 85% sequence identity to SEQ ID NO:6. In some embodiments, the RNA molecule has at least 90% sequence identity to SEQ ID NO:6. In some embodiments, the RNA molecule has at least 95% sequence identity to SEQ ID NO:6. In some embodiments, the RNA molecule has at least 96% sequence identity to SEQ ID NO:6. In some embodiments, the RNA molecule has at least 97% sequence identity to SEQ ID NO:6. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO:6. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:6.

[0109] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule (3H-2NN1) comprising a nucleic acid aptamer capable of binding to exosite 2 of thrombin replacing tetraloop region 1 of the RNA molecule, a nucleic acid aptamer capable of binding to exosite 1 of thrombin replacing tetraloop region 4 of the RNA molecule, and an A-form double helix structure separating the nucleic acid aptamer capable of binding to exosite 2 of thrombin from the nucleic acid aptamer capable of binding to exosite 1 of thrombin. In some embodiments, the RNA molecule has 80% sequence identity to SEQ ID NO:7. In some embodiments, the RNA molecule has at least 85% sequence identity to SEQ ID NO:7. In some embodiments, the RNA molecule has at least 90% sequence identity to SEQ ID NO:7. In some embodiments, the RNA molecule has at least 95% sequence identity to SEQ ID NO:7. In some embodiments, the RNA molecule has at least 96% sequence identity to SEQ ID NO:7. In some embodiments, the RNA molecule has at least 97% sequence identity to SEQ ID NO:7. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:7.

[0110] In some embodiments, the single stranded nucleic acid molecule is an RNA molecule comprising a nucleic acid aptamer capable of binding to exosite 2 of thrombin replacing tetraloop region 1 of the RNA molecule, a nucleic acid aptamer capable of binding to exosite 1 of thrombin replacing tetraloop region 4 of the RNA molecule, and two A-form double helix structures separating the nucleic acid aptamer capable of binding to exosite 2 of thrombin from the nucleic acid aptamer capable of binding to exosite 1 of thrombin (4H-2NN1). In some embodiments, the RNA molecule has 80% sequence identity to SEQ ID NO:8. In some embodiments, the RNA molecule has at least 85% sequence identity to SEQ ID NO:8. In some embodiments, the RNA molecule has at least 90% sequence identity to SEQ ID NO:8. In some embodiments, the RNA molecule has at least 95% sequence identity to SEQ ID NO:8. In some embodiments, the RNA molecule has at least 96% sequence identity to SEQ ID NO:8. In some embodiments, the RNA molecule has at least 97% sequence identity to SEQ ID NO:8. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:8.

[0111] The embodiments of the present disclosure also include DNA molecules that code for any of the single-stranded nucleic acid molecules described herein.As will be recognized by those skilled in the art based on this disclosure, the DNA molecules that code for any of the single-stranded nucleic acid molecules described herein can be single-stranded or double-stranded, and can act as a template for generating any of the single-stranded nucleic acid molecules described herein.The DNA template can be part of an expression plasmid or other construct for in vivo and / or in vitro biochemical reactions.

[0112] The embodiments of the present disclosure also include anticoagulant compositions. According to these embodiments, the compositions include a single-stranded nucleic acid molecule that includes an A-type double helix structure and at least one crossover region, at least one kissing loop region, and at least one nucleic acid aptamer with anticoagulant activity, and a pharma- ceutically acceptable excipient, solvent, carrier, or diluent. In some embodiments, the single-stranded nucleic acid molecule further includes at least one tetraloop region. As will be recognized by those skilled in the art based on the present disclosure, the compositions can be administered to subjects or patients according to a treatment regimen to regulate blood clotting in the context of a surgical procedure and / or to treat a disease state.

[0113] The embodiments of the present disclosure also include a system for regulating coagulation. According to these embodiments, the system includes any of the single-stranded nucleic acid molecules described herein and at least one single-stranded nucleic acid antidote that can bind to at least a portion of any of the single-stranded nucleic acid molecules described herein and prevent the anticoagulant activity of these single-stranded nucleic acid molecules. As will be recognized by those skilled in the art based on the present disclosure, this system can be used to regulate blood coagulation in the context of surgical procedures and / or to treat subjects or patients according to a treatment plan for treating a disease state.

[0114] In some embodiments, at least one nucleic acid antidote is a DNA molecule, an RNA molecule, an O-methyl RNA molecule, a fluoro-modified RNA molecule, a PNA molecule, an LNA molecule, or a combination or derivative thereof.In some embodiments, at least one nucleic acid antidote binds to at least a portion of any of the single-stranded nucleic acid molecules described herein in a reverse complementary manner.In some embodiments, at least one nucleic acid antidote binds to at least one nucleic acid aptamer of any of the single-stranded nucleic acid molecules described herein to prevent anticoagulant activity.

[0115] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have the meanings commonly understood by those skilled in the art. For example, any terminology used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein, and nucleic acid chemistry and hybridization described herein is well known and commonly used in the art. The meaning and scope of the terms should be clear; however, in case of potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. Furthermore, unless otherwise required by context, singular terms shall include the plural, and plural terms shall include the singular.

[0116] 2. Design and Methods The embodiments of the present disclosure include methods for designing and generating single-stranded nucleic acid molecules including nucleic acid aptamers with various therapeutic functions, such as, but not limited to, anticoagulant activity. In some embodiments, the single-stranded nucleic acid molecules of the present disclosure include RNA molecules (RNA origami) including nucleic acid aptamers with anticoagulant activity. According to these embodiments, the present disclosure provides a general process for designing RNA origami, including (i) creating a 3D model, (ii) converting to a 2D model, (iii) creating a text file design from the 2D model, and (iv) analyzing the RNA sequence.

[0117] In some embodiments of RNA origami design, an RNA double helix A-type is used (Figures 5A-5B). The geometry of the helix contributes to determining where to place the double crossover. Multiple motifs can be used in this design. For example, the use of a kissing loop motif allows the multiple helical structure to be routed by a single strand. In some embodiments, a 180° kissing loop may be used. Additionally, a tetraloop motif may be used; a tetraloop is a small four nucleotide motif that caps the ends of a structure. The presence of a tetraloop may function to stabilize the overall structure of the RNA molecule.

[0118] According to the methods described herein, 3D models of RNA origami molecules can be created. For example, a 2-helical RNA origami structure was created and included a thrombin RNA aptamer. Bioinformatics software can be used to generate files for each of the motifs, including, but not limited to, the RNA duplex, the tetraloop, the 180° kissing loop, and the RNA thrombin aptamer. Generally, the file corresponding to the A-form RNA duplex is generated first, as it serves as the base for all other motifs. Next, a file corresponding to the 180° kissing loop (Figure 5B) is added, followed by a file corresponding to the tetraloop, which in some cases can be extracted from a larger file (Figures 6A-6B). Finally, files corresponding to the exosite 1 and exosite 2 RNA aptamers are added; again, in some cases, these files can be extracted from a larger source (Figures 7A-7B).

[0119] Once all motif files are obtained, they can be assembled and aligned using programs such as Chimera (cgl.ucsf.edu / chimera). For example, two A-form RNA helices can be aligned as shown in Figure 8A. The nucleotides where the crossovers are to be placed can then be identified using alternative coloring, etc., to facilitate visualization of where the crossovers should be placed. After the RNA helices are aligned, all motifs including tetraloops, kissing loops and RNA aptamers can be inserted into the alignment panel (Figure 8B). The next step involves converting this structure to a single-stranded structure, which can be done using various bioinformatics software (e.g., andersen-lab.dk), as shown in Figure 9.

[0120] The method of the present disclosure also includes converting the 3D model of the RNA origami molecule into a 2D model using the above file and an appropriate software program (e.g., Assemble2 software), as shown in Figure 10. The 2D model is then transcribed into a text file or similar format. To generate the nucleotide sequence of the single-stranded RNA origami molecule, use appropriate software (e.g., NUPACK.org), and then run the 2D test file through a trace script (e.g., Anderson-lab.dk). The output code from the trace script is shown in Figure 11A, and the generated out RNA sequence is shown in Figure 11B.

[0121] The disclosed method also includes analyzing the generated RNA sequence by software (e.g., NUPACK). NUPACK and mfold were used to test for proper folding of the RNA origami molecules. The sequence can be analyzed to select the optimal sequence that ensures proper sequence folding. For example, sequences with proper folding are generally those with low ΔG, GC% less than 65%, and low normalized ensemble defect (NED). The less secondary structure a sequence has, the more likely it is to fold properly. To optimize the sequence, manual editing of the sequence can be performed, including but not limited to changing the position of GC base pairing to remove unfavorable structures.

[0122] The embodiments of the present disclosure also include designs and methods for including nucleic acid aptamers in single-stranded nucleic acid origami molecules. The nucleic acid aptamers that may be included in the single-stranded RNA origami molecules of the present disclosure may be made from RNA, DNA, PNA, or any derivatives thereof. For example, as further described herein, the RNA origami molecules may include one or more nucleic acid aptamers, such as RNA aptamers that specifically bind to and regulate proteins involved in blood clotting. In some embodiments, the RNA aptamers exhibit anticoagulant activity by inhibiting one or more coagulation proteins, including, but not limited to, one or more of thrombin, factor XIIa, factor XIIIa, factor XIa, factor IXa, factor Xa, and von Willebrand factor. In some embodiments, the RNA aptamers exhibit antithrombin activity that prevents blood clotting and protects against conditions such as thrombosis. In some embodiments, the antithrombin RNA aptamer included in the single-stranded RNA origami molecules of the present disclosure is an RNA aptamer that binds prothrombin and thrombin at exosite 1. R9D-14T aptamer (A below), and the Toggle-25 aptamer (B below) that binds to exosite 2 of thrombin.

[0123] [ka]

[0124] Other nucleic acid aptamers that can be included in the RNA origami molecules disclosed herein include any aptamer involved in regulating blood coagulation, including, but not limited to, ARC183 / HD1 (targets FIIa); HD22 (targets FIIa); HD1-22 (targets FIIa); Tog25 (targets FII); R9d14t (targets FII / FIIa); 11F7t (targets FXa); 16.3 (targets FVIIa); 7S-1 / 7S-2 (targets FVII); 9.3t (targets FIXa); R4cXII-1 (targets FXII / FXIIa); NU172 (targets thrombin); REG1 (targets FIX / FIXa); REG2 (targets FIX / FIXa); ARC1779 (targets von Willebrand factor); and ARC19499 (targets TFPI).

[0125] To improve and optimize anticoagulant activity, we included one to four aptamers in the RNA origami molecule at four different positions. For example, a two-helical RNA origami (2HO-RNA-XXXX) provides four possible positions for the RNA aptamer, one aptamer for each tetraloop, as shown in Figures 12A-12B.

[0126] In some embodiments, it was determined that the binding activity of a duplex RNA aptamer included in an RNA origami molecule depends at least in part on the distance between the two aptamers and the flexibility of each aptamer at different positions on the RNA origami. In accordance with these embodiments, four configurations of RNA aptamers were designed by including them in the RNA origami, as shown in Figures 13A-13D. For the purposes of terminology, four digits were added after the specific RNA origami used, e.g., 2HO-RNA-XXXX (no aptamer; SEQ ID NO: 1). Depending on the aptamer and the configuration position, X can be replaced with a number or letter corresponding to the specific aptamer. For example, exosite 1 and exosite 2 binding RNA aptamers are referred to as "1" and "2", respectively. (No aptamer is defined as "N".) Thus, 2HO-RNA-1N2N refers to an exosite 1 binding aptamer placed at position 1 on a 2-helical RNA origami and an exosite 2 binding aptamer 2 tethered to position 3. All four designs are depicted in Figures 13A-13D. The 2HO-RNA-NNNN molecule was used as a negative control in subsequent experiments.

[0127] The folding of these RNA origami structures was computationally analyzed using online software (mfold; see unafold.rna.albany.edu) and NUPACK (see nupack.org), as shown in Figures 14-17. The structure of the kissing loops is not shown in the simulations.

[0128] According to these embodiments, the single-stranded RNA origami structure without aptamers is about 200 nucleotides in length, and when two aptamers are included in the RNA origami, it is about 500 nucleotides in length. As will be recognized by those skilled in the art based on the present disclosure, single-stranded RNA molecules with or without aptamers can be synthesized chemically, enzymatically, or using cell-based techniques. For example, T7 RNA polymerase can be used for RNA production via in vitro and in vivo transcription. In some embodiments, double-stranded DNA can be used as a template. For example, the DNA template can be engineered to include a blueprint for the RNA origami and a T7 promoter located at the 5' end of the sequence.

[0129] In some embodiments, both modified and unmodified RNA origami structures can be produced. For example, the single-stranded RNA origami molecules of the present disclosure can include at least one nucleoside with a 2'-modification. In some embodiments, the single-stranded RNA origami molecules of the present disclosure can include at least one 2'-fluoro-dCTP or 2'-fluoro-dUTP, or one other nucleoside with a 2'-modification such as 2'-amino or 2'-O-methyl, or a chemical modification of the backbone phosphate group such as phosphorothioate.

[0130] The above designs and methods are applicable to the construction of all nucleic acid molecules described herein, including those embodied in the Examples and Figures. As one of skill in the art will recognize based on this disclosure, the above designs and methods can also be used to generate variations of the nucleic acid molecules described herein, for example, with respect to desired functionality (e.g., antithrombin activity).

[0131] 3. Working Example It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the disclosed method described herein can be easily applied, recognized, and can be made using suitable equivalents without departing from the scope of the disclosure or the aspects and embodiments disclosed herein.Although the disclosure has been described in detail, the disclosure will be more clearly understood by referring to the following examples, which are intended to merely illustrate some aspects and embodiments of the disclosure, and should not be considered as limiting the scope of the disclosure.The disclosures of all journal references, US patents, and publications referenced herein are incorporated herein by reference in their entirety.

[0132] The present disclosure has multiple aspects, exemplified by the following non-limiting examples.

[0133] Example 1 Amplification of DNA templated from G-blocks by polymerase chain reaction (PCR). DNA sequences were amplified and used for transcription. Each sequence was double-stranded DNA and had a different aptamer arrangement, as shown in Figures 12-17 and 35-39. Sequences without aptamers were used as negative controls. DNA templates were amplified from G-blocks by PCR for in vitro production. All DNA sequences were successfully amplified with good transcription yields. Figures 18 and 39 show 1% agarose gels with clear bands of the correct size for all amplified DNA sequences. Each amplification typically produced approximately 30-60 ng / ul of DNA after purification.

[0134] Production of RNA origami from amplified DNA. RNA origami was then produced by transcription. Two types of RNA origami were produced: (i) unmodified RNA origami and (ii) modified RNA origami. To produce modified RNA origami, 2'-fluoro-dCTP and -dUTP were used instead of the normal CTP and UTP, and mutant T7 RNA polymerase (Y639F) was used instead of native T7 polymerase. The difference between RNA transcribed with and without DTT can be seen in Figure 19. DTT was then added to each transcription reaction.

[0135] Analysis of RNA origami structures based on size. Unmodified and modified RNAs were produced. All DNA sequences were transcribed into modified and unmodified RNAs, except for 2H-12NN. RNAs were labeled as "2HO-RNA-XXXX" for unmodified double-stranded RNAs with various aptamer configurations and "2HF-RNA-XXXX" for double-stranded modified RNAs with various aptamer configurations. RNA aptamers binding to exosites 1 and 2 were labeled "1" and "2", respectively. Figure 20 shows modified and unmodified RNA bands for NNNN, 2NN1, and 1N2N sequences run on a 6% denaturing acrylamide gel at 20W for 1 hour. Figure 21 shows unmodified transcripts for NNNN and 1N2N and modified transcripts for all four sequences. To achieve a sharper single band, a smaller amount of RNA was added to the gel in Figure 21 compared to Figure 20. Following thermal annealing, a native gel was run to characterize the folded structures. FIG. 22 shows an example of a 6% native acrylamide gel run at 150V for 3 hours with 2HO-RNA-2NN1 heat annealed samples and a 1 kb DNA ladder.

[0136] Experiments were also performed to characterize the nucleic acid constructs embodied in Figures 35-38. Figures 35A-35C include a representative 2D model of two aptamers (Fss12; Figure 35A) contained in a 31-nucleotide single-stranded RNA linker. Figures 36A-36C include a representative 2D model of an RNA origami containing four aptamers (2H-RNA-2211; Figure 36A). Figures 37A-37C include a representative 2D model of an RNA origami containing two aptamers and three A-form duplex structures (3H-RNA-2NN1; Figure 37A). Also, Figures 38A-38C include a representative 2D model of an RNA origami containing two aptamers and four A-form duplex structures (4H-RNA-2NN1; Figure 38A). Computational analysis of RNA origami folding for the above embodiments was analyzed using mfold RNA and NUPACK software. Purple and blue rectangles represent exosite-1 and exosite-2 binding aptamers, respectively, and yellow and green rectangles indicate tetraloop and kissing loop motifs, respectively.

[0137] Taken together, these results provide a wide degree of variability and flexibility for constructing effective nucleic acid-based anticoagulant therapeutics. Notably, these results also demonstrate the ability to produce both modified and unmodified RNA origami structures that bind exosites 1 and 2 of thrombin. This was done by amplification of DNA sequences, followed by transcription and thermal annealing to generate the RNA origami structures. As shown in Figures 12-17 and Figures 35-38, eight types of origami structures were produced, each with a different aptamer arrangement (or no aptamer as a control; see Figures 13A-13D), and each was characterized by gel electrophoresis. Fluoro-modified NTPs and mutant T7 polymerase were used to generate modified RNAs that are stable in plasma. In vitro production allows for the mass production of the structures, creating enough to trigger clotting in plasma.

[0138] Example 2 Anticoagulant activity. Clotting in human blood is the result of a complex series of reactions between various proteins in the blood, called the blood coagulation cascade (BCC). The aptamers used herein bind to thrombin, one of the proteins in the BCC. By binding to thrombin, the aptamers contained in the RNA origami inhibit the BCC and delay clotting. The origami uses two different aptamers to bind to exosites 1 and 2 on the thrombin protein, which prevents BCC. The relative inhibition of BCC can be tested using an aPTT assay in a coagulometer. The coagulometer measures the time it takes for clotting to occur after clotting is artificially induced using CaCl2. This method can be used to determine the coagulation modulating efficacy of the single-stranded nucleic acid molecules described herein.

[0139] For anticoagulation testing, four aptamer configurations for both DNA and RNA were tested on a Model ST4 coagulometer from Diagnostica Stago. The collected data obtained confirmed that no anticoagulant activity of unmodified RNA origami was found in all aptamer configuration designs, as 2HN RNA origami showed the same clotting time as standard buffer. These results also confirmed that unmodified RNA origami is unstable in human plasma. However, modified RNA origami showed remarkable activity compared to unmodified RNA tiles with clotting times of 150-260 seconds. Furthermore, DNA aptamers present on the tested DNA tiles showed the same anticoagulant activity trends as previously reported, with similar magnitude of activity. The activity of all tiles tested is shown in Figure 23.

[0140] The results demonstrated that the modified RNAs were as effective or better than the DNA tiles, with the data falling within the standard deviation. The 12NN, 1N2N, 2NN1 (Figures 23 and 48), and 2211 (Figures 47 and 48) RNA structures all showed significant anticoagulant activity, albeit to different degrees. The RNA origami tiles with RNA aptamers were preformed as well, if not better, than their DNA counterparts. The observed binding is also a further confirmation that the modified RNAs are stable in human plasma.

[0141] Example 3 Specificity Testing. In the complex environment of the coagulation cascade and human plasma, many proteins and small molecules are involved and present in blood. Therefore, specific binding of the capture molecule to its target is important. Thrombin contains two active sites for activation of the coagulation pathway known as exosites 1 and 2. To inhibit the activity of thrombin, a thrombin RNA aptamer was used, as further described herein. A functional RNA origami molecule was designed containing two aptamers that bind to thrombin to inhibit the coagulation process. To test the specificity of the thrombin-binding RNA origami, thrombin, factor IXa, and factor Xa, all involved in the coagulation cascade, were used with bovine serum albumin (BSA). The binding of the RNA origami-protein complex was characterized by gel electrophoretic mobility shift assay.

[0142] The binding complex of RNA thrombin aptamer contained in RNA origami (Th-RNA origami) with thrombin was tested using gel electrophoretic mobility shift assay. Eight designs of RNA origami (one without thrombin aptamer and seven designs containing thrombin aptamer) were examined. RNA origami without thrombin aptamer (2HF-RNA-NNNN) was unable to bind thrombin. All seven designs of thrombin-containing RNA origami (2HF-RNA-12NN, 1N2N, 2NN1, Fss12, 2HF-2211, 3HF-2NN1, and 4HF-2NN1) incubated with thrombin migrated slower than the RNA origami in the absence of thrombin (Figures 24 and 41). Furthermore, protein stained gels show that a smear pattern band of thrombin protein appears at the same position of the RNA-thrombin complex in the nucleic acid stained gel. These results demonstrate that RNA origami bearing the RNA thrombin aptamer binds to thrombin.

[0143] We performed specificity testing of Th-RNA origami with two proteins involved in the coagulation cascade (factor IXa and factor Xa) and one common protein (bovine serum albumin, BSA). To test the specificity, the RNA origami was incubated with the proteins for 1 h at 37 °C and characterized by native acrylamide gel electrophoresis. The non-aptamer present on the RNA origami (2HF-RNA-NNN) was unable to bind to all four proteins (Figure 25). All seven designs of RNA origami with RNA thrombin aptamer (2HF-RNA-12NN, 1N2N, 2NN1, Fss12, 2HF-2211, 3HF-2NN1, and 4HF-2NN1) show specificity to bind with thrombin, as the results shown in Figures 26-28 and Figures 42-45.

[0144] Furthermore, the specific binding of thrombin DNA aptamers decorated on DNA weave tiles with thrombin protein was also tested. 2-helix-DNA weave tiles (2HT) were used. For the DNA tiles, two aptamers, called "Apt-P" and "Apt-B", were extended on each design that bind to exosites 1 and 2 of thrombin. The DNA tile, called "NNNN", does not contain any aptamer. For the 2HT-DNA-BPNN construct, aptamers B and P were extended from positions 1 and 2 on the DNA weave tiles (Figure 29). These results demonstrate that no thrombin binding with 2HT-DNA-NNNN was observed.

[0145] The binding of 2HF-RNA and 2HT-DNA containing two and four aptamers with thrombin was evaluated using gel electrophoretic mobility shift assays. These results demonstrated that both RNA origamis and DNA weave tiles with aptamers specifically bound with thrombin. Furthermore, no nonspecific binding of RNA origamis with nonspecific targets (factor IXa, factor Xa, and factor BSA) was found (Figures 26-28 and 42-45).

[0146] As further described herein, the nucleic acid constructs embodied in Figures 35-38 demonstrate that effective anticoagulant activity was achieved using single-stranded RNA linked to an aptamer without tetraloop and kissing loop motifs (Figures 35A-35C) compared to the use of a double-stranded RNA origami platform having one or more of the tetraloop and kissing loop. Effective anticoagulant activity was also achieved using an RNA origami platform having four aptamers but no tetraloop (Figures 36A-36C). Furthermore, effective anticoagulant activity was also achieved using an RNA origami platform having two aptamers and two, three, or four helical structures separating the aptamers.

[0147] Example 4 Stability Testing. RNA is a functional biomolecule that plays a vital role in cell biology such as gene regulation. Although RNA is stable in cell physiological conditions, it generally has a short half-life in human plasma (see figure below). To use functional RNA for therapeutic purposes, RNA stability is one of the major challenges. 2' modification of ribose sugar has been widely used to improve the stability of RNA in nuclease conditions such as human plasma. It has been previously reported that 2'-fluoro- and 2'-amino modified nucleotides incorporated into ribozymes are resistant to ribonuclease degradation. Importantly, 2'-fluoro-dCTP and 2'-fluoro-dUTP did not affect the catalytic activity of the ribozyme. Therefore, 2'-fluoro-CTP and -UTP were selected as building blocks for the in vitro production of RNA origami.

[0148] [ka]

[0149] As shown above, (A) native nucleotide, cytidine-5'-triphosphate (CTP) and (B-D) modified nucleotides, (B) 2'-fluoro-2'-deoxycytidine-5'-triphosphate (2'F-dCTP), (C) 2'-amino-2'-deoxycytidine-5'-triphosphate (2'-amino-dCTP), and (D) 2'-O-methylcytidine-5'-triphosphate (2'-O-methyl-CTP). Cytosine, ribose sugar, triphosphate, and 2' modifications are shown as green, blue, orange, and yellow rectangles, respectively.

[0150] To test the stability of RNA origami in RNase A, unmodified and modified RNA origami were incubated with RNase A (10 and 500 μg / ml) at 37 °C for 10 min to 24 h. The integrity of the RNA origami was characterized by using denaturing gel electrophoresis (Figures 30-31). As the results show, unmodified RNA origami was degraded within 10 min in RNase A-containing solution (Figure 30B). 2'-Fluoro-CTP and 2'-Fluoro-UTP modified RNA origami are stable for at least 6 h in 10 μg / ml RNase A (Figure 30A). At a high concentration of RNase A (500 μg / ml), modified RNA origami was stable for 30 min as shown in Figure 31A.

[0151] For therapeutic applications, the stability of anticoagulants in human plasma is important. Human plasma contains multiple components such as DNases and RNases that degrade DNA and RNA structures. Here, we tested the resistance of RNA origamis and DNA tiles in pooled human plasma. Denaturing gel electrophoresis was used to characterize the integrity of the nucleic acid nanostructures. RNA origamis and DNA tiles were incubated with human plasma for various time points ranging from 10 min to 24 h. 2'-fluoro modified RNA origamis were stable in human plasma over 24 h, as shown in Figures 32A-32B. The intensity of the RNA that appeared in the top band in Figure 32A indicates some amount of RNA origami that still binds to thrombin in human plasma. Unmodified RNA origamis were degraded in less than 10 min (Figure 33). DNA weave tiles are stable in human plasma for 6 h (Figure 34). These results demonstrate that 2'-fluoro modified RNA origamis are more stable than DNA tiles in human plasma.

[0152] Native RNA origamis are degraded by ribonucleases in less than 10 minutes. To use functional RNA origamis in therapeutic applications, the stability of the RNA origamis is important. These results demonstrate that 2'-fluoro modified RNA origamis are stable in RNase A for at least 6 hours. Furthermore, the modified RNA origamis are stable in human plasma over 24 hours, which is more stable than DNA tiles. The stability of 2'-fluoro modified RNA origamis in human plasma over 24 hours demonstrates that RNA origamis are promising biomolecules for use in therapeutic applications.

[0153] The storage stability of the nucleic acid aptamer constructs of the present disclosure was also tested, as shown in FIG. 46. In one embodiment, the storage buffer used contained 20 mM HEPES (pH 7.4), 150 mM NaCl, and 2 mM CaCl2. As will be recognized by those of skill in the art based on this disclosure, the components of this storage buffer may vary by up to ±25%, depending on the conditions under which the aptamer constructs are stored. For example, as shown in FIG. 46, the average anticoagulant activity of freshly prepared 2HF-RNA-2NN1 samples was compared to samples stored at 4° C. for up to 90 days. The results demonstrate that the RNA origami anticoagulant is stable and active for at least 3 months after storage at 4° C.

[0154] According to these embodiments, the nucleic acid aptamer constructs of the present disclosure can be stored at temperatures ranging from room temperature to -20°C without significant loss of anticoagulant activity. In some embodiments, the nucleic acid aptamer constructs of the present disclosure can be dissolved directly in a storage buffer and / or lyophilized in water (e.g., ultrapure water) prior to long-term storage. In some embodiments, the nucleic acid aptamer constructs of the present disclosure are dissolved in a storage buffer, then dissolved in water, lyophilized, and stored. Prior to use, the nucleic acid aptamer constructs can be reconstituted and allowed to properly fold for a certain period of time (e.g., 30 minutes). In other embodiments, the nucleic acid aptamer constructs of the present disclosure can be allowed to properly fold in a storage buffer prior to lyophilization. Prior to use, water or a buffer can be added to dissolve the lyophilized construct, which will generally be functional and ready for use.

[0155] Example 5 Reversal of thrombin inhibition. Control of the coagulation cascade is beneficial in surgical and disease applications. Chemical-based anticoagulants have been developed and are frequently used, but due to their small therapeutic window (narrow concentration difference between therapeutic and toxic doses), patients must be constantly monitored to prevent dangerous side effects such as hemorrhage and bleeding. An alternative solution is nucleic acid-based anticoagulants, which never induce hemorrhage and can be stopped by available antidotes.

[0156] Antidotes for aptamer-based anticoagulants can be short strands of single-stranded nucleic acids (DNA and PNA) with nucleotide sequences complementary to the aptamer sequence. Previous studies have shown the reversal inhibition and reactivation of thrombin activity by the addition of ssDNA antidotes. This was also demonstrated with DNA aptamers on DNA tiles. RNA origami with RNA aptamers provides high anticoagulant activity compared to free aptamers (as demonstrated herein). Reversal of thrombin inhibition can be difficult due to the tight thrombin binding and the need to disrupt the stable folding of the aptamer. Here, recovery of coagulation activity was tested by adding antidotes that are complementary counterparts of exosite-1 and exosite-2 binding aptamers. This antidote mechanism for regulating the coagulation cascade may provide great benefits during medical procedures and disease treatment.

[0157] As shown in Figures 50A-50B, an antidote for 2HF-RNA-2NN1 was designed made from DNA for both aptamers. After incubating the RNA origami with plasma and other reagents for the aPTT assay, the antidote was added and the entire sample was incubated for an additional 5 min.

[0158] Antidote testing revealed a mean clotting time of approximately 85 seconds with 80% recovery (thrombin was still inhibited by 20%), so the data indicated that reversal of activity was possible with the addition of antidote. The incomplete reversal could be due to the antidote being less effective at strand entry into one of the two aptamers or due to differences in the concentration of antidote required to prevent thrombin binding. Furthermore, as shown in Figure 51, a peptide nucleic acid (PNA) antidote for 2HF-RNA-2NN1 was also effective, significantly more effective than its DNA-based counterpart.

[0159] 2HF-RNA-2NN1 origami has been shown to be effective in inhibiting and slowing clotting at concentrations as low as 0.5 μM. However, another advantage of RNA origami and RNA aptamer design is the easy implementation of antidotes to the aptamer, allowing, for example, surgeons to stop anticoagulation. Thrombin activity can be recovered by approximately 80% using a ssDNA antidote, or at least 80% using a PNA antidote, as demonstrated.

[0160] 4. Materials and Methods Amplification of G-block sequences was performed. Reaction buffer, forward and reverse primers, dNTPs, DNA polymerase and nuclease-free water were added to a PCR tube at the concentrations shown in Table 1. DNA polymerase was added last and the sample was mixed with a pipette.

[0161] [Table 1]

[0162] The samples were placed in a thermocycler and the following protocol was used for PCR:

[0163] [ka]

[0164] After PCR, a small amount of amplified DNA sample (approximately 2-5 μl) was used for testing in a 1% agarose gel. The DNA was run alongside a 1 kb ladder (Promega) at 150 V for 30 minutes. The gel was then viewed under UV light (ProteinSimple instrument). If the appropriate band size was observed, the remaining DNA sample was then used for in-solution purification using a GFX DNA purification kit (GE Healthcare). Approximately 1 μl of the purified solution was used for analysis using a Nanodrop 3000c spectrophotometer (ThermoFisher Scientific). The concentration was recorded for further use and the DNA was retained and labeled (2H-XXXX) for later transcription.

[0165] Next, unmodified transcription was performed. All contents seen in Table 2 below, except for the RNA T7 polymerase, were mixed in a PCR tube. It should be noted that the DTT used was mixed in the lab to ensure freshness. Finally, the RNA T7 polymerase was added and the sample was mixed with a pipette. The samples were mixed on ice to try and slow down enzymes such as RNase that negatively affect the production of RNA. Once all components were added and mixed, the samples were placed in a thermocycler and incubated at 37°C for 4-16 hours, then held at 4°C.

[0166] [Table 2]

[0167] For fluoro-modified transfer the same protocol as above was followed but with the contents found in Table 3 below:

[0168] [Table 3]

[0169] After transfer, a small amount of sample (approximately 5 μl) was used for viewing on a 6% acrylamide denaturing gel. Samples were run at 20 W for 1 hour at the nucleic acid manufacturer. The gel was then viewed under UV light to check for correct length. If the sequence length was correct and good bands were present, the sample was then purified using the Monarch RNA Clean-Up kit. Approximately 31 μl of elution buffer was used for purification and 1 μl of sample was used for analysis on the Nanodrop 3000c. The optical density (A260) was recorded and the molar concentration of the sample was calculated using Beer's law.

[0170] The samples were then thermally annealed by heating to 95° C. for 5 min followed by cooling to −20° C. for 3 min. 5X DNA tiling buffer was then added and the samples were heated to 37° C. for 30 min. 1X DNA tiling buffer was used to dilute the samples to the desired volume for further use.

[0171] The APPT coagulation test assessed the clotting time of pooled human plasma with DNA / RNA tiles using anticoagulant aptamers. Approximately 16.67 μL of 5 μM samples of both RNA and DNA tiles were tested in 50 μL of pooled human plasma, 50 μL of aPTT reagent, and 50 μL of CaCl2 solution.

[0172] For specificity testing, heat-annealed RNA origami or DNA weave tiles (5 pmol) were dissolved in 1X annealing buffer and incubated with protein (25 pmol) for 1 h at 37°C. Samples were run by 6% native acrylamide gel electrophoresis in 1X TBE as running buffer at 150 V for 3 h. Gels were stained with ethidium bromide for nucleic acid staining and visualized under a UV lamp. Gels were then further stained with Coomassie blue for protein staining and imaged on a ProteinSimple instrument.

[0173] To fold the RNA origami, unmodified and modified RNA origami were dissolved in nuclease-free water, heated at 95 °C for 5 min, and rapidly cooled at -20 °C for 3 min. Next, the samples were mixed with 5X annealing buffer to obtain the concentration in 1X buffer and annealed at 37 °C for 30 min. Finally, 1X buffer was added to the folded RNA origami to obtain the desired concentration. The folded RNA origami (1 μl, 5 μM) was mixed with RNase A (1 μl of 10 and 500 μg / ml) or human plasma (3 μl) and incubated at 37 °C for various time courses from 10 min to 24 h. The integrity of the RNA origami was characterized by denaturing gel electrophoresis. For denaturing gel electrophoresis, the gel was pre-run at 20 W for 15 min and the samples were run at 20 W for 1 h. Finally, for nucleic acid staining, the gel was stained with ethidium bromide. Nucleic acid bands were visualized under the UV lamp of the ProteinSimple instrument.

[0174] For antidote testing, clotting tests were performed with an activated partial thromboplastin time (APTT) assay using a model ST4 coagulometer (Diagnostica Stago). Approximately 50 μL of pooled human plasma (George King Bio-Medical) was added to each cuvette, mixed with 50 μL of aPTT reagent (TriniClot) and incubated at 37°C for 5 min. Then, 13.67 μL of 6.09 μM RNA origami sample or buffer was added and incubated at 37°C for another 5 min. After 5 min, 3.00 μL of DNA or PNA antidote was added and incubated at 37°C for another 5 min. To activate clotting, 50 μL of CaCl2 solution was added. The final concentration of the RNA sample was 0.5 μM. The time to clotting was then measured by the machine and recorded.

[0175] 5. Arrays The following nucleic acids are provided by this disclosure as referenced herein:

[0176] RNA-NNNN (SEQ ID NO: 1) GGGAGAUCGAGCGACUUCCGACUUCGGUCGGGAGUCGGGCUAGUCAUCUUCGGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUUGCUUCGGCAAGGCACUUUGGCUGCUAGACUGGCUGGCUUCGGCCAGCUAGUUUAGGAUUCUAUUGC RNA-12NN (SEQ ID NO: 2) GGGAGAUCGAGCGACUUCCGACUUCGGUCGGGAGUCGGGCUAGUCAUCGGGAACAAAGCUGAAGUACUUACCCGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCAGGCACUUUGGCUGCUAGACUGGCUGGCUUCGGCCAGCUAGUUUAGGAUUCUAUUGC RNA-1N2N (SEQ ID NO: 3) GGGAGAUCGAGCGACUUCCGACGGGAACAAAGCUGAAGUACUUACCCGUCGGGAGUCGGGCUAGUCAUCUUCGGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCAGGCACUUUGGCUGCUAGACUGGCUGGCUUCGGCCAGCUAGUUUAGGAUUCUAUUGC RNA-2NN1 (SEQ ID NO: 4) GGGAGAUCGAGCGACUUCCGACUUCGGUCGGGAGUCGGGCUAGUCAUCUUCGGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUUGCGGGAACAAAGCUGAAGUACUUACCCGCAAGGCACUUUGGCUGCUAGACUGGCUGGCGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCGCCAGCUAGUUUAGGAUUCUAUUGC Fss12 (SEQ ID NO: 5) GGGAACAAAGCUGAAGUACUUACCCACCUUACCACUCCACCUCACUCACCUAUUACGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC 2H-2211 (SEQ ID NO: 6) GGGAGAUCGAGCGACUUCCGACUCUGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCAGAGUCGGGAGUCGGGCUAGUCAUCAGGCACGGGAACAAAGCUGAAGUACUUACCCGUGCCUGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUUGCGGGAACAAAGCUGAAGUACUUACCCGCAAGGCACUUUGGCUGCUAGACUGGCUGGCGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCGCCAGCUAGUUUAGGAUUCUAUUGC 3H-2NN1 (SEQ ID NO: 7) GGAAAUGAUGCCGAGUUGACGCUUCGGCGUCAGCUCGCCCUGUGGCCUAGUUCGCUAGGUCACAGACAUCUUGGCGUUCGCGCCAGGAUGUCUCGCCCAAUUCCGUAGGGCGAGGGUAGCCAAAUCCAGAGGCUAGCAUUAUUUCCGAUCUAGGAUCGCGUUGAGAACUGGAUACUCAACAGCGGUAAACGGAAAACCGCUCAGCCGAAGUGUCUUGCGGGAACAAAGCUGAAGUACUUACCCGCAAGGCACUUUGGCUGGCCACGCGUCGUAUUCGUACGGCGCGUGCUAGACUGGCUGGCGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCGCCAGCUAGUUUAGGAUUCUAGAUC 4H-2NN1 (SEQ ID NO: 8) GGAAAUGAUGCCGAGUUGACGCUUCGGCGUCAGCUCGCCCUGUGGCCUAGUUCGCUAGGUCACAGCCGACCAUUGCGUUUCGACGCAGUGGUCACAUCUUGGCGUUCGCGCCAGGAUGUCUCGCCCAAUUCCGUAGGGCGAGGGGACCCAAAUCCCUAGGGUCGGUAGCCAAAUCCAGAGGCUAGCAUUAUUUCCGAUCUAGGAUCGCGUUGAGAACUGGAUACUCAACCGUGGCAUAAAGGGAUAAUGCCAAGCGGUAAACGGAAAACCGCUCAGCCGAAGUGUCUUGCGGGAACAAAGCUGAAGUACUUACCCGCAAGGCACUUUGGCUGCGUGGCGUUACAGUUCGCUGUGACGCCAGCCACGCGUCGUAUUCGUACGGCGCGUGCUAGACUGGCUGGCGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCGCCAGCUAGUUUAGGAUUCUAGAUC The G block sequence is provided below (the T7 promoter is in bold).

[0177] 2H-DNAGblock-NNNN (SEQ ID NO: 9)

[0178] [ka]

[0179] 2H-DNAGblock-12NN (SEQ ID NO: 10)

[0180] [ka]

[0181] 2H-DNAGblock-1N2N (SEQ ID NO: 11)

[0182] [ka]

[0183] 2H-DNAGblock-2NN1 (SEQ ID NO: 12)

[0184] [ka]

[0185] DNAGblock-Fss12 (SEQ ID NO: 13)

[0186] [ka]

[0187] 2H-DNAGblock-2211 (SEQ ID NO: 14)

[0188] [ka]

[0189] 3H-DNAGblock-2NN1 (SEQ ID NO: 15)

[0190] [ka]

[0191] 4H-DNAGblock-2NN1 (SEQ ID NO: 16)

[0192] [ka]

[0193] The DNA and PNA antidote sequences are shown below. Anti_Ex1_A06 (SEQ ID NO: 17) GTCTGCCTCGTACATTGGCT Anti_Ex2_Full (SEQ ID NO: 18) GGGTAAGTACTTCAGCTTTGTTCCC Anti_Ex1_PNA_A06 (SEQ ID NO: 19) GTCTGCCTCGTACATTGGCT Anti_Ex2_PNA_19nt (SEQ ID NO: 20) GTACTTCAGCTTTGTTCCC Other suitable modifications will be readily apparent to those skilled in the art.

[0194] It is understood that the foregoing detailed description and accompanying examples are merely illustrative and are not to be taken as limitations on the scope of the present disclosure, which is defined solely by the appended claims and their equivalents.

[0195] Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications, including but not limited to, with respect to the chemical structures, substituents, derivatives, intermediates, syntheses, compositions, formulations, or methods of use of the present disclosure, may be made without departing from the spirit and scope thereof. [Brief description of the drawings]

[0196] [Figure 1]Figure 1 contains a schematic diagram of the coagulation cascade and the corresponding enzymes targeted by anticoagulants. Thrombin plays a key role in coagulation by catalyzing the cleavage of fibrinogen, upstream coagulation factors, and platelet receptors. The catalytic active site and two extended surfaces of thrombin, called exosites, are involved in macromolecular ligand binding and can be blocked using chemical and biologically based molecules to prevent clotting. Control of thrombin activity in the coagulation cascade provides therapeutic, surgical, and clinical benefits. [Figure 2A] Figures 2A-2E include representative depictions of nucleobase aptamers with anticoagulant activity. Figure 2A includes the tertiary structure of thrombin, including the locations of exosite 1 and exosite 2. [Figure 2B-E] Figures 2A-2E contain representative depictions of nucleobase aptamers with anticoagulant activity. Figures 2B-2E contain examples of DNA and RNA aptamers used as anticoagulants for the specific inhibition of thrombin activity. RNAR9D-14T (Figure 2B) and Toggle-25t (Figure 2C) RNA aptamers bind to exosite 1 and exosite 2 of thrombin, respectively. DNA aptamers NU172 (Figure 2D) and HD22 (Figure 2E) bind to exosite 1 and exosite 2 of thrombin, respectively. [Diagram 3] FIG. 3 shows the crystal structure of the Toggle-25 tRNA aptamer bound to exosite 2 of thrombin. [Figure 4] 4 is an exemplary image of an RNA origami bound to thrombin (not to scale). The RNA origami structure comprises a double helix structure. [Figure 5A-B] Figures 5A-5B include representative images of an RNA molecule with an A-form duplex structure (Figure 5A) and a 180° kissing loop (Figure 5B). [Figure 6A-B] Figures 6A-6B contain representative images of the tetraloop before (Figure 6A) and after (Figure 6B) extraction from the larger structure. The red circle indicates the tetraloop in the larger structure. [Figure 7A-B]Figures 7A-7B contain representative images of the exosite 2 thrombin aptamer before (Figure 7A) and after (Figure 7B) extraction from the larger structure. The red circles indicate the tetraloops within the larger structure. [Figure 8A-B] Figures 8A-8B include representative images of the double helices after they have been aligned to form a crossover (Figure 8A; the top helix is ​​helix 1 and the bottom helix is ​​helix 2). The phosphate atoms and the backbone and side (sugar / base) where the crossover is located are identified in red and yellow, respectively. Figure 8B includes a representative side view of the RNA structure with all the motifs aligned into a helix. The motif in the top left is the RNA thrombin aptamer. [Figure 9] FIG. 9 is a 3D representation of the ligation structure of a double-stranded RNA origami molecule containing an RNA aptamer. [Figure 10] Figure 10 is a representative illustration of an RNA origami molecule (top) being transcribed from a 2D model into a text file (bottom). [Figure 11A] Figures 11A-11B include representative depictions of the RNA origami sequences. Figure 11A includes a representative depiction of the text file after going through the trace script, with the red box highlighting the outputted code that can be presented to NUPACK, which then provides the RNA sequence. [Figure 11B] Figures 11A-11B include representative depictions of RNA origami sequences. Figure 11B includes a representative depiction of an RNA sequence output by NUPACK; NED is also provided (generally, the sequence with the lowest NED is selected for analysis). [Figure 12A] Figures 12A-12B include a representative depiction of a 3D view (Figure 12A) of a double-stranded RNA origami without an RNA aptamer (2HO-RNA-NNNN). The numbers represent the four positions on the RNA origami molecule that may contain an RNA aptamer. The tetraloop is represented by a yellow box and the kissing loop is indicated by a green box. [Figure 12B]Figures 12A-12B include a representative depiction of a 2D ribbon model (Figure 12B) of a double-stranded RNA origami without an RNA aptamer (2HO-RNA-NNNN). The numbers represent the four positions on the RNA origami molecule that may contain an RNA aptamer. The tetraloop is represented by a yellow box and the kissing loop is indicated by a green box. [Figure 13A-D] Figures 13A-13D include representative 2D models of four designs of RNA origami containing two aptamers: Figure 13A shows 2HO-RNA-NNNN (SEQ ID NO: 1), Figure 13B shows 2HO-RNA-12NN (SEQ ID NO: 2), Figure 13C shows 2HO-RNA-1N2N (SEQ ID NO: 3), and Figure 13D shows 2HO-RNA-2NN1 (SEQ ID NO: 4). [Figure 14A-C] Figures 14A-14C contain a representative 2D model of 2HO-RNA-NNNN (A), and computational simulations of RNA folding analyzed by mfold (B) and NUPACK (C). The tetraloop and kissing loop are indicated by yellow and green boxes, respectively. [Figure 15A-C] Figure 15A-15C includes a representative 2D model of 2HO-RNA-12NN (A), and computational simulations of RNA folding analyzed by mfold (B) and NUPACK (C). The tetraloop and kissing loop are shown in yellow and green boxes, respectively. Exosite 1- and 2-binding RNA aptamers are represented by purple and blue rectangles, respectively. [Figure 16A-C] Figures 16A-16C include a representative 2D model of 2HO-RNA-1N2N (A), and computational simulations of RNA folding analyzed by mfold (B) and NUPACK (C). The tetraloop and kissing loop are shown in yellow and green boxes, respectively. Exosite 1- and 2-binding RNA aptamers are represented by purple and blue rectangles, respectively. [Figure 17A-C]Figure 17A-17C includes a representative 2D model of 2HO-RNA-2NN1 (A), and computational simulations of RNA folding analyzed by mfold (B) and NUPACK (C). The tetraloop and kissing loop are shown in yellow and green boxes, respectively. Exosite 1- and 2-binding RNA aptamers are represented by purple and blue rectangles, respectively. [Figure 18] Figure 18 includes representative images characterizing DNA template amplification using a 1% agarose gel run at 150 V for 30 min. 1 kb ladder (lanes 1 and 5), 2H-DNA-NNNN (lane 2), 2H-DNA-12NN (lane 3), 2H-DNA-1N2N (lane 4), and 2H-DNA-2NN1 (lane 6). [Figure 19] Figure 19 contains representative images of the difference between transcription with and without the new DTT. Native T7 RNA polymerase from New England Biolab was used for transcription of the unmodified RNA structures. [Figure 20] Figure 20 includes representative images of RNA origami run on a 6% denaturing acrylamide gel for 1 hour at 20 W. 1 kb ladder (lane 1), 2HO-RNA-NNNN (lane 2), 2HF-RNA-NNN (lane 3), 2HO-RNA-2NN1 (lane 4), 2HF-RNA-2NN1 (lane 5), 2HO-RNA-1N2N (lane 6), and 2HF-RNA-1N2N (lane 7). [Figure 21] Figure 21 includes representative images of RNA origami run on a 6% denaturing acrylamide gel for 1 hour at 20 W. 1 kb ladder (lane 1), 2HO-RNA-1N2N, 279 nt (lane 2), 2HO-RNA-NNNN, 210 nt (lane 3), 1 kb ladder (lane 4), 2HF-RNA-2NN1, 285 nt (lane 5), 2HF-RNA-1N2N, 279 nt (lane 6), 2HF-RNA-12NN, 279 nt (lane 7), and 2HF-RNA-NNNN, 210 nt (lane 8). [Figure 22]Figure 22 includes representative images of RNA origami run on a 6% native acrylamide gel for 3 hours at 150 V. DNA markers, GeneRuler Ultra Low Range DNA Ladder (left lane) and 2HO-RNA-2NN1 (right lane). [Figure 23] Figure 23 includes representative results of an anticoagulation study comparing the mean clotting times of 2'-fluoro-modified free aptamer, unmodified RNA origami (2HO-RNA), 2'-fluoro-modified RNA origami (2HF-RNA), and DNA woven tiles (2HT-DNA) using the aPTT assay. Error bars are standard deviation (N=3). [Figure 24] Figure 24 includes representative images of the results of acrylamide gel electrophoresis of RNA origami-thrombin complexes: nucleic acid stained gel (left) and protein stained gel (right). [Diagram 25] Figure 25 includes representative images of acrylamide gel electrophoresis results of specificity testing of thrombin aptamer contained in RNA origami with four different proteins by gel electrophoretic mobility shift assay. Lane 1: DNA marker, lane 2: 2HF-RNA-NNNN, lanes 3-6: 2HF-RNA-NNNN incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel. [Figure 26] Figure 26 includes representative images of acrylamide gel electrophoresis results of specificity testing of thrombin aptamers contained in RNA origami with four different proteins. Lane 1: DNA marker, lane 2: 2HF-RNA-12NN, lanes 3-6: 2HF-RNA-12NN incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel. [Figure 27]Figure 27 includes representative images of acrylamide gel electrophoresis results of specificity testing of thrombin aptamers contained in RNA origami with four different proteins. Lane 1: DNA marker, lane 2: 2HF-RNA-1N2N, lanes 3-6: 2HF-RNA-1N2N incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel. [Figure 28] Figure 28 includes representative images of acrylamide gel electrophoresis results of specificity testing of thrombin aptamers contained in RNA origami with four different proteins. Lane 1: DNA marker, lane 2: 2HF-RNA-2NN1, lanes 3-6: 2HF-RNA-2NN1 incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel. [Figure 29] Figure 29 includes representative results of a binding assay between the thrombin DNA aptamer contained in the DNA weave tile and thrombin. The gel on the left is a nucleic acid stained gel, and the gel on the right is a protein stained gel. [Fig. 30A-B] Figures 30A-30B contain representative results of stability testing of modified (A) and unmodified (B) RNA origami treated with 10 ug / ml of RNase A. Samples were characterized by denaturing gel electrophoresis. [Fig. 31A-B] Figures 31A-31B contain representative results of stability testing of modified (A) and unmodified (B) RNA origami treated with high concentrations of RNase A (500ug / ml). Samples were characterized by denaturing gel electrophoresis. [Fig. 32A-B] Figures 32A-32B include representative results of a stability study of modified RNA origami (2HF-RNA-2NN1) stored in human plasma for 10 min to 24 h. Modified RNA origami (A) was stored with human plasma at 37 °C for 4 h. 2HF-RNA-2NN1 origami (B) was stored in human plasma for 10 min to 24 h. The control is 2HF-RNA-2NN1 stored in 1x buffer at 37 °C for 24 h. [Diagram 33] Figure 33 contains representative results of a stability study of unmodified RNA origami (2HO-RNA-2NN1) stored in human plasma at 37 °C for 10 min to 24 h. [Diagram 34] FIG. 34 contains representative results of a stability study of DNA woven tiles (2HT-DNA-PNNB) stored in human plasma at 37° C. for 10 minutes to 24 hours. [Fig. 35A-C] Figures 35A-35C contain representative 2D models of four designs of RNA origami containing two aptamers (Fss12; A) on a 31-nucleotide single-stranded RNA linker. Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B-C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively. [Fig. 36A-C] Figures 36A-36C contain representative 2D models of four designs of RNA origami containing four aptamers (2H-RNA-2211; A). Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B-C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, while green rectangles indicate kissing loop motifs. [Figure 37A-C] Figures 37A-37C contain representative 2D models of four designs of RNA origami (3H-RNA-2NN1; A) containing two aptamers and three A-form duplex structures. Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B-C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, while yellow and green rectangles indicate tetraloop and kissing loop motifs, respectively. [Fig. 38A-C]Figures 38A-38C contain representative 2D models of four designs of RNA origami (4H-RNA-2NN1; A) containing two aptamers and four A-form duplex structures. Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B-C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, while yellow and green rectangles indicate tetraloops and kissing loops, respectively. [Figure 39] Figure 39 includes representative images characterizing DNA template amplification: Lanes 1 and 8: DNA marker, lane 2: Fss12, lane 3: 2H-DNA-NNNN, lane 4: 2H-DNA-2NN1, lane 5: 2H-DNA-2211, lane 6: 3H-DNA-2NN1, and lane 7: 4H-DNA-2NN1. [Diagram 40] Figure 40 includes representative images characterizing RNA origami by denaturing acrylamide gel electrophoresis. Lanes 1 and 8: ssRNA marker, lane 2: 31 nt-linked aptamer (Fss12), lane 3: 2 HF-RNA-NNNN, lane 4: 2 HF-RNA-2NN1, lane 5: 2 HF-RNA-2211, lane 6: 3 HF-RNA-2NN1, lane 7: 4 HF-RNA-2NN1. [Fig. 41A-D] Figures 41A-41D include representative images characterizing RNA origami with aptamer binding to thrombin by 6% native acrylamide gel electrophoresis. RNA origami was incubated with thrombin for 1 hour at 37°C prior to characterization (A). Gels in (A) and (B) are the same gel and run at 150V for 3 hours. Gels (C) and (D) are the same gel and run at 150V for 6 hours. Nucleic acid stain gel, ethidium bromide (A and C). Protein stain gel, Coomassie blue (B and D). Negative and positive signs indicated the absence and presence of thrombin, respectively. [Fig. 42A-B]Figures 42A-42B include representative images of specific binding studies of two aptamers (Fss12) linked by 31 nt with four different proteins by native acrylamide gel electrophoresis. Lane 1: Fss12. Lane 2: Fss12 incubated with thrombin. Lane 3: Fss12 incubated with factor IXa. Lane 4: Fss12 incubated with factor Xa, and lane 5: Fss12 incubated with BSA. 6% native PAGE gels were run at 150 for 3 hours. Nucleic acid stained gel, ethidium bromide (A). Protein stained gel, Coomassie blue (B). (A) and (B) are the same gel. [Fig. 43A-B] Figures 43A-43B include representative images of specific binding studies of 2HF-RNA-2211 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 2HF-RNA-2211. Lane 2: 2HF-RNA-2211 incubated with thrombin. Lane 3: 2HF-RNA-2NN1 incubated with factor IXa. Lane 4: 2HF-RNA-2211 incubated with factor Xa, and Lane 5: 2HF-RNA-2211 incubated with BSA. 6% native PAGE gels were run at 150 for 3 hours. Nucleic acid stain gel, ethidium bromide (A). Protein stain gel, Coomassie blue (B). (A and B). (A) and (B) are the same gel. [Fig. 44A-B] Figures 44A-44B include representative images of specific binding studies of 3HF-RNA-2NN1 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 3HF-RNA-2NN1. Lane 2: 3HF-2NN1 incubated with thrombin. Lane 3: 3HF-RNA-2NN1 incubated with factor IXa. Lane 4: 3HF-RNA-2NN1 incubated with factor Xa, and Lane 5: 3HF-RNA-2NN1 incubated with BSA. 6% native PAGE gels were run at 150 for 6 hours. Nucleic acid stained gel, ethidium bromide (A). Protein stained gel, Coomassie blue (B). (A) and (B) are the same gel. [Fig. 45A-B]Figures 45A-45B include representative images of specific binding studies of 4HF-RNA-2NN1 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 2HF-RNA-4NN1. Lane 2: 4HF-RNA-2NN1 incubated with thrombin. Lane 3: 4HF-RNA-2NN1 incubated with factor IXa. Lane 4: 2HF-RNA-4NN1 incubated with factor Xa, and Lane 5: 4HF-RNA-2NN1 incubated with BSA. 6% native PAGE gels were run at 150 for 6 hours. Nucleic acid stained gel, ethidium bromide (A). Protein stained gel, Coomassie blue (B). (A) and (B) are the same gel. [Diagram 46] Figure 46 contains representative results testing long-term storage of RNA origami. The average anticoagulant activity of freshly prepared 2HF-RNA-2NN1 samples is compared to samples stored at 4°C for up to 90 days. The results demonstrate that the RNA origami anticoagulant is stable and active for at least 3 months after storage at 4°C. [Figure 47] Figure 47 includes representative results of the anticoagulant activity of free aptamers, ssRNA-linked aptamers, and RNA origamis containing aptamers, tested by aPTT assay. All designs of anticoagulants are at a final concentration of 500 nM, except for 2HF-RNA-2211, which has a final concentration of 400 nM. The results demonstrate that the anticoagulant activity of two aptamers linked with ssRNA (Fss12) is higher than the free aptamer and the mixture of free aptamers. Furthermore, the anticoagulant activity of the two aptamers contained in the RNA origami (2HF-RNA-2NN1) is greater than the ssRNA-linked aptamer (Fss12). Furthermore, the RNA origami containing four aptamers (2HF-RNA-2211) shows the highest anticoagulant activity (more than twice the activity of 2HF-RNA-2NN1). [Figure 48]Figure 48 includes representative results testing the concentration-dependent clotting time of RNA origami containing two (2HF-RNA-2NN1) and four (2HF-RNA-2211) RNA aptamers. For 2HF-RNA-2211 at a concentration of 400 nM, the clotting time reached the maximum limit (999 seconds measured using a coagulometer). Surprisingly, the anticoagulant activity of 2HF-RNA-2211 (4 aptamers) is more than twice that of 2HF-RNA-2NN1 (2 aptamers). [Figure 49] Figure 49 includes representative results testing the anticoagulant activity of RNA origamis containing two RNA aptamers (2NN1) and two (2HF), three (3HF), or four (4HF) helical structures. The results show that 2HF, 3HF, and 4HF RNA origamis containing two RNA aptamers all exhibit anticoagulant activity. [Fig. 50A-B] 50A-50B include representative results of reversal of thrombin inhibition, showing clotting time (A) and anticoagulant activity (B). [Figure 51] Figure 51 contains representative results testing the reversal of thrombin activity by the addition of DNA or PNA antidote. The anticoagulant activity of 2HF-2NN1 origami anticoagulant was used as a control sample. DNA or PNA antidote (9 equiv.) was incubated with RNA origami. The inhibitory activity of PNA antidote was higher than that of DNA antidote.

Claims

1. A single stranded nucleic acid molecule comprising: at least one A-form double helix structure and at least one crossover region; at least one kissing loop region; and at least one nucleic acid aptamer having anticoagulant activity; wherein the single stranded nucleic acid molecule is a modified RNA molecule that includes a 2'-fluoro modification.

2. The nucleic acid molecule of claim 1 , further comprising at least one tetraloop region.

3. The nucleic acid molecule of claim 2, wherein the at least one tetraloop region comprises a four-nucleotide motif.

4. The nucleic acid molecule of claim 1, wherein the at least one kissing loop region is a 180° kissing loop region.

5. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises 1 to 4 aptamers having anticoagulant activity.

6. The nucleic acid molecule of claim 5, wherein each of the one to four aptamers replaces a tetraloop region.

7. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is an RNA molecule having at least 90% sequence identity to SEQ ID NO:

1.

8. The nucleic acid molecule of claim 1 , wherein the anticoagulant activity of at least one nucleic acid aptamer comprises thrombin inhibition.

9. The nucleic acid molecule of claim 1, wherein the anticoagulant activity of at least one nucleic acid aptamer comprises inhibition of one or more of factors XIIa, XIIIa, XIa, IXa, Xa, and von Willebrand factor.

10. The at least one nucleic acid aptamer is an anti-thrombin RNA Ｒ９Ｄ－１４Ｔ The nucleic acid molecule of claim 8 , comprising an aptamer or a derivative thereof.

11. The nucleic acid molecule of claim 8, wherein the at least one nucleic acid aptamer comprises an anti-thrombin toggle-25 tRNA aptamer or a derivative thereof.

12. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is an RNA molecule comprising 100 to 600 nucleotides.

13. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is an RNA molecule comprising: a nucleic acid aptamer capable of binding to exosite 1 of thrombin which replaces tetraloop region 1 of said RNA molecule; and a nucleic acid aptamer capable of binding to exosite 2 of thrombin which replaces tetraloop region 2 of said RNA molecule.

14. The nucleic acid molecule of claim 13, wherein the RNA molecule has at least 90% sequence identity to SEQ ID NO:

2.

15. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is an RNA molecule comprising: a nucleic acid aptamer capable of binding to exosite 1 of thrombin which replaces tetraloop region 1 of said RNA molecule; and a nucleic acid aptamer capable of binding to exosite 2 of thrombin which replaces tetraloop region 3 of said RNA molecule.

16. The nucleic acid molecule of claim 15, wherein the RNA molecule has at least 90% sequence identity to SEQ ID NO:

3.

17. An anticoagulant composition comprising: a single-stranded nucleic acid molecule comprising at least one A-form double helix structure, at least one crossover region, at least one kissing loop region, and at least one nucleic acid aptamer having anticoagulant activity; and a pharma- ceutically acceptable excipient, solvent, carrier, or diluent; wherein the single stranded nucleic acid molecule is a modified RNA molecule that includes a 2'-fluoro modification.

18. The composition of claim 17 , wherein the nucleic acid molecule further comprises at least one tetraloop region.

Images