Dry eye improver

The combination of neem and bilberry in a dry eye improving agent addresses the instability of tear films and corneal epithelial cell damage, providing effective and long-lasting relief from dry eye symptoms and enhancing eye brightness.

JP7690195B2Active Publication Date: 2025-06-10NIPPON MENARD COSMETIC CO
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
JP2021113469
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-07-08
Publication Date
2025-06-10
Estimated Expiration
2041-07-08

AI Technical Summary

Technical Problem

Current dry eye treatments, such as eye drops, provide short-lasting relief and require frequent application, making them inconvenient for daily use. Additionally, they do not effectively address the underlying issues of unstable tear films and corneal epithelial cell damage caused by blue light exposure.

Method used

A dry eye improving agent and eye brightness enhancer characterized by containing neem and bilberry, which promotes mucin production, stabilizes the tear film, and inhibits corneal epithelial cell damage, thereby improving dry eye symptoms and eye sparkle.

Benefits of technology

The use of neem and bilberry in the dry eye improving agent significantly enhances mucin production, stabilizes the tear film, and protects corneal epithelial cells from blue light damage, leading to improved dry eye symptoms and eye brightness with long-lasting effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007690195000001
    Figure 0007690195000001
  • Figure 0007690195000002
    Figure 0007690195000002
  • Figure 0007690195000003
    Figure 0007690195000003
Patent Text Reader

Abstract

To provide an excellent dry eye improver, an eye brightness improver, a mucin production promoter, and a corneal epithelial cell damage inhibitor.SOLUTION: Since neem exhibits excellent dry eye improving action, eye brightness improving action, mucin production promoting action, and a corneal epithelial cell damage inhibiting action, neem can be used as food, as a quasi drug, and as a pharmaceutical having these actions. Furthermore, since the combination of neem and bilberry exhibits remarkably excellent dry eye improving action and eye brightness improving action, this combination can be used as food, as a quasi drug, and as a pharmaceutical having these actions.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a dry eye improving agent characterized by containing neem. More specifically, it relates to a brightening agent for eyes, a mucin production promoter, and a corneal epithelial cell disorder inhibitor, each characterized by containing neem. Furthermore, it relates to a dry eye improving agent and a brightening agent for eyes, each characterized by containing neem and bilberry.

Background Art

[0002] The definition of dry eye in Japan announced in 2016 is "a disease in which the stability of the tear film decreases due to various factors, causing eye discomfort and visual function abnormalities, and sometimes accompanied by damage to the ocular surface", emphasizing not simply a decrease in the amount of tears but the stability of the tear film.

[0003] With the change in lifestyle, the number of dry eye patients has been increasing year by year. Due to the spread of personal computers, smartphones, etc., the number of dry eye patients complaining of eye dryness is increasing due to VDT (Visual Display Terminals) work using digital devices, a low-humidity environment using air conditioners, wearing contact lenses, etc. A considerable number of such dry eye cases are classified as the BUT (Tear Film Break Up Time) shortening type with an unstable tear film (Non-Patent Document 1).

[0004] The tear film consists of a mucin layer, an aqueous layer, and an oil layer from the corneal and conjunctival surfaces. The BUT shortening type of dry eye with an unstable tear film is said to be due to a lack of secretory mucin present in the aqueous layer or a disorder of membrane-type mucin expressed on the surface of epithelial cells on the corneal and conjunctival surface layers (Non-Patent Document 1). That is, promoting mucin production to stabilize the tear film is important for improving dry eye.

[0005] Although the sparkle in the eyes decreases with age, it has been shown that the sparkle in the eyes greatly affects the impression, and the more the eyes sparkle, the more attractive they become. Furthermore, the sparkle in the eyes not only improves the impression of the eye area, but also has the effect of improving the gloss of the skin due to the optical illusion effect (Non-Patent Document 2). Therefore, it is very important to improve the sparkle in the eyes in order to enhance the overall impression of the face.

[0006] The sparkle in the eyes changes depending on the pupil diameter and the state of the tears. The pupil diameter changes depending on the brightness and convergence of the external environment. The larger the pupil diameter, the stronger the light reflection and the more the eyes sparkle, but it is difficult to control. When the state of the tears is such that the tear film is unstable and there is a part on the cornea that is not covered by the tear film when the eyelids are opened, the light is diffusely reflected, the reflected light is weak, and the eyes appear dull. On the contrary, if the tear film is stable, a uniform tear film exists on the surface of the eyes, so the light becomes specular reflection, the reflected light is strong, and the eyes appear to sparkle. Therefore, stabilizing the tear film is expected to improve the sparkle in the eyes and lead to an improvement in the overall impression of the face.

[0007] With the spread of LEDs (Light Emitting Diodes), concerns have begun to arise about the effects of the blue light contained in LEDs on the human body. Blue light is blue light with a wavelength of 380 - 500 nm, which is also contained in sunlight and is essential for maintaining the circadian rhythm. It is the light necessary for the body clock to distinguish between day and night. However, if the amount of blue light exposure at night is high due to the use of computers, smartphones, etc. that emit a lot of blue light, the risk of sleep disorders, cancer, diabetes, hypertension, and depression increases due to circadian rhythm disorders (Non-Patent Document 3). Also, as an effect on the eyes, damage to the retina and corneal epithelial cells has been reported (Non-Patent Documents 4 and 5). When the corneal epithelial cells are damaged, the expression of membrane-type mucin expressed on the corneal epithelial cells becomes insufficient, leading to a decrease in the stability of the tear film. As a result, dry eye and a decrease in the sparkle in the eyes occur. Therefore, suppressing corneal epithelial cell damage is important for improving dry eye and enhancing the sparkle in the eyes.

[0008] Heretofore, eye drops such as hyaluronic acid preparations and artificial tears have been used to improve dry eye, but the effects only last for a short time. There are also eye drops that have the effect of increasing the amount of moisture and the effect of increasing the production of mucin, which are said to have a long-lasting effect, but even so, it is necessary to instill the eye drops multiple times a day. Due to inconvenience, forgetting to instill the eye drops, and makeup smudging, etc., instillation during the day becomes insufficient, and the effects may not be fully exerted. Therefore, there is a need for a dry eye improver that can be easily used daily in combination.

[0009] Neem has the scientific name Melia azadirachta and is also called Indian lilac. It grows wild from Southeast Asia to the Middle East and has been venerated as a mysterious tree since ancient times. It is regarded as an essential mysterious medicine in Ayurveda in India. The bitter components contained in the whole tree are disliked by pests and are used for pest control. It is also known to exhibit nerve growth factor inhibitory activity (Patent Document 1), cyclooxygenase activity inhibitory activity (Patent Document 2), anti-inflammatory activity, and anti-itch activity (Patent Document 3).

[0010] Bilberry has the scientific name Vaccinium myrtillus and is a wild blueberry that grows in northern Europe. Standardized bilberry extracts with standards for 15 types of anthocyanins are included in the European Pharmacopoeia and have been used as pharmaceuticals for eye diseases, vascular disorders, dermatitis, etc. in Europe for many years. Its virus inactivating activity (Patent Document 4), blood flow improving activity, capillary protecting activity, anti-tumor activity, and anti-ulcer activity (Non-Patent Document 6) have been clarified.

[0011] However, a dry eye improver, eye brightness enhancer, mucin production promoter, corneal epithelial cell damage inhibitor characterized by containing neem, a dry eye improver, eye brightness enhancer characterized by containing neem and bilberry, and food compositions containing them are not known at all.

Prior Art Documents

Patent Documents

[0012]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Non-Patent Document

[0013]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Summary of the Invention

Problems to be Solved by the Invention

[0014] The present invention relates to a dry eye improving agent characterized by containing niam. More specifically, it relates to an eye brightness improving agent, a mucin production promoting agent, and a corneal epithelial cell disorder inhibitor, each characterized by containing niam. Further, it relates to a dry eye improving agent and an eye brightness improving agent, each characterized by containing niam and bilberry.

Means for Solving the Problems

[0015] As a result of intensive research, the inventors of the present invention have found that neem has excellent dry eye improvement effects, eye brightness improvement effects, mucin production promotion effects, and corneal epithelial cell damage suppression effects. Furthermore, by combining neem and bilberry, they have found that these have better dry eye improvement effects and eye brightness improvement effects than when used alone.

[0016] For the neem used in the present invention, neem (Melia azadirachta), which is a plant of the Meliaceae family, can be used. The part of the neem used in the present invention is not particularly limited, and examples include leaves, fruits, seeds, bark, etc., and it is particularly preferable to use leaves.

[0017] For the bilberry used in the present invention, bilberry (Vaccinium myrtillus), which is a plant of the Ericaceae family, can be used. The part of the bilberry used in the present invention is not particularly limited, and examples include fruits, leaves, etc., and it is particularly preferable to use fruits.

[0018] The neem and bilberry used in the present invention can be used as they are, and if necessary, those that have been subjected to treatments such as drying, pulverization, and cutting can also be used. In addition, extracts obtained by extracting the neem and bilberry as they are or after the above treatments can also be used. Examples of the solvent for extraction include water, lower alcohols (such as methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (such as 1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (such as acetone, methyl ethyl ketone, etc.), acetonitrile, esters (such as ethyl acetate, butyl acetate, etc.), hydrocarbons (such as hexane, heptane, petroleum ether, etc.), and ethers (such as ethyl ether, tetrahydrofuran, propyl ether, etc.). These solvents may be used alone or in combination of two or more. For the neem of the present invention, the extraction solvent is a polar solvent such as water or a lower alcohol, and water is particularly preferable. For the bilberry of the present invention, the extraction solvent is a polar solvent such as water or a lower alcohol, and ethanol containing water is particularly preferable.

[0019] The above extract may be used as the extracted solution as it is, or, if necessary, may be used after undergoing treatments such as concentration, dilution, filtration, decolorization with activated carbon or the like, deodorization, and ethanol precipitation. Further, the extracted solution may be subjected to treatments such as concentration to dryness, spray drying, and freeze drying, and used as a dried product.

[0020] The intake amount of neem and bilberry used in the present invention can be appropriately adjusted according to the dosage form, purpose of use, age, body weight, and the like. The intake amount of neem per day for an adult can be orally ingested once to several times a day in the range of 0.05 to 500 mg, preferably 0.5 to 150 mg, in terms of the hot water extract of neem leaves. The intake amount of bilberry per day for an adult can be orally ingested once to several times a day in the range of 0.1 to 1000 mg, preferably 10 to 500 mg, as the water-containing ethanol extract of bilberry fruits. There may be cases where an amount less than the above intake range is sufficient, or cases where it is necessary to ingest beyond the range. Also, regarding the method of adding the active ingredient in formulation, it may be added in advance or during the manufacturing process, and it may be appropriately selected considering workability.

[0021] The dry eye improver, eye brightness enhancer, mucin production promoter, and corneal epithelial cell damage inhibitor of the present invention can be used as foods, quasi-drugs, and pharmaceuticals. As foods, they can be used as soft capsules, hard capsules, granules, tablets, gummies, beverages, jelly, and the like. Also, in quasi-drugs and pharmaceuticals, they can be used as oral capsules, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, solutions, emulsions, etc., and non-oral eye drops, injections, suppositories, external skin preparations, and the like. For achieving the object of the present invention, oral intake is preferred.

[0022] The dry eye ameliorant, eye brightness enhancer, mucin production promoter, and corneal epithelial cell damage inhibitor of the present invention can contain, within the range that does not impair the effects, excipients, stabilizers, lubricants, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, preservatives, fragrances, and other components that are usually used in foods, quasi-drugs, or pharmaceuticals as necessary. Furthermore, it can contain components such as plant materials, polyphenols, vitamins, saccharides, proteins, and fats and oils.

Effects of the Invention

[0023] The dry eye ameliorant, eye brightness enhancer, mucin production promoter, and corneal epithelial cell damage inhibitor characterized by containing the neem of the present invention have a dry eye ameliorating effect, an eye brightness enhancing effect, a mucin production promoting effect, and a corneal epithelial cell damage inhibiting effect. Furthermore, the dry eye ameliorant and eye brightness enhancer characterized by containing neem and bilberry have an extremely excellent dry eye ameliorating effect and eye brightness enhancing effect.

Modes for Carrying Out the Invention

[0024] The following examples are for illustrative purposes and the scope of the claims of the present invention is not limited by these examples in any way. The % of the content shown in the examples indicates weight %.

Examples

[0025] Production Example 1 Neem Leaf Hot Water Extract To 100 g of neem leaves, 2 L of purified water was added, and after extraction at 95 - 100 °C for 2 hours, the filtrate was concentrated and freeze-dried to obtain 8.5 g of neem leaf hot water extract.

[0026] Production Example 2 30% Ethanol Extract of Neem Leaf To 100 g of neem leaves, 1.4 L of purified water and 0.6 L of ethanol were added, and after extraction at room temperature for 5 days, the filtrate was concentrated to dryness to obtain 2.6 g of 30% ethanol extract of neem leaf.

[0027] Production Example 3: 30% Ethanol Extract of Bilberry Fruit To 100 g of bilberry fruit, 1.4 L of purified water and 0.6 L of ethanol were added, and after extraction at room temperature for 5 days, the filtrate was concentrated to dryness to obtain 3.0 g of a 30% ethanol extract of bilberry fruit.

[0028] Production Example 4: 50% Ethanol Extract of Bilberry Fruit To 100 g of bilberry fruit, 1 L of purified water and 1 L of ethanol were added, and after extraction at room temperature for 5 days, the filtrate was concentrated to dryness to obtain 2.1 g of a 50% ethanol extract of bilberry fruit.

[0029] Next, formulation examples using the neem, neem, and bilberry of the present invention will be given, but the present invention is not limited thereto.

Example

[0030] Formulation Example 1: Soft Capsule <Formulation> Component Content (%) 1. Hot Water Extract of Neem Leaves (Production Example 1) 20.0 2. Flaxseed Oil Added to Make the Total Amount 100 3. Beeswax 5.0 4. Glyceryl Fatty Acid Ester 5.0 5. Vitamin E 3.0 <Production Method> Components 1 to 5 were mixed and filled with 250 mg into a film composed of starch, carrageenan, reduced starch syrup, and glycerin, and after drying, a soft capsule was obtained. <Dosage> Take 3 capsules per day.

[0031] Formulation Example 2: Soft Capsule <Formulation> Component Content (%) 1. Hot Water Extract of Neem Leaves (Production Example 1) 10.0 2. 30% Ethanol Extract of Bilberry Fruit (Production Example 3) 10.0 3. Flaxseed Oil Added to Make the Total Amount 100 4. Beeswax 5.0 5. Glyceryl fatty acid ester 5.0 6. Vitamin E 3.0 <Manufacturing method> Ingredients 1 to 6 were mixed, filled with 250 mg into a film composed of starch, carrageenan, reduced starch syrup, and glycerin, and after drying, a soft capsule was obtained. <Dosage> Take 3 capsules per day.

[0032] Prescription Example 3 Soft capsule <Prescription> Ingredient Content (%) 1. Neem leaf hot water extract (Production Example 1) 0.07 2. Bilberry fruit 30% ethanol extract (Production Example 3) 16.0 3. Lutein 1.4 4. Zeaxanthin 0.3 5. Flaxseed oil Added so that the total amount is 100 6. Beeswax 5.0 7. Glyceryl fatty acid ester 5.0 8. Vitamin E 3.0 <Manufacturing method> Ingredients 1 to 8 were mixed, filled with 250 mg into a film composed of starch, carrageenan, reduced starch syrup, and glycerin, and after drying, a soft capsule was obtained. <Dosage> Take 3 capsules per day.

[0033] Prescription Example 4 Tablet <Prescription> Ingredient Content (%) 1. Neem leaf 30% ethanol extract (Production Example 2) 1.0 2. Bilberry fruit 30% ethanol extract (Production Example 3) 15.0 3. Maltitol Added so that the total amount is 100 4. Cellulose 5.0 5. Sucrose fatty acid ester 3.0 <Manufacturing method> Mix Components 1 to 4, add 10% water as a binder, and perform fluidized bed granulation. Add Component 5 to the formed granules, mix them, and tableting to obtain tablets of 300 mg per tablet. <Dosage> Take 3 tablets per day.

[0034] Prescription Example 5 Hard Capsules <Prescription> Component Content (%) 1. Ethanol extract of neem leaves 30% (Production Example 2) 0.1 2. Ethanol extract of bilberry fruit 50% (Production Example 4) 24.0 3. Corn starch Add to make the total amount 100 4. Sucrose fatty acid ester 3.0 <Manufacturing method> Mix Components 1 to 4, fill 250 mg into No. 2 hard capsules to obtain hard capsules. <Dosage> Take 2 capsules per day.

[0035] Comparative Example 1 Conventional Bilberry-containing Soft Capsules In the soft capsules of Prescription Example 1, replace the hot water extract of neem leaves (Production Example 1) with the ethanol extract of bilberry fruit 30% (Production Example 3) to obtain conventional bilberry-containing soft capsules.

[0036] Comparative Example 2 Conventional Soft Capsules In the soft capsules of Prescription Example 1, replace the hot water extract of neem leaves (Production Example 1) with linseed oil to obtain conventional soft capsules.

Example

[0037] Test Example 1 Promoting Effect of Neem on Mucin Production Culture corneal epithelial cells HCE-T in DMEM / HamF12 (hereinafter referred to as the medium) containing 5% fetal bovine serum, 5 μg / mL insulin, 10 ng / mL human EGF, and 0.5% dimethyl sulfoxide at 37 °C, 5% CO 2It was cultured under the following conditions. Subsequently, the medium was replaced with a solution in which the hot water extract of Nim leaves (Production Example 1) was dissolved to a concentration of 100 μg / mL, and the cells were cultured for 24 hours, followed by gene expression analysis. The gene expression analysis evaluated the gene expression variation of MUC16 (Mucin16), a membrane-type mucin, by real-time PCR. β-actin was used as an internal standard. The gene expression level without adding the sample was set to 1, and the gene expression level ratio was calculated.

[0038] Primer set for MUC16 GATGTCAAGCCAGGCAGCACAA (Sequence 1) GAGAGTGGTAGACATTTCTGGGC (Sequence 2) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (Sequence 3) GTGTTGGCGTACAGGTCTTTG (Sequence 4)

[0039] The results of Test Example 1 are shown in Table 1. The gene expression of MUC16 was enhanced by the hot water extract of Nim leaves (Production Example 1). Also, the gene expression of MUC16 was enhanced by the 30% ethanol extract of Nim leaves (Production Example 2). From the above results, a mucin production promoting effect was recognized in Nim.

[0040]

Table 1

[0041] Test Example 2 Mucin production reduction inhibitory effect and anti-inflammatory effect of blue light irradiation of Nim The corneal epithelial cells HCE-T were cultured in DMEM / HamF12 (hereinafter referred to as the medium) containing 5% fetal bovine serum, 5 μg / mL insulin, 10 ng / mL human EGF, and 0.5% dimethyl sulfoxide at 37 °C and 5% CO 2 under the following conditions. Subsequently, the medium was replaced with a solution in which the hot water extract of Nim leaves (Production Example 1) was dissolved to a concentration of 200 μg / mL, and after culturing for 30 minutes, blue light (blue LED) was irradiated at 4 J / cm 2It was irradiated. Then, it was cultured for 24 hours, and gene expression analysis was performed. For the gene expression analysis, the gene expression fluctuations of MUC16 (Mucin16), which is a membrane-type mucin, and inflammatory cytokines IL-1β (Interleukin 1 beta), IL-4 (Interleukin 4), and IL-6 (Interleukin 6) were evaluated by real-time PCR. β-actin was used as an internal standard. The gene expression level of the sample without addition without blue light irradiation was set to 1, and the gene expression level ratio was calculated.

[0042] Primer set for MUC16 GATGTCAAGCCAGGCAGCACAA (Sequence 1) GAGAGTGGTAGACATTTCTGGGC (Sequence 2) Primer set for IL-1β ACGAATCTCCGACCACCACTA (Sequence 5) GGCAGGGAACCAGCATCTT (Sequence 6) Primer set for IL-4 CCACGGACACAAGTGCGATA (Sequence 7) TCTTCTGCTCTGTGAGGCTGTTC (Sequence 8) Primer set for IL-6 ATGGCTGAAAAAGATGGATGCT (Sequence 9) GCTCTGGCTTGTTCCTCACTACTC (Sequence 10) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (Sequence 3) GTGTTGGCGTACAGGTCTTTG (Sequence 4)

[0043] The results of Test Example 2 are shown in Table 2. The gene expression of MUC16 decreased upon blue light irradiation, and the decrease was suppressed by the hot water extract of neem leaves (Production Example 1). The gene expressions of IL-1β, IL-4, and IL-6 increased upon blue light irradiation, and the increases were suppressed by the hot water extract of neem leaves (Production Example 1). Also, the decrease in the gene expression of MUC16 was suppressed by the 30% ethanol extract of neem leaves (Production Example 2), and the increases in the gene expressions of IL-1β, IL-4, and IL-6 were suppressed. From the above results, neem was found to have an effect of suppressing the decrease in mucin production caused by blue light irradiation and an effect of suppressing the inflammation caused by blue light irradiation.

[0044]

Table 2

[0045] Test Example 3 Inhibitory effect of neem on corneal epithelial cell damage caused by blue light irradiation Corneal epithelial cells HCE-T were cultured in DMEM / HamF12 (hereinafter referred to as the medium) containing 5% fetal bovine serum, 5 μg / mL insulin, 10 ng / mL human EGF, and 0.5% dimethyl sulfoxide at 37 °C and 5% CO 2 under conditions. Then, the medium was replaced with a solution in which the hot water extract of neem leaves (Production Example 1) was dissolved to a concentration of 200 μg / mL, and after culturing for 30 minutes, blue light (blue LED) was irradiated at 4 J / cm 2 2. Thereafter, the cells were cultured for 24 hours, and the cell viability was measured using Cell Counting Kit-8. The cell viability of the sample-untreated cells without blue light irradiation was calculated as 100%.

[0046] The results of Test Example 3 are shown in Table 3. The cell viability decreased upon blue light irradiation, and the decrease was suppressed by the hot water extract of neem leaves (Production Example 1). Also, the decrease in cell viability was suppressed by the 30% ethanol extract of neem leaves (Production Example 2). From the above results, neem was found to have an effect of suppressing corneal epithelial cell damage caused by blue light irradiation.

[0047]

Table 3

[0048] Test Example 4 Anti-inflammatory effect in the dry eye model of Nimu In dry eye, hyperosmolarity of the tear fluid occurs. Therefore, culture in a hyperosmolar medium is used as a dry eye model. In this test as well, a hyperosmolar medium supplemented with sodium chloride was used as the dry eye model. Corneal epithelial cells HCE-T were cultured in DMEM / HamF12 (hereinafter referred to as the medium) containing 5% fetal bovine serum, 5 μg / mL insulin, 10 ng / mL human EGF, and 0.5% dimethyl sulfoxide at 37 °C and 5% CO 2 conditions. Subsequently, the hyperosmolar medium supplemented with sodium chloride to a final concentration of 75 mM was replaced with a solution of the hot water extract of Nimu leaves (Production Example 1) dissolved to a concentration of 100 μg / mL. After culturing for 48 hours, gene expression analysis was performed. For gene expression analysis, the gene expression variation of TNFα (Tumor Necrosis Factor alpha), an inflammatory cytokine, was evaluated by real-time PCR method. β-actin was used as the internal standard. The gene expression level without sample addition in the normal medium (medium without sodium chloride addition) was set to 1, and the gene expression level ratio was calculated.

[0049] Primer set for TNFα GCAGGTCTACTTTGGGATCATTG (SEQ ID NO: 11) GCGTTTGGGAAGGTTGGAT (SEQ ID NO: 12) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 3) GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 4)

[0050] The results of Test Example 4 are shown in Table 4. The gene expression of TNFα increased in the hyperosmolar medium and was suppressed by the hot water extract of Nimu leaves (Production Example 1). Also, the increase in the gene expression of TNFα was suppressed by the 30% ethanol extract of Nimu leaves (Production Example 2). From the above results, Nimu was found to have an effect of suppressing the inflammation caused by dry eye.

[0051]

Table 4

[0052] Test Example 5 Inhibitory effect on corneal epithelial cell damage in the dry eye model of Nime Corneal epithelial cells HCE-T were cultured at 37 °C and 5% CO 2 under the condition in DMEM / HamF12 containing 5% fetal bovine serum, 5 μg / mL insulin, 10 ng / mL human EGF, and 0.5% dimethyl sulfoxide. Then, the high-osmotic pressure medium with sodium chloride added to a final concentration of 50 mM was replaced with a solution of the hot water extract of Nime leaves (Production Example 1) dissolved to 200 μg / mL, and cultured for 24 hours. The cell viability was measured using Cell Counting Kit-8. The cell viability without sample addition in the normal medium (medium without sodium chloride addition) was calculated as 100%.

[0053] The results of Test Example 5 are shown in Table 5. The cell viability decreased in the high-osmotic pressure medium, and the decrease was suppressed by the hot water extract of Nime leaves (Production Example 1). Also, the decrease in cell viability was suppressed by the 30% ethanol extract of Nime leaves (Production Example 2). From the above results, Nime was found to have an effect of suppressing corneal epithelial cell damage caused by dry eye.

[0054]

Table 5

[0055] Test Example 6 Effect of improving dry eye by human consumption Forty men and women (aged 25 to 65 years) who perform VDT (Visual Display Terminals) work and complain of dry eyes on a daily basis were divided into 4 groups of 10 each. Test group 1 was given soft capsules containing neem (Formulation Example 1), test group 2 was given soft capsules containing neem and bilberry (Formulation Example 2), test group 3 was given conventional bilberry-containing soft capsules (Comparative Example 1), and test group 4 was given conventional soft capsules (Comparative Example 2). Each group was made to ingest 3 soft capsules per day, and a questionnaire regarding dry eyes was conducted in the evening 3 months after ingestion. Regarding dry eyes, the subjects were asked to select one of the four levels: "greatly improved", "improved", "slightly improved", "no change or deteriorated" compared to before ingestion.

[0056] The results of Test Example 6 are shown in Table 6. The numbers in the table indicate the number of subjects. Compared with Test Group 4 (Comparative Example 2), in Test Group 1 (Formulation Example 1), Test Group 2 (Formulation Example 2), and Test Group 3 (Comparative Example 1), the number of people who answered "greatly improved", "improved", or "slightly improved" was large, and an improvement effect on dry eyes was recognized. Furthermore, in Test Group 2 (Formulation Example 2), the number of people who answered "greatly improved" was the largest, and an extremely excellent improvement effect on dry eyes was recognized. Therefore, neem showed an effect of improving dry eyes. Furthermore, the combination of neem and bilberry showed an extremely excellent effect of improving dry eyes.

[0057]

Table 6

[0058] Test Example 7 Effect of improving eye shine by human ingestion Forty men and women (aged 25 to 65) were divided into four groups of ten each. Test group 1 was given soft capsules containing neem (formulation example 1), test group 2 was given soft capsules containing neem and bilberry (formulation example 2), test group 3 was given conventional bilberry-containing soft capsules (comparative example 1), and test group 4 was given conventional soft capsules (comparative example 2). Each group was made to ingest three soft capsules per day, and face images were taken in the evening before ingestion and three months after ingestion. Based on the taken face images, three persons engaged in the external evaluation of cosmetics who were not involved in this test evaluated them. The evaluation method was to arrange the photos before ingestion and three months after ingestion side by side for the evaluators so that they did not know which was before ingestion and which was three months after ingestion, and regarding the sparkle of the eyes, one of "the photo on the right is more sparkling", "the photo on the left is more sparkling", or "both are equally sparkling" was selected by the three persons after discussion. The left and right arrangements of the photos were randomly arranged so that both before ingestion and three months after ingestion were arranged on the left and right the same number of times.

[0059] The results of Test Example 7 are shown in Table 7. The numbers in the table indicate the number of subjects. In Test Group 1 (Formulation Example 1), Test Group 2 (Formulation Example 2), and Test Group 3 (Comparative Example 1), more than half of the subjects evaluated that "it is more sparkling three months after ingestion", and an effect of improving the sparkle of the eyes was recognized. Furthermore, in Test Group 2 (Formulation Example 2), all subjects evaluated that "it is more sparkling three months after ingestion", and an excellent effect of improving the sparkle of the eyes was recognized. Therefore, neem showed an effect of improving the sparkle of the eyes. Furthermore, the combination of neem and bilberry showed an extremely excellent effect of improving the sparkle of the eyes.

[0060]

Table 7

Industrial Applicability

[0061] From the above, the present invention can be used as a dry eye ameliorating agent, an agent for improving eye brightness, a mucin production promoter, a corneal epithelial cell damage inhibitor, a dry eye ameliorating agent containing niam and bilberry, and an agent for improving eye brightness. Further, it can be used in foods, quasi-drugs, and pharmaceuticals containing these. Furthermore, it can also be used as a mucin production promoter and a corneal epithelial cell damage inhibitor in vitro.

Claims

1. An oral dry eye improvement agent characterized by containing neem.

2. An oral eye brightness improvement agent characterized by containing neem.

3. An oral mucin production promoter for corneal epithelium characterized by containing neem.

4. An oral corneal epithelial cell damage inhibitor characterized by containing neem.

5. The dry eye improvement agent according to Claim 1, characterized by containing bilberry.

6. The eye brightness improvement agent according to Claim 2, characterized by containing bilberry.

7. A food composition for improving dry eyes, improving eye brightness, promoting mucin production of corneal epithelium, or inhibiting corneal epithelial cell damage, characterized by containing the agent according to any one of Claims 1 to 6.

Citation Information

Patent Citations

  • Antiinflammatory and antipruritic agent composition

    JP1994199675A

  • Cyclooxygenase activity inhibitor

    JP2006076910A

  • Food / drink for antiobese use containing melia azadirachta l. extract

    JP2007091645A

  • Nerve growth factor inhibitor

    JP2016190823A

  • Composition for preventing or ameliorating dry eye or eye dryness, composition for preventing or ameliorating stiffness, and composition for preventing or ameliorating dry eye, eye dryness and stiffness

    JP2018154624A