Compositions and Methods for Treating Leber's Hereditary Optic Neuropathy
Recombinant nucleic acids targeting mitochondrial proteins within the retina, delivered via AAV vectors, aim to enhance the treatment of Leber hereditary optic neuropathy (LHON) by improving transfection efficiency and therapeutic efficacy.
Patent Information
- Application Number
- JP2023205807
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-01-04
- Filing Date
- 2023-12-06
- Publication Date
- 2025-06-11
- Estimated Expiration
- 2039-08-20
AI Technical Summary
Current treatments for Leber hereditary optic neuropathy (LHON) lack high transfection efficiency and therapeutic efficacy, primarily due to the mitochondrial nature of the disease and the specific mutations involved.
Development of recombinant nucleic acids comprising a mitochondrial targeting sequence, a mitochondrial protein coding sequence that is at least 99% identical to specific sequences, and a 3'UTR nucleic acid sequence, delivered via adeno-associated virus (AAV) vectors for enhanced gene therapy.
The proposed solution aims to achieve higher transfection efficiency and therapeutic efficacy in treating LHON by specifically targeting mitochondrial proteins within the retina, potentially leading to improved visual acuity recovery.
Smart Images

Figure 0007690713000072 
Figure 0007690713000073 
Figure 0007690713000074
Abstract
Description
Technical Field
[0001] Cross - Reference to Related Applications This application claims the benefit of PCT Application No. PCT / CN2018 / 103937 filed on September 4, 2018, PCT Application No. PCT / CN2018 / 113799 filed on November 2, 2018, Chinese Application No. CN201811230856.2 filed on October 22, 2018, PCT Application No. PCT / CN2018 / 118662 filed on November 30, 2018, Chinese Application No. CN201811221305.X filed on October 19, 2018, PCT Application No. PCT / CN2019 / 070461 filed on January 4, 2019, and Chinese Application No. CN201810948193.1 filed on August 20, 2018, and hereby incorporates by reference the entire contents of each of them herein.
[0002] Reference to Sequence Listing This application includes a sequence listing submitted in ASCII format via EFS - Web, which is hereby incorporated by reference in its entirety. The above ASCII copy was created on August 16, 2019, with the name WNBT - 005_02WO_ST25.txt and a size of 298 kb.
Background Art
[0003] Leber hereditary optic neuropathy (LHON) is a mitochondrial genetic (transmitted from mother to child) degeneration of retinal ganglion cells (RGCs) and their axons that causes acute or subacute central vision loss, mainly affecting young adult males. LHON is transmitted only through the mother because its main cause is a mutation in the mitochondrial genome (not the nuclear genome), and only the egg gives mitochondria to the embryo. LHON is mostly caused by one of three pathogenic mitochondrial DNA (mtDNA) point mutations. These mutations are at nucleotide positions 11778 G to A (G11778A), 3460 G to A (G3460A), and 14484 T to C (T14484C) in the subunit genes of NADH dehydrogenase subunit 4 protein (ND4), NADH dehydrogenase subunit 1 protein (ND1), and NADH dehydrogenase subunit 6 protein (ND6) of the oxidative phosphorylation chain in mitochondria, respectively. Each mutation is thought to have a significant risk of permanent vision loss. It usually progresses without pain over weeks to months and eventually leads to a visual acuity of less than 0.1 in both eyes, which has a significant impact on the patient's quality of life. The two LHON mutants G3460A and T14484C reduce the NADH dehydrogenase activity of mitochondria isolated from the patient's platelets by 80%. Ninety percent of Chinese LHON patients carry the G11778A mutation. The G11778A mutation changes arginine to histidine in the ND4 protein, resulting in dysfunction and optic nerve damage in LHON patients. There is a need to develop compositions and methods for treating LHON with higher transfection efficiency and therapeutic efficacy.
Summary of the Invention
Problems to be Solved by the Invention
[0004]
Means for Solving the Problems
[0005] This specification discloses recombinant nucleic acids, pharmaceutical compositions, and methods of treating LHON. In one aspect, this specification discloses a recombinant nucleic acid comprising a mitochondrial targeting sequence; a mitochondrial protein coding sequence comprising a sequence that is at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 10, and 12; and a 3'UTR nucleic acid sequence.
[0006] In some cases, the mitochondrial targeting sequence encodes a polypeptide comprising a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 129 - 159. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 3. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 5.
[0007] In certain cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8. In certain cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 10. In certain cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 12.
[0008] In certain cases, the 3’UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111 - 125. In certain cases, the 3’UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14.
[0009] In certain cases, the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 17 - 20, 23 - 24, 27 - 28, 31 - 34, 37 - 38, 41 - 42, 45 - 48, 51 - 52, 55 - 56, 59 - 62, 65 - 66, 69 - 70, 73 - 76, 79 - 80, and 83 - 84.
[0010] In another aspect herein, there is disclosed a recombinant nucleic acid comprising a mitochondrial targeting sequence comprising a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2, 3, 4, and 5; a mitochondrial protein coding sequence encoding a polypeptide comprising a mitochondrial protein; and a 3’UTR nucleic acid sequence.
[0011] In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 3. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 5.
[0012] In some cases, the mitochondrial protein is selected from the group consisting of NADH dehydrogenase 4 (ND4), NADH dehydrogenase 6 (ND6), NADH dehydrogenase 1 (ND1), and variants thereof. In some cases, the mitochondrial protein comprises NADH dehydrogenase 4 (ND4) or a variant thereof. In some cases, the mitochondrial protein comprises a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 160. In some cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 6, 7, or 8. In some cases, the mitochondrial protein comprises NADH dehydrogenase 6 (ND6) or a variant thereof. In some cases, the mitochondrial protein comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 161. In some cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 10. In some cases, the mitochondrial protein comprises NADH dehydrogenase 1 (ND1) or a variant thereof. In some cases, the mitochondrial protein comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 162. In some cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 11 or SEQ ID NO: 12.
[0013] In some cases, the 3'UTR nucleic acid sequence is located 3' to the mitochondrial targeting sequence. In some cases, the 3'UTR nucleic acid sequence comprises a sequence selected from the group consisting of hsACO2, hsATP5B, hsAK2, hsALDH2, hsCOX10, hsUQCRFS1, hsNDUFV1, hsNDUFV2, hsSOD2, hsCOX6c, hsIRP1, hsMRPS12, hsATP5J2, rnSOD2, and hsOXA1L. In some cases, the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111 to 125. In some cases, the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14.
[0014] In some cases, the mitochondrial targeting sequence is located 5' to the 3'UTR nucleic acid sequence. In some cases, the mitochondrial targeting sequence is located 3' to the mitochondrial targeting sequence.
[0015] In some cases, the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 29 to 84.
[0016] In another aspect herein, there is disclosed a recombinant nucleic acid comprising a mitochondrial targeting sequence; a mitochondrial protein coding sequence comprising a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 10, and 12; and a 3'UTR nucleic acid sequence.
[0017] In some cases, the mitochondrial targeting sequences are hsCOX10, hsCOX8, scRPM2, lcSirt5, tbNDUS7, ncQCR2, hsATP5G2, hsLACTB, spilv1, gmCOX2, crATP6, hsOPA1, hsSDHD, hsADCK3, osP0644B06.24-2, Neurospora crassa It includes a sequence encoding a polypeptide selected from the group consisting of ATP9 (ncATP9), hsGHITM, hsNDUFAB1, hsATP5G3, crATP6_hsADCK3, ncATP9_ncATP9, zmLOC100282174, ncATP9_zmLOC100282174_spilv1_ncATP9, zmLOC100282174_hsADCK3_crATP6_hsATP5G3, zmLOC100282174_hsADCK3_hsATP5G3, ncATP9_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6_hsATP5G3, crATP6_hsADCK3_zmLOC100282174_hsATP5G3, hsADCK3_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6, ncATP9_zmLOC100282174_spilv1_GNFP_ncATP9, and ncATP9_zmLOC100282174_spilv1_lcSirt5_osP0644B06.24-2_hsATP5G2_ncATP9. In some cases, the mitochondrial targeting sequence encodes a polypeptide comprising a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 129 to 159. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 5.
[0018] In certain cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8. In certain cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 10. In certain cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 12.
[0019] In certain cases, the 3’UTR nucleic acid sequence is located 3’ to the mitochondrial targeting sequence. In certain cases, the 3’UTR nucleic acid sequence comprises a sequence selected from the group consisting of hsACO2, hsATP5B, hsAK2, hsALDH2, hsCOX10, hsUQCRFS1, hsNDUFV1, hsNDUFV2, hsSOD2, hsCOX6c, hsIRP1, hsMRPS12, hsATP5J2, rnSOD2, and hsOXA1L. In certain cases, the 3’UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111 - 125. In certain cases, the 3’UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14.
[0020] In certain cases, the mitochondrial targeting sequence is located 5’ to the 3’UTR nucleic acid sequence. In certain cases, the mitochondrial targeting sequence is located 3’ to the mitochondrial targeting sequence.
[0021] In some cases, the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 17-20, 23-24, 27-28, 31-34, 37-38, 41-42, 45-48, 51-52, 55-56, 59-62, 65-66, 69-70, 73-76, 79-80, and 83-84.
[0022] In another aspect herein, there is disclosed a recombinant nucleic acid comprising a mitochondrial targeting sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 2, 3, and 4. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 3. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4.
[0023] In some cases, the recombinant nucleic acid further comprises a mitochondrial protein coding sequence, and the mitochondrial protein coding sequence encodes a polypeptide comprising a mitochondrial protein. In some cases, the mitochondrial protein is selected from the group consisting of NADH dehydrogenase 4 (ND4), NADH dehydrogenase 6 (ND6), NADH dehydrogenase 1 (ND1), and variants thereof. In some cases, the mitochondrial protein comprises NADH dehydrogenase 4 (ND4) or a variant thereof. In some cases, the mitochondrial protein comprises a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 160. In some cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 6, 7, or 8. In some cases, the mitochondrial protein comprises NADH dehydrogenase 6 (ND6) or a variant thereof. In some cases, the mitochondrial protein comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 161. In some cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 10. In some cases, the mitochondrial protein comprises NADH dehydrogenase 1 (ND1) or a variant thereof. In some cases, the mitochondrial protein comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 162. In some cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 11 or SEQ ID NO: 12.
[0024] In some cases, the recombinant nucleic acid further comprises a 3’UTR nucleic acid sequence. In some cases, the 3’UTR nucleic acid sequence is located 3’ to the mitochondrial targeting sequence. In some cases, the 3’UTR nucleic acid sequence comprises a sequence selected from the group consisting of hsACO2, hsATP5B, hsAK2, hsALDH2, hsCOX10, hsUQCRFS1, hsNDUFV1, hsNDUFV2, hsSOD2, hsCOX6c, hsIRP1, hsMRPS12, hsATP5J2, rnSOD2, and hsOXA1L. In some cases, the 3’UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111 to 125. In some cases, the 3’UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14 and comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14. In some cases, the mitochondrial targeting sequence is located 5’ to the 3’UTR nucleic acid sequence. In some cases, the mitochondrial targeting sequence is located 3’ to the mitochondrial targeting sequence.
[0025] In some cases, the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 29 to 70.
[0026] In another aspect herein, there is disclosed a recombinant nucleic acid comprising a mitochondrial protein coding sequence, wherein the mitochondrial protein coding sequence encodes a polypeptide comprising a mitochondrial protein and the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 10, and 12.
[0027] In some cases, the recombinant nucleic acid further comprises a mitochondrial targeting sequence. In some cases, the mitochondrial targeting sequence comprises a sequence encoding a polypeptide selected from the group consisting of hsCOX10, hsCOX8, scRPM2, lcSirt5, tbNDUS7, ncQCR2, hsATP5G2, hsLACTB, spilv1, gmCOX2, crATP6, hsOPA1, hsSDHD, hsADCK3, osP0644B06.24-2, Neurospora crassa ATP9 (ncATP9), hsGHITM, hsNDUFAB1, hsATP5G3, crATP6_hsADCK3, ncATP9_ncATP9, zmLOC100282174, ncATP9_zmLOC100282174_spilv1_ncATP9, zmLOC100282174_hsADCK3_crATP6_hsATP5G3, zmLOC100282174_hsADCK3_hsATP5G3, ncATP9_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6_hsATP5G3, crATP6_hsADCK3_zmLOC100282174_hsATP5G3, hsADCK3_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6, ncATP9_zmLOC100282174_spilv1_GNFP_ncATP9, and ncATP9_zmLOC100282174_spilv1_lcSirt5_osP0644B06.24-2_hsATP5G2_ncATP9. In some cases, the mitochondrial targeting sequence comprises a sequence encoding a polypeptide comprising a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 129 to 159. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 3.In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4. In some cases, the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 5.
[0028] In some cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8. In some cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 10. In some cases, the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 12.
[0029] In some cases, the recombinant nucleic acid further comprises a 3'UTR nucleic acid sequence. In some cases, the 3'UTR nucleic acid sequence is located 3' to the mitochondrial targeting sequence. In some cases, the 3'UTR nucleic acid sequence comprises a sequence selected from the group consisting of hsACO2, hsATP5B, hsAK2, hsALDH2, hsCOX10, hsUQCRFS1, hsNDUFV1, hsNDUFV2, hsSOD2, hsCOX6c, hsIRP1, hsMRPS12, hsATP5J2, rnSOD2, and hsOXA1L. In some cases, the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111-125. In some cases, the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14. In some cases, the mitochondrial targeting sequence is located 5' to the 3'UTR nucleic acid sequence. In some cases, the mitochondrial targeting sequence is located 3' to the mitochondrial targeting sequence.
[0030] In some cases, the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 17-20, 23-24, 27-28, 31-34, 37-38, 41-42, 45-48, 51-52, 55-56, 59-62, 65-66, 69-70, 73-76, 79-80, and 83-84.
[0031] In another aspect, the present specification discloses a viral vector comprising a recombinant nucleic acid disclosed herein. In certain cases, the viral vector is an adeno-associated virus (AAV) vector. In certain cases, the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16 vectors. In certain cases, the AAV vector is a recombinant AAV (rAAV) vector. In certain cases, the rAAV vector is an rAAV2 vector.
[0032] In another aspect, the present specification discloses a pharmaceutical composition comprising an adeno-associated virus (AAV) comprising any recombinant nucleic acid disclosed herein. In certain cases, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient thereof. Also disclosed is a pharmaceutical composition comprising a viral vector disclosed herein and a pharmaceutically acceptable excipient thereof, wherein the viral vector comprises any recombinant nucleic acid disclosed herein. Also disclosed is a pharmaceutical composition comprising an adeno-associated virus (AAV) comprising any recombinant nucleic acid disclosed herein, wherein the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 15, and further comprising a pharmaceutically acceptable excipient.
[0033] In certain cases, the pharmaceutically acceptable excipient is phosphate buffered saline (PBS), α,α-trehalose dehydrate, L-histidine monohydrochloride monohydrate, polysorbate 20, NaCl, NaH 2 PO 4 、Na 2 HPO 4 、KH 2 PO 4 、K 2 HPO 4, including poloxamer 188 or any combination thereof. In certain cases, the pharmaceutically acceptable excipient is phosphate buffered saline (PBS), α,α-trehalose dihydrate (α,α-trehalose dehydrate ), L-histidine monohydrochloride monohydrate, polysorbate 20, NaCl, NaH 2 PO 4 , Na 2 HPO 4 , KH 2 PO 4 , K 2 HPO 4 , selected from poloxamer 188 and any combination thereof. In certain cases, the pharmaceutically acceptable excipient contains poloxamer 188. In certain cases, the pharmaceutically acceptable excipient contains 0.0001 to 0.01% of poloxamer 188. In certain cases, the pharmaceutically acceptable excipient contains 0.001% of poloxamer 188. In certain cases, the pharmaceutically acceptable excipient further contains one or more salts. In certain cases, the one or more salts are NaCl, NaH 2 PO 4 , Na 2 HPO 4 and KH 2 PO 4 . In certain cases, the one or more salts are 80 mM of NaCl, 5 mM of NaH 2 PO 4 , 40 mM of Na 2 HPO 4 , and 5 mM of KH 2 PO 4 . In certain cases, the one or more salts are NaCl, Na 2 HPO 4 and KH 2 PO 4 . In certain cases, the one or more salts are 154 mM of NaCl, 5.6 mM of Na 2 HPO 4 , and 8.4 mM of KH 2 PO 4It includes. In certain cases, the pH of the pharmaceutical composition is 6 - 8. In certain cases, the pH of the pharmaceutical composition is 7.2 - 7.4. In certain cases, the pH of the pharmaceutical composition is 7.3. In certain cases, the viral titer of the pharmaceutical composition is at least 1.0×10 10 vg / mL. In certain cases, the viral titer of the pharmaceutical composition is at least 5.0×10 10 vg / mL.
[0034] In certain cases, the pharmaceutical composition is subjected to 5 freeze / thaw cycles, and the pharmaceutical composition retains at least 60%, 70%, 80% or 90% of the viral titer compared to the viral titer before the 5 freeze / thaw cycles. In certain cases, the pharmaceutical composition, when administered to patients with Leber's hereditary optic neuropathy, results in a higher average visual acuity recovery compared to an equivalent pharmaceutical composition that does not contain recombinant nucleic acid. In certain cases, the pharmaceutical composition, when administered to patients with Leber's hereditary optic neuropathy, results in a higher average visual acuity recovery compared to an equivalent pharmaceutical composition containing the recombinant nucleic acid shown in SEQ ID NO: 15.
[0035] In another aspect herein, a method for treating an eye disorder is disclosed, which includes administering to a patient in need thereof any of the pharmaceutical compositions disclosed herein. In certain cases, the eye disorder is Leber's hereditary optic neuropathy (LHON). In certain cases, the method includes administering the pharmaceutical composition to one or both eyes of the patient. In certain cases, the pharmaceutical composition is administered by intraocular or intravitreal injection. In certain cases, the pharmaceutical composition is administered by intravitreal injection. In certain cases, about 0.01 - 0.1 mL of the pharmaceutical composition is administered by intravitreal injection. In certain cases, about 0.05 mL of the pharmaceutical composition is administered by intravitreal injection.
[0036] In some cases, the method further comprises administering methylprednisolone to the patient. In some cases, methylprednisolone is administered prior to intravitreal injection of the pharmaceutical composition. In some cases, methylprednisolone is administered orally. In some cases, methylprednisolone is administered daily for at least 1, 2, 3, 4, 5, 6, or 7 days prior to intravitreal injection of the pharmaceutical composition. In some cases, methylprednisolone is administered daily. In some cases, a daily dosage of about 32 mg / 60 kg of methylprednisolone is administered. In some cases, methylprednisolone is administered after intravitreal injection of the pharmaceutical composition. In some cases, the method further comprises administering sodium creatine phosphate to the patient. In some cases, sodium creatine phosphate is administered intravenously. In some cases, methylprednisolone is administered intravenously or orally. In some cases, the method comprises administering methylprednisolone intravenously for at least 1 day and then administering methylprednisolone orally for at least 1 week. In some cases, the method comprises administering methylprednisolone intravenously for about 3 days and then administering methylprednisolone orally for at least about 6 weeks. In some cases, methylprednisolone is administered intravenously at a daily dose of about 80 mg / 60 kg. In some cases, administering the pharmaceutical composition results in a higher mean visual acuity recovery compared to an equivalent pharmaceutical composition that does not contain a recombinant nucleic acid. In some cases, administering the pharmaceutical composition results in a higher mean visual acuity recovery compared to an equivalent pharmaceutical composition that contains the recombinant nucleic acid set forth in SEQ ID NO: 15.
[0037] In some embodiments, the present disclosure provides a method for treating an eye disorder, the method comprising administering to a patient in need thereof: (a) a first pharmaceutical composition comprising an adeno-associated virus (AAV) comprising a recombinant nucleic acid comprising (i) a nucleic acid sequence encoding a mitochondrially-targeted peptide, (ii) a nucleic acid sequence encoding a mitochondrial protein, the nucleic acid sequence being at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 6-12, and (iii) a 3’UTR nucleic acid sequence; and (b) a second pharmaceutical composition comprising a steroid.
[0038] In some embodiments, the nucleic acid sequence encoding the mitochondrial protein encodes a polypeptide comprising an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 160-162. In some embodiments, the nucleic acid sequence encoding the mitochondrially-targeted peptide encodes a polypeptide comprising an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 126-159. In some embodiments, the nucleic acid sequence encoding the mitochondrially-targeted peptide comprises a nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-5. In some embodiments, the 3’UTR nucleic acid sequence comprises a nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 13, 14, and 111-125.
[0039] In some embodiments, the present disclosure provides a method for treating an eye disorder, the method comprising administering to a patient in need thereof: (a) a first pharmaceutical composition comprising an adeno-associated virus (AAV) comprising a recombinant nucleic acid comprising (i) a nucleic acid sequence encoding a mitochondrially-targeted peptide comprising an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 126 to 159, (ii) a nucleic acid sequence encoding a mitochondrial protein, and (iii) a 3'UTR nucleic acid sequence; and (b) a second pharmaceutical composition comprising a steroid.
[0040] In some embodiments, the mitochondrial protein is selected from the group consisting of NADH dehydrogenase 4 (ND4), NADH dehydrogenase 6 (ND6), NADH dehydrogenase 1 (ND1), and variants thereof. In some embodiments, the nucleic acid sequence encoding the mitochondrial protein comprises a nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 6 to 12. In some embodiments, the nucleic acid sequence encoding the mitochondrial protein encodes a polypeptide comprising an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 160 to 162. In some embodiments, the nucleic acid sequence encoding the mitochondrially-targeted peptide comprises a nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1 to 5. In some embodiments, the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 13, 14, and 111 to 125.
[0041] In some embodiments, the present disclosure provides a method for treating an eye disorder, the method comprising administering to a patient in need thereof To a patient in need thereof, a first pharmaceutical composition comprising an adeno-associated virus (AAV) comprising a recombinant nucleic acid comprising (a) (i) a nucleic acid sequence encoding a mitochondrially targeted peptide comprising an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 126 to 159, (ii) a nucleic acid sequence encoding a mitochondrial protein comprising a nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 6 to 12, and (iii) a 3'UTR nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 13, 14, and 111 to 125, and (b) a second pharmaceutical composition comprising a steroid. The method comprises administering the second pharmaceutical composition.
[0042] In some embodiments, the present disclosure provides a method of treating an eye disorder, the method comprising administering to a patient in need thereof: (a) a first pharmaceutical composition comprising an adeno-associated virus (AAV) comprising a recombinant nucleic acid comprising (i) a nucleic acid sequence encoding a mitochondrially targeted peptide and (ii) a nucleic acid sequence encoding a mitochondrial protein; and (b) a second pharmaceutical composition comprising a steroid. In some embodiments, the mitochondrial protein is selected from the group consisting of NADH dehydrogenase 4 (ND4), NADH dehydrogenase 6 (ND6), NADH dehydrogenase 1 (ND1), and variants thereof. In some embodiments, the 3'UTR nucleic acid sequence comprises a nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 13, 14, and 111 to 125.
[0043] In some embodiments, the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 15-84. In some embodiments, the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO: 15.
[0044] In some embodiments, the first pharmaceutical composition is administered by intravitreal or intracameral injection. In some embodiments, about 0.01 - 0.1 mL of the first pharmaceutical composition is administered by intravitreal injection. In some embodiments, about 0.05 mL of the first pharmaceutical composition is administered by intravitreal injection. In some embodiments, the first pharmaceutical composition is administered to one or both eyes of a patient.
[0045] In some embodiments, the steroid is alclometasone dipropionate, amcinonide, beclomethasone dipropionate, betamethasone, betamethasone benzoate, betamethasone dipropionate, betamethasone sodium phosphate, betamethasone sodium phosphate and acetate, betamethasone valerate, clobetasol propionate, clocortolone pivalate, cortisol (hydrocortisone), cortisone acetate (hydrocortisone), cortisone butyrate (hydrocortisone), cortisone cypionate (hydrocortisone), cortisone sodium phosphate (hydrocortisone), cortisone sodium succinate (hydrocortisone), cortisone valerate (hydrocortisone), cortisone acetate, desonide, desoxymethasone, dexamethasone, dexamethasone acetate, dexamethasone sodium phosphate, diflorasone diacetate, fludrocortisone acetate, fluocinonide, fluocinolone acetonide, fluocinide, fluorometholone, flurandrenolide, halcinonide, medrysone, methylprednisolone, methylprednisolone acetate, methylprednisolone sodium succinate, mometasone furoate, paramethasone acetate, prednisolone, prednisolone acetate, prednisolone sodium phosphate, prednisolone tebutate, prednisone, triamcinolone, triamcinolone acetonide, triamcinolone diacetate, and triamcinolone hexacetonide or a synthetic analog thereof, selected from the group consisting of is effected.
[0046] In some embodiments, the steroid is a glucocorticoid. In some embodiments, the glucocorticoid is methylprednisolone or prednisone.
[0047] In some embodiments, methylprednisolone is formulated as a tablet or as a solution for intravenous administration. In some embodiments, the steroid is administered orally or intravenously.
[0048] In some embodiments, the steroid is administered before the administration of the first pharmaceutical composition. In some embodiments, the steroid is administered daily for at least 1, 2, 3, 4, 5, 6, or 7 days before the administration of the first pharmaceutical composition. In some embodiments, the steroid is methylprednisolone and is administered at a daily dosage of about 30 mg / 60 kg to about 40 mg / 60 kg, or about 30 mg to about 40 mg. In some embodiments, the daily dosage of methylprednisolone is about 32 mg / 60 kg or 32 mg. In some embodiments, the steroid is prednisone and is administered at a daily dosage of about 50 mg / 60 kg to about 70 mg / 60 kg. In some embodiments, the daily dosage of prednisone is about 60 mg / 60 kg.
[0049] In some embodiments, the steroid is administered after the administration of the first pharmaceutical composition. In some embodiments, the steroid is administered daily for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, at least 13 weeks, at least 14 weeks, or at least 15 weeks after the administration of the first pharmaceutical composition.
[0050] In some embodiments, the steroid is methylprednisolone and is administered at a daily dosage of about 70 mg / 60 kg to 90 mg / 60 kg, or about 70 mg to 90 mg. In some embodiments, the daily dosage of methylprednisolone is about 80 mg / 60 kg or 80 mg. In some embodiments, methylprednisolone is administered for at least 2 days after the administration of the first pharmaceutical composition. In some embodiments, subsequent doses of methylprednisolone are administered daily for at least 7 weeks after the administration of the first pharmaceutical composition and the dosage of methylprednisolone is reduced weekly.
[0051] In some embodiments, the steroid is prednisone and is administered at a daily dosage of about 50 mg / 60 kg to 70 mg / 60 kg, or about 50 mg to about 70 mg. In some embodiments, the daily dosage of prednisone is about 60 mg / 60 kg or about 60 mg. In some embodiments, prednisone is administered for at least 7 days after administration of the first pharmaceutical composition. In some embodiments, after 7 days, prednisone is administered at a daily dosage of about 30 mg / 60 kg to about 50 mg / 60 kg, or about 30 mg to 50 mg. In some embodiments, the daily dosage of prednisone is about 40 mg / 60 kg or 40 mg. In some embodiments, subsequent doses of prednisone are administered daily for at least 4 days and the dosage of prednisone is reduced daily.
[0052] In some embodiments, the steroid is administered before and after administration of the first pharmaceutical formulation.
[0053] In some embodiments, the steroid is methylprednisolone and the first pharmaceutical formulation It is administered daily for at least 7 days before the administration of the first pharmaceutical composition and daily for at least 7 weeks after the administration of the first pharmaceutical composition. In some embodiments, methylprednisolone is administered at a daily dosage of about 32 mg / 60 kg or 32 mg before the administration of the first pharmaceutical composition. In some embodiments, methylprednisolone is administered at a daily dosage of about 80 mg / 60 kg or 80 mg for at least 2 days after the administration of the first pharmaceutical composition. In some embodiments, methylprednisolone is administered at a daily dosage of about 40 mg / 60 kg or 40 mg for at least 4 days starting 3 days after the administration of the first pharmaceutical composition. In some embodiments, methylprednisolone is administered at a daily dosage of about 32 mg / 60 kg or 32 mg for at least 1 week starting 1 week after the administration of the first pharmaceutical composition. In some embodiments, methylprednisolone is administered at a daily dosage of about 24 mg / 60 kg or 24 mg for at least 1 week starting 2 weeks after the administration of the first pharmaceutical composition. In some embodiments, methylprednisolone is administered at a daily dosage of about 16 mg / 60 kg or 16 mg for at least 1 week starting 3 weeks after the administration of the first pharmaceutical composition. In some embodiments, methylprednisolone is administered at a daily dosage of about 8 mg / 60 kg or 8 mg for at least 1 week starting 4 weeks after the administration of the first pharmaceutical composition. In some embodiments, methylprednisolone is administered at a daily dosage of about 6 mg / 60 kg or 6 mg for at least 1 week starting 5 weeks after the administration of the first pharmaceutical composition. In some embodiments, methylprednisolone is administered at a daily dosage of about 4 mg / 60 kg or 4 mg for at least 1 week starting 6 weeks after the administration of the first pharmaceutical composition.
[0054] In some embodiments, the steroid is prednisone and is administered daily for at least 2 days prior to administration of the first pharmaceutical formulation and daily for at least 11 days after administration of the first pharmaceutical formulation. In some embodiments, prednisone is administered at a daily dosage of about 60 mg / 60 kg or 60 mg prior to administration of the first pharmaceutical formulation. In some embodiments, prednisone is administered at a daily dosage of about 60 mg / 60 kg or 60 mg for at least 7 days after administration of the first pharmaceutical formulation. In some embodiments, prednisone is administered at a daily dosage of about 40 mg / 60 kg or 40 mg for at least 1 day 8 days after administration of the first pharmaceutical formulation. In some embodiments, prednisone is administered at a daily dosage of about 20 mg / 60 kg or 20 mg for at least 1 day 9 days after administration of the first pharmaceutical formulation. In some embodiments, prednisone is administered at a daily dosage of about 10 mg / 60 kg or 10 mg for at least 1 day 10 days after administration of the first pharmaceutical formulation.
[0055] In some embodiments, the method further comprises administering sodium creatine phosphate to the patient. In some embodiments, sodium creatine phosphate is administered intravenously before and / or after administration of the first pharmaceutical composition.
[0056] In some embodiments, administration of the first and second pharmaceutical compositions results in a higher mean visual acuity recovery compared to an equivalent pharmaceutical composition administered without the second pharmaceutical composition. In some embodiments, administration of the first and second pharmaceutical compositions results in a lower incidence of side effects compared to an equivalent pharmaceutical composition administered without the second pharmaceutical composition. In some embodiments, the side effects are selected from anterior chamber inflammation, vitritis, ocular hypertension, cataract removal, keratitis, vitreous hemorrhage, allergic conjunctivitis, and eye pain. In some embodiments, a higher mean visual acuity recovery and a lower incidence of side effects are observed in the patient population with eye disorders. In some embodiments, the patient population is ethnically homogeneous. In some embodiments, the patient population is Chinese or Argentine.
[0057] In some embodiments, the eye disorder is Leber hereditary optic neuropathy (LHON). In some embodiments, the AAV is selected from AAV1, AAV2, AAV3, AAV4, AAV5, A AV6, AAV7, AA8, AAV9, and AAV10. In some embodiments, the AAV is AAV2.
[0058] In some embodiments, the present disclosure provides a method of screening a patient for the treatment of an eye disorder, comprising: (a) obtaining a serum sample from the patient; (b) culturing a population of target cells in the presence of the serum sample with a composition comprising an adeno-associated virus (AAV) comprising a recombinant nucleic acid encoding a detectable label; and (c) detecting an expression level of the detectable label in the target cell population after culturing, wherein the patient is selected for treatment if the expression level of the detectable label in the target cell population is higher than a predetermined threshold.
[0059] In some embodiments, the present disclosure provides a method of screening a patient for the treatment of an eye disorder, comprising: (a) culturing a population of target cells in the presence of a serum sample from the patient with a composition comprising an adeno-associated virus (AAV) comprising a recombinant nucleic acid encoding a detectable label; and (b) detecting an expression level of the detectable label in the target cell population after culturing, wherein the patient is selected for treatment if the expression level of the detectable label in the target cell population is higher than a predetermined threshold.
[0060] In some embodiments, the present disclosure provides a method of treating an eye disorder in a patient in need thereof, comprising: (a) obtaining a serum sample from the patient; (b) culturing a population of target cells in the presence of the serum sample with a composition comprising a first adeno-associated virus (AAV) comprising a first recombinant nucleic acid encoding a detectable label; (c) detecting an expression level of the detectable label in the target cell population; and (d) administering to the patient a pharmaceutical composition comprising a second AAV comprising a second recombinant nucleic acid, wherein the expression level of the detectable label in the target cell population is higher than a predetermined threshold.
[0061] In some embodiments, the present disclosure provides a method of treating an eye disorder for a patient in need thereof, the method comprising: (a) culturing a population of target cells in the presence of a serum sample from the patient with a composition comprising a first adeno-associated virus (AAV) comprising a first recombinant nucleic acid encoding a detectable label; (b) detecting the expression level of the detectable label in the population of target cells; and (c) administering to the patient a pharmaceutical composition comprising a second AAV comprising a second recombinant nucleic acid, wherein the expression level of the detectable label in the population of target cells is higher than a predetermined threshold.
[0062] In some embodiments, the detectable label is a fluorescent protein. In some embodiments, the fluorescent protein is green fluorescent protein (GFP). In some embodiments, the detectable label is detected by flow cytometry or qPCR. In some embodiments, the culturing step is for at least 12 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or longer.
[0063] In some embodiments, the predetermined threshold is about 40% of the cells in which the detectable label is expressed when detected by flow cytometry. In some embodiments, the predetermined threshold is a relative expression level of about 0.6 of the detectable label when detected by qPCR. In some embodiments, the target cells are HEK-293T cells.
[0064] In some embodiments, the treatment is a recombinant AAV comprising a nucleic acid sequence encoding a mitochondrial protein. In some embodiments, the mitochondrial protein is selected from the group consisting of NADH dehydrogenase 4 (ND4), NADH dehydrogenase 6 (ND6), NADH dehydrogenase 1 (ND1), and variants thereof. In some embodiments, the patient comprises a mutation selected from G11778A in the ND4 gene, G3460A in the ND1 gene, and T14484C in the ND6 gene.
[0065] In some embodiments, the present disclosure provides a kit comprising an adeno-associated virus (AAV) comprising a recombinant nucleic acid encoding a detectable label, a population of target cells, and one or more reagents for detecting the detectable label. In some embodiments, the kit further comprises a transfection reagent for transfecting the population of target cells with the AAV. In some embodiments, the kit further comprises a second AAV comprising a recombinant nucleic acid encoding a mitochondrial protein. In some embodiments, the one or more reagents for detecting the detectable label are selected from an antibody that binds to the detectable label and one or more primer oligonucleotides specific for the recombinant nucleic acid encoding the detectable label.
[0066] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the invention will be obtained from the following detailed description that illustrates exemplary embodiments of the invention and the accompanying drawings thereof.
Brief Description of the Drawings
[0067]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Figure 20
[0068] Definitions Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Any methods and materials similar to or equivalent to those described herein can be used in the practice or testing of the formulations or unit doses herein, but some methods and materials are described herein. Unless otherwise noted, the techniques used or contemplated herein are standard techniques. The materials, methods, and examples are illustrative only and not limiting.
[0069] As used herein and in the appended claims, the singular forms "a," "and," and "the" include plural meanings unless the context clearly dictates otherwise. Thus, for example, reference to "a compound" includes reference to a plurality of such agents, and reference to "a salt" includes reference to one or more salts (or plural salts) and equivalents thereof known to those of ordinary skill in the art, and the like.
[0070] As used herein, the term "or" can be conjunctive or disjunctive unless otherwise indicated. As used herein, any embodiment can be combined with any other embodiment unless otherwise indicated.
[0071] As used herein, some embodiments of the present invention described herein contemplate numerical ranges unless otherwise indicated. When ranges are provided, the ranges include their endpoints. In addition, every sub-range and value within the range exists as if explicitly written out.
[0072] The term "about" and its grammatical equivalents with respect to a reference numerical value, as used herein, can include a range of values from 10% above to 10% below that value, e.g., a range of values from 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% above or below that value. For example, "about 10" includes amounts from 9 to 11.
[0073] The term "comprising" (and related terms such as "comprise", "comprises", "having", or "including") is not intended to exclude that in other particular embodiments an embodiment, such as any composition, composition, method or process described herein, may consist of or consist essentially of the features described.
[0074] The term "subject" refers to a mammal that has been or is to be a subject of treatment, observation or experiment. The term "mammal" is intended to have its standard meaning and includes, for example, humans, dogs, cats, sheep and cows. The methods described herein may be useful in both human therapy and veterinary applications. In some embodiments, the subject is a human.
[0075] The term "treating" or "treatment" refers to at least one administering a compound or a pharmaceutically acceptable salt thereof to a mammalian subject, particularly a human subject, in need thereof, including (i) arresting the progression of clinical symptoms of a disease such as cancer, (ii) bringing about regression of clinical symptoms of a disease such as cancer, and / or (iii) including prophylactic treatment for preventing the onset of a disease such as cancer.
[0076] The term "therapeutically effective amount" of a chemical entity described herein refers to an amount effective to provide a therapeutic benefit such as improvement of symptoms, deceleration of disease progression, or prevention of a disease when administered to a human or non-human subject.
[0077] As used herein, the terms "nucleic acid" and "polynucleotide" may be used interchangeably unless otherwise indicated.
[0078] As used herein, unless otherwise indicated, a drug dosage of X mg / 60 kg refers to X mg of a drug per 60 kg of a patient's body weight. For example, a drug dosage of 100 mg / 60 kg means instructing a patient weighing 60 kg to take 100 mg of the drug, and thus, instructing another patient weighing 30 kg to take 50 mg of the drug.
[0079] Nucleic acid and polypeptide sequences Table 1 discloses all nucleic acid and polypeptide sequences disclosed herein. The first column shows the sequence numbers of each sequence. The second column represents the nucleic acid or polypeptide construct. For example, the construct COX10-ND6-3’UTR is a nucleic acid that combines the nucleic acid sequences of COX10 (SEQ ID NO: 1), ND6 (SEQ ID NO: 9), and 3’UTR (SEQ ID NO: 13) from 5’ to 3’ without a linker between the nucleic acid sequences.
[0080] [Table 1] JPEG0007690713000002.jpg 214164 JPEG0007690713000003.jpg 199170 JPEG0007690713000004.jpg 228169 JPEG0007690713000005.jpg 221170 JPEG0007690713000006.jpg 185170 JPEG0007690713000007.jpg 229170 JPEG0007690713000008.jpg 223166 JPEG0007690713000009.jpg 214168 JPEG0007690713000010.jpg 210168 JPEG0007690713000011.jpg 226169 JPEG0007690713000012.jpg 201170 JPEG0007690713000013.jpg 226170 JPEG0007690713000014.jpg 204168 JPEG0007690713000015.jpg 184169 JPEG0007690713000016.jpg 225168 JPEG0007690713000017.jpg 226169 JPEG0007690713000018.jpg 212170 JPEG0007690713000019.jpg 212169 JPEG0007690713000020.jpg 225169 JPEG0007690713000021.jpg 198167 JPEG0007690713000022.jpg 225170 JPEG0007690713000023.jpg 199167 JPEG0007690713000024.jpg 184168 JPEG0007690713000025.jpg 226170 JPEG0007690713000026.jpg 224169 JPEG0007690713000027.jpg 211168 JPEG0007690713000028.jpg 225170 JPEG0007690713000029.jpg 228169 JPEG0007690713000030.jpg 200169 JPEG0007690713000031.jpg 226168 JPEG0007690713000032.jpg 199169 JPEG0007690713000033.jpg 185169 JPEG0007690713000034.jpg227170JPEG0007690713000035.jpg225168JPEG0007690713000036.jpg215169JPEG0007690713000037.jpg225169JPEG0007690713000038.jpg222168JPEG0007690713000039.jpg226169JPEG0007690713000040.jpg228170JPEG0007690713000041.jpg183168JPEG0007690713000042.jpg194168JPEG0007690713000043.jpg227168JPEG0007690713000044.jpg224168JPEG0007690713000045.jpg228170JPEG0007690713000046.jpg224168JPEG0007690713000047.jpg219169JPEG0007690713000048.jpg224168JPEG0007690713000049.jpg229170JPEG0007690713000050.jpg199170JPEG0007690713000051.jpg228167JPEG0007690713000052.jpg222169JPEG0007690713000053.jpg229169JPEG0007690713000054.jpg225167JPEG0007690713000055.jpg141167.
[0081] Adeno-associated virus (AAV) Adeno-associated virus (AAV) is a small virus that infects humans and several other primate species. The compositions disclosed herein first comprise an adeno-associated virus (AAV) genome or a derivative thereof.
[0082] AAV genome is a polynucleotide sequence that encodes functions required for the production of AAV viral particles. These functions include those that act in the replication and packaging cycle of AAV in host cells, including the encapsidation of the AAV genome into AAV viral particles. Naturally occurring AAV viruses are growth-defective and depend on the provision of helper functions in trans for the completion of the replication and packaging cycle. Therefore, the AAV genome of the vector of the present invention is typically growth-defective.
[0083] The AAV genome can be in a single-stranded form, either positive or negative sense, or in a double-stranded form, which allows bypassing the DNA replication step in the target cell and therefore accelerates transgene expression.
[0084] The AAV genome may be from any naturally occurring serotype or isolate or grade of AAV.Therefore, the AAV genome may be the whole genome of naturally occurring AAV virus.As known to those skilled in the art, naturally occurring AAV virus can be classified according to various biological systems.
[0085] AAV viruses are generally designated by their serotypes. Serotypes are determined by the sequence of the capsid surface antigen. These represent variant subtypes of AAV with unique reactivity that can be used to distinguish them from other variant subtypes due to their original expression profile. Usually, viruses with a particular AAV serotype do not cross-react efficiently with neutralizing antibodies specific for any other AAV serotype. AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, as well as recombinant serotypes recently identified from primate brains, such as Rec2 and Rec3.
[0086] A desirable serotype of AAV for use in the present invention is AAV2. Other serotypes of particular interest for use in the present invention include AAV4, AAV5, and AAV8, which efficiently transduce intraocular tissues such as the retinal pigment epithelium. The serotype of AAV used may be an AAV serotype other than AAV4. A review of AAV serotypes can be found in Choi et al (Curr Gene Ther. 2005;5(3);299-310), and Wu et al (Molecular Therapy. 2006;14(3),316-327). The sequence of the AAV genome, or elements of the AAV genome including the ITR sequence, rep or cap gene, for use in the present invention may be derived from the following accession numbers of the AAV full genome sequence: adeno-associated virus 1 NC_002077, AF063497; adeno-associated virus 2 NC_001401; adeno-associated virus 3 NC_001729; adeno-associated virus 3B NC_001863; adeno-associated virus 4 NC_001829; adeno-associated virus 5 Y18065, AF085716; adeno-associated virus 6 NC_001862; avian AAV ATCC VR-865 AY186198, AY629583, NC_004828; avian AAV strain DA-1 NC_006263, AY629583; bovine AAV NC_005889, AY388617.
[0087] AAV viruses may also be designated by clade or clone. This represents the phylogenetic relatedness of naturally occurring AAV viruses and typically represents a group of phylogenetic AAV viruses that can be traced back to a common ancestor and includes all of its descendants. In addition, AAV viruses may be designated by a particular isolate, i.e., a genetic isolate of a particular AAV virus found in nature. The term genetic isolate represents a population of AAV viruses that has undergone limited genetic mixing with other naturally occurring AAV viruses, thereby defining a population that is distinguishable at the gene level.
[0088] Examples of AAV cradles and isolates that can be used in the present invention include Cradle A: AAV1 NC_002077, AF063497, AAV6 NC_001862, Hu.48 AY530611, Hu43 AY530606, Hu44 AY530607, Hu46 AY530609; Cradle B: Hu.19 AY530584, Hu.20 AY530586, Hu23 AY530589, Hu22 AY530588, Hu24 AY530590, Hu21 AY530587, Hu27 AY530592, Hu28 AY530593, Hu29 AY530594, Hu63 AY530624, Hu64 AY530625, Hu13 AY530578, Hu56 AY530618, Hu57 AY530619, Hu49 AY530612, Hu58 AY530620, Hu34 AY530598, Hu35 AY530599, AAV2 NC_001401, Hu45 AY530608, Hu47 AY530610, Hu51 AY530613, Hu52 AY530614, Hu T41 AY695378, Hu S17 AY695376, Hu T88 AY695375, Hu T71 AY695374, Hu T70 AY695373, Hu T40 AY695372, Hu T32 AY695371, Hu T17 AY695370, Hu LG15 AY695377; Cradle C: Hu9 AY530629, Hu10 AY530576, Hu11 AY530577, Hu53 AY530615, Hu55 AY530 617, Hu54 AY530616, Hu7 AY530628, Hu18 AY530583, Hu15 AY530580, Hu16 AY530581, Hu25 AY530591, Hu60 AY530622, Ch5 AY243021, Hu3 AY530595, Hu1 AY530575, Hu4 AY530602 Hu2, AY530585, Hu61 AY530623; Clade D: Rh62 AY530573, Rh48 AY530561, Rh54 AY530567, Rh55 AY530568, Cy2 AY243020, AAV7 AF513851, Rh35 AY243000, Rh37 AY242998, Rh36 AY242999, Cy6 AY243016, Cy4 AY243018, Cy3 AY243019, Cy5 AY243017, Rh13 AY243013; Clade E: Rh38 AY530558, Hu66 AY530626, Hu42 AY530605, Hu67 AY530627, Hu40 AY530603, Hu41 AY530604, Hu37 AY530600, Rh40 AY530559, Rh2 AY243007, Bb1 AY243023, Bb2 AY243022, Rh10 AY243015, Hu17 AY530582, Hu6 AY530621, Rh25 AY530557, Pi2 AY530554, Pi1 AY530553, Pi3 AY530555, Rh57 AY530569, Rh50 AY530563, Rh49 AY530562, Hu39 AY530601, Rh58 AY530570, Rh61 AY530572, Rh52 AY530565, Rh53 AY530566, Rh51 AY530564, Rh64 AY530574, Rh43 AY530560, AAV8 AF513852, Rh8 AY242997, Rh1 AY530556; Clade F: Hu14 (AAV9) AY530579, Hu31 AY530596, Hu32 AY530597, Clone isolate AAV5 Y18065, AF085716, AAV3 NC_001729, AAV3B NC_001863, AAV4 NC_001829, Rh34 AY243001, Rh33 AY243002, Rh32 AY243003 are included.
[0089] A person skilled in the art can select an AAV serotype, Glade, clone, or isolate suitable for use in the present invention based on their common general knowledge. For example, the AAV5 capsid has been shown to efficiently transduce primate cone photoreceptors, as evidenced by the successful correction of hereditary color vision defects (Mancuso et al., Nature 2009, 461:784-7).
[0090] However, it should be understood that the present invention also encompasses the use of AAV genomes of other serotypes that may not yet have been identified or characterized. The AAV serotype determines the tissue specificity (or tropism) of AAV virus infection. Therefore, a desirable AAV serotype for use in the AAV virus administered to a patient according to the present invention is one that has a natural tropism for intraocular target cells in LHON, or a high infection efficiency thereof. Thus, the AAV serotype for use in the AAV virus administered to a patient can be one that infects cells of the neurosensory retina and retinal pigment epithelium.
[0091] Typically, a naturally occurring serotype or isolate or Glade of AAV genome contains at least one inverted terminal repeat (ITR) sequence. The ITR sequence acts in cis to provide a functional origin of replication and enables integration and excision of the vector from the cell's genome. In a preferred embodiment, one or more ITR sequences are adjacent to a polynucleotide sequence encoding ND4, ND6, or ND1, or variants thereof. Desirable ITR sequences are those of AAV2 and variants thereof. The AAV genome typically also contains packaging genes, such as the rep and / or cap genes that encode packaging functions for AAV virus particles. The rep gene encodes one or more of the proteins Rep78, Rep68, Rep52, and Rep40, or variants thereof. The cap gene encodes one or more capsid proteins, such as VP1, VP2, and It encodes VP3 or its variants. These proteins constitute the capsid of the AAV viral particle. Capsid variants are described below.
[0092] A promoter will be operably linked to each of the packaging genes. Specific examples of such promoters include the p5, p19, and p40 promoters (Laughlin et al., 1979, PNAS, 76:5567 - 5571). For example, the p5 and p19 promoters are generally used to express the rep gene, while the p40 promoter is generally used to express the cap gene.
[0093] Therefore, the AAV genome used in the vectors of the present invention may be, as described above, the entire genome of a naturally occurring AAV virus. For example, AAV viruses may be produced in vitro using vectors containing the entire AAV genome. However, although such vectors may in principle be administered to patients, this will rarely be done. It would be preferable to derivatize the AAV genome for the purpose of administration to patients. Such derivatization is standard in the art, and the present invention encompasses the use of any known derivatives of the AAV genome, as well as derivatives that could be produced by applying techniques known in the art. Derivatization of the AAV genome and of the AAV capsid is reviewed in Coura and Nardi (Virology Journal, 2007, 4:99), as well as Choi et al and Wu et al referenced above.
[0094] Derivatives of the AAV genome include any truncated or modified form of the AAV genome that enables the expression of the ND4, ND6, or ND1 transgene from the vector of the present invention in vivo. Usually, it is possible to significantly truncate the AAV genome so as to contain a minimal viral sequence while retaining the above functions. This is desirable for safety reasons, which reduce the risk of recombination of the vector by the wild-type virus and further avoid the induction of a cellular immune response due to the presence of viral gene proteins in the target cells.
[0095] Typically, the derivative will contain at least one inverted terminal repeat (ITR), preferably more than one ITR, for example two or more ITRs. One or more of the ITRs may be derived from AAV genomes having different serotypes, or may be chimeric ITRs or mutant ITRs. A desirable mutant ITR is one in which the trs (terminal resolution site) is deleted. This deletion allows for continuous replication of the genome and generates a single-stranded genome containing both the coding sequence and the complementary sequence, i.e., a self-complementary AAV genome. This makes it possible to avoid DNA in the target cells and thus enables the acceleration of transgene expression.
[0096] It would be preferable for one or more ITRs to be adjacent to each end of the polynucleotide sequence encoding ND4, ND6, ND1, or variants thereof. Inclusion of one or more ITRs is desirable, for example, in assisting the formation of concatemers of the vector of the present invention in the nucleus of the host cell according to the conversion of single-stranded vector DNA to double-stranded DNA by the action of host cell DNA polymerase. The formation of such episomal concatemers protects the vector construct over the lifespan of the host cell, thereby enabling long-term expression of the transgene in vivo.
[0097] In a preferred embodiment, the ITR element will be the only sequence retained from the native AAV genome in the derivative. Thus, it would be preferable for the derivative not to contain the rep and / or cap genes of the native genome, nor any other optional sequences of the native genome. This is desirable for the reasons stated above, and also to reduce the possibility of integration of the vector into the host cell genome. Additionally, reducing the size of the AAV genome allows for greater flexibility in incorporating other sequence elements (such as regulatory elements) into the vector in addition to the transgene. In addition, reducing the size of the AAV genome allows for greater flexibility in incorporating other sequence elements (such as regulatory elements) into the vector in addition to the transgene.
[0098] Thus, with respect to the AAV2 genome, the following portions can be removed in the derivatives of the present invention: one terminal inverted repeat (ITR) sequence, the replication (rep) and capsid (cap) genes (note: the rep gene in the wild-type AAV genome should not be confused with the human genes ND4, ND6 or ND1 that are invaded by LHON). However, in some embodiments, including in vitro embodiments, the derivative may further contain one or more rep and / or cap genes or other viral sequences of the AAV genome. Naturally occurring AAV viruses integrate at a specific site on human chromosome 19 with high frequency and show a negligibly low frequency of random integration such that retention of the vector's integration ability may be acceptable in a therapeutic setting.
[0099] If the derivative genome contains a gene encoding a capsid protein, i.e., VP1, VP2 and / or VP3, the derivative can be a chimeric, shuffling or capsid-modified derivative of one or more naturally occurring AAV viruses. In particular, the present invention encompasses providing capsid protein sequences from different serotypes, clades, clones or isolates of AAV within the same vector, i.e., pseudotyping.
[0100] Chimeric, shuffling, or capsid-modified derivatives will typically be selected to provide one or more desired functionalities to a viral vector. Thus, these derivatives may exhibit improved gene delivery efficiency, reduced (humoral or cellular) immunogenicity, altered tropism range, and / or improved specificity for certain cell types, as compared to AAV viral vectors containing a naturally occurring AAV genome, such as that of AAV2. The improvement in gene delivery efficiency can also be brought about by improved binding to receptors or co-receptors at the cell surface, improved internalization, improved transport within the cell and into the nucleus, improved uncoating of viral particles, and improved conversion of the single-stranded genome into the double-stranded form. The improvement in efficiency can also be related to changes in tropism range or specificity for certain cell populations in such a way that the vector dose is not diluted by administration to tissues that do not require it.
[0101] Chimeric capsid proteins include those generated by recombination between the capsid-encoding sequences of two or more naturally occurring AAV serotypes. This can be carried out, for example, by co-transfecting a non-infectious capsid sequence of one serotype with a capsid sequence of a different serotype and selecting the capsid sequence with the desired properties using specific selection, by a marker rescue technique. Novel chimeric capsid proteins can be generated by altering the capsid sequences of different serotypes by homologous recombination within the cell.
[0102] Chimeric capsid proteins also include those created by manipulation of the capsid protein sequence to move specific capsid protein domains, surface loops, or specific amino acid residues between two or more capsid proteins, for example, between two or more capsid proteins of different serotypes.
[0103] Shuffling or chimeric capsid proteins can also be generated by DNA shuffling or by error-prone PCR. Hybrid AAV capsid genes can be created by randomly fragmenting the sequences of the relevant AAV genes, e.g., those encoding capsid proteins of multiple different serotypes, and then subsequently reassembling the fragments in a self-priming polymerase reaction that can also cause crossovers in sequence homology regions. In this way, a library of hybrid AAV genes created by shuffling the capsid genes of several serotypes can be s creened to identify viral clones with desired functionality. Similarly, error-prone PCR can be used to randomly mutate the AAV capsid gene to create diverse mutant libraries from which selection of desired properties can be made later.
[0104] In addition, genetic recombination can be performed on the sequence of the capsid gene to introduce specific deletions, substitutions or insertions with respect to the native wild-type sequence. In particular, the capsid gene may be modified by inserting the sequence of an irrelevant protein or peptide within the open reading frame of the capsid coding sequence, or at the N and / or C termini of the capsid coding sequence.
[0105] An unrelated protein or peptide may advantageously act as a ligand for a particular cell type, thereby resulting in improved binding to target cells or improved tropism of the vector for a particular cell population. An example may include the use of an RGD peptide that blocks uptake in retinal pigment epithelium and thereby enhances transduction of the surrounding retinal tissue (Cronin et al., 2008 ARVO Abstract: D1048). An unrelated protein may also be an epitope or affinity tag that aids in the purification of viral particles as part of the manufacturing process. The site of insertion will typically be selected so as not to interfere with other functions of the viral particle, such as internalization, transport of the viral particle. Those skilled in the art will be able to identify sites suitable for insertion based on their common general knowledge. Specific sites are disclosed in Choi et al. referenced above.
[0106] The present invention further encompasses providing the sequences of the AAV genome in an order and configuration different from that of the native AAV genome. The present invention also encompasses replacing one or more AAV sequences or genes with sequences from another virus or with a chimeric gene consisting of sequences from more than one virus. Such chimeric genes may consist of sequences from two or more related viral proteins of different viral species.
[0107] The vector of the present invention takes the form of a polynucleotide sequence comprising an AAV genome or derivative thereof and a sequence encoding ND4, ND6, ND1 or a variant thereof.
[0108] For the sake of avoiding misunderstanding, it should be noted that the present invention also provides AAV virus particles containing the vector of the present invention. The AAV particles of the present invention include transcapsidated forms in which an AAV genome or derivative having an ITR of a certain serotype is packaged in a capsid of a different serotype. The AAV particles of the present invention also include mosaic forms in which the viral envelope is composed of a mixture of unmodified capsid proteins from two or more different serotypes. The AAV particles also include chemically modified forms carrying ligands adsorbed on the capsid surface. For example, such ligands may include antibodies for targeting specific cell surface receptors.
[0109] The present invention further provides host cells containing the vector or AAV virus particles of the present invention.
[0110] Recombinant nucleic acid sequence The present specification also discloses a recombinant nucleic acid sequence comprising a polynucleotide sequence encoding NADH dehydrogenase subunit 4 (ND4), NADH dehydrogenase subunit 1 (ND1) and NADH dehydrogenase subunit 6 (ND6) polypeptides or variants thereof.
[0111] The polynucleotide sequence of ND4 is shown in SEQ ID NO: 6 and encodes the protein shown in SEQ ID NO: 160. Further nucleic acid sequences of ND4 are SEQ ID NO: 7 and SEQ ID NO: 8. N The polynucleotide sequence of D6 is shown in SEQ ID NO: 9 and encodes the protein shown in SEQ ID NO: 161. A further nucleic acid sequence of ND6 is SEQ ID NO: 10. The polynucleotide sequence of ND1 is shown in SEQ ID NO: 11 and encodes the protein shown in SEQ ID NO: 162. A further nucleic acid sequence of ND1 is SEQ ID NO: 12.
[0112] Any one of the variants of SEQ ID NO: 160, 161 or 162 may include a truncated body, mutant or homolog thereof encoding a functional ND4, ND6 or ND1 polypeptide, and any transcript variant thereof. Any homolog mentioned herein is typically at least 70% homologous to the corresponding region of ND4, ND6 or ND1 and can functionally compensate for polypeptide deficiencies.
[0113] Homology can be measured using known methods. For example, the UWGCG package provides the BESTFIT program that can be used to calculate homology (e.g., used with its default settings) (Devereux et al (1984) Nucleic Acids Research 12, 387-395). Homology can be calculated or sequences can be aligned using the PILEUP and BLAST algorithms (typically with their default settings), as described, for example, in Altschul S.F. (1993) J Mol Evol 36:290-300, Altschul, S.F. et al (1990) J Mol Biol 215:403-10. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ).
[0114] In a preferred embodiment, the recombinant nucleic acid sequence encodes a polypeptide that is at least 55%, 65%, 70%, 75%, 80%, 85%, 90%, more preferably at least 95%, 97%, 99%, 99.5% or 100% homologous to the corresponding region of ND4, ND6 or ND1 (SEQ ID NO: 160, 161 or 162) over at least 20, preferably at least 30, for example at least 40, 60, 100, 200, 300, 400 or more consecutive amino acids, and thus over the entire sequence of the recombinant nucleic acid. The corresponding region is to be taken as providing the functional activity of ND4, ND6 or ND1.
[0115] Alternatively, and preferably, the recombinant nucleic acid sequence can encode a polypeptide that is at least 70%, 75%, 80%, 85%, 90%, more preferably at least 95%, 97%, 99%, 99.5% or 100% identical to the full-length ND4, ND6 or ND1 (SEQ ID NO: 160, 161 or 162) over its entire sequence. Typically, the recombinant nucleic acid sequence differs from the corresponding region of ND4, ND6 or ND1 (SEQ ID NO: 160, 161 or 162) by 2, 5, 10, 20, 40, 50 or more or less than 60 mutations (each of which can be a substitution, insertion or deletion).
[0116] The ND4, ND6 or ND1 polypeptide of the recombinant nucleic acid can have the same percent identity with a specific region of SEQ ID NO: 160, 161 or 162 as any of the specific percent homology values over any of the lengths of the above sequences (i.e., it can have an identity of at least 70%, 80% or 90%, more preferably at least 95%, 97%, 99%).
[0117] Variants of ND4, ND6 or ND1 (SEQ ID NO: 160, 161 or 162) include truncations. Any truncation may be used as long as the variant is still functional. Truncations are typically made to remove sequences that are not essential for protein activity and / or do not affect the conformation of the folded protein, particularly the folding of the active site. Appropriate truncations can be routinely identified by systematic trimming of sequences of various lengths from the N or C terminus. Preferably, the truncation is made on the N-terminal side and may remove all sequences other than the catalytic domain.
[0118] Variants of ND4, ND6 or ND1 (SEQ ID NO: 160, 161 or 162) further include mutants having one or more, for example, 2, 3, 4, 5-10, 10-20, 20-40 or more amino acid insertions, substitutions or deletions with respect to specific regions of ND4, ND6 or ND1 (SEQ ID NO: 160, 161 or 162). Deletions and insertions are preferably made outside the catalytic domain described below. Substitutions are also typically made in regions that are not essential for protease activity and / or do not affect the conformation of the folded protein.
[0119] The substitution preferably introduces one or more conservative changes that replace an amino acid with another amino acid of a similar chemical structure, similar chemical properties or similar amount of side chain. The introduced amino acid may have a polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality or charge similar to the amino acid it replaces. Alternatively, the conservative change may introduce another amino acid that is aromatic or aliphatic in place of an existing aromatic or aliphatic amino acid. Conservative amino acid changes are well known in the art and can be selected according to the properties of the amino acids.
[0120] Similarly, desirable variants of the polynucleotide sequences of ND4, ND6 or ND1 (SEQ ID NO: 6, 9 or 11) include polynucleotides having at least 70%, 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99% or 99.5% homology with the corresponding regions of ND4, ND6 or ND1 (SEQ ID NO: 6, 9 or 11). Preferably, the variant exhibits homology with the full-length ND4, ND6 or ND1 (SEQ ID NO: 6, 9 or 11) at these levels throughout its sequence.
[0121] A mitochondrial targeting sequence (MTS) and a 3 prime untranslated region (3’UTR) can be used to direct a target protein or mRNA to mitochondria. The charge, length, and structure of the MTS can be important in protein import into mitochondria. Certain 3’UTRs can promote mRNA localization to the mitochondrial surface and thus promote protein import during translation into mitochondria.
[0122] Polynucleotide sequences for mitochondrial targeting sequences are hsCOX10, hsCOX8, scRPM2, lcSirt5, tbNDUS7, ncQCR2, hsATP5G2, hsLACTB, spilv1, gmCOX2, crATP6, hsOPA1, hsSDHD, hsADCK3, osP0644B06.24-2, Neurospora crassa ATP9 (ncATP9), hsGHITM, hsNDUFAB1, hsATP5G3, crATP6_hsADCK3, ncATP9_ncATP9, zmLOC100282174, ncATP9_zmLOC100282174_spilv1_ncATP9, zmLOC100282174_hsADCK3_crATP6_hsATP5G3, zmLOC100282174_hsADCK3_hsATP5G3, ncATP9_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6_hsATP5G3, crATP6_hsADCK3_zmLOC100282174_hsATP5G3, hsADCK3_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6, ncATP9_zmLOC100282174_spilv1_GNFP_ncATP9, and ncATP9_zmLOC100282174_spilv1_lcSirt5_osP0644B06.24-2_hsATP5G2_ncATP9 and may encode a polypeptide (see Table 1 for sequence numbers). In one example, the polynucleotide sequence The column COX10 (SEQ ID NO: 1, 2, or 3) may encode the mitochondrial targeting sequence MTS-COX10 (SEQ ID NO: 126). In another example, the polynucleotide sequence COX8 (SEQ ID NO: 4) may encode the mitochondrial targeting sequence MTS-COX8 (SEQ ID NO: 127). In another example, the polynucleotide sequence OPA1 (SEQ ID NO: 5) may encode the mitochondrial targeting sequence MTS-OPA1 (SEQ ID NO: 128).
[0123] The 3’UTR nucleic acid sequence may be selected from hsACO2 (SEQ ID NO: 111), hsATP5B (SEQ ID NO: 112), hsAK2 (SEQ ID NO: 113), hsALDH2 (SEQ ID NO: 114), hsCOX10 (SEQ ID NO: 115), hsUQCRFS1 (SEQ ID NO: 116), hsNDUFV1 (SEQ ID NO: 117), hsNDUFV2 (SEQ ID NO: 118), hsSOD2 (SEQ ID NO: 119), hsCOX6c (SEQ ID NO: 120), hsIRP1 (SEQ ID NO: 121), hsMRPS12 (SEQ ID NO: 122), hsATP5J2 (SEQ ID NO: 123), rnSOD2 (SEQ ID NO: 124), and hsOXA1L (SEQ ID NO: 125). The 3’UTR nucleic acid sequence may also be a variant having at least 70%, 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%, 99.5% or 100% homology with any 3’UTR nucleic acid sequence disclosed herein. For example, the 3’UTR nucleic acid sequence may be SEQ ID NO: 13 or SEQ ID NO: 14.
[0124] The present specification further discloses a recombinant nucleic acid sequence comprising a mitochondrial targeting sequence, a mitochondrial protein coding sequence, and a 3’UTR nucleic acid sequence. For example, the recombinant nucleic acid sequence may be selected from SEQ ID NOs: 15 to 84. The recombinant nucleic acid sequence may also be a variant having at least 70%, 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%, 99.5% or 100% homology with any recombinant nucleic acid sequence disclosed herein.
[0125] Promoters and regulatory sequences The vectors of the present invention also include elements that enable the expression of the disclosed transgenes in vitro or in vivo. Thus, the vector typically includes a promoter sequence operably linked to a polynucleotide sequence encoding the ND4, ND6 or ND1 transgene or variants thereof.
[0126] Any suitable promoter may be used. The promoter sequence may be constitutively active, i.e., functional, under any host cell background, or may be active only in a particular host cell environment and thus enable the directed expression of the transgene in a particular cell type. The promoter may exhibit inducible expression in response to another factor, such as a factor present in the host cell. In any case, when the vector is administered for therapy, the promoter must be functional in the retinal cell background.
[0127] In some embodiments, it is desirable for the promoter to exhibit retinal cell-specific expression in order to enable the transgene to be expressed only in the retinal cell population. Thus, expression from the promoter can be retinal cell-specific and can be restricted, for example, to only the cells of the neurosensory retina and retinal pigment epithelium.
[0128] Desirable promoters for the ND4, ND6 or ND1 transgenes include the chicken beta-actin (CBA) promoter optionally combined with the cytomegalovirus (CME) enhancer element. In some cases, the desirable promoter for the ND4, ND6 or ND1 transgene comprises the CAG promoter. A particularly desirable promoter is the hybrid CBA / CAG promoter, for example, the promoter used in the rAVE expression cassette. Inducing retinal-specific gene expression Examples of promoters based on human sequences that might be used include rhodopsin kinase for rods and cones (Allocca et al., 2007, J Viol 81:11372-80), PR2.1 for cones only (Mancuso et al. 2009, Nature), and RPE65 for retinal pigment epithelium (Bainbridge et al., 2008, N Eng J Med).
[0129] The vectors of the present invention may also contain one or more additional regulatory sequences that can act before or after transcription. The regulatory sequences may be part of the native ND4, ND6 or ND1 locus, or may be heterologous regulatory sequences. The vectors of the present invention may contain a portion of the 5'UTR or 3'UTR from the native ND4, ND6 or ND1 transcript.
[0130] A regulatory sequence is any sequence that promotes the expression of a transgene, i.e., acts to increase the expression of the transcript, improves nuclear import of the mRNA, or enhances its stability. Such regulatory sequences include, for example, enhancer elements, post-regulatory elements, and polyadenylation sites. A desirable polyadenylation site is the bovine growth hormone polyA signal. In the context of the vectors of the present invention, such regulatory sequences will be considered cis-acting. However, the present invention also encompasses the use of trans-acting regulatory sequences located on additional gene constructs.
[0131] A desirable post-regulatory element for use in the vectors of the present invention is the woodchuck hepatitis post-regulatory element (WPRE) or a variant thereof. Another regulatory sequence that can be used in the vectors of the present invention is the scaffold attachment region (SAR). Additional regulatory sequences can be selected by those skilled in the art based on their common general knowledge.
[0132] Production of vectors The vectors of the present invention can be produced by standard means known in the art for providing vectors for gene therapy. Thus, suitable vector preparations can be made using well-established and known transfection, packaging, and purification methods.
[0133] As described above, the vectors of the present invention may contain the complete genome of a naturally occurring AAV virus in addition to a polynucleotide sequence encoding ND4, ND6, or ND1 or variants thereof. However, generally, a derivative genome will be used, for example, a derivative having at least one inverted terminal repeat (ITR) but lacking any AAV genes such as rep or cap.
[0134] In such embodiments, to effect assembly from the derivative genome into AAV virus particles, additional gene constructs providing AAV and / or helper virus functions are provided in combination with the derivative genome in a host cell. These additional constructs will typically contain genes encoding the structural AAV capsid proteins, i.e., cap, VP1, VP2, VP3, and genes encoding other functions required for the AAV life cycle, such as rep. The choice of structural capsid proteins incorporated into the additional construct will determine the serotype of the packaged viral vector.
[0135] Particularly desirable viral vectors to be packaged for use in the present invention include a derivative genome of AAV2 in combination with AAV5 or AAV8 capsid proteins. This packaged viral vector typically contains one or more AAV2 ITRs.
[0136] As described above, the AAV virus is replication-deficient and thus, typically, one or more additional constructs will also be provided with helper virus functions, preferably adenovirus helper functions, to enable AAV replication.
[0137] All of the above additional constructs may be provided within the host cell as plasmids or other episomal elements, or alternatively, one or more constructs may be integrated into the genome of the host cell.
[0138] In these embodiments, the present invention provides a method for manufacturing the vector of the present invention. The method includes providing within a host cell a vector comprising an adeno-associated virus (AAV) genome or a derivative thereof, and a polynucleotide sequence encoding ND4, ND6 or ND1 or a variant thereof, and providing means for replication and assembly from the vector into AAV virus particles. Preferably, the method includes providing a vector comprising a derivative of the AAV genome, and a polynucleotide sequence encoding ND4, ND6 or ND1 or a variant thereof, together with one or more additional gene constructs encoding AAV and / or helper virus functions. Typically, the derivative of the AAV genome includes at least one ITR. Optionally, the method further includes the step of purifying the assembled virus particles. In addition, the method may include the step of formulating the virus particles for therapeutic use.
[0139] Therapeutic Methods and Medical Uses As described above, the inventors have surprisingly demonstrated that the vectors of the present invention can be used to address the cellular dysfunction underlying LHON. Specifically, they have shown that the deficits associated with LHON can be corrected by the use of the vectors. This provides a means by which the degenerative process of the disease can be treated, arrested, alleviated or prevented.
[0140] Accordingly, the present invention provides a method of treating or preventing LHON in a patient in need thereof, the method comprising administering to the patient, by direct injection into the retina, subretinally or intravitreally, a therapeutically effective amount of a vector encoding a mitochondrial protein described herein. In some embodiments, the method further comprises administering steroids before, during, and / or after administration of the vector encoding the mitochondrial protein. Thus, LHON is treated or prevented in the patient.
[0141] Vectors suitable for use in the methods of the present invention include those described herein, equivalent vectors encoding mitochondrial proteins, and biosimilars thereof. Equivalent vectors encoding mitochondrial proteins suitable for use in the methods of the present invention include those described in the art, for example, those described in Guy et al., Ophthalmology 2017;124:1621-1634, and Vignal et al., Ophthalmology 2018;6:945-947, each of which is incorporated by reference in its entirety. A biosimilar is a biological product that is highly similar to an existing FDA-approved reference product (the "reference product") and has no clinically meaningful differences therefrom. A "highly similar" product is one that has a similar purity, chemical identity, and biological activity as the reference product. However, minor differences in clinically inactive components between the reference product and the proposed biosimilar product are acceptable. For example, these may include minor differences in stabilizers or buffers compared to those used in the reference product, and minor differences (i.e., acceptable variations in the product) are expected during the manufacturing process. Any differences between the proposed biosimilar product and the reference product are carefully evaluated by the FDA to ensure that the biosimilar meets the high FDA approval standards. "No clinically meaningful differences" generally means demonstrated by human pharmacokinetic (exposure) and pharmacodynamic (response) studies, evaluation of clinical immunogenicity, and additional clinical studies as needed. It means that there is no clinically meaningful difference between the biosimilar and the reference product in terms of the safety, purity, and titer (safety and efficacy) achieved.
[0142] In some embodiments, a patient in need of treatment by the methods provided herein has one or more mitochondrial DNA (mtDNA) point mutations. In some embodiments, the patient has a point mutation in a gene encoding a protein of complex I of the mitochondrial oxidative phosphorylation chain. For example, the patient may have one or more point mutations in the MT-ND4 gene encoding the NADH dehydrogenase subunit 4 protein (ND4, also known as NCBI Gene ID: 4538), the MT-ND1 gene encoding the NADH dehydrogenase subunit 1 protein (ND1, also known as NCBI Gene ID: 4535), or the MT-ND6 gene encoding the NADH dehydrogenase subunit 6 protein (ND6, also known as NCBI Gene ID: 4541). In some embodiments, the patient has a point mutation at nucleotide position 11778 of the ND4 gene. In some embodiments, the point mutation is G11778A in the ND4 gene. In some embodiments, the patient has a point mutation at nucleotide position 3460 of the ND1 gene. In some embodiments, the point mutation is G3460A in the ND1 gene. In some embodiments, the patient has a point mutation at nucleotide position 14484 of the ND6 gene. In some embodiments, the point mutation is T14484C in the ND6 gene. In some embodiments, a patient in need of treatment by the methods provided herein has one or more of the point mutations selected from G11778A in the ND4 gene, G3460A in the ND1 gene, and T14484C in the ND6 gene, and is of Chinese and / or Argentinean descent.
[0143] In some embodiments, a patient in need of treatment by the methods provided herein has one or more point mutations selected from G11778A in the ND4 gene, G3460A in the ND1 gene, and T14484C in the ND6 gene, and is of Argentinean origin. In some embodiments, a patient in need of treatment by the methods provided herein has one or more point mutations selected from G11778A in the ND4 gene, G3460A in the ND1 gene, and T14484C in the ND6 gene, and is of Chinese origin. In certain embodiments, a patient in need of treatment by the methods provided herein has one or more point mutations selected from G11778A in the ND4 gene, and is of Chinese origin.
[0144] In related aspects, the invention provides the use of the vector of the invention in a method of treating or preventing LHON by administering the vector of the invention to a patient by direct injection into the retina, subretina or vitreous body. In addition, the invention provides the use of the vector of the invention in the manufacture of a medicament for treating or preventing LHON by direct injection into the retina, subretina or vitreous body.
[0145] In all these embodiments, the vector of the invention can be administered to prevent the onset of one or more symptoms of LHON. The patient may be asymptomatic. The subject may be a person having a predisposition to the disease. The method or use may include the step of identifying whether the subject has a risk of developing or having LHON. A prophylactically effective amount of the vector is administered to such a subject. A prophylactically effective amount is an amount that prevents the onset of one or more symptoms of the disease.
[0146] Alternatively, at the time when symptoms of the disease appear in the subject, i.e., in order to cure the existing symptoms of the disease, the vector may be administered. A therapeutically effective amount of the antagonist is administered to such a subject. A therapeutically effective amount is an amount effective to improve one or more symptoms of the disease. An amount such as may also prevent, slow, or reverse some peripheral vision loss associated with LHON. Such an amount may also prevent, slow, or reverse the onset of LHON.
[0147] A typical single dose depends on the amount of residual retinal tissue requiring transduction but is 10 10 ~10 12 genomic particles. As used herein, genomic particles are defined as AAV capsids containing single-stranded DNA molecules that can be quantified by sequence-specific methods (e.g., real-time PCR). The dose may be provided as a single dose, but may be repeated for binocular vision or if the vector may not have targeted the correct area of the retina for any reason (e.g., surgical complications). Treatment is preferably a single permanent treatment for each eye, but consideration may be given to repeating the injection, for example, at a later year and / or with a different AAV serotype.
[0148] The invention also provides a method of monitoring the treatment or prevention of LHON in a patient, the method comprising measuring in vitro the activity in retinal cells obtained from the patient after administration of an AAV vector of the invention by direct injection into the retina, subretinal space, or vitreous body. This method may enable determination of the effectiveness of the treatment.
[0149] In some embodiments, the present disclosure provides a method of treating an eye disorder (e.g., LHON) comprising administering a therapeutically effective amount of the vectors and steroids described herein. Exemplary steroids include, but are not limited to, alclometasone dipropionate, amcinonide, beclomethasone dipropionate, betamethasone, betamethasone benzoate, betamethasone dipropionate, betamethasone sodium phosphate, betamethasone sodium phosphate and acetate, betamethasone valerate, clobetasol propionate, clocortolone pivalate, cortisol (hydrocortisone), cortisone acetate (hydrocortisone), cortisone butyrate (hydrocortisone), cortisone cypionate (hydrocortisone), cortisone sodium phosphate (hydrocortisone), cortisone sodium succinate (hydrocortisone), cortisone valerate (hydrocortisone), cortisone acetate, desonide, desoxymethasone, dexamethasone, dexamethasone acetate, dexamethasone sodium phosphate, diflorasone diacetate, fludrocortisone acetate, flunisolide, fluocinolone acetonide, fluocinonide, fluorometholone, flurandrenolide, halcinonide, medrysone, methylprednisolone, methylprednisolone acetate, methylprednisolone sodium succinate, mometasone furoate, paramethasone acetate, prednisolone, prednisolone acetate, prednisolone sodium phosphate, prednisolone tebutate, prednisone, triamcinolone, triamcinolone acetonide, triamcinolone diacetate, and triamcinolone hexacetonide or synthetic analogs thereof, or combinations thereof. In some embodiments, the steroid is a glucocorticoid. In some embodiments, the steroid is selected from prednisone, methylprednisolone, and methylprednisolone sodium succinate.
[0150] In some embodiments, the steroid is methylprednisolone. In some embodiments, methylprednisolone is formulated as tablets for oral administration, such as MEDROL® tablets. For example, in some embodiments, methylprednisolone is formulated as tablets with one or more inactive ingredients, such as calcium stearate, corn starch, erythrosine sodium, lactose, mineral oil, sorbic acid, sucrose, or FD&C Yellow No. 6. In some embodiments, methylprednisolone is formulated as a solution for administration by injection, such as SOLU-MEDROL®. For example, in some embodiments, methylprednisolone sodium succinate is formulated as a solution with one or more inactive ingredients, such as anhydrous monobasic sodium phosphate, dried dibasic sodium phosphate, or lactose monohydrate, and optionally with a preservative such as benzyl alcohol. In some embodiments, the steroid is delayed MEDROL® or SOLU-MEDROL®, including pharmaceuticals.
[0151] In some embodiments, the patient receives a steroid dosage of from about 1 mg / 60 kg to about 100 mg / 60 kg, from about 1 mg / 60 kg to about 80 mg / 60 kg, from about 1 mg / 60 kg to about 60 mg / 60 kg, from about 1 mg / 60 kg to about 40 mg / 60 kg, from about 1 mg / 60 kg to about 20 mg / 60 kg, from about 20 mg / 60 kg to about 100 mg / 60 kg, from about 20 mg / 60 kg to about 80 mg / 60 kg, from about 20 mg / 60 kg to about 60 mg / 60 kg, from about 20 mg / 60 kg to about 40 mg / 60 kg, from about 40 mg / 60 kg to about 100 mg / 60 kg, from about 40 mg / 60 kg to about 80 mg / 60 kg, from about 40 mg / 60 kg to about 60 mg / 60 kg, from about 60 mg / 60 kg to about 100 mg / 60 kg, from about 60 mg / 60 kg to about 80 mg / 60 kg, or from about 80 mg / 60 kg to about 100 mg / 60 kg one or more times. In some embodiments, the patient receives a steroid dosage of about 4 mg / 60 kg, 6 mg / 60 kg, 8 mg / 60 kg, 10 mg / 60 kg, 16 mg / 60 kg, 20 mg / 60 kg, 24 mg / 60 kg, 32 mg / 60 kg, 40 mg / 60 kg, 48 mg / 60 kg, 60 mg / 60 kg, or 80 mg / 60 kg one or more times. In some embodiments, the patient receives a steroid dosage of from about 1 mg to about 96 mg one or more times. In some embodiments, the patient receives a steroid dosage of at least about 1 mg one or more times. In some embodiments, the patient receives a steroid dosage of up to about 96 mg one or more times. In some embodiments, the patient receives a steroid dosage of from about 1 mg to about 2 mg, from about 1 mg to about 4 mg, from about 1 mg to about 8 mg, from about 1 mg to about 16 mg, from about 1 mg to about 32 mg, from about 1 mg to about 64 mg, from about 1 mg to about 96 mg, from about 2 mg to about 4 mg, from about 2 mg to about 8 mg, from about 2 mg to about 16 mg, from about 2 mg to about 32 mg, from about 2 mg to about 64 mg, from about 2 mg to about 96 mg, from about 4 mg to about 8 mg, from about 4 mg to about 16 mg, from about 4 mg to about 32 mg, from about 4 mg to about 64 mg, from about 4 mg to about 96 mg, from about 8 mg to about 16 mg, from about 8 mg to about 32 mg, from about 8 mg to about 64 mg, from about 8 mg to about 96 mg, from about 16 mg to about 32 mg, from about 16 mg to about 64 mg, from about 16 mg to about 96 mg, from about 32 mg to about 64 mg, from about 32 mg to about 96 mg, or from about 64 mg to about 96 mg one or more times.In some embodiments, the patient receives one or more doses of a steroid at about 1 mg, about 2 mg, about 4 mg, about 8 mg, about 16 mg, about 32 mg, about 64 mg, or about 96 mg. In some embodiments, the steroid is methylprednisolone (e.g., MEDROL®). In some embodiments, the steroid is prednisone.
[0152] In some embodiments, one or more doses of a steroid (i.e., one or more preoperative steroid doses) are administered prior to administration of the therapeutic vector. In some embodiments, a daily dose of a steroid is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or at least 10 days prior to administration of the therapeutic vector. In some embodiments, the patient receives one or more preoperative steroid doses of about 1 mg / 60 kg to about 100 mg / 60 kg, about 1 mg / 60 kg to about 80 mg / 60 kg, about 1 mg / 60 kg to about 60 mg / 60 kg, about 1 mg / 60 kg to about 40 mg / 60 kg, about 1 mg / 60 kg to about 20 mg / 60 kg, about 20 mg / 60 kg to about 100 mg / 60 kg, about 20 mg / 60 kg to about 80 mg / 60 kg, about 20 mg / 60 kg to about 60 mg / 60 kg, about 20 mg / 60 kg to about 40 mg / 60 kg, about 40 mg / 60 kg to about 100 mg / 60 kg, about 40 mg / 60 kg to about 80 mg / 60 kg, about 40 mg / 60 kg to about 60 mg / 60 kg, about 60 mg / 60 kg to about 100 mg / 60 kg, about 60 mg / 60 kg to about 80 mg / 60 kg, or about 80 mg / 60 kg to about 100 mg / 60 kg. In some embodiments, the patient receives a preoperative steroid dose of about 4 mg / 60 kg, 6 mg / 60 kg, 8 mg / 60 kg, 10 mg / 60 kg, 16 mg / 60 kg, 20 mg / 60 kg, 24 mg / 60 kg, 32 mg / 60 kg, 40 mg / 60 kg, 48 mg / 60 kg, 60 mg / 60 kg, or 80 mg / 60 kg one or more Receive preoperatively. In some embodiments, the patient receives a preoperative steroid dose of about 1 mg to about 96 mg one or more times. In some embodiments, the patient receives a preoperative steroid dose of at least about 1 mg one or more times. In some embodiments, the patient receives a preoperative steroid dose of up to about 96 mg one or more times. In some embodiments, the patient receives a preoperative steroid dose of about 1 mg to about 2 mg, about 1 mg to about 4 mg, about 1 mg to about 8 mg, about 1 mg to about 16 mg, about 1 mg to about 32 mg, about 1 mg to about 64 mg, about 1 mg to about 96 mg, about 2 mg to about 4 mg, about 2 mg to about 8 mg, about 2 mg to about 16 mg, about 2 mg to about 32 mg, about 2 mg to about 64 mg, about 2 mg to about 96 mg, about 4 mg to about 8 mg, about 4 mg to about 16 mg, about 4 mg to about 32 mg, about 4 mg to about 64 mg, about 4 mg to about 96 mg, about 8 mg to about 16 mg, about 8 mg to about 32 mg, about 8 mg to about 64 mg, about 8 mg to about 96 mg, about 16 mg to about 32 mg, about 16 mg to about 64 mg, about 16 mg to about 96 mg, about 32 mg to about 64 mg, about 32 mg to about 96 mg, or about 64 mg to about 96 mg one or more times. In some embodiments, the patient receives a preoperative steroid dose of about 1 mg, about 2 mg, about 4 mg, about 8 mg, about 16 mg, about 32 mg, about 64 mg or about 96 mg one or more times. In some embodiments, the steroid is methylprednisolone (e.g., MEDROL®). In some embodiments, the steroid is prednisone.
[0153] In some embodiments, the patient receives a preoperative steroid dose of from about 20 mg / 60 kg to about 45 mg / 60 kg, from about 25 mg / 60 kg to about 45 mg / 60 kg, from about 30 mg / 60 kg to about 45 mg / 60 kg, from about 35 mg / 60 kg to about 45 mg / 60 kg, from about 40 mg / 60 kg to about 45 mg / 60 kg, from about 20 mg / 60 kg to about 40 mg / 60 kg, from about 25 mg / 60 kg to about 40 mg / 60 kg, from about 30 mg / 60 kg to about 40 mg / 60 kg, from about 35 mg / 60 kg to about 40 mg / 60 kg, from about 20 mg / 60 kg to about 35 mg / 60 kg, from about 25 mg / 60 kg to about 35 mg / 60 kg, from about 30 mg / 60 kg to about 35 mg / 60 kg, from about 20 mg / 60 kg to about 30 mg / 60 kg, from about 25 mg / 60 kg to about 30 mg / 60 kg, or from about 20 mg / 60 kg to about 25 mg / 60 kg one or more times. In some embodiments, the patient receives a preoperative steroid dose of about 25 mg / 60 kg, about 26 mg / 60 kg, about 27 mg / 60 kg, about 28 mg / 60 kg, about 29 mg / 60 kg, about 30 mg / 60 kg, about 31 mg / 60 kg, about 32 mg / 60 kg, about 33 mg / 60 kg, about 34 mg / 60 kg, or about 35 mg / 60 kg one or more times. In some embodiments, the steroid is methylprednisolone (e.g., MEDROL®). In some embodiments, a daily dose of from about 25 mg / 60 kg to about 45 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days prior to administration of the therapeutic vector. In some embodiments, a daily dose of about 32 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days prior to administration of the therapeutic vector.
[0154] In some embodiments, the patient receives a preoperative steroid dose of from about 50 mg / 60 kg to about 70 mg / 60 kg, from about 55 mg / 60 kg to about 70 mg / 60 kg, from about 60 mg / 60 kg to about 70 mg / 60 kg, from about 65 mg / 60 kg to about 70 mg / 60 kg, from about 50 mg / 60 kg to about 65 mg / 60 kg, from about 55 mg / 60 kg to about 65 mg / 60 kg, from about 60 mg / 60 kg to about 65 mg / 60 kg, from about 50 mg / 60 kg to about 60 mg / 60 kg, from about 55 mg / 60 kg to about 60 mg / 60 kg, or from about 50 mg / 60 kg to about 55 mg / 60 kg one or more times. In some embodiments, the patient receives a preoperative dose of about 55 mg / 60 kg, about 56 mg / 60 kg, about 57 mg / 60 kg, about 58 mg / 60 kg, about 59 mg / 60 kg, about 60 mg / kg, about 61 mg / 60 kg, about 62 mg / 60 kg, about 63 mg / 60 kg, about 64 mg / 60 kg, or about 65 mg / 60 kg one or more times. In some embodiments, the steroid is prednisone. In some embodiments, a daily dose of prednisone of from about 50 mg / 60 kg to about 70 mg / 60 kg is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days prior to administration of the therapeutic vector. In some embodiments, a daily dose of prednisone of about 60 mg / 60 kg is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days prior to administration of the therapeutic vector.
[0155] In some embodiments, one or more doses of steroids (i.e., one or more postoperative steroid doses) are administered after administration of the therapeutic vector. In some embodiments, the daily dose of steroids is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or at least 10 days after administration of the therapeutic vector. In some embodiments, the daily dose of steroids is administered for at least 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, or at least 15 weeks after administration of the therapeutic vector. In some embodiments, the patient receives one or more postoperative steroid doses of from about 1 mg / 60 kg to about 100 mg / 60 kg, from about 1 mg / 60 kg to about 80 mg / 60 kg, from about 1 mg / 60 kg to about 60 mg / 60 kg, from about 1 mg / 60 kg to about 40 mg / 60 kg, from about 1 mg / 60 kg to about 20 mg / 60 kg, from about 20 mg / 60 kg to about 100 mg / 60 kg, from about 20 mg / 60 kg to about 80 mg / 60 kg, from about 20 mg / 60 kg to about 60 mg / 60 kg, from about 20 mg / 60 kg to about 40 mg / 60 kg, from about 40 mg / 60 kg to about 100 mg / 60 kg, from about 40 mg / 60 kg to about 80 mg / 60 kg, from about 40 mg / 60 kg to about 60 mg / 60 kg, from about 60 mg to about 100 mg / 60 kg, from about 60 mg / 60 kg to about 80 mg / 60 kg, and from about 80 mg / 60 kg to about 100 mg / 60 kg. In some embodiments, the patient receives one or more postoperative steroid doses of from about 1 mg to about 96 mg. In some embodiments, the patient receives one or more postoperative steroid doses of at least about 1 mg. In some embodiments, the patient receives one or more postoperative steroid doses of up to about 96 mg.In some embodiments, the patient receives a postoperative steroid dose of from about 1 mg to about 2 mg, from about 1 mg to about 4 mg, from about 1 mg to about 8 mg, from about 1 mg to about 16 mg, from about 1 mg to about 32 mg, from about 1 mg to about 64 mg, from about 1 mg to about 96 mg, from about 2 mg to about 4 mg, from about 2 mg to about 8 mg, from about 2 mg to about 16 mg, from about 2 mg to about 32 mg, from about 2 mg to about 64 mg, from about 2 mg to about 96 mg, from about 4 mg to about 8 mg, from about 4 mg to about 16 mg, from about 4 mg to about 32 mg, from about 4 mg to about 64 mg, from about 4 mg to about 96 mg, from about 8 mg to about 16 mg, from about 8 mg to about 32 mg, from about 8 mg to about 64 mg, from about 8 mg to about 96 mg, from about 16 mg to about 32 mg, from about 16 mg to about 64 mg, from about 16 mg to about 96 mg, from about 32 mg to about 64 mg, from about 32 mg to about 96 mg, or from about 64 mg to about 96 mg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 1 mg, about 2 mg, about 4 mg, about 8 mg, about 16 mg, about 32 mg, about 64 mg or about 96 mg one or more times. In some embodiments, the steroid is methylprednisolone (e.g., MEDROL®). In some embodiments, the steroid is prednisone.
[0156] In some embodiments, the patient receives a postoperative steroid dose of from about 70 mg / 60 kg to about 90 mg / 60 kg, from 75 mg / 60 kg to about 90 mg / 60 kg, from about 80 mg / 60 kg to about 90 mg / 60 kg, from about 85 mg / 60 kg to about 90 mg / 60 kg, from about 70 mg / 60 kg to about 85 mg / 60 kg, from about 75 mg / 60 kg to about 85 mg / 60 kg, from about 80 mg / 60 kg to about 85 mg / 60 kg, from about 70 mg / 60 kg to about 80 mg / 60 kg, from about 75 mg / 60 kg to about 80 mg / 60 kg, or from about 70 mg / 60 kg to about 75 mg / 60 kg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 75 mg / 60 kg, about 76 mg / 60 kg, about 77 mg / 60 kg, about 78 mg / 60 kg, about 79 mg / 60 kg, about 80 mg / 60 kg, about 81 mg / 60 kg, about 82 mg / 60 kg Receive a postoperative steroid dose of about 83 mg / 60 kg, about 84 mg / 60 kg, or about 85 mg / 60 kg one or more times. In some embodiments, the steroid is methylprednisolone sodium succinate (e.g., SOLU-MEDROL®). In some embodiments, a daily dose of about 70 mg to about 90 mg / 60 kg of methylprednisolone sodium succinate (e.g., SOLU-MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days after administration of the therapeutic vector. In some embodiments, a daily dose of about 80 mg / 60 kg of methylprednisolone sodium succinate (e.g., SOLU-MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days after administration of the therapeutic vector.
[0157] In some embodiments, the patient receives a postoperative steroid dose of from about 30 mg / 60 kg to about 50 mg / 60 kg, from 35 mg / 60 kg to about 50 mg / 60 kg, from about 40 mg / 60 kg to about 50 mg / 60 kg, from about 45 mg / 60 kg to about 50 mg / 60 kg, from about 30 mg / 60 kg to about 45 mg / 60 kg, from about 35 mg / 60 kg to about 45 mg / 60 kg, from about 40 mg / 60 kg to about 45 mg / 60 kg, from about 30 mg / 60 kg to about 40 mg / 60 kg, from about 35 mg / 60 kg to about 40 mg / 60 kg, or from about 30 mg / 60 kg to about 35 mg / 60 kg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 35 mg / 60 kg, about 36 mg / 60 kg, about 37 mg / 60 kg, about 38 mg / 60 kg, about 39 mg / 60 kg, about 40 mg / 60 kg, about 41 mg / 60 kg, about 42 mg / 60 kg, about 43 mg / 60 kg, about 44 mg / 60 kg, or about 45 mg / 60 kg one or more times. In some embodiments, the steroid is methylprednisolone (e.g., MEDROL®). In some embodiments, a daily dose of from about 30 mg / 60 kg to about 50 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector. In some embodiments, a daily dose of about 40 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector.
[0158] In some embodiments, the patient receives a postoperative steroid dose of from about 20 mg / 60 kg to about 45 mg / 60 kg, 25 mg / 60 kg to about 45 mg / 60 kg, about 30 mg / 60 kg to about 45 mg / 60 kg, about 35 mg / 60 kg to about 45 mg / 60 kg, about 40 mg / 60 kg to about 45 mg / 60 kg, about 20 mg / 60 kg to about 40 mg / 60 kg, about 25 mg / 60 kg to about 40 mg / 60 kg, about 30 mg / 60 kg to about 40 mg / 60 kg, about 35 mg / 60 kg to about 40 mg / 60 kg, about 20 mg / 60 kg to about 35 mg / 60 kg, about 25 mg / 60 kg to about 35 mg / 60 kg, about 30 mg / 60 kg to about 35 mg / 60 kg, about 20 mg / 60 kg to about 30 mg / 60 kg, about 25 mg / 60 kg to about 30 mg / 60 kg, or from about 20 mg / 60 kg to about 25 mg / 60 kg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 25 mg / 60 kg, about 26 mg / 60 kg, about 27 mg / 60 kg, about 28 mg / 60 kg, about 29 mg / 60 k, about 30 mg / 60 kg, about 31 mg / 60 kg, about 32 mg / 60 kg, about 33 mg / 60 kg, about 34 mg / 60 kg, or about 35 mg / 60 kg one or more times. In some embodiments, the steroid is methylprednisolone (e.g., MEDROL®). In some embodiments, a daily dose of about 20 mg / 60 kg to about 45 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector. In some embodiments, a daily dose of about 32 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector.
[0159] In some embodiments, the patient receives a postoperative steroid dose of from about 15 mg / 60 kg to about 35 mg / 60 kg, from 20 mg / 60 kg to about 35 mg / 60 kg, from about 25 mg / 60 kg to about 35 mg / 60 kg, from about 30 mg / 60 kg to about 35 mg / 60 kg, from about 15 mg / 60 kg to about 30 mg / 60 kg, from about 20 mg / 60 kg to about 30 mg / 60 kg, from about 25 mg / 60 kg to about 30 mg / 60 kg, from about 15 mg / 60 kg to about 25 mg / 60 kg, from about 20 mg / 60 kg to about 25 mg / 60 kg, or from about 15 mg / 60 kg to about 20 mg / 60 kg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 20 mg / 60 kg, about 21 mg / 60 kg, about 22 mg / 60 kg, about 23 mg / 60 kg, about 24 mg / 60 kg, about 25 mg / 60 kg, about 26 mg / 60 kg, about 27 mg / 60 kg, about 28 mg / 60 kg, about 29 mg / 60 kg, or about 30 mg / 60 kg one or more times. In some embodiments, the steroid is methylprednisolone (e.g., MEDROL®). In some embodiments, a daily dose of from about 15 mg / 60 kg to about 35 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector. In some embodiments, a daily dose of about 24 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector.
[0160] In some embodiments, the patient receives a postoperative steroid dose of from about 5 mg / 60 kg to about 25 mg / 60 kg, from 10 mg / 60 kg to about 25 mg / 60 kg, from about 15 mg / 60 kg to about 25 mg / 60 kg, from about 20 mg / 60 kg to about 25 mg / 60 kg, from about 5 mg / 60 kg to about 20 mg / 60 kg, from about 10 mg / 60 kg to about 20 mg / 60 kg, from about 15 mg / 60 kg to about 20 mg / 60 kg, from about 5 mg / 60 kg to about 15 mg / 60 kg, from about 10 mg / 60 kg to about 15 mg / 60 kg, or from about 5 mg / 60 kg to about 10 mg / 60 kg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 10 mg / 60 kg, about 11 mg / 60 kg, about 12 mg / 60 kg, about 13 mg / 60 kg, about 14 mg / 60 kg, about 15 mg / 60 kg, about 16 mg / 60 kg, about 17 mg / 60 kg, about 18 mg / 60 kg, about 19 mg / 60 kg, or about 20 mg / 60 kg one or more times. In some embodiments, the steroid is methylprednisolone (e.g., MEDROL®). In some embodiments, a daily dose of from about 5 mg / 60 kg to about 25 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector. In some embodiments, a daily dose of about 16 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector.
[0161] In some embodiments, the patient receives a dose of from about 1 mg / 60 kg to about 20 mg / 60 kg, from 5 mg / 60 kg to about 20 mg / 60 kg, from about 10 mg / 60 kg to about 20 mg / 60 kg, from about 15 mg / 60 kg to about 20 mg / 60 kg, from about 1 mg / 60 kg to about 15 mg / 60 kg, from about 5 mg / 60 kg to about 15 mg / 60 kg, from about 10 mg / 60 kg to about 15 mg / 60 kg, from about 1 mg / 60 kg to about 10 mg / 60 kg, from about 5 mg / 60 kg to about 10 Receive a postoperative steroid dose of mg / 60 kg, or about 1 mg / 60 kg to about 5 mg / 60 kg, one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 1 mg / 60 kg, about 2 mg / 60 kg, about 3 mg / 60 kg, about 4 mg / 60 kg, about 5 mg / 60 kg, about 6 mg / 60 kg, about 7 mg / 60 kg, about 8 mg / 60 kg, about 9 mg / 60 kg, about 10 mg / 60 kg, about 11 mg / 60 kg, about 12 mg / 60 kg, about 13 mg / 60 kg, about 14 mg / 60 kg, or about 15 mg / 60 kg, one or more times. In some embodiments, the steroid is methylprednisolone (e.g., MEDROL®). In some embodiments, a daily dose of about 1 mg / 60 kg to about 20 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or at least 10 days after administration of the therapeutic vector. In some embodiments, a daily dose of about 8 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or at least 10 days after administration of the therapeutic vector. In some embodiments, a daily dose of about 6 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or at least 10 days after administration of the therapeutic vector. In some embodiments, a daily dose of about 4 mg / 60 kg of methylprednisolone (e.g., MEDROL®) is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or at least 10 days after administration of the therapeutic vector.
[0162] In some embodiments, the patient receives a postoperative steroid dose of from about 30 mg / 60 kg to about 50 mg / 60 kg, 35 mg / 60 kg to about 50 mg / 60 kg, from about 40 mg / 60 kg to about 50 mg / 60 kg, from about 45 mg / 60 kg to about 50 mg / 60 kg, from about 30 mg / 60 kg to about 45 mg / 60 kg, from about 35 mg / 60 kg to about 45 mg / 60 kg, from about 40 mg / 60 kg to about 45 mg / 60 kg, from about 30 mg / 60 kg to about 40 mg / 60 kg, from about 35 mg / 60 kg to about 40 mg / 60 kg, or from about 30 mg / 60 kg to about 35 mg / 60 kg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 35 mg / 60 kg, about 36 mg / 60 kg, about 37 mg / 60 kg, about 38 mg / 60 kg, about 39 mg / 60 kg, about 40 mg / 60 kg, about 41 mg / 60 kg, about 42 mg / 60 kg, about 43 mg / 60 kg, about 44 mg / 60 kg, or about 45 mg / 60 kg one or more times. In some embodiments, the steroid is prednisone. In some embodiments, a daily dose of prednisone of from about 30 mg / 60 kg to about 50 mg / 60 kg is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector. In some embodiments, a daily dose of prednisone of about 40 mg / 60 kg is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector.
[0163] In some embodiments, the patient receives a postoperative steroid dose of from about 10 mg / 60 kg to about 30 mg / 60 kg, from 15 mg / 60 kg to about 30 mg / 60 kg, from about 20 mg / 60 kg to about 30 mg / 60 kg, from about 25 mg / 60 kg to about 30 mg / 60 kg, from about 10 mg / 60 kg to about 25 mg / 60 kg, from about 15 mg / 60 kg to about 25 mg / 60 kg, from about 20 mg / 60 kg to about 25 mg / 60 kg, from about 10 mg / 60 kg to about 20 mg / 60 kg, from about 15 mg / 60 kg to about 20 mg / 60 kg, or from about 10 mg / 60 kg to about 15 mg / 60 kg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 15 mg / 60 kg, about 16 mg / 60 kg, about 17 mg / 60 kg, about 18 mg / 60 kg, about 19 mg / 60 kg, about 20 mg / 60 kg, about 21 mg / 60 kg, about 22 mg / 60 kg, about 23 mg / 60 kg, about 24 mg / 60 kg, or about 25 mg / 60 kg one or more times. In some embodiments, the steroid is prednisone. In some embodiments, a daily dose of prednisone of from about 10 mg / 60 kg to about 30 mg / 60 kg is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector. In some embodiments, a daily dose of prednisone of about 20 mg / 60 kg is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector.
[0164] In some embodiments, the patient receives a postoperative steroid dose of from about 1 mg / 60 kg to about 20 mg / 60 kg, 5 mg / 60 kg to about 20 mg / 60 kg, from about 10 mg / 60 kg to about 20 mg / 60 kg, from about 15 mg / 60 kg to about 20 mg / 60 kg, from about 1 mg / 60 kg to about 15 mg / 60 kg, from about 5 mg / 60 kg to about 15 mg / 60 kg, from about 10 mg / 60 kg to about 15 mg / 60 kg, from about 1 mg / 60 kg to about 10 mg / 60 kg, from about 5 mg / 60 kg to about 10 mg / 60 kg, or from about 1 mg / 60 kg to about 5 mg / 60 kg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 1 mg / 60 kg, about 2 mg / 60 kg, about 3 mg / 60 kg, about 4 mg / 60 kg, about 5 mg / 60 kg, about 6 mg / 60 kg, about 7 mg / 60 kg, about 8 mg / 60 kg, about 9 mg / 60 kg, about 10 mg / 60 kg, about 11 mg / 60 kg, about 12 mg / 60 kg, about 13 mg / 60 kg, about 14 mg / 60 kg, or about 15 mg / 60 kg one or more times. In some embodiments, the steroid is prednisone. In some embodiments, a daily dose of prednisone of from about 1 mg / 60 kg to about 20 mg / 60 kg is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector. In some embodiments, a daily dose of prednisone of about 10 mg / 60 kg is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector.
[0165] In some embodiments, the patient receives a postoperative steroid dose of from about 1 g / 60 kg to about 15 g / 60 kg, from about 5 g / 60 kg to about 15 g / 60 kg, from about 10 g / 60 kg to about 15 g / 60 kg, from about 1 g / 60 kg to about 10 g / 60 kg, from about 5 g / 60 kg to about 10 g / 60 kg, or from about 1 g / 60 kg to about 5 g / 60 kg one or more times. In some embodiments, the patient receives a postoperative steroid dose of about 1 g / 60 kg, about 2 g / 60 kg, about 3 g / 60 kg, about 4 g / 60 kg, about 5 g / 60 kg, about 6 g / 60 kg, about 7 g / 60 kg, about 8 g / 60 kg, about 9 g / 60 kg, about 10 g / 60 kg, about 11 g / 60 kg, about 12 g / 60 kg, about 13 g / 60 kg, about 14 g / 60 kg, or about 15 g / 60 kg one or more times. In some embodiments, the steroid is sodium creatine phosphate. In some embodiments, a daily dose of from about 1 g / 60 kg to about 15 g / 60 kg of sodium creatine phosphate is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector. In some embodiments, a daily dose of about 2 g / 60 kg of sodium creatine phosphate is delivered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or at least 10 days following administration of the therapeutic vector.
[0166] In some embodiments, on the same day as the administration of the therapeutic AAV vector and daily for 3 days following the administration of the therapeutic AAV vector, the patient receives an intravenous dose (2 g / 60 kg) of sodium creatine phosphate and an intravenous dose of methylprednisolone sodium succinate (e.g., SOL-MEDROL®, 80 mg / 60 kg). On the third day after administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 40 mg / 60 kg for 4 days. The therapeutic AAV vector On the 7th day after the administration of - , the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 32 mg / 60 kg for 7 days. On the 14th day after the administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 24 mg / 60 kg for 7 days. On the 21st day after the administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 16 mg / 60 kg for 7 days. On the 28th day after the administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 8 mg / 60 kg for 7 days. On the 35th day after the administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 6 mg / 60 kg for 7 days. On the 42nd day after the administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 4 mg / 60 kg for 7 days. See Figure 19 for a schematic of an exemplary treatment plan for LHON gene therapy.
[0167] In some embodiments, the patient receives methylprednisolone (e.g., MEDROL®) tablets at a dose of 32 mg / 60 kg seven days prior to administration of the therapeutic AAV vector. On the day of administration of the therapeutic AAV vector, the patient receives an intravenous dose of methylprednisolone sodium succinate (e.g., SOL-MEDROL® (80 mg / 60 kg), which is administered daily for three days. On the third day after administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 40 mg / 60 kg for four days. On the seventh day after administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 32 mg / 60 kg for seven days. On the fourteenth day after administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 24 mg / 60 kg for seven days. On the twenty-first day after administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 16 mg / 60 kg for seven days. On the twenty-eighth day after administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 8 mg / 60 kg for seven days. On the thirty-fifth day after administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 6 mg / 60 kg for seven days. On the forty-second day after administration of the therapeutic AAV vector, the patient is administered methylprednisolone (e.g., MEDROL®) tablets at a dose of 4 mg / 60 kg for seven days. See FIG. 20 for a schematic of an exemplary treatment regimen for LHON gene therapy.
[0168] In some embodiments, the patient receives prednisone tablets at a dose of 60 mg / 60 kg daily for 7 days before and after the administration of the therapeutic AAV vector. On the 8th day after the administration of the therapeutic AAV vector, the patient is administered prednisone tablets at a dose of 40 mg / kg for 1 day. On the 9th day after the administration of the therapeutic AAV vector, the patient is administered prednisone tablets at a dose of 20 mg / kg for 1 day. On the 10th day after the administration of the therapeutic AAV vector, the patient is administered prednisone tablets at a dose of 10 mg / kg for 1 day. See Figure 21 for a schematic of an exemplary treatment plan for LHON gene therapy.
[0169] The dosage and interval of administration can be individually adjusted to be sufficient to maintain the therapeutic effect. One of ordinary skill in the art would be able to optimize an effective topical dosage without performing more experiments than necessary.
[0170] In some embodiments, the administration of steroids before, during, and / or after the administration of the therapeutic AAV vectors described herein results in a higher mean visual acuity recovery than that obtained by the administration of equivalent therapeutic AAV vectors without steroids, for example, in a population of at least 10 patients. In some embodiments, the administration of steroids before, during, and / or after the administration of the therapeutic AAV vectors results in a lower incidence of side effects than that obtained by the administration of equivalent therapeutic AAV vectors without steroids, for example, in a population of at least 10 patients. In some embodiments, the side effects are selected from anterior chamber inflammation, vitritis, glaucoma, cataract removal, keratitis, vitreous hemorrhage, allergic conjunctivitis, and eye pain (see, for example, Example 15).
[0171] In some embodiments, the higher average vision recovery and lower incidence of side effects obtained according to the methods of the present invention are determined by comparison with a population of patients with eye disorders treated with a therapeutic AAV vector without administration of steroids before, during, and / or after administration of the therapeutic AAV vector. In some embodiments, the population of patients treated by the methods of the present disclosure and the population of patients treated with an equivalent therapeutic AAV vector are ethnically matched. In some embodiments, the population of patients is Chinese or Argentine.
[0172] Diagnostic methods and kits In some embodiments, the present disclosure provides a method of screening a patient for treatment of an eye disorder. In such embodiments, the method comprises culturing a population of target cells with a composition comprising an AAV comprising a recombinant nucleic acid sequence encoding a detectable label in the presence of a serum sample obtained from the patient, and detecting the level of expression of the detectable label in the target cells after culturing, wherein the patient is selected for treatment if the level of expression of the detectable label in the target cells is higher than a predetermined threshold. In some embodiments, the method further comprises administering to the patient a pharmaceutical composition comprising an AAV comprising a recombinant nucleic acid sequence encoding a mitochondrial protein.
[0173] The method of screening a patient for the treatment of an eye disorder described herein utilizes a patient-derived serum sample to assess the patient's immune response to a recombinant viral vector used to deliver a therapeutic protein. Soluble factors present in the patient's serum, such as antibodies, can prevent viral infection of target cells, thereby reducing the delivery of the therapeutic protein and / or decreasing the effectiveness of the pharmaceutical composition. The methods of the present disclosure utilize AAVs encoding a detectable label such that the level of infectivity of the target cells can be measured by detection of the label. In some embodiments, the present disclosure provides a method of identifying patients showing low immunoreactivity to an AAV composition and selecting patients for treatment with a therapeutic AAV vector described herein. In some embodiments, the present disclosure provides a method of identifying patients showing high immunoreactivity to an AAV composition and excluding those patients from future treatment with a therapeutic AAV vector described herein.
[0174] In some embodiments, the level of expression of the detectable label in the target cells correlates with the patient's immune response to the AAV vector. For example, serum from a patient showing high immunoreactivity to AAV contains soluble factors that prevent the AAV encoding the detectable label from infecting the target cells and prevent expression of the detectable label in the target cells. In such cases, the level of expression of the detectable label in the target cells cultured in the presence of the patient's serum is reduced compared to the level of expression of the detectable label in the target cells cultured in the absence of the patient's serum. Alternatively, serum from a patient showing low immunoreactivity to AAV contains fewer or no soluble factors that prevent the AAV encoding the detectable label from infecting the target cells. In such cases, the level of expression of the detectable label in the target cells cultured in the presence of the patient's serum is the same or not significantly reduced compared to the level of expression of the detectable label in the labeled cells cultured in the absence of the patient's serum.
[0175] The detectable label is any that is not endogenously expressed by the target cells and / or the AAV vectorIt can be the protein or nucleic acid molecule of interest. Examples of detectable labels include, but are not limited to, FLAG tag, polyhistidine tag (e.g., 6×His), SNAP tag, Halo tag, cMyc tag, glutathione-S-transferase tag, avidin, enzyme, fluorescent protein, luminescent protein, chemiluminescent protein, bioluminescent protein, and phosphorescent protein.In some embodiments, the fluorescent protein is selected from the group consisting of blue / UV proteins (e.g., BFP, TagBFP, mTagBFP2, Azurite, EBFP2, mKalama1, Sirius, Sapphire, and T-Sapphire); cyan proteins (e.g., CFP, eCFP, Cerulean, SCFP3A, mTurquoise, mTurquoise2, monomeric Midoriishi-Cyan, TagCFP, and mTFP1); green proteins (e.g., GFP, eGFP, meGFP (A208K mutation), Emerald, Superfolder GFP, monomeric azami green, TagGFP2, mUKG, mWasabi, Clover, and mNeonGreen); yellow proteins (e.g., YFP, eYFP, Citrine, Venus, SYFP2, and TagYFP); orange proteins (e.g., monomeric Kusabira Orange, mKOκ, mKO2, mOrange, and mOrange2); red proteins (e.g., RFP, mRaspberry, mCherry, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, and mRuby2); far-red proteins (e.g., mPlum, HcRed-Tandem, mKate2, mNeptune, and NirFP); near-infrared proteins (e.g., TagRFP657, IFP1.4, and iRFP); long Stokes shift proteins (e.g., mKeima Red, LSS-mKate1, LSS-mKate2, and mBeRFP); photoactivatable proteins (e.g., PA-GFP, PAmCherry1, and PATagRFP); photoconvertible proteins (e.g., Kaede (green), Kaede (red), KikGR1 (green), KikGR1 (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), mEos3.2 (green), mEos3.2 (red), PSmOrange, and PSmOrange); and photoswitching proteins (e.g., Dronpa).In some embodiments, the detectable tag can be selected from AmCyan, AsRed, DsRed2, DsRed Express, E2-Crimson, HcRed, ZsGreen, ZsYellow, mCherry, mStrawberry, mOrange, mBanana, mPlum, mRasberry, tdTomato, DsRed monomer, and / or AcGFP, all of which are available from Clontech. In certain embodiments, the detectable label is GFP.
[0176] The detectable label can be detected by means generally known in the art including, but not limited to, flow cytometry, qPCR, Western blot, ELISA, and immunohistochemistry. In certain embodiments, the detection method is a high-throughput detection method such as flow cytometry or qPCR that can analyze multiple patient samples simultaneously. In some embodiments, the detection method is flow cytometry. In some embodiments, the detection method is qPCR.
[0177] In some embodiments, a predetermined threshold of the expression level of the detectable label is determined for screening patients for the treatment of eye disorders. In some embodiments, patients who meet or exceed this threshold are selected for treatment with the therapeutic AAV vectors described herein. In some embodiments, patients who do not meet this threshold are excluded from future treatment with the therapeutic AAV vectors described herein or must undergo an immunosuppressive treatment regimen prior to initiation of treatment with the therapeutic AAV vectors described herein.
[0178] In some embodiments, the predetermined threshold can be expressed as the absolute expression level of the detectable label in the test sample, above which the patient is evaluated as suitable for gene therapy, and / or Lower than that, the patient is evaluated as not suitable for gene therapy. For example, in some embodiments where the detectable label is detected by qPCR, the predetermined threshold is an absolute expression level of 0.2 or more. In such embodiments, the patient is evaluated as suitable for gene therapy if the absolute expression level of the detectable label is 0.2 or more, and is evaluated as not suitable for gene therapy if the absolute expression level of the detectable label is less than 0.2. In some embodiments, the predetermined threshold is an absolute expression level of 0.6 or more. In such embodiments, the patient is evaluated as suitable for gene therapy if the absolute expression level of the detectable label is 0.6 or more, and is evaluated as not suitable for gene therapy if the absolute expression level of the detectable label is less than 0.6.
[0179] In some embodiments, the detectable label is detected by flow cytometry, and the predetermined threshold is the absolute expression level of 20% or more labeled positive target cells in the test sample (e.g., GFP+ cell % ≥ 20%). In such embodiments, the patient is evaluated as suitable for gene therapy if the absolute expression level of the detectable label is 20% or more labeled positive target cells, and is evaluated as not suitable for gene therapy if the absolute expression level of the detectable label is less than 20% labeled positive target cells. In some embodiments, the predetermined threshold is the absolute expression level of 40% or more labeled positive target cells in the test sample (e.g., GFP+ cell % ≥ 40%). In such embodiments, the patient is evaluated as suitable for gene therapy if the absolute expression level of the detectable label is 40% or more labeled positive target cells, and is evaluated as not suitable for gene therapy if the absolute expression level of the detectable label is less than 40% labeled positive target cells.
[0180] In some embodiments, a predetermined threshold can be expressed as the relative expression level of a detectable label in a test sample (i.e., the expression of the detectable label in the test sample when compared to a control sample), and a patient is evaluated as suitable for gene therapy if it is higher and / or evaluated as not suitable for gene therapy if it is lower. In some embodiments where the detectable label is detected by flow cytometry, the predetermined threshold is the relative expression level of 40% or more labeled positive target cells in the test sample (e.g., GFP+ cell % ≧ 40%). In such embodiments, a patient is evaluated as suitable for gene therapy if the absolute expression level of the detectable label is 40% or more labeled positive target cells, and evaluated as not suitable for gene therapy if the absolute expression level of the detectable label is less than 40% labeled positive target cells. In some embodiments where the detectable label is detected by flow cytometry, the predetermined threshold is the relative expression level of 80% or more labeled positive target cells in the test sample (e.g., GFP+ cell % ≧ 80%). In such embodiments, a patient is evaluated as suitable for gene therapy if the absolute expression level of the detectable label is 80% or more labeled positive target cells, and evaluated as not suitable for gene therapy if the absolute expression level of the detectable label is less than 80% labeled positive target cells.
[0181] In some embodiments, the patients screened and / or selected for treatment by the methods described herein have one or more mtDNA point mutations. In some embodiments, the patient has a point mutation in the gene encoding the protein of complex I of the mitochondrial oxidative phosphorylation chain. For example, the patient may have one or more point mutations in the ND4 gene, the ND1 gene, or the ND6 gene. In some embodiments, the patient has a point mutation at nucleotide position 11778 of the ND4 gene. In some embodiments, the point mutation is G11778A in the ND4 gene. In some embodiments, the patient has a point mutation at nucleotide position 3460 of the ND1 gene. In some embodiments, the point mutation is G3460A in the ND1 gene. In some embodiments, the patient has a point mutation at nucleotide position 14484 of the ND6 gene. In some embodiments, the point mutation is T14484C in the ND6 gene. In some embodiments, for treatment by the methods described herein, the patients screened and / or selected have one or more point mutations selected from G11778A in the ND4 gene, G3460A in the ND1 gene, and T14484C in the ND6 gene, and are of Chinese and / or Argentinean descent.
[0182] In some embodiments, the patients screened and / or selected for treatment by the methods described herein have one or more point mutations selected from G11778A in the ND4 gene, G3460A in the ND1 gene, and T14484C in the ND6 gene and are of Argentinean origin. In some embodiments, the patients screened and / or selected for treatment by the methods described herein have one or more point mutations selected from G11778A in the ND4 gene, G3460A in the ND1 gene, and T14484C in the ND6 gene and are of Chinese origin. In certain embodiments, the patients screened and / or selected for treatment by the methods described herein have one or more point mutations selected from G11778A in the ND4 gene and are of Chinese origin.
[0183] In some embodiments, the present disclosure provides a kit for use in screening patients for the treatment of an ophthalmic disorder and / or for use in selecting patients for the treatment of an ophthalmic disorder. In such embodiments, the kit includes an AAV comprising a recombinant nucleic acid encoding a detectable label and one or more reagents for detecting the detectable label. In some embodiments, the one or more reagents for detecting the detectable label are selected from an antibody that binds to the detectable label and one or more primer oligonucleotides specific for the recombinant nucleic acid encoding the detectable label.
[0184] In some embodiments, the kit further includes one or more reagents for reconstituting and / or diluting the AAV vector and / or the detection reagent components. In some embodiments, the kit further includes one or more additional reagents, such as a buffer for introducing the AAV vector into cells, a washing buffer, and / or a cell culture medium. The components of the kit may be contained in separate containers or may be combined in a single container.
[0185] In some embodiments, in addition to the above components, the kit further includes instructions for using the components of the kit to practice the methods of the present disclosure. Instructions for practicing the methods are typically recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. In this way, the instructions may be present in the kit as an accompanying document of the package, or on the label of the kit or the container of its components (i.e., in a state combined with the packaging material or the secondary packaging material). In other embodiments, the instructions exist as an electronic storage data file present on a suitable computer-readable recording medium, such as a CD-ROM, diskette, flash drive, etc. In yet other embodiments, the actual instructions are not present in the kit, and means are provided for obtaining the instructions from a remote source, for example via the Internet. An example of this embodiment is a kit that includes a web address through which the instructions can be viewed and / or downloaded. With respect to the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
[0186] Pharmaceutical composition The vectors of the present invention can be formulated into pharmaceutical compositions. These compositions can include, in addition to the vector, pharmaceutically acceptable excipients, carriers, buffers, stabilizers or other materials well known to those skilled in the art. Such materials must be non-toxic and must not interfere with the effectiveness of the active ingredient. The exact nature of the carrier or other materials can be determined by those skilled in the art depending on the route of administration, i.e., in this specification, depending on direct injection into the retina, subretinal or intravitreal.
[0187] Pharmaceutical compositions are typically in liquid form. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oil, mineral oil or synthetic oil. It may also include physiological saline, magnesium chloride, dextrose or other sugar solutions, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. In some cases, a surfactant such as 0.001% Pluronic acid (PF68) can be used.
[0188] In the case of injection into the affected area, the active ingredient will take the form of an aqueous solution having a suitable pH, isotonicity and stability and not containing pyrogenic substances. A person skilled in the art can sufficiently prepare a suitable solution using, for example, an isotonic vehicle such as sodium chloride injection solution, Ringer's injection solution, or lactated Ringer's injection solution. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included as necessary.
[0189] For delayed release, the vector may be included in a pharmaceutical composition formulated for slow release according to methods known in the art, for example, in microcapsules formed from a biocompatible polymer, or in a liposome carrier system.
[0190] sample Samples suitable for use in the methods described herein can be nucleic acid samples from a subject. As used herein, "nucleic acid sample" can include RNA or DNA, or a combination thereof. In another embodiment, a "polypeptide sample" (e.g., a peptide or protein, or a fragment thereof) can be used to confirm information that an amino acid change has occurred as a result of a gene variant. Nucleic acids and polypeptides can be extracted from one or more samples including, but not limited to, blood, saliva, urine, buccal mucosal swabs, sputum, serum, tears, skin, tissue, or hair. Nucleic acid samples can be assayed to obtain nucleic acid information. As used herein, "nucleic acid information" includes the nucleic acid sequence itself, the presence / absence of gene variants in the nucleic acid sequence, physical properties that vary according to the nucleic acid sequence (e.g., Tm), and the amount of nucleic acid (e.g., mRNA copy number). "Nucleic acid" means any one of DNA, RNA, DNA containing artificial nucleotides, or RNA containing artificial nucleotides. As used herein, "purified nucleic acid" includes cDNA, fragments of genomic nucleic acid, nucleic acids generated using polymerase chain reaction (PCR), nucleic acids formed by restriction enzyme treatment of genomic nucleic acid, recombinant nucleic acids, and chemically synthesized nucleic acid molecules. "Recombinant" nucleic acid molecules include nucleic acid molecules made by artificially combining two sequence segments that would otherwise be separate, for example, by chemical synthesis or by manipulation of isolated nucleic acid segments using genetic engineering techniques. As used herein, "polypeptide" includes proteins, fragments of proteins, and peptides, whether isolated from a natural source, produced by recombinant techniques, or chemically synthesized. Polypeptides can have one or more modifications, such as post-translational modifications (e.g., glycosylation, phosphorylation, etc.) or any other modifications (e.g., pegylation, etc.). Polypeptides can contain one or more non-naturally occurring amino acids (e.g., amino acids with side chain modifications, etc.).
[0191] In some embodiments, the nucleic acid sample can include cells or tissues, such as cell lines. Exemplary cell types from which nucleic acids can be obtained using the methods described herein include, but are not limited to, the following: blood cells, such as B lymphocytes, T lymphocytes, white blood cells, red blood cells, macrophages or neutrophils; muscle cells, such as skeletal cells, smooth muscle cells or cardiomyocytes; germ cells, such as sperm or eggs; epithelial cells; connective tissue cells, such as adipocytes, cartilage tissue; fibroblasts or osteoblasts; neurons; astrocytes; stromal cells; organ-specific cells, such as kidney cells, pancreatic cells, liver cells or keratinocytes; stem cells; or any cells developed from them. The cells from which nucleic acids can be obtained are blood cells, or a specific type of blood cells, such as hematopoietic stem cells, or cells derived from hematopoietic stem cells, such as red blood cells, B lymphocytes, T lymphocytes, natural killer cells, neutrophils, basophils, eosinophils, monocytes, macrophages or platelets. Generally, any type of stem cell, including but not limited to embryonic stem cells, adult stem cells or pluripotent stem cells, can be used.
[0192] In some embodiments, the nucleic acid sample can be processed for RNA or DNA isolation, e.g., the RNA or DNA in a cell or tissue sample can be separated from other components of the nucleic acid sample. Cells can be obtained from the nucleic acid sample using standard techniques, e.g., by centrifuging a cell sample to pellet the cells and then resuspending the pelleted cells in a buffer, e.g., phosphate buffered saline (PBS). In some embodiments, after centrifuging the cell suspension to obtain a cell pellet, the cells can be lysed to extract DNA. In some embodiments, the nucleic acid sample can be concentrated and / or purified to isolate DNA. All nucleic acid samples obtained from a subject are considered to be those obtained from the subject, including those to be subjected to any kind of further processing. In some embodiments, RNA or DNA can be extracted from the nucleic acid sample using standard techniques and kits known in the art, including, e.g., the phenol extraction method, the QIAAMP® Tissue Kit (Qiagen, Chatsworth, Calif.), the WIZARD® Genomic DNA Purification Kit (Promega), or the Qiagen Autopure method using Puregene chemistry which can enable purification of highly stable DNA suitable for long-term storage.
[0193] In some embodiments, determination of allele identity, or determination of copy number, can include, although not necessarily, obtaining a nucleic acid sample containing RNA and / or DNA from a subject and / or evaluating identity, copy number, the presence or absence of one or more genetic variants, and their chromosomal locations within the genomic DNA (i.e., the genome of the subject) from which the nucleic acid sample is derived.
[0194] The individual or organization performing the determination need not actually perform a physical analysis of the nucleic acid sample from the subject. In some embodiments, the method can include using information obtained by analysis of the nucleic acid sample by a third party. In some embodiments, the method can include steps that occur in more than one location. For example, the nucleic acid sample can be obtained from the subject at a first location, e.g., a medical institution, or in the case of a self-test kit, at the subject's home. The nucleic acid sample can be analyzed at the same location or at a second location, e.g., a laboratory or other testing facility.
[0195] nucleic acid The nucleic acids and polypeptides described herein can be used in the methods and kits of the present disclosure. In some embodiments, aptamers that specifically bind to the nucleic acids and polypeptides described herein can be used in the methods and kits of the present disclosure. As used herein, nucleic acids include deoxyribonucleotides (DNA) or ribonucleotides (RNA), whether single or in polymers, whether naturally occurring or non-naturally occurring, whether double-stranded or single-stranded, e.g., whether encoding a gene to be translated or not encoding, e.g., a regulatory region or any fragment, derivative, mimetic or complement thereof. In some embodiments, nucleic acids can include oligonucleotides, nucleotides, polynucleotides, nucleic acid sequences, genomic sequences, complementary DNA (cDNA), antisense nucleic acids, DNA regions, probes, primers, genes, regulatory regions, introns, exons, open reading frames, binding sites, target nucleic acids, and allele-specific nucleic acids.
[0196] As used herein, a "probe" includes a nucleic acid fragment for examining nucleic acids in a sample using a hybridization reaction based on nucleic acid complementarity.
[0197] As used herein, a "hybrid" includes a double-strand formed between any one of the above nucleic acids, e.g., DNA-DNA, DNA-RNA, RNA-RNA, or the like, within the same type or across different types.
[0198] As used herein, an "isolated" nucleic acid is separated from nucleic acids that normally flank a gene or nucleotide sequence as found in a genomic sequence, and / or has been purified to remove some or all other transcribed sequences (such as found in an RNA library). For example, an isolated nucleic acid of the disclosure can be substantially isolated with respect to the complex cellular environment in which it naturally occurs, or with respect to the culture medium when produced by recombinant techniques, or with respect to chemical precursors or other chemicals when chemically synthesized. In some cases, the isolated material may form part of a composition, such as a crude extract containing other substances, a buffer system, or a reagent mixture. In some embodiments, the material can be purified to substantial homogeneity using methods known in the art, such as polyacrylamide gel electrophoresis (PAGE) or column chromatography (e.g., HPLC). With respect to genomic DNA (gDNA), the term "isolated" can also refer to nucleic acid separated from the chromosome with which the genomic DNA is naturally associated. For example, an isolated nucleic acid molecule can contain less than about 250 kb, 200 kb, 150 kb, 100 kb, 75 kb, 50 kb, 25 kb, 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of the nucleotides flanking the nucleic acid molecule in the gDNA of the cell from which the nucleic acid molecule is obtained.
[0199] The nucleic acid may be fused with other coding or regulatory sequences, and this may be considered isolated. For example, recombinant DNA contained in a vector is included in the definition of "isolated" as used herein. In some embodiments, not only partially or substantially purified DNA molecules in solution, but also recombinant DNA molecules in heterologous host cells or organisms may be included in the isolated nucleic acid. Isolated nucleic acids also include in vivo and in vitro RNA transcripts of the DNA molecules of the present disclosure. Isolated nucleic acid molecules or nucleotide sequences can be synthesized chemically or by recombinant means. Such isolated nucleotide sequences can be useful, for example, in the production of the encoded polypeptide, as a probe for isolating homologous sequences (e.g., from other mammalian species), in gene mapping (e.g., by in situ hybridization with chromosomes), or in the detection of gene expression in tissues (e.g., human tissues) by, for example, Northern blot analysis or other hybridization techniques disclosed herein. The present disclosure also relates to nucleic acid sequences that hybridize to the nucleotide sequences described herein under high stringency hybridization conditions, such as for selective hybridization. Such nucleic acid sequences can be detected and / or isolated by allele- or sequence-specific hybridization (e.g., under high stringency conditions). Stringency conditions and methods for nucleic acid hybridization are well known to those skilled in the art (see, for example, Current Protocols in Molecular Biology, Ausubel, F. et al., John Wiley & Sons, (1998), and Kraus, M. and Aaronson, S., Methods Enzymol., 200:546-556 (1991), and these teachings are hereby incorporated by reference in their entirety into this specification.
[0200] The calculated value of "identity" or "percent identity" between two or more nucleotide or amino acid sequences can be determined by aligning the sequences for optimal comparison purposes (e.g., gaps may be introduced into the sequence of the first sequence). The nucleotides at the corresponding positions are then compared, and the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions / total number of positions × 100). For example if a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap.
[0201] In some embodiments, the length of the sequences to be aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the length of the reference sequence. The actual comparison of the two sequences can be accomplished by well-known methods, such as those using mathematical algorithms. Non-limiting examples of such mathematical algorithms are described in Karlin, S. and Altschul, S., Proc. Natl. Acad. Sci. USA, 90-5873-5877 (1993). Such algorithms are incorporated into the NBLAST and XBLAST programs (version 2.0) as described in Altschul, S. et al., Nucleic Acids Res., 25:3389-3402 (1997). When using the BLAST and Gapped BLAST programs, any appropriate parameters of each program (e.g., NBLAST) can be used. For example, the parameters for sequence comparison can be set to score = 100, word length = 12 or can be changed (e.g., W = 5 or W = 20). Other examples include the algorithms of Myers and Miller, CABIOS (1989), ADVANCE, ADAM, BLAT, and FASTA. In some embodiments, the percent identity between two amino acid sequences can be obtained, for example, using the GAP program in the GCG software package (Accelrys, Cambridge, UK).
[0202] A "probe" or "primer" can be an oligonucleotide that hybridizes to a complementary strand of a nucleic acid molecule in a base-specific manner. A probe can include a primer, which can be a single-stranded oligonucleotide probe that can serve as a starting point for template-specific DNA synthesis using methods including, but not limited to, polymerase chain reaction (PCR) and ligase chain reaction (LCR) for amplification of a target sequence. An oligonucleotide can, as described herein, include a segment or fragment of a nucleic acid sequence, or a complement thereof. In some embodiments, a DNA segment can be 5 to 10,000 contiguous bases, and can range from 5, 10, 12, 15, 20, or 25 nucleotides to 10, 15, 20, 25, 30, 40, 50, 100, 200, 500, 1000, or 10,000 nucleotides. Probes and primers can include, in addition to DNA and RNA, polypeptide nucleic acids (PNAs) as described in Nielsen, P. et al., Science 254:1497-1500 (1991). A probe or primer can include a region of nucleotide sequence that hybridizes to at least about 15, typically about 20-25, and in certain embodiments about 40, 50, 60, or 75 contiguous nucleotides of a nucleic acid molecule.
[0203] The present disclosure also provides an isolated nucleic acid, such as a probe or primer, containing a fragment or portion that can selectively hybridize to a nucleic acid comprising or consisting of a nucleotide sequence that can include at least one polymorphism or polymorphic allele contained by a gene variant described herein, or a wild-type nucleotide located at the same position, or a complement thereof. In some embodiments, a probe or primer can be at least 70%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a contiguous nucleotide sequence or the complement of a contiguous nucleotide sequence.
[0204] In some embodiments, the nucleic acid probe contains a gene variant described herein It can be an oligonucleotide capable of hybridizing to a complementary region of a symptom (e.g., LHON)-related gene. The nucleic acid fragment of the present disclosure can be used as a probe or primer in an assay as described herein.
[0205] The nucleic acids of the present disclosure, such as those described above, can be identified and isolated using standard molecular biology techniques well known to those skilled in the art. In some embodiments, DNA can be amplified and / or labeled (e.g., radioactively labeled, fluorescently labeled) and used as a probe for screening, for example, a cDNA library derived from an organism. cDNA can be obtained from mRNA and can be included in a suitable vector. For example, the corresponding clone can be isolated and the DNA obtained after excision in vivo, and the cloned insert can be sequenced in one or both orientations by methods recognized in the art for identifying the correct reading frame encoding a polypeptide of appropriate molecular weight. Using these or similar methods, polypeptides and the DNA encoding the polypeptides can be isolated, sequenced, and further characterized.
[0206] In some embodiments, the nucleic acid can include one or more polymorphisms, mutations or variations, such as single nucleotide polymorphisms (SNPs), single nucleotide variants (SNVs), copy number variations (CNVs), such as insertions, deletions, inversions and translocations. In some embodiments, the nucleic acid can include analogs, such as phosphorothioates, phosphoramidates, methylphosphonates, chiral methylphosphonates, 2-O-methyl ribonucleotides, or modified nucleic acids, such as modified backbone residues or linkages, or nucleic acids combined with carbohydrates, lipids, polypeptides or other materials, or peptide nucleic acids (PNAs), such as chromatin, ribosomes and transcriptosomes. In some embodiments, the nucleic acid can include nucleic acids of various structures, such as A-form DNA, B-form DNA, Z-DNA, siRNA, tRNA and ribozymes. In some embodiments, the nucleic acid can be a natural or non-natural polymorphism having, for example, one or more differences in sequence, such as additions, deletions and / or substitutions, compared to a reference sequence. In some embodiments, the reference sequence can be based on publicly available information, such as the U.C.Santa Cruz Human Genome Browser Gateway (genome.ucsc.edu / cgi-bin / hgGateway), or the NCBI website (www.ncbi.nlm.nih.gov). In some embodiments, the reference sequence can be determined by an implementer of the present disclosure using methods well known in the art, such as by sequencing a reference nucleic acid.
[0207] In some embodiments, a probe can be hybridized to an allele, SNP, SNV or CNV described herein. In some embodiments, the probe can bind to another marker sequence associated with LHON described herein.
[0208] One of ordinary skill in the art will know how to design a probe such that sequence-specific hybridization can occur only if a particular allele is present in the genomic sequence from the test nucleic acid sample. The present disclosure can also be simplified in its implementation by using any convenient genotyping method, including commercially available techniques and methods for genotyping a particular genetic mutation.
[0209] Control probes can also be used. For example, a probe that binds to a more invariant sequence, such as repetitive DNA associated with the centromere of a chromosome, can be used as a control. In some embodiments, the probes can be obtained from a commercial supplier. In some embodiments, the probes can be synthesized, for example, chemically or in vitro, or made from chromosomal or genomic DNA by standard techniques. In some embodiments, sources of DNA that can be used include genomic DNA, cloned DNA sequences, somatic hybrids containing one human chromosome or a portion thereof in combination with the normal chromosomal complement of the host, and chromosomes purified by flow cytometry or microdissection. Regions of interest can be isolated by cloning or by site-specific amplification using PCR.
[0210] One or more nucleic acids, such as probes or primers, may be labeled, for example, by direct labeling, to include a detectable label. Detectable labels can include any label that can be detected by physical, chemical, or biological processes, such as radioactive labels, such as 32P or 3H, fluorescent labels, such as FITC, chromophore labels, affinity ligand labels, enzyme labels, such as alkaline phosphatase, horseradish peroxidase, or I2 galactosidase, enzyme cofactor labels, hapten conjugate labels, such as digoxigenin or dinitrophenyl, Raman signal generating labels, magnetic labels, spin labels, epitope labels, such as FLAG or HA epitopes, luminescent labels, heavy atom labels, nanoparticle labels, electrochemical labels, light scattering labels, spherical shell labels, semiconductor nanocrystal labels, such as quantum dots (described in U.S. Patent No. 6,207,392), and any other signal generating labels known to those skilled in the art. The labels can be those that can visualize the probe with or without using secondary detection molecules. Nucleotides can be directly incorporated into the probe by standard techniques, such as nick translation, random priming, and PCR labeling. As used herein, "signal" includes signals such as fluorescence, radiation, chemiluminescence, etc., that can be suitably detected and measured by appropriate means.
[0211] Non-limiting examples of label moieties useful for detection include, but are not limited to, suitable enzymes, such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; members of binding pairs that can form complexes, such as streptavidin / biotin, avidin / biotin, or antigen / antibody complexes, such as rabbit IgG and anti-rabbit IgG; fluorophores, such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, tetramethylrhodamine, eosin, green fluorescent protein, erythrosin, coumarin, methylcoumarin, pyrene, malachite green, stilbene, lucifer yellow, cascade blue, Texas Red, dichlorotriazinylamine fluorescein, dansyl chloride, phycoerythrin, fluorescent lanthanide complexes such as those containing europium and terbium, cyanine dye family members such as Cy3 and Cy5, molecular beacons and their fluorescent derivatives, and other materials known in the art such as, for example, Principles of Fluorescence Spectroscopy, Joseph R. Lakowicz (Editor), Plenum Pub Corp, 2nd edition (July 1999), and those described in the 6th Edition of the Molecular Probes Handbook by Richard P. Hoagland; luminescent materials such as luminol; light scattering or plasmon resonance materials such as gold or silver particles, or quantum dots; or radioactive materials containing 14C, 123I, 124I, 125I, Tc99m, 32P, 33P, 35S or 3H.
[0212] Other labels, such as backbone labels, can also be used in the methods of the present disclosure. Backbone labels include nucleic acid stains that bind to nucleic acids independent of the sequence. Non-limiting examples include intercalating dyes such as phenanthridine and acridine (e.g., ethidium bromide, propidium iodide, hexidium iodide, dihydroethidium, ethidium homodimer 1 and 2, ethidium monoazide, and ACMA); some minor groove binders such as indole and imidazole (e.g., Hoechst 33258, Hoechst 33342, Hoechst 34580 and DAPI); and numerous nucleic acid stains such as, for example, acridine orange, 7-AAD, actinomycin D, LDS751 and he Examples include doxystilbamidine. All of the above nucleic acid stains are commercially available from suppliers such as Molecular Probes, Inc. Further examples of nucleic acid stains include the following dyes provided by Molecular Probes: cyanine dyes such as SYTOX Blue, SYTOX Green, SYTOX Orange, POPO-1, POPO-3, YOYO-1, YOYO-3, TOTO-1, TOTO-3, JOJO-1, LOLO-1, BOBO-1, BOBO-3, PO-PRO-1, PO-PRO-3, BO-PRO-1, BO-PRO-3, TO-PRO-1, TO-PRO-3, TO-PRO-5, JO-PRO-1, LO-PRO-1, YO-PRO-1, YO-PRO-3, PicoGreen, OliGreen, RiboGreen, SYBR Gold, SYBR Green I, SYBR Green II, SYBR DX, SYTO-40, -41, -42, -43, -44, -45 (blue), SYTO-13, -16, -24, -21, -23, -12, -11, -20, -22, -15, -14, -25 (green), SYTO-81, -80, -82, -83, -84, -85 (orange), SYTO-64, -17, -59, -61, -62, -60, -63 (red).
[0213] In some embodiments, different colored fluorophores, such as 7-amino-4-methylcoumarin-3-acetic acid (AMCA), 5-(and -6)-carboxy-X-rhodamine, Lissamine rhodamine B, 5-(and -6)-carboxyfluorescein, fluorescein-5-isothiocyanate (FITC), 7-diethylaminocoumarin-3-carboxylic acid, tetramethylrhodamine-5-(and -6)-isothiocyanate, 5-(and -6)-carboxytetramethylrhodamine, 7-hydroxycoumarin-3-carboxylic acid, 6-[fluorescein 5-(and -6)-carboxamide]hexanoic acid, N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a diaza-3-indacenepropionic acid, eosin-5-isothiocyanate, erythrosin-5-isothiocyanate, TRITC, rhodamine, tetramethylrhodamine, R-phycoerythrin, Cy-3, Cy-5, Cy-7, Texas Red, Phar-Red, allophycocyanin (APC), and cascade™ blue acetyl azide can be selected so that each probe, whether assembled or not, can be individually visualized. In some embodiments, the fluorescently labeled probes can be viewed with a fluorescence microscope and filters suitable for each fluorophore, or by using a dual or triple bandpass filter set for observing multiple fluorophores. In some embodiments, techniques such as flow cytometry can be used to examine the hybridization patterns of the probes.
[0214] In other embodiments, the probe can be indirectly labeled, for example, with biotin or digoxigenin, or can be labeled with a radioisotope, such as 32P and / or 3H. By way of non-limiting example, a probe indirectly labeled with biotin can be detected by avidin bound to a detectable marker. For example, avidin can be conjugated to an enzyme marker, such as alkaline phosphatase or horseradish peroxidase. In some embodiments, the enzyme marker can be detected using a colorimetric reaction that uses a substrate and / or a catalyst of the enzyme. In some embodiments, a catalyst for alkaline phosphatase, such as 5-bromo-4-chloro-3-indolyl phosphate and nitroblue tetrazolium, can be used. In some embodiments, a catalyst for horseradish peroxidase, such as diaminobenzoate, can be used.
[0215] Formulations, Routes of Administration, and Effective Dosages Yet another aspect of the disclosure relates to formulations, routes of administration, and effective dosages for pharmaceutical compositions comprising the agents or combinations of agents of the disclosure. Such pharmaceutical compositions can be used to treat the above-described conditions (e.g., LHON).
[0216] The compounds of the disclosure are suitable for oral (including buccal and sublingual), rectal, nasal, topical, transdermal patch, pulmonary , vaginal, suppository, or parenteral (including intraocular, intravitreal, intramuscular, intra-articular, intrathecal, intradermal, intraperitoneal, subcutaneous, and intravenous) administration, or can be administered as a pharmaceutical formulation including those suitable for administration by aerosolization, inhalation, or insufflation. General information on drug delivery can be found in Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems (Lippencott Williams & Wilkins, Baltimore Md. (1999)).
[0217] In various embodiments, the pharmaceutical composition includes a carrier and excipients (including, but not limited to, buffers, carbohydrates, mannitol, polypeptides, amino acids, antioxidants, bacteriostatic agents, chelating agents, suspending agents, thickening agents, and / or preservatives), water, oils including those of petroleum origin, animal origin, plant origin, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc., physiological saline, dextrose, and glycerol aqueous solutions, flavoring agents, coloring agents, viscosity reducing agents, as well as other acceptable additives, adjuvants or binders, and other pharmaceutically acceptable auxiliary substances for approaching physiological conditions, such as pH buffers, tonicity agents, emulsifying agents, wetting agents, etc. Examples of excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, wheat, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol, etc. In some embodiments, the pharmaceutical formulation substantially does not contain a preservative. In other embodiments, the pharmaceutical formulation may contain at least one preservative. General methodologies for pharmaceutical dosage forms can be found in Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems (Lippencott, Williams, & Wilkins, Baltimore Md. (1999)). It can be recognized that any suitable carrier known to those skilled in the art can be employed to administer the compositions of the present disclosure, and the type of carrier can vary depending on the mode of administration.
[0218] Compounds can also be encapsulated within liposomes using well-known techniques. Biodegradable microspheres can also be employed as carriers for the pharmaceutical compositions of the present disclosure. Suitable biodegradable microspheres are disclosed, for example, in U.S. Patent Nos. 4,897,268, 5,075,109, 5,928,647, 5,811,128, 5,820,883, 5,853,763, 5,814,344, and 5,942,252.
[0219] The compound can be administered in a state encapsulated in liposomes or microspheres (or microparticles). Methods for preparing liposomes and microspheres for administration to a subject are well known to those skilled in the art. U.S. Patent No. 4,789,734 describes a method for encapsulating biological materials in liposomes, the contents of which are incorporated herein by reference. Essentially, the material is dissolved in an aqueous solution, appropriate phospholipids and lipids are added, together with a surfactant if necessary, and the material is dialyzed or sonicated as required. A review of known methods is provided by G. Gregoriadis, Chapter 14, “Liposomes,” Drug Carriers in Biology and Medicine, pp. 287-341 (Academic Press, 1979).
[0220] Microspheres formed of polymers or polypeptides are well known to those skilled in the art and can be adapted to enter the bloodstream directly through the digestive tract. Alternatively, microspheres or composite materials of microspheres incorporating the compound can be implanted for slow release over a period ranging from several days to several months. For example, reference is made to U.S. Patent Nos. 4,906,474, 4,925,673 and 3,625,214, as well as Je in, TIPS 19:155-157 (1998), the contents of which are incorporated herein by reference.
[0221] The concentration of the drug can be adjusted, the pH of the solution can be buffered, and the isotonicity can be adjusted to be suitable for intraocular or intravitreal injection.
[0222] The compounds of the present disclosure can be formulated as sterile solutions or suspensions in a suitable vehicle. The pharmaceutical compositions can be sterilized by conventional well-known sterilization techniques or can be sterile filtered. The resulting aqueous solutions can be packaged for use as such or can be lyophilized, and the lyophilized formulations can be mixed with a sterile solution prior to administration. For suitable formulation compositions and additional carriers, reference is made to Remington “The Science and Practice of Pharmacy” (20th Ed., Lippincott Williams & Wilkins, Baltimore MD), the entire teachings of which are incorporated herein by reference.
[0223] The agent or its pharmaceutically acceptable salt can be provided alone or in combination with one or more other agents or one or more other forms. For example, the formulation can contain one or more agents in a specific ratio depending on the relative potencies of the respective agents and the intended indication. For example, in a composition for targeting two different host targets, if the potencies are similar, the agents can be used in a ratio of about 1:1. The two forms can be formulated together into the same dosage unit, for example, a single cream, suppository, tablet, capsule, aerosol spray, or sachet of powder dissolved in a beverage, or each form can be formulated into separate units, for example, two creams, two suppositories, two tablets, two capsules, a tablet and a solution for dissolving the tablet, two aerosol sprays, or a sachet of powder and a solution for dissolving the powder.
[0224] The term “pharmaceutically acceptable salt” means a salt that retains the biological effectiveness and properties of the agent used in the present disclosure and that is not undesirable biologically or otherwise.
[0225] Typical salts are those of inorganic ions, such as sodium, potassium, calcium, magnesium ions and the like. Such salts include salts with inorganic or organic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, methanesulfonic acid, p-toluenesulfonic acid, acetic acid, fumaric acid, succinic acid, lactic acid, mandelic acid, malic acid, citric acid, tartaric acid or maleic acid. In addition, when the agent(s) contains a carboxyl group or other acidic group, it can be converted into a pharmaceutically acceptable addition salt with an inorganic or organic base. Examples of suitable bases include sodium hydroxide, potassium hydroxide, ammonia, cyclohexylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine and the like.
[0226] Pharmaceutically acceptable esters or amides retain the biological effectiveness and properties of the agents used in the present disclosure and refer to those that are not undesirable biologically or otherwise. Typical esters include ethyl, methyl, isobutyl, ethylene glycol and the like. Typical amines include unsubstituted amides, alkyl amides, dialkyl amides and the like.
[0227] In some embodiments, the agent can be administered in combination with one or more other compounds, forms and / or agents such as those described above. A pharmaceutical composition containing one or more other active agents can be formulated to have a specific molar ratio. For example, a molar ratio of about 99:1 to about 1:99 of the first active agent to the other active agent can be used. In a certain subpopulation of embodiments, the range of the molar ratio of the first active agent: the other active agent is about 80:20 to about 20:80, about 75:25 to about It is selected from 25:75, about 70:30 to about 30:70, about 66:33 to about 33:66, about 60:40 to about 40:60, about 50:50, and about 90:10 to about 10:90. The molar ratio of the first active agent to the other active agent may be about 1:9 and, in some embodiments, may be about 1:1. The two agents, forms and / or compounds may be formulated together into the same dosage unit, for example, one cream, suppository, tablet, capsule, or a subpackage of powder dissolved in a beverage, or each agent, form and / or compound may be formulated into separate units, for example, two creams, suppositories, tablets, two capsules, a tablet and a liquid for dissolving the tablet, an aerosol spray, a subpackage of powder and a liquid for dissolving the powder, etc.
[0228] If necessary or desirable, the agent and / or combination of agents may be further administered together with other agents. The selection of agents that can be co-administered with the agents and / or combinations of agents of the present disclosure may depend at least in part on the symptoms to be treated.
[0229] The agent(s) (or its pharmaceutically acceptable salt, ester or amide) can be administered by itself or in the form of a pharmaceutical composition in which the active agent(s) are contained in a mixture or blend together with one or more pharmaceutically acceptable carriers. A pharmaceutical composition, as used herein, can be any composition prepared for administration to a subject. The pharmaceutical compositions for the uses according to the present disclosure can be formulated by conventional methods using one or more physiologically acceptable carriers, including excipients, diluents and / or adjuvants, for example, those that facilitate processing the active agent into a dosage form that can be administered. The appropriate formulation can be determined at least in part by the dosage form selected. The agent(s) or its pharmaceutically acceptable salt, ester or amide useful in the present disclosure can be delivered to a subject using multiple routes or modes of administration, including oral, buccal, topical, rectal, transdermal, transmucosal, subcutaneous, intravenous, intraocular, intravitreal and intramuscular applications as well as by inhalation.
[0230] In some embodiments, an oil or non-aqueous solvent may be used to make the agent into a liquid formulation, for example due to the presence of a large lipophilic moiety. Alternatively, emulsions, suspensions or other formulations, such as liposomal formulations, may be used. With respect to liposomal formulations, any known method for formulating liposomes for the treatment of symptoms can be used. See, for example, Bangham et al., J. Mol. Biol. 23:238-252 (1965) and Szoka et al., Proc. Natl Acad. Sci. USA 75:4194-4198 (1978), which are incorporated herein by reference. Ligands can also be attached to the liposomes to direct these compositions to specific sites of action. The agents of the present disclosure can also be incorporated into foods, such as cream cheese, butter, salad dressing or ice cream, to facilitate solubilization, administration, and / or compliance in a specific target population.
[0231] The compounds of the present disclosure can be formulated for parenteral administration (e.g., by injection, such as intravitreal or intracameral injection), and can be provided in unit dosage forms of ampoules, prefilled syringes, small volume infusions, or in multiple dose containers with added preservatives. The compositions can take the form of suspensions, solutions or emulsions, such as solutions with aqueous polyethylene glycol, in oily or aqueous vehicles.
[0232] In the case of injectable formulations, the vehicle can be selected from those known to be suitable in the art, including aqueous solutions or oil suspensions, or emulsions using sesame oil, corn oil, cottonseed oil or peanut oil, and also elixirs, mannitol, dextrose, or sterile aqueous solutions and similar pharmaceutical vehicles. The formulations may also include biocompatible, biodegradable polymer compositions such as poly(lactic-co-glycolic acid). These materials can be used to form micro or nanospheres loaded with the drug and further coated or derivatized. It can be reformulated into air to provide excellent sustained release performance. Examples of vehicles suitable for periorbital or intraocular injection include, for example, suspensions of therapeutic agents in injection grade water, liposomes, and vehicles suitable for lipophilic substances. Other vehicles for periorbital or intraocular injection are well known in the art.
[0233] In some embodiments, the composition is formulated as a pharmaceutical composition suitable for intravenous administration to humans according to conventional procedures. Typically, the composition for intravenous administration is a solution in sterile isotonic buffered water. If necessary, the composition may further contain solubilizing agents and local anesthetics such as lidocaine to relieve pain at the injection site. Generally, the components are supplied separately or combined in unit dosage forms, for example, as dry lyophilized powders or water-free concentrates in sealed containers such as ampoules or sachets, indicating the amount of the active agent. If the composition is to be administered by infusion, it can be dispensed using an infusion bottle containing sterile pharmaceutical grade water or physiological saline. If the composition is to be administered by injection, an ampoule of sterile water for injection or physiological saline can be provided so that the components can be mixed before administration.
[0234] When administration is by injection, the active compound can be formulated in an aqueous solution, specifically a physiologically compatible buffer such as Hank's solution, Ringer's solution or buffered physiological saline. The solution may contain formulation agents such as suspending agents, stabilizers and / or dispersing agents. Alternatively, the active compound can be in powder form for reconstitution with a suitable vehicle such as sterile water free of pyrogens before use. In some embodiments, the pharmaceutical composition does not contain adjuvants or any other substances added to enhance the immune response stimulated by peptides. In some embodiments, the pharmaceutical composition contains substances that inhibit the immune response to peptides. Methods of formulation are known in the art and are disclosed, for example, in Remington’s Pharmaceutical Sciences, latest edition, Mack Publishing Co., Easton P.
[0235] In some embodiments, the eye disorder can be effectively treated by an ophthalmic solution, suspension, ointment, or insert containing the agent or combination of agents of the present disclosure. The eye drops can be prepared by dissolving the active ingredient in a sterile aqueous solution, such as physiological saline, buffer solution, etc., or by mixing with a powder composition that is dissolved before use. Other vehicles known in the art can be selected, such as, but not limited to, balanced salt solution, physiological saline, water-soluble polyethers such as polyethylene glycol, polyvinyls such as polyvinyl alcohol and povidone, cellulose derivatives such as methylcellulose and hydroxypropylmethylcellulose, petroleum derivatives such as mineral oil and white petrolatum, animal fats such as lanolin, polymers of acrylic acid such as carboxypolymethylene gel, vegetable oils such as peanut oil, and polysaccharides such as dextran, and glycosaminoglycans such as sodium hyaluronate. Optionally, additives commonly used in eye drops can be used. Such additives include isotonic agents (such as sodium chloride, etc.), buffering agents (such as boric acid, sodium monohydrogen phosphate, sodium dihydrogen phosphate, etc.), preservatives (such as benzalkonium chloride, benzethonium chloride, chlorobutanol, etc.), thickening agents (such as saccharides such as lactose, mannitol, maltose, etc.; such as hyaluronic acid or its salts such as sodium hyaluronate, potassium hyaluronate, etc.; such as mucopolysaccharides such as chondroitin sulfate, etc.; such as sodium polyacrylate, carboxyvinyl polymer, cross-linked polyacrylate, polyvinyl alcohol, polyvinyl pyrrolidone, methylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, carboxymethylcellulose, hydroxypropylcellulose, or other agents known to those skilled in the art).
[0236] The solubility of the components of the composition of the present invention can be improved by a surfactant or other suitable co-solvent in the composition. Such co-solvents include polysorbates 20, 60, and 80, pluronics F68, F-84, and P-103, cyclodextrin, or other agents known to those skilled in the art. Such co-solvents can be used at levels of about 0.01% to 2% by weight.
[0237] The compositions of the present disclosure can be packaged in multi-dose forms. Preservatives may be preferred to prevent microbial contamination during use. Suitable preservatives include benzalkonium chloride, thimerosal, chlorobutanol, methylparaben, propylparaben, phenylethyl alcohol, disodium edetate, sorbic acid, Onamer M, or other agents known to those skilled in the art. In conventional ophthalmic products, such preservatives can be used at levels of 0.004 to 0.02%. In the compositions of the present application, the preservative, preferably benzalkonium chloride, can be used at levels from 0.001% to less than 0.01% by weight, for example 0.001 to 0.008%, preferably about 0.005%. It has been found that a concentration of 0.005% of benzalkonium chloride may be sufficient to protect the compositions of the present disclosure from microbial attack.
[0238] In some embodiments, the agents of the present disclosure are delivered in a soluble form rather than a suspension form, which allows for more rapid and quantitative absorption at the site of action. Generally, formulations such as gels, creams, lotions, suppositories, and ointments can provide longer exposure to the agents of the present disclosure on the surface, while liquid formulations, such as sprays, provide more rapid short-term exposure.
[0239] In addition, it is contemplated that the compounds of the present disclosure can be releasably conjugated to a biocompatible polymer for use in sustained release formulations attached to, contained within, or conjugated to an insert for topical, intraocular, periocular, or systemic administration. Controlled release from the biocompatible polymer can also be utilized with a water-soluble polymer to form an ophthalmic formulation. Controlled release from a biocompatible polymer, such as PLGA microspheres or nanospheres, can be utilized in formulations suitable for intraocular implantation or injection for sustained release administration, and any suitable biodegradable and biocompatible polymer can be used.
Examples
[0240] The present invention will be further described by the following exemplary embodiments. It should be understood that these examples are merely intended to illustrate the present invention and not to limit the scope of the present invention. In the following examples, unless otherwise indicated, methods and conditions disclosed in, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or conditions recommended by the manufacturer can be used.
[0241] Example 1 - Preparation of ND4 Plasmid and Virus 1.1 Plasmid Preparation The nucleotide sequence of human ND4 (SEQ ID NO: 6) was obtained based on the reference sequence yp_003024035.1 of the National Center for Biotechnology Information of the United States. The sequence for the non-optimized mitochondrion-directed sequence COX10 is SEQ ID NO: 1. To improve the transcription efficiency and translation efficiency, an optimized sequence for the mitochondrion-directed sequence COX10 (opt_COX10, SEQ ID NO: 2), and the coding sequence of human ND4 (opt_ND4, SEQ ID NO: 7) were designed. A 3' untranslated region (i.e., 3'UTR, SEQ ID NO: 13) was continued to the optimized COX10-ND4 sequence with a homology of about 75.89% to the non-optimized COX10-ND4, and a recombinant nucleic acid opt_COX10-opt_ND4-3'UTR (shown in SEQ ID NO: 31) was obtained.
[0242] The synthesized recombinant nucleic acid opt_COX10-opt_ND4-3'UTR was incorporated into an adeno-associated virus (AAV) vector by PCR amplification (Figure 1). opt_COX10-opt_ND4-3'UTR was cleaved with EcoRI / SalI restriction enzymes to form sticky ends, and then embedded into an AAV vector having EcoRI / SalI restriction sites, such as the pSNaV vector, to generate a pSNaV / rAAV2 / 2-ND4 plasmid (i.e., pAAV2 optimized ND4 plasmid). The pAAV2-opt_ND4 plasmid was compared with the non-optimized pAAV2-ND4 plasmid.
[0243] The preliminary screening and identification steps were the same as those in CN102634527B, and the plasmid was cultured at 37 °C in an LB plate. Blue colonies and white colonies appeared, and the white colonies were recombinant clones. The white colonies were collected, an LB culture medium containing 100 mg / L ampicillin was added, and the culture was carried out at 37 °C for 8 hours at 200 rpm. Then, the plasmid was extracted from the cultured bacterial medium according to the Biomiga plasmid extraction protocol. The identification of the plasmid was verified using EcoRI / SalI restriction enzymes.
[0244] 1.2 Cell transfection HEK293 cells were seeded at 225 cm2 The cell culture bottle was seeded at a seeding density of 3.0×10 7 cells / ml, and Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum was used as the culture medium, and the cells were incubated overnight at 37°C in an incubator with 5% CO 2 . On the day of transfection, the culture medium was replaced with fresh DMEM containing 10% fetal bovine serum.
[0245] After the cells grew to 80 - 90%, the culture medium was discarded, and the cells were transfected with pAAV2-ND4 and pAAV2-opt_ND4 plasmids using the PlasmidTrans (VGTC) transfection kit. The detailed transfection protocol was described in Example 1 of CN102634527B. The cells were harvested 48 hours after transfection.
[0246] 1.3 Recovery, Concentration and Purification of Recombinant Adeno-Associated Virus Virus recovery: 1) Prepare a dry ice-ethanol (or liquid nitrogen) bath and a 37°C water bath. 2) Harvest the transfected cells together with the medium into a 15 ml centrifuge tube. 3) Centrifuge the cells at 1000 rpm for 3 minutes to separate the cells and the supernatant. Save the supernatant separately and resuspend the cells in 1 ml of PBS. 4) Alternately transfer the cell suspension between the dry ice-ethanol bath and the 37°C water bath 4 times, each time performing freeze-thawing for 10 minutes, and gently shake the suspension after each thawing.
[0247] Virus concentration: 1) Remove cell debris by centrifugation at 10,000 g, transfer the supernatant after centrifugation to a new centrifuge tube, 2) Remove impurities by filtration through a 0.45 μm filter, 3) Add 1M NaCl and 10% PEG8000 solutions, each with a volume of 1 / 2, to the sample, mix uniformly, store overnight at 4°C, 4) After centrifugation at 12,000 rpm for 2 hours, discard the supernatant, completely dissolve the virus precipitate in an appropriate amount of PBS solution, and then sterilize the sample with a 0.22 μm filter, 5) Add benzonase nuclease to remove residual plasmid DNA (final concentration 50 U / ml). Invert the tube several times to mix completely, then incubate at 37°C for 30 minutes, 6) Filter the sample through a 0.45 μm filtration head, and the filtrate is the concentrated rAAV2 virus.
[0248] Virus purification: 1) Add CsCl to the concentrated virus solution until a density of 1.41 g / ml (refractive index 1.372) is reached, 2) Add the sample to an ultracentrifuge tube, and fill the tube with the previously prepared 1.41 g / ml CsCl solution, 3) Centrifuge at 175,000 g for 24 hours to form a density gradient. Perform sequential recovery of samples with different densities. Recover the concentrated rAAV2 particles, 4) Repeat the process one more time. Load the virus into a 100 kDa dialysis bag and dialyze / desalt overnight at 4°C. The concentrated and purified recombinant adeno-associated virus was rAAV2-ND4 and rAAV2-optimized ND4.
[0249] Similarly, other mitochondrial targeting sequences (MTS), such as OPA1 (SEQ ID NO: 5), can be used to replace COX10 in the above examples to produce AAVs with recombinant plasmids.
[0250] Example 2 - Intravitreal injection of rAAV2 in rabbit eyes Twelve rabbits were divided into two groups: rAAV2-ND4 and rAAV2-optimized ND4. Puncture through the pars plana, 3 mm outside the corneal limbus, and inject the virus solution (1×10 10(0.05 mL of vg) was injected. After intravitreal injection, the eyes were examined using slit-lamp examination and fundus photography. The injection was carried out for 30 days. RT-PCR detection and immunoblotting were performed in each group respectively.
[0251] Real-time PCR regarding the expression of Example 3 - ND4 RNA from transfected rAAV2-ND4 and rAAV2-optimized ND4 rabbit optic nerve cells was extracted using the TRIZOL total RNA extraction kit. cDNA templates were synthesized by reverse transcription of the extracted RNA.
[0252] The conserved structure of ND4 was analyzed using NCBI conserved domain analysis software to ensure that the fragment amplified by the designed primers is located in the non-conserved region, and then primers were designed according to the principle of fluorescence quantitative PCR primer design: (a) β-actin-S: CGAGATCGTGCGGGACAT (SEQ ID NO: 85), (b) β-actin-A: CAGGAAGGAGGGCTGGAAC (SEQ ID NO: 86), (c) ND4-S: CTGCCTACGACAAACAGAC (SEQ ID NO: 87), (d) ND4-A: AGTGCGTTCGTAGTTTGAG (SEQ ID NO: 88).
[0253] Fluorescence quantitative PCR reaction and protocol: Fluorescence quantitative PCR was measured with a real-time PCR detection system. In a 0.2 ml PCR reaction tube, 12.5 μl of SYBR Green, 8 μl of ddH 20, 1 μl of each primer, and 2.5 μl of the cDNA sample were added to make a total volume of 25 μl. Each sample was used for the amplification of the target gene and the reference gene β-actin, and each amplification was repeated 3 times. To minimize variations due to handling, common reagents were added together and then separated separately. Fluorescent quantitative PCR was performed: pre-denaturation was at 95 °C for 1 second, denaturation was at 94 °C for 15 seconds, annealing was at 55 °C for 15 seconds, and extension was at 72 °C for 45 seconds. A total of 40 cycles of amplification reaction were carried out, and fluorescence signals were acquired during the extension period of each cycle. After the reaction, melting curve analysis from 94 °C to 55 °C was performed. By adopting the relative quantification method, the difference in gene expression levels with β-actin was studied using the internal standard gene.
[0254] As shown in Figure 2, the relative expression levels (mRNA level) of rAAV2-ND4 and rAAV2-optimized ND4 were 0.42 ± 0.23 and 0.57 ± 0.62, respectively (p < 0.05, Figure 2). The results unexpectedly showed that the optimized ND4 (opt_ND4, SEQ ID NO: 7) coding nucleic acid sequence and the corresponding recombinant nucleic acid (opt_COX10-opt_ND4-3’UTR, SEQ ID NO: 31) significantly improved the transcription efficiency and enhanced the expression of rAAV2-optimized ND4 by about 36%. The results indicated that the transcription efficiency of rAAV2-optimized ND4 was significantly higher.
[0255] Example 4 - Immunoblotting Detection of ND4 Expression ND4 protein was purified from each rabbit neuron transfected with rAAV2-optimized ND4 and rAAV2-ND4. After 10% polyacrylamide gel electrophoresis, it was transferred to a polyvinylidene fluoride membrane (Bio-Rad, HER-hercules, CA, USA) for immunodetection. β-actin was used as the internal standard gene. The film strip was observed with an automatic image analyzer (Li-Cor, Lincoln, NE, USA), and the integrated optical density of the protein band by the integrated normalization method was used for analysis to obtain the corresponding optical density value of the same sample. The statistical analysis software SPSS 19.0 was used for data analysis.
[0256] The results are shown in Figure 3. For rAAV2-optimized ND4 (left black bars) and rAAV2-ND4, the average relative protein expression levels of ND4 were 0.32 ± 0.11 and 0.68 ± 0.20, respectively (p < 0.01, Figure 3). Unexpectedly, the results indicate that the optimized ND4 coding nucleic acid sequence (opt_ND4, SEQ ID NO: 7) and the corresponding recombinant nucleic acid (opt_COX10-opt_ND4-3’UTR, SEQ ID NO: 31) significantly improved the translation efficiency and enhanced the expression of rAAV2-optimized ND4 by approximately 112%. The results also showed that the translation efficiency of rAAV2-optimized ND4 was significantly higher.
[0257] Example 5 - Rabbit Intraocular Pressure and Fundus Photography Slit lamp examination and intraocular pressure measurement were performed on both groups of rabbits at 1, 3, 7, and 30 days after surgery. No obvious abnormalities, conjunctival congestion, secretions, or endophthalmitis were observed in all rabbits, and the intraocular pressure did not increase.
[0258] The fundus photography results are shown in Figure 4. There was no obvious damage or complication in the optic nerve and retinal blood vessels of the rabbits, suggesting that standard intravitreal injection is safe without significant inflammatory reaction or other complications.
[0259] Example 6 - Human Clinical Trial Two groups of patients were tested: 1) As a control group, intravitreal injection of 1×10 10 vg / 0.05 mL of rAAV2-ND4 was performed on one eye of 9 patients from 2011 to 2012, and 2) As an experimental group, intravitreal injection of 1×10 10 vg / 0.05 mL of rAAV2-optimized ND4 was performed on one eye of 20 patients from 2017 to January 2018. The results of the clinical trial were analyzed using SPSS 19.0 for statistical analysis.
[0260] The comparison between the two groups is shown in Table 2. The fastest visual acuity improvement time was 1 month in the experimental group, which was significantly faster than 3 months in the control group (p < 0.01); the optimal visual acuity recovery in the experimental group was 1.0, which was significantly higher than 0.8 in the control group (p < 0.01); the average visual acuity recovery in the experimental group was 0.582 ± 0.086, which was significantly higher than 0.344 ± 0.062 in the control group (p < 0.01). The fundus photography results are shown in Figure 5. There were no obvious damages or complications in the optic nerves and retinal blood vessels of the patients in the experimental group and the control group, suggesting the safety of intravitreal injection of rAAV2-optimized ND4 and rAAV2-ND4.
Table 2
[0261] Example 7 - OPA1 as a mitochondrial targeting sequence In the recombinant nucleic acids (opt_COX10-opt_ND4-3’UTR, SEQ ID NO: 31) of Examples 1 to 6, the COX10 and 3’UTR sequences were replaced with OPA1 (SEQ ID NO: 5), which is another mitochondrial targeting sequence, and 3’UTR * (SEQ ID NO: 14) respectively to generate a new recombinant nucleic acid OPA1-opt_ND4-3’UTR * (SEQ ID NO: 74).
[0262] The experimental method was the same as that of Examples 1 to 6, and the recombinant nucleic acid opt_COX10-opt_ND4-3’UTR (SEQ ID NO: 31) was replaced with OPA1-opt_ND4-3’UTR * (SEQ ID NO: 74). The optimized ND4 sequence was found to have significantly improved transcription and translation efficiencies, expression levels, as well as higher efficacy and safety in the treatment of LHON compared with non-optimized ND4 (COX10-ND4-3’UTR, SEQ ID NO: 15).
[0263] Example 8 - Optimized ND4 sequence opt_ND4 * Nucleic acid opt_COX10*-opt_ND4 *- The 3’UTR (SEQ ID NO: 47) was used, and the same experimental methods as in Examples 1 to 6 were followed. According to the same procedure as in Example 1, viruses labeled with the fluorescent protein EGFP were prepared as rAAV2-ND4-EGFP and rAAV2-opt_ND4 * -EGFP.
[0264] Frozen 293T cells were thawed and grown to approximately 90% confluence in a T75 flask. The cells were pelleted and resuspended in complete DMEM medium to a cell density of 5×10 4 cells / mL. Approximately 100 μl of the cell suspension (about 5000 cells) was added to each well of a 96-well plate. The cells were cultured at 37 °C and 5% CO 2 2 until they reached 50% confluence. Approximately 0.02 μl of PBS was mixed with 2×10 10 vg / 0.02 μl of the viruses rAAV2-ND4-EGFP and rAAV2-opt_ND4 * -EGFP, respectively. After 48 hours, fluorescence microscopy observation, RT-PCR detection, and immunoblotting experiments were performed. As shown in Figure 6, the expression of EGFP was a good result, suggesting that rAAV carrying the EGFP gene was successfully transfected into 293T cells, and that the expression of rAAV2-ND4-EGFP and rAAV2-opt_ND4 * -EGFP was a good result.
[0265] The following primers were used and the same real-time PCR test as in Example 3 was followed: (a) β-actin-S: CGAGATCGTGCGGGACAT (SEQ ID NO: 85), (b) β-actin-A: CAGGAAGGAGGGCTGGAAC (SEQ ID NO: 86), (c) ND4-S: GCCAACAGCAACTACGAGC (SEQ ID NO: 107), (d) ND4-A: TGATGTTGCTCCAGCTGAAG (SEQ ID NO: 108).
[0266] The results were unexpectedly that the optimized ND4 *(opt_ND4, SEQ ID NO: 8) coding nucleic acid sequence and corresponding recombinant nucleic acid (opt_COX10 * -opt_ND4 * -3'UTR, SEQ ID NO: 47) significantly improved the transcription efficiency and enhanced the expression of rAAV2-opt_ND4 by about 20%. The results indicated that the transcription efficiency of rAAV2-opt_ND4 was significantly higher.
[0267] Figure 7 shows ND4 expression in 293T cells. The average expression of ND4 protein in rAAV2_ND4 is 0.36, while in rAAV2-opt_ND4 * the average expression of ND4 protein is 1.65, which is about 4.6 times higher than that in the rAAV2-ND4 group (p<0.01) (see Figure 8).
[0268] Figure 9 shows ND4 expression in rabbit optic nerve cells. The average expression of ND4 protein in rAAV2-ND4 is 0.16, while in rAAV2-opt_ND4 * the average expression of ND4 protein is 0.48, which is about 3 times higher than that in the rAAV2-ND4 group (p<0.01) (see Figure 10).
[0269] Similar to Example 5, slit lamp examination and intraocular pressure measurement were performed on both groups of rabbits on days 1, 3, 7, and 30 after surgery. No obvious abnormalities, conjunctival congestion, secretions, or endophthalmitis were observed in all rabbits, and the intraocular pressure did not increase.
[0270] Fundus photography results for rAAV2-ND4 and rAAV2-opt_ND4 * are shown in Figure 11. There were no obvious damages or complications in the optic nerve and retinal blood vessels of rabbits, suggesting that standard intravitreal injection is safe without significant inflammatory reactions or other complications.
[0271] After slit lamp examination and intraocular pressure measurement, the eyeballs were removed from both groups of rabbits. The eyeballs were fixed and dehydrated using paraffin. The tissues were pathologically sectioned into thin slices along the direction of the optic nerve. After further dehydration, the tissue samples were stained using hematoxylin and eosin. The microscopic examination results are shown in Fig. 12. As shown in the HE staining results, it was suggested that the rabbit retinal ganglion fiber layer was not damaged, the number of ganglion cells did not decrease, and intravitreal injection could be safely used without causing retinal toxicity or nerve damage.
[0272] The experimental method was the same as in Example 8, and the recombinant nucleic acid opt_COX10 * -opt_ND4 * -3’UTR (SEQ ID NO: 47) was replaced with OPA1-opt_ND4 * -3’UTR* (SEQ ID NO: 76). The optimized ND4 sequence was found to have significantly improved transcription and translation efficiency, expression level, as well as higher efficacy and safety in the treatment of LHON compared to the non-optimized ND4 (COX10-ND4-3’UTR, SEQ ID NO: 15).
[0273] Example 9 - ND6 sequence Using the nucleic acid COX10-ND6-3’UTR (SEQ ID NO: 21), which is a combination of COX10 (SEQ ID NO: 1), ND6 (SEQ ID NO: 9) and 3’UTR (SEQ ID NO: 13) (from 5’ to 3’), the same experimental method as in Examples 1 to 6 was followed.
[0274] The following primers were used for plasmid screening of COX10-ND6-3’UTR (SEQ ID NO: 21): (a) ND6-F: ATGATGTATGCTTTGTTTCTG (SEQ ID NO: 89), (b) ND6-R: CTAATTCCCCCGAGCAATCTC (SEQ ID NO: 90).
[0275] The transfected and screened virus rAAV2-ND6 was 2.0×10 11It had a virus titer of vg / mL. Similar to Example 5, slit lamp examination and intraocular pressure measurement were performed on three groups of rabbits (A: rAAV2-ND6, B: rAAV-GFP, C: PBS) on the 1st, 7th, and 30th days after surgery (Figure 13). In all rabbits, no obvious abnormalities, conjunctival congestion, secretions, or endophthalmitis were observed, and the intraocular pressure did not increase.
[0276] The following primers were used and the same real-time PCR test as in Example 3 was followed: (a) β-actin-S: CGAGATCGTGCGGGACAT (SEQ ID NO: 85), (b) β-actin-A: CAGGAAGGAGGGCTGGAAC (SEQ ID NO: 86), (c) ND6-S: AGTGTGGGTTTAGTAATG (SEQ ID NO: 91), (d) ND4-A: TGCCTCAGGATACTCCTC (SEQ ID NO: 92).
[0277] The results showed that the expression of ND6 in rAAV2-ND6 and the control (PBS) was 0.59 ± 0.06 and 0.41 ± 0.03, respectively. The results showed that the transcription efficiency of rAAV2-ND6 was higher than that of the control group (p < 0.01).
[0278] Example 10 - Optimized opt_ND6 sequence (From 5' to 3') opt_COX10 * The nucleic acid opt_COX10, which is a combination of (SEQ ID NO: 3), opt_ND6 (SEQ ID NO: 10), and 3'UTR (SEQ ID NO: 13) * -opt_ND6-3'UTR (SEQ ID NO: 51) was used and the same experimental method as in Examples 1 to 6 was followed.
[0279] Three groups of rabbits were given, A: 10 10 vg / 50 μl of rAAV2-opt_ND6, B: 10 10 vg / 50 μl of rAAV2-ND6 (Example 9), and C: 10 1050 μl of vg of rAAV2-EGFP was injected. Figure 14 shows the fundus photography results of rabbits injected with rAAV2-opt_ND6 (A), rAAV2-ND6 (B), and rAAV-EGFP (C), respectively. In all rabbits, no obvious abnormalities, conjunctival congestion, secretions, or endophthalmitis were observed, and the intraocular pressure did not increase.
[0280] The following primers were used and the real-time PCR test was conducted according to Example 3: (a) β-actin-F: CTCCATCCTGGCCTCGCTGT (SEQ ID NO: 93), (b) β-actin-R: GCTGTCACCTTCACCGTTCC (SEQ ID NO: 94), (c) ND6-F: GGGTTTTCTTCTAAGCCTTCTCC (SEQ ID NO: 95), (d) ND6-R: CCATCATACTCTTTCACCCACAG (SEQ ID NO: 96), (e) opt_ND6-F: CGCCTGCTGACCGGCTGCGT (SEQ ID NO: 97), (f) opt_ND6-R: CCAGGCCTCGGGGTACTCCT (SEQ ID NO: 98).
[0281] As shown in Figure 15, both rAAV2-opt_ND6 (A) and rAAV2-ND6 (B) had higher (p < 0.05) relative ND6 expression levels compared to the control group (C). rAAV2-opt_ND6 (A) had a slightly higher relative ND6 expression level than rAAV2-ND6 (B). As shown in the Western blot of Figure 16, rAAV2-opt_ND6 (A) had a relative ND6 expression level more than three times higher than that of rAAV2-ND6 (B).
[0282] The experimental method was the same as in Example 8, and the recombinant nucleic acid COX10-ND6-3’UTR (SEQ ID NO: 21) and opt_COX10 *-The -opt_ND6-3’UTR (SEQ ID NO: 51) was replaced with OPA1-ND6-3’UTR (SEQ ID NO: 77) and OPA1-opt_ND6-3’UTR (SEQ ID NO: 79). The optimized ND6 sequence was found to have significantly improved transcription and translation efficiency, expression levels, as well as higher efficacy and safety in the treatment of LHON.
[0283] Example 11 - ND1 and opt_ND1 sequences (5' to 3') COX10 (SEQ ID NO: 1), ND1 (SEQ ID NO: 11), and 3’UTR (SEQ ID NO: 13) combination, COX10-ND1-3’UTR (SEQ ID NO: 25), rAAV2-ND1; and (5' to 3') opt_COX10 * (SEQ ID NO: 3), opt_ND1 (SEQ ID NO: 12), and 3’UTR (SEQ ID NO: 13) combination, opt_COX10 * -Using -opt_ND1-3’UTR (SEQ ID NO: 55) and rAAV2-opt_ND1, the same experimental methods as in Examples 1 - 6 were followed.
[0284] The following primers were used for plasmid screening for COX10-ND1-3’UTR (SEQ ID NO: 25): (a) ND1-F: ATGGCCGCATCTCCGCACACT (SEQ ID NO: 99), (b) ND1-R: TTAGGTTTGAGGGGGAATGCT (SEQ ID NO: 100).
[0285] opt_COX10 * The following primers were used for plasmid screening for -opt_ND1-3’UTR (SEQ ID NO: 55): (a) ND1-F: AACCTCAACCTAGGCCTCCTA (SEQ ID NO: 101), (b) ND1-R: TGGCAGGAGTAACCAGAGGTG (SEQ ID NO: 102).
[0286] Three groups of rabbits, A: 10 10rAAV2-opt_ND1 at 50 μl of vg, B: 10 10 rAAV2-ND1 at 50 μl of vg (Example 9), and C: 10 10 rAAV2-EGFP at 50 μl of vg was injected. In all rabbits, no obvious abnormalities, conjunctival congestion, secretions or endophthalmitis were observed, and the intraocular pressure did not increase.
[0287] The following primers were used and the same real-time PCR test as in Example 3 was followed: (a) ND1-F: AGGAGGCTCTGTCTGGTATCTTG (SEQ ID NO: 103), (b) ND1-R: TTTTAGGGGCTCTTTGGTGAA (SEQ ID NO: 104), (c) opt_ND1-F: GCCGCCTGCTGACCGGCTGCGT (SEQ ID NO: 105), (d) opt_ND1-R: TGATGTACAGGGTGATGGTGCTGG (SEQ ID NO: 106).
[0288] As shown in Figure 17, both rAAV2-opt_ND1 (A) and rAAV2-ND1 (B) had higher (p < 0.05) relative ND1 expression levels compared to the control group (C). As shown in the Western blot of Figure 18, rAAV2-opt_ND1 (A) had a relative ND6 expression level more than twice as high as that of rAAV2-ND1 (B).
[0289] The experimental method was the same as in Example 8, and the recombinant nucleic acids COX10-ND1-3’UTR (SEQ ID NO: 25) and opt_COX10 * -opt_ND1-3’UTR (SEQ ID NO: 55) were replaced with OPA1-ND1-3’UTR (SEQ ID NO: 81) and OPA1-opt_ND1-3’UTR (SEQ ID NO: 83). The optimized ND1 sequence was found to have significantly improved transcription and translation efficiency, expression levels, as well as higher efficacy and safety in the treatment of LHON.
[0290] Example 12 - Other fusion proteins Other fusion proteins shown in SEQ ID NOs: 15 to 84 can be used to follow the same experimental methods as in Examples 1 to 6. And it is expected that the same results will be obtained.
[0291] Example 13 - Formulation Development Various AAV formulations were screened using AAV2 virus samples. Various AA The stability of V formulations was evaluated using a StepOnePlus real-time PCR system. The viral titers of each formulation under freeze / thaw cycle conditions were measured.
[0292] First, three different formulations were tested under 1, 2, 3, 4, and 5 freeze / thaw cycles, the viral titers were measured, and the results are summarized in Table 3. The three formulations tested were: A: phosphate-buffered saline (PBS); B: 1% α,α-trehalose dihydrate, 1% L-histidine monohydrochloride monohydrate, and 1% polysorbate 20; and C: 180 mM NaCl, 10 mM NaH 2 PO 4 / Na 2 HPO 4 , and 0.001% poloxamer 188, pH 7.3. As shown in Table 3, formulation C had the lowest relative standard deviation (RSD) after 5 freeze / thaw cycles, suggesting excellent stability as an AAV formulation.
Table 3
[0293] As shown in Table 3, formulation C had the lowest relative standard deviation (RSD) after 5 freeze / thaw cycles, suggesting excellent stability as an AAV formulation.
[0294] Next, three other different groups of formulations were tested under 1, 2, 3, 4, and 5 freeze / thaw cycles, the viral titers were measured, and the results were summarized in Table 4. The three formulations tested were: D: Phosphate Buffered Saline (PBS), pH 7.2 - 7.4; E: PBS and 0.001% poloxamer 188, pH 7.2 - 7.4; and F: 80 mM NaCl, 5 mM NaH 2 PO 4 4, 40 mM Na 2 HPO 4 4, 5 mM KH 2 PO 4 , and 0.001% poloxamer 188, pH 7.2 - 7.4.
Table 4
[0295] As shown in Table 4, formulation F had the lowest relative standard deviation (RSD) after 5 freeze / thaw cycles, suggesting excellent stability as an AAV formulation. Overall, formulation F had the lowest RSD among all the formulations tested and could be used as an AAV formulation for future development.
[0296] A third group of formulations was tested under 1, 2, 3, and 4 freeze / thaw cycles, and the viral titers were determined using qRT-PCR. The other two formulations tested in addition to formulation F were: G: 8.4 mM KH 2 PO 4 4, 5.6 mM Na 2 HPO 4 4, and 154 mM NaCl; H: 8.4 mM KH 2 PO 4 4, 5.6 mM Na 2 HPO 4 4, 0.15 M NaCl, and 0.001% poloxamer 188, pH 7.2 - 7.4.
[0297] HEK293 Cell Culture and rAAV2 Transduction: Cryotubes containing HEK293 cells were thawed and dispensed into cell culture flasks containing high-glucose DMEM medium supplemented with 10% fetal bovine serum. The HEK293 cells were incubated at 37°C for 24 hours in 5% CO 2 2 n and 5% CO
[0298] RNA Extraction: Total RNA was isolated from the transduced HEK293 cells using TRIzol, and cDNA was synthesized by reverse transcription. The primers for RT-PCR analysis were as follows: (a) β-actin-F: CTCCATCCTGGCCTCGCTGT (SEQ ID NO: 93) (b) β-actin-R: GCTGTCACCTTCACCGTTCC (SEQ ID NO: 94) (c) ND4-F: ATCTCCGCACACTCTCTCCTCA (SEQ ID NO: 165) (d) ND4-R: TAGGTTGTTGTTGATTTGGTT (SEQ ID NO: 166).
[0299] qRT-PCR: A reaction mixture containing 10 μL of TB Green, 0.3 μL of forward and reverse primers, 0.4 μL of ROX reference dye, 4.3 μL of EASY Dilution, and 5 μL of cDNA was prepared. Quantitative RT-PCR was performed by pre-denaturation at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Fluorescence signals were collected during the elongation phase of each cycle. The ND4 expression level (relative quantification) can be calculated as 2-(Ct(ND4, sample)-Ct(β-actin, sample)-Ct(ND4, control)-Ct(β-actin, control)).
Table 17
[0300] As shown in Table 17, Formulations F and H showed higher relative expression of ND4 after 4 freeze / thaw cycles, and in particular, Formulation H showed excellent stability and transduction efficiency as an AAV formulation.
[0301] Example 14 - Preparation of Recombinant Adeno-Associated Virus The recombinant adeno-associated virus rAAV2 / 2-ND4 was prepared according to the method described in Example 1.
[0302] Plasmid preparation: The fusion nucleic acid shown in SEQ ID NO: 6 was synthesized by Chengdu Qingke Yuxi Biotechnology Co., Ltd. The full-length gene was amplified by PCR, and sticky ends were formed on the fusion gene by EcoRI / SalI digestion. The fusion gene was inserted into the adeno-associated virus vector pSNaV having EcoRI / SalI restriction sites, that is, pSNaV / rAAV2 / 2-ND4 (hereinafter referred to as pAAV2-ND4). Briefly, after incubation at 37°C, the LB plate showed blue colonies and white colonies, and the white colonies were recombinant clones. The white colonies were collected and added to LB liquid medium containing ampicillin (100 mg / L) and cultured at 37°C for 8 hours at 200 rpm. After culturing, a bacterial solution was obtained and the plasmid was extracted. In the plasmid extraction step, EcoRI / SalI enzyme digestion was used while referring to the instructions of Biomega. EcoRI / SalI enzyme digestion was used.
[0303] Cell transfection: HEK293 cells were seeded in a 225 cm 7 cell culture flask at a density of 3.0×10 2 cells / mL in DMEM containing 10% fetal bovine serum and cultured at 37°C and 5% CO 2Incubated overnight. When the cell confluence reached 80 - 90%, the medium was discarded, and the cells were transfected with pAAV2 - ND4 using the PlasmidTrans II (VGTC) transfection kit (see Example 1 for specific transfection steps). Cells were collected 48 hours after transfection.
[0304] Virus recovery and concentration: The transduced cells were collected together with the medium into a 15 mL centrifuge tube and centrifuged at 1000 rpm for 3 minutes. The cells and the supernatant were separated. The supernatant was further stored, and the cells were resuspended in 1 mL of PBS. The cell suspension was frozen in a dry - ice ethanol bath or a liquid nitrogen bath and thawed in a 37°C water bath 4 times, each for 10 minutes, with slight vortexing after each thawing. The supernatant was centrifuged at 10,000×g to remove cell debris, transferred to a new centrifuge tube, and filtered using a 0.45 μm filter to remove impurities. Half - volume of 1M NaCl 10% PEG8000 solution was added to the supernatant, mixed well, and kept at 4°C overnight. The next day, the virus was centrifuged at 12,000 rpm for 2 hours, the supernatant was discarded, and the precipitated virus was resuspended in an appropriate amount of PBS solution and filtered using a 0.22 μm filter for sterilization. Residual plasmid DNA was removed by digestion with Benzonase nuclease (50 U / mL) at 37°C for 30 minutes and re - filtered through a 0.45 μm filter head to obtain concentrated rAAV2 virus.
[0305] Virus purification: Solid CsCl was added to the concentrated virus until a density of 1.41 g / mL was reached (the refractive index was 1.372). The sample was placed in an ultracentrifugation tube, and the remaining space in the centrifugation tube was filled with a pre-prepared CsCl solution of 1.41 g / mL. The sample was centrifuged at 175,000×g for 24 hours to form a density gradient, and samples of various densities were collected. The virus titer of the samples was determined, and the components rich in rAAV2 particles were recovered. This process was repeated, and the virus was loaded into a 100 kDa dialysis bag and stored at 4°C overnight for dialysis.
[0306] Example 15 - Gene Therapy for the Treatment of Leber Hereditary Optic Neuropathy A multi-center prospective clinical trial was conducted to evaluate the efficacy of rAAV-ND4 in patients meeting the diagnostic criteria for LHON.
[0307] Study Design Study location: This trial was a clinical trial, and the genetic diagnosis was performed at the Genetic Diagnosis Center of Tongji Hospital. The ophthalmic examination was completed in the ophthalmology examination room of Tongji Hospital. The general examination (partial) was performed by designated staff and standard equipment within the research institute.
[0308] Patient inclusion criteria: Patients were required to be diagnosed with LHON by genetic testing for the 11778-site mutation. The subjects were men or women aged 10 - 65 years. Patients were observed for at least 3 months for vision recovery. Patients were excluded from the study if they had end-stage diseases, a history of eye diseases, allergies to essential drugs used during treatment, or showed positive results in the AAV2 humoral response test. Patients were required to sign an informed consent form for label gene therapy and an informed consent for intravitreal injection.
[0309] Pre-operative guidelines: Medical staff were advised to disinfect the operating room and medical supplies before the operation, as well as prepare the consumables during the operation, and strictly follow the surgical evaluation system and aseptic operation principles.
[0310] Preoperative examinations: Before the surgery, the patient was given a comprehensive physical examination including blood tests, urine tests, liver and kidney functions, blood coagulation function, infectious disease screening, immunoassay (cellular immunity: CD3, CD4, CD8; humoral immunity: IgA, IgM, IgG), electrocardiogram, and chest fluoroscopy. In addition, the patient was given a preoperative ophthalmological examination including visual acuity, intraocular pressure, slit lamp examination, fundus examination, fundus photography, anterior segment photography of the eyeball, optic nerve OCT, visual field examination, and VEP. These series of examinations were carried out more than three times within six months. The patient was screened for the mtDNA base pair mutation G11778A in Leber's disease. That is, the arginine of the NADH dehydrogenase subunit 4 protein changed to histidine, resulting in loss-of-function disorder, optic nerve damage, and Leber hereditary optic neuropathy with a high incidence and poor prognosis (see Chinese Patent No. CN102634527B). Before treatment, the AAV2 humoral immunological assay (described in Example 16 below) was also carried out.
[0311] Preoperative treatment: Oral steroid MEDROL (registered trademark) at a daily dose of 32 mg / 60 kg was administered once a day to the patient receiving LHON gene therapy starting from 7 days before the surgery. To determine whether the patient had low pre-treatment rAAV2 immunity before the start of rAAV2 treatment, an AAV2 humoral immunological test using the patient's serum was carried out. Antibiotic eye drops and eye ointment were applied on the day before the surgery to wash the lacrimal conjunctival sac.
[0312] Intravitreal injection: The clinical-grade rAAV2-ND4 formulation (State Key Laboratory of Biotherapy of Sichuan University) was used as an injection. The recombinant adeno-associated virus rAAV2-ND4 (SEQ ID NO: 6) was prepared as described in Example 14. The dosage was 1×10 10It was vg / 0.05 mL. The amount of the drug for intravitreal injection under local anesthesia was 0.05 mL. A single dose of the drug was administered by intracavitary injection under local anesthesia. Disinfection means and surgical consumables were prepared in a laminar flow operating room. Before the operation, daily disinfection of the towel, face, and eyes was performed, and the eyes were marked for injection.
[0313] The gene drug was managed by designated staff. Before administering the drug, the patient's information was confirmed to ensure that the drug packaging material was intact and not contaminated, and that the drug packaging material was strictly sterilized. When extracting the drug from the vial, the operation was performed slowly and smoothly, the drug was pumped once, and suction and contact with the bottle wall were not repeated to avoid drug contamination. After extracting the drug from the vial, the injection was completed within 30 minutes. After the injection was completed, the drug packaging material and the remaining drug were kept and stored at -20 °C for reference. Absolute aseptic operation was required during the drug extraction process. If the drug fell to the floor or the suction needle touched a contaminated area, the drug was discarded. No drug with a risk of contamination was injected into the patient's vitreous cavity.
[0314] Specific working guidelines for intravitreal injection: An assistant who performs conventional intravitreal injection operations such as preparation of the device and drug before injection, as well as disinfection and covering. The drug was taken out of dry ice and held firmly by hand for 2 - 3 minutes until the drug thawed and became liquid. The bottle cap and the bottle were wiped twice with gauze containing iodophor for sterilization, and then the bottle and the bottle cap were wiped with dry gauze. It should be noted that the wiping was done clockwise to prevent the mouth of the bottle from opening and the iodophor from seeping in. After disinfection, the bottle cap was opened, and the operator took the drug with an insulin needle and adjusted the volume to 0.05 mL. At the same time, the assistant prepared for anesthesia injection, disinfection, recovery, etc., washed the conjunctival sac 3 times with 0.5% povidone iodine, and injected it into the vitreous cavity according to the intravitreal injection guidelines. Immediately after removing the needle, the injection site was pressed with a cotton ball and massaged for 10 seconds to prevent drug leakage.
[0315] After injecting the drug, an antibiotic eye ointment was applied to the injected eye, and the eye was covered with a cotton ball. The patient was allowed to lie down for 20 minutes and then returned to the ward. The patient was instructed not to rub the eye. After the injection was completed, attention was paid to the recovery of the patient after gene therapy.
[0316] Postoperative drug therapy: Systemic drug therapy: (a) MEDROL® tablets, 32 mg / 60 kg, for 7 days before surgery; (b) Sodium creatine phosphate intravenous drip solution, 2 g / 60 kg, for 3 days after surgery (including the day of surgery); (c) SOLU-MEDROL® intravenous drip solution, 80 mg / 60 kg, for 3 days after surgery (including the day of surgery); (d) On the 3rd day after surgery, SOLU-MEDROL® was changed to oral MEDROL® 40 mg / 60 kg; once a day for 4 days; (e) On the 2nd week after surgery, MEDROL® was reduced to oral 32 mg / 60 kg; once a day for 7 days; (f) On the 3rd week after surgery, MEDROL® was reduced to oral 24 mg / 60 kg; once a day for 7 days; (g) On the 4th week after surgery, MEDROL® was reduced to oral 16 mg / 60 kg; once a day for 7 days; (h) On the 5th week after surgery, MEDROL® was reduced to oral 8 mg / 60 kg; once a day for 7 days; (i) On the 6th week after surgery, MEDROL® was reduced to oral 6 mg / 60 kg; once a day for 7 days; (j) On the 7th week after surgery, MEDROL® was reduced to oral 4 mg / 60 kg; once a day for 7 days.
[0317] Local drug therapy: (a) Tobramycin dexamethasone: eye drops, once a day for 7 days; (b) Tobramycin dexamethasone eye ointment: eye drops, once a day for 7 days.
[0318] A diagram representing the dosing schedule is shown in FIG. 19.
[0319] Post-operative examination and confirmation On the first day after surgery, the patient was given a post-operative ophthalmological examination including visual acuity, intraocular pressure, slit lamp examination, fundus examination, anterior segment photography of the eyeball and fundus photography. On the second day after surgery, the patient was given an examination of visual acuity and intraocular pressure, as well as slit lamp and fundus examinations. On the third day after surgery, the patient was given an examination of visual acuity and intraocular pressure, as well as slit lamp and fundus examinations.
[0320] Patients receiving LHON gene therapy for the eye were informed to consult the hospital at the time reserved with the doctor or when they had any discomfort. The post-operative examinations were carried out by specialists. All test reports were confirmed and signed by medical staff. It was prohibited for non-specialists or medical staff not familiar with the technical field to examine the patient or deal with the patient's symptoms without permission.
[0321] Before all examinations, the contact area between the device and the patient was wiped with alcohol. After the examination was completed, antibiotic eye drops were given. It was prohibited to use contaminated eye drops and to instill eye drops into the conjunctival sac.
[0322] Results Effectiveness evaluation: International standard guidelines for visual acuity improvement indicate that a visual acuity improvement of 0.3 logMAR (15 letters) is considered a significant improvement, and an improvement of 0.2 logMAR (10 letters) is considered an improvement. An improvement of less than 0.1 logMAR (5 letters) means there is no improvement. A treatment that brings about a visual acuity improvement of 0.2 logMAR is considered effective.
[0323] In the first phase of the trial, a total of 145 patients were treated. In the treatment within 1 day, 24 cases (16.55%) showed a significant improvement of 0.3 logMAR, and 6 cases (4.14%) showed an improvement of 0.2 logMAR. The overall effectiveness after 1 day of treatment was 20.69%, and vision loss occurred in 2 cases (1.38%). In the treatment within 2 days, 35 cases (24.14%) showed a significant improvement of 0.3 logMAR, 12 cases (8.22%) showed an improvement of 0.2 logMAR, and the overall effectiveness was 32.41%. In the treatment within 3 days, 42 cases (28.96%) showed a significant improvement of 0.3 logMAR, 11 cases (7.59%) showed an improvement of 0.2 logMAR, and the overall effectiveness was 36.55%. These results are summarized in Table 5 below.
Table 5
[0324] Confirmation was completed for 129 patients 1 month after surgery. Among these patients, 55 patients (42.66%) had a significant improvement in vision of 0.3 logMAR, and 16 patients (12.40%) had an improvement in vision of 0.2 logMAR. The confirmation at the 1-month mark showed that the overall effective rate of vision improvement was 55.04%. Vision decreased in 9 patients (6.98%). Confirmation was completed for 67 patients 3 months after surgery. Among these patients, 37 patients (55.22%) had a significant improvement in vision of 0.3 logMAR, and 8 patients (11.94%) had an improvement in vision of 0.2 logMAR. The confirmation at the 3-month mark showed that the overall effective rate of vision improvement was 67.16%. Vision decreased in 4 patients (5.97%). Recently, a total of 159 patients were treated, and a significant improvement in vision of 0.3 logMAR was observed in 64.66% of the patients, and an improvement in vision of 0.2 logMAR was observed in 6.89% of the patients. The effectiveness of the treatment is shown in Table 6 below.
Table 6
[0325] Safety results: A total of 143 patients, including 7 Argentinean patients staying in the country, received treatment at an early stage of the trial. The start time was divided into 2 years and after 2 years, and safety tests were regularly conducted. The inventors investigated eye side effects 3 days, 1 month, and 3 months after surgery. There were 21 patients with mild ocular hypertension 3 days after surgery, which was a mild complication and recovered naturally without other serious complications. There were 17 patients with ocular hypertension 1 month after surgery, and only 5 patients with ocular hypertension 3 months after surgery. There were no other side effects. The side effects are summarized in Table 7.
Table 7
[0326] A total of 10 Argentinean patients were treated. The safety test conducted on the 3rd day after surgery showed that there were no problems with safety. Another safety test conducted on the 10th day showed that 1 subject had mild ocular hypertension, which returned to normal within 1 month after drug treatment. An efficacy test was also conducted on the 3rd day after surgery. Among these Argentinean patients, the improvement in visual acuity of 0.3 logMAR and 0.2 logMAR was 50% and 10% respectively. The improvement in visual acuity of 0.3 logMAR at 1 month, 3 months, and 6 months was 60%, 90%, and 100% respectively.
[0327] A similar trial was conducted by GenSight Biologics: 15 subjects with the ND4-G11778A mutation received a single intravitreal injection of rAAV2 / 2-ND4 in the eye with the weaker vision. The study design included a 48-week initial follow-up evaluation period and then It also included a further long period of four years. The patients were divided into two groups: at the start, six months and six to twelve months. Generally, patients with an earlier start had less optic nerve cell damage and the best prognosis for gene therapy. The prognosis worsened as the start time was delayed. Among the 15 patients treated, there were 10 cases of ocular hypertension, selective cataract removal in 2 patients, severe anterior chamber inflammation and vitritis events in 2 patients, and many other side effects, such as keratitis, vitreous hemorrhage, allergic conjunctivitis and eye pain (see Table 7). See Vignal et al., Ophthalmology 2018;6:945-947.
[0328] In another study by Guy et al., 14 patients with LHON received a single intravitreal injection of AAV2(Y444,500,730F)-PIND4v2 and were followed up for 18 months. The patients were divided into two groups, one with a start time of more than 12 months and the other with a start time of less than 12 months. Similar to GenSight Biologics, patients with a start of less than 12 months had a better prognosis for gene therapy. Two cases of uveitis, one case of keratitis, one case of eye pain and one case of ocular hypertension were observed. See Guy et al., Ophthalmology 2017;124:1621-1634. As shown in Table 8 below, the method of the present disclosure had fewer postoperative complications than either the method of GenSight Biologics or Guy et al.
Table 8
[0329] Of note, there were no cases of postoperative uveitis with the disclosed method. Uveitis is considered a serious complication, and many types of uveitis require hormonal and immunosuppressant treatment. Approximately one-quarter of uveitis patients in the Western world require hormonal and immunosuppressant treatment, and even then, 35% of patients suffer from visual impairment. Ocular hypertension is considered a minor complication, and is the most common complication in ophthalmic surgery. Under normal circumstances, patients recover on their own, and intraocular pressure returns to normal levels.
[0330] In summary, the disclosed method provides a safe and effective treatment for LHON without any serious complications.
[0331] Similar experiments will be performed to evaluate the efficacy of rAAV2 containing the nucleic acid sequence of SEQ ID NO: 7. These results are expected to demonstrate that administration of rAAV2-SEQ5 is a safe and effective treatment for ocular diseases.
[0332] Example 16 - Diagnostic Assays for LHON Gene Therapy In this example, green fluorescent protein was used as a reporter gene in the rAAV2 vector. (rAAV2-GFP) was used. HEK293T cells were cultured with serum from different patients and transduced with rAAV2-GFP. To determine the cell infection ability of rAAV2 vector in the presence of patient serum, RT-PCR or flow cytometry was used to determine the transduction efficiency of rAAV2. Patients can be screened before treatment with rAAV2 vectors using the method disclosed herein to identify patients with low immune response to rAAV2 vectors (i.e. high rAAV2 vector transduction) and high immune response to rAAV2 vectors (i.e. low rAAV2 vector transduction). In this example, patients with low immune response to rAAV2 vectors were classified as suitable for treatment with rAAV2 vectors.
[0333] Generation of rAAV2-GFP virus HEK293T cells were seeded into a 225 cm 7 cell culture flask at a density of 3.0×10 2 cells / mL in DMEM containing 10% fetal bovine serum and cultured overnight in an incubator at 37°C containing 5% CO 2 . When the HEK293T cells reached a confluence density of 80 - 90%, the medium was discarded and the cells were transfected with rAAV2 - GFP using the Plasmid Trans II (VGTC) transfection kit. Two days after transfection, the HEK293T cells were harvested, the collected cells were resuspended in PBS, and frozen and thawed three times, and then separated, concentrated and purified to obtain recombinant adeno - associated virus rAAV2 - GFP. The titer was measured and the product was custom - produced by Guangzhou Paizhen Biotechnology Co., Ltd.
[0334] Isolation of patient serum 2 mL of whole blood was collected from the patient and centrifuged to isolate the serum. The serum was added separately to two tubes and stored at - 20°C or - 80°C for later use. The remaining whole blood was placed in test tubes. Patient information was recorded.
[0335] HEK293T cell culture Sterilization: Tips (1 mL, 5 mL, 0 mL) and EP tubes were sterilized by autoclaving and UV disinfection for at least 30 minutes before use. After sterilization, the storage of tips and EP tubes was within 12 hours to avoid cell contamination.
[0336] Cell culture medium preparation: In the 1:9 medium preparation or 1:4 medium preparation kept at 4°C, the 1:9 medium preparation was prepared by putting 5 mL of fetal bovine serum, 45 mL of DMEM high glucose cell culture medium, and 0.5 mL or 1 mL of penicillin (10000 U / mL) and streptomycin (10000 / mL) into a 50 mL centrifuge tube and mixing them. The 1:4 dosage was prepared by putting 10 mL of fetal bovine serum, 40 mL of DMEM high glucose cell culture medium, and 0.5 mL or 1 mL of penicillin (10000 U / mL) and streptomycin (10000 / mL) into a 50 mL centrifuge tube and mixing them.
[0337] Subculture and seeding of HEK293T cells The cryotube containing HEK293T cells was taken out from liquid nitrogen and quickly transferred to a 37°C water bath for 1 - 2 minutes. After thawing, the outside of the cryotube was wiped with alcohol and placed in a 4°C ice bath. The cryotube was shaken occasionally in the water bath to ensure uniform heat distribution.
[0338] After disinfection, the HEK293T cells were transferred to a centrifuge tube, and high glucose DMEM 10 times the volume was added to the cells. Then, the suspension was centrifuged at 1000 rpm for 5 minutes, the supernatant was discarded, and the HEK293T cells were resuspended in the culture medium. Then, the cell suspension was transferred to a 4 mL culture medium vial, and the vial was transferred to an incubator to attach the HEK293T cells to the wall of the vial. After the cells adhered, the medium was carefully removed, 5 mL of fresh medium was added, and the culture was continued. After incubating the HEK293T cells for 24 hours, the culture medium was changed, and the cells were grown until a monolayer was formed, which was then used for cell subculture. The tissue culture medium was changed every 2 - 3 days by removing the old medium, rinsing the cells 3 times with PBS, and adding freshly prepared medium to the cells.
[0339] Cell passage in flask: When the cells reached confluence and became round in shape, the medium was removed from the flask using a 10 mL pipette, and the HEK293T cells were washed three times with 5 mL of PBS. After washing, 5 mL of EDTA was added to the cells and incubated for 3 minutes, then 20 mL of medium was quickly added to the flask. Air was repeatedly pumped into the culture using a 10 mL pipette until the cells were uniformly resuspended. Half of the cell suspension was transferred to another flask, and culture medium was added to both flasks until the volume reached 20 mL.
[0340] Cell passage in 24-well plate: When the cells reached confluence and became round in shape, the medium was removed from the flask using a 10 mL pipette, and the HEK293T cells were washed three times with 5 mL of PBS. After washing, 5 mL of EDTA was added to the cells and incubated for 3 minutes, then 50 mL of medium was quickly added to the flask. Air was repeatedly pumped into the culture using a 10 mL pipette until the cells were uniformly resuspended. 2 mL of the cell suspension was dispensed into each well of a 24-well plate, the flask was fixed at a total volume of 20 mL, and both the flask and the 24-well plate were placed in an incubator to continue the culture. When the HEK293T cells in the 24-well plate reached confluence (after 2 - 3 days), 1.7 mL of fresh medium was given to the cells, and rAAV2-GFP virus was transduced as described below.
[0341] Transduction of rAAV2-GFP in HEK293T cells in the presence of patient serum Virus dilution: 1 μL of rAAV2-GFP was diluted with 40 μL of PBS and added to 1960 μL of high-glucose DMEM in a 4 mL EP tube. After the rAAV2-GFP dilution was prepared, the EP tube seal was kept at 4°C.
[0342] Patient serum and diluted rAAV2-GFP were prepared as follows: (a) 1:20 group: 300 μL of patient serum + 300 μL of culture medium + 300 μL of virus dilution (1:3 working dilution), (b) Group 1:60: 100 μL of patient serum + 500 μL of culture medium + 300 μL of virus dilution (1:9 working dilution), (c) Control group: 600 μL of culture medium (or 300 μL of PBS + 300 μL of culture medium) + 300 μL of virus dilution.
[0343] rAAV2-GFP transduction: 300 μL of patient serum / rAAV2-GFP from Group 1:20, Group 1:60, and the control group was added to each well of HEK293T cells and incubated for 48 hours after transduction. The experiment was performed in triplicate for each group.
[0344] Example 17 - RT-PCR Analysis of rAAV2-GFP Expression Total RNA was isolated from the transduced HEK293T cells using TRIzol, and cDNA was synthesized by reverse transcription. Primers for RT-PCR analysis were designed using Primer Premier5 and are as follows: (a) β-actin-F: CCTAGAAGCATTTGCGGT (SEQ ID NO: 167) (b) β-actin-R: GAGCTACGAGCTGCCTGA (SEQ ID NO: 168) (c) GFP-F: ACAAGTTCAGCGTGTCCG (SEQ ID NO: 163) (d) GFP-R: CTCGTTGGGGTCTTTGCT (SEQ ID NO: 164).
[0345] For qRT-PCR analysis, 5 μL of SYBR Green, 8 μL of ddH 2A reaction mixture containing 1 μL each of the forward and reverse primers and 2.5 μL of cDNA was prepared. The reaction mixture was added to a 0.2 mL tube for PCR reaction with a total volume of 25 μL. Each sample was analyzed in triplicate. To reduce errors, the reagents were mixed in each PCR reaction tube and then dispensed. After adding the sample, quantitative RT-PCR was performed by carrying out a total of 40 cycles in an RT-PCR detection system with a pre-denaturation at 95°C for 1 second, denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 45 seconds. Fluorescence signals were collected during the extension phase of each cycle. After each cycle, melting curve analysis from 94°C to 55°C was performed.
[0346] The relative expression value was calculated as GFP expression level / β-actin, and the expression levels of GFP and the internal standard gene were 1. The screening criteria for GFP expression levels were as follows: (a) Low expression = relative expression value < 0.2 (b) Moderate expression = 0.2 ≤ relative expression value < 0.6 (c) High expression = 0.6 ≤ relative expression value.
[0347] High and moderate expression of GFP indicated that the patient's serum did not contain anti-rAAV2 antibodies that interfere with the infection of HEK293T cells and that the possibility of an immune response to the virus was low. These patients were identified as suitable candidates for gene therapy. Low GFP expression indicated that the patient's serum contained anti-rAAV2 antibodies that interfere with the infection of HEK293T cells and that rAAV gene therapy may cause an immune response and that it was necessary to administer immunotherapy to the patient before gene therapy treatment. The results are shown in Table 9 below.
Table 9
[0348] Example 18 - GFP Expression in HEK293T Cells by Flow Cytometry The HEK293T cells transduced with rAAV2-GFP were resuspended in the well and transferred to a flow cytometry tube. GFP expression in HEK293T cells was determined using a Beckman Coulter Cyto FLEX S.
[0349] Un-transduced cells (without drug) were used as a negative control for GFP expression (data not shown). Cells transduced with the rAAV2-GFP vector in the absence of patient serum were used as a positive control for GFP expression (control group described in Example 16). The infection efficiency of the control group was set at 50%. GFP expression in HEK293T cells after incubation with serum dilutions from Patient A is shown in Table 10, GFP expression in HEK293T cells after incubation with serum dilutions from Patient B is shown in Table 11, GFP expression in HEK293T cells after incubation with serum dilutions from Patient C is shown in Table 12, GFP expression in HEK293T cells after incubation with serum dilutions from Patient D is shown in Table 13, and GFP expression in HEK293T cells after incubation with serum dilutions from Patient E is shown in Table 14.
Table 10
Table 11
Table 12
Table 13
Table 14
[0350] GFP expression (i.e., the percentage of GFP+ cells as determined by flow cytometry) can be expressed as absolute fluorescence (the percentage of GFP+ cells in the test sample; as shown in Tables 10 - 14) or relative fluorescence ([percentage of GFP+ cells in the test sample / percentage of GFP+ cells in the control sample]*100; shown in the "Relative GFP Fluorescence" column in Table 15). The criteria for screening patients based on relative GFP expression are as follows: (a) Low expression = GFP+ cell % < 20% (b) Moderate expression = 20% ≤ GFP+ cell % < 40% (c) High expression = 40% ≤ GFP+ cell %.
[0351] High and moderate GFP expression indicated that the patient's serum did not contain anti - rAAV2 antibodies that would prevent infection of target cells, and that gene therapy could be carried out. Low GFP expression indicated that the patient's serum contained anti - rAAV2 antibodies that would prevent infection of target cells, and that gene therapy with rAAV might trigger an immune response and immunotherapy would have to be carried out before proceeding with gene therapy.
[0352] The GFP expression of Patients A, B, C, and D was all higher than 20% (as shown in Tables 10 - 14, indicating that the patient serum did not contain anti - rAAV2 antibodies that would prevent infection of target cells and that gene therapy could be carried out immediately. In particular, the GFP expression level of Patient D was higher than 40%, indicating that the patient was in an ideal state for gene therapy (Table 13). The GFP expression level revealed for Patient E was less than 20% (Table 14), indicating that gene therapy with rAAV2 might trigger an immune response and that immunotherapy was necessary before starting treatment.
[0353] Example 19 - Efficiency of Gene Therapy in Patients with Low Immunity to rAAV2 The relationship between GFP expression and gene therapy was first discovered by the inventors of the present invention. There is no relevant report in the prior art, and no criteria for the relationship between a specific expression level and the effect of gene therapy have been established in the prior art.
[0354] Unexpectedly, the inventors found that subjects with a GFP expression level of less than 20% in an external clinic had an immune response to rAAV2 gene therapy and did not include them in further tests for safety reasons. Subjects with an expression level higher than 50% were rare. Therefore, the purpose of this example was to prove for subjects with an expression level of 20% to 50%.
[0355] Candidates for gene therapy were screened for immune responses to the above recombinant adeno-associated virus (Examples 16 to 18). The patient inclusion criteria and pre- and post-operative examination procedures are described in Example 15. The dose for intravitreal injection under local anesthesia was 1×10 10 vg / 0.05 mL. A single administration was performed. Clinical observations were continued for 3 months, and vision was examined over time.
[0356] Subjects were classified by GFP+ cell percentage: Group A = high GFP expression (40% ≤ GFP+ cell percentage ≤ 50%), and Group B = moderate GFP expression (20% ≤ GFP+ cell percentage < 40%). rAAV2-GFP was transduced into target cells so that approximately 50% of the cells were transduced in the control group. In the range of 20% to 50% GFP+, the inventors found a relationship between the expression level and the effect of gene therapy. Gene therapy was slightly less effective in subjects with a GFP+ cell percentage of less than 40% than in subjects with a GFP+ cell percentage of 40% or more. Therefore, the above criteria for low, moderate, and high expression were established.
[0357] The results are shown in Table 15. Gene therapy was significantly more effective in Group A (high expression) than in Group B (moderate expression) (P < 0.05). The guidelines for the evaluation of efficacy and vision are described in Example 15.
Table 15
[0358] Patient Screening for Example 20 - LHON Gene Therapy The effectiveness of the above diagnostic assay was further verified in additional patients. Serum from 37 patients was diluted as described in Example 16 and evaluated by the qPCR and flow cytometry assays described in Examples 17 and 18 above. Each sample was tested 3 times (n = 3) to obtain the mean value (i.e., mean GFP+ cell %). The relative GFP+ cell % of the 1:20 and 1:60 dilutions was calculated relative to the mean GFP+ cell % of the control sample, and subjects were classified as suitable or unsuitable for therapy with the rAAV2 vector based on the relative GFP+ cell % (suitable for therapy = relative GFP+ cell % ≥ 40%; not suitable for therapy = relative GFP+ cell % < 40%). Using the methods described herein, 28 patients were classified as suitable for therapy and 9 patients were classified as not suitable for therapy. The results for 37 subjects are shown in Table 16.
Table 16
[0359] The 28 patients classified as suitable for therapy received the rAAV2 gene therapy vector. Therapy was effective in 20 of the 28 patients who received therapy (71.43% (20 / 28) efficacy rate). Six of the 9 patients classified as not suitable for therapy still desired to receive gene therapy. However, therapy was effective in only 1 of the 6 patients classified as not suitable for therapy (16.67% (1 / 6) efficacy rate).
[0360] Example 21 - Prednisone Treatment Plan for LHON Gene Therapy This study will be conducted in accordance with the patient enrollment guidelines, surgical and examination procedures described in Example 15.
[0361] Patients receiving gene therapy for LHON will receive the following treatment plan: (a) Two days before surgery: Prednisone tablets, 60 mg / 60 kg, once a day for 10 days; (b) Eight days after surgery: Prednisone tablets, 40 mg / 60 kg, once a day for 1 day; (c) Nine days after surgery: Prednisone tablets, 20 mg / 60 kg, once a day for 1 day; (d) Ten days after surgery: Prednisone tablets, 10 mg / 60 kg, once a day for 1 day; (e) Eleven days after surgery: Discontinue steroid treatment.
[0362] A schematic diagram showing the dosing schedule is shown in Figure 20. The patient will be followed up for 3 months after surgery and will be advised to consult a doctor if there is any discomfort or pain throughout the trial.
[0363] The results are expected to show improvement in vision with minimal side effects after intravitreal administration of AAV2-ND4 and the above treatment plan in LHON patients.
[0364] Preferred embodiments of the present invention have been shown and described herein, but it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Now those skilled in the art will be able to conceive of numerous variations, changes and substitutions without departing from the present invention. In the practice of the present invention, it should be understood that various alternative forms to the embodiments of the present invention described herein may be employed. It is intended to define the scope of the present invention by the following claims and thereby to cover methods and structures within the scope of these claims and their equivalents.
[0365] Further enumerated embodiments Further embodiments of the present invention are shown in the embodiments numbered as follows:
[0366] Embodiment 1. A recombinant nucleic acid comprising a mitochondrial targeting sequence; a mitochondrial protein coding sequence comprising a sequence that is at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 10, and 12; and a 3'UTR nucleic acid sequence.
[0367] Embodiment 2. The recombinant nucleic acid according to Embodiment 1, wherein the mitochondrial targeting sequence encodes a polypeptide comprising a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 129 to 159.
[0368] Embodiment 3. The recombinant nucleic acid according to Embodiment 1, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2.
[0369] Embodiment 4. The recombinant nucleic acid according to Embodiment 1, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 3.
[0370] Embodiment 5. The recombinant nucleic acid according to Embodiment 1, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4.
[0371] Embodiment 6. The recombinant nucleic acid according to Embodiment 1, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 5.
[0372] Embodiment 7. The recombinant nucleic acid according to Embodiment 1, wherein the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8.
[0373] Embodiment 8. The recombinant nucleic acid according to Embodiment 1, wherein the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 10.
[0374] Embodiment 9. The recombinant nucleic acid according to Embodiment 1, wherein the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 12.
[0375] Embodiment 10. The recombinant nucleic acid according to Embodiment 1, wherein the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111 to 125.
[0376] Embodiment 11. The recombinant nucleic acid according to Embodiment 1, wherein the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14.
[0377] Embodiment 12. The recombinant nucleic acid according to Embodiment 1, wherein the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 17 to 20, 23 to 24, 27 to 28, 31 to 34, 37 to 38, 41 to 42, 45 to 48, 51 to 52, 55 to 56, 59 to 62, 65 to 66, 69 to 70, 73 to 76, 79 to 80, and 83 to 84.
[0378] Embodiment 13. A recombinant nucleic acid comprising a mitochondrial targeting sequence comprising a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2, 3, 4, and 5; a mitochondrial protein coding sequence encoding a polypeptide comprising a mitochondrial protein; and a 3'UTR nucleic acid sequence.
[0379] Embodiment 14. The recombinant nucleic acid according to Embodiment 13, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2.
[0380] Embodiment 15. The recombinant nucleic acid according to any one of Embodiments 13 to 14, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 3.
[0381] Embodiment 16. The recombinant nucleic acid according to any one of Embodiments 13 to 15, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4.
[0382] Embodiment 17. The recombinant nucleic acid according to any one of Embodiments 13 to 16, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 5.
[0383] Embodiment 18. The recombinant nucleic acid according to any one of Embodiments 13 to 17, wherein the mitochondrial protein is selected from the group consisting of NADH dehydrogenase 4 (ND4), NADH dehydrogenase 6 (ND6), NADH dehydrogenase 1 (ND1), and variants thereof.
[0384] Embodiment 19. The recombinant nucleic acid according to Embodiment 18, wherein the mitochondrial protein comprises NADH dehydrogenase 4 (ND4) or a variant thereof.
[0385] Embodiment 20. The recombinant nucleic acid according to any one of Embodiments 13 to 19, wherein the mitochondrial protein comprises a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 160.
[0386] Embodiment 21. The recombinant nucleic acid according to any one of Embodiments 13 to 20, wherein the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 6, 7, or 8.
[0387] Embodiment 22. The recombinant nucleic acid according to Embodiment 18, wherein the mitochondrial protein comprises NADH dehydrogenase 6 (ND6) or a variant thereof.
[0388] Embodiment 23. The recombinant nucleic acid according to any one of Embodiments 13 to 22, wherein the mitochondrial protein comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 161.
[0389] Embodiment 24. The recombinant nucleic acid according to any one of Embodiments 13 to 23, wherein the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 10.
[0390] Embodiment 25. The recombinant nucleic acid according to any one of Embodiments 13 to 24, wherein the mitochondrial protein comprises NADH dehydrogenase 1 (ND1) or a variant thereof.
[0391] Embodiment 26. The recombinant nucleic acid according to any one of Embodiments 13 to 25, wherein the mitochondrial protein comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 162.
[0392] Embodiment 27. The recombinant nucleic acid according to any one of Embodiments 13 to 26, wherein the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 11 or SEQ ID NO: 12.
[0393] Embodiment 28. The recombinant nucleic acid according to any one of Embodiments 13 to 27, wherein the 3'UTR nucleic acid sequence is located 3' to the mitochondrial targeting sequence.
[0394] Embodiment 29. The 3'UTR nucleic acid sequence comprises a sequence selected from the group consisting of hsACO2, hsATP5B, hsAK2, hsALDH2, hsCOX10, hsUQCRFS1, hsNDUFV1, hsNDUFV2, hsSOD2, hsCOX6c, hsIRP1, hsMRPS12, hsA TP5J2, rnSOD2, and hsOXA1L. The recombinant nucleic acid according to any one of Embodiments 13 to 28.
[0395] Embodiment 30. The recombinant nucleic acid according to any one of Embodiments 13 to 29, wherein the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111 to 125.
[0396] Embodiment 31. The recombinant nucleic acid according to any one of Embodiments 13 to 29, wherein the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14.
[0397] Embodiment 32. The recombinant nucleic acid according to any one of Embodiments 13 to 31, wherein the mitochondrial targeting sequence is located 5' to the 3'UTR nucleic acid sequence.
[0398] Embodiment 33. The recombinant nucleic acid according to any one of Embodiments 13 to 32, wherein the mitochondrial targeting sequence is located 3' to the mitochondrial targeting sequence.
[0399] Embodiment 34. The recombinant nucleic acid according to any one of Embodiments 13 to 33, wherein the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 29 to 84.
[0400] Embodiment 35. A recombinant nucleic acid comprising a mitochondrial targeting sequence; a mitochondrial protein coding sequence comprising a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 10, and 12; and a 3'UTR nucleic acid sequence.
[0401] Embodiment 36. The recombinant nucleic acid according to Embodiment 35, comprising a sequence encoding a polypeptide selected from the group consisting of hsCOX10, hsCOX8, scRPM2, lcSirt5, tbNDUS7, ncQCR2, hsATP5G2, hsLACTB, spilv1, gmCOX2, crATP6, hsOPA1, hsSDHD, hsADCK3, osP0644B06.24-2, Neurospora crassa ATP9 (ncATP9), hsGHITM, hsNDUFAB1, hsATP5G3, crATP6_hsADCK3, ncATP9_ncATP9, zmLOC100282174, ncATP9_zmLOC100282174_spilv1_ncATP9, zmLOC100282174_hsADCK3_crATP6_hsATP5G3, zmLOC100282174_hsADCK3_hsATP5G3, ncATP9_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6_hsATP5G3, crATP6_hsADCK3_zmLOC100282174_hsATP5G3, hsADCK3_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6, ncATP9_zmLOC100282174_spilv1_GNFP_ncATP9, and ncATP9_zmLOC100282174_spilv1_lcSirt5_osP0644B06.24-2_hsATP5G2_ncATP9.
[0402] Embodiment 37. The mitochondrion-targeting sequence encodes a polypeptide comprising a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 129 to 159. The recombinant nucleic acid according to any one of Embodiments 35 to 36.
[0403] Embodiment 38. The recombinant nucleic acid according to any one of Embodiments 35 to 37, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3.
[0404] Embodiment 39. The recombinant nucleic acid according to any one of Embodiments 35 to 38, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4.
[0405] Embodiment 40. The recombinant nucleic acid according to any one of Embodiments 35 to 39, wherein the mitochondrial targeting sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 5.
[0406] Embodiment 41. The recombinant nucleic acid according to any one of Embodiments 35 to 40, wherein the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8.
[0407] Embodiment 42. The recombinant nucleic acid according to any one of Embodiments 35 to 41, wherein the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 10.
[0408] Embodiment 43. The recombinant nucleic acid according to any one of Embodiments 35 to 42, wherein the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 12.
[0409] Embodiment 44. The recombinant nucleic acid according to any one of Embodiments 35 to 43, wherein the 3'UTR nucleic acid sequence is located 3' of the mitochondrial targeting sequence.
[0410] Embodiment 45. The recombinant nucleic acid according to any one of Embodiments 35 to 44, wherein the 3'UTR nucleic acid sequence comprises a sequence selected from the group consisting of hsACO2, hsATP5B, hsAK2, hsALDH2, hsCOX10, hsUQCRFS1, hsNDUFV1, hsNDUFV2, hsSOD2, hsCOX6c, hsIRP1, hsMRPS12, hsATP5J2, rnSOD2, and hsOXA1L.
[0411] Embodiment 46. The recombinant nucleic acid according to any one of Embodiments 35 to 45, wherein the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111 to 125.
[0412] Embodiment 47. The recombinant nucleic acid according to any one of Embodiments 35 to 46, wherein the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14.
[0413] Embodiment 48. The recombinant nucleic acid according to any one of Embodiments 35 to 47, wherein the mitochondrial targeting sequence is located 5' of the 3'UTR nucleic acid sequence.
[0414] Embodiment 49. The recombinant nucleic acid according to any one of Embodiments 35 to 48, wherein the mitochondrial targeting sequence is located 3' of the mitochondrial targeting sequence.
[0415] Embodiment 50. The recombinant nucleic acid according to any one of Embodiments 35 to 49, wherein the recombinant nucleic acid contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 17 to 20, 23 to 24, 27 to 28, 31 to 34, 37 to 38, 41 to 42, 45 to 48, 51 to 52, 55 to 56, 59 to 62, 65 to 66, 69 to 70, 73 to 76, 79 to 80, and 83 to 84.
[0416] Embodiment 51. The recombinant nucleic acid, which is a recombinant nucleic acid containing a mitochondrial targeting sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 2, 3, and 4.
[0417] Embodiment 52. The recombinant nucleic acid according to Embodiment 51, wherein the mitochondrial targeting sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2.
[0418] Embodiment 53. The recombinant nucleic acid according to any one of Embodiments 51 to 52, wherein the mitochondrial targeting sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 3.
[0419] Embodiment 54. The recombinant nucleic acid according to any one of Embodiments 51 to 53, wherein the mitochondrial targeting sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4.
[0420] Embodiment 55. The recombinant nucleic acid according to any one of Embodiments 51 to 54, further containing a mitochondrial protein coding sequence, wherein the mitochondrial protein coding sequence encodes a polypeptide containing a mitochondrial protein.
[0421] Embodiment 56. The recombinant nucleic acid according to any one of Embodiments 51 to 55, wherein the mitochondrial protein is selected from the group consisting of NADH dehydrogenase 4 (ND4), NADH dehydrogenase 6 (ND6), NADH dehydrogenase 1 (ND1), and variants thereof.
[0422] Embodiment 57. The recombinant nucleic acid according to any one of Embodiments 51 to 56, wherein the mitochondrial protein contains NADH dehydrogenase 4 (ND4) or a variant thereof.
[0423] Embodiment 58. The recombinant nucleic acid according to any one of Embodiments 51 to 57, wherein the mitochondrial protein contains a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 160.
[0424] Embodiment 59. The recombinant nucleic acid according to any one of Embodiments 51 to 58, wherein the mitochondrial protein coding sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 6, 7, or 8.
[0425] Embodiment 60. The mitochondrial protein is NADH dehydrogenase 6 (ND6) or a variant thereof, and the recombinant nucleic acid according to any one of Embodiments 51 to 59.
[0426] Embodiment 61. The recombinant nucleic acid according to any one of Embodiments 51 to 60, wherein the mitochondrial protein contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 161.
[0427] Embodiment 62. The recombinant nucleic acid according to any one of Embodiments 51 to 61, wherein the mitochondrial protein coding sequence includes a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 10.
[0428] Embodiment 63. The recombinant nucleic acid according to any one of Embodiments 51 to 62, wherein the mitochondrial protein includes NADH dehydrogenase 1 (ND1) or a variant thereof.
[0429] Embodiment 64. The recombinant nucleic acid according to any one of Embodiments 51 to 63, wherein the mitochondrial protein includes a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 162.
[0430] Embodiment 65. The recombinant nucleic acid according to any one of Embodiments 51 to 64, wherein the mitochondrial protein coding sequence includes a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 11 or SEQ ID NO: 12.
[0431] Embodiment 66. The recombinant nucleic acid according to any one of Embodiments 51 to 65, further including a 3'UTR nucleic acid sequence.
[0432] Embodiment 67. The recombinant nucleic acid according to any one of Embodiments 51 to 66, wherein the 3'UTR nucleic acid sequence is located 3' to the mitochondrial targeting sequence.
[0433] Embodiment 68. The recombinant nucleic acid according to any one of Embodiments 51 to 67, wherein the 3'UTR nucleic acid sequence includes a sequence selected from the group consisting of hsACO2, hsATP5B, hsAK2, hsALDH2, hsCOX10, hsUQCRFS1, hsNDUFV1, hsNDUFV2, hsSOD2, hsCOX6c, hsIRP1, hsMRPS12, hsATP5J2, rnSOD2, and hsOXA1L.
[0434] Embodiment 69. The recombinant nucleic acid according to any one of Embodiments 51 to 68, wherein the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111 to 125.
[0435] Embodiment 70. The recombinant nucleic acid according to any one of Embodiments 51 to 69, wherein the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14.
[0436] Embodiment 71. The recombinant nucleic acid according to any one of Embodiments 51 to 70, wherein the mitochondrial targeting sequence is located 5' to the 3'UTR nucleic acid sequence.
[0437] Embodiment 72. The recombinant nucleic acid according to any one of Embodiments 51 to 71, wherein the mitochondrial targeting sequence is located 3' to the mitochondrial targeting sequence.
[0438] Embodiment 73. The recombinant nucleic acid according to any one of Embodiments 51 to 72, wherein the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 29 to 70.
[0439] Embodiment 74. A recombinant nucleic acid comprising a mitochondrial protein coding sequence, wherein the mitochondrial protein coding sequence encodes a polypeptide comprising a mitochondrial protein, and the mitochondrial protein coding sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 10, and 12.
[0440] Embodiment 75. The recombinant nucleic acid according to Embodiment 74, further comprising a mitochondrial targeting sequence.
[0441] Embodiment 76. The recombinant nucleic acid according to any one of Embodiments 74 to 75, wherein the mitochondrial targeting sequence comprises a sequence encoding a polypeptide selected from the group consisting of hsCOX10, hsCOX8, scRPM2, lcSirt5, tbNDUS7, ncQCR2, hsATP5G2, hsLACTB, spilv1, gmCOX2, crATP6, hsOPA1, hsSDHD, hsADCK3, osP0644B06.24-2, Neurospora crassa ATP9 (ncATP9), hsGHITM, hsNDUFAB1, hsATP5G3, crATP6_hsADCK3, ncATP9_ncATP9, zmLOC100282174, ncATP9_zmLOC100282174_spilv1_ncATP9, zmLOC100282174_hsADCK3_crATP6_hsATP5G3, zmLOC100282174_hsADCK3_hsATP5G3, ncATP9_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6_hsATP5G3, crATP6_hsADCK3_zmLOC100282174_hsATP5G3, hsADCK3_zmLOC100282174, hsADCK3_zmLOC100282174_crATP6, ncATP9_zmLOC100282174_spilv1_GNFP_ncATP9, and ncATP9_zmLOC100282174_spilv1_lcSirt5_osP0644B06.24-2_hsATP5G2_ncATP9.
[0442] Embodiment 77. The recombinant nucleic acid according to any one of Embodiments 74 to 76, wherein the mitochondrial targeting sequence encodes a polypeptide comprising a peptide sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 129 to 159.
[0443] Embodiment 78. The recombinant nucleic acid according to any one of Embodiments 74 to 77, wherein the mitochondrial targeting sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 2.
[0444] Embodiment 79. The recombinant nucleic acid according to any one of Embodiments 74 to 78, wherein the mitochondrial targeting sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 3.
[0445] Embodiment 80. The recombinant nucleic acid according to any one of Embodiments 74 to 79, wherein the mitochondrial targeting sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 4.
[0446] Embodiment 81. The recombinant nucleic acid according to any one of Embodiments 74 to 80, wherein the mitochondrial targeting sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 5.
[0447] Embodiment 82. The recombinant nucleic acid according to any one of Embodiments 74 to 81, wherein the mitochondrial protein coding sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8.
[0448] Embodiment 83. The recombinant nucleic acid according to any one of Embodiments 74 to 80, wherein the mitochondrial protein coding sequence contains a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 10.
[0449] Embodiment 84. The recombinant nucleic acid according to any one of Embodiments 74 to 83, wherein the mitochondrial protein coding sequence includes a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 12.
[0450] Embodiment 85. The recombinant nucleic acid according to any one of Embodiments 74 to 84, further including a 3'UTR nucleic acid sequence.
[0451] Embodiment 86. The recombinant nucleic acid according to any one of Embodiments 74 to 85, wherein the 3'UTR nucleic acid sequence is located 3' to the mitochondrial targeting sequence.
[0452] Embodiment 87. The recombinant nucleic acid according to any one of Embodiments 74 to 86, wherein the 3'UTR nucleic acid sequence includes a sequence selected from the group consisting of hsACO2, hsATP5B, hsAK2, hsALDH2, hsCOX10, hsUQCRFS1, hsNDUFV1, hsNDUFV2, hsSOD2, hsCOX6c, hsIRP1, hsMRPS12, hsATP5J2, rnSOD2, and hsOXA1L.
[0453] Embodiment 88. The recombinant nucleic acid according to any one of Embodiments 74 to 87, wherein the 3'UTR nucleic acid sequence includes a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 111 to 125.
[0454] Embodiment 89. The recombinant nucleic acid according to any one of Embodiments 74 to 88, wherein the 3'UTR nucleic acid sequence includes a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14.
[0455] Embodiment 90. The recombinant nucleic acid according to any one of Embodiments 74 to 89, wherein the mitochondrial targeting sequence is located 5' to the 3'UTR nucleic acid sequence.
[0456] Embodiment 91. The recombinant nucleic acid according to any one of Embodiments 74 to 90, wherein the mitochondrial targeting sequence is located 3' to the mitochondrial targeting sequence.
[0457] Embodiment 92. The recombinant nucleic acid according to any one of Embodiments 74 to 91, wherein the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 17-20, 23-24, 27-28, 31-34, 37-38, 41-42, 45-48, 51-52, 55-56, 59-62, 65-66, 69-70, 73-76, 79-80, and 83-84. Embodiment 93. A viral vector comprising the recombinant nucleic acid according to any one of Embodiments 1 to 92.
[0458] Embodiment 94. The viral vector according to Embodiment 93, wherein the viral vector is an adeno-associated virus (AAV) vector.
[0459] Embodiment 95. The viral vector according to Embodiment 94, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16 vectors.
[0460] Embodiment 96. The viral vector according to any one of Embodiments 93 to 95, wherein the AAV vector is a recombinant AAV (rAAV) vector.
[0461] Embodiment 97. The viral vector according to Embodiment 96, wherein the rAAV vector is an rAAV2 vector.
[0462] Embodiment 98. A pharmaceutical composition comprising an adeno-associated virus (AAV) comprising the recombinant nucleic acid according to any one of Embodiments 1 to 92.
[0463]
[0464] Embodiment 99. The pharmaceutical composition according to Embodiment 98, further comprising a pharmaceutically acceptable excipient, said pharmaceutical composition.
[0465] Embodiment 100. A pharmaceutical composition comprising the virus vector according to any one of Embodiments 93 to 97 and a pharmaceutically acceptable excipient, wherein the virus vector comprises the recombinant nucleic acid according to any one of Embodiments 1 to 92, said pharmaceutical composition. |
[0466] Embodiment 101. A pharmaceutical composition comprising an adeno-associated virus (AAV) containing the recombinant nucleic acid according to any one of Embodiments 1 to 92, wherein the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to the sequence shown in SEQ ID NO: 15, and further comprising a pharmaceutically acceptable excipient, said pharmaceutical composition.
[0467] Embodiment 102. The pharmaceutically acceptable excipient is phosphate buffered saline (PBS), α,α-trehalose dehydrate, L-histidine monohydrochloride monohydrate, polysorbate 20, NaCl, NaH 2 PO 4 、Na 2 HPO 4 、KH 2 PO 4 、K 2 HPO 4 、poloxamer 188 or any combination thereof, the pharmaceutical composition according to any one of Embodiments 98 to 101.
[0468] Embodiment 103. The pharmaceutically acceptable excipient is phosphate buffered saline (PBS), α,α-trehalose dehydrate, L-histidine monohydrochloride monohydrate, polysorbate 20, NaCl, NaH 2 PO 4 、Na 2 HPO4 , KH 2 PO 4 , K 2 HPO 4 , a pharmaceutical composition according to any one of embodiments 98 to 102, selected from KH, K 2 HPO 4 , poloxamer 188, and any combination thereof.
[0469] Embodiment 104. The pharmaceutical composition according to embodiment 102, wherein the pharmaceutically acceptable excipient comprises poloxamer 188.
[0470] Embodiment 105. The pharmaceutical composition according to embodiment 104, wherein the pharmaceutically acceptable excipient comprises 0.0001 to 0.01% of poloxamer 188.
[0471] Embodiment 106. The pharmaceutical composition according to embodiment 105, wherein the pharmaceutically acceptable excipient comprises 0.001% of poloxamer 188.
[0472] Embodiment 107. The pharmaceutical composition according to any one of embodiments 98 to 106, wherein the pharmaceutically acceptable excipient further comprises one or more salts.
[0473] Embodiment 108. The one or more salts are NaCl, NaH 2 PO 4 , Na 2 HPO 4 and KH 2 PO 4 . The pharmaceutical composition according to embodiment 107.
[0474] Embodiment 109. The one or more salts are 80 mM of NaCl, 5 mM of NaH 2 PO 4 , 40 mM of Na 2 HPO 4 , and 5 mM of KH 2 PO 4 . The pharmaceutical composition according to embodiment 107.
[0475] Embodiment 109.1. The one or more salts are NaCl, Na 2 HPO 4, and KH 2 PO 4 The pharmaceutical composition according to embodiment 107, comprising
[0476] Embodiment 109.2. The one or more salts are 154 mM of NaCl, 5.6 mM of Na 2 HPO 4 , and 8.4 mM of KH 2 PO 4 The pharmaceutical composition according to embodiment 107, comprising
[0477] Embodiment 110. The pharmaceutical composition according to any one of embodiments 98 to 109, wherein the pH of the pharmaceutical composition is 6 to 8.
[0478] Embodiment 111. The pharmaceutical composition according to embodiment 110, wherein the pH of the pharmaceutical composition is 7.2 to 7.4.
[0479] Embodiment 112. The pharmaceutical composition according to embodiment 111, wherein the pH of the pharmaceutical composition is 7.3.
[0480] Embodiment 113. The pharmaceutical composition according to any one of embodiments 98 to 112, wherein the virus titer of the pharmaceutical composition is at least 1.0×10 10 vg / mL.
[0481] Embodiment 114. The pharmaceutical composition according to embodiment 113, wherein the virus titer of the pharmaceutical composition is at least 5.0×10 10 vg / mL.
[0482] Embodiment 115. When the pharmaceutical composition is subjected to 5 freeze / thaw cycles, the pharmaceutical composition retains at least 60%, 70%, 80% or 90% of the virus titer compared to the virus titer before the 5 freeze / thaw cycles. The pharmaceutical composition according to any one of embodiments 98 to 114.
[0483] Embodiment 116. The pharmaceutical composition according to any one of Embodiments 98 to 115, which, when administered to a patient with Leber's hereditary optic neuropathy, results in a higher average visual acuity recovery than an equivalent pharmaceutical composition that does not contain the recombinant nucleic acid.
[0484] Embodiment 117. The pharmaceutical composition according to any one of Embodiments 98 to 116, which, when administered to a patient with Leber's hereditary optic neuropathy, results in a higher average visual acuity recovery than an equivalent pharmaceutical composition containing the recombinant nucleic acid shown in SEQ ID NO: 15.
[0485] Embodiment 118. A method for treating an eye disorder, the method comprising administering to a patient in need thereof the pharmaceutical composition according to any one of Embodiments 98 to 117.
[0486] Embodiment 119. The method according to Embodiment 118, wherein the eye disorder is Leber's hereditary optic neuropathy (LHON).
[0487] Embodiment 120. The method according to Embodiment 118 or Embodiment 119, comprising administering the pharmaceutical composition to one or both eyes of the patient.
[0488] Embodiment 121. The method according to any one of Embodiments 118 to 120, wherein the pharmaceutical composition is administered by intravitreal or subretinal injection.
[0489] Embodiment 122. The method according to Embodiment 121, wherein the pharmaceutical composition is administered by intravitreal injection.
[0490] Embodiment 123. The method according to Embodiment 122, wherein about 0.01 to 0.1 mL of the pharmaceutical composition is administered by intravitreal injection.
[0491] Embodiment 124. The method according to Embodiment 123, wherein about 0.05 mL of the pharmaceutical composition is administered by intravitreal injection.
[0492] Embodiment 125. The method according to any one of Embodiments 118 to 124, further comprising administering methylprednisolone to the patient.
[0493] Embodiment 126. The method according to Embodiment 125, wherein the methylprednisolone is administered before the intravitreal injection of the pharmaceutical composition.
[0494] Embodiment 127. The method according to any one of Embodiments 125 to 126, wherein the methylprednisolone is administered orally.
[0495] Embodiment 128. The method according to any one of Embodiments 125 to 127, wherein the methylprednisolone is administered daily for at least 1, 2, 3, 4, 5, 6 or 7 days before the intravitreal injection of the pharmaceutical composition.
[0496] Embodiment 129. The method according to any one of Embodiments 125 to 128, wherein the methylprednisolone is administered daily.
[0497] Embodiment 130. The method according to any one of Embodiments 125 to 129, wherein a daily dosage of about 32 mg / 60 kg of methylprednisolone is administered.
[0498] Embodiment 131. The method according to any one of Embodiments 125 to 130, wherein the methylprednisolone is administered after the intravitreal injection of the pharmaceutical composition.
[0499] Embodiment 132. The method according to any one of Embodiments 125 to 131, further comprising administering sodium creatine phosphate to the patient.
[0500] Embodiment 133. The method according to Embodiment 132, wherein the sodium creatine phosphate is administered intravenously.
[0501] Embodiment 134. The method according to any one of Embodiments 125 to 133, wherein the methylprednisolone is administered intravenously or orally.
[0502] Embodiment 135. Intravenous administration of methylprednisolone for at least 1 day, followed by oral administration of methylprednisolone for at least 1 week The method according to any one of Embodiments 125 to 134, comprising
[0503] Embodiment 136. Intravenous administration of methylprednisolone for about 3 days, followed by oral administration of methylprednisolone for at least about 6 weeks The method according to Embodiment 135, comprising
[0504] Embodiment 137. The method according to any one of Embodiments 125 to 136, wherein the methylprednisolone is intravenously administered at a daily dose of about 80 mg / 60 kg
[0505] Embodiment 138. The method according to any one of Embodiments 125 to 137, wherein administering the pharmaceutical composition results in a higher average visual acuity recovery compared to an equivalent pharmaceutical composition that does not contain the recombinant nucleic acid
[0506] Embodiment 139. The method according to any one of Embodiments 125 to 138, wherein administering the pharmaceutical composition results in a higher average visual acuity recovery compared to an equivalent pharmaceutical composition that contains the recombinant nucleic acid shown in SEQ ID NO: 15
[0507] Embodiment 140. A method for treating an eye disorder, comprising administering to a patient in need thereof: (a) a first pharmaceutical composition comprising an adeno-associated virus (AAV) comprising a recombinant nucleic acid comprising (i) a nucleic acid sequence encoding a mitochondrion-targeting peptide, (ii) a nucleic acid sequence encoding a mitochondrial protein, which is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 6 to 12, and (iii) a 3'UTR nucleic acid sequence; and (b) a second pharmaceutical composition comprising a steroid
[0508] Embodiment 141. The method according to Embodiment 140, wherein the nucleic acid sequence encoding the mitochondrial protein encodes a polypeptide comprising an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 160 to 162.
[0509] Embodiment 142. The method according to Embodiment 140 or Embodiment 141, wherein the nucleic acid sequence encoding the mitochondrial targeting peptide encodes a polypeptide comprising an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 126 to 159.
[0510] Embodiment 143. The method according to any one of Embodiments 140 to 142, wherein the nucleic acid sequence encoding the mitochondrial targeting peptide comprises a nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1 to 5.
[0511] Embodiment 144. The method according to any one of Embodiments 140 to 143, wherein the 3'UTR nucleic acid sequence comprises a nuclear sequence that is at least 90%, at least 95%, at least 97% %, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 13, 14, and 111 to 125.
[0512] Embodiment 145. A method for treating an eye disorder, comprising administering to a pati...
Claims
A pharmaceutical composition for use in combination with a second pharmaceutical composition for treating Leber hereditary optic neuropathy (LHON) in a patient in need thereof, said pharmaceutical composition comprising: i) a nucleic acid sequence encoding a mitochondrially targeted peptide; ii) a nucleic acid sequence encoding a mitochondrial protein, comprising a nucleic acid sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 7 and SEQ ID NOs: 9-12; and iii) a 3'UTR nucleic acid sequence comprising a therapeutically effective amount of an adeno-associated virus (AAV) comprising a recombinant nucleic acid, wherein a promoter is operably linked; said mitochondrial protein being a functional ND4, ND1, or ND6 polypeptide; said pharmaceutical composition being administered intravitreally or intravitreally into the eye of said patient; said second pharmaceutical composition comprising a steroid, said steroid being methylprednisolone or prednisone, and said steroid being administered daily for 2 days prior to said administration of said pharmaceutical composition. **Claim 2** The pharmaceutical composition according to claim 1, wherein the nucleic acid sequence encoding the mitochondrial protein encodes a polypeptide comprising an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 160-162. **Claim 3** The pharmaceutical composition according to claim 1, wherein the nucleic acid sequence encoding the mitochondrially targeted peptide encodes a polypeptide comprising an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 126-159. **Claim 4** The pharmaceutical composition according to claim 1, wherein the nucleic acid sequence encoding the mitochondrially targeted peptide comprises a nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 2-4. **Claim 5** The pharmaceutical composition according to claim 1, wherein the 3'UTR nucleic acid sequence comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 13, 14, and 111-125. **Claim 6** The pharmaceutical composition according to claim 1, wherein the recombinant nucleic acid comprises a sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 17-18, 21-28, 31-32, 35-42, 45-46, 49-56, 59-60, 63-70, 73-74, 77-84.
7. The pharmaceutical composition according to claim 1, wherein the nucleic acid sequence encoding the mitochondrial protein comprises a sequence selected from the group consisting of SEQ ID NOs: 7 and 9-12.
8. The pharmaceutical composition according to claim 1, wherein about 0.01-0.1 mL of the pharmaceutical composition is administered by intravitreal injection.
9. The pharmaceutical composition according to claim 1, wherein the steroid is administered orally or intravenously.
10. The pharmaceutical composition according to any one of claims 1-9, wherein the steroid is administered daily for 2 weeks, 3 weeks, or 4 weeks after the administration of the pharmaceutical composition.
11. The pharmaceutical composition according to claim 10, wherein the steroid is administered at a daily dosage of 1 mg / 60 kg to 40 mg / 60 kg.
12. The pharmaceutical composition according to claim 11, wherein the steroid is methylprednisolone and is administered at a daily dosage of about 30 mg / 60 kg to about 40 mg / 60 kg, or about 30 mg to about 40 mg.
13. The pharmaceutical composition according to claim 10, wherein the steroid is prednisone and is administered at a daily dosage of about 50 mg / 60 kg to about 70 mg / 60 kg.
14. The pharmaceutical composition according to claim 1, wherein the steroid is further administered after the administration of the pharmaceutical composition.
15. The pharmaceutical composition according to claim 14, wherein the steroid is methylprednisolone and is administered at a daily dosage of about 70 mg / 60 kg to 90 mg / 60 kg, or about 70 mg to 90 mg.
16. The pharmaceutical composition according to claim 14, wherein the steroid is methylprednisolone, the methylprednisolone is administered daily for at least 7 weeks after the administration of the pharmaceutical composition, and the dosage of the methylprednisolone is reduced weekly.
17. The pharmaceutical composition according to claim 14, wherein the steroid is prednisone and is administered at a daily dosage of about 50 mg / 60 kg to 70 mg / 60 kg, or about 50 mg to about 70 mg.
18. The pharmaceutical composition according to claim 17, wherein the prednisone is administered for at least 7 days after the administration of the pharmaceutical composition.
19. The pharmaceutical composition according to claim 18, wherein the prednisone is administered at a daily dosage of about 30 mg / 60 kg to about 50 mg / 60 kg, or about 30 mg to 50 mg, 7 days later.
20. The pharmaceutical composition according to claim 1, wherein the steroid is prednisone and is administered daily for at least 11 days after the administration of the pharmaceutical formulation.
21. The pharmaceutical composition according to claim 1, further comprising administering sodium creatine phosphate to the patient.
22. The pharmaceutical composition according to claim 1, wherein the AAV is AAV2.
23. A pharmaceutical composition for use in combination with a second pharmaceutical composition for treating Leber's hereditary optic neuropathy (LHON) in a patient in need thereof, the pharmaceutical composition comprising: i) a nucleic acid sequence encoding a mitochondrially targeted peptide, wherein the nucleic acid sequence is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-5, or the mitochondrially targeted peptide comprises an amino acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 126-159, a nucleic acid sequence; ii) a nucleic acid sequence encoding a mitochondrial protein, comprising a nucleic acid sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 7 and 9-12, and iii) a 3'UTR nucleic acid sequence that is at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 13, 14, and 111-125; comprising an adeno-associated virus (AAV) comprising a recombinant nucleic acid to which a promoter is operably linked, wherein the mitochondrial protein is a functional ND4, ND1, or ND6 polypeptide, the pharmaceutical composition is administered intravitreally or intravitreally to the eye of the patient, the second pharmaceutical composition comprises methylprednisolone or prednisone, and the methylprednisolone or prednisone is administered daily for 2 days prior to the administration of the pharmaceutical composition.
Citation Information
Patent Citations
Recombinant human NADH (nicotinamide-adenine dinucleotide) dehydrogenase subunit-4 gene and constructing method of expression vector thereof
CN102634527A
Recombinant AAV vectors and methods of use thereof
JP2021526834A
Compositions and methods for treating Leber's hereditary optic neuropathy
JP2021529001A
Importation of mitochodrial protein by an enhanced allotopic approach
US20150225740A1